Vous êtes sur la page 1sur 5

Material de apoio para Aula ao Vivo

Anabolismo Nuclear e Diviso Celular


Professor: Rubens Oda
14/04/2014

Anabolismo Nuclear e Diviso Celular


1. (UFRN) Uma protena X codificada pelo gene Xp sintetizada nos ribossomos, a partir de um
RNAm. Para que a sntese acontea, necessrio que ocorram, no ncleo e no citoplasma,
respectivamente, as etapas de
a) iniciao e transcrio.
b) iniciao e terminao.
c) traduo e terminao.
d) transcrio e traduo.
2. (UFRGS) Meselson e Stahl, em 1957, fizeram um experimento sobre a replicao do DNA.
Nesse experimento, a bactria Escherichia coli foi cultivada, por muitas geraes, em meio
contendo um istopo pesado de nitrognio, 15N, at todo o seu DNA estar marcado com esse
istopo. Depois disso, as bactrias foram transferidas para um meio contendo nitrognio leve,
14N. As molculas de DNA foram ento isoladas e analisadas com relao ao seu contedo de
15N e de 14N, sendo observado o seguinte:

Com relao a esses dados, podemos concluir que:


a) a replicao do DNA semiconservativa.
b) a replicao do DNA conservativa.
c) a replicao do DNA randmica.
d) no ocorreu replicao do DNA mas, sim, uma mutao.
e) no ocorreu replicao do DNA mas, sim, transcrio.
3. (UNIFESP-SP) Analise a figura

A figura representa um cromossomo em metfase mittica. Portanto, os nmeros I e II


Este contedo pertence
ao Descomplica. vedada a cpia ou a reproduo no autorizada previamente e por escrito.
correspondem
a:
Todos oscada
direitosum
reservados.
a) cromossomos emparelhados na meiose,
com uma molcula diferente de DNA.
b) cromtides no-irms, cada uma com uma molcula idntica de DNA.
c) cromtides-irms, cada uma com duas molculas diferentes de DNA.

Material de apoio para Aula ao Vivo

Anabolismo Nuclear e Diviso Celular


Professor: Rubens Oda
14/04/2014

A figura representa um cromossomo em metfase mittica. Portanto, os nmeros I e II


correspondem a:
a) cromossomos emparelhados na meiose, cada um com uma molcula diferente de DNA.
b) cromtides no-irms, cada uma com uma molcula idntica de DNA.
c) cromtides-irms, cada uma com duas molculas diferentes de DNA.
d) cromtides-irms, com duas molculas idnticas de DNA.
e) cromossomos duplicados, com duas molculas diferentes de DNA.

4. (UEL) Considere as seguintes fases da mitose:


I. telfase
II. metfase
III. anfase
Considere tambm os seguintes eventos:
a. As cromtides-irms movem-se para os plos opostos da clula.
b. Os cromossomos alinham-se no plano equatorial da clula.
c. A carioteca e o nuclolo reaparecem.
Assinale a alternativa que relaciona corretamente cada fase ao evento que a caracteriza.
a) I -a; II -b; III -c
b) I -a; II -c; III -b
c) I -b; II -a; III -c
d) I -c; II -a; III -b
e) I -c; II -b; III -a

5. (UFRS) Considere as afirmaes a seguir, referentes aos cromossomos homlogos.


I. Durante a mitose e a meiose, quando os cromossomos so visveis como entidades distintas, os
membros de um par de homlogos so de mesmo tamanho e exibem localizao centromrica
idntica.
II. Durante os estgios iniciais da meiose, os cromossomos homlogos pareiam.
III. Cromossomos homlogos so os que contm os mesmos alelos para cada loco gnico.
Quais esto corretas?
a) Apenas I.
b) Apenas II.
c) Apenas III.
d) Apenas I e II.
e) I, II e III.

Este contedo pertence ao Descomplica. vedada a cpia ou a reproduo no autorizada previamente e por escrito.
Todos os direitos reservados.

Material de apoio para Aula ao Vivo

Anabolismo Nuclear e Diviso Celular


Professor: Rubens Oda
14/04/2014

6. (UFT) As atividades celulares so orientadas pelas informaes contidas no DNA, que so


decodificadas em protenas atravs dos mecanismos de transcrio e traduo. O que
faz uma baleia parecer uma baleia so suas protenas. Assim, as protenas determinam as
funes vitais da baleia, como de todos os seres vivos. Para ditar o desenvolvimento de um
organismo, a informao do DNA deve, de algum modo, ser convertida em protenas. Esta
converso ocorre porque o DNA contm um cdigo gentico para os aminocidos que compem
as protenas. Neste cdigo, cada aminocido representado por uma sequncia de pares de
bases, e esta sequncia refletida na sequncia de aminocidos reunidos em uma cadeia
proteica. Assim, traduzir o cdigo gentico significa passar o cdigo de sequncia de bases para
uma sequncia de aminocidos.
Deste modo, o DNA decodificado na forma de uma protena estrutural ou enzimtica que, por
sua vez, responsvel por uma caracterstica do organismo.
Podemos afirmar que:
I. Esta decodificao se faz atravs da leitura de sequncias de trs nucleotdeos, chamados
cdons, que especificam aminocidos.
II. Os cdons diferem entre diferentes txons de seres vivos; h cdons que no codificam
aminocidos.
III. A decodificao ocorre no citoplasma celular, em estruturas chamadas ribossomos, a partir de
uma fita simples de DNA que deixa momentaneamente o ncleo somente para tal funo.
IV. Cada cdon traduz apenas um aminocido.
V. Alguns aminocidos so codificados por mais de um cdon. A isto chamamos degenerao do
cdigo, o que possivelmente traz maior estabilidade contra mutaes no DNA.
Indique a alternativa em que todas as afirmativas so falsas.
a) I e III
b) II, III e IV
c) II e III
d) II, III e V

7. (UNIFESP) No ano de 2009, o mundo foi alvo da pandemia provocada pelo vrus influenza A
(H1N1), causando perdas econmicas, sociais e de vidas. O referido vrus possui, alm de seus
receptores proticos, uma bicamada lipdica e um genoma constitudo de 8 genes de RNA.
Considerando:
1. a sequncia inicial de RNA mensageiro referente a um dos genes deste vrus:
5 AAAUGCGUUACGAAUGGUAUGCCUACUGAAU 3

Este contedo pertence ao Descomplica. vedada a cpia ou a reproduo no autorizada previamente e por escrito.
Todos os direitos reservados.

Material de apoio para Aula ao Vivo

Anabolismo Nuclear e Diviso Celular


Professor: Rubens Oda
14/04/2014

Responda:
a) Qual ser a sequncia de aminocidos que resultar da traduo da sequncia inicial de RNA
mensageiro, referente a um dos genes deste vrus indicada em 1?
b) Considerando os mecanismos de replicao do genoma viral, qual a principal diferena entre o
vrus da gripe e o vrus que causa a AIDS?

Este contedo pertence ao Descomplica. vedada a cpia ou a reproduo no autorizada previamente e por escrito.
Todos os direitos reservados.

Material de apoio para Aula ao Vivo

Anabolismo Nuclear e Diviso Celular


Professor: Rubens Oda
14/04/2014

Gabarito
1. D
2. A
3. D
4. D
5. A
6. C
7.
a) No esquea que h o cdon de iniciao (AUG) e o cdon de parada (UGA). Logo, o peptdeo
traduzido tem a sequncia:
MetioninaArginina Tirosina cido glutmico TriptofanoTirosinaAlanina Tirosina.
b) A replicao do vrus influenza A H1N1 envolve a enzima RNA-polimerase, que realiza a
replicao atravs dos RNAsvirais. J o HIV, por ser um retrovrus, utiliza a enzima
transcriptasereversa para gerar uma fita de DNA-viral, que se integra ao DNA da clula
hospedeira, e num dado momento passa a formar cpias do RNA-viral.

Este contedo pertence ao Descomplica. vedada a cpia ou a reproduo no autorizada previamente e por escrito.
Todos os direitos reservados.