Vous êtes sur la page 1sur 209

UNIVERSIT

DORLANS
COLE DOCTORALE SCIENCES DE LHOMME ET DE LA SOCIT
LABORATOIRE CEDETE

THSE

prsente par :

Ylzouomin Stphane Corentin SOME


soutenue le 13 juillet 2010

pour obtenir le grade de : Docteur de luniversit dOrlans


Discipline/ Spcialit : Gographie Amnagement - Environnement

MODELISATION DE LA DISTRIBUTION SPATIALE


DES FORMES MOLECULAIRES M ET S DAnopheles gambiae sensu stricto
AU BURKINA FASO AVEC LES SIG ET LANALYSE SPATIALE
THSE dirige par :
Monsieur Jean-Marie FOTSING, Professeur, Universit dOrlans
RAPPORTEURS :
Monsieur Jean-Pierre LACAUX, Physicien des Observatoires, CNES-MEDIAS
Monsieur Franois de Charles OUEDRAOGO, Matre de Confrences (CAMES), Universit de
Ouagadougou
________________________________________________________________
JURY :
Monsieur Jean-Marie FOTSING, Professeur, Universit dOrlans
Monsieur Jean-Pierre LACAUX, Physicien des Observatoires, CNES-MEDIAS
Monsieur Franois de Charles OUEDRAOGO, Matre de confrences CAMES, Rapporteur
Monsieur Carlo COSTANTINI, Directeur de recherche, IRD
Monsieur Jean-Marc ZANINETTI, Professeur, Universit d'Orlans

Sommaire
________________________________________________________________________________________________________________

SOMMAIRE
LISTE DES ABREVIATIONS _____________________________________________________________ 3
DEDICACE ____________________________________________________________________________ 5
REMERCIEMENTS _____________________________________________________________________ 6
INTRODUCTION GENERALE ____________________________________________________________ 9
PREMIERE PARTIE : __________________________________________________________________ 15
CADRAGE THEMATIQUE, DEMARCHE SCIENTIFIQUE ET METHODE ______________________ 15
CHAPITRE I : ETAT DE LART, DEFINITION DU CHAMP CONCEPTUEL ET POSITIONNEMENT
SCIENTIFIQUE _______________________________________________________________________ 17
CHAPITRE II : BIO-ECOLOGIE DAAn. gambiae AU BURKINA FASO : UNE RELATION A
FORMALISER ________________________________________________________________________ 40
CHAPITRE III : APPROCHE METHODOLOGIQUE DE LETUDE _____________________________ 68
DEUXIEME PARTIE ___________________________________________________________________ 96
STRUCTURATION DES DONNEES, ELABORATION ET EVALUATION DES MODELES ________ 96
CHAPITRE IV : ORGANISATION ET STRUCTURATION DE LA BASE DE DONNEES ___________ 98
CHAPITRE V : DISTRIBUTION SPATIALE DES MEMBRES DU COMPLEXE An. gambiae :
STRUCTURES GLOBALES ET CONFIGURATIONS LOCALES ______________________________ 123
CHAPITRE VI : MODELISATION DE LA DISTRIBUTION SPATIALE ________________________ 156
CONCLUSION GENERALE ____________________________________________________________ 181
ANNEXES __________________________________________________________________________ 191
ANNEXE 1 : METHODES DE COLLECTE DES MOUSTIQUES SUR LE TERRAIN ______________ 192
ANNEXE 2 : IDENTIFICATION DES FORMES MOLECULAIRES ____________________________ 194
LISTE DES FIGURES _________________________________________________________________ 199
LISTE DES TABLEAUX _______________________________________________________________ 202

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

Liste des Sigles et Abrviations


________________________________________________________________________________________________________________

LISTE DES ABREVIATIONS


2iE

Institut International dIngnierie de lEau et de lEnvironnement

ACP

Analyse en Composantes Principales

ADN

Acide Dsoxyribonuclique

ANCOVA

Analyse de Covariance

ARN

Acide Ribonuclique

AVHRR

Advanced Very High Resolution Radiometer

BDOT

Base de Donnes sur lOccupation des terres

BNDT

Banque National de Donnes Topographique

CEDETE

Centre d'Etudes sur le Dveloppement des Territoires et Environnement

CIT

Convergence Intertropicale

CNRFP

Centre National de Recherche et de Formation sur le Paludisme

CRDI

Centre International de Recherche sur le Dveloppement

CTA

Combinaisons Thrapeutiques base d'Artmisinine

DDT

Dichorodiphnyltrichlorothane

ESRI

Environmental Systems Research Institute Inc

ETM+,

Enhanced Thematic Mapper Plus

ETP

Evapotranspiration

FAO

Food Alimentary Organization

FIT

Front intertropical

GIS

Geographic Information System

GPS

Global Positioning System

IBC

Interventions Base Communautaire

IDW

Inverse Distance Weigthing

INSD

Institut National de Statistique et de la Dmographie

IRD

Institut de Recherche pour le Dveloppement

ISO

International Organization for Standardization

LISA

Local Indices for Spatial Association

LIV

Lutte Intgre contre les Vecteurs

LocClim

Local Climate

LPI

Local polynomial interpolation

MCD

Modle Conceptuel de Donnes

MCT

Modle Conceptuel de Traitement

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

Liste des Sigles et Abrviations


________________________________________________________________________________________________________________

MTI

Moustiquaires Traites aux Insecticides

NDVI

Normalized Vegetation Index

NIH

National Institute of Health

NOAA

National Oceanic and Atmospheric Administration

OCEAC

Organisation de Coordination pour la lutte contre les Endmies en Afrique Centrale

OMD

Objectifs du Millnaire pour le Dveloppement

OMS

Organisation Mondiale de la Sant

PCIME

Prise en Charge Intgre des Maladies de lEnfant

PCR

Polymerized Chain Reaction

PNLP

Programme National de Lutte contre le Paludisme

RBF

Radial Basic Fonction

SIG

Systme dInformation Gographique

SNIS

Systme National dInformation Sanitaire

SPOT

Satellite pour lObservation de la Terre

TM

Thematic Mapper

TPI

Traitement Prventif Intermittent

USGS

United States Geological Service

UTM

Universal Transverse Mercator

WHO

World Health Organization

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

Ddicace
________________________________________________________________________________________________________________

DEDICACE

A Vous qui tes sensibles la douleur dautrui,


A Vous qui peinez devant linjustice,
A Vous qui prenez des risques pour dfendre le faible, lopprim,
Je ddis ce travail.
A vous qui souffrez de linjustice, de lindiffrence et qui appelez de tous votre tre au secours,
Trouvez en ce document les raisons de garder espoir et de croire quaprs la nuit froide et obscure,
le soleil slvera dans votre existence et en clairera tous les recoins pour vous donner de
savourer les dlices dune vie belle et fraternelle sur la terre des Hommes.
Au Pre Tout Puissant pour sa grce et sa misricorde infinies,
Il ma accord de voir la manifestation de la force de son Bras.
Jai mis ma confiance en Lui, je serai toujours dans la gloire de son Nom.

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

Remerciements
________________________________________________________________________________________________________________

REMERCIEMENTS
Nous arrivons tous dans ce monde dans les mains des Hommes et nous dpendons des Hommes
pendant les premires annes de notre vie. Quand nous quittons ce monde, cest encore les
Hommes qui soccupent de la gestion de notre dpouille mortelle. Nul succs nest donc possible
sans la contribution des Hommes et nul mrite ne peut senvisager en dehors des opportunits
cres par les Hommes. Nous sommes tous, puissants comme faibles, redevables des autres dans
nos succs et nous devons faire preuve de gratitude.
Mais qui remercier et qui laisser ? Dans tous les cas, il est impossible de citer tout le monde. Et
pour ne frustrer personne, jen tais arriv me questionner sur la ncessit dun mot de
remerciement.
Mais une sagesse africaine dit : Les yeux voient mais ils ne peuvent raconter. La bouche ne voit
pas mais elle raconte ce quelle ne peut voir. Telle est la ralit de notre existence terrestre. Les
honneurs ne reviennent pas toujours celui quils sont dus.
Jai alors pens que le pire, cest de ne rien faire. Ne rien faire, cest refuser de reconnatre les
contributions diverses qui mont permis darriver ce rsultat. Ce serait injuste car de nombreuses
personnes se sont donnes tant de peine pour que ce travail voie le jour. Pour que jamais elles ne
regrettent davoir pris de linitiative, davoir compatie, davoir espr pour moi et avec moi,
davoir pri et souffert, je me suis dcid leur adresser quelques mots de remerciement.
Les penses et les paroles sont cratrices de force, dengagement. Les penses positives
engendrent la force, le courage, lidal dune humanit plus harmonieuse, plus juste, plus
quitable. Ce que je voudrais, cest que ces mots de remerciement crent en toute personne qui les
lira, un dragon puisant de sagesse et de paix ; un esprit si puissant que tout leur tre matriel et
subtil transpire damour et de charit. Alors, vous tous qui avez tant donn pour moi, lami dun
jour, le fils, le collgue, le pre, le mari, le nouvel ami et mme le parfait infortun inconnu,
jadresse ma profonde gratitude. Je pris la Toute Puissance Divine, la Cration elle-mme, Celle de
qui nous provenons tous, mauvaises comme bonnes gens, de vous inspirer toujours cet lan
transcendant vers lautre pour un avenir de paix et de grce.
Les grandes choses commencent par la petite ide qui jaillit de la pens pure de tout tre. Alors,
que nul estime que ce quil a fait est peu ou pas assez, du moment o il a eu cette petite ide de
faire quelque chose de bien. La montagne est constitue de roches, la roche, de minraux, le
minral de molcules, la molcule datomes et latome de cette nergie invisible mais combien
puissante qui donne lessence de toute chose. Vous croyez sans doute que vous vous tes sentis

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

Remerciements
________________________________________________________________________________________________________________

impuissant et vous avez souffert de votre impotence en vous disant : voil ce que je ferai pour
laider si javais t dcideur. H bien ! Lunivers nest pas rest sourd. Il a entendu les
complaintes qui montent de votre cur meurtri et dcider que votre compassion porte le fruit
dont voil la matrialisation. Grce vous le miracle sest ralis !
Ce mmoire ne peut donc se rduire son contenu scientifique. Il est porteur de force, de
persvrance, de joie, desprance. Il est galement un intgral dnergie, de combat, de foi en
lhomme et en lamour. Il est donc une proprit de luniversel de la persvrance, de lamour
infini, de lexistence cratrice dune humanit grandissante et en qute dharmonie.
Amour et sagesse, lumire et vrit en vous et autour de vous, pour lavnement dun monde
meilleur sur la terre des hommes.
Je voudrais citer des noms pour quils incarnent les interactions multiples que jai eues avec les
tres de tout bord. Chacun ressentira ma gratitude selon ce quil aura fait dans sa conscience. Un
nom dans cette liste ne fait pas de vous un homme de bien ou de mal, car lultime jugement vous
sera fait par votre conscience qui est expression de la prsence de lhumanit en vous. Si vous
navez pas trouv votre nom dans cette liste alors que vous pensez avoir fait quelque chose de
bien, ne men voulez pas car ce document vous appartient. Vous avez vu le nom dune personne
indigne vos yeux, ne vous en faites pas, cest pour que les sentiments de joie que vous dgagez le
purifie afin quil devienne lui aussi un jour, pour un autre commun des mortels, un artisan de la
paix universelle. Sans prsance, merci vous :
-

Moussa Guelbogo, Sagnon NFal, N Ismael Bassol, du CNRFP,

Dapola Evariste Constant Da, Tanga Pierre Zoungrana, P. Honor Som et Stanislas
Ouaro, de lUniversit de Ouagadougou,

Grald Guillaumet, Youssoufi Tour, Anne Lavigne, Gabriel Bergounioux, Guillaume


Groir, Jean-Marc Zaninetti, Pascal Pore, Catherine Alhonor et Sylvie Bargain de
lUniversit dOrlans,

Jean-Marie Fotsing, mon directeur de thse

Jean-Pierre Lacaux du CNES-Media et Franois de Charles Oudraogo de lUniversit de


Ouagadougou, les rapporteurs, Carlo Costantini et Jean-Marc Zaninetti les examinateurs

Hlne Gurgel Da Costa, Maureen Douka, Joachim Etouna, Gervais Wafo, Raphal PinDiop tous doctorants ou ancien doctorant en accueil au Centre IRD dOrlans

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

Remerciements
________________________________________________________________________________________________________________

Carlo Costantini, Didier Fontenille, Frdric Simard, Frdric Huynh, Evelyne Poncet,
Jocelyne Petit, Christine Chauviat, Christophe Mahuzier, Jean-Marie Fotsing, Kenji Ose de
lIRD

Paul

Gnies,

Joseph

Wth,

Amadou

Hama

Maga,

Sina

Thiam,

Salimata

Diakit/Coulibaly, Malick Zorom, Lydie Yiougo, Yacouba Konat, Yonkeu Samuel,


Salifou Dn, Martial Amoussou, Diane Som, Feu Lamine Traor, mes tudiants de M2
MGIEC et GIRE, M1, L3 du 2iE, le corps des enseignants et chercheurs du 2iE
-

Kadidiatou Som/Ouattara, mon pouse, Biauviel Som notre fils, Flicien et Bernadette
Som mon pre et ma mre,

Feu Jean-Franois Som, Feu Jean-Franois Dabir, Pascal Som, Urbain Dabir,
Thomson et Alice Somda, Serges et Zenabou Som, Ghislain Dabir, Abdon et Gisle
Hien, Zan Traor, Mamou Bayala, Dsir Pal, Bamassi Fayama, Tchani, Franois et
Marie-Rose Maurin, Soir Konat, Mathieu Kientga, Arlette Dabir, Lydie Wafo, Issiaka
Sombi, Dramane et Elsa Sanon, Fabrice et vronique Bogo, Evariste Oudraogo, Estelle
et Douada Barro, Boubacar Diaby, Alkassim Bah, Labasse Koumar, Camara Papou et
Maude et Gustave Yamogo, Arsne et Audrey Dabir et tous les autres parents et amis en
France et au Burkina dont les noms nont pu tre cits.

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

Introduction gnrale
________________________________________________________________________________________________________________

INTRODUCTION GENERALE
Contexte et justification
Lenvironnement agit quotidiennement sur notre sant par le biais du milieu qui nous entoure : eau,
air ou sol. En cas de dtrioration brutale de lenvironnement, comme dans les camps de rfugis par
exemple, les impacts sanitaires sont dailleurs considrables 1, affirme la Fondation Nicolas Hulot
pour la Nature et l'Homme. Pour le Centre International de Recherche sur le Dveloppement (CRDI),
Sant des cosystmes gale sant humaine .
Cette mise en miroir de la sant et de lenvironnement nest pas nouvelle. Le fondateur de la
mdecine moderne, Hippocrate, (v. 460 - 377 av. J.-C.) ne disait-il pas que pour approfondir la
mdecine, il faut considrer d'abord les saisons, connatre la qualit des eaux, des vents, tudier les
divers tats du sol et le genre de vie des habitants2 . La dcouverte par Louis Pasteur en 1865, du
microbe et le dveloppement de la microbiologie ont conduit la strilisation, lhygine du milieu
et lassainissement dont limpact sur lesprance de vie de lhomme est indniable. Dans les annes
1980, lmergence de la mdecine environnementale et de lco-toxicologie sinscrit dans cette
dynamique de prise en compte de lenvironnement dans les questions de sant et du bien-tre des
hommes.
La communaut internationale a reconnu ce lien inextricable entre environnement et sant et la dj
exprim de faon trs formelle plusieurs reprises. Cest le cas aux points 3 et 4 du prambule et
aux principes 1 et 7 de la dclaration de la Confrence des Nations Unies sur lEnvironnement, tenue
Stockholm du 5 au 16 juin 1972. Cette reconnaissance est raffirme Rio de Janeiro dans la
dclaration de Confrence des Nations Unies sur lEnvironnement et le Dveloppement du 3 au 14
juin 1992.
Daprs le rapport O.M.S., (2006), plus de 13 millions de dcs sont dus annuellement des causes
environnementales vitables. Prs du tiers des dcs et des maladies qui surviennent dans les rgions
les moins dveloppes sont provoqus par l'environnement. Plus de 40% des dcs des suites du
paludisme et environ 94% des dcs provoqus par des maladies diarrhiques, deux des principaux
tueurs d'enfants au niveau mondial, pourraient tre vits par une meilleure gestion de

http://www.fnh.org/francais/doc/en_ligne/sante/dossier1_intro.htm
D'aprs "Airs, eaux, lieux", in Hippocrate - De l'art mdical, Le livre de poche classique
http://www.fnh.org/francais/doc/en_ligne/sante/dossier1_art1.htm

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

Introduction gnrale
________________________________________________________________________________________________________________

l'environnement [] D'une faon ou d'une autre, l'environnement affecte de manire significative


plus de 80% des principales maladies. 3
Daprs ce rapport, les quatre principales maladies influences par un environnement de mauvaise
qualit sont la diarrhe, les infections des voies respiratoires infrieures, les diffrentes formes de
lsions involontaires et le paludisme 4.
Le paludisme constitue un problme majeur de sant publique dans les rgions tropicales. Selon
lOrganisation Mondiale de la Sant (OMS), 350 500 millions de cas de paludisme sont enregistrs
chaque anne dans le monde, avec plus dun million de dcs. Cest une affection dorigine
parasitaire due un sporozoaire hmatozoaire du genre Plasmodium. Elle est transmise lhomme
lors du repas de sang dun anophle femelle infect. Cest donc une maladie transmission
vectorielle. Les couches de population les plus touches sont les enfants de moins de cinq ans. Le
paludisme est la cause de 18% des dcs denfants de moins de cinq ans. LAfrique est de loin le
continent le plus concern avec plus de 80% de dcs. Environ 25 35% des consultations cliniques,
20 45% des hospitalisations et 15 35% des dcs en milieu hospitalier sont dus cette affection
en Afrique subsaharienne WHO, (2005). Au Burkina Faso, prs de 41,1% des dcs survenus en
milieu hospitalier en 2001 taient imputables cette affection Sirima et al., (2003).
En 1996, une attention particulire est accorde aux maladies lies lenvironnement. Des initiatives
sintressant au paludisme apparaissent, mais travers des programmes larges concernant les
maladies en rapport avec lenvironnement. Le programme Ecosystmes et Sant humaine (cosant)
du Centre International de Recherche sur le Dveloppement (CRDI) en est un exemple. En 1997, la
lutte contre le paludisme fait lobjet dun regain dintrt en raison de la recrudescence de la maladie
dans les pays en voie de dveloppement et de son lien direct avec lenvironnement. Sous lincitation
du Fogarty International Center (FIC), la Multilateral Initiative on Malaria (MIM) est cre en 1997.
En 1998, Roll Back Malaria nat. Le paludisme et le SIDA sont les seules maladies cites parmi les
Objectifs du Millnaire pour le Dveloppement (OMD).
Les programmes de lutte antipaludique reposent sur la lutte anti-plasmodiale combine celle
antivectorielle. La lutte anti-vectorielle a dailleurs constitu la base des premiers succs des
programmes dradication du paludisme dans certaines contres, particulirement en Europe. Elle
vise la rduction du taux de survie de la population vectorielle et du contact homme-vecteur. Les
3

http://www.who.int/mediacentre/news/releases/2006/pr32/fr/index.html

http://www.aidh.org/sante/sante-environn.htm

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

10

Introduction gnrale
________________________________________________________________________________________________________________

premiers succs de cette bataille dans les annes 1950, avec lutilisation des insecticides de synthse
comme le Dichorodiphnyltrichlorothane (DDT) et la dieldrine, ont suscit un espoir dradication
du paludisme.
Cependant, lobjectif dradication na pas t atteint, parce que les vecteurs ont vite dvelopp une
rsistance aux insecticides. Ce qui a contribu la rsurgence de la maladie partout o elle avait
connu un recul Greenwood et Mutabingwa, (2002), Trape et al., (1996). Rien dtonnant que de
nouvelles initiatives soient prises pour limiter le contact homme-vecteur. Actuellement la lutte antivectorielle sattache aussi rduire laccs des vecteurs lhomme par lutilisation de matriaux
imprgns dinsecticides. Toutefois, cette option pose la question des consquences de la rduction
de la transmission du Plasmodium sur limmunit des enfants en bas ge dans les zones hyper
endmiques DAlessandro et al., (1995) ; Snow et Marsh, 1995 ; Binka et al., (1996) ; Nebie, (2002).
Aussi, la lutte gntique sinscrit-elle parmi les initiatives dveloppes pour le contrle de la
population vectorielle. Elle vise le remplacement de la population de vecteurs sauvages par des
moustiques rfractaires au Plasmodium Collin et Besansky, (1994).
Il est largement admis aujourdhui quune lutte anti-vectorielle ne sera efficace long terme qu la
condition dune connaissance approfondie des cycles de transmission, de la biologie et de lcologie
des vecteurs. La non prise en compte de lhtrognit comportementale des vecteurs impliqus
dans le systme de transmission, cest--dire, la mconnaissance de la biologie et de lcologie des
vecteurs, a t sans doute la base des checs enregistrs dans lradication du paludisme en Afrique
Chauvet et al., (1969). Ltat actuel des connaissances sur lcologie des anophles reste insuffisant
pour permettre la mise en place de mesures efficaces de contrle vectoriel. Par exemple, les causes
de lhtrognit spatiale observes dans labondance et la distribution des membres du complexe
Anopheles gambiae sont encore mconnues. Il en est de mme pour les mcanismes qui interviennent
dans la rgulation des populations.
Il est devenu ainsi ncessaire, dans la perspective du contrle de la population des vecteurs, de
prendre en compte cette diversit spcifique et de rpondre efficacement un certain nombre de
questions telles que :
-

quelle est la comptence des nouvelles espces en matire de transmission du paludisme ?

cette spciation en cours est-elle double dune diversification au niveau thologique,


cologique ou biologique ?

un processus dendmisme est-il en cours ?

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

11

Introduction gnrale
________________________________________________________________________________________________________________

Compte tenu des effets dvastateurs de cette maladie sur la sant de la population mondiale, de
nombreux projets ont t initis. Ils visent une meilleure connaissance de la biologie, de lcologie et
de lthologie de cette espce, voire de ce complexe despces, pour plus defficacit dans le contrle
de la population vectorielle. Ainsi, un projet de NIH5 Ecological genomic of An. gambiae, qui
porte la fois sur le Burkina Faso et le Cameroun, est initi conjointement par lUniversit Notre
Dame aux Etats-Unis, le CNRFP6, lOCEAC7 et lIRD8. Ses objectifs sont :
-

tudier les mcanismes gntiques impliqus dans ladaptation du moustique son


environnement ;

dcrire le biotope des deux formes molculaires M et S dAnophles gambiae au


Cameroun et au Burkina Faso ;

tudier et identifier les paramtres du milieu favorisant la prsence de lune ou lautre de ces
deux formes.

Pour atteindre ces objectifs, le projet Ecological genomic of An. gambiae a mis en place un
protocole de recherche plusieurs niveaux dont laire dapplication la plus dtaille (le niveau micro
gographique) doit concider avec une zone de sympatrie, cest--dire une zone o cohabitent,
proportion presque gale, An. gambiae forme molculaire M et An. gambiae forme molculaire S.
Sujet
Le projet Ecological genomic of An. gambiae dont drive ce travail dtude et de recherche, vise
donc rsoudre un problme de sant dans lequel intervient lenvironnement en tant que cadre de
vie du vecteur. Cette problmatique soulve un aspect important, celui de la distribution spatiale des
formes molculaires M et S dAnopheles gambiae, do le titre que porte cette tude :
modlisation de la distribution spatiale des formes molculaires M et S dAnopheles gambiae
sensu stricto au Burkina Faso par les SIG et lanalyse spatiale.
Aussi, ce travail de recherche sinscrit-il dans la problmatique environnement et sant , dans le
volet lutte contre les vecteurs. Il ne sagit pas dune recherche pidmiologique, encore moins de
mdecine, mais plutt une tude dont le but est de contribuer la lutte contre le paludisme par une
meilleure connaissance de la gographie des anophles. La prsente tude propose une rflexion sur
la distribution spatiale des vecteurs. Son ambition est de rpondre des questions essentielles dans la
dfinition de politique et de stratgie de lutte anti-vectorielle. Ces questions sont les suivantes :
comment sont reparties, sur le territoire burkinab, les formes molculaires M et S An. gambiae ?
5

NIH : National Institute for Health


CNRFP : Centre National de Recherche et de Formation sur le Paludisme
7
OCEAC : Organisation de Coordination pour la lutte contre les Endmies en Afrique Centrale
8
IRD : Institut de Recherche pour le Dveloppement
6

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

12

Introduction gnrale
________________________________________________________________________________________________________________

Dans lenvironnement, quest-ce qui dtermine cette rpartition spatiale ?

Objectifs et hypothses
Ce travail a pour objectifs de :
-

dcrire la distribution spatiale des formes molculaires M et S dAn. gambiae s.s. au


Burkina Faso

identifier les facteurs qui dterminent cette distribution

modliser la distribution spatiale

Il sappuie sur trois hypothses : la distribution non alatoire des formes molculaires M et S dAn.
gambiae au Burkina Faso, la dtermination de lorganisation spatiale par les facteurs cologiques et
la contribution diffrentielle des diffrents facteurs environnementaux. Les deux dernires
hypothses ouvrent la perspective dune formalisation mathmatique partir de donnes empiriques.
Ces objectifs et hypothses invitent la gographie une rflexion plus globale, celle de la chorologie
des espces, particulirement celles impliques dans la transmission de certaines maladies. La
biogographie est la branche de la gographie dont lobjet dinvestigation est la rpartition spatiale
des espces et les causes de cette rpartition. Elle dispose dun ensemble de concepts, de mthodes
et doutils qui pourraient tre renouvels sur le plan oprationnel avec lapparition de techniques
nouvelles de traitement de linformation spatiale. Il sagit en loccurrence des systmes
dinformation gographique, de la tldtection et de lanalyse spatiale. Si la biogographie peut
fournir un cadre thorique pour larticulation de lensemble du travail, il ne peut suffire ni du point
de vue technologique ni du point de vue thmatique.

Approche mthodologique
Aussi ce travail sinscrit-il dans une approche pluridisciplinaire qui intgre la fois : la
biogographie, comme cadre thorique de structuration de ltude, lentomologie, comme discipline
qui fournit les connaissances sur les formes molculaires M et S dAn. gambiae. Lanalyse spatiale,
le systme dinformation gographique et lanalyse de donnes statistiques peuvent tre apprhends
comme des mthodes et techniques de structuration et de traitement de donnes.
Ce travail sinscrit dans une dmarche de construction dune structure formalise qui rend compte
des relations spatiales entre les formes molculaires M et S dAn. gambiae s.s. et le milieu. Il doit
permettre une reprsentation formelle simplifie de la distribution spatiale de chaque forme
molculaire dAn. gambiae s.s. travers une fonction mathmatique et une carte de distribution. Le
__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

13

Introduction gnrale
________________________________________________________________________________________________________________

processus de construction de ces modles offre une approche de problmes anciens (la chorologie
des espces) avec des outils nouveaux et des mthodes ractualises par les nouvelles technologies
de traitements de linformation spatiale.

Plan du mmoire
Ce mmoire est structur en deux parties. La premire, intitule Cadrage thmatique, dmarche
scientifique et mthodes ,pose les bases de la rflexion. Elle est compose de trois chapitres. Le
premier chapitre, Etat de lart, dfinition dun champ conceptuel et positionnement scientifique ,
dfinit, lissu dun tat de lart, le champ dinvestigation. Il permet une analyse des concepts et
insre ltude dans une discipline scientifique. Ce qui est indispensable lorientation de la
rflexion. Le second chapitre Bio-cologie dAn. gambiae au Burkina Faso : une relation
formaliser est une prsentation du paludisme, des anophles et du Burkina Faso. Ces trois lments
constituent les objets de ltude, les porteurs de la problmatique et des informations traites dans ce
mmoire. Leur connaissance est indispensable la comprhension du problme tudi, au traitement
des donnes, llaboration de la mthodologie et linterprtation des rsultats. Dans le troisime
chapitre Approche mthodologique sont prsentes la dmarche mthodologique, les mthodes
et les techniques de collecte et de traitement des donnes.
La deuxime partie de ce travail, structuration des donnes, laboration et valuation des
modles , est tourne vers la vrification des hypothses et lvaluation des objectifs. Elle est
compose de trois chapitres. Elle prsente les rsultats du travail travers la structuration de la base
de donnes et des processus au chapitre IV. Le chapitre V contient la prsentation de lorganisation
spatiale des formes molculaires M et S dAn. gambiae s.s. au Burkina Faso et les facteurs
dterminants de cette organisation. Le chapitre VI propose les modles de distribution et leur
valuation.

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

14

Premire Partie : Cadrage thmatique, positionnement scientifique et mthodes


________________________________________________________________________________________________________________

PREMIERE PARTIE :
CADRAGE THEMATIQUE, DEMARCHE
SCIENTIFIQUE ET METHODE

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

15

Premire Partie : Cadrage thmatique, positionnement scientifique et mthodes


________________________________________________________________________________________________________________

Cette premire partie sappuie sur la revue de la littrature scientifique pour situer ce travail de
recherche dans une discipline scientifique : la gographie. Elle contient aussi une prsentation du
paludisme, de lanophle et du Burkina Faso. Elle prsente enfin la mthodologie de ltude. Cette
partie a pour but de cadrer ce travail de recherche tant sur le plan thmatique, thorique,
mthodologique que gographique. Elle rpond aux questions suivantes : dans quelle perspective est
conduite cette tude ? O se situe le site de ltude et quelles sont ses proprits ? Comment
envisager la ralisation de cette tude ? Quels sont les techniques et les outils qui sont utiliss ?
Cette partie est compose de trois chapitres :
-

Le premier vise fixer les limites de nos ambitions partir de la littrature scientifique ;

Le second est une prsentation des anophles et du Burkina Faso (la zone dtude).

Le troisime chapitre est consacr la prsentation de la dmarche, des mthodes et des


techniques.

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

16

Chapitre I : Etat de lart, dfinition dun champ conceptuel et positionnement scientifique


________________________________________________________________________________________________________________

CHAPITRE I : ETAT DE LART, DEFINITION DU CHAMP CONCEPTUEL


ET POSITIONNEMENT SCIENTIFIQUE
Cette tude est loin dtre la premire qui sintresse la distribution spatiale des espces vivantes.
Elle nest ni la premire contribution de la gographie dans le domaine de la sant, ni la premire
dans le domaine de la modlisation spatiale. Les travaux antrieurs sur la modlisation en
gographie, la chorologie des espces, lanalyse spatiale, les maladies transmission vectorielle ou
lpidmiologie, ont donn une richesse aux concepts qui sexprime par la diversit des
interprtations. Ils ont apport beaucoup lvolution de la perception de termes et des techniques
qui sont en usage dans ce mmoire. Dans cet ensemble de rsultats scientifiques et techniques, il faut
trouver sa voie en faisant un usage original des acquis pour rpondre une problmatique donne.
Pour cela, il faut partir de ce qui est fait et dfinir son champ dinvestigation en reprcisant les
concepts structurants du thme et en indiquant un positionnement scientifique. Cest lobjet de ce
chapitre.
Ce chapitre est structur en 2 sections. La premire sancre dans la littrature scientifique pour faire
une synthse sur les diffrents travaux qui abordent la question de la distribution spatiale des vecteurs
de maladies. Elle doit permettre aussi de montrer le rle de la gographie dans ltude des
problmatiques lies la sant et positionner ce travail sur le plan scientifique. La seconde section
situe ces investigations dans le champ de la gographie. Elle sappuie sur le paradigme
biogographique qui lui fournit des hypothses et des indicateurs pour construire un schma
conceptuel.

I.1. GEOGRAPHIE ET ETUDE DES RELATIONS ENTRE


ENVIRONNEMENT ET SANTE
Que vient chercher la gographie dans un questionnement sur la sant humaine ? La maladie est-elle
un phnomne qui entre dans le domaine de comptence des gographes et pourquoi ? Ce sont des
questions rcurrentes auxquelles il faut apporter des rponses qui imposent de dfinir non seulement
la gographie mais galement sa dmarcation avec les autres sciences dans un esprit de conciliation.
Il sagit de soffrir une place dans ce processus de lutte contre les maladies sans tomber dans ce que
Bavoux, (2007) qualifie de boulimie et dbordement pangographique .
Les rponses ces questions sappuient sur une dfinition de lobjet dtude de la gographie et sa
place dans ltude des problmatiques lies la sant. Il est question, tout en dlimitant le champ de

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

17

Chapitre I : Etat de lart, dfinition dun champ conceptuel et positionnement scientifique


________________________________________________________________________________________________________________

comptence de la gographie, de montrer comment elle interagit avec les autres disciplines pour
contribuer une rflexion sur les questions de sant.
Cette analyse du rle de la gographie dans ltude des questions de sant se fonde sur trois axes :
-

laxe conceptuel qui repose sur une volution de la perception de la lutte contre les maladies
en gnral et les maladies transmission vectorielle en particulier ; et offre lopportunit
dune nouvelle contribution de la gographie la rsolution des problmes de sant,

laxe mthodologique fond sur lapproche gographique dans le contexte de la lutte contre
les maladies,

laxe technologique orient sur lutilisation des outils propres au gographe dans ltude des
problmes de sant.

I.1.1

GEOGRAPHIE ET LUTTE CONTRE LES MALADIES

Comment la gographie peut-elle intervenir dans la rflexion sur les problmatiques lies la sant ?
A travers son objet dtude : lespace. Ce paragraphe dveloppe cette rponse et se subdivise en deux
sous paragraphes. Le premier est consacr la dfinition de lobjet de la gographie. Le second se
focalise beaucoup plus sur la relation entre cet objet et les questions de sant.

I.1.1.1

Lobjet de la gographie : lespace

Durant son volution sur plus de 2500 ans, la gographie a connu de nombreuses remises en cause et
de nombreuses reconstructions de son objet. Lunanimit au sein mme de la discipline nest pas
dfinitivement acquise. Toutefois, la tendance actuelle laquelle nous souscrivons et qui semble
fdrer une grande partie de la communaut des gographes, consiste dire que lobjet de la
gographie, cest lespace et son organisation. Comme beaucoup dautres, nous pensons que lobjet
de la gographie contemporaine porte sur lespace et son organisation. [] Lespace est form, soit
par des lieux dfinis par leurs coordonnes gographiques, soit par des portions plus ou moins
tendues de la surface terrestre dont les lments sont des lieux unis par des relations fonctionnelles
que leur confrent ou leur ont confr les socits humaines . Chamussy et al., (1977) cit par
Ciattoni et al., (2005). Cette dfinition de lobjet de la gographie base sur lespace est sans doute la
plus rpandue aujourdhui dans lenseignement suprieur, mme si lacceptation de la notion
despace est aussi sujette discussion.

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

18

Chapitre I : Etat de lart, dfinition dun champ conceptuel et positionnement scientifique


________________________________________________________________________________________________________________

Lespace est [] en ralit, lensemble des lieux rpertoris et qualifis par les gographes, la
totalit des signes quils identifient et interprtent pour diffrencier les objets, les phnomnes la
surface de la terre. Les gographes linventorient, le dcoupent et le ramnent des lments
isolables et combinables, parlant par exemple despaces naturels, ruraux, urbains, perus, vcus, etc.
Ils le cartographient, en extraient les structures directrices, en dcryptent les formes, les fonctions et
les dynamiques []. La gographie permet de rpondre aux questions suivantes qui sont essentielles
dans tout processus humain : quoi ressemble la terre ? O sommes-nous sur la terre et quest-ce
quil y a sur la terre ? La gographie donne aux hommes la connaissance de lespace dans lequel ils
se situent et les cls pour dchiffrer ses fonctionnements Bavoux, (2007). La notion despace se
conoit donc comme milieu gographique, cest--dire un espace dot de proprits dfinies en
fonction des problmatiques. Dans le cadre de ce travail, lespace milieu de vie, habitat des
anophles, influence leur rpartition. Sa dimension gomtrique (forme, taille) comme ces
caractristiques biophysiques, participe la distribution des frquences de ces vecteurs du paludisme
dans lespace.

I.1.1.2

Relation entre espace et lutte contre les maladies

Lespace tant lobjet dtude de la gographie, la lutte contre la maladie sinscrit en partie dans les
comptences du gographe. En effet, la maladie affecte les socits et les hommes qui sont situs
quelque part sur la terre. Le gographe peut y observer la diffusion, les rgularits, les singularits et
les discontinuits. Cette relation de la gographie la rflexion sur les problmes de sant est
particulirement loquente dans le cas du paludisme qui est une maladie transmission vectorielle.
Sa propagation au sein des humains nest possible que par lintermdiaire dun vecteur dont la survie
dpend normment du milieu gographique, de lenvironnement. La lutte contre les maladies,
surtout celles transmission vectorielle, tire dnormes intrts de la gographie qui permet de
caractriser lespace. Lintrt de la gographie pour la rsolution des questions mdicales est bien
antrieur celui des gographes pour la question de sant. La gographie de la sant s'appuie sur
une trs longue tradition, initie par Hippocrate lui-mme qui avanait le rle du climat et de
l'environnement, mais aussi de la localisation gographique, sur l'apparition des maladies 9. La
gographie mdicale est linitiative dun mdecin, lAllemand Leonhard Ludwig Finke (17471837).10 Cest ce quexprime Barrett Frank, (2000) en titrant leur article, Finke's 1792 map of
human diseases: the first world disease map? Le fondateur de lpidmiologie, le Britannique John

http://www.scienceshumaines.com/-0ales-sciences-humaines-et-la-sante-0a_fr_13795.html
Barrett A., Frank (2000) "Finke's 1792 map of human diseases: the first world disease map?" Social Science &
Medicine 50 915-921. http://www.csiss.org/classics/content/106

10

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

19

Chapitre I : Etat de lart, dfinition dun champ conceptuel et positionnement scientifique


________________________________________________________________________________________________________________

Snow11 (1813-1858) ntait pas non plus un gographe. Son fameux essai sur la propagation de
l'pidmie de cholra en 1854 et l'hypothse d'une dissmination de celle-ci par l'intermdiaire de la
distribution d'eau en utilisant les cartes le consacre comme utilisateur de la gographie pour la
rsolution des questions de sant. Ce qui caractrise ces prcurseurs de lusage de la gographie dans
le domaine de la sant, cest la prise en compte de lespace. La place de la gographie dans la lutte
contre la maladie se situe dans la spatialisation des phnomnes morbides et dans lintelligibilit de
lespace pour les questions de sant.
Lespace, porte dentre du gographe dans ltude des phnomnes, donne une autre dimension et
un autre angle dattaque dans la lutte contre la propagation des maladies. La gographie peut alors
contribuer avec efficacit la planification de lutte. Cette contribution de la question spatiale dans la
lutte contre les maladies est de plus en plus exige par les spcialistes de la sant et les tudes
intgrant la dimension spatiale ou msologique de la maladie sont lgions. Lmergence du concept
cosant procde de lintgration de la lutte contre les maladies dans un systme global qui prend
en compte lenvironnement (espace gographique) travers ses diffrentes dclinaisons. Ainsi,
lusage de plus en plus courant de mthodes et outils traditionnellement connus comme
gographiques est perceptible dans les sciences de la sant. Le concept de complexe pathogne12
dvelopp par M. Sorre en 1933 a impos aux plus sceptiques la ncessit dintgrer les phnomnes
morbides dans un systme plus large. 13Le-Bras et Malvy, (2004) confirment cet avis en soutenant le
fait que le concept de complexe pathogne dfini par le gographe Maximillien Sorre en 1933
mrite d'tre revisit la lumire des nouveaux outils permettant de mieux identifier les
dterminants biologiques (gntique molculaire), d'environnement (systme d'information
gographique), des comportements, dpendants des activits des services de soins. Son utilisation
invite porter sur toute menace de maladie un regard l'chelle du monde et envisager les
consquences des bouleversements de l'poque tels que la mondialisation des personnes, des denres
et des biens, la dynamique dmographique, l'urbanisation rapide, l'industrialisation, la dforestation,
l'volution rapide des comportements, la capacit d'efficacit mais aussi de nuisance des systmes de
sant . En exemple, nous citons des publications darticles dans des revues spcialises comme Bio-

11

http://fr.wikipedia.org/wiki/John_Snow
Linterdpendance des organismes mis en jeu dans la production dune mme maladie infectieuse permet de
dgager une unit biologique dun ordre suprieur : le complexe pathogne. Il comprend, avec lhomme et lagent
causal de la maladie, ses vecteurs et tous les tres ou facteurs qui conditionnent ou compromettent leur existence
Sorre, 1961, cit par Raphal Pin-Diop 2006.

12

13

Le Bras M et Malvy J-M. D., Le complexe pathogne tropical : Regard nouveau sur un concept ancien, Mdecine
tropicale 2004, vol. 64, no 6, pp. 613-618 (http://cat.inist.fr/?aModele=afficheN&cpsidt=16594466 )

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

20

Chapitre I : Etat de lart, dfinition dun champ conceptuel et positionnement scientifique


________________________________________________________________________________________________________________

Med : Costantini et al., (2009)14, Thomas et al., (2003)15, de Mushinzimana et al., (2006),16 de
Ratana et al., (2005)17, et de Valle et al., (2007)18, Sabatier et al., (2004)19. Si donc on retrouve la
gographicit dans de nombreuses questions scientifiques, cest parce que [la gographie] est belle,
utile et aise tout ensemble. On peut dire quelle est ncessaire tout le monde20. Cest parce que
son objet est associ des questions existentielles, pratiques, que lusage des produits de la
gographie sert tout le monde un certain moment.
En somme, de par son objet, ses domaines de comptences, la gographie doit apporter sa
contribution aux questions de sant et ce travail de recherche participe de cette dynamique. Elle est
gographique par ses objectifs et par son approche mthodologique. Si lespace fait partie intgrante
de lobjet de la gographie, tout usage de lespace nest pas forcement gographique. La gographie a
son originalit dans lusage de lespace comme moyen de lecture et comprhension des phnomnes.

I.1.2

CONTRIBUTION DE LA GEOGRAPHIE A LA LUTTE CONTRE LES


MALADIES

Lobjet de la gographie justifie son implication dans la recherche sur les questions de sant.
Lapproche des phnomnes spatiaux en gographie a cependant des spcificits. En effet,
lapproche mthodologique des gographes, en tant que spcialistes du spatial, diffre sans doute des
autres disciplines scientifiques et constitue une deuxime raison de limplication de la gographie
dans le domaine de la lutte contre les maladies. Comment lespace intervient-il au plan
14
Costantini, C., Ayala, D., Guelbeogo, W.M., Pombi, M., Som, C.Y., Bassole, I.H., Ose, K., Fotsing, J.-M., Sagnon, N.F.,
Fontenille, D., Besansky, N.J., et Simard, F., 2009, Living at the edge: biogeographic patterns of habitat segregation conform to
speciation by niche expansion in Anopheles gambiae: BioMed Center Ecology, v. 9:16.
15

Thomas P Eisele, Joseph Keating, Chris Swalm, Charles M Mbogo, Andrew K Githeko, James L Regens, John I Githure, Linda
Andrews et John C Beier, 2003, Linking field-based ecological data with remotely sensed data using a geographic information system
in two malaria endemic urban areas of Kenya, Malaria Journal 2003, 2:44, BioMed Central
16

Emmanuel Mushinzimana1, Stephen Munga1, Noboru Minakawa, Li Li, 2006Chen-chieng Feng, Ling Bian, Uriel Kitron, Cindy
Schmidt, Louisa Beck, Guofa Zhou, Andrew K Githeko1 et Guiyun Yan, 2006, Landscape determinants and remote sensing of
anopheline mosquito larval habitats in the western Kenya highlands , BioMed, Malaria Journal2006, 5:13
17

Ratana Sithiprasasna, Won Ja Lee, Donald M Ugsang et Kenneth J Linthicum, Identification and characterization of larval and
adult anopheline mosquito habitats in the Republic of Korea: potential use of remotely sensed data to estimate mosquito distributions,
BioMed Central, International Journal of Health Geographics 2005, 4:17

18
Julie Valle, Marc Souris, Florence Fournet, Audrey Bochaton, Virginie Mobillion, Karine Peyronnie and Grard Salem, 2007,
Sampling in health geography: reconciling geographical objectives and probabilistic methods. An example of a health survey in
Vientiane (Lao PDR) BioMed Central, Emerging Themes in Epidemiology 4:6 doi:10.1186/1742-7622-4-6 http://www.eteonline.com/content/4/1/6
19
P. Sabatier, Babouchkine, J.-M., Morvan, J., Polidori, L., Lacaux, J.-P., Braak, L., Dubois, M.A., et Chaude, H., 2004, S2.Dengue.
Surveillance spatiale et de la dengue. Conception doutils dacquisition, de cheminement, danalyse et de prvision pidmiologique:
ITBM-RBM v. 25 (2004) p. 292-296.
20

D. Martineau, 1970, Nouvelle Gographie, Paris, in Jean-Jacques Bavoux (2007)

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

21

Chapitre I : Etat de lart, dfinition dun champ conceptuel et positionnement scientifique


________________________________________________________________________________________________________________

mthodologique en gographie ? En quoi cette approche de lespace constitue-t-elle un apport dans


lanalyse des problmatiques de sant ?

I.1.2.1 Lespace dans lanalyse gographique


Les gographes, dans leur diversit, ont une conception assez partage de lespace qui est leur
dnominateur commun. Pour eux, lespace est une porte dentre dans la connaissance des
phnomnes. Il est le ferment dun ensemble de questionnements permettant de connatre ltat, le
fonctionnement et la dynamique des phnomnes. Ces questionnements fondent une approche
particulire en gographie : lanalyse spatiale. Cette dernire, en tant quapproche gographique,
localise les phnomnes, rvle leurs structures et leurs configurations. Elle sappuie sur
lorganisation spatiale des phnomnes pour les comprendre et les expliquer. Considrer lespace
comme source de comprhension des phnomnes est en soit une approche qui confre la
gographie, science de lespace, une dimension originale. Ainsi, pour le gographe, le caractre dun
lieu dpend, au moins partiellement, de la situation dans lespace. La rcurrence de certaines
structures et configurations spatiales doit donc tre tudie pour comprendre et expliquer le
fonctionnement et la dynamique des phnomnes dans lespace. La statistique classique, non spatiale
par tradition, est largement btie sur le postulat dun espace neutre, simple support des phnomnes
tudis. Dans cette perspective, la localisation dobservations dans lespace (absolu) et leur position
les unes par rapport aux autres (espace relatif) nexercent aucune influence sur la nature mme de ces
observations. Cette ngation de la premire loi de la gographie de Tobler, selon laquelle chaque
phnomne est reli tous les autres, mais des phnomnes proches dans lespace auront tendance
tre davantage lis que des phnomnes loigns, ne peut que faire frmir le gographe Banos,
(2001) .21 Cette position centrale de lespace comme moyen de comprhension des phnomnes est si
importante quon ne saurait faire de la gographie en dehors de lespace. Cest du moins ce
quaffirme Abler et al., (1971) in Banos, (2001) en disant : la gographie naurait pas lieu dtre si
lubiquit caractrisait toute chose .
Lanalyse spatiale, approche spcifique de lespace dans lanalyse des phnomnes, est ne dans les
annes 1960 dans le monde anglo-saxon et sest particulirement appuye sur des disciplines comme
lconomie spatiale et la sociologie de lEcole de Chicago. Ses prcurseurs sont Von Thm,
Christaller et, beaucoup plus tard Paul Claval et Philippe Pinchemel. Elle prend corps dans les
diffrentes branches de la gographie qui lui fournissent les paradigmes spcifiques. Ltude de
21

Arnaud Banos, A propos de lanalyse spatiale exploratoire des donnes , Cybergeo : European Journal of
Geography [En ligne], Systmes, Modlisation, Gostatistiques Systmes, Modlisation, Gostatistiques,]-->,document
197, mis en ligne le 18 octobre 2001. URL : http://www.cybergeo.eu/index4056.html
__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

22

Chapitre I : Etat de lart, dfinition dun champ conceptuel et positionnement scientifique


________________________________________________________________________________________________________________

larmature urbaine dun pays nutilise pas les mmes concepts que celle relative lorganisation
agraire, mme si ces deux tudes peuvent interfrer dans certains cas. Ainsi lespace est territoire,
biotope ou cosystme et autre chose en fonction des circonstances. Il est peru, vcu ou construit. Il
est physique ou conceptuel. Cette diversit dapprhension de lespace en gographie sintgre dans
diffrents schmes dont les branches de la discipline sont porteuses. Lespace est donc un lment de
fcondit dans lentreprise scientifique du gographe. Il est la fois diversement utilis selon les
circonstances et porte toujours en lui une source dexplication et de comprhension des phnomnes
tudier.
Dans le cadre de ce travail, lespace, lieu de vie du complexe Anopheles gambiae, vecteur du
paludisme, prsente une variabilit dtat qui le rend plus ou moins propice la vie de ce culicid.
Lespace contribue plus ou moins directement lamplification ou la rduction de la transmission
du paludisme. Nul ne peut donc comprendre la propagation du paludisme en excluant lespace qui
dtermine, au moins en partie, le cycle de transmission de la maladie. Cette vision de lespace, milieu
de vie, provient de la biogographie et a t dterminante dans la conceptualisation de la dmarche
de cette tude. Ainsi, lanalyse spatiale en tant quapproche gographique a pris corps dans le
paradigme biogographique et a permis de proposer une perception objective de la distribution
spatiale de membre du complexe An. gambiae.

I.1.2.2 Analyse spatiale et analyse des problmes de sant


La lutte contre les maladies ncessite de comprendre leur tiologie et leur modle de diffusion. Dans
le processus dclosion des maladies, lespace peut prendre une importance particulire, car la
maladie survient dans certains milieux et pas dans dautres, parce que lespace y offre les conditions
favorables. Les travaux du mdecin James Lind 1768, celui du pre de lpidmiologie John Snow,
sur lpidmie de cholra Londres en 1854, de lpidmiologiste Pavlovsky en 1930 avec sa thorie
des foyers naturels des maladies, ceux de M. Sorre (1933) et son concept de complexe pathogne, en
sont des illustrations loquentes. Cela est particulirement vrai pour les maladies infectieuses et les
maladies transmission vectorielle. La gographie peut permettre de rvler lorganisation spatiale
de la maladie en mettant en exergue les structures et les configurations spatiales. Elle connat un
renouveau dans les annes 1960 avec des ambitions de modlisation et de quantification. Cest le
triomphe des quatre grandes familles, celle de Von Thnen, celle Christaller rvise par Lsch, celle
de Reilly et Thiessen, et moins congrment celle de Zipf, Brunet (2000b)22. Cest la priode
22

Roger Brunet; confrence prononce le 24 novembre 1999 et publie dans le Bulletin de la Socit de Gographie de
Lige, 2000, n2, p. 21-30.
__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

23

Chapitre I : Etat de lart, dfinition dun champ conceptuel et positionnement scientifique


________________________________________________________________________________________________________________

dapparition des modles de diffusion associs au calcul des probabilits. Cest aussi lpoque des
modles de simulation qui visaient reproduire des systmes dynamiques. Ces modles
sintressaient anticiper les chances ou les effets d'un changement. Cest encore lavnement des
modles de configurations spatiales, notamment de rseaux et graphes sagittaux, visant modliser
des systmes. La gographie, travers la statistique spatiale exploratoire et lanalyse des
configurations spatiales, a prouv son importance dans la comprhension des problmes de sant et
dans la lutte contre les maladies.
Lorsquil sagit de maladies transmission vectorielle, comme cest le cas dans ce travail de
recherche, lanalyse de la rpartition spatiale des espces vectrices de maladies peut apporter une
contribution importante dans la comprhension de la survenue et de la dynamique des phnomnes
morbides. Cette comprhension soutient la conception des plans de riposte efficace. La contribution
de ce travail, la comprhension de la distribution des formes molculaires M et S dAn. gambiae
s.s., sintgre dans une perspective de recherche de solution efficace pour lutter contre la
transmission vecteur/homme du paludisme. En mettant en relief les facteurs dterminants de la
distribution des diffrentes formes molculaires au Burkina Faso, cette tude ouvre le champ
dautres investigations comme lutilisation de mthode biologique dans le contrle des populations
danophles, la mise en place de pesticides plus adapts la population culicidienne, etc.
Lapproche spatiale de la gographie apporte certes une contribution intressante la connaissance et
la lutte contre les maladies. La mise en uvre de cette approche est possible grce lutilisation des
technologies dont il convient galement danalyser la contribution la rsolution des problmatiques
lies la sant.

I.1.2.3 Techniques gographiques et tude des problmes de sant


Les gographes utilisent certaines techniques en vue doprationnaliser leur approche. Il sagit
essentiellement de la cartographie, des systmes dinformation gographique et de la tldtection.
Selon le cas, les outils spatiaux servent formuler des hypothses, vrifier des hypothses poses
au pralable, orienter les activits de terrain et faire des prdictions (Pin-Diop, 2006). Ces
techniques offrent de ce fait des possibilits de production de donnes et de traitement fort utile dans
de nombreuses disciplines et participent galement au positionnement de la gographie comme une
science importante dans lanalyse des questions de sant. Lengouement quelles suscitent auprs de
bien dautres disciplines est sans doute li aux opportunits particulires quelles offrent la

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

24

Chapitre I : Etat de lart, dfinition dun champ conceptuel et positionnement scientifique


________________________________________________________________________________________________________________

communaut scientifique. Cest ce que lon prsente trs succinctement dans les sous paragraphes
suivants.

Loutil cartographique
Le cartographe par dfaut est devenu, dans certaines contres, certaines priodes, le gographe.
Ainsi, du XVe au XVIIe sicle, dans le contexte des grandes dcouvertes maritimes, la figure du
gographe et celle du cartographe se confondent en Europe Zaninetti, (2005). La cartographie
dsigne la ralisation et l'tude des cartes. Elle mobilise un ensemble de techniques servant la
production des cartes. La cartographie constitue un des moyens privilgis pour l'analyse et la
communication en gographie. Elle sert mieux comprendre l'espace, les territoires et les paysages.
Elle est aussi utilise dans des sciences connexes, comme la dmographie, lconomie, dans le but de
proposer une lecture spatialise des phnomnes (Encyclopdie scientifique en ligne) 23.
Outils de spatialisation par excellence, la cartographie est la fois pour le gographe, un outil
danalyse et un puissant moyen de communication. Cest outil de communication graphique qui
sappuie sur un langage visuel et qui permet une vision simultane et synthtique des phnomnes
spatiaux. Les travaux comme ceux de Jacques Bertin

24

, Serge Bonin25 Roger Brunet26 sur la

smiologie graphique27 pour une utilisation de la carte en tant que mdia, en tant que moyen de
communication mais galement en tant que mthode danalyse en sont une preuve. Les cartes
servent reprsenter des phnomnes gographiques, c'est--dire des phnomnes dont la
configuration spatiale produit du sens (Encyclopdie scientifique en ligne). La cartographie
reconnue plus ou moins unanimement comme un outil privilgi du gographe est lune des
techniques qui a introduit la discipline gographique dans de nombreux champs de recherche et
particulirement celui de la sant. Lvolution technologique, travers lavnement de la
tldtection et du SIG, a facilit la ralisation des cartes.

23

http://www.techno-science.net/?onglet=glossaire&definition=2569
Jacques Bertin, 1967, smiologie graphique : les diagrammes, les rseaux, les cartes, EHESS, dition originale, 2005
4me dition, 452 pages
25
Serge Bonin, 1975, initiation a la graphique, EPI, 172 p.
26
Brunet Roger: la carte mode d'emploi. FAYARD / RECLUS, 1987, 270 p.
27
On appelle smiologie graphique l'ensemble des rgles permettent l'utilisation d'un systme graphique de signes
pour la transmission d'une information Bguin, Michle et Pumain, Denise (1994), La reprsentation des donnes
gographiques. Statistique et cartographie. Paris, Armand Colin.
24

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

25

Chapitre I : Etat de lart, dfinition dun champ conceptuel et positionnement scientifique


________________________________________________________________________________________________________________

Loutil systme dinformation gographique (SIG)


Aujourdhui la gomatique est considre comme un puissant outil pour llaboration des travaux
qui exigent une connaissance plus approfondie de la dynamique spatiale et temporelle des
phnomnes et qui requiert la manipulation, le stockage et la visualisation des gros volumes de
donnes Fotsing, (2003). Lapparition des premiers logiciels de SIG bureautiques sur PC dans
les annes 1990 (Arcview, Mapinfo, etc.), la rduction considrable des cots des logiciels et des
ordinateurs les rendent accessibles aux petites entreprises individuelles, aux laboratoires de
gographie des facults de lettres dsargents. Cette accessibilit aux technologies des SIG, va
galvaniser lusage de la cartographie et de lanalyse spatiale Zaninetti, (2005). Dsormais, lusage de
la carte et de lanalyse spatiale est techniquement accessible. Jusqu cette poque rcente, la
ralisation dune carte relevait dun parcours du combattant. Le spcialiste de la cartographie devait
avoir dnormes connaissances en godsie, en mathmatique etc. et avoir une dextrit
extraordinaire dans le maniement de la plume et autres outils de dessin Som, (2006). La prise en
charge de nombreux calculs et lamlioration de la technique de dessin dj avec la cartomatique puis
avec les SIG ont entran un intrt pour lespace dans de nombreuses disciplines. Cet intrt pour
lespace dans de nouvelles disciplines est galement provoqu par les SIG. Ces derniers ont fourni
des modules puissants de calcul de certains paramtres et dvaluation de certains indicateurs qui ont
ncessit de nombreuses recherches sur la structure de linformation gographique. Nous citons
comme exemple de rflexion Souris, (2006). Les modles dinterpolation et destimation, les
modles de transformation gomtrique et de projection, les fonctions dextrapolation et de mise en
page, sont des composantes de traitement des SIG qui ont t mis contribution dans le cadre de
cette tude. Toutes ces routines de calcul ne sont pas ignores et ne peuvent pas tre ignores dans le
cadre de la rflexion sur les problmes de sant. Les travaux en sant utilisant les SIG comme outils
danalyse ou de cartographie se multiplient. A titre illustratif, citons la thse en pidmiologie de
Tran, (2004) soutenue en 2004 lUniversit de Strasbourg 1, celle de Biteau, (2006) soutenue
l'Universit Montpellier II, celle de Bouyer, (2006) en entomologie mdicale soutenue galement
l'Universit Montpellier II et celle de celle de Balenghien, (2006) lUniversit des sciences des
technologies et de la sant de Grenoble soutenue en 2006. A titre illustratif pour les publications
scientifiques, rappelons galement, les rfrences dj utilises dans la section prcdente telles que
Costantini et al., (2009)28 Thomas et al., (2003), de Mushinzimana et al., (2006) et de Ratana et al.,
(2005).

28

Nous sommes coauteur avec les autres membres du projet de cet article.

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

26

Chapitre I : Etat de lart, dfinition dun champ conceptuel et positionnement scientifique


________________________________________________________________________________________________________________

Les SIG, dans leur fonction de stockage et dintgration de donnes, utilisent bien souvent des
informations provenant de la tldtection, la plus grande source actuelle de donnes spatiales.

La tldtection
En tant quensemble de mthodes et de techniques permettant dacqurir des informations sur les
surfaces sans contact direct avec celles-ci Bonn, (1991), la tldtection a permis au cours des trois
dernires dcennies de produire une grande quantit de donnes spatiales Bouzou et al., (2001);
Som, (2000). Lapplication de la tldtection la surveillance et au contrle des vecteurs de
maladies remonte 1949, lorsque Audy utilisa des photographies ariennes en noir et blanc pour
dterminer les foyers endmiques de typhus en Asie du sud-ouest, partir de la distribution dun
certain type de vgtation Pin-Diop, (2006). Depuis le lancement des premiers satellites civils
dobservation de la terre dans les annes 1970, les progrs scientifiques dans le domaine de la
tldtection sont normes. Les rsolutions spatiales, spectrales et temporelles sont en progrs. Les
mthodes de traitement des donnes issues de la tldtection se sont galement beaucoup
amliores. Les logiciels sont de plus en plus performants et intgrent une grande diversit dindices
(indice de vgtation, indice minralogique, indice ferrugineux, indice hydrologique, etc.). Ceux-ci
sont rattachs des surfaces spcifiques qui peuvent avoir un intrt dans le profil pidmiologique
de certaines maladies. Par son caractre rptitif, synoptique et diversifi du point de vue des
thmatiques, la tldtection est une source dinformation indispensable dans la prvention et le suivi
de certains phnomnes qui affectent la sant des populations. La tldtection, en permettant le suivi
de certains paramtres environnementaux, constitue une source dinformation importante pour
ltude de certaines maladies. Ainsi, et de plus en plus, les capteurs de tldtection sont mme de
fournir aux pidmiologistes linformation pertinente sur le milieu pour ltude et la surveillance des
maladies lies des conditions environnementales particulirement les maladies transmission
vectorielle Tran, (2004). Son impact sur les intervenants dans le domaine de la sant a conduit
lmergence du concept de Tlsant qui sappuie la fois sur la tldtection, les SIG, lanalyse
cartographique et dautres technologies de linformation et de la communication (Internet,
tlcommunication) dont Sabatier et al., (2004), Valle et al., (2007) en sont des illustrations.

I.2. DEFINITION DU CHAMP CONCEPTUEL ET POSITIONNEMENT


SCIENTIFIQUE
Dans les paragraphes prcdents, laccent a t mis sur le rle que peut jouer la gographie dans le
domaine de la sant. Cette fcondit nest pas sans inconvnient car, comme la gographie, un travail

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

27

Chapitre I : Etat de lart, dfinition dun champ conceptuel et positionnement scientifique


________________________________________________________________________________________________________________

de rappropriation de concept et des outils est effectu dans ces disciplines. Il est vident, au regard
de ce qui prcde, que les termes qui constituent le thme de ce travail de recherche peuvent faire
lobjet dune interprtation plurielle. Une mme dfinition dans une mme discipline peut cacher
des paradigmes, mthodologies et enjeux diffrents, voire divergents ou contradictoires, et une mme
posture thorique dans deux disciplines diffrentes peut recourir des mots diffrents Langlois,
(2005). Il convient, en raison des interprtations auxquelles ils sont sujets, de les redfinir dans le
contexte de ce travail. De prime abord, trois concepts sont essentiels : la modlisation, lanalyse
spatiale et le SIG.

I.2.1

MODELISATION : DEFINITION ET TYPE

Le terme modlisation dsigne la fois lactivit de produire un modle et le rsultat de cette


activit Langlois et Reguer, (2005). La modlisation est lart ou la science de produire des
modles au sens fort et de hisser au rang de modles des observations rassembles, cest--dire
didentifier les lments majeurs et les relations les plus assures qui expriment ou bien la structure
dun objet particulier, ou bien la structure commune des objets dune mme classe Brunet et al.,
(1993).
Le modle, quant lui, est une structure formalise pour rendre compte dun ensemble de
phnomnes qui possdent entre eux certaines relations Sanders, (2001) Cette premire dfinition
fait allusion aux relations entre des objets au sein dune structure. Elle prsuppose une totalit et une
interdpendance entre les lments dun systme. Cette totalit nest pas le fruit du hasard. Cette
premire acceptation du modle renvoie la notion de systme et donc la perspective holistique.
Cest le modle - structure. Nous ignorons si ce que nous disons est vrai, mais nous savons que cela
a un sens Langlois et Reguer, (2005). La modlisation se situe ici dans une dmarche de
construction de la structure logique, du fonctionnement dun phnomne conu comme systme.
Un modle est une reprsentation schmatique dun processus, dune dmarche raisonne
Guermond, (2005). Cest une reprsentation idalise du monde rel construite pour dmontrer
certaines de ses proprits Haggett, (1965) in Brunet, (2000b). Le modle est galement une
reprsentation formelle et pure du rel ou d'un systme de relations [] des fins d'interprtation
Brunet, (2000b). Cette seconde acceptation du modle renvoie la notion de modle - schma, une
reprsentation graphique. Elle consiste donc associer une formalisation verbale (comme en
mathmatique, en physique, en chimie, en gographie, etc.) une formalisation graphique (comme un
graphique associ un graphe, un diagramme de phase associ un systme diffrentiel, un schma
__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

28

Chapitre I : Etat de lart, dfinition dun champ conceptuel et positionnement scientifique


________________________________________________________________________________________________________________

molculaire associ une formule chimique, une carte associe aux valeurs dun tableau statistique).
Le modle - schma est une reprsentation du modle - structure Langlois et Reguer, (2005). Elle
peut permettre la mise en forme empirique dobservations non encore expliques. Dans cette
perspective, nous ignorons si ce que nous disons a un sens, mais cest vrai Langlois et Reguer,
(2005). La dmarche, dans ce cas, est de partir dun jeu de donnes observes ou dun systme dj
formalis pour construire une reprsentation dun phnomne de faon en simplifier soit la
description, soit lexplication, soit linterprtation.
Quelle que soit la perspective, la modlisation procde de :
-

la reprsentation qui est un exercice dabstraction de la ralit. Elle aboutit un schma


fidle de la ralit mais qui lui est diffrent. La carte topographique en est une illustration
presque parfaite ; elle est une reprsentation fidle du territoire mais qui lui est diffrent ;

la formalisation qui est synonyme de rigueur mthodologique et confre au modle sa


capacit fournir les moyens de sa rplicabilit sur des phnomnes pouvant tre diffrents.
Cest dire que le modle fournit un langage, un corpus de normes et un canevas pour la
reprsentation du phnomne ;

linterprtation : le modle en tant que rsultat dun processus cognitif, dbouche sur une
interprtation cest--dire quil doit donner un sens Brunet, (2000a).

Toute modlisation doit donc avoir pour objectifs de :


-

comprendre : saisir les motivations qui ont un sens pour chaque homme ;

expliquer : trouver une loi gnrale extrieure lobjet ;

interprter : donner une signification par la mise en relation dun champ de reprsentation
(signifi) avec un autre (signifiant).

Le sens du concept de modlisation, dans ce travail de recherche, ne scarte pas du contenu qui lui
est donne ci-dessus. Il faut donc entendre par modlisation une dmarche de construction dun
modle. Le modle est la fois une structure formalise pour rendre compte dun ensemble de
phnomnes qui possdent entre eux des relations et une reprsentation formelle et pure du rel ou
d'un systme de relations des fins d'interprtation.
Le processus de la modlisation, tel que dfini, sappuie sur une dmarche scientifique qui comprend
la fois le choix des donnes, le choix des chelles, de la mtrique pour lobservation et la collecte
des donnes, leur structuration, leur organisation. Pour cela, la modlisation recourt, dune certaine

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

29

Chapitre I : Etat de lart, dfinition dun champ conceptuel et positionnement scientifique


________________________________________________________________________________________________________________

faon, dautres modles existants dans le cadre de disciplines scientifiques et techniques. La


modlisation est donc difficile envisager en dehors des cadres thoriques scientifiques qui ont
fond les hypothses et les modes de raisonnement. Elle ne peut se raliser non plus sans les outils
techniques et mthodes doprationnalisation de la conception.

Dans le cadre de cette tude,

lanalyse spatiale constitue un des cadres mthodologiques de la modlisation.

I.2.2

LANALYSE SPATIALE

Lanalyse spatiale est ltude formalise de la configuration et des proprits de lespace produit et
vcu par les socits humaines Pumain et Saint-julien Thrse, (1997). Elle est aussi un ensemble
de mthodes mathmatiques et statistiques visant prciser la nature, la quantit et la qualit
attaches aux lieux et aux relations quils entretiennent lensemble constituant lespace en
tudiant simultanment attributs et localisation Brunet, (2000a). Elle recouvre un ensemble de
thories gographiques et de mthodes provenant de la physique, des mathmatiques et de
linformatique Mathian et Piron, (2001). Lanalyse spatiale est donc la fois cadre de penses et
ensemble de mthodes. En tant que cadre de penses, elle considre lespace la fois comme support
dexistence et comme produit de laction. A ce titre, lespace peut servir de justification et
dexplication scientifique autonome. En tant quensemble de mthodes, lanalyse spatiale regorge de
moyens (procdures, modles, techniques, indices, etc.) qui permettent la fois la transformation des
donnes, leur analyse et leur interprtation dun point de vue spatial.
Lanalyse spatiale est utilise dans le cadre de cette tude la fois comme mthode et technique de
traitement de donnes (analyse des sries gostatistiques, choix des techniques destimation,
dextrapolation, etc.) et comme mthode danalyse gographique. Elle doit permettre de montrer sil
existe une organisation / une structuration dans lespace des populations d'An. gambiae s.s. au
Burkina Faso. Elle devra, si cette organisation existe, fournir les outils pour mettre en exergue les
facteurs dorganisation permettant d'expliquer la configuration observe.
Lanalyse spatiale, dans le cadre de cette thse, ne peut donc se concevoir en dehors de la thmatique
qui est la distribution spatiale d'An. gambiae s.s.. En liaison avec le concept de modlisation, il sagit
de trouver un modle qui reprsente la faon dont les configurations spatiales des populations du
complexe An. gambiae sexpriment. Ce modle, reprsentation simplifie de cette configuration, doit
permettre de la comprendre et de lexpliquer. Lespace est une composante importante de cette
modlisation, cest pourquoi, lanalyse spatiale est retenue comme mthode. Encore faut-il des outils
pour lapplication des techniques !
__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

30

Chapitre I : Etat de lart, dfinition dun champ conceptuel et positionnement scientifique


________________________________________________________________________________________________________________

I.2.3

LE SYSTEME DINFORMATION GEOGRAPHIQUE (SIG).

Parmi les nombreuses dfinitions des SIG, nous retenons celle de Thriault, (1995) pour qui, le SIG
est dfini comme un ensemble de principes, de mthodes, dinstruments et de donnes rfrence
spatiale, utilis pour saisir, conserver, transformer, analyser, modliser, simuler et cartographier les
phnomnes et les processus distribus dans lespace gographique.
Les SIG ont deux composantes structurelles :
-

la composante utilisateur qui comprend les hommes et les projets ;

la composante informatique qui regroupe les ordinateurs, les logiciels SIG et les
priphriques spcifiques tels que les systmes de radio positionnement, les scanners,
imprimantes, tables numriser, etc.

Par sa composante utilisateur, le SIG sert de cadre dorganisation de la collecte de donnes et de leur
structuration pour la formalisation de la distribution spatiale d'An. gambiae s.s.. Par sa composante
informatique, il offre lanalyse spatiale des outils de structuration et de stockage des donnes en
vue den faciliter laccs. Il concentre des outils dapplication des techniques (statistique, calcul
dindice, interpolation et estimation, reprsentation cartographique, etc.).
En synthse de cette analyse conceptuelle, ce travail de recherche sinscrit dans une dmarche de
construction dune structure formalise qui rend compte des relations spatiales entre An. gambiae s.s.
et le milieu. Elle vise une reprsentation formelle simplifie pour permettre dexpliquer, de faire
comprendre les configurations spatiales observes. Cette synthse permet non seulement une
meilleure dfinition des objectifs, mais aussi dinscrire cette tude dans un champ scientifique qui
fournira les outils la ralisation des objectifs.

I.2.4

PARADIGME

BIOGEOGRAPHIQUE :

UNE

MATRICE

CONCEPTUELLE POUR LA CONSTRUCTION DU PROJET DE


MODELISATION
Aprs la dfinition des concepts qui ont permis de donner une vue densemble sur le thme, cette
section prcise les objectifs viss par ce travail de recherche et linscrit dans un champ disciplinaire.
Ce champ disciplinaire lui fournit les moyens thoriques ncessaires pour la formulation des bonnes
hypothses et des indicateurs qui en permettront la vrification. Cette section est donc consacre la
prsentation des objectifs, du positionnement scientifique, des hypothses ainsi que des indicateurs.
__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

31

Chapitre I : Etat de lart, dfinition dun champ conceptuel et positionnement scientifique


________________________________________________________________________________________________________________

I.2.4.1

Objectifs de recherche

Lobjectif global de ce travail est dtudier la distribution spatiale des formes molculaire M et S An.
gambiae s.s. et les causes de cette rpartition au Burkina Faso en utilisant les SIG et lanalyse
spatiale. Cest, en quelque sorte, lautcologie d'An. gambiae s.s. au Burkina Faso avec lutilisation
des SIG et de lanalyse spatiale. Il sinscrit dans la perspective de lutte contre les maladies
transmission vectorielle qui se dcline par le biais du contrle de la population de vecteurs. Elle se
dcompose en trois objectifs spcifiques :
1. dcrire la distribution spatiale d'An. gambiae s.s. au Burkina Faso. Ce premier objectif doit
permettre de rpondre aux questions suivantes : comment se repartissent, sur le territoire
burkinab, les formes molculaires M et S An. gambiae s.s. ? Y a-t-il une structure ou une
direction particulire, une tendance des regroupements ou toute autre forme dorganisation
dans la rpartition spatiale des membres du complexe An. gambiae ?
2. identifier les facteurs environnementaux qui dterminent la distribution spatiale des formes
molculaires M et S d'An. gambiae s.s. au Burkina Faso. Ce qui intresse, dans ce second
objectif, ce sont les causes de la distribution observe et dcrite. Nous cherchons donc une
explication ou plutt une justification de la distribution spatiale dcrite.
3. modliser la distribution spatiale des membres du complexe An. gambiae au Burkina Faso. Il
sagit de formaliser la description obtenue en mettant contribution lexplication qui en
dcoule. Ce modle doit permettre de reproduire la distribution sans tre contraint
lobservation directe sur le terrain tout en minimisant le plus possible les carts avec la
ralit. Il doit permettre dexpliquer la distribution des espces concernes.
Latteinte des objectifs ci-dessus cits nest envisageable que si lon sinscrit dans une perspective
thorique en positionnant le thme dans une dmarche scientifique prouve. Pour cela, il convient
de choisir un champ disciplinaire. Cest de cela quil sera question dans le paragraphe
Positionnement scientifique .
En effet, celui qui ambitionne de dcrire, de comprendre et dexpliquer un phnomne sur le plan
scientifique, doit sadosser une science existante, moins den crer une autre. Modlisation,
analyse spatiale et SIG nont donc de pertinence que sils sinscrivent dans un champ disciplinaire
appropri qui leur confre un encrage thmatique. Ce dernier permet de disposer dindicateurs qui
ont un sens pour la mesure des relations, davoir des mthodes dlaboration des mesures, etc. Le
champ disciplinaire qui apparat le plus convenable dans le cadre de cette tude est la biogographie

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

32

Chapitre I : Etat de lart, dfinition dun champ conceptuel et positionnement scientifique


________________________________________________________________________________________________________________

parce quelle est la branche de la gographie qui sintresse la rpartition des tres vivants la
surface de la terre ainsi quaux causes de cette rpartition.

I.2.4.2

Paradigme biogographique et conceptualisation de la modlisation


de la distribution spatiale

Il est aujourdhui tabli que la distribution des espces animales et vgtales la surface de la terre
nest ni uniforme, ni homogne, ni isotrope. Chacune y occupe une aire qui lui est propre, cest-dire une surface dtendue variable, continue ou discontinue, qui circonscrit lensemble des localits
o les populations despces se rencontrent ltat spontan Lacoste et Salanon, (2006). Cest ce qui
permet la dlimitation des aires de distribution gographique des espces ainsi que celles des autres
units taxonomiques des organismes vivants.
La biogographie qui sintresse la rpartition des espces la surface de la terre en a fait son objet
dtude. De ce fait, elle a dvelopp un paradigme, cest--dire un ensemble de concepts
fondamentaux, dhypothses thoriques gnrales, de dmarches mthodologiques et de techniques
qui font consensus et qui guident la recherche scientifique en son sein Bavoux, (2007). Ainsi, le
paradigme biogographique nous offre un cadre de pense, une perspective thorique et une matrice
conceptuelle dans laquelle nous trouvons les concepts de base ncessaires la thorisation de notre
objet dtude. La plupart des modles cologiques dvelopps tirent leur origine dans ce paradigme
biogographique ainsi que le confirme Guisan et Zimmermann, (2000) en affirmant : The core
theory of predictive modeling of biotic entities originates from major trends published in the field of
biogeography.
Dans cette perspective biogographique, la distribution spatiale des organismes vivants est le rsultat
de linfluence de facteurs tant internes quexternes ceux-ci.
Les facteurs internes aux organismes qui dterminent leurs aires de distribution sont :
-

la capacit de propagation,

lamplitude cologique,

le potentiel dvolution.

La capacit de propagation dun organisme vivant est sa capacit dexpansion. Elle dpend la fois
de son potentiel reproductif et de sa capacit de dissmination. Son potentiel reproductif est son
aptitude produire de nouveaux individus en un temps donn dans des conditions optimales. Ce
potentiel reproductif nexprime pas la capacit de reproduction totale car cette dernire dpend
dautres paramtres comme la longvit, la dure de vie fconde, etc. La capacit de dissmination
__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

33

Chapitre I : Etat de lart, dfinition dun champ conceptuel et positionnement scientifique


________________________________________________________________________________________________________________

exprime laptitude de lorganisme se dplacer, se disperser dans lespace, soit de faon passive,
soit de faon active.
Lamplitude cologique est la capacit dun organisme occuper une diversit dhabitats. A la
capacit de propagation se combine donc la valence cologique pour dterminer laire potentielle de
rpartition dun organisme vivant, dune espce. La valence cologique exprime la tolrance dune
espce par rapport un facteur de lenvironnement dtermin, tant donn que tout processus
biologique participant au dveloppement dun organisme ne peut seffectuer que dans des limites de
tolrance dtermines pour un facteur donn. Aussi, existe-t-il une limite minimale et une limite
maximale entre lesquelles tout processus biologique est possible dans un milieu donn par rapport
un facteur environnemental. Entre ces limites se situe le prfrendum ou loptimum cologique. Pour
une espce donne, il est possible de dfinir, en sappuyant sur les prfrenda de lensemble des
paramtres, lenvironnement optimal de dveloppement de lespce : la niche cologique thorique
ou potentielle. Dans la nature, il est toutefois difficile de faire concider cette niche potentielle avec la
niche ralise.
Le potentiel volutif recouvre la plasticit intraspcifique, cest--dire la variabilit des caractres
plus ou moins rversibles lintrieur des individus dune mme espce et lis des conditions du
milieu. Il induit tous les phnomnes dadaptation, de slection, de mutation, dhybridation
observables lintrieur dune espce et qui permettent de sadapter efficacement la pression
exerce par les facteurs environnementaux. Le potentiel volutif tient donc compte des phnomnes
de slection et des stratgies adaptatives.
Le milieu constitue un facteur externe dans la distribution des espces la surface de la terre
travers les conditions quil offre. Pour lessentiel, les principaux facteurs externes sont constitus, des
facteurs cologiques que lon dfinit comme tout lment du milieu, biotique ou abiotique,
susceptible dagir sur les tres vivants, au moins durant une phase de leur cycle de dveloppement
(Dajoz, 2006). Les facteurs cologiques peuvent tre regroups en trois types : les facteurs
abiotiques, les facteurs biotiques et les facteurs historiques.
Les facteurs abiotiques sont lensemble des facteurs cologiques non lis un organisme vivant,
comme le climat, le relief, les sols, etc. A loppos, les facteurs biotiques relvent du vivant. Cest
par exemple la comptition pour les ressources (eau, air, lumire, etc.), les phnomnes de prdation,
etc. La distribution actuelle ne peut toutefois sexpliquer entirement que par des facteurs actuels. Le

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

34

Chapitre I : Etat de lart, dfinition dun champ conceptuel et positionnement scientifique


________________________________________________________________________________________________________________

recours des faits historiques peut concourir lexplication des distributions actuelles des tres
vivants la surface de la terre.
De la synthse sur les facteurs internes et externes de la distribution des espces la surface de la
terre mergent deux lois : la loi du minimum de Liebig (1840)29 et la loi de tolrance de Shelford
(1911)30. Celles-ci supportent la conception thorique en autcologie, ltude des rapports entre une
espce et lenvironnement.
Par gnralisation de la loi du minimum de Liebig, un facteur cologique est une contrainte pour le
dveloppement de lespce lorsquil est absent ou rduit au-dessous dun seuil critique ou bien sil
excde une limite maximale.
La loi de Shelford dit que chaque tre vivant prsente vis--vis des divers facteurs cologiques des
limites de tolrance entre lesquelles se situe un optimum. Cette loi a trois pour corollaires :
1. une espce a des frquences rduites ou est compltement absente dans un milieu lorsque les
facteurs cologiques de celui-ci ont des intensits proches des limites de tolrance ou lorsque
les limites de tolrance sont dpasses ;
2. en raction aux facteurs cologiques dfavorables, les espces peuvent modifier leur cycle de
dveloppement ;
3. lintrieur dune mme espce, mergent des stratgies adaptatives qui sexpriment en
termes daccommodation, de mutation, dcotypage ou de spciation.
Ces lois contribuent, toutes deux, donner un contenu opratoire au concept de facteur limitant qui
dsigne lensemble des facteurs cologiques qui constituent vis--vis dune espce ou dun taxon
donn, un frein, une contrainte au dveloppement de lespce ou du taxon et jouent donc la fois sur
les frquences de population et sur les stratgies adaptatives.
Nous retenons An. gambiae forme molculaire M et An. gambiae forme molculaire S comme des
espces ayant chacune leurs exigences cologiques propres et le territoire du Burkina Faso comme
milieu ayant une varit de conditions environnementales. Lobjectif tant de modliser la
distribution spatiale dAn. gambiae forme molculaire M et dAn. gambiae forme molculaire S,
nous nous appuyons sur ltude des relations qui existent entre ces espces. Chaque forme est tudie
29

La croissance dun vgtal nest possible que dans la mesure o tous les lments indispensables pour lassurer sont
prsents en quantits suffisantes dans le sol. Ce sont les lments dficitaires, proches du minimum limitant, qui
conditionnent la production des cultures http://agora.qc.ca/mot.nsf/Dossiers/Justus_von_Liebig ;
http://fr.wikipedia.org/wiki/Justus_von_Liebig
30
Pour tout facteur de lenvironnement existe un domaine de valeurs (ou intervalle de tolrance) dans lequel tout
processus cologique sous la dpendance de ce facteur pourra seffectuer normalement

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

35

Chapitre I : Etat de lart, dfinition dun champ conceptuel et positionnement scientifique


________________________________________________________________________________________________________________

dans ses relations avec diffrents paramtres du milieu. La biogographie, sous ses aspects
autocologiques, est en phase avec la problmatique et sert de cadre thorique et thmatique.
En adquation avec ce paradigme de la biogographie et lobjectif de cette thse, plusieurs
hypothses peuvent tre formules.

I.2.4.3

Les hypothses de la recherche

La premire hypothse, qui mane du paradigme biogographique et qui est pertinente, est quil
existe une structure dans la distribution spatiale des membres du complexe An. gambiae au Burkina
Faso. Il est possible dobserver, dans ce pays, une variation de la densit des diffrents membres du
complexe en fonction des conditions environnementales. Les populations des diffrents membres du
complexe sont dautant plus leves dans un milieu que celui-ci prsente des conditions proches de
leur niche cologique thorique. Elles satisfont alors aux exigences cologiques des formes
molculaires, conformment aux lois de Schelford et de Liebig.
La deuxime hypothse est que tous les facteurs cologiques ne contribuent pas de la mme faon
la dtermination de cette structure spatiale observe. Certains facteurs environnementaux peuvent
devenir plus facilement que dautres, une contrainte importante, des facteurs limitant pour le
dveloppement et la propagation de lespce.
De la troisime hypothse, nous retiendrons quil est possible dexprimer les frquences de
population en fonction des paramtres les plus dterminants dans la distribution spatiale des membres
du complexe An. gambiae.
Soient P(m), P(s) les frquences de population respectivement dAn. gambiae de forme molculaire M
et de forme molculaire S.
Soient Em et Es, les facteurs environnementaux dterminants de la distribution respectivement des
formes molculaires M et de S dAn. gambiae s.s. ;
P(m) = f(Em)
P(s) = f(Es)
Es= - Em
Cette hypothse signifie quil est possible, connaissant certains paramtres dun milieu, danticiper
sur les frquences de population de forme molculaire M et S dans ce milieu. Elle suppose galement

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

36

Chapitre I : Etat de lart, dfinition dun champ conceptuel et positionnement scientifique


________________________________________________________________________________________________________________

une opposition en terme de dterminants environnementaux entre les formes molculaires M et S.


Pour tester ces hypothses, un certain nombre dindicateurs ont t retenus.

I.2.4.4

Les indicateurs retenus pour la vrification des hypothses de


recherche

La vrification de la premire hypothse sappuie sur deux indicateurs gostatistiques utiliss en


analyse spatiale :
1. lellipse de dviation standard. Cest lexpression sous la forme dune ellipse de la dispersion des
points autour du centre moyen correspondant soit un centrode, soit un barycentre. Il permet
de mesurer si un ensemble dobjets gographiques ont une tendance directionnelle dans lespace.
The ellipse allows you to see if the distribution of features is elongated, and hence has a
particular orientation. You can calculate the standard deviational ellipse using either the
locations of the features or using the locations influenced by an attribute value associated with
the features. The latter is termed a weighted standard deviational ellipse .31
2.

Autocorrlation spatiale et les indices locaux dassociation spatiale (LISA) :


a. Lautocorrlation spatiale permet de mesurer linfluence que la proximit gographique peut
avoir sur les valeurs attributaires observes sur des entits spatiales, le degr de dpendance
spatiale dun processus ponctuel Zaninetti, (2005). Elle vrifie la loi de la proximit de Tobler
daprs laquelle, toutes choses gales par ailleurs, les points voisins ont une propension plus
grande avoir des valeurs plus proches que les points loigns. Ce test est un pralable
lutilisation dun certain nombre dindices. Une distribution autocorrle prsentera un biais
dans lestimation et linterprtation dun certain nombre dindices et de tests statistiques. Cest
pourquoi, il est indispensable de tester lautocorrlation Aubry, (2000). Ce test est fait dans
cette thse partir de la mthode de concentration des valeurs faible/forte (Getis Ord
Gnrale G) et lindice de Moran au seuil de signification de 95%.
b. Les indices locaux dassociation spatiale (LISA) servent identifier les agrgats ou
associations locales et les singularits, ainsi que les configurations spatiales locales dun semi
de points marqus dun caractre quantitatif. Ils mettent en exergue lexistence dune
configuration spatiale dans la distribution des frquences dobservation de M et de S au
Burkina Faso. Les indices retenus dans le cadre de cette thse sont : lindice Getis/Ord Gi* et
lindice I dAnselin Local Moran.

31

ESRI, ArcGIS, Help for spatial statistics toolbox

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

37

Chapitre I : Etat de lart, dfinition dun champ conceptuel et positionnement scientifique


________________________________________________________________________________________________________________

Lexistence dune structure spatiale dans la distribution des formes molculaires M et S dAn.
gambiae s.s., en tant quhypothse, repose sur la mise en rapport de la diversit des milieux et des
exigences cologiques. Aussi, une confirmation de cette hypothse renvoie-t-elle une interrogation
sur la caractrisation du milieu qui met en rapport facteurs cologiques et exigences des populations
dAn. gambiae forme molculaire M et forme S, essence mme de la deuxime hypothse. La
question qui se pose est : quels sont les paramtres qui dterminent la distribution spatiale de la
population dAn. gambiae de forme molculaire M et S ? Ces paramtres sentendent alors comme
facteurs cologiques de distribution des espces cibles.
Il sagit moins didentifier la structure des donnes relatives la fois aux populations dAn. gambiae
forme molculaire M et S que de mesurer limpact des facteurs environnementaux sur leur
distribution spatiale. Pour cela, la statistique exploratoire multidimensionnelle est mise contribution
sous sa composante analyse des axes principaux. Compte tenu des objectifs, de la structure et du type
des donnes, lanalyse en composantes principales est retenue comme mthode danalyse des
donnes. En sortie, cette analyse met en exergue les corrlations entre les variables, les axes de
ressemblance et de dissemblance. Elle servira de premire base de tri de variables pertinentes entrant
dans la dfinition de la niche cologique ralise pour chaque forme molculaire M et S An. gambiae
s.s.. Elle ouvre vers la modlisation de la distribution spatiale des membres du complexe.
Lanalyse en composantes principales a permis de rvler la structure des donnes. Lhypothse
relative la mise en relation des facteurs environnementaux et la rpartition spatiale des populations
des formes molculaires An. gambiae s.s. est plus envisageable. La rgression ou lanalyse de la
covariance (ANCOVA) sont des techniques statistiques appropries pour cela. La rgression met en
quation les frquences transformes des formes molculaires prises individuellement et les facteurs
environnementaux. Elle permet dvaluer la possibilit dune prdiction des frquences en fonction
dun ou de plusieurs paramtres environnementaux. Le seuil de confiance retenu pour la rgression
est de 95%. Lapplication dune analyse de la covariance est indispensable si une ou plusieurs
variables nominales se rvlent dterminantes dans la distribution de ces vecteurs du paludisme.
Cette tude vise donc trois objectifs : la description de la distribution spatiale des formes
molculaires M et S dAn. gambiae s.s., lexplication de cette distribution et sa formalisation. Elle
sappuie sur la biogographie qui fournit les hypothses. Lanalyse spatiale et lanalyse de donnes
sont retenues comme mthodes de traitement de linformation pour la vrification des hypothses.

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

38

Chapitre I : Etat de lart, dfinition dun champ conceptuel et positionnement scientifique


________________________________________________________________________________________________________________

CONCLUSION DU CHAPTIRE I
De ce chapitre, nous retenons que la gographie, de par son objet, son approche et ses outils apporte
une contribution indispensable la connaissance des problmes de sant. Ce travail sinsre dans
cette dynamique douverture de la gographie sur les problmatiques de sant en abordant la
distribution spatiale des vecteurs de maladie en loccurrence les formes molculaires M et S, vecteurs
principaux du paludisme au Burkina Faso. Cela va consister formaliser, travers des modles, les
relations entre ces deux formes molculaires et lenvironnement / lespace. Le paradigme
biogographique savre efficace fournir un cadre thorique et des hypothses prouves afin de
fdrer les contributions des autres disciplines scientifiques et techniques pour atteindre les objectifs
de description, didentification des dterminants environnementaux et de modlisation de la
distribution spatiale des formes molculaires M et S dAn. gambiae au Burkina Faso.
Ce chapitre a ainsi permis de cadrer ce travail de recherche tant au plan conceptuel quau plan
thorique. Toutefois, la dlimitation du thme resterait incomplte tant que le champ dapplication
naurait pas t dfini. Cest lobjet du chapitre suivant consacr la prsentation de lanophle et de
son environnement, le Burkina Faso.

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

39

Chapitre II : Biocolgie dAn. gambiae au Burkina Faso : Une relation formaliser


________________________________________________________________________________________________________________

CHAPITRE II : BIO-ECOLOGIE DAn. gambiae AU BURKINA FASO : UNE


RELATION A FORMALISER
La modlisation en gographie commence par deux questions invitables et associes : o sommesnous ? Quest-ce qui a des chances d'tre en jeu ? Brunet, (2000a). Ce chapitre vise rpondre
ces deux questions. Son objectif est de prsenter le champ dapplication de ce travail de recherche.
La connaissance du champ dapplication (lanophle et le Burkina) est indispensable non seulement
la conception dune mthodologie oprationnelle mais aussi linterprtation des donnes. Parce que
le paludisme confre cette tude un caractre utilitaire par son engagement dans une problmatique
dactualit sur les questions de sant, nous y donnons galement une prsentation de cette maladie.
Ce chapitre est compos de trois sections : la premire est un expos sur le paludisme dont les deux
formes molculaire M et S dAn. gambiae sont vecteurs, la seconde est consacre la biocologique
des anophles, enfin, la troisime fait une prsentation du Burkina Faso, la zone dtude.

II.1 LE PALUDISME UNE MALADIE DE SANTE PUBLIQUE DONT


LANOPHELE EST LE VECTEUR
Le Paludisme (ou malaria) est une maladie endmique qui svit de faon continuelle dans les rgions
tropicales et subtropicales de lAfrique, de lAsie du sud et du sud-est et de lAmrique du sud. Elle
doit son nom au mot Latin Palus (= marais) ou au mot Italien malaria (= mauvais air). Cest une
maladie infectieuse due des parasites protozoaire du genre Plasmodium. Ces parasites sont transmis
dun individu lautre par les femelles des moustiques du genre Anopheles. Il existe quatre espces
de Plasmodium capables dinfecter lHomme : Plasmodium falciparum, Welch, (1897), Plasmodium
vivax, Grassi et Felleti, (1890), Plasmodium malariae (Laveran, 1881) et Plasmodium ovale
Stephens, (1922).
II.1.1 LE PALUDISME DANS LE MONDE ET AU BURKINA FASO
Le Paludisme est la maladie la plus rpandue dans le monde. Selon lOrganisation Mondiale de la
Sant (O.M.S), 102 pays y sont exposs. Plus de 40% de la population mondiale, soit plus de deux
milliards de personnes, vivent dans des rgions risque. Quelques 300 millions de cas cliniques de
paludisme sont enregistrs chaque anne dans le monde et entranent prs de 1 1,5 millions de
dcs par an. Prs de 90% de ces dcs sont enregistrs en Afrique subsaharienne o les plus touchs
sont les enfants de 0 5 ans et les femmes enceintes OMS, (1999).
Au Burkina Faso, le paludisme est la premire cause de consultation, dhospitalisation et de dcs
dans les formations sanitaires. Il reprsente plus de trois millions de cas cliniques avec
__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

40

Chapitre II : Biocolgie dAn. gambiae au Burkina Faso : Une relation formaliser


________________________________________________________________________________________________________________

15 000 dcs dclars chaque anne surtout parmi les enfants de 0 5 ans CNLP (1994). Daprs la
Banque Mondiale32 citant le Programme national de lutte contre le paludisme du Burkina (PNLP),
environ 5 450 000 cas de paludisme ont t enregistrs, en 2007, dans lensemble des formations
sanitaires du pays. 12 000 cas de dcs sont recenss sur ce nombre soit un taux de ltalit de 2 %.
Chez les enfants de 0 5 ans qui ne reprsentent que 19% de la population,
2 615 000 cas de paludisme ont t enregistrs. En moyenne, chaque enfant de cette tranche dge a
consult un mdecin ou un agent de sant au moins une fois pour le paludisme. Le total des cas de
paludisme enregistrs chez les femmes enceintes est de 154 000 et 94 en sont dcdes. Plus de la
moiti des cas et des dcs par paludisme surviennent pendant la saison pluvieuse, entre aot et
novembre (correspondant la saison de forte transmission de la maladie).
Selon le Programme National de lutte contre le Paludisme (PNLP, 2007)33 au Burkina Faso, cette
maladie reste une endmie stable dans tout le pays, avec une recrudescence saisonnire (mai
octobre). Selon les donnes statistiques du systme national dinformation sanitaire (SNIS), le
paludisme est la premire cause de consultation (35%), dhospitalisation (41%) et de dcs (37%) en
2005. Les enfants de moins de 5 ans restent les plus touchs durant lanne 2005. Dans cette tranche
dge, le paludisme reprsente 45% des motifs de consultation, 55% des hospitalisations et 57% des
dcs.
II.1.2 LA LUTTE CONTRE LE PALUDISME
Au Burkina Faso, le plan stratgique 2006-2010 de lutte contre le paludisme, estim prs de 45
milliards de francs CFA, se rsume en 13 points :
1. rendre disponible et accessible le traitement aux Combinaisons Thrapeutiques base
d'Artmisinine (CTA) au niveau des formations sanitaires et de la communaut ;
2. promouvoir les Interventions Base Communautaire (IBC) par la clarification du statut et
rle des relais communautaires ;
3. rendre accessible le traitement du paludisme grave dans les centres de rfrence ;
4. acclrer le passage lchelle de la Prise en Charge Intgre des Maladies de lEnfant
(PCIME) ;
5. promouvoir la lutte intgre contre les vecteurs (LIV) ;

32

http://web.worldbank.org/WBSITE/EXTERNAL/ACCUEILEXTN/PAYSEXTN/AFRICAINFRENCHEXT/BURKI
NAFASOINFRENCHEXTN/0,,contentMDK:21744044~pagePK:1497618~piPK:217854~theSitePK:463455,00.html
33
PNLP, 2007, Plan stratgique de lutte contre le paludisme 2006-2010,
http://209.85.129.132/search?q=cache:T1SAeMEEo0YJ:www.rollbackmalaria.org/countryaction/nsp/burkina.pdf+PNL
P+Burkina+p%C3%A9riode+de+transmission&cd=7&hl=fr&ct=clnk&gl=fr&client=firefox-a
__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

41

Chapitre II : Biocolgie dAn. gambiae au Burkina Faso : Une relation formaliser


________________________________________________________________________________________________________________

6. rendre disponibles et accessibles les moustiquaires traites aux insecticides (MTI) travers
diffrents canaux (Secteur public, priv) ;
7. mettre lchelle le traitement prventif intermittent (TPI) chez la femme enceinte ;
8. renforcer le plaidoyer, la mobilisation sociale et la communication pour le changement de
comportement CNLP, (2007) ;
9. renforcer les capacits institutionnelles du PNLP ;
10. renforcer le partenariat et la collaboration multisectorielle dans la lutte contre le paludisme;
11. orienter les domaines de recherche adapts aux besoins de gestion du programme ;
12. contribuer la ralisation des travaux de recherche sur le paludisme ;
13. renforcer le systme de suivi valuation.
La lutte antipaludique a t dfinie comme lensemble des mesures destines supprimer, ou tout au
moins rduire, la mortalit et la morbidit dues au paludisme O.M.S, (1974). Elle comporte des
actions curatives fondes sur la chimiothrapie des malades, et des actions prventives bases sur la
chimioprophylaxie et/ou la rduction du contact homme/vecteur.
II.1.2.1

La lutte contre le Parasite

La lutte contre le parasite repose sur la chimiothrapie des malades et la chimioprophylaxie pour les
groupes risques (femme enceinte, enfant de moins de 5 ans et personnes provenant de zones non
impaludes). Cette chimiothrapie connat des limites aujourd'hui cause de lapparition de souches
de Plasmodium rsistantes aux antipaludiques Charmot, (1987); Wernsdorfer, (1991).
II.1.2.2

La lutte contre les vecteurs

La lutte anti-vectorielle repose actuellement sur deux types de mthodes savoir : les mthodes de
lutte anti-larvaire et celles contre les adultes. La lutte anti-larvaire consiste rduire les populations
danophles

leur

source

de

production.

Trois

mthodes

sont

couramment

utilises :
-

les mthodes physiques, par suppression des gtes larvaires Mouchet et Carnevale, (1991) ;

les mthodes chimiques, par utilisation de substances chimiques (huile, vert de Paris ou
acetoarsenite de cuivre) qui dtruisent les larves Service, (1993) ;

les mthodes biologiques, par levage de poissons larvivores (Gambusia affinis, Poecillia
reticulata) ou par pandage dans les gtes, de bactries (Bacillus thuringiensis israeliensis,
Bacillus sphaericus) empchant le dveloppement des larves Lacey et al., (1984).

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

42

Chapitre II : Biocolgie dAn. gambiae au Burkina Faso : Une relation formaliser


________________________________________________________________________________________________________________

Les mthodes de lutte contre les anophles adultes reposent sur lutilisation de barrires physiques,
de rpulsifs ou dinsecticides Diabat, (1999); Ilboudo-Sanogo, (2001). Lusage des matriaux
imprgns dinsecticides pose la question de la consquence de la rduction de la transmission du
Plasmodium sur limmunit des enfants en bas ge dans les zones hyper-endmiques Binka et al.,
(1996); Nbi, (2002); Snow et Marsh, (1995). Tous ces problmes font quil existe aujourdhui peu
doutils efficaces pour lutter contre le paludisme, do la ncessit denvisager dautres mthodes de
lutte en attendant la mise en place dun vaccin.

II.1.2.3

Les perspectives de la lutte contre le paludisme

Face aux doutes de la communaut scientifique vis vis de leffet des matriaux imprgns
dinsecticides Binka et al., (1996); Nbi, (2002); Quinones et al., (1997); Snow et Marsh, (1995);
Trape et Roger, (1996) et dans lattente dun vaccin efficace et financirement accessible, il apparat
ncessaire de dvelopper dautres mthodes de contrle vectoriel. Parmi ces mthodes, la lutte
gntique apparat comme une alternative intressante.
La lutte gntique envisage est le remplacement ventuel des populations vectrices sauvages par
dautres trans-gniques incapables de transmettre le parasite par lintroduction de gnes de rsistance
au Plasmodium au sein de la population vectorielle Curtis, (1996); Carlson et al., (1995). Avec le
squenage du gnome dAnopheles gambiae publi en 2002 Holt et al., (2002), il devient possible
de dvelopper de nouvelles cibles pour le contrle de la transmission.
Quelle que soit la stratgie de lutte anti-vectorielle adopte, la caractrisation exacte des espces, la
connaissance de leur bio-cologie, du flux gntique entre elles et leur rpartition spatio-temporelle
constituent un pralable si lon veut rendre la lutte plus slective et plus efficace.
II.1.3 LE CYCLE DE TRANSMISSION DU PALUDISME
Le cycle de dveloppement des Plasmodium comporte deux phases : une chez le moustique et une
autre chez lHomme (figure 1).
Chez lhomme, par sa piqre, la femelle de lanophle infeste inocule des centaines de parasites (les
sporozotes) qui gagnent rapidement le foie o ils se multiplient. Au bout de 9 18 jours selon
lespce de Plasmodium, les parasites qui se trouvent sous une forme appele mrozote, passent
dans le sang, envahissent les hmaties et se multiplient nouveau. Aprs un certain nombre de
multiplications, certains mrozotes se transforment en gamtocytes mles et femelles.

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

43

Chapitre II : Biocolgie dAn. gambiae au Burkina Faso : Une relation formaliser


________________________________________________________________________________________________________________

Le moustique sinfeste en piquant une personne dont le sang contient des gamtocytes. Le
dveloppement des parasites dans lorganisme de linsecte aboutit une nouvelle gnration de
parasites, les sporozotes qui migrent vers les glandes salivaires o ils demeurent jusqu ce que
linsecte pique de nouveau un individu. Et un nouveau cycle reprend ainsi.

.
Figure 1 : cycle du plasmodium, http://www.traveldoctor.co.uk/malaria.htm

II.2

BIO-ECOLOGIE DAnopheles gambiae

Connatre la bio-cologie dune espce est une condition sine qua non ltude de sa rpartition dans
un espace donn. Il est difficile de saisir les rapports entre un milieu et un organisme sans connatre
loffre cologique de ce milieu et les exigences vitales de lespce. Ce paragraphe est un expos sur
la bio-cologie dAnopheles gambiae. Mme si la connaissance de ce complexe despces par
rapports aux diffrents facteurs cologiques pris individuellement nest pas toujours trs prcise, une
synthse de celle-ci constitue une avance significative dans la conduite de ce projet.
Ce point, consacr la bio-cologie des anophles, sarticule autour de la position zoologique de
celles-ci, de leur cycle de dveloppement et de leur cologie diffrents stades de dveloppement.

II.2.1 LA POSITION ZOOLOGIQUE


Les anophles sont des Arthropodes appartenant la classe des Insectes, lordre des Diptres, du
sous-ordre des Nmatocres et la grande famille des Culicidae. Cette famille compte plus de 3 450
espces et sous-espces regroupes en trois sous-familles : la sous-famille des Toxorhynchitinae, la
sous-famille des Anophelinae et celle des Culicinae. Parmi ces sous-familles, celle des Anophelinae

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

44

Chapitre II : Biocolgie dAn. gambiae au Burkina Faso : Une relation formaliser


________________________________________________________________________________________________________________

est constitue de 3 genres (Bironella ; Chagasia ; Anopheles). Le genre Anopheles est le plus
important sur le plan mdical. Il regroupe 400 espces dont 70 sont des vecteurs de maladies
humaines Bruce-Chwatt et Zulueta, (1985).

En Afrique subsaharienne, ce sont les membres du complexe34 Anopheles gambiae et Anopheles


funestus qui sont les vecteurs majeurs du paludisme. Certaines observations faites sur lcologie des
vecteurs ont mis en exergue une htrognit au sein de cette population Anopheles gambiae. Les
investigations ont rvl plus tard que Anopheles gambiae est un complexe despces.
II.2.2 PRESENTATION DU COMPLEXE Anopheles gambiae
La plupart des espces danophle ont t dcrites et nommes suivant le concept morphologique
de lespce . Avec le dveloppement de la gntique, le concept moderne de lespce est
essentiellement bas sur la mise en vidence de barrire de reproduction entre spcimens. Un
complexe despces est un ensemble despces non identifiables morphologiquement et caractrises
par un isolement reproductif. Le complexe An. gambiae est le plus tudi au monde Mouchet et al.,
(2004).
Les premires indications dune htrognit au sein des populations dAn. gambiae furent en effet
bases sur des considrations purement cologiques avec la description de variants capables de
coloniser des gtes larvaires saumtres Muirhead-Thomson, (1951). Sur la base de croisements
effectus en laboratoire, ces variants se sont avrs partiellement isols des souches infodes aux
gtes deau douce, elles-mmes formant trois groupes de croisements distincts Davidson, (1964);
Davidson et Jakson, (1962); Paterson, (1964). Les travaux de Coluzzi en cytogntique Coluzzi et
Sabatini, (1967), (1968a, b), ont permis une avance considrable des moyens didentification des
diffrentes espces

constitutives du complexe An. gambiae, base sur lexistence dinversions

chromosomiques polymorphes mises en vidence par coloration des chromosomes gants isols des
glandes salivaires des larves au stade IV ou des ovaires des femelles semi-gravides Green, (1972).
Les progrs de la biologie molculaire ont alors permis le dveloppement de sondes ADN
spcifiques Collins et al., (1987); Crampton et Hill, (1993) qui ont dbouch sur la mise au point
dun test diagnostic bas sur lamplification par PCR des gnes codant pour les ARN ribosomaux
Scott et al., (1993). Ce test permet lidentification rapide des spcimens collects sur le terrain, quels
que soient le sexe et le stade de leur dveloppement. Il ncessite trs peu de matriel de dpart. Son

34
Un complexe despces est un ensemble despces jumelles parce que morphologiquement trs voisines, voire indiffrentiables, dont lidentification
demande lutilisation de critres mixiologiques, cytogntique, biochimique ou molculaire. Chaque espce dun complexe prsente des
comportements, une cologie et des comptences vectorielles spcifiques. (J. Mouchet et al. 2004)

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

45

Chapitre II : Biocolgie dAn. gambiae au Burkina Faso : Une relation formaliser


________________________________________________________________________________________________________________

efficacit a t grandement dmontre Fontenille et al., (1993) et il est maintenant pratiqu en


routine dans de nombreux laboratoires.
Le complexe An. gambiae comprend aujourdhui sept espces bien diffrencies :
- An. gambiae s.s. (sens strict) Giles, (1902);
- An. arabiensis Patton, (1904);
- An. bwambae White, (1985);
- An. melas Theobald, (1903);
- An. merus Doenitz, (1902);
- An. quadriannulatus Theobald, (1911);
- An. quadriannulatus B, dnomination provisoire de la septime espce du complexe identifie trs
rcemment en Ethiopie Hunt et al., (1998).
An. gambiae s.s., An. arabiensis, sont les membres du complexe prsents au Burkina Faso Petrarca
et al., (1986). An. gambiae s.s. prsente deux formes chromosomiques appeles Mopti et Savane,
caractrises par une limitation de flux gnique. Ces deux formes correspondent respectivement
deux profils molculaires dnomms : forme molculaire M et forme molculaire S Favia et al.,
(1997); Favia et al., (2001). Le cycle de dveloppement de ces formes molculaires na pas t
particulirement dcrit. Aussi, retient-on pour leur cycle de dveloppement, celui des anophles.

II.2.3 LE CYCLE DE DEVELOPPEMENT DES ANOPHELES


Les anophles sont des holomtaboles35 qui prsentent quatre stades au cours de leur vie. Ces stades
constituent le cycle de dveloppement. Ce cycle de dveloppement des anophles est marqu par
deux phases : une phase aquatique et une phase arienne. La phase aquatique regroupe les trois
premiers stades. Elle est appele aussi phase pr-imaginale. Elle va de luf la nymphe via les
stades larvaires. La phase arienne concerne ladulte ail ou imago (Figure 2).

35

Holomtaboles : A mtamorphose complte.

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

46

Chapitre II : Biocolgie dAn. gambiae au Burkina Faso : Une relation formaliser


________________________________________________________________________________________________________________

Figure 2 : Cycle de dveloppement de lAnophle In Y (2005)36

II.2.3.1

La phase de vie aquatique

Cette phase dbute avec la ponte des ufs la surface de leau. Les ufs au nombre de 30 300 par
ponte sont dposs un un la surface de leau et flottent jusqu lclosion. Sous les tropiques, les
ufs closent habituellement 2 3 jours aprs la ponte Rodhain et Perez, (1985). La larve merge en
utilisant une dent duf place en position postro-dorsale sur sa tte. Elle possde les trois
tagmes caractristiques des insectes, cest dire la tte, le thorax et labdomen. La larve est
dpourvue de pattes mais possde de nombreuses soies qui recouvrent tout le corps. Elle est capable
de nager dans leau grce des mouvements ondulants de son corps. Elle respire lair extrieur par
des stigmates dorsaux situs lextrmit de labdomen, ce qui lui impose une position de repos
parallle la surface de leau.
Les larves ne se dveloppent pas en continu, elles passent par quatre stades diffrents. La petite larve
qui merge de luf est appele larve de premier stade ou larve de stade I. Elle mesure environ 1,5
mm de long et subit trois mues successives qui la transforment en larve de stade II, III et enfin de
stade IV. La larve de 4e stade mesure environ 8 10 mm de long. La vie larvaire dure de 8 12 jours
dans des conditions favorables Rodhain et Perez, (1985).
La larve de quatrime stade, au terme de son dveloppement, se transforme en une nymphe, dont la
forme gnrale est celle dune virgule. La nymphe ne se nourrit pas, elle reprsente un stade
intermdiaire. Elle subit de trs profondes transformations morphologiques et physiologiques pour
36

Yazoum Y, 2005, Incorporating environmental factors in modelling malaria transmission in under five children in rural Burkina Faso, doctor

scientiarum humanarum, ruprecht-karls-university Heidelberg.

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

47

Chapitre II : Biocolgie dAn. gambiae au Burkina Faso : Une relation formaliser


________________________________________________________________________________________________________________

donner un moustique adulte arien aprs une priode de 1 4 jours sous les tropiques Rodhain et
Perez, (1985).

II.2.3.2

La phase de vie arienne

Ladulte ou imago qui merge de la nymphe est un insecte au corps long et grle, dot de longues
pattes et de longues pices buccales en forme daiguille. Peu aprs leur mergence, les adultes (mles
et femelles) senvolent et les femelles saccouplent aussitt avec des mles plus gs qui essaiment
au-dessus de leau. En gnral, les femelles ne saccouplent quune seule fois dans leur vie, mais
pondent priodiquement pendant toute leur existence. Les spermatozodes sont stocks dans une
spermathque o ils conservent leur pouvoir fcondant jusqu la mort de la femelle Bruce-Chwatt et
Zulueta, (1985).
Aprs 24 48 heures de vie adulte, la femelle va la recherche de son premier repas sanguin. Elle a
besoin de sang comme source de protines pour le dveloppement et la maturation de ses ufs. Ds
la fin du repas, commence la digestion et simultanment les ovaires se dveloppent. Les femelles
gravides se mettent en qute dun lieu favorable la ponte. La fcondation de lovule a lieu lors de la
ponte. Une fois quelles ont dpos leurs ufs, elles retournent prendre un autre repas de sang pour
aller pondre nouveau et le cycle reprend. La longvit de ladulte est estime une vingtaine de
jours, gure plus dun mois dans les conditions habituelles Robert et al., (1989). La priode allant du
repas sanguin la ponte est appele cycle gonotrophique. Elle dure environ 48 heures dans les
conditions de tempratures comprises entre 23C et 25C Bruce-Chwatt et Zulueta, (1985).
Le cycle gonotrophique comprend trois phases :
- la recherche de lhte et la prise du repas de sang,
- la digestion du sang et la maturation ovarienne,
- la recherche du lieu de ponte par la femelle gravide.
La ponte a lieu gnralement au crpuscule. Les caractristiques physico-chimiques de leau des
gtes sont analyses par des chmorcepteurs situs sur les pattes.

II.2.4 LECOLOGIE DES ADULTES


Les anophles sont actifs du coucher au lever du soleil. Toutefois, les heures dagressivit maximale
varient selon les espces. Il y a galement des variations dans les comportements trophiques. Certains
moustiques piquent prfrentiellement lintrieur des habitations, ce sont des endophages, dautres
prfrent piquer lextrieur des habitations, ce sont des exophages.
__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

48

Chapitre II : Biocolgie dAn. gambiae au Burkina Faso : Une relation formaliser


________________________________________________________________________________________________________________

Les anophles prsentent galement des choix pour leur repas sanguin. De nombreuses espces
danophles se nourrissent la fois sur lhomme et sur lanimal. Certaines espces prennent leur
repas sanguin principalement sur les animaux. Ce sont des zoophiles. Dautres ne se gorgent
pratiquement que sur lhomme. Ce sont des anthropophiles. Les espces anthropophiles ont un taux
dinfection plus lev que les zoophiles White, (1974).
Les vecteurs de paludisme sont ingalement repartis sur les continents. En Afrique subsaharienne,
Anopheles gambiae sensu lato et Anopheles funestus sont les vecteurs majeurs du paludisme
Mouchet et Carnevale, (1991). Anopheles gambiae s.s. et An. arabiensis sont les deux espces du
complexe les plus rpandues Tour, (1988). Leurs aires de rpartition se chevauchent partiellement :
An.gambiae s.s. est classiquement adapt aux zones de forts et de savanes humides alors quAn.
arabiensis peuple les environnements plus secs jusquen bordure du Sahara Chauvet et al., (1969);
Coluzzi et al., 1979; Coz, (1973).
En zone de savane, ils sont souvent en sympatrie et trs bien adapts lhomme et son
environnement. Ils se comportent comme des espces endophiles et anthropophiles. Cest auprs de
lhomme quelles trouvent les gtes larvaires et ceux de repos qui leur conviennent le mieux Coluzzi,
(2002); Gillies et Meillon, (1968). Cependant An. arabiensis est plus zoophile et exophile
quAn.gambiae s.s. Costantini et al., (1998); Robert et Carnevale, (1984); White, (1974). Daprs
Rajagopalan et al., (1991), la plupart des anophles se dispersent dans un rayon denviron un
kilomtre autour de leur gte. Pour An. gambiae s.s., ce rayon de dispersion autour des gtes varie en
moyenne entre 1 et 1,6 km. Ce rayon est de 0,8 km pour An. funestus.

II.2.5 LECOLOGIE DES LARVES (STADES PRE-IMAGINAUX) :


CARACTERISTIQUES DES HABITATS LARVAIRES
Les larves des deux vecteurs majeurs du complexe An. gambiae tendent occuper des gtes de
diverses natures, mais tous sont gnralement des gtes temporaires ou semi permanents ensoleills
comme les flaques deau Gillies et Coetzee, (1987); Gillies et Meillon, (1968); Hamon et al., (1956).
Les gtes de reproduction dAn. gambiae s.s. et dAn. arabiensis concident gnralement. Les deux
espces ont t rencontres ensembles dans les mmes gtes au Nigeria Service, (1970b). Cependant,
dautres tudes ont montr une rpartition htrogne significative entre ces deux espces Minakawa
et al., (1999); Sagnon, (1999); Sagnon et al., (2000); Service et al., (1978); White et Rosen, (1973).

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

49

Chapitre II : Biocolgie dAn. gambiae au Burkina Faso : Une relation formaliser


________________________________________________________________________________________________________________

Une htrognit temporelle dans la composition des gtes a t observe au Mali Sangar, (2000);
Tour et al., (1998). Pour Le-Sueur et Sharp, (1988), les paramtres tels que le pH, loxygne
dissous, la turbidit nexpliquent pas la distribution des membres du complexe An. gambiae deau
douce au Natal.
Dautres tudes nont pu mettre en vidence une relation entre les facteurs environnementaux et la
rpartition des membres du complexe An. gambiae Minakawa et al., (1999); Robert et al., (1998);
Ye-Ebiyo et al., (2003). Pour Minakawa et al., (1999), labondance dAn. gambiae s.s. serait associe
la proximit des concessions. Koenraadt et al., (2004), ont mis en vidence les effets de la
prcipitation et de lvapotranspiration sur la dynamique temporelle des membres du complexe An.
gambiae au Kenya.
Au Burkina Faso, les larves An. arabiensis et An. gambiae tendent occuper des gtes spcifiques.
Selon Sagnon, (1999), il est probable, au regard des statistiques sur la structure de la population
larvaire des trois taxa, que An. gambiae forme molculaire M se reproduit prfrentiellement dans
des gtes de nature plus permanente. La reproduction dans les gtes temporaires reprsente pour cette
espce seulement un deuxime choix, tandis que An. arabiensis et An. gambiae forme molculaire S
sont plus adapts se reproduire dans les gtes temporaires.
Cette diffrence dans loccupation des gtes par ces trois taxa du complexe An. gambiae pourrait
sexpliquer par des proprits de rpulsion inter-spcifique des derniers stades larvaires Guelbeogo,
(1999); MC-Crae, (1984). Dans tous les cas, linfluence des facteurs environnementaux dans cette
rpartition nest pas encore bien connue Charlwood et Edoh, (1996); Sagnon, (1999). La
connaissance de la bio-cologie des larves savre indispensable si lon veut laborer des stratgies
efficientes de lutte antivectorielle.
Fort de cette prsentation de la bio-cologie du complexe An. gambiae, nous pouvons dfinir son
environnement.

II.2.6 LENVIRONNEMENT DU COMPLEXE AN. GAMBIAE


Lenvironnement est une notion relative dont la perception effective est fonction dune entit
biologique de rfrence. Cest partir des composantes initiales, modifies par les organismes
mesure de leur implantation, que sest progressivement constitu un environnement , propre
lensemble biologique localement considr Lacoste et Salanon, (2006). Lenvironnement ne peut se
dfinir que par rapport un organisme vivant. Lenvironnement dAn. gambiae s.s. peut tre dfini

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

50

Chapitre II : Biocolgie dAn. gambiae au Burkina Faso : Une relation formaliser


________________________________________________________________________________________________________________

partir dune synthse de son cycle de vie. Cette synthse sur la bio-cologie du complexe nous
permet de prsumer des facteurs environnementaux qui peuvent influencer sa prolifration.
Trs souvent, les facteurs climatiques comme les prcipitations, les tempratures, et linsolation sont
considrs. La disponibilit et laccessibilit en eau sont deux autres paramtres importants parce
quelles intervenent dans la biologie des larves. La qualit de leau (taille, Ph, stabilit, coulement,
etc.) dpend du contexte physique. Ce sont autant dlments qui obligent intgrer des paramtres
tels que la topographie (altitude) et la disponibilit de la matire organique. La prsence humaine
(ncessit dun repas sanguin pour la maturation des ufs) et la vgtation (alimentation en jus sucr,
lutte contre les prdateurs) interviennent aussi dans la dfinition de lenvironnement du vecteur.
Lenvironnement dAn. gambiae s.s., simple premire vue, est plus complexe quil ne le parait.
Cette complexit est lie la ncessit dune variation des exigences en fonction du stade de
dveloppement double dune variation en fonction du membre du complexe concern. Prendre en
compte la forte variabilit saisonnire de certains paramtres environnementaux tels que la
disponibilit en eau, le climat, conduit un niveau trs lev de complexit. De plus, la mesure ou
lvaluation objective de certains paramtres ne sont pas videntes compte tenu de lextension
spatiale de la zone dtude.
De cette prsentation sur les anophles, nous retenons quil ny a pas un vecteur du paludisme mais
plutt des vecteurs du paludisme au regard de la diversit des espces qui composent le complexe An.
gambiae.
Les tudes sur la biologie et lcologie des vecteurs du paludisme sont trs riches mais non
spcifiques aux espces cibles dans cette tude. Ainsi, ltat de la connaissance sur la
bio-cologie des anophles est-il ouvert et la dfinition dun biotope prcis pour les anophles
devient trs complexe. A cette diversit spcifique des anophles, sajoutent, pour une mme espce,
des exigences cologiques variables en fonction du stade de dveloppement. Le niveau de complexit
devient alors trs lev et impose de rduire le champ dinvestigation, do la limitation aux formes
molculaires S et M. Le contrle de la population vectorielle ne pouvant se concevoir en dehors de
lenvironnement de vie de celle-ci, il est indispensable de comprendre les dterminants msologiques
de distribution des formes molculaires S et M dAn. gambiae. Cest lobjet de la section trois de ce
chapitre.

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

51

Chapitre II : Biocolgie dAn. gambiae au Burkina Faso : Une relation formaliser


________________________________________________________________________________________________________________

II.3

PRESENTATION DE LA ZONE DETUDE37

Le Burkina Faso est un pays situ au cur de lAfrique occidentale, entre 530 de longitude ouest et
240 de longitude, est et entre 930 et 1515 de latitude nord. Il est limit au nord et au nord-ouest
par le Mali, lest par le Niger, au sud-est par le Bnin, au sud par le Togo, le Ghana, et au sud-ouest
par la Cte dIvoire (Figure 3). Sa superficie38 est de 274 200 km2. Quelles sont les caractristiques de
ce pays, tant au plan physique quhumain, qui pourraient contribuer mesurer et expliquer la
distribution spatiale des populations des deux formes molculaires An. gambiae s.s. ?

Figure 3 : Situation du Burkina Faso

37

Les lments utiliss pour la prsentation du Burkina Faso, le site de ltude, ont t retenus sur la base de leur
contribution la comprhension de la rpartition des formes molculaires M et S dAn. gambiae (section prcdente).
Nous avons choisi de faire une prsentation trs visuelle, graphique parce que nous voulons faire un modle spatial.
Cette forme est plus efficace dans la communication. Cest pourquoi, nous avons prfr utiliser des cartes, des
graphiques et des tableaux.

38

http://www.primature.gov.bf/burkina/infopratique/fsites.htm
http://www.inforoute-communale.gov.bf/col_cadre1.htm

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

52

Chapitre II : Biocolgie dAn. gambiae au Burkina Faso : Une relation formaliser


________________________________________________________________________________________________________________

Le Burkina Faso est compos de 8 200 villages39 et secteurs repartis en 351 communes/dpartements,
45 provinces et 13 rgions qui sont des circonscriptions administratives et des collectivits
territoriales dcentralises.
II.3.1

LA POPULATION

La population du Burkina Faso est de 13 117 100 habitants40. Cette population est compose de plus
de 72 ethnies classes en 7 groupes linguistiques : langues Berbre, Dogon, Kru, Ouest Atlantique,
Gur ou Voltaque, Manden, Nilo Saharien (Figure 4)

Figure 4 : Rpartition des ethnies au Burkina Faso

Ces ethnies ont des organisations sociales et politiques diffrentes. Certaines sont des socits trs
hirarchises et sdentarises qui formaient, avant la colonisation, de puissants empires. Cest le lieu
de citer lempire des Mosss, le royaume des Gulmacma, les Emirats du Liptako et du Yagha,
etc. Ces entits politiques fortes occupent aujourdhui les parties centre, nord et est du pays. Les
rgions sud et ouest du pays sont occupes par des socits plutt segmentaires, avec des systmes
politiques trs peu centraliss, et sont connues sous le nom de socit acphale ou anarchiquo-

39

Les villages sont des localits dotes du statut de village dans lorganisation du territoire au Burkina Faso. Il nest pas
confondre avec la localit qui est plus gnrique.
40
http://www.insd.bf/
__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

53

Chapitre II : Biocolgie dAn. gambiae au Burkina Faso : Une relation formaliser


________________________________________________________________________________________________________________

dmocratique. Ce sont les ethnies comme les Lobi, les Dagara, les Bwa, les Gourounsi, les Pougouli,
les Dioula, les Senoufo, etc.
La consquence dune telle diversit culturelle et politique est la structuration spatiale des densits de
populations et des implantations humaines (Figure 5). La distribution de centres urbains et les
dcisions de politique damnagement interviennent pour nuancer cette rgle de distribution des
densits. La densit moyenne de la population du Burkina en 200641 est de 47 habitants au km2. Elle
cache cependant des disparits. Les densits de population sont beaucoup plus fortes dans les rgions
danciens empires dans la partie centrale du pays. La Rgion Centre du Burkina a la densit la plus
leve du pays avec 460 habitants au km2, dans la province du Kadiogo. En plus dabriter le plus
grand centre urbain (Ouagadougou, plus dun million dhabitants), cette rgion tait le ple de
convergence et la capitale politique de lempire des Mosss.

Figure 5 : Densits des populations par provinces

Les densits les plus faibles sont observes dans la Rgion de lEst, avec les provinces de la
Komondjari et de la Kompienga qui comptent respectivement 9 et 12 habitants au km2. A lest, le

41

http://www.insd.bf/donnees/donnees_structurelles/T0317.htm

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

54

Chapitre II : Biocolgie dAn. gambiae au Burkina Faso : Une relation formaliser


________________________________________________________________________________________________________________

classement de nombreuses zones en parcs nationaux justifie sans doute les faibles densits de
population. Plus de 60% des aires protges du Burkina Faso sont situes dans cette rgion.
Lextrme nord connat de faibles densits de population. Mme si lEmirat du Liptako sy trouve,
cette partie du pays est plus propice lactivit dlevage qu lagriculture. Les populations y
partiquent plutt une activit pastorale transhumante.
Par contre, le sud et louest concentrent, en dpit des densits de populations relativement faibles, de
forte dimplantations humaines. Ce qui est rvlateur du caractre trs segmentaire des structures
sociopolitiques. En outre, cette zone tait jadis trs peu hospitalire en raison de son infestation par
de grandes endmies comme la ccit de rivires ou la maladie du sommeil.
Du point de vue de la rpartition des populations, les densits diminuent du centre vers les
extrmits. Lhistoire du peuplement et

les politiques damnagement du

pays sont

vraisemblablement les causes de cette organisation spatiale des densits de population. Le milieu
biophysique prsente une organisation et une structure diffrentes. Cest lobjet de la suite de cette
section consacre la prsentation du milieu qui sarticule autour de la gomorphologie, du climat,
de lhydrographie et de la vgtation.

II.3.2

LE RELIEF

Le Burkina Faso se caractrise par un relief plat, quasi monotone. Cest une vaste pnplaine
parseme dlvations de quelques dizaines de mtres de commandement. Le point le plus haut du
pays, le Mont Tnakourou, culmine 749 mtres. L'altitude moyenne est de 400 m. Prs de la moiti
du pays se situe entre 250 et 350 mtres daltitude et plus de 98 % entre 160 et 480 m. La dnivel
maximale ne dpasse pas 600 m (Figure 6).

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

55

Chapitre II : Biocolgie dAn. gambiae au Burkina Faso : Une relation formaliser


________________________________________________________________________________________________________________

Figure 6 : Les grands ensembles topographiques du Burkina Faso

Dun point de vue gologique, le Burkina Faso est situ sur le craton Ouest Africain. Cinq grandes
priodes marquent la mise en place des formations gologiques du Burkina Faso :
-

le Prcambrien D, avec la mise en place des formations cristallines constitues


essentiellement

de

granito-migmatiques.

Ces

formations

couvrent

plus

de

136 000 km2, soit prs de la moiti du territoire ;


-

le Prcambrien C ou Birimien pendant lequel ont t formes des roches mtamorphises


dorigine volcanique ou sdimentaire et des granites syntectoniques. Ces formations couvrent
prs de 81 500 km2, soit environ 1/3 du territoire ;

le Prcambrien A et le Cambro-ordovicien qui connaissent la mise en place de formations


sdimentaires plus ou moins mtamorphises, composes surtout de grs, de schistes et de
calcaire ;

le Tertiaire avec la mise en place du continental terminal constitu essentiellement de


formations sdimentaires marines (grs et schistes argileux) et des dpts rcents.

Du faonnement de ces roches, nous retenons quatre grands domaines gomorphologiques (Figure 7).

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

56

Chapitre II : Biocolgie dAn. gambiae au Burkina Faso : Une relation formaliser


________________________________________________________________________________________________________________

Figure 7 : gomorphologie du Burkina Faso

1- le domaine granitique. Il est plat avec, par endroit des reliefs rsiduels de type chaos de blocs
issus de lrosion diffrentielle lie lintrusion des venues volcaniques ;

2- le domaine volcanique. Il est constitu de chanons appalachiens tantt linaires, tantt


curvilinaires qui stirent sur des dizaines, voire des centaines de kilomtres et qui sont
quelquefois coiffs de cuirasses bauxitiques ou ferro-allumineuses ;

3- le domaine sdimentaire, dominance grseuse, stend sur louest et lextrme est du pays.
Il domine les formations du socle avec des altitudes allant de 450 500 m. Le contact trs
marqu avec les formations du socle a permis de dgager des escarpements trs abrupts ;

4- le domaine olien qui se situe dans le nord du pays.


Sur ces formations gologiques se sont dvelopps les sols.
II.3.3

LES SOLS

Les sols sont trs diversifis au Burkina Faso. La carte pdologique du Burkina Faso au
1/500 000 compte 11 classes42 (Tableau 1).

42

La classification considre est la classification franaise

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

57

Chapitre II : Biocolgie dAn. gambiae au Burkina Faso : Une relation formaliser


________________________________________________________________________________________________________________

Tableau 1 : Les sols au Burkina Faso

Classe des sols


Sols mull
Sols Sesquioxydes
Sols Sesquioxydes et matire organique rapidement
minralise
Sols Fersiallitiques
Sols Halomorphes
Sols hydromorphes
Sols isohumiques
Sols minraux bruts
Sols peu volues
Vertisols
Vertisols et paravertisols

Superficie en km2

% de la superficie

14481,25
7624,3

5,32
2,8

68263,12

25,07

12911,9
8854,53
48081,52
4729,6
12684,72
84185,05
2180,01
8311,52

4,74
3,25
17,66
1,74
4,66
30,92
0,8
3,05

Source : O.R.S.T.O.M., (1969-1973)


Parmi les facteurs qui ont contribu et contribuent toujours au faonnement des formes prsentes en
gomorphologie, le climat occupe une place de choix.

II.3.4

LE CLIMAT

Le climat du Burkina Faso est rgl par trois vents dominants issus de trois zones de haute pression
que sont les anticyclones : lanticyclone de Ste Hlne, lanticyclone des Aores et lanticyclone
temporaire du Sahara qui renforce le prcdent
Le premier de ces vents, communment appel Mousson, est un aliz provenant de lanticyclone de
Ste Hlne dans locan Atlantique. Il souffle du sud-ouest vers le nord-est dans lhmisphre Nord.
Cest un vent humide. Le second, lHarmattan, est galement un aliz. Il est issu de lanticyclone du
Sahara. Cest un vent temporaire sec et desschant, froid la nuit et chaud le jour. De direction nordest / sud-ouest dans lhmisphre Nord, il souffle en sens oppos celui provenant de Ste Hlne. Il
relaie le vent issu de lanticyclone des Aores, au large des ctes portugaises. La rencontre de ces
deux vents cre le front intertropical (FIT) ou convergence intertropicale (CIT). Le balancement du
FIT, conjugu avec la position en latitude, dtermine un gradient climatique de direction nord-nordest sud-sud-ouest. La Figure 8 illustre cela.

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

58

Chapitre II : Biocolgie dAn. gambiae au Burkina Faso : Une relation formaliser


________________________________________________________________________________________________________________

Figure 8 : Profils de distribution des tempratures et prcipitations au Burkina Faso

Ces deux courbes reprsentent, le long dun transect de 800 km orient nord-nord-est sud-sudouest, les valeurs moyennes des prcipitations et des tempratures. Sur ce transect, les prcipitations
augmentent du nord-nord-est vers le sud-sud-ouest. Les tempratures diminuent, quant elles, en
sens oppos. Les prcipitations passent ainsi de plus de 1000 mm de pluie par an Loumana,
Banfora, Farakoba, Legmoin, Bati, au sud-ouest moins de 500 mm Dori, Gorom-Gorom,
Markoye, Djibo au nord. La pluviosit densemble du pays est de 777 mm. La droite de tendance
spatiale du profil des prcipitations a une pente ngative, avec une diffrence denviron 650 mm de
pluie entre lextrme nord et lextrme sud-ouest. A loppos, les tempratures moyennes
augmentent de 27,6C Dibougou, 29,45C Dori, soit une amplitude peine suprieure 2,5C.
La droite de tendance du profil des tempratures est largement positive.
Sur le plan des tempratures, 4 saisons thermiques se distinguent :
-

une froide et sche qui stend de novembre fvrier,

une chaude et sche qui va de mars mai,

une froide et humide qui va de juin aot,

une chaude et humide qui va de septembre octobre.

La Figure 9 illustre ce propos travers les diagrammes ombro-thermiques de trois stations


mtorologiques.

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

59

Chapitre II : Biocolgie dAn. gambiae au Burkina Faso : Une relation formaliser


________________________________________________________________________________________________________________

Figure 9 : Diagrammes ombrothermiques de quelques stations de rfrences au Burkina Faso

La station de Dori est situe au nord du pays, celle de Kamboinc au centre et celle de Farakoba au
sud-ouest. Sur ces trois stations, les courbes de tempratures sont bi-modales. Le premier maximum
se situe entre le mois davril et le mois de mai, et le second entre le mois de septembre et doctobre.
Les moyennes des tempratures maximales observes entre 1975 et 2005 sont toujours suprieures
25C pour lensemble des stations. Elles varient entre 42,2C Dori au nord et 29,3C Bobo
Dioulasso au sud-ouest.
Les minima sont observables au mois daot puis entre les mois de dcembre et de janvier pour
toutes les stations et demeurent toujours suprieures 10C. Les moyennes des tempratures
minimales, quant elles, varient de 28,1C Dori 13,3C dans la valle du Kou au sud-ouest.
Lamplitude thermique moyenne annuelle est de 13,3C. Elle varie galement du nord au sud-ouest,
entre 16,4C Dionkl, au centre-nord et 11,3C Niangoloko, lextrme sud ouest.
Sur le plan des prcipitations, la courbe est uni-modale, avec un maximum au mois daot pour
lensemble des stations. Cela tmoigne de lexistence, au plan pluviomtrique, de deux saisons
fortement contrastes par rapport aux saisons thermiques. La premire est pluvieuse et intervient
entre mars et juin. La seconde est sche et se manifeste entre septembre - octobre et avril - mai.
La mise en rapport des tempratures et des prcipitations, travers des climogrammes dans trois
stations (Figure 10), permet dobserver des courbes dallure trs allonge.

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

60

Chapitre II : Biocolgie dAn. gambiae au Burkina Faso : Une relation formaliser


________________________________________________________________________________________________________________

Figure 10 : Climogramme de quelques stations de rfrence au Burkina Faso

La droite dquation (P=2t) permet de dlimiter deux saisons : la premire, humide, appele
hivernage, longue de 3 5 mois; elle intervient entre la troisime dcade davril et la troisime
dcade doctobre au sud-ouest et entre la troisime dcade de juin et la premire dcade doctobre au
Nord. La dernire, sche contraste avec lhivernage. Dune dure de 7 mois au sud-ouest contre 9
mois au nord, elle occupe le reste de lanne (Figure 11).

Figure 11 : Dbuts et fins de saison pluvieuse au Burkina Faso

Le Burkina Faso est donc un pays chaud. Il est caractris par des tempratures toujours leves avec
des amplitudes thermiques faibles. Les prcipitations marquent fortement les diffrences entre les
saisons et varient entre 1 200 mm lextrme sud-ouest et 450 mm au nord. Cest un climat tropical
allant du pr-guinen humide dans lextrme sud-ouest au sahlien dans le nord. Entre ces deux
extrmes, les variantes observes reposent essentiellement sur les volumes des prcipitations et sur la
dure de la saison pluvieuse.
Le climat, travers les prcipitations et lvaporation, influence normment la dynamique des cours
deau.

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

61

Chapitre II : Biocolgie dAn. gambiae au Burkina Faso : Une relation formaliser


________________________________________________________________________________________________________________

II.3.5

LHYDROGRAPHIE43

Le rseau hydrographique du Burkina relve de trois bassins internationaux que sont : la Volta, le
Niger et la Como auxquels sajoute un systme endorique. Ces trois bassins correspondent,
lintrieur du pays, quatre bassins nationaux que sont : le Mouhoun, le Nakamb, la Como et le
Niger. Chacun de ces systmes hydrographiques est compos des principales rivires dont les bassins
versants structurent le drainage des eaux.
Dans le Tableau 2, ci-dessous, sont prsents les diffrents bassins versants internationaux, les bassins
nationaux, les sous bassins hydrographiques, ainsi que les bassins endoriques.
Tableau 2 : Les bassins hydrographique du Burkina Faso
Bassin international

Bassin national

Sous-bassin national

Superficie (km2)

Comoe

Comoe

Como-Lraba

17 590

Niger

Niger

83 442
Beli

15 382

Gorouol

7 748

Darjol

1 709

Faga

24 519

Sirba-Gouroubi

11 946

Bonsoaga

7 231

Dyamangou

3 759

Tapoa Mekrou

5 707

Banifing

5 441

VOLTA

172 968
Nakamb

81 932
Pendjari-kompienga

21 595

Nakamb

41 407

Nazinon

11 370

Sissili

7 559

Mouhoun

Bassin endroique

Bassin endroique

91 036
Mouhoun suprieur

20 978

Mouhoun infrieur

54 802

Sourou

15 256

Bassin endroique

300

BURKINA FASO

274 300

Source : (MEE-Burkina, 2002)


Ce rseau compte des lacs naturels et surtout de nombreuses retenues deau artificielles. Par exemple,
le

bassin

de

la

Como,

qui

couvre

une

superficie

de

43

Cette prsentation de lhydrographique sappuie essentiellement sur la Carte de LAfrique de lOuest, 1 : 500.000,
Institut Gographique National; Paris ; le Rapport sur lEtat de lEnvironnement au Burkina de 2002, la Banque
nationale de donnes topographique Burkina et Programme GIRE
__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

62

Chapitre II : Biocolgie dAn. gambiae au Burkina Faso : Une relation formaliser


________________________________________________________________________________________________________________

17 590 km, comptait en 2000, 27 barrages et 20 lacs naturels. Le bassin du Nakamb qui a une
superficie de 81 000 km, abrite plus de 400 barrages dont les plus importants du pays. Il abrite : les
barrages hydrolectriques de Bagr et de la Kompienga et le barrage de Ziga. Sy retrouvent aussi de
nombreux lacs naturels comme celui de Dem, de Bam. Daprs la Direction des Ressources en Eau
du Burkina, plus de 800 barrages fonctionnels ont t inventoris en 2006.
La Figure 12 prsente lhydrographie du Burkina Faso travers les grandes rivires, leurs affluents et
leurs bassins versants.

Figure 12 : Les principaux cours deau et leur bassins versants au Burkina Faso

Il apparat sur ce rseau que les cours deau les plus importants se situent tous dans la partie ouest et
sud du pays. Par ailleurs, la plupart de ces cours deau, lexception du Nakamb, prennent leur
source sur les hautes terres du sud-ouest, dans la rgion des Hauts Bassins. Ceci renforce le caractre
pluvial des rgimes hydrologiques.
Ce rseau hydrographique du Burkina Faso est compos essentiellement de cours deau rgime
pluvial tropical, fortement tributaire des prcipitations. Ceux-ci sont, pour lessentiel, intermittents
avec des coulements qui sarrtent quelques jours quelques semaines seulement aprs les
prcipitations Som, (2000). Moins dune dizaine d'entre eux sont permanents et coulent toute
lanne. La plupart des cours deau connaissent leur dbit maximum en fin aot dbut septembre,
__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

63

Chapitre II : Biocolgie dAn. gambiae au Burkina Faso : Une relation formaliser


________________________________________________________________________________________________________________

pendant la priode de maximum pluviomtrique. En contrepartie, les tiages sont trs svres. Ils
interviennent juste avant le dbut de la saison de pluies qui se situe entre la fin du mois davril et le
dbut du mois de juin selon la position gographique. Il arrive souvent que les coulements arrttent
compltement. Dans un milieu o la disponibilit en eau constitue une contrainte majeure,
lorganisation du couvert vgtal est fortement influence par le climat et lhydrographie.

II.3.6

LA VEGETATION

En rfrence aux travaux de Fontes et Guinko, (1995); Guinko, (1984) et la cartographie de la


vgtation de Fontes et al., (1994), la vgtation du Burkina Faso relve de deux domaines
phytogographiques : le domaine phytogographique sahlien et le domaine phytogographique
soudanien. Leurs aires de rpartition se superposent aux grands ensembles climatiques
(Figure 13).

Figure 13 : Domaines phytogographiques du Burkina Faso

Le premier couvre environ 35% du territoire et se situe au nord du pays, partir du 13me parallle.
Sa limite sud, la plus pluvieuse, concide plus avec lisohyte 650 mm. Le second, occupe un peu
plus de la moiti sud du pays, au sud du 13me parallle. Lisohyte 650 mm correspond sa limite la
plus sche. Des diffrences de facis sont perceptibles dans les diffrents domaines
phytogographiques (Figure 14).
__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

64

Chapitre II : Biocolgie dAn. gambiae au Burkina Faso : Une relation formaliser


________________________________________________________________________________________________________________

Le domaine sahlien est celui des steppes. Les formations steppiques prsentent des variantes allant
dune steppe presque sans espces ligneuses celle arbustive, voire arbore. Elles ont deux facis
majeurs appels secteurs :
-

le secteur nord sahlien caractris par des steppes herbeuses Aristida spp et des steppes
herbeuses arbustives Cenchrus biflorus, Combretum glutinosum, Balanites aegyptiaca ;

le secteur sud sahlien, plus humide est le domaine de steppes avec une prsence
relativement plus abondante de ligneux. Ce sont des steppes arbustives arbores truffes de
fourres et domines essentiellement par des combretacs et des espces arbustives du genre
Acacia (Acacia tortilis ssp. Acacia raddiana, Acacia laeta, Combretum spp.). Les valles de
ce secteur abritent quelques savanes arbores Butyrospermum parkii44, Lannea microcarpa,
Acacia albida.

Le domaine soudanien est celui de la savane, avec un tapis herbac haut et continu comparativement
au domaine sud sahlien. Cette savane prsente de nombreux facis regroups en deux secteurs
phytogographiques : le secteur nord soudanien et le secteur sud soudanien.
-

Le secteur nord soudanien est constitu pour lessentiel de savanes fortement anthropises du
fait des densits de population leves. Il correspond des savanes arbustives arbores
Combretum spp, Anogeisus leiocarpus, Butyrospermum parkii, Laenna spp. Il renferme aussi
des savanes parcs domines par des espces arboricoles trs utilitaires et protges. Ce sont
en gnral les parcs Butyrospermum parkii, Parkia biglobosa, Adansonia digitata et
Tamarindus indica.

Le secteur sud soudanien, quant lui, est constitu pour lessentiel de savane arbore
boise avec comme espces dominantes Burkea africana, Butyrospermum parkii,
Pterocarpus erinaceus, Parkia biglobosa. Il abrite aussi des forts claires avec des espces
dominantes telles que Isoberlinia doka, Burkea africana, Terminalia spp. Les valles des
principales rivires tels comme Mouhoun sont colonises des forts galeries trs denses,
Berlinia grandifolia, Daniellia oliveri, Mitragyna inermis et quelques reliques de palmiers
rafia.

La vgtation est donc organise suivant un gradient nord-nord-est sud-sud-ouest comme le climat.

44

Vitallaria paradoxa est le nouveau nom de Butyrospermum parkii

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

65

Chapitre II : Biocolgie dAn. gambiae au Burkina Faso : Une relation formaliser


________________________________________________________________________________________________________________

Figure 14 : Formations vgtales du Burkina Faso


__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

66

Chapitre II : Biocolgie dAn. gambiae au Burkina Faso : Une relation formaliser


________________________________________________________________________________________________________________

CONCLUSION DU CHAPITRE II
Au Burkina Faso, le paludisme constitue un problme majeur de sant publique. La stratgie de lutte
contre cette maladie y est multiforme et intgre la lutte contre le vecteur, lanophle. Les anophles
constituent un complexe despces. A cette diversit spcifique des anophles, sajoutent, pour une
mme espce, des exigences cologiques variables en fonction du stade de dveloppement. Compte
tenu du niveau de complexit de la question et de la ncessit de rduire le champ dinvestigation,
nous limitons notre tude aux formes molculaires M et S.
Le Burkina Faso est un pays de transition entre le dsert du Sahara et les zones forestires trs
humides du Golf de Guine. Sur moins de 600 km vol doiseau, il stend du Sahel, o les
prcipitations sont de lordre de 300 mm par an, la zone soudanienne pr-guinenne, avec plus de
1 200 mm/an, soit 900 mm dcart. Ce pays se caractrise galement par son relief plat, une diversit
au niveau gomorphologique et un rseau hydrographique dense qui effacent la monotonie sousjacente. Il prsente aussi une diversit culturelle double dune variation de densits rgionales de
population. Ces densits oscillent entre 10 et prs de 500 habitants au km2 et sont lies lhistoire et
aux politiques damnagement du territoire.
Un complexe despces aux exigences cologiques variant dun type un autre et en fonction du
stade de dveloppement, dans un environnement offrant une diversit de conditions cologiques, tel
est le visage du champ dapplication de ce travail de recherche. Un tel schma, dans une tude
portant sur la modlisation, impose la dfinition dune dmarche mthodologique adapte, objet du
chapitre suivant.

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

67

Chapitre III : Approche mthodologique de ltude


____________________________________________________________________________________________________________

CHAPITRE III : APPROCHE METHODOLOGIQUE DE LETUDE


La recherche sur la distribution spatiale des espces vivantes est trs ancienne et de nombreuses
mthodologies ont dj t construites. Lavnement de la tldtection, des SIG, de lanalyse
spatiale et de lanalyse de donnes statistiques, a apport une nouvelle dynamique dans la recherche
sur la rpartition des tres vivants dans lespace, particulirement celle des vecteurs de maladies. Ces
rsultats peuvent aider concevoir la mthodologie pour modliser la distribution spatiale des formes
molculaire M et S dAn. gambiae au Burkina Faso. Il est donc opportun de faire un aperu des
mthodes de modlisation spatiale des espces vivantes et dy situer notre dmarche.
Lessence de ce chapitre consiste donc partir dun rappel sur les mthodes de modlisation pour
prsenter la dmarche mthodologique utilise dans le cadre de ce travail. Nous y rpondons aux
questions portant sur larticulation densemble de la recherche, les mthodes et les matriels utiliss.
Ce chapitre couvre les aspects portant la fois sur la collecte et le traitement des donnes,
lvaluation des indicateurs et la vrification des hypothses. Il est structur en deux sections :
-

la premire, aperu des mthodes de modlisation de la distribution spatiale des espces


vivantes utilisant lanalyse spatiale et les SIG , fait un tat de lart sur les mthodes de
modlisation ;

la seconde, dmarche, matriel et mthodes , est consacre la mthodologie et au


matriel utilis dans cette tude.

III.1
APERU DES METHODES DE MODELISATION DE LA
DISTRIBUTION SPATIALE DES ESPECES VIVANTES UTILISANT
LANALYSE SPATIALE ET LES SIG
Une vieille sagesse enseigne que rares sont les situations vraiment nouvelles et que dautres ont
dj su rsoudre les nouveaux problmes que nous rencontrons Le-Moigne, (1990). Les
modles de la distribution spatiale des espces, et particulirement des espces qui sont des vecteurs
de maladies, sont nombreux et varis en raison de la diversit des sites, de lcologie et de ltiologie
des espces. Cette fcondit de la recherche dans le domaine de la modlisation est lie sans doute
aux usages dont les modles font lobjet, au caractre bien souvent utilitaire et pragmatique des
modles. Quels sont ces usages ? Quelles sont les mthodes utilises pour le processus de
modlisation ? Cette section vise rpondre ces deux questions. Elle a pour but de prsenter les
usages qui sont faits des modles de distribution spatiale des espces et les diffrents types de
modles. Cette prsentation devrait contribuer faire comprendre la dynamique de modlisation dans
laquelle sinscrit ce mmoire de recherche. Elle doit galement permettre de faire comprendre les
__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

68

Chapitre III : Approche mthodologique de ltude


____________________________________________________________________________________________________________

choix qui sont faits en ce qui concerne les mthodes et donnes. Elle est compose de deux
paragraphes :
-

le premier est un expos sur les impacts des usages des modles sur le processus de
modlisation

le second, une classification des mthodes de modlisation.

III.1.1

LIMPACT DES USAGES DES MODELES SUR LA MODELISATION

Et quoiquon en dise, dans la vie scientifique, les problmes ne se posent nous deux-mmes.
Cest prcisment ce qui donne la marque du vritable esprit scientifique Sil ny a pas eu de
question, il ne peut y avoir de connaissance scientifique. Rien ne va de soi. Rien nest donn. Tout
est construit G. Bachelard, 1938-1978, cit par Le-Moigne, (1990). Le modle est le fruit du
raisonnement de son auteur qui cherche, travers lui, prsenter et expliquer les points saillant
dun phnomne. Le modle est une uvre produite par limagination au sens le plus strict puisque
cest la prise en compte dlments slectionns entre lesquels sont tablies des relations pertinentes.
Ladquation du modle une partie de la ralit est lexpression de limagination scientifique
Raffestin, (1983) in Gumuchian et Marois, (2000). Les modles sont donc des constructions de
lesprit et comme tels, ils sont objectivs, cest--dire quils visent un ou plusieurs objectifs. Nous
retenons de prsenter deux types dobjectifs dans le domaine du contrle des populations
vectorielles. Ce choix est li au fait que ces objectifs dteignent sur le choix de donnes. En
complment lassertion de Bachelard sur lesprit scientifique, nous disons avec les mots de LeMoigne, (1990) sappuie lui-mme sur le Discours de lesprit positif dAuguste Comte 1843, que
les donnes du problme sont donnes par le problme que rencontre le modlisateur .

III.1.1.1

Les usages des modles pour llaboration des politiques et dfinition


de stratgies

Les plans de lutte contre les maladies transmission vectorielle intgrent, bien souvent et dailleurs
trs logiquement, le contrle, voire lradication des vecteurs. La mise au point de tels programmes
ncessite de disposer dinformation sur la bio-cologie du vecteur et surtout sur la rpartition dans
lespace. Ceci explique le recourt frquent des modles spatiaux. Ces modles servent la
dfinition de politiques ou de stratgies de contrle ou dradication du vecteur. Ceux utiliss de
telles fins couvrent gnralement de grands espaces. Ce sont des modles couvrant de grands
espaces, des tendues continentales nationales Pin-Diop, (2006). Or, la modlisation sappuie bien
souvent sur des observations. Lobservation est une mesure dans le temps et dans lespace et fait
__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

69

Chapitre III : Approche mthodologique de ltude


____________________________________________________________________________________________________________

appel la notion dchelle. Elle est lie la mesure de lespace ou du temps. Passer dune chelle
une autre consiste changer dunit de mesure 45Pav A (1994) cit Mathian et Piron, (2001). La
taille des objets gographiques dans lespace et la taille de lespace couvrir ne sont pas sans effets
sur lutilisation des donnes dans les travaux de recherche, particulirement en modlisation spatiale.
Le choix de lchelle gographique oriente et influence les rsultats. En effet, les rsultats changent
selon lchelle gographique : cest le problme de lunit spatiale modifiable bien connu sous
lacronyme MAUP en anglais. Les conclusions dduites une chelle gographique ne sont pas
ncessairement valables une autre chelle Gumuchian et Marois, (2000). Les chelles influent
aussi sur les cots financiers, temporels et matriels. Ces modles destins llaboration de
politiques et de stratgies gnrales utilisent principalement des donnes provenant dimages
satellites basse rsolution comme les AVHRR NOAA, HRR Meteosat, avec des rsolutions spatiales
de lordre de 1 km 1,5 km. Ils utilisent galement des donnes mtorologiques et des modles
numriques de terrain comme GOTO30. Leur objectif en gnral est didentifier et de cartographier
les zones risque de manire ce que les efforts de contrle et les stratgies dintervention soient les
plus efficaces et cibls possible Tran et al., (2005). Ils sont appels, en raison de la faible rsolution
spatiale de donnes, des modles petite chelle. Les exemples sans doute les plus cits dans la
littrature spcialise concernent les glossines/la trypanosomiase et la Fivre de la Valle du Rift en
Afrique de lEst. Pin-Diop, (2006) fait un expos assez exhaustif des travaux dvelopps dans le
cadre de la lutte contre la trypanosomiase et le contrle de la population de glossines avec les travaux
suivants: Hendrickx et al., (2001); Hendrickx et al., (1989); Robinson et al., (1997); Rogers et
Randolph, (1993); Rogers et Williams, (1993). Pour la Fivre de la Valle du Rift, elle utilise les
travaux de Anyamba et al., (2001); Davies et al., (1992); Linthicum et al., (1999); Linthicum et al.,
(1987); Linthicum et al., (1990).

III.1.1.2

Limpact des usages des modles pour laction

La dfinition de politiques gnrales ou de stratgies globales nest pas la seule utilisation des
modles spatiaux dans le contrle de populations vectorielles. Les modles spatiaux sont galement
recherchs pour lintervention, pour laction ou pour les ripostes contre la prolifration de certains
vecteurs. Dans ce cas, il est inopportun de se contenter de donnes basse rsolution spatiale des
modles petite chelle. Lusage des modles spatiaux pour laction requiert des donnes plus
prcises et sur des espaces beaucoup plus restreints. Les tendues spatiales comme les villes, les sous
bassins versants sont raisonnables. Les rsolutions spatiales de lordre de quelques dizaines mtres
45

PAVE A, La modlisation en biologie et en cologie, Edition Alas, Lyon, 1994.

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

70

Chapitre III : Approche mthodologique de ltude


____________________________________________________________________________________________________________

(30 m) sub-mtriques (60 cm) sont les plus appropries. Dans ce cas, les donnes proviennent
dobservations de terrain et de traitements dimages satellites, haute rsolution trs haute rsolution.
Les images comme LandSat TM et ETM+, SPOT XS, XI, Ikonos et QuikBird sont adaptes ce type
de modlisation. Les informations recherches en ce qui concerne les vecteurs de maladies sont par
exemple loccupation des terres, les gtes de reproduction, les gtes de repos et des lments
beaucoup plus prcis sur la vgtation comme la composition floristiques. Les travaux de
Mushinzimana et al., (2006) utilisant les Images LandSat 7 au Kenya, Ratana et al., (2005) en Core
avec galement des images LandSat 7 tous relatifs au vecteur du paludisme, Pin-Diop, (2006) pour
les vecteurs de la fivre de la valle du Rift partir dimages satellites Landsat 7 au Sngal
Septentrional, en sont des illustrations.
Que les travaux se ralisent au niveau local ou global, pour des raisons daction ou pour des raisons
dlaboration de politiques gnrales, les mthodes restent les mmes. Cest principalement le type
de donnes et les usages des rsultats qui changent. Les chercheurs utilisent soit des modles
rhtoriques, soit des modles mathmatiques, soit des modles iconiques, soit enfin un mlange de
deux ou des trois. Cette synthse introduit au paragraphe consacr aux mthodes de modlisation.

III.1.2

LES MODELES CLASSES DAPRES LES METHODES

Il existe de nombreux auteurs qui classent les modles suivant le critre des mthodes. Cest le cas de
Tran et al., (2005) qui proposent une classification en deux groupes : les modles conceptuels qui
sattachent expliquer de manire qualitative un phnomne et les modles mathmatiques. Les
modles mathmatiques comprennent les modles statistiques / empiriques et les modles thoriques.
Un troisime groupe de modlisation, que lon pourrait appeler modle informatique, runit les
programmes dvelopps pour faire de la cartographie automatique de la distribution spatiale des
espces. Nous pouvons citer aussi, Guisan et Zimmermann, (2000) qui prsentent les Predictive
habitat distribution models in ecology . Cet article propose une analyse des mthodes de
modlisation en cologie et peut inspirer les chercheurs qui sintressent ce domaine.
Cependant, nous nous adosserons dans cette prsentation sur celle de Brunet, (2000a) qui semble
plus complte et intgre de faon plus ou moins directe la plupart des classifications suivant la
mthode. En outre, en tant que gographe, Roger Brunet tient compte de la spcificit de la
discipline. Il distingue trois groupes de modles : les modles rhtoriques, les modles
mathmatiques et les modles iconiques. Ce paragraphe est structur autour de ces trois groupes de
modles.

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

71

Chapitre III : Approche mthodologique de ltude


____________________________________________________________________________________________________________

III.1.2.1

Les modles rhtoriques

Ce type de modle procde une description des phnomnes et sexprime par des textes, des
discours. Cest une formalisation par le discours. Il prsente les grands traits des phnomnes par des
textes. Il runit par le discours un ensemble de faits et de donnes qui donnent les caractristiques
essentielles des phnomnes. Il sappelle aussi modle conceptuel. En cologie, ce type est trs
utilis et consiste faire un rapprochement entre les lments du paysage et lcologie du vecteur. La
dmarche, dans le cas de la modlisation conceptuelle, sappuie sur la recherche documentaire. Elle
vise acqurir de linformation pour produire un modle discursif sur lhabitat du vecteur. Ces
modles rhtoriques sont trs usits en smiologie mdicale, en taxonomie et plus gnralement en
systmatique. Ils servent souvent traduire certaines thories. Par exemple, la loi du minimum de
Liebig fournit un modle pour le raisonnement sur la productivit vgtale.
Ce type de modle est souvent appuy par dautres types de modle, comme les modles
mathmatiques.

III.1.2.2

Les modles mathmatiques

Les modles mathmatiques s'expriment par des formules : quelque chose entre image et texte
(Brunet, 2000a). Ils visent dcrire de manire quantitative le fonctionnement dun systme, en
crivant sous forme dquations les lois qui le rgissent Tran et al., (2005). La modlisation en
langage mathmatique atteint assurment le degr suprieur dabstraction, du moins du point de vue
du langage, qui nest pas le seul prendre en compte Durand-Dasts, (2001). Elle est considre
par beaucoup dauteurs comme le plus haut niveau dabstraction, le niveau le plus labor du modle.
Il existe cependant une difficult pour raliser un compromis partir dun langage mathmatique :
il sagit dun langage qui se fonde sur lexactitude et tend vacuer toute approximation, imprcision
ou ambigut pour raliser un compromis avec dautres disciplines pour ltude dun objet naturel,
chaque discipline tant porteuse dun point de vue. () Lart de la modlisation (mathmatique) est
de trouver le meilleur compromis entre la simplicit des formes mathmatiques et le respect des
lments saillants et identitaires du phnomne tudi Franc, (2001). Parmi ces derniers, on
distingue encore les modles empiriques (ou statistiques), bass sur les donnes, et les modles
mcanistes (ou thoriques), qui sont bass sur les concepts Tran et al., (2005). Il convient dajouter
la liste des dveloppements actuels de modules informatiques proposant des outils intgrer sur les
logiciels de SIG et visant llaboration de carte de distribution spatiale.

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

72

Chapitre III : Approche mthodologique de ltude


____________________________________________________________________________________________________________

Les modles mathmatiques mcanistes ou thoriques


Ce sont des modles visant dterminer les relations partir de la comprhension du fonctionnement
du systme Tran et al., (2005). Ce type de modle mathmatique sinscrit dans le cadre de la thorie
des modles. La notion de modle est utilise de manire assez particulire, puisquelle utilise le
terme modle comme quelque chose qui peut donner sens un discours thorique, par une
correspondance terme terme entre le modle et la thorie formelle Langlois, (2005). La thorie
exprime par la formulation explicite des relations qui existent entre des concepts Gumuchian et
Marois, (2000). Dans cette acceptation du modle mathmatique, le modle tend reproduire au plan
thorique le phnomne en identifiant tous les dterminants et en dfinissant pour chaque
dterminant sa contribution au fonctionnement du systme. Il existe trs peu de cas de modles
thoriques en gographie. Ils sont le plus souvent imports dautres disciplines comme lconomie ou
la sociologie. Comme le dit Gumuchian et Marois, (2000), le gographe qui na pas souvent produit
ses propres thories, procde des transfert partir dautres disciplines. Les plus clbres transferts
sont ceux de J.H Von Thnen sur la thorie des aroles et ceux de W. Christaller sur les places
centrales.

Les modles mathmatiques empiriques


Les modles mathmatiques de la distribution spatiale des vecteurs sont pour lessentiel des modles
empiriques. Cest une mise en ordre dans la ralit empirique Durand-Dasts, (2001). Reprsenter un
ensemble dindividus spatiaux dcrits par deux variables ou un nuage de points, puis rsumer celui-ci
par le calcul dune courbe dajustement relve bien de la modlisation. Il sagit, en modlisation
mathmatique empirique, dintgrer des mthodes statistiques classiques ou gostatistique dans le
processus de modlisation. Le dveloppement de ce type de modle a galement t facilit par
lessor rcent des systmes dinformation gographique (SIG). Dans ce type dexercice, lintrt est
dtablir des corrlations statistiques entre prsence/absence ou frquence de vecteur et le milieu
dcrit par un certain nombre de paramtres. Ces derniers doivent tre importants dans lcologie du
vecteur. Certaines sont dterministes comme les rgressions, dautres par contre sont stochastiques
avec lusage de techniques probabilistes.

Exemple dutilisation des modles mathmatiques empiriques


Pour illustrer ce type de modle, nous citons la thse de Hlne Guis sur Gomatique et
pidmiologie : Caractrisation des paysages favorables Culicoides imicola, vecteur de la fivre
__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

73

Chapitre III : Approche mthodologique de ltude


____________________________________________________________________________________________________________

catarrhale ovine en Corse soutenue en 2007, les travaux de Thomas et al., (2003) sur Linking
field-based ecological data with remotely sensed data using a geographic information system in two
malaria endemic urban areas of Kenya, Mushinzimana et al., (2006), (Ratana et al., (2005)
Identification and characterization of larval and adult anopheline mosquito habitats in the Republic
of Korea: potential use of remotely sensed data to estimate mosquito distributions.
Lhypothse sous-jacente ces modles est que la prsence () des vecteurs dpend fortement de
lenvironnement : type de vgtation, conditions climatiques (temprature, prcipitations), etc. qui
dterminent leur habitat. [] La mthode consiste donc rechercher des corrlations entre la
distribution des vecteurs et des paramtres environnementaux. Linversion de la relation statistique
observe, condition de pouvoir justifier le lien vecteur/environnement, permet dextrapoler les
rsultats pour obtenir des cartes de la rpartition des vecteurs Tran et al., (2005). Dans ces cas, les
logiciels de SIG doivent disposer dautres fonctions de calcul de statistiques spatiales et tre soutenus
par des logiciels danalyse statistique de donnes, lorsque la structure des donnes lautorise (par
exemple, en absence dautocorrlation spatiale). Les SIG servent dans ce type de modle comme
outils danalyse. Mais bien souvent dans ce cas, les logiciels de SIG sont trs peu outills pour
prendre en charge certaines analyses Joost, (2006). Do la cration de module informatique
intgrant des fonctions pour permettre la ralisation de la modlisation mathmatique dans les SIG.
Les modles mathmatiques informatiques
Il sagit de modles beaucoup plus gnriques consistant palier les insuffisances des logiciels de
SIG comme Arcview de Esri, MapInfo de Claristas ou SAVANE de lIRD dvelopp sous la
supervision de Marc Souris46. Ils proposent des modules complmentaires ddis spcifiquement la
ralisation de la cartographie de distribution des espces en gnral. Ce qui pourrait tre fort utile
dans la modlisation de la distribution spatiale des vecteurs de maladies. Les logiciels SIG offrent
des fonctions classiques de traitements de linformation gographique souvent trs riches mais dont
lusage spcifique dans la modlisation de la distribution spatiale des espces en biogographie et en
cologie en gnral est trs peu vidente. Joost, (2006) met ainsi en vidence le faible niveau
dintgration des outils danalyse spatiale dans les logiciels de SIG : the lack of integration between
GIS and spatial analysis, by picking out that GIS, despite being widely used in different types of
spatially explicit studies, are still deficient in integrating generic statistical procedures for predictive
purposes.

46

http://www.th.ird.fr/publications/publications_auteurs_souris.html

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

74

Chapitre III : Approche mthodologique de ltude


____________________________________________________________________________________________________________

Exemples de modles mathmatiques informatiques


Parmi ces modles, nous pouvons citer "Biomapper"47 dvelopp au Laboratoire de Biologie de la
Conservation de lUniversit de Lausanne, par Alexandre H. Hirzel. Ce logiciel est inter-oprable
avec Idrisi de lUniversit de Clarke aux Etats-Unis. Il est sa version 4 et est gratuit. Nous pouvons
aussi citer OpenModeller48 dvelopp par Centro de Referncia em Informao Ambiental (CRIA),
Escola Politcnica da USP (Poli), et Instituto Nacional de Pesquisas Espaciais (INPE). Comme il est
dit sur leur site internet, openModeller is a fundamental niche modelling library, providing a
uniform method for modelling distribution patterns using a variety of modelling algorithms. Cet
open source est sa version 7 et peut tre intgr ArcInfo de ESRI. Dans cette ligne, ComDym49,
qui est sa version 4, est dvelopp par USGS.
La modlisation mathmatique produit souvent des fonctions. Linversion de ces fonctions permet
dobtenir des cartes de distribution qui font partie dun autre type de modle, les modles iconiques.

III.1.2.3

Les modles iconiques

Les modles iconiques passent par le dessin, qu'il s'agisse d'une courbe, d'un profil ou d'une
configuration spatiale. [] Le modle iconique offre une vision panoptique, ou synchrone si l'on
prfre ; il montre d'un coup les relations rciproques des lieux : il les met en situation. Il permet de
comprendre, grce au dessin, les effets d'interfrence des formes, la dformation rciproque des
modles. [] Il est commode et mme fcond ; il n'exclut en rien la quantification, ni mme la
mathmatisation ; il les appelle d'ailleurs, comme moyens de contrle Brunet, (2000a). La carte est
lexemple mme de modle iconique. Elle peut atteindre des niveaux dabstraction trs levs. Par
exemple, la carte disobare couramment utilise est fonde sur un calcul de correction des
observations et atteint un trs haut niveau dabstraction Durand-Dasts, (2001). Chormatique,
chorme et chorotype sont des termes qui voquent par la schmatisation, un niveau dabstraction
plus lev que celui de la carte.
Les modles iconiques procdent la mise en image des phnomnes pour faciliter leur
comprhension et leur prsentation. Cette mise en image se traduit lorsque la dimension spatiale
entre en jeu, par les cartes ou les chormes. La traduction sous forme de carte de phnomne rpond
une double exigence : la fidlit et la lisibilit. Llaboration des cartes relve donc de la
modlisation spatiale. Elle sappuie souvent sur des modles mathmatiques ou rhtoriques/discursif.
47

http://www2.unil.ch/biomapper/
http://openmodeller.sourceforge.net/index.php?option=com_frontpage&Itemid=1
49
http://www.mbr-pwrc.usgs.gov/software/comdyn.html
48

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

75

Chapitre III : Approche mthodologique de ltude


____________________________________________________________________________________________________________

Ainsi, la cartographie de distribution de lespce peut-elle tre la recherche dans lespace (zone
dtude) des sites qui rpondent au modle dcrit de lhabitat. Linformation spatiale
environnementale provient en gnral du traitement dimage de tldtection/photographie arienne,
dobservations sur le terrain, de linterpolation de donnes climatique etc. En sappuyant sur un SIG,
de simples requtes permettent de slectionner des espaces rpondant la description de lhabitat du
vecteur et sa cartographie. Dans certains cas, les SIG servent aux traitements dinformations
spatiales (gorfrencement des informations, interpolations et estimations, extrapolations). Comme
le dit Y, (2005), The power of GIS is its ability to integrate and manipulate multiple layers or
themes of spatial data for a large area and from different sources at different scales [] For malaria
research and control, GIS has great potential since it has the capacity to integrate information on all
aspects of malaria including the environmental factors, infrastructure and demography [.] it is a
good tool of communication to support the decision making process. Cest donc la capacit des SIG
intgrer des donnes multisources, multimdia et croiser ces informations travers des requtes
spatiales qui est fortement utilise. Les fonctions ddition cartographique et daide la dcision sont
galement intressantes pour la restitution des rsultats.

Exemples dutilisation des modles iconiques


Ce type de modle est fortement utilis en gographie, en pidmiologie et en cologie. Les travaux
de thse Bouyer, (2006), cologie des glossines du Mouhoun au Burkina Faso : intrt pour
lpidmiologie et le contrle des trypanosomoses africaines soutenu en 2006, de Pin-Diop, (2006)
"spatialisation du risque de transmission de la Fivre de la Valle du Rift en milieu agropostoral
sahlien du Sngal septentrional" soutenu en 2006, Balenghien, (2006), portant sur le thme De
lidentification des vecteurs du virus West Nile la modlisation du risque dinfection dans le sud de
la France soutenu galement en 2006 sinscrivent dans cette dynamique.
La cartographie de la distribution spatiale des espces peut galement tre le rsultat de linversion
dune fonction mathmatique. La fonction dune courbe dajustement dun phnomne spatial
partir de certaines de ces variables permet la production de la carte de distribution spatiale par
inversion de la fonction. Les modles iconiques sont un moyen dexprimer dans lespace un modle
rhtorique ou un modle mathmatique.
Il convient de remarquer lissue de cet expos que les objectifs et les mthodes de modlisation ne
sont pas exclusifs en soi. Il appartient donc au modlisateur de faire des choix en fonction de sa
__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

76

Chapitre III : Approche mthodologique de ltude


____________________________________________________________________________________________________________

problmatique, de ses objectifs, des moyens dont il dispose etc. Comment a-t-on fait la modlisation
dans ce travail, cest lobjet de la seconde section de ce chapitre.

III.2

LA DEMARCHE, METHODES ET MATERIELS

En rappel, ce travail a pour objectifs: de dcrire lorganisation spatiale des deux formes molculaires
M et S dAn. gambiae au Burkina Faso, didentifier les dterminants de cette organisation et de la
modliser. Un tel objectif implique de combiner des comptences relatives des domaines divers, les
uns lis la thmatique, les autres la technique ou la mathmatique Sanders, (2001). Au plan
thmatique, cette tude met contribution la biogographie qui oriente et donne la perspective
thorique et lentomologie qui fournit linformation ncessaire la connaissance des anophles. Au
plan technique, elle met profit lanalyse spatiale, lanalyse de donnes statistiques et le systme
dinformation gographique. Lapproche pluridisciplinaire simpose dans une telle situation. Mais si
une telle approche est stimulante et enrichissante dans le processus de modlisation, une utilisation
dsordonne des contributions des diffrentes disciplines scientifiques peut porter prjudice la
logique et la comprhension du raisonnement. Do la ncessit de cette section destine la
prsentation de larticulation densemble de la mthodologie et aux usages faites des mthodes et des
techniques. Cette section est structure en cinq paragraphes : le premier svertue montrer la
perspective et larticulation de la recherche et les quatre autres sappesantissent sur les mthodes
utilises chaque tape du processus dinvestigation.

III.2.1 DEMARCHE DENSEMBLE DE LA RECHERCHE


Lobjectif de la dmarche est de mettre en exergue les diffrentes articulations de la mthodologie et
sa structure logique globale. Linsertion de cette tude dans une approche pluridisciplinaire, faisant
intervenir deux groupes de disciplines, justifie davantage cette prcision de la dmarche.
Lutilisation de ces deux groupes de disciplines sarticule autour des quatre tapes suivantes :
1. la modlisation de la distribution qui sinscrit dans une perspective mathmatique empirique et
hypothtico - dductive. Sur les bases des connaissances priori, le paradigme
biogographique en loccurrence, trois hypothses ont t formules. La premire postule de
lexistence dune structure dans lorganisation des populations dAn. gambiae s.s.. La seconde
prsume dune contribution diffrentielle des facteurs cologiques la distribution spatiale des
populations. La troisime tend privilgier le fait qu partir des facteurs les plus dterminants
de la distribution des vecteurs, il est possible de formaliser la relation entre la distribution
__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

77

Chapitre III : Approche mthodologique de ltude


____________________________________________________________________________________________________________

spatiale An. gambiae s.s. et lenvironnement. Cette formulation des hypothses constitue la
premire phase de la modlisation.
2. la perspective tant mathmatique / empirique, il sagit didentifier sur des observations de
terrain les rgularits et de les exprimer sous forme simplifie, sans en trahir lesprit. Pour cela, il
est indispensable de procder une conceptualisation qui permet didentifier des objets pertinents
et de procder la quantification, cest--dire associer chaque objet une liste de variables qui
permet de le dcrire le plus exactement possible (voir paragraphe univers de variables ). Il
arrive souvent que des modles soient disponibles et facilitent ce travail de conceptualisation.
Cest le cas, dans ce mmoire, de lutilisation des modles dinterpolation et destimation dans
lajustement des donnes aux besoins de ltude, de lemploi de modles danalyse des
configurations et structures spatiales (ellipse de dviation standard, indice dautocorrection de
Morin etc.) et de la mise contribution de certains modles de calcul statistiques.
3. la formalisation est la troisime tape et consiste en lexpression du modle sous un langage
dtermin. Deux types de langages sont viss dans le cadre de ce travail. Il sagit du langage
iconique et du langage mathmatique. Les modles issus de ce travail sont prsents sous forme
de fonctions mathmatiques et sous forme de cartes par inversion des fonctions mathmatiques.
Lanalyse spatiale et la statistique multidimensionnelle/lanalyse de donnes sont les deux
mthodes utilises cette tape.
4. la dernire tape de cette dmarche consiste en lvaluation de la qualit du modle. Il sagit de
contrler la qualit du modle et, si besoin, de procder son amlioration par retour sur une ou
plusieurs tapes prcdentes. Deux mthodes sont utilises pour lvaluation de la qualit du
modle : une valuation partir de lanalyse des rsidus du modle et une valuation par
comparaison des donnes produites par les modles des donnes empiriques externes aux
modles.
La mise en uvre de cette dmarche ncessite des donnes de bonne qualit. Encore faut-il avoir un
tat des besoins en donnes bien labor !

III.2.2 UNIVERS

DES

VARIABLES

ET

ENTITES

OBJETS

GEOGRAPHIQUES
Les hypothses et les indicateurs devant permettre de les vrifier, mettent en jeu un certain nombre
de concepts. Il faut pouvoir les rendre opratoires travers une dfinition de leurs caractristiques.
Cest le rle de la variable que Jambou M., (1999), dfinit comme toute caractristique dune
personne ou dune chose qui peut tre exprime par un nombre . Lunivers des variables est
__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

78

Chapitre III : Approche mthodologique de ltude


____________________________________________________________________________________________________________

lensemble des informations visant caractriser le plus possible les phnomnes tudis. Il rpond
la question suivante : quelles sont les informations ncessaires pour renseigner les indicateurs ? Ce
qui implique aussi de sinterroger sur les objets sur lesquels les informations doivent tre collectes
(objets gographiques, priodes, acteurs).
Lobjectif de ltude est, rappelons-le, de modliser la distribution spatiale des membres du complexe
An. gambiae au Burkina Faso pour comprendre et faire comprendre la distribution des membres de
ce complexe despces travers lidentification des facteurs environnementaux les plus dterminants.
En dautres termes, nous cherchons expliquer la variabilit des frquences dans des lieux donns,
compte tenu de la variabilit de lenvironnement.
En nous appuyant sur le paradigme biogographique, la bio-cologie du complexe An. gambiae
(section I, chapitre II), nous construisons le diagramme de cause effet (ou diagramme en arte de
poisson ou encore diagramme Ishikawa), pour inventorier lensemble des variables prendre en
compte (Figure 15).

Figure 15 : Diagramme dIshikawa des facteurs environnementaux influenant les frquences dAnopheles gambiae
s.s., ralisation SOME Y. S. Corentin

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

79

Chapitre III : Approche mthodologique de ltude


____________________________________________________________________________________________________________

Ce diagramme prsente trois grands groupes de facteurs qui contribuent la distribution spatiale des
espces : les facteurs actuels et passs, les facteurs internes lespce et les facteurs externes
lespce.
Dans le cadre de cette tude, lintrt est port sur les facteurs externes. Ces derniers constituent le
milieu dans lequel vivent les membres du complexe. Ces facteurs externes sont les facteurs
environnementaux.50 Ils peuvent tre subdiviss en trois classes : les facteurs gographiques, les
facteurs climatiques et les facteurs biotiques.

III.2.3 LINVENTAIRE DES VARIABLES


Daprs ltat actuel de lart sur la bio-cologie des anophles (voir chapitre prcdant), le climat
travers des paramtres tels que la temprature, les prcipitations et linsolation, conditionne
normment le taux et la dure dclosion des ufs. Il influence donc le potentiel reproductif des
anophles. Il est donc dun intrt certain de retenir ces paramtres importants comme variables.
Aussi, la temprature, les prcipitations, les pressions, linsolation, lvapotranspiration potentielle
(ETP) et les vents ont-ils t retenus comme variables sur le plan climatique.
Au niveau gographique, le relief est retenu comme un facteur limitant partir de certaines altitudes.
La ponte se faisant dans les eaux de surface, la disponibilit et laccessibilit cette ressource par les
anophles est de ce fait dune grande importance. Les hommes, travers lamnagement du territoire,
surtout en matire de mobilisation des ressources en eau, peuvent tre en densit trs leve par
endroit. Dans les implantations humaines, les amnagements peuvent crer des conditions locales,
quelques fois temporaires, favorables la prolifration des anophles. Il semble que la composition
chimique des eaux,51 en particulier leur pH intervient dans la distribution des vecteurs.
Lhydrographie, lamnagement, la topographie (altitude) et les sols constituent des variables
retenir comme facteurs gographiques.
Les anophles ont besoin de sang humain pour la maturation de leurs ufs. Les adultes se nourrissent
galement de jus sucr prlev sur la vgtation qui leur sert galement de site de repos et de
protection contre les prdateurs. La prsence humaine et la vgtation constituent des facteurs
biotiques retenus comme variables.
En somme, les variables retenues sont au nombre de 14, reparties en deux groupes : les variables
expliquer et les variables explicatives. Les variables expliquer sont au nombre de deux : les
frquences dAn. gambiae forme molculaire M et les frquences d'An. gambiae forme molculaire
50
51

Utilisation quivalante de facteurs co-gographiques et de facteurs environnementaux.


Il na pas t possible de runir linformation spatiale sur la qualit des eaux et sur la chimie des sols.

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

80

Chapitre III : Approche mthodologique de ltude


____________________________________________________________________________________________________________

S, chacune exprimant la population dune forme molculaire dnombre en un lieu. Ce sont les
variables entomologiques. Les variables explicatives sont les variables environnementales ou
cologiques. Nous les appelons aussi variables co-gographiques. Elles peuvent tre classes en
trois sous groupes :
-

les variables climatiques qui regroupent la temprature, les prcipitations, lETP, les vents,
linsolation, la pression de vapeur ;

les variables gographiques qui runissent lamnagement, lhydrographie, le relief, les


localits ;

les variables biotiques constitues de la prsence humaine et de la vgtation.

Certaines dentre elles sont dvaluation si courante que leurs units sont connues et les mthodes de
leur valuation ne sont pas nombreuses. Dautres ont des contenus dinterprtations peu videntes par
rapport lobjectif de ltude. Do lintrt de prciser les units. Dans le Tableau 3 sont consignes
les variables retenues ainsi que leurs contenus.

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

81

Chapitre III : Approche mthodologique de ltude


____________________________________________________________________________________________________________

Tableau 3 : Les variables, leurs units de rfrence et leurs dfinitions

Variables

Units

Contenus

Apport dans l'cologie du vecteur

Temprature

Degr Celsius

Degr de chaleur en un lieu

Limite de temprature tolrable, qualit des gtes

Prcipitation

Millimtre

Hauteur d'eau tombe dans un lieu

Quantit et qualit de gtes larvaires

Insolation

Fraction

Pourcentage de temps d'ensoleillement au


cours d'une journe
En temps totalement couvert, la fraction
d'ensoleillement est gale 0

Qualit des gtes larvaires

Vent

Mille/second

ETP

Millimtre

Pression

Hectopascal

Tension de vapeur

Qualit de l'atmosphre

Hydrographie

Mtre

Distance en tout point des cours d'eau. Elle


exprime l'accessibilit l'eau

Disponibilit de site des gtes larvaires

Relief

Mtre

Altitude (hauteur par rapport au niveau moyen


de la mer)

Difficult de survie partir de certaines altitudes, effet sur les


tempratures et les pressions

Amnagement

Type d'occupation des


terres

La diversit de l'occupation des terres

Disponibilit de gtes larvaires de ponte, en gtes de repos et


repas sanguin

Localits

Mtre

Vgtation

Proche infrarouge/rouge
Nombre d'habitants/
kilomtre carr
Nombre de M
Nombre de S

Prsence humaine
Population de M
Population de S

Vitesse du vent
La vapeur d'eau potentiellement produite du
fait de la transpiration et de l'vaporation

Qualit des sites de repos


Limite d'aridit tolrable (indicateur d'humidit de l'atmosphre)

Accessibilit par rapport aux implantations


humaines
Intensit de la reflectance chlorophyllienne

Lieu de repos, alimentation des adultes surtout mle

Densit de la population

Disponibilit du repas sanguin

Nombre de M en un lieu donn


Nombre de S en un lieu donn

Expression de l'adquation aux exigences cologiques de M


Expression de l'adquation aux exigences cologiques de S

Disponibilit en repas sanguin

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

82

Chapitre III : Approche mthodologique de ltude


____________________________________________________________________________________________________________

III.2.4 ENTITES / OBJETS GEOGRAPHIQUES


O et sur quoi valuer les variables inventories ? Cest lobjet de ce paragraphe. Lhabitat est
lexpression par excellence des relations entre une espce et son environnement. Lhabitat est donc
lunit lmentaire de dnombrement des frquences de vecteurs qui cadre avec lenvironnement.
Cependant, lhabitat des vecteurs varie au cours dune journe en fonction de ltat physiologique et
des prfrences cologiques (endophilie, exophilie, ponte, repos pour maturation des ufs, etc.).
La capture des anophles est ralise par maison, un des habitats prfrentiels des anophles. La
maison correspond une habitation humaine. Elle est le premier niveau gographique de
dnombrement des anophles capturs. La maison est un objet gographique appartenant une
localit.52 Les moustiques dnombrs au niveau des maisons dune mme localit sont cumuls au
niveau de la localit. La sommation des captures permet la caractrisation la population danophles
au niveau des localits. Le niveau gographique danalyse de la population danophles est donc la
localit. La localit est une rsolution plus fine que le village qui est lentit administrative de base
de lorganisation du territoire burkinab.
La caractrisation de lenvironnement des anophles dans une localit ncessite galement la
dfinition dune unit de rfrence. Cette unit peut acqurir une grande performance si elle sappuie
sur une chelle spatiale dintgration des cosystmes pour reprendre les termes de Lacoste et
Salanon, (2006). Par rfrence au niveau spatial pertinent de collecte de donnes climatiques, le
niveau microcosystmique correspond au niveau stationnel o interagissent et peuvent tre
caractriss tous les facteurs climatiques Lacoste et Salanon, (2006). Ce niveau doit rpondre au
critre fondamental dhomognit. Il doit galement tre en adquation le plus possible avec
lhabitat des vecteurs. Pour ce faire, un carr dun kilomtre de ct, soit une superficie de 1 km2, a
t retenu comme surface de rfrence pour la caractrisation de lenvironnement. Cette superficie
correspond laire de comptence des vecteurs et est suffisamment rduite pour garantir une
homognit confortable. Lobjet gographique de rfrence est donc une cellule de 1km sur 1km.

52

La localit correspondant tout regroupement humain, dot ou non dun statut juridique au niveau national. Elle est
diffrente du village qui lui est une implantation humaine reconnu comme tel par ladministration publique.
__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

83

Chapitre III : Approche mthodologique de ltude


____________________________________________________________________________________________________________

En somme, deux entits/objets gographiques par type de donnes, sont retenues :


1. pour les donnes entomologiques, lobjet gographique de rfrence pour la capture des
moustiques est la maison. La maison est donc le niveau gographique de collecte. Lobjet
gographique pour lanalyse des informations entomologiques est la localit. Le passage du
niveau maison au niveau localit est bas sur la sommation
2. Pour les donnes environnementales, lobjet gographique pour lobservation est la station.
Lenvironnement est dfini sur une maille de 1km sur 1km ; les variables associes cette
entit sont les suivantes : pluie, temprature, ETP, pression, vent, insolation, relief,
hydrographie, amnagement, localit, population humaine, vgtation. Lobjet gographique
pour lanalyse des donnes environnementales est la maille de 1km2. Le passage de la station
la maille de 1km sur 1km, est base essentiellement sur linterpolation et lestimation.
Lobjet gographique de rfrence est une maille de 1km2 implante en polygone (pixel).

III.2.5 LES METHODES DE COLLECTE DE DONNEES


Deux types de donnes sont collects :
1- les donnes primaires correspondant aux donnes entomologiques ;
2- les donnes secondaires constitues des donnes co-gographiques.
Deux mthodes sont utilises pour la collecte de ces donnes : le transect et la consultation
documentaire.
Pour runir les frquences des diffrents membres du complexe An. gambiae, le recours une
enqute gographique par sondage sest impos compte tenu du protocole du projet, de la dure de
ltude et des ressources. Cet chantillonnage sest appuy sur la mthode du transect.

III. 2.5.1 Le transect


En vue de la collecte des donnes entomologiques, un transect long de 3 183 km et de 15 km de large
de part et dautre de laxe du transect est dfini. Il couvre une superficie totale de
107 875 km2 sur 274 200 km2, soit plus de 35% du territoire burkinab. Il recoupe lensemble de la
diversit cologique de la zone dtude. Ce transect permet de slectionner 5 150 sur 10 04453
localits que compte le Burkina Faso, soit plus de 50% de la population statistique.
Ce transect est subdivis en trois sections ou circuits : le premier circuit, long de 547 km, le second
de 1 303 km et le troisime de 1 333 km. Ce transect constitue la premire tape dun
chantillonnage alatoire spatial stratifi.
53

Les localits se dfinissent comme toute implantation humaine sans lien avec son statut juridique (village, ville,
hameau de culture lieu dit etc.)

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

84

Chapitre III : Approche mthodologique de ltude


____________________________________________________________________________________________________________

La seconde phase consiste en un maillage du site, avec des cellules de 5 x 5 km54, soit 11 321
mailles. Ces mailles sont indexes. Parmi elles, 4 315 rpondent au critre de distance par rapport
laxe du transect. De celles-ci 300 sont tires au sort. Le tirage est stratifi de manire
proportionnelle la longueur du circuit. Ainsi, sur le circuit de 547 km, 50 cellules sont tires au sort
et sur les deux autres circuits, 125 cellules sont choisies au hasard.
La troisime phase consiste tirer au sort, une localit et une seule, dans chacune de 300 cellules.
Les coordonnes de ces localits sont remises lquipe dentomologistes du Centre National de
Recherche et de Formation sur le Paludisme (CNRFP) en vue de la capture et du dnombrement
dAn. gambiae s.s.. Les mthodes de capture et didentification des formes molculaires dAn.
gambiae sont prsentes en annexe 1 et 2. La Figure 16 prsente les diffrents aspects de cet
chantillonnage. Les captures et les identifications ont t effectues par lquipe dentomologique
du CNRFP.

Figure 16 : Transect, circuits et points de collecte des donnes entomologiques

III. 2.5.2

La revue de littrature scientifique

La revue de littrature est utilise pour faire le point sur les donnes relatives aux variables cogographiques, la mthodologie, la bio-cologie des vecteurs et aux diffrentes techniques de

54

Certains paramtres lis cet chantillonnage ont t dfinis dans le document du projet NIH. Il sagit du nombre de
sites de dnombrement (300) et de la taille des sites de prlvement (5km x 5km).

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

85

Chapitre III : Approche mthodologique de ltude


____________________________________________________________________________________________________________

traitement de linformation spatiale et statistique. Elle consiste essentiellement en linventaire des


bases de donnes (bases de donnes gographiques/cartographiques, base de donnes climatiques),
en la lecture dun certain nombre de documents (ouvrages de rfrence, thses, manuels, revues
scientifiques, etc.), en des discussions avec les experts sur des thmes trs varis (biologie et cologie
des vecteurs, mthodologie en modlisation, analyse spatiale, biogographie, etc.).
III.2.6 EVALUATION DE LA QUALITE DES DONNEES
La perspective de la modlisation est de partir dobservations de terrain pour formaliser le
phnomne et sen servir comme moyen de son explication et de sa comprhension. Cest donc une
perspective empirique de la modlisation base sur lobservation du rel pour reprendre les termes de
Langlois et Reguer, (2005). Dans ces conditions, la qualit des donnes revt une importance toute
particulire. Elle dtermine, en effet, la qualit du modle.
Lobjectif de cette analyse de la qualit est dapprcier, le plus objectivement possible, la capacit
des donnes collectes, particulirement les donnes secondaires, rpondre aux exigences de
lanalyse. Il ne sagit nullement de porter un jugement de valeur absolue sur la qualit lie la
production des donnes, tant les objectifs de la production peuvent tre trs loigns des ntres et
justifier certaines dcisions techniques. Le but de cet exercice est de rpondre aux questions
essentielles suivantes : est-ce que les donnes collectes sont adaptes aux besoins ? Sinon, est-il
possible de les traiter pour les adapter ? Dans ce cas, quels sont les traitements applicables ?

III.2.6.1 Mthode dvaluation utilise


La norme ISO 19113 rsume par Devilliers et Jeansoulin, (2005), portant sur la qualit de
linformation gographique, fournit une cl intressante lapprciation de la qualit interne et
externe des donnes dans les SIG.
Sur le plan de la qualit interne des donnes, cest--dire le niveau de similitude entre les donnes
collects et celles parfaites qui auraient dues tre collectes et appeles encore terrain nominal
ou univers du discours , nous nous intressons :
1. lexhaustivit qui se rapporte la prsence ou labsence dun lment, dun attribut ou
dune relation ;
2. la cohrence logique qui sintresse la pertinence par rapport des rgles logiques de
structure de donnes, dattributs ou de relations ;
__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

86

Chapitre III : Approche mthodologique de ltude


____________________________________________________________________________________________________________

3. lexactitude spatiale relative la vracit du positionnement de lobjet dans lespace ;


4. lexactitude temporelle qui revisite les attributs temporels et les relations temporelles des
objets ;
5. lexactitude des attributs qui fait allusion aux attributs quantitatifs, la justesse des attributs
qualitatifs et la classification des objets et des relations.
Pour la qualit externe des donnes, il sagit plutt dune apprciation contextuelle des donnes. Elle
sintresse ladquation, une utilisation particulire et intgre des paramtres tels que le rapport
cot/qualit, temps de production/dure de ltude. Cest comme le dfinit la norme ISO,
lensemble des proprits et caractristiques dun produit ou service qui lui confre laptitude
satisfaire des besoins implicites ou explicites .
Lvaluation de la qualit externe peut tre ralise aussi sur un canevas propos par Bedard et
Valliere, (1995), in Rodolphe et Robert, (2005), et qui sappuie sur six paramtres :
1. la dfinition cest--dire ladquation de la nature des donnes et des objets aux besoins ;
2. la couverture ou la compatibilit de lextension spatiale et temporelle de la donne aux
besoins ;
3. la gnalogie, cest la correspondance entre lorigine des donnes, les mthodes de
production et les besoins ;
4. la prcision smantique, temporelle et spatiale des objets et des attributs par rapport aux
besoins ;
5. la lgitimit qui exprime la reconnaissance officielle, la porte lgale et le respect des normes
de la donne par rapport aux besoins ;
6. laccessibilit, cest--dire la facilit daccs aux donnes (cot, dlais, format,
confidentialit, droit dauteur).
Lapplication dune telle grille dvaluation requiert la dfinition dun terrain nominal qui
reprsente les donnes attendues.
III.2.6.2 Terrain nominal
L'idal est de runir sur les lieux de prlvement, soit sur les 300 points de prlvements, toutes les
caractristiques du milieu et du complexe An. gambiae. Les donnes relatives aux diffrentes
variables doivent se superposer parfaitement au plan spatial pour permettre la comparabilit. Au plan
temporel, la caractrisation du milieu doit tre faite sur tous les 300 sites en mme temps.
Lensemble des informations doit tre cohrent avec le site par conformit la description officielle

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

87

Chapitre III : Approche mthodologique de ltude


____________________________________________________________________________________________________________

et la littrature scientifique. La prcision temporelle est lheure avec une rptitivit, toutes les
semaines la mme heure de prlvement. Le choix de la semaine sappuie sur le cycle
gonotrophique qui est dun maximum de 7 jours. Cette rptitivit devrait permettre de suivre la
variabilit spatio-temporelle de population des vecteurs et du milieu au cours dune anne. La
prcision spatiale est le kilomtre. En effet, le kilomtre correspond la distance de vol de
lanophle. Les sources, moins dtre produites dans le cadre direct de cette tude, doivent provenir
au moins de structures officielles.

III.2.6.3 Apprciation de la qualit des donnes


Ce terrain nominal permet dapprcier les donnes et de prendre les dcisions en matire de
recevabilit, compte tenu de la ralit objective de terrain (contrainte temporelle, logistique,
budgtaire etc.), et le cas chant, de dcider des traitements visant rapprocher le plus possible les
donnes au terrain nominal.
Le Tableau 4 prsente lapprciation des informations collectes par variable et selon les diffrents
paramtres retenus dans linventaire des variables en III.2.3 et le terrain nominal.
Du point de vue de la qualit interne, les donnes ont une bonne cohrence logique, une bonne
exactitude spatiale et une bonne exactitude des attributs. Elles ont cependant dnormes lacunes en
termes dexhaustivit et dexactitude temporelle. Les donnes relatives aux facteurs climatiques sont
des donnes historiques et sont collectes travers un rseau de stations totalement diffrentes des
lieux dobservations. Il en est de mme pour ce qui concerne les donnes relatives aux facteurs
gographiques. Ce sont des informations historiques agrges qui ont parfois plus de 20 ans. Cest le
lieu de citer les informations sur lhydrographie et la topographie (altitude) qui relvent des cartes
topographiques et dont les plus rcentes datent de 1984. Lensemble des donnes ne rpond donc pas
lexhaustivit et lexactitude temporelle.
Sur le plan de la qualit externe, la limite observable sur les donnes concerne particulirement la
couverture et la prcision temporelle et spatiale.
Pour rapprocher le plus possible le terrain nominal et la nature des donnes collectes, deux types de
traitement sont appliqus: le premier vise rsoudre la question de la temporalit et le second
apporte la solution la question de la spatialit.

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

88

Chapitre III : Approche mthodologique de ltude


____________________________________________________________________________________________________________

Tableau 4 : Evaluation de la qualit des donnes collectes

Paramtres

Donnes valuer
Prcipitation

Temprature

vent

insolation

pression

ETP

Hydrographie

Topographie (Altitude)

Amnagement

localit

population humaine

vgtation

population de M

population de S

Qualit Interne
Exhaustivit

Non

Non

Non Non

Non

Non Non

Non

Non

Non

Non

Non

Oui

Oui

Oui

Oui

Oui

Oui

Oui

Oui

Oui

Oui

Oui

Oui

Oui

Oui

Oui

Oui

Oui

Oui

Oui

Oui

Oui

Oui

Oui

Oui

Oui

Oui

Oui

Oui

Oui

Oui

Non

Non

Non Non

Non

Non Non

Non

Non

Non

Non

Non

Non

Non

Oui

Oui

Oui

Oui

Oui

Oui

Oui

Oui

Oui

Oui

Oui

Oui

Cohrence
logique
Exactitude
spatiale
Exactitude
temporelle
Exactitude d
attributs

Oui

Oui

Qualit externe
Dfinition

Oui

Oui

Oui

Oui

Oui

Oui

Oui

Oui

Oui

Oui

Oui

Oui

Oui

Oui

Couverture

Non

Non

Non Non

Non

Non Non

Non

Non

Non

Non

Non

Non

Non

Gnalogie

Oui

Oui

Oui

Oui

Oui

Oui

Oui

Oui

Oui

Non

Oui

Non

Oui

Oui

Prcision

Non

Non

Non Non

Non

Non Non

Non

Non

Non

Non

Non

Non

Non

Lgitimit

Oui

Oui

Oui

Oui

Oui

Oui

Oui

Oui

Oui

Oui

Oui

Oui

Oui

Oui

Accessibilit

Oui

Oui

Oui

Oui

Oui

Oui

Oui

Oui

Oui

Oui

Oui

Oui

Non

Non

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

89

Conclusion de la premire partie


____________________________________________________________________________________________________________

III.2.7 LES METHODES DE TRAITEMENT DES DONNEES


Les mthodes de traitement recouvrent lensemble de oprations appliques aux donnes pour les
rapprocher le plus possible du terrain nominal. Les principales lacunes observes relvent de
lexactitude et de la prcision temporelle, de la couverture et de la prcision spatiale. Cest pour
rsoudre les questions de temporalit et de spatialit que ces traitements sont appliqus. Ceux-ci
peuvent tre regroups en types de traitements : les traitements de type spatial et les traitements de
type temporel.

III.2.7.1

les traitements de type spatial

Les donnes disponibles ne couvrent pas lensemble des sites et prsentent aussi des rfrentiels
techniques diffrents. Pour rsoudre ces problmes, nous appliquons des mthodes de transformation
gomtrique/topologique et des mthodes dinterpolation et destimation spatiales. Ces traitements
sont appliqus lorsque les donnes ont des rfrentiels techniques htrognes ou lorsquelles ne
couvrent pas lensemble des points chantillonns (Cf. tableau 4).

Les mthodes de transformation gomtrique


Elles consistent inscrire lensemble de donnes dans un mme systme de projection. Et pour
conserver la lgitimit, toutes les donnes spatiales ont t inscrites dans le rfrentiel cartographique
officiel du Burkina Faso : Ellipsode Clark 1880, Projection Univers Transverse Mercator (UTM),
Zone 30 tendue 31.
Les donnes spatiales, nayant pas de systme de coordonnes ont fait lobjet de gorfrencement et
de transformation. Pour les transformations et le gorfrencement, la mthode de transformation
affine est utilise. La validation de la transformation est ralise pour une erreur quadratique
moyenne trs faible ( 0,04). Les donnes ayant dj un systme mais diffrent du rfrentiel officiel
ont t re-projetes.

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

90

Conclusion de la premire partie


____________________________________________________________________________________________________________

Les mthodes dinterpolation et destimation


Ces mthodes sont utilises pour combler les lacunes constates en termes de couverture spatiale. La
plupart des donnes tant collectes en certains points chantillonns, les valeurs prises en des points
non chantillonns sont souvent ignores. Le but de lutilisation de ces mthodes est donc dobtenir
des valeurs en tout point du site, soit par estimation soit par interpolation.
Cinq mthodes dinterpolation ont t utilises : Global Polynomial Interpolation (GPI), Inverse
Distance Weigthing (IDW), Local Polynomial Interpolation (LPI), Radial basis fonction (RBF) et
Krigeage. Certaines sont exactes et dterministes comme IDW, dautres sont stochastiques comme
le Krigeage. Pour chaque variable considre, nous appliquons par essais successifs les cinq
mthodes puis nous choisissons celle qui a lerreur prdite la plus faible. La rsolution retenue pour
linterpolation est de 1km sur 1km, correspondant approximativement laire de comptence en un
vol des anophles.
Linterpolation est utilise pour les altitudes ainsi que pour les diffrents paramtres climatiques,
temprature, prcipitation, vent, pression, insolation, ETP, Arnaud et Emery, (2000); Claritas,
(2002); Droesbeke et al., (2006); ESRI, (2006); Zaninetti, (2005)
Deux autres mthodes ont t utilises pour pallier les insuffisances lies la couverture et
lexhaustivit. Il sagit du calcul des densits et du calcul des distances. Lestimation des distances a
t faite pour deux variables : lhydrographie et les localits. Cela consiste calculer la distance en
tous points, par rapport aux cours deau, et la distance en tout point par rapport aux localits. Le type
de distance utilis est linaire. La maille est un carre de 100 m de ct. La rduction de la taille de la
maille 100 m, donc laugmentation de la rsolution spatiale permet de prendre en compte un
minimum de diversit par rapport au centre de collecte.
La mthode destimation des densits est utilise pour la variable population. Elle consiste repartir
des valeurs (valeurs mesures) attaches un ensemble de points sur une maille. La fonction de
rpartition est, soit lgalit, soit la proportionnelle la distance. Nous obtenons ainsi une population
par unit de surface.
Dans le cadre de cette tude, les paramtres utiliss sont les suivants :
Type de maille : carr
Taille des mailles de la grille : 1km sur 1km
__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

91

Conclusion de la premire partie


____________________________________________________________________________________________________________

Type de densit : pondre la distance


Rayon de comptence : 10 000 m
Unit de surface : km2
Ces traitements ont permis dapprocher le terrain nominal en proposant par estimation les
caractristiques concernes au niveau spatial. Si la question de la couverture et de lexhaustivit
spatiale trouve ainsi une solution acceptable, la question de lexactitude et de la prcision temporelle
reste traiter.

III.2.7.2

Les traitements de type temporel

La simultanit souhaite pour les variables co-gographiques et les frquences des vecteurs et la
rptitivit de la caractrisation constituent un niveau de prcision et dexactitude temporelle
extrmement difficile atteindre. Aussi, le recours des valeurs moyennes caractrisant les
diffrents facteurs est-il une solution !
Lusage des donnes les plus rcentes
Certains paramtres connaissent une grande stabilit et des mesures forte rptitivit dans le temps
napporteront pas de grands changements. Cest le cas du relief, de lhydrographie et des localits.
Cest pourquoi, pour ces variables, les donnes nont subi aucun traitement au niveau temporel.
Dautres sont destimation tellement coteuse que leur production est difficilement envisageable la
priodicit souhaite. Cest le cas des statistiques sur la population et de la cartographie de
loccupation des terres. Pour ce qui est de la population, une estimation a t faite pour lanne de
collecte des donnes entomologiques partir du taux daccroissement naturel. Pour ce qui concerne
loccupation des terres, la donne cartographique la plus rcente a t retenue comme significative
pour la priode de collecte des donnes entomologiques.
Les mthodes statistiques
Concernant les autres variables, pour lesquelles il existe une production journalire des informations
et qui intressent les facteurs climatiques et la vgtation, nous considrons les tats moyens. Pour
les facteurs climatiques, le recul statistique ncessaire est de 30 ans. Cette condition na pas toujours
pu tre respecte. Dans de tels cas, nous prenons en compte le recul maximum pour les stations
disponibles.

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

92

Conclusion de la premire partie


____________________________________________________________________________________________________________

Ainsi, lorsque la srie le permet, les valeurs moyennes pour tous les paramtres ont-elles t
calcules sur 30 ans. Sinon, lensemble de la srie est pris en compte. Pour ce qui concerne la
vgtation, la moyenne des indices dcadaires normaliss de vgtation, calcule sur lensemble de la
priode de collecte qui stend de juillet octobre 2005, a t retenue.
En somme, sur le plan temporel, la solution a t dutiliser les caractristiques moyennes. Cet tat
moyen a t obtenu soit par calcul soit par prise en compte des caractristiques propres de la variable
considre.

III.2.8 MATERIELS / LOGICIELS UTILISES


Le dploiement de cette mthodologie a t possible grce lutilisation dun certain nombre de
logiciels.

Nous

regroupons

les

logiciels

en

cinq

classes :

SIG

et

analyse

spatiale,

tldtection/traitement numrique dimages, analyse de donnes, modlisation et gestion des GPS.


Logiciels de SIG et danalyse spatiale.
Ils ont servi lapplication des traitements de type spatial sur les donnes : transformation
gomtrique, projection, interpolation et estimation. Ces logiciels ont galement t utiliss pour le
calcul de certains indicateurs choisi pour la vrification des hypothses. Il sagit des indices
dautocorrlation spatiale et des indices locaux dassociation spatiale. Aprs la dfinition des
modles de rpartition en fonction des paramtres environnementaux, ces logiciels ont permis
dinverser les fonctions et de passer des modles mathmatiques aux modles iconiques. Certains
lments de gomtries ont t galement calculs comme la distance moyenne entre les localits. En
sus de ces fonctions de traitement et de calcul, les logiciels de SIG sont galement utiliss comme
logiciel de cartographie en permettant ldition cartographique partir des donnes qui ont t
collectes et restructures en bases de donnes. Les logiciels utiliss sont : Arcview 3x avec
lextension Spatiale Analyst de ESRI et extension complmentaire et Arcgis 9 x avec les extensions
Spatiale Analyst et Gostatiscal Analyst de ESRI. La raison de lutilisation des deux logiciels est lie
au fait que nous avons dmarr le processus avec la version 3X avant davoir accs la version
suprieure. De plus, parce que la version 3X existait depuis longtemps, elle avait une plus grande
disponibilit en shareware avec les fonctions trs utiles dans les traitements et inexistantes dans la
version suprieure.
Logiciels de tldtection / traitement numrique dimage

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

93

Conclusion de la premire partie


____________________________________________________________________________________________________________

Les logiciels de tldtection ont t utiliss principalement pour le traitement des images NDVI. Ces
traitements ont consist gorfrencer les images, les dcouper et calculer un NDVI moyens sur
12 images obtenues. Lusage galement de deux solutions logicielles est li galement des
fonctionnalits spcifiques que nous recherchions. Ainsi, le gorfrencement et le dcoupage des
images ont t effectus avec le logiciel ERDAS Imagine. Pour le calcul de limages arithmtique
correspondant au NDVI moyen sur les 12 images, il a t effectu sur Winchips qui offre un module
de calcul trs simples et trs accessibles.
Logiciels danalyse de donnes
Les logiciels danalyse de donnes ont servi la fouille des donnes. Il sagit principalement des
traitements lis lACP, aux diffrentes rgressions, la ralisation de certains tests et calculs
comme le test de Kolmogorov-Smirnov et le calcul de pourcentage des diffrentes formes
molculaires par site de capture. Les logiciels utiliss sont XL-Stat 2003, en extension Microsoft
Excel 2003, de Microsoft Corporation et Tanagra de Universit de Lyon II.
Logiciel de modlisation
Ce logiciel a servi llaboration des modles conceptuels de donnes et de traitement. Cest le
logiciel Power AMC-Designor de Sybase qui a t utilis.
Logiciels pour GPS
La collecte de donnes entomologiques ncessitait que lquipe de terrain dispost des coordonnes
gographiques sur les localits chantillons pour y aller. De plus, de retour du terrain, il fallait
galement tlcharger les donnes du GPS aux ordinateurs. Pour cela, les logiciels suivants ont t
mis contribution : GPS track maker, de Odilon Ferreira Junior, Individual resident in Belo
Horizonte MG Brazil, et Mapsource de Garming.

CONCLUSION DU CHAPITRE III


Lapproche mthodologique utilise dans le cadre de cette tude est pluridisciplinaire. La
biogographie y est positionne comme discipline charnire de formulation des hypothses. Elle a
permis dintgrer des rsultats fournis par lutilisation des apports dautres disciplines scientifiques et
techniques. Les mthodes utilises peuvent tre regroupes en trois grandes classes :
-

La collecte des donnes, effectue travers deux types de mthodes que sont la revue de
littrature et le transect,

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

94

Conclusion de la premire partie


____________________________________________________________________________________________________________

Lanalyse de qualit des donnes qui appuie sur la norme ISO 19113 reformule par
Devilliers et al., (2005) avec pour objectif, lidentification du terrain nominal partir dune
connaissance a priori des besoins en information et en traitement,

Les mthodes de traitement qui regroupent les mthodes de traitement spatial et a-spatial et
les mthodes de calcul des indicateurs.

Ces mthodes se sont appuyes essentiellement sur la statistique/lanalyse de donnes, la


tldtection, lanalyse spatiale et le systme dinformation gographique. Les traitements
fournissent des rsultats dont linterprtation permettra la vrification des hypothses de dpart, le
niveau datteinte des objectifs spcifiques.

CONCLUSION DE LA PREMIERE PARTIE


Cette premire partie a permis de dlimiter le champ dinvestigation de ce travail de recherche. Elle
la positionn comme un travail de gographie et plus prcisment de biogographie qui procde
dune approche pluridisciplinaire pour contribuer la rflexion sur une question de sant, celui de la
rpartition spatiale des principaux vecteurs du paludisme au Burkina Faso, les formes molculaires
M et S dAnopheles gambiae. Sans renier son caractre gographique, ce travail a bnfici des
contributions indispensables de lentomologie, de lanalyse des donnes, de lanalyse spatiale et des
systmes dinformation gographique pour la mise en place dune dmarche mthodologique qui
permet chaque mthode dapporter sa contribution dans le processus dinvestigation. Cette tude
ambitionne de modliser la distribution spatiale dAnopheles gambiae s.s. cest--dire den donner
une reprsentation formelle et fidle.
Les contours de ltude sont dfinis au plan scientifique. Le champ dapplication est connu travers
une prsentation de lanophle et du Burkina Faso. La dmarche mthodologique et lensemble du
processus ont t exposs. A quels rsultats aboutit-on ? Quelle interprtation faire de ces rsultats ?
Quelles apprciations donner par rapport aux hypothses et aux objectifs de ce travail. Cest le
contenu de la seconde partie de ce travail.

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

95

Deuxime Partie : Structuration des donnes, laboration et valuation des modles


________________________________________________________________________________________________________________

DEUXIEME PARTIE
STRUCTURATION DES DONNEES, ELABORATION
ET EVALUATION DES MODELES

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

96

Deuxime Partie : Structuration des donnes, laboration et valuation des modles


________________________________________________________________________________________________________________

Cette partie fait une synthse sur les donnes collectes et leurs traitements. Elle fait aussi le point de
lorganisation spatiale dAn. gambiae s.s. au Burkina Faso et des facteurs environnementaux qui
dterminent les structures et configurations spatiales mises en exergue.
Aussi, a-t-elle pour but dvaluer les indicateurs pour vrifier les hypothses de recherche et
apprcier le niveau datteinte des objectifs. Elle est compose de trois chapitres :
-

le chapitre 4 est consacr la prsentation de la base de donnes travers les modles


conceptuels de donnes et de traitement, ainsi que les traitements appliqus aux donnes cogographiques /environnementales ;

le chapitre 5 sintresse lorganisation spatiale des formes molculaires M et S dAn.


gambiae et lanalyse des facteurs dterminants de la distribution spatiale ;

le chapitre 6 est destin la modlisation de la distribution spatiale des formes molculaires


M et S dAn. gambiae au Burkina Faso.

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

97

Chapitre IV : Organisation et structuration de base de donnes


________________________________________________________________________________________________________________

CHAPITRE IV : ORGANISATION ET STRUCTURATION DE LA BASE DE


DONNEES
Recueillir des donnes est une chose, les structurer en fonction de la logique dun domaine, des
objectifs de stockage, de laccessibilit et des traitements, en est une autre. La collecte de donnes,
mme en suivant une mthodologie bien dfinie, nest pas suffisante pour en assurer une bonne
organisation et une bonne structuration. Cela est particulirement vrai en bases de donnes
numriques o des contraintes techniques imposent des logiques de conception de la structure
organisationnelle des donnes et des traitements qui sappuient sur un formalisme bien dfini.
Lutilisation efficace et efficiente des SIG requiert quon sintresse la structuration des donnes et
des traitements. Aussi, ce chapitre est-il consacr la modlisation des donnes ainsi qu leur
traitement. Le formalisme utilis dans le cadre de cette tude est MERISE. Deux modles ont t
raliss : le modle conceptuel de donnes et le modle conceptuel de traitement. La prsentation
suivante est structure selon les deux modles auxquels sajoute le traitement des donnes cogographiques.

IV.1 LE MODELE CONCEPTUEL DE DONNEES


Le processus doprationnalisation de la mthodologie a conduit la collecte dun ensemble de
donnes quil est ncessaire de bien structurer pour pouvoir en faire une exploitation optimale
laide des systmes de gestion des bases de donnes (logiciel). Cela a conduit llaboration dun
modle conceptuel de donnes.
Le modle conceptuel de donnes (MCD) reprsente la structure logique globale d'une base de
donnes, indpendamment du logiciel ou de la structure de stockage des donnes. Un modle
conceptuel contient toujours des donnes qui constituent une reprsentation formelle des donnes
ncessaires au fonctionnement d'une entreprise. Il permet de reprsenter l'organisation des donnes
sous forme graphique, de vrifier la validit des donnes de conception et gnrer le modle
physique de donnes, qui spcifie les modalits physiques de mise en oeuvre de la base de donnes
55. Le MCD est une reprsentation du domaine tudi travers lidentification de des objets qui le
constituent et des relations fonctionnelles. La Figure 17, ci-aprs, prsente la modlisation des donnes
utilises dans le cadre de ce travail de recherche.

55

Aide PowerAMC Version 6.1

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

98

Chapitre IV : Organisation et structuration de base de donnes


________________________________________________________________________________________________________________

Modle Conceptuel de Donnes


Projet : Modle Conceptuel de Donnes
Modle :An. gambiae et environnement
Auteur : SOME C Version1.0 24/05/2008

Priode
Date mesure D

Catgorie
Nom A20

0,n

1,n

Mesurer
Valeur DC3,2

concerner

0,n
Variables
code variable
Nom variable
Unit variable
Type variable

Sites
Code
Nom du site
Longitude
Latitude

A5
A20
0,n
A10
A20

A5
A20
DC7,7
DC7,7 1,n

Figure 17 : Modle conceptuel de donnes

Le modle conceptuel contient 14 groupes dinformation (Tableau 5) repartis entre les entits et les
associations.
Tableau 5 : Liste des informations
Nom
Catgorie
Code
code variable
Date mesure
Latitude
Longitude
Nom
Nom du site
Nom variable
Type variable

Code
CATEGORIE
CODE
CODE_VARIABLE
DATE_MESURE
LATITUDE
LONGITUDE
NOM_CATEGORIE
NOM_SITE
NOM
TYPE_VARIABLE

Unit variable
Valeur

UNITE
VALEUR

Type
A15
A5
A5
D
DC7,7
DC7,7
A20
A20
A20
A20
A10
DC3,2

Contenu
Classification des sites selon les variables mesures
Code de la catgorie
Code de la variable
Date de collecte des donnes
Latitude du lieu de collecte
Longitude du lieu de collecte
Nom du lieu de collecte
Nom de la variable collecte
Rpartition des variables entre variables explicatives
variables expliquer. Type de variable (entomologiqu
environnementale
Unit de la variable
Valeur prise par la variable

Lentit est un objet dfini au sein du systme d'information et au sujet duquel vous voulez
conserver des informations Sysbase, (1994). Notre systme en compte quatre (Tableau 6).
__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

99

Chapitre IV : Organisation et structuration de base de donnes


________________________________________________________________________________________________________________

Tableau 6 : Liste des entits


Nom
Catgorie

Code
CATEGORIE

Priode
Sites
Variables

PERIODE
SITES
VARIABLES

Signification
La catgorie permet de distinguer/classer les sites de collecte de donn
par variables
Priode pendant laquelle les donnes ont t collectes
Lieu de collecte des donnes
Les variables

Ces entits sont mises en relation travers deux associations (Tableau 7)


Tableau 7 : Liste des associations
Nom
Concerner
Mesurer

Code
CATEGORIE_SITE
VARIABLES_SITE

Nombre
0
0

Sur la base de ce modle, les variables sont mesures sur des sites et plusieurs dates durant une
priode. Ces variables sont regroupes par catgorie.
Chaque entit a des proprits qui sont des lments dinformation lis lentit. Cest lensemble
des lments qui permettent de dcrire les entits.

IV.1.1

LENTITE CATEGORIE

La catgorie correspond un jeu de sites dcrivant une mme variable. Par exemple, les sites de
mesure de la temprature vont correspondre la catgorie temprature. Elle est dcrite par la
proprit nom de catgorie. La catgorie est associe lentit site. Dans cette association, un site
relve d'une catgorie et une catgorie peut concerner un ou plusieurs sites. Cest une relation de 1
plusieurs qui lie lentit catgorie et lentit site.

IV.1.2

LENTITE SITES

Le site est le lieu dvaluation dune variable. Il correspond par exemple au poste pluviomtrique,
la localit de collecte des donnes entomologiques, ou la densit de vgtation sur une surface dun
km2. Les proprits du site, cest--dire les lments qui le caractrisent dans le systme, sont : le
nom du site, son code et ses coordonnes gographiques en longitude et en latitude. Le nom du site
correspond au nom du lieu de collecte et le code est un identifiant qui lui est affect. Ces
coordonnes permettent didentifier sa position dans le rfrentiel gographique.
Le site est en relation avec deux entits : lentit catgorie qui permet de classer le site selon la

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

100

Chapitre IV : Organisation et structuration de base de donnes


________________________________________________________________________________________________________________

variable qui y est mesure et lentit variable qui est lensemble des lments mesurs sur le site.
Ainsi, sur un site, peuvent tre mesures plusieurs variables et une variable peut tre mesure sur
plusieurs sites. Lassociation entre lentit site et lentit variable est de type plusieurs plusieurs.
Ces mesures peuvent tre effectues plusieurs dates durant une certaine priode, do lexistence
dune entit priode.

IV.1.3

LENTITE PERIODE

Cette entit contient les informations relatives aux dates dvaluation ou de mesure des variables sur
les sites. Par exemple, pour les tempratures, les prcipitations, linsolation ou lindice de vgtation,
il est ncessaire de savoir quand et o les observations / mesures ont t effectues. Lentit priode a
deux proprits : la date et le code. Elle est en relation avec deux entits que sont : lentit site et
lentit variable.
La relation entre lentit priode et lentit variable est de type plusieurs plusieurs. Une variable
peut donc tre mesure en zro ou plusieurs dates et une date, zro ou plusieurs variables peuvent
tres mesures.
La relation entre lentit priode et lentit site est galement de type plusieurs plusieurs. En effet,
plusieurs dates de mesure peuvent tre effectues sur un site et plusieurs sites peuvent tre des lieux
de mesure la mme date.

IV.1.4

LENTITE VARIABLES

La variable est un facteur qui rentre dans l'valuation de la qualit de l'environnement par rapport aux
exigences cologiques dAn. gambiae s.s. ou dans le dnombrement des frquences dAn. gambiae
s.s.. Cest par exemple, la temprature, lvapotranspiration potentielle (ETP), la densit de
population, le vent, la pression, lhydrographie, le relief, la prsence humaine, la population de S.

Lentit variable est dcrite par quatre proprits (Tableau 8) : le nom de la variable, le code de la
variable, lunit dvaluation de la variable et le type de variable.
Tableau 8 : Proprit de lentit variable
Nom
Code variable
Nom variable
Unit variable
Type variable

Code
CODE_VARIABLE
NOM
UNITE
TYPE_VARIABLE

Contenu
Code de la variable
Nom de la variable
Unit de mesure de la variable
Rle de la variable

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

101

Chapitre IV : Organisation et structuration de base de donnes


________________________________________________________________________________________________________________

Lentit variable est en relation avec les entits priode et site. La relation entre lentit
variable et lentit priode est de type plusieurs plusieurs. Une variable peut tre mesure
plusieurs dates et une mme date plusieurs variables peuvent tre mesures. Il en va de mme de la
relation entre lentit variable et lentit site. Plusieurs variables peuvent alors tre mesures sur un
mme site et sur plusieurs sites peut tre mesure une mme variable.
Ainsi modlises, les donnes servent des traitements et le modle conceptuel de traitement permet
de les anticiper.

IV.2 LE MODELE CONCEPTUEL DE TRAITEMENT


Le modle conceptuel de traitement (MCT) a pour objectif de reprsenter formellement les
activits exerces par le domaine de gestion et les changes de ce domaine avec son environnement
Sysbase, (1994). Il permet de modliser les activits exerces par le domaine et didentifier les
changes du domaine avec son environnement et les activits induites pour structurer le
fonctionnement du domaine (Figure 18). En dautres termes, le modle consiste en larticulation de
lensemble des processus envisags dans le cadre du travail.

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

102

Chapitre IV : Organisation et structuration de base de donnes


________________________________________________________________________________________________________________

Figure 18 : Modle conceptuel de traitement

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

103

Chapitre IV : Organisation et structuration de base de donnes


________________________________________________________________________________________________________________

Dans le cas de cette tude, les traitements peuvent tre subdiviss en trois processus :
-

le processus collecte et traitement des donnes entomologiques ;

le processus collecte et traitement de donnes environnementales ;

le processus modlisation et laboration de carte de prdiction de distribution .

IV.2.1 LE PROCESSUS DE COLLECTE ET DE TRAITEMENT DES


DONNEES ENTOMOLOGIQUES
Ce premier processus est compos de trois oprations :
1. Lopration slection du site concerne lensemble des dispositions pratiques devant permettre la
collecte des donnes primaires sur le terrain, particulirement les donnes entomologiques. Elle
consiste en quatre actions : la dfinition du transect, lchantillonnage des sites de collecte, la
dfinition des circuits de collecte, lidentification des lieux au moyen de coordonnes gographiques.
La mise en uvre de cette opration est conditionne par la disponibilit des ressources humaines et
financires ainsi qu laccord des dcideurs. A lissue de lopration, les lieux de collectes et de la
logistique (les fiches de collecte, ncessaires lopration de collecte des donnes entomologiques)
sont disponibles.
2. Lopration de collecte de donnes entomologiques est lexcution pratique de la collecte de
donnes sur le terrain. Elle consiste recueillir sur les sites chantillonns les informations sur les
donnes relatives aux deux formes molculaires M et S dAn. gambiae s.s.. Les annexes 1 et 2
prsentent, respectivement, les mthodes de collecte des moustiques et les mthodes didentification
des formes molculaires M et S dAn. gambiae. Elle est mise en uvre seulement lorsque lopration
de slection de sites est russie et fournit la liste des localits et la fiche de collecte et que la priode
est propice la collecte de donnes (priode de prolifration de moustiques). Cette opration est
constitue de quatre actions : la capture des moustiques, lidentification des formes molculaires M et
S d'An. gambiae s.s., le dnombrement des frquences utiles (femelles gravides et semi-gravides, ou
gorges), un premier renseignement des fiches (lieu de collecte, frquences de membres du
complexe). Cette opration produit des fiches renseignes et des carcasses dAn. gambiae s.s.
analyser au laboratoire. Si cette opration est russie, elle permet denclencher lopration de
dpouillement.
3. Lopration dpouillement/analyse de laboratoire. Lidentification des formes molculaires nest
pas totale sur le terrain et il faut des analyses au laboratoire pour lachever. Cest la finalit de
lopration dpouillement/analyse de laboratoire. Lidentification des membres du complexe achve

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

104

Chapitre IV : Organisation et structuration de base de donnes


________________________________________________________________________________________________________________

par le tri et le regroupement les anophles capturs par unit spatiale de collecte (site) le
renseignement dune fiche synthtique. Cette fiche permet de connatre, par site dobservation, le
nombre dAn. gambiae forme molculaire S, le nombre dAn. gambiae forme molculaire M, le
nombre dAn. arabiensis, les coordonnes en longitude et en latitude des sites dobservation. Ces
actions de lopration dpouillement/analyse de laboratoire clturent le processus collecte de
donnes entomologiques.

IV.2.2 LE PROCESSUS DE COLLECTE ET DE TRAITEMENT DES


DONNEES ENVIRONNEMENTALES
Il regroupe lensemble des oprations ddies la collecte de donnes secondaires sur la
bio-cologie des anophles, sur les caractristiques du milieu physique et humain du Burkina Faso, le
site de ltude. Un accent particulier a t mis sur les donnes secondaires spatiales permettant la
caractrisation du Burkina Faso en rapport avec la bio-cologie des anophles dans ce modle. Ce
processus est compos de trois oprations :
1. Lopration collecte des donnes secondaires : elle consiste en la revue de littrature : manuels,
prcis, dictionnaires, planches, cartes, publications scientifiques, bases de donnes gographiques ou
non, etc. Cest une opration de fouilles des travaux dj raliss et dont les informations peuvent
constituer des apports intressants en termes de donnes dans le test des hypothses de dpart. Cette
opration se rsume la seule action dinventaires et de collectes des informations dj existantes. Il
en rsulte toujours un jeu de donnes.
2. Lopration caractrisation des donnes secondaires ; cest un travail danalyse et dvaluation du
jeu de donnes issues de lopration prcdente. Elle se dcline en six actions : la description et le
renseignement des donnes, la vrification de ladquation entre les diffrents systmes de
projection, la vrification de ladquation des chelles spatiales et temporelles par rapport aux
objectifs de ltude, la structuration des donnes et la cration dune base de donnes. Cette opration
produit toujours une base de donnes et un rapport sur les donnes collectes.
3. Les travaux complmentaires consistent en une opration de mise en phase des donnes par
rapport lensemble de ltude, du point de vue de leur adquation aux objectifs et la
mthodologie. Cette opration est compose de cinq actions : lharmonisation des systmes de
projection, la dfinition dun rfrentiel spatial, lharmonisation des chelles spatiales et temporelles
et le compltement des donnes manquantes par estimation ou par interpolation ou encore par
extrapolation. Cette opration permet galement de produire, en sortie, une table compltant la table

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

105

Chapitre IV : Organisation et structuration de base de donnes


________________________________________________________________________________________________________________

issue du processus de collecte de donnes entomologiques en fournissant, pour chaque site de


collecte, des informations relatives au milieu et intervenant dans la bio-cologie des anophles.
Ces deux premiers processus peuvent se drouler en mme temps. Par exemple, en mme temps que
se droule lopration slection des sites , la collecte de donnes peut avoir lieu. Le troisime
processus quant lui nest possible que lorsque les rsultats des deux premiers processus sont
disponibles.

IV.2.3

LE PROCESSUS DE MODELISATION ET DE REALISATION DE


CARTE DE DISTRIBUTION PREDICTIVE

Ce processus vise llaboration de carte de distribution des deux formes molculaires M et S dAn.
gambiae au Burkina Faso, en sappuyant sur les observations de terrain, les caractristiques du milieu
et la bio-cologie des anophles. Pour cela, ce processus doit permettre, par identification des
rgularits, de formaliser la relation entre la distribution des diffrentes formes molculaires et
lenvironnement. Cette formalisation sert de support pour la production de carte de distribution. Ce
processus compte de cinq oprations :
1. Lopration formatage du tableau de synthse . Il sagit de faire le formatage des tableaux de
donnes analyser en regroupant en un seul les synthses des processus collecte de donnes
entomologiques et collecte de donnes secondaires . Il sagit galement de

vrifier

lexhaustivit de linformation sur les diffrents sites de collecte.


2. Lopration analyse spatiale descriptive consiste en lanalyse de la structure spatiale travers
lutilisation dindicateurs statistiques (centrode, barycentre, ellipse de dviation standard) et
dindices (Moran, Getis-Ord General G, Anselin Local Moran et Getis-Ord Gi*).
3. Lopration ACP , analyse en Composantes Principales, avec variables qualitatives
complmentaires, est un traitement statistique que lon ralise pour avoir la structure de donnes
statistiques travers les corrlations entre les variables et lidentification des axes factoriels. Cette
opration permet galement une premire apprciation de la contribution des diffrentes variables
la distribution spatiale des deux formes molculaires dAn. gambiae s.s.
4. Lopration ANCOVA (analyse de covariance) est utilise dans le cas o lACP rvle que les
variables qualitatives peuvent amliorer la qualit de la modlisation. Si lANCOVA est concluante,
il en rsulte plusieurs fonctions de la distribution selon les modalits des variables qualitatives.

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

106

Chapitre IV : Organisation et structuration de base de donnes


________________________________________________________________________________________________________________

Lvaluation de la contribution des variables qualitatives est faite avec des tests statistiques.
5. Lopration rgression suppose que lANCOVA montre une faible contribution des variables
qualitatives. Dans ce cas, toutes ces variables qualitatives sont limines. A cela suit le calcul de
diffrents coefficients et certains tests statistiques : tests de Fisher, coefficient de dtermination,
analyse de rsidus, composition dune fonction de rgression etc. Par ces actions, lanalyse de rsidus
permet une valuation de la qualit du modle. La fonction de rgression est inverse au niveau
spatial pour produire une carte de distribution. Une comparaison est ensuite ralise entre des
donnes issues du modle et des observations empiriques. Elle permet de juger de la qualit du
modle et confirmer lvaluation par lanalyse des rsidus.

IV.3 TRAITEMENT DES VARIABLES ECO-GEOGRAPHIQUES


Dans le processus traitement , le traitement des donnes co-gographiques est pris en charge
travers les activits dinterpolation, destimation et de classification. Le traitement de variables cogographiques prsente quelques spcificits relatives surtout lexhaustivit spatiale de
linformation qui est indispensable la modlisation. Elles subissent des traitements spcifiques dont
les rsultats sont rintgrs la base de donnes comme entit. Cest pourquoi, cette section leur a
t spcialement ddie.
Ltude des relations entre la distribution d'An. gambiae s.s. et les facteurs de lenvironnement
requiert que lon dispose des informations sur chaque partie de la relation comme le montre le
processus

de

modlisation

du

MCT.

Les

donnes

co-gographiques constituent les facteurs externes de la rpartition spatiale des espces. En fonction
de leur nature et de leur impact sur la bio-cologie des membres du complexe An. gambiae, elles ont
t regroupes en trois types : les facteurs gographiques, les facteurs biotiques et les facteurs
climatiques. Les donnes collectes ne sont pas homognes par groupe de facteurs et ne prsentent
pas non plus le mme niveau de conformit par rapport au besoin de ltude (terrain nominal). Aussi,
les donnes co-gographiques ont-elles t reparties en trois catgories en fonction des traitements
effectus.

IV.3.1 INTERPOLATION DES DONNEES


Elle concerne : les prcipitations, les tempratures, les vents, linsolation, lETP, la pression, les
altitudes.

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

107

Chapitre IV : Organisation et structuration de base de donnes


________________________________________________________________________________________________________________

IV.3.1.1

Les prcipitations : des donnes sources aux donnes


interpoles

Les donnes de prcipitation proviennent de deux sources : la base de donnes LoClim de la FAO et
la base de donnes de la Direction Gnrale de la Mtorologie du Burkina. Les donnes utilises
couvrent la priode de 1975-2005 et concernent 157 stations dont 140 lintrieur du Burkina Faso
et 17 dans les pays voisins (Niger, Mali, Togo, Bnin, Cte dIvoire, Ghana). Les valeurs archives
sur ces stations qui ont t utilises sont les prcipitations annuelles. Les stations sont implantes en
point et sont repres par des coordonnes angulaires sexagsimales (degr, minute, seconde) en
longitude / latitude.
Les traitements effectus sur les donnes de prcipitation sont :
-

la spatialisation et le changement de systme de projection avec transformation des


coordonnes dorigine en coordonnes rectangulaires dans le systme de projection de
rfrence du Burkina dfini en mthodologie (UTM, ellipsode de Clarke 1880, Zone 30
tendue 31) ;

le calcul de la pluviosit de chaque station ;

linterpolation par la mthode du Krigeage simple avec une fonction dajustement


trtrasphrique aprs analyse de la drivabilit de la variable rgionalise et une analyse de
lerreur (Figure 19 et Figure 20).

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

108

Chapitre IV : Organisation et structuration de base de donnes


________________________________________________________________________________________________________________

Variogramme
Pas de saut lorigine, pas deffet de ppite,
Fonction dajustement : Tretraspherical

Mean: 0,2571
Root-Mean-Square: 62,78
Average Standard Error: 65,59
Mean Standardized:
0,00937
Root-Mean-Square Standardized: 1,306
Samples: 157 of 157
Rgression fonction : 0,969 * x + 23,273

Figure 19 : Variogramme et fonction de rgression pour linterpolation des prcipitations

Figure 20 : Rpartition des prcipitations au Burkina Faso

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

109

Chapitre IV : Organisation et structuration de base de donnes


________________________________________________________________________________________________________________

IV.3.1.2

Les tempratures : des donnes sources aux donnes


interpoles

Les donnes de temprature proviennent de la base de donnes LocClim de la FAO et la base de


donnes de la Direction de la Mtorologie Nationale. Elles couvrent la priode de 1975 2005. Le
rseau dobservation utilis compte 68 points dobservation. Les donnes enregistres sont les
tempratures moyennes minimales mensuelles et les tempratures moyennes maximales mensuelles.
Sur les 68 points dobservation, 31 sont situs sur le territoire burkinab, soit moins de 50% des
stations dobservations. Le reste se trouve dans les pays voisins limitrophes. Ces stations sont toutes
repres en coordonnes gographiques (latitude / longitude), en degrs sexagsimaux.
Les traitements effectus sur les donnes de tempratures sont :
-

la spatialisation et le changement de systme de projection avec transformation des


coordonnes dorigine en coordonnes rectangulaires dans le systme de projection de
rfrence du Burkina dfini en mthodologie (UTM, ellipsode de Clarke 1880, Zone 30
tendue 31) ;

le calcul de la temprature moyenne annuelle de chaque station ;

linterpolation par la mthode IDW aprs analyse de la drivabilit de la variable rgionalise


et une analyse de lerreur (Figure 21 et Figure 22).

Prdiction avec IDW


Fonction de Rgression : 0,500 * x + 13,893
Erreur de prdiction
Moyenne : -0,03116
RMS: 0,5883
Echantillon : 68 of 68

Figure 21 : Fonction de rgression de linterpolation des tempratures moyennes annuelles

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

110

Chapitre IV : Organisation et structuration de base de donnes


________________________________________________________________________________________________________________

Figure 22 : Rpartition des tempratures moyennes annuelles au Burkina Faso

IV.3.1.3

LEvapotranspiration potentielle : des donnes sources


aux donnes interpoles

Les donnes de lvapotranspiration potentielle proviennent de la base de donnes de la Direction


Gnrale de la Mtorologie Nationale du Burkina et la base de donnes Loclim de la FAO. Elles
couvrent la priode allant de 1975 2005. Les observations ont t effectues sur 38 stations dont 7
lintrieur du Burkina Faso. Les points dobservations sont positionns en coordonnes
gographiques en longitude/latitude et exprims en units sexagsimales.
Les traitements ont consist :
-

en la spatialisation et le changement de systme de projection avec transformation des


coordonnes dorigine en coordonnes rectangulaires dans le systme de projection de
rfrence du Burkina dfini en mthodologie (UTM, ellipsode de Clarke 1880, Zone 30
tendue 31) ;

au calcul de l'ETP moyenne annuelle de chaque station ;

En linterpolation par la mthode du krigeage ordinaire aprs analyse de la drivabilit de


la variable rgionalise et une analyse de lerreur (

Figure 23 et Figure 24).

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

111

Chapitre IV : Organisation et structuration de base de donnes


________________________________________________________________________________________________________________

Semi-variogramme
Mean: 0,5494 ;Root-Mean-Square: 16,66 ;Average Standard Error:
- Pas de saut lorigine, pas de deffet d Mean Standardized: 0,01635 ; Root-Mean-Square Standardized: 0,6671
ppite,
Samples: 38 of 38
- Fonction dajustement : exponentielle

27,6

Figure 23 : Variogramme et droite de rgression de linterpolation de lvapotranspiration potentielle moyenne


annuelle

Figure 24 : Rpartition de lvapotranspiration potentielle annuelle au Burkina Faso

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

112

Chapitre IV : Organisation et structuration de base de donnes


________________________________________________________________________________________________________________

IV.3.1.4

La pression de vapeur : des donnes sources aux


donnes interpoles

Les donnes de pression de vapeur proviennent de la base de donnes LocClim de la FAO. Elles
couvrent galement la priode allant de 1975 2005. Pour notre zone, 40 points dobservations dont
7 lintrieur du site sont disponibles. Le gorfrencement de ces points est fait en coordonnes
gographiques avec les units en degrs sexagsimaux.
Les traitements effectus sur ces donnes sont :
-

la transformation du systme de coordonnes et leur inscription dans le rfrentiel technique


retenu ;

le calcul des valeurs moyennes annuelles des pressions sur lensemble des sites
dobservation ;

linterpolation par la mthode Global polynomial Interpolation . Cette mthode a eu les


meilleurs taux derreur et le meilleur ajustement (Figure 25 et Figure 26).

Mthode : Global polynomial Interpolation


Mean:
0,002028 ; Root-Mean-Square:

0,7497; Fonction de rgression : 0,989 * x + 0,206 ; Samples: 40 of 40

Figure 25 : Droite de rgression des pressions de vapeur moyennes annelles au Burkina Faso

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

113

Chapitre IV : Organisation et structuration de base de donnes


________________________________________________________________________________________________________________

Figure 26 : Rpartition des pressions de vapeurs moyennes annuelles au Burkina Faso

IV.3.1.5

Linsolation : des donnes sources aux donnes


interpoles

Les donnes dinsolation proviennent de la base de donnes LoClim de la FAO. Les donnes
dobservation couvrent 41 stations, dont 7 sont situes sur le territoire burkinab. Ces stations sont
repres par des coordonnes gographiques en degrs sexagsimaux. Les relevs couvrent la
priode 1975-2005 et sont en moyennes mensuelles. Les traitements subis par ces donnes
concernent la fois ladaptation au rfrentiel technique gographique et au niveau dchelle
temporelle. Aprs la spatialisation, une re-projection des donnes en UTM Clarke 1880, Zone 30
tendue 31 est applique. Au niveau temporel, linsolation moyenne annuelle par station a t
calcule. Pour la question de couverture et dexhaustivit, une interpolation avec la mthode Global
Polynomial Interpolation a t adopte (Figure 27, Figure 28).

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

114

Chapitre IV : Organisation et structuration de base de donnes


________________________________________________________________________________________________________________

Mthode : Global polynomial Interpolation ; Mean:


0,00113 ; Root-Mean-Square: 0,06316
Fonction de rgression : 0,647 * x + 0,229 ; Samples: 41 of 41

Figure 27 : Droite de rgression de linsolation

Figure 28 : Rpartition de linsolation moyenne annuelle au Burkina Faso

IV.3.1.6

La vitesse du vent : des donnes sources aux donnes


interpoles

Les donnes relatives la vitesse du vent ont t extraites de la base de donnes LocClim de la FAO.
39 stations dobservation ont t mises contribution dont 7 au Burkina Faso. Le gorfrencement
de ces stations est fait avec des coordonnes gographiques en units sexagsimales. Les donnes
enregistres sont des vitesses moyennes mensuelles. Les traitements appliqus aux donnes extraites
sont :

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

115

Chapitre IV : Organisation et structuration de base de donnes


________________________________________________________________________________________________________________

la transformation du systme de coordonnes des stations et leurs inscriptions dans le


systme de rfrence retenu pour ltude ;

ladaptation au niveau dchelle temporelle retenue (qui est lanne) par le calcul des vitesses
moyennes annuelles par station ;

lapplication de la mthode dinterpolation Radial Basis Fonctions pour rsoudre le problme


de lexhaustivit et dtendue spatiale (Figure 29, Figure 30).

Mthode : Radial Basis Fonctions


Mean:0,002819 ; Root-Mean-Square : 0,5981 ; Fonction de rgression : 0,371 * x + 1,030 ; Samples: 39 of 39

Figure 29 : Droite de rgression de la vitesse des vents

Figure 30 : Rpartition des vitesses moyennes annuelles des vents au Burkina Faso

IV.3.1.7

Laltitude:

des

donnes

sources

aux

donnes

interpoles
Les donnes dentre des altitudes proviennent de la Banque Nationale de Donnes Topographiques
(BNDT) du Burkina Faso. Elles sont constitues de lensemble des points cts de la carte
topographique au 1/200 000. 5 381 points cots ont t utiliss et tous se situent sur le territoire
__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

116

Chapitre IV : Organisation et structuration de base de donnes


________________________________________________________________________________________________________________

burkinab (Figure 31 et Figure 32 ). En dehors de linterpolation avec la mthode Global Polynomial


Interpolation, aucun traitement na t effectu.
Mthode : Global polynomial Interpolation ; Mean: 1,936 ; Root-Mean-Square: 39,82 ;
Fonction de regression : 0,606 * x + 121,359
Samples: 5381 of 5381

Figure 31 : Droite de rgression des altitudes

Figure 32 : Rpartition des altitudes au Burkina Faso

IV.3.2 ESTIMATION DES DONNEES


Linterpolation sadapte mal aux ensembles finis, comme par exemple les cas de dnombrement de
population. Pour ces cas, des mthodes destimation particulires ont t adoptes. Elles sont mieux
__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

117

Chapitre IV : Organisation et structuration de base de donnes


________________________________________________________________________________________________________________

adaptes ce type de donnes et permettent davoir une meilleure prcision. Lestimation concerne
trois donnes co-gographiques : les populations, lhydrographie et les localits. Pour les
populations, ce sont les densits qui sont recherches. Pour lhydrographie et les localits, les
distances en tous points du site par rapport ces objets gographiques sont requises.
IV.3.2.1 Population : des effectifs de population aux densits en tout
point
Les donnes de population proviennent du recensement gnral de la population et de lhabitat de
1996. Ce sont des donnes sur les effectifs des populations humaines par villages. Elles ne sont pas
gorfrences et ne couvrent que les villages administratifs du Burkina en 1996. Pour le
gorfrencement de ces donnes de recensement, une jointure avec les localits de la base de
donnes topographiques a t effectue. Au total, 7 733 villages ont t identifis et joints aux
localits de la base de donnes topographiques. Les statistiques attaches ces points datent de
1996. Elles ont t rvalues en appliquant le taux daccroissement naturel du pays qui est de 3,3%
pour la priode 1985 1996. Pour rpondre la question dexhaustivit et dtendue, une
estimation des Densits lisses par dsagrgation des effectifs de population affects aux diffrents
points reprsentant les villages a t applique. Les statistiques sur les distances entre deux villages
sont les suivantes :
-

distance minimum56 entre deux localits voisines : 427 m soit environ 0,5 km ;

distance moyenne entre deux localits voisines : 4 148 m soit environ 4,1 km ;

distance maximum entre deux localits voisines : 22 471 m soit environ 22,5 km.

Le diamtre moyen des localits est donc de 8 396 m soit 8,5 km. Cest cette distance qui est
retenue comme estimateur de la zone de rpartition des effectifs autour de chaque point. La Figure 33
donne le rsultat de ces traitements.

56

Les distances considres sont les distances euclidiennes.

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

118

Chapitre IV : Organisation et structuration de base de donnes


________________________________________________________________________________________________________________

Figure 33 : Rpartition des densits de population au Burkina Faso en 2005

IV.3.2.2 Des NDVI la densit de la vgtation


La quantification de la vgtation sest appuye sur les indices dcadaires normaliss de la
vgtation de SPOT Vgtation. Les images NDVI de lAfrique pour la priode allant du 1er juillet
2005 au 31 octobre 2005 correspondant la priode de capture ont t retenues. Au total, 12
images NDVI ont t collectes sur lAfrique. Habituellement, les NDVI ont des valeurs comprises
entre -1 et 1. Les images NDVI exploites fournies par SPOT Vgtation sont recodes sur 8 bits.
Ce recodage est effectu en multipliant la valeur du NDVI par 127 et ajoutant 127 au rsultat
((NDVI x 127) + 127). Ce recodage conduit des valeurs sur les pixels allant de 0 255.
Les traitements appliqus aux donnes NDVI concernent leur gorfrencement en coordonnes
gographiques, la cration dune image arithmtique par calcul du NDVI moyen, le dcoupage de
la zone dtude et enfin la transformation du systme de coordonnes dans le rfrentiel technique
retenu (Figure 34).

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

119

Chapitre IV : Organisation et structuration de base de donnes


________________________________________________________________________________________________________________

Figure 34 : Rpartition des densits vgtales au Burkina Faso

IV.3.2.3 Les localits et lhydrographie : la distance en tout point par


rapport ces objets gographiques
Les donnes sur lhydrographie et les localits proviennent de la Banque Nationale de Donnes
Topographiques (BNDT). Aucun autre traitement na t effectu sur ces couches en dehors du
calcul des distances en touts points du Burkina Faso. Les Figure 35 et Figure 36 ci-aprs prsentent les
rsultats de ces traitements pour lhydrographie et pour les localits.

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

120

Chapitre IV : Organisation et structuration de base de donnes


________________________________________________________________________________________________________________

Figure 35 : Rpartition des distances en tout point par rapport lhydrographie

Figure 36 : Rpartition des distances par rapport aux localits

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

121

Chapitre IV : Organisation et structuration de base de donnes


________________________________________________________________________________________________________________

IV.3.3

LES DONNEES CLASSIFIEES

Les donnes classifies concernent les donnes qualitatives. Ce sont les donnes relatives aux sols,
la vgtation et loccupation des terres. Elles proviennent respectivement de la carte de
reconnaissance pdologique du Burkina, de la carte de vgtation du Burkina et de la Base de
Donnes sur lOccupation des Terres (BDOT) du Burkina. La nomenclature utilise dans le cadre
de ces bases de donnes est trs dtaille. Ces donnes sont de production trs coteuse et il ny a
pas une srie. Elles nont par consquent subies que deux types de traitement : le changement de
projection et la classification. Ce dernier traitement a consist en la rduction du nombre de
modalits.

CONCLUSION AU CHAPITRE IV
La base de donnes utilise a un modle conceptuel de donnes assez simple qui comprend quatre
entits et trois processus. Elle stocke cependant une grande quantit dinformations en raison de
lentit variable qui regroupe lensemble des informations qui seront utilises dans le cadre de cette
tude. Lentit variable et le processus de traitement des donnes entomologiques engendrent 13
couches dinformation gographique supplmentaires et autant en donnes tabulaires non
gographiques.
A partir de ce riche jeu de donnes, rien de plus normal que dentreprendre lanalyse de la structure
et des configurations spatiales. Il s'agira de calculer nos indicateurs et valuer nos deux premires
hypothses (Chapitre 1) qui sont la distribution non alatoire des formes molculaires M et S dAn.
gambiae au Burkina Faso et la contribution diffrentielle des facteurs environnementaux
lorganisation spatiale de ces vecteurs du paludisme. Cest lobjet du chapitre V.

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

122

Chapitre V : Distribution spatiale des membres du complexe An. gambiae : structures globales et configurations locale
________________________________________________________________________________________________________________

CHAPITRE V : DISTRIBUTION SPATIALE DES MEMBRES DU


COMPLEXE AN. GAMBIAE : STRUCTURES GLOBALES ET
CONFIGURATIONS LOCALES
Comment se distribuent, au Burkina Faso, les formes molculaires M et S dAn. gambiae s.s. ? Cette
distribution est-elle alatoire ? Sinon, peut-on mettre en exergue une direction prfrentielle ? Y a-t-il
une influence de la position des points de collecte les uns par rapport aux autres sur les frquences
observes ? Y a-t-il une influence de la distance entre les points de collecte les uns par rapport aux
autres sur les frquences observes ? Ce sont autant de questions auxquelles cette section rpond.
Lobjectif de ce chapitre est de tester les deux premires hypothses, savoir lexistence dune
structure spatiale et la contribution diffrentielle des facteurs environnementaux lorganisation
spatiale. Ce chapitre est compos de trois sections. La premire est consacre lanalyse de
lorganisation spatiale dAn. gambiaes.l., la seconde lanalyse des configurations spatiales locales
et la troisime lanalyse des corrlations entre les distributions spatiales et les facteurs
environnementaux.

V.1

LORGANISATION SPATIALE DAn. gambiae s.s.

Cette tude postule de lexistence dune structure dans la distribution spatiale des espces et de
limpact de quelques facteurs environnementaux majeurs dans cette distribution. En dautres termes,
lespace gomtrique (la proximit, distance,) ne peut pas expliquer entirement la distribution
observe. Pour le vrifier, trois statistiques spatiales comme indicateurs sont retenues. Il sagit de
statistiques descriptives (centrographique et de dispersion) et de lautocorrelation spatiale. La
statistique spatiale descriptive est destine rsumer lessentiel des observations. La seconde,
lautocorrelation spatiale vise tudier lorganisation et la structuration dAn. gambiae s.s..
Lorganisation spatiale dAn. gambiae s.s. au Burkina est aborde dabord globalement, puis chaque
forme molculaire est analyse de faon indpendante. Au pralable, une prsentation des donnes
utilises pour les analyses est ncessaire. Cette section est subdivise en quatre paragraphes : le
premier est consacr la prsentation des donnes, les trois autres la structure spatiale des deux
formes molculaires prises individuellement et An. gambiae s.l.

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

123

Chapitre V : Distribution spatiale des membres du complexe An. gambiae : structures globales et configurations locale
________________________________________________________________________________________________________________

V.1.1

LES

STATISTIQUES

GENERALES

SUR

LES

DONNEES

ENTOMOLOGIQUES COLLECTEES.
La collecte de donnes a t effectue de juillet octobre 2005 dans trois cents localits du Burkina
Faso. Au total, 5 496 moustiques capturs ont t identifis par la PCR Fanello et al, (2002). Une
moyenne de 18,32 individus a t identifie par localit avec un cart type de 6,01. Le maximum de
capture identifi est de 39 et a t ralis Pimpindiang au nord du Burkina. Le minimum a t
ralis Mati et Tlkaya, galement dans le nord Burkina.
Ces indicateurs globaux se dcomposent au plan spcifique conformment la Figure 37 ci-dessous.

Rpartition des captures d'An gambiae s.l.

An. Arabienis
29%

An. Gambiae
Forme S
44%

An. Gambiae
Forme M
27%

Figure 37 : Rpartition des captures dAnopheles gambiaes.l. au Burkina Faso de juillet octobre 2005

Sur les 5 496 anophles capturs, 2 422 appartiennent An. gambiae forme molculaire S, soit 44%,
1 505 An. gambiae forme molculaire M, soit 27% et enfin 1 569 An. arabiensis soit 29%.
Daprs ces statistiques, An. gambiae forme molculaire S reprsente presque la moiti des captures
dans le complexe. An. arabensis et An. gambiae forme molculaire M sont en proportion presque
gale. 3 929 soit 71 % des captures appartiennent An. gambiae s.s..

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

124

Chapitre V : Distribution spatiale des membres du complexe An. gambiae : structures globales et configurations locale
________________________________________________________________________________________________________________

V.1.2

LA STRUCTURE SPATIALE DAnopheles gambiae s.l.

Au plan spatial, quelques calculs de statistiques descriptives permettent une premire caractrisation
des donnes collectes (Figure 38). Il sagit du barycentre, du centrode et de lellipse de dviation
standard. Le barycentre de la distribution des points de collecte se situe pratiquement au centre du
pays quelques kilomtres de Ouagadougou. Il se superpose presque parfaitement avec le centrode
des points de collecte, une distance infrieure 3 km et largement infrieure la distance moyenne
entre deux points dobservation qui est de 15 km. Cette quasi superposition du barycentre de
distribution et du centrode suggre une faible influence de la localisation sur les frquences.
La distance standard permet dobserver une dispersion de 221,1 km autour du barycentre. Lellipse
de dviation standard, quant lui, est tire en direction nord-est/sud-ouest et sur une superficie de
119 290,49 km2. Le grand rayon a une longueur de 282,35 km contre 134,5 pour le petit, soit
pratiquement le double du second, pour un angle de rotation de 65,41. Ces statistiques indiquent une
orientation dans la distribution spatiale dAn. gambiaes.l. qui est tire dans la direction nord-est/sudouest. 175 points de collecte sur les 300 sont recouverts par lellipse de dviation standard, soit 58%
des points de collecte contre 42% qui se situent en priphrie. La dispersion des frquences des
moustiques est donc normale.

Figure 38 : Structure spatiale de distribution dAn. gambiae s.s.

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

125

Chapitre V : Distribution spatiale des membres du complexe An. gambiae : structures globales et configurations locale
________________________________________________________________________________________________________________

Si la distribution semble normale au regard des indicateurs statistiques prsents, des interrogations
demeurent : quelle est le rle de lespace dans la distribution des frquences sur les lieux de
collecte ? Existe-t-il des agrgats spatiaux ? Lexistence dune orientation mise en exergue par
lellipse de dviation standard pose galement une question sur lexistence dune anisotropie. En
somme, deux proccupations restent en suspend. La premire concerne lautocorrelation spatiale et la
seconde la configuration spatiale.
Le calcul57 de lindice dautocorrelation spatiale effectu sur les 300 points de collecte et les
frquences observes sur ces points prsentent les rsultats suivants : Indice dautocorrelation
spatiale de Moran = 0,014316 ; Indice attendue = -0,003344 ; Variance = 0,000074 ; Z Score =
2,046.
Lindice de Moran est trs proche de 0. La ralisation de la variable alatoire rgionalise est donc
indpendante. Cela signifie que les frquences dAn. gambiaes.l. en un point de collecte ne sont pas
influences par les frquences observes dans les points voisins. Il nest donc pas possible de prdire
les frquences en un point, connaissant les frquences observes en un autre point, appuyant sur la
distance qui les spare.
Cette indpendance observe dans la ralisation peut tre le fruit du hasard et na de valeur que pour
lchantillon qui a servi au calcul. Il est donc ncessaire de faire un test pour vrifier la validit de
cette indpendance spatiale pour la variable spatiale dans sa totalit. Ce test statistique
dindpendance de la variable rgionalise donne un Z score gale 2,05 au seuil de confiance de
95%. Il se situe en dehors de lintervalle de confiance [-1,96 ; 1,96]. Il est difficile den dduire
labsence totale dautocorrelation spatiale sur lensemble de la variable. Il existe sans doute des
agrgats spatiaux exprimant lexistence locale dautocorrelation spatiale.
Le calcul des concentrations des valeurs fortes et des valeurs faibles de Getis-Ord General G prsente
les rsultats suivants : Gnral G Observ = 0,000007 ; Gnral G attendus = 0,000007 ; Variance de
Gnral G = 0,000000 ; Z Score = -1,35. Ces indicateurs statistiques montrent que les agrgats
observs sont le fait du hasard ; lhypothse nulle de concentration des faibles et fortes valeurs
alatoires tant accepte au seuil de 95%.

57

Le type de distance utilis dans le calcul de lindice dautocorrelation spatiale de Moran est la distance euclidienne.
La conception des relations spatiales entre les frquences dAn. gambiae l.s. dnombr sur les diffrents points de
collecte, sappuie sur la distance inverse.

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

126

Chapitre V : Distribution spatiale des membres du complexe An. gambiae : structures globales et configurations locale
________________________________________________________________________________________________________________

Lindice de Getis-Ord General G montre quil y a indpendance spatiale dans la distribution dAn.
gambiae s.l., cest--dire que les frquences observes en un point ne sont pas influences par la
valeur des frquences observes dans les points voisins. Lorientation spatiale mise en exergue par
lellipse de dviation standard ne trouve pas dexplication dans les relations de voisinage. Il est donc
important de recourir dautres facteurs qui expliquent cette orientation observe. De plus,
linfirmation statistique de la dpendance spatiale de la variable alatoire rgionalise observe avec
lindice de Moran, impose de pousser lanalyse en vrifiant les relations entre les frquences
observes et lenvironnement.
Mais avant, il faut se demander si ces conclusions au niveau An. gambiaes.l. sont exactement les
mmes lorsquon sintresse lune ou lautre forme molculaire du complexe An. gambiae :
An. gambiae forme molculaire S et An. gambiae forme molculaire M.

V.1.3

LA

STRUCTURE

SPATIALE

DAnopheles

gambiae

FORME

MOLECULAIRE S
Au plan de la statistique spatiale descriptive, le barycentre de la distribution spatiale dAn. gambiae
forme molculaire S se situe compltement au sud du pays une distance denviron 125 km au sudouest du centrode. Les frquences dAn. gambiae de forme molculaire S ont donc fortement
influenc la position du barycentre. Ce dcalage met galement en exergue une tendance la
concentration dAn. gambiae de forme molculaire S dans la partie sud du site dobservation. La
distance standard est de 236,04 km. Lellipse directionnelle a un rayon de 96,45 km observable en
abscisse, un rayon en ordonne de 319,57 km et un angle de rotation 75,41. Lellipse de dviation
standard couvre une superficie de 96813,72 km2 et recouvre 155/300 points dobservation, soit
51,66% de la distribution. Cette rpartition des points dobservation par rapport lellipse de
dviation standard montre une distribution assez normale (Figure 39).
Lindice dautocorrlation spatiale de Moran utilis pour mesurer le niveau de dpendance spatiale
donne les rsultats suivants : Indice de Moran = 0,28 ; Expected Index = -0,0033 ; Variance =
0,000075 ; Z score = 32,73.
La valeur de lindice de Moran est trs proche de 0. Il ny a donc pas autocorrlation spatiale dans la
distribution observe.
Cependant, le test statistique devant valider cette indpendance spatiale pour lensemble de la
variable alatoire rgionalise donne un Z score de 32,72 qui relativise linterprtation de lindice

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

127

Chapitre V : Distribution spatiale des membres du complexe An. gambiae : structures globales et configurations locale
________________________________________________________________________________________________________________

dautocorrlation de Moran. Ce Z score indique, en effet, lexistence de noyau dautocorrlation


spatiale avec un seuil de confiance de 99%.
Le calcul de lindice de concentration des valeurs fortes et des valeurs faibles de Getis-Ord General
G confirme les statistiques de Moran et donne les valeurs suivantes : Observed General G =
0,000008 ; Expected General G = 0,000007 ; General G Variance = 0,000000 ZScore = 3,87. Il y a
sans doute existence dune autocorrlation spatiale mais elle est locale.

Figure 39: Structure spatiale de distribution dAnopheles gambiae forme molculaire S

En somme, dAn. gambiae forme molculaire S a tendance se concentrer au sud du Burkina Faso,
dans les rgions des Cascades, du Sud-Ouest et des Hauts Bassins. Cette zone correspond la partie
o les prcipitations sont les plus abondantes, les tempratures basses, la vgtation la plus dense.
Cest la partie la plus humide du pays. Nous pensons donc une prfrence par rapport lhumidit.
La distribution des frquences se dgrade fortement du sud-ouest vers le nord-est. Nous percevons
une similitude entre le front de dgradation des frquences et celui de lhumidit (Figure 8, Chapitre
2).

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

128

Chapitre V : Distribution spatiale des membres du complexe An. gambiae : structures globales et configurations locale
________________________________________________________________________________________________________________

Les frquences observes en un point ne sont pas dpendantes des points leur voisinage. Il nest pas
convenable de driver les frquences en tous points sur la base de la position de points connus.
Toutefois, la concentration au sud cre des agrgats, des zones dans lesquelles les frquences peuvent
avoir des similarits. Le sud-ouest et louest du Burkina Faso prsentent sans doute des conditions
cologiques plus favorables An. gambiae forme molculaire S. Quen est-il pour la forme
molculaire M dAn. gambiae ?
V.1.4

LA

STRUCTURE

SPATIALE

DAnopheles

gambiae

FORME

MOLECULAIRE M
La distribution spatiale dAn. gambiae forme molculaire M (Figure 40) se caractrise par les
statistiques suivantes : un barycentre dcal par rapport au centrode de 112 km au nord-est, pour une
distance standard de 176,7 km. Il y a donc tendance une concentration dans la partie nord du site.
Lellipse de direction a un rayon en abscisse de longueur gale 122 km, un rayon de 218 km en
ordonne et un angle de rotation de 56,84. Lellipse couvre 138 points dobservation sur 300 soit
44% des frquences sur une superficie de 83695,12 km2. Nous en dduisons lexistence dune
direction dans la distribution des frquences dAn. gambiae forme molculaire M. Cette orientation
dans la direction permet de souponner une dpendance spatiale dans la distribution des frquences
dAn. gambiae forme molculaire M, do la ncessit de tester lautocorrelation spatiale.

Figure 40 : Structure spatiale de distribution dAn. gambiae forme molculaire M

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

129

Chapitre V : Distribution spatiale des membres du complexe An. gambiae : structures globales et configurations locale
________________________________________________________________________________________________________________

Lvaluation de lindice dautocorrelation de Moran donne les rsultats suivants : Indice de Moran =
0,18 ; Indice attendu = -0,0033 ; Variance = 0,000074 ; Z Score = 22,08. Lindice dautocorrelation
de Moran tant proche de 0, il y a indpendance spatiale pour cette ralisation de la variable alatoire
rgionalise. Le Z score indique lexistence de corrlation spatiale localise travers des agrgats
spatiaux. Lexistence de ces agrgats spatiaux est acceptable au seuil de confiance de 99%. Lindice
de concentration des valeurs fortes et des valeurs faibles de Getis-Ord General G, avec les rsultats
suivants, renforce linterprtation du Z score de lindice de Moran : Gnral G Observ = 0,000009 ;
Gnral G attendu = 0,000007 ; Variance du Gnral G = 0,000000 ; Z Score = 6,71. Daprs ces
statistiques, il y a indpendance spatiale sur les observations effectues. Il existe toutefois des
agrgats spatiaux lintrieur desquels peut sexprimer une autocorrelation spatiale.
En somme, An. gambiae forme molculaire M a tendance se concentrer au nord du Burkina. Ses
frquences diminuent du nord-est vers le sud-ouest. Cette partie du Burkina correspond celle o les
prcipitations sont les plus faibles, les tempratures les plus leves, la vgtation la moins
luxuriante. Cest le domaine des steppes. Cest la partie la plus aride du pays. Nous pensons donc
une prfrence par rapport laridit. Il y a une similitude entre le front daggradation des frquences
et celui de laridit.
Malgr cette orientation, il ny a pas dautocorrlation spatiale mme sil existe des agrgats
spatiaux. Puisquil y a indpendance spatiale double dune forte concentration des frquences au
nord-est, le nord du pays semble avoir de meilleures conditions cologiques dAn. gambiae forme
molculaire M que le sud.
Nous retenons de lanalyse des structures spatiales une tendance lallopatrie entre les deux formes
molculaires M et S. La forme S prsente de fortes concentrations au sud-ouest et louest du pays,
dans les rgions des Cascades, du Sud-Ouest et des Hauts Bassins. La forme molculaire M, quant
elle, est plus dominante au nord et au nord-est, dans les rgions du Sahel, du Nord et du Centre-Nord.
Ce rsultat doccupation diffrentielle de lespace est en conformit avec celui de Costantini et al.,
(2009)58 qui a t ralis au Burkina Faso dont nous sommes coauteurs. Il est aussi en phase avec
celui de Torre et al., (2005) bas sur des observation au Ghana et au Burkina Faso, daprs lequel M
and S have different geographical and micro-geographical distributions. The differentiated microgeographical distribution in dry savannah regions of west Africa may be associated with a diverse
ability of the two forms to exploit man-made breeding sites. Pour Onyabe et al. (2003), parlant de la
distribution spatiale des formes molculaire M et S An. gambiae au Nigeria, both molecular forms

58

Voir lintgralit tre trouv http://www.biomedcentral.com/1472-6785/9/16

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

130

Chapitre V : Distribution spatiale des membres du complexe An. gambiae : structures globales et configurations locale
________________________________________________________________________________________________________________

occurred throughout the country, with no apparent relationship to the ecological transition from dry
savannah in the north to humid forest in southern Nigeria. In all localities, however, 1 form or the
other occurred virtually exclusively. Cette forte prdominance dune forme molculaire sur lautre
voque galement des zones doccupation prfrentielle.
Lanalyse de la structure spatiale a galement montr labsence dautocorrelation spatiale. Toutefois,
elle laisse entrevoir, malgr lindpendance spatiale globale, la prsence dagrgats spatiaux,
tmoignant de lexistence, au niveau local, dautocorrlation spatiale. En dautres termes, cette
analyse suggre lexistence de lieux o les frquences observes semblent trs proches. Il convient
donc didentifier ces agrgats et rechercher les facteurs de ces concentrations de valeurs similaires en
certains points.

V.2

LANALYSE DES CONFIGURATIONS SPATIALES LOCALES

O se situent les sous ensembles spatiaux ? Rpondre cette question est lobjectif de cette seconde
section. Elle sinscrit dans la continuit de la prcdente pour identifier les agrgats spatiaux. Les
indices locaux dassociation spatiale dAnselin Local Moran et Getis-Ord Gi* sont retenus comme
mthodes didentification des agrgats spatiaux. Lindice dAnselin Moran permet de quantifier le
niveau de similarit/dissimilarit entre points voisins et met en exergue les zones valeurs
homognes ou htrognes. Le Gi* de Getis-Ord quant lui permet de faire lanalyse des
concentrations (hot pot). Cette section est compose en 6 paragraphes. Chaque forme molculaire est
analyse avec lindice local dAnselin Moran et du point de vue de lindice Gi* de Getis-ord aprs
une tude globale de An. gambiaes.l..

V.2.1 ANALYSE

DES

CONFIGURATIONS

SPATIALES

LOCALES

DAnopheles gambiaes.l.
Le calcul de lindice Local dAnselin et Moran est effectu sur les frquences de An. gambiaes.l. en
vue didentifier les zones de similarit. Les statistiques sur les valeurs de Z score de lindice local
dAnselin et Moran pour An. gambiaes.l. sur les points dobservation se prsentent de la faon
suivante : effectif total : 300 ; minimum : -9,08 ; maximum : 5,95; total : 62,21 ; moyenne : 0,2 ;
dviation standard : 1,62.
La classification de ces valeurs en seuil naturel de Jenks en trois classes et leur spatialisation permet
dobtenir la Figure 41.

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

131

Chapitre V : Distribution spatiale des membres du complexe An. gambiae : structures globales et configurations locale
________________________________________________________________________________________________________________

Figure 41 : configuration spatiale dAnopheles gambiaes.l.

Les valeurs fortes du Z score reprsentent les plus fortes similarits des frquences. Il y a quatre
zones de concentration de valeurs fortes. Ces zones de concentration sont disperses sur lensemble
du territoire burkinab. La plupart des points ont des valeurs de Z score moyennes et occupent
lessentiel du pays. Il y a donc un cart entre le zonage et le gradient nord-est/sud-ouest rvl par
lellipse de dviation standard au niveau de lanalyse globale. Ce mme cart sobserve entre le
gradient nord-est/sud-ouest mis en exergue dans lanalyse du milieu physique. Le facteur dterminant
des concentrations doit alors tre fortement localis et li des conditions trs particulires. Cette
conclusion nest pas forcment valable pour les formes molculaires M et S dAn. gambiae s.s.,
prises individuellement.
V.2.2 ANALYSE

DES

CONFIGURATIONS

SPATIALES

LOCALES

DAnopheles gambiae FORME MOLECULAIRE S

Les valeurs de Z scores de lindice local dAnselin et Moran pour An. gambiae forme molculaire S
pris sur les points dobservation, se caractrisent par un effectif total de 300 individus, un Z score
minimum de -4,34 et un Z score maximum de 20,76 pour une moyenne de 3,52, un cart type de 4,08
__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

132

Chapitre V : Distribution spatiale des membres du complexe An. gambiae : structures globales et configurations locale
________________________________________________________________________________________________________________

et un cumul total de 1058,25. La classification des 300 points dobservation en fonction des Z scores
en 3 classes au seuil naturel de Jenks rvle des zones de forte ressemblance (Figure 42).

Figure 42 : configuration spatiale dAnopheles gambiae de forme molculaire S

Les Z score qui ont les valeurs les plus leves (Z score compris entre 7,75 et 20,77) constituent un
agrgat dans lextrme sud-ouest du pays avec quelques points isols dans la partie nord. Il y a donc
une forte similarit entre les valeurs du Z score dans la partie sud-ouest de la zone dtude. Ces
points isols Z score levs sont noys dans des Z scores moyens, (Z score compris entre 2,13 et
7,75) dominant dans la partie nord du Burkina. Dans cette partie du pays, la similarit des valeurs est
moyenne. Les Z scores les plus faibles abondent dans le sud, le centre et lest du pays. Ces parties
constituent donc une zone trs htrogne. Les valeurs entre les points proches y sont trs diffrentes.
Cette configuration indique que le sud-ouest prsente des conditions assez homognes par rapport
aux exigences dAn. gambiae de forme molculaire S. Dans la moiti nord du Burkina, il y a une
variabilit relativement plus leve par rapport au sud-ouest. Dans cette zone, les conditions
cologiques sont moins homognes par rapport aux exigences dAn. gambiae forme molculaire S.
Dans le centre, les frquences sont trs diffrentes entre deux points proches. La configuration de la
distribution spatiale dAn. gambiae forme molculaire S est donc plus visible par rapport celle du
complexe An. gambiae.
__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

133

Chapitre V : Distribution spatiale des membres du complexe An. gambiae : structures globales et configurations locale
________________________________________________________________________________________________________________

An. gambiae de forme molculaire M a-t-il lui aussi des agrgats trs distincts ?
V.2.3 ANALYSE

DES

CONFIGURATIONS

SPATIALES

LOCALES

DAnopheles gambiae FORME MOLECULAIRE M


A quelques variantes prs, la configuration spatiale dAn. gambiae forme molculaire M est
loppose de celle dAn. gambiae forme molculaire S (Figure 43).

Figure 43 : configuration spatiale dAnopheles gambiae forme molculaire M

Le nombre dindividus ayant fait lobjet de lvaluation du Z score est de 300. Les valeurs prises par
le Z score sur ces 300 points varient de -4,13 (le minimum) 31,11 (le maximum) pour une moyenne
de 2,5 et un cart type de 5,46. Le cumul de Z score sur lensemble des 300 points est de 752,28. La
classification en trois classes en seuil naturel de Jenks dgage trois grandes zones de concentrations
des valeurs faibles et fortes. Dans le nord, les Z scores sont les plus levs. Ce qui indique une zone
homogne. Lextrme sud-ouest du pays prsente les valeurs moyennes de Z score. Lhomognit
des valeurs des Z scores est moins forte que dans le nord. Le centre, le sud et lest sont trs
htrognes. Les Z scores y sont les plus faibles.
__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

134

Chapitre V : Distribution spatiale des membres du complexe An. gambiae : structures globales et configurations locale
________________________________________________________________________________________________________________

Les agrgats dAn. gambiae forme molculaire M sont galement plus marqus que ceux dAn.
gambiaes.l. La position spatiale des agrgats est linverse dAn. gambiae forme molculaire S.
Lopposition des configurations spatiales dAn. gambiae forme molculaire S et An. gambiae forme
molculaire M permet de comprendre labsence dagrgats marqus pour lensemble du complexe.
Lexpression localise dagrgats doit provenir de linfluence trs peu marque dAnopheles
arabiensis, un autre membre du complexe.
Il convient cependant danalyser de plus prs les agrgats. Cest ce que vise lutilisation de lindice
de GI* de Getis-Ord. Avec cet indice, nous analysons le niveau dhomognit des agrgats travers
les similarits qui existent entre deux points voisins dobservs.

V.2.4 CONFIGURATIONS SPATIALES SELON LINDICE GI* DE GETISORD POUR Anopheles gambiaes.l.
Le Z score de GI* de Getis-Ord prsente les statistiques suivantes pour les 300 points dobservation
pour An. gambiae sl. Le Z score de GI* minimum est de -2,87, son maximum de 3,43 pour une
moyenne de 0,0019 et un cart type de 1,001 ; le cumul de lensemble des valeurs tant de 0,57. La
classification des Z de GI* en trois classes au seuil naturel de Jenks et la spatialisation donnent la
Figure 44.

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

135

Chapitre V : Distribution spatiale des membres du complexe An. gambiae : structures globales et configurations locale
________________________________________________________________________________________________________________

Figure 44 : configuration spatiale dAnopheles gambiaes.l. selon lindice Getis et Ord

Cette carte montre un fort mlange des valeurs fortes et des valeurs faibles, de sorte quil y a une
grande mosaque de petits agrgats spatiaux. La distribution des agrgats est alatoire et conforte
linterprtation faite de lanalyse effectue avec lindice local dAnselin et Moran. Les agrgats
spatiaux ne sont pas marqus et il est difficile, compte tenu de lorganisation du milieu, denvisager
une relation entre lenvironnement dAn. gambiaes.l. ce niveau de prcision (chelle). Cette analyse
pourrait tre envisage un niveau dchelle beaucoup plus fin, comme les gtes. La diversit des
exigences spcifiques des membres du complexe An. gambiaes.l. est certainement la cause de cette
absence de structuration spatiale bien marque. La rduction de la diversit, en considrant que
chaque membre du complexe, pourrait prsenter une structure spatiale plus visible et des conditions
de mise en relation plus favorables, compte tenu de la diversit du milieu.
V.2.5 CONFIGURATIONS SPATIALES SELON LINDICE GI* DE GETISORD POUR Anopheles gambiae FORME MOLECULAIRE S
Pour An. gambiae forme molculaire S, les rsultats de lvaluation de lindice GI* de Getis-Ord
donnent les statistiques suivantes pour les 300 points dobservation : Minimum : -2,87 ; Maximum :
3,43 ; Moyenne : 0,001907 ; Ecart type : 1,001 et cumul de 0,57. La classification de Z score de GI*
__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

136

Chapitre V : Distribution spatiale des membres du complexe An. gambiae : structures globales et configurations locale
________________________________________________________________________________________________________________

en trois classes au seuil naturel de Jenks et la spatialisation des rsultats donnent la Figure 45.

Figure 45 : Configuration spatiale dAnopheles gambiae forme molculaire S selon lindice Getis et Ord

Cette carte met en exergue deux grands ensembles spatiaux avec une dmarcation presque brusque le
long de la latitude 1230. En dessous de cette latitude, se concentrent les valeurs fortes et moyennes
de Z de GI*. Cest donc une zone de forte concentration An. gambiae forme molculaire S. Audessus de 1230, les valeurs Z de GI* sont trs faibles et expriment une forte dispersion des
frquences. Deux grands ensembles bien marqus se distinguent clairement. Cette dmarcation
observe correspond grosso modo la dmarcation entre le domaine soudanien et le domaine
sahlien. De plus, les valeurs sont orientes dans le mme sens que celui de lellipse de dviation
standard et lessentiel des paramtres du milieu biophysique. Lhypothse de lexistence dune
structuration dans la distribution spatiale des frquences de la forme molculaire M est donc vrifie.
Il existe la fois une orientation dans la distribution spatiale des frquences et, mieux, une
orientation dans la distribution spatiale des agrgats. La distribution nest donc pas le fait du hasard.
Cette hypothse est-elle galement vrifie pour An. gambiae de forme molculaire M ?

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

137

Chapitre V : Distribution spatiale des membres du complexe An. gambiae : structures globales et configurations locale
________________________________________________________________________________________________________________

V.2.6 CONFIGURATIONS SPATIALES SELON LINDICE GI* DE GETISORD POUR Anopheles gambiae FORME MOLECULAIRE M
Pour An. gambiae forme molculaire M, les statistiques du Z de Getis pour les 300 points
dobservation sont les suivants : le minimum est de -1,13 ; le maximum de 3,67 ; la moyenne de 0,002 ; lcart type est de 1,002 et le cumul de -0,67. Discrtiss en trois classes au seuil naturel de
Jenks et spatialiss, nous obtenons la Figure 46.

Figure 46 : configuration spatiale dAnopheles gambiae forme molculaire M selon lindice Getis et Ord

Deux zones se dgagent lobservation. Une zone de Z de GI* moyen lev, situe au dessus de la
latitude 1230 et une zone de Z de GI* faible en dessous de la latitude 1230. Il existe dans la partie
sud, quelques points isols valeurs moyennes. Une structure est tout de mme visible : au nord, des
niveaux de Z scores relativement identiques et plus levs dans leur ensemble par rapport au sud. Il y
a une orientation nord-est/sud-ouest galement dans la disposition des agrgats. Cette orientation est
conforme celle observe avec lellipse de dviation standard effectue sur les frquences. Cette
disposition suit lorganisation du milieu physique. Elle est inverse dans lensemble par rapport
celle observe avec An. gambiae de forme molculaire S. Lexistence de quelques points de valeurs
moyennes dans la partie sud o prdominent des valeurs de Z score faible, suggre un niveau de
__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

138

Chapitre V : Distribution spatiale des membres du complexe An. gambiae : structures globales et configurations locale
________________________________________________________________________________________________________________

complexit certainement plus lev quAn. gambiae de forme molculaire S. La dtermination de la


distribution spatiale dAn. gambiae forme molculaire M devrait prsenter plus de difficults quAn.
gambiae forme molculaire S.
Nous retenons la suite de cette analyse que lhypothse dune distribution spatiale non alatoire
dAn. gambiae forme molculaire M est vrifie. En effet, lellipse de dviation standard montre une
orientation dans la distribution, et des agrgats sont mis en exergue par lanalyse des indices locaux
dassociation spatiale dAnselin et Moran et celui de Getis et Ord. Ces agrgats sont galement
orients dans la direction mise en exergue par lellipse de dviation standard.
Les donnes entomologiques collectes sont analyses trois niveaux : le niveau An. gambiae sl, le
niveau An. gambiae forme molculaire S et le niveau An. gambiae forme molculaire M. La
distribution des frquences observes dAn. gambiae sl est assez normale. Celle dAn. gambiae forme
molculaire M est centre au nord-est tandis que celle dAn. gambiae forme molculaire S est plutt
centre au sud-ouest. Toutes ces distributions sont spatialement indpendantes lchelle de collecte
des donnes. Toutefois, elles prsentent localement des dpendances spatiales. Lanalyse des
agrgats et des configurations spatiales rvle une homognit spatiale au nord pour An. gambiae
forme molculaire M et au sud pour An. gambiae forme molculaire S.
Les statistiques spatiales descriptives, en loccurrence les ellipses de dviation standard, les
barycentres et les centrodes ont permis de mettre en exergue le caractre orient et non alatoire de
la distribution spatiale des frquences du complexe et de ses membres. Lutilisation des indices
locaux dassociation spatiale, en particulier lindice dAnselin et Moran puis lindice Gi*de Getis et
Ord a mis en exergue des agrgats spatiaux orients dans la mme direction que celle des ellipses de
dviation standard pour les membres du complexe pris individuellement. Ces indices ont rvl
galement trois niveaux de structuration spatiale des frquences :
-

An. gambiae forme molculaire S est trs bien structur avec des agrgats marqus et bien
repartis dans lespace ;

An. gambiae forme molculaire M est galement bien structur mais quelques bruits sont
observables dans la zone sud ouest avec lapparition de quelques agrgats ;

pour An. gambiaes.l., les agrgats sont disperss.

Ces rsultats permettent de dire que lhypothse de distribution spatiale non alatoire des formes
molculaires S et M d'An. gambiae s.s. est vrifie. Une direction et des agrgats ont t galement

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

139

Chapitre V : Distribution spatiale des membres du complexe An. gambiae : structures globales et configurations locale
________________________________________________________________________________________________________________

identifis. Les tests dautocorrelation ont mis en vidence lindpendance spatiale et le fait que
lespace (absolu) est insuffisant pour expliquer la distribution observe.
Si la disposition des objets dans lespace nexplique pas la configuration spatiale observe du fait de
lindpendance spatiale lchelle de collecte, lexistence dagrgats spatiaux pourrait sexpliquer
par un ou plusieurs facteurs msologiques ou leur combinaison. Lanalyse des relations entre la
distribution spatiale des frquences observes et la distribution spatiale des facteurs
environnementaux pourrait donner une explication des configurations spatiales observes.

V.3

ANALYSE DES CORRELATIONS ENTRE LA DISTRIBUTION

SPATIALE

DES

VECTEURS

ET

LES

FACTEURS

ENVIRONNEMENTAUX
Lespace gomtrique, la position relative des points de collecte les uns par rapport aux autres
nayant pas t suffisantes pour expliquer la structure spatiale observe, la prise en compte des
proprits de lespace pourrait le faire. Il sagit donc de considrer plutt lespace comme
environnement, cest--dire milieu de vie. A ce titre, lespace offre des conditions cologiques qui
savrent plus ou moins contraignantes au dveloppement dune espce. Ce sont les facteurs
environnementaux. Est-ce que loffre cologique nest pas en dfinitive le dterminant de la structure
spatiale observe ? Est-ce que ces facteurs environnementaux ne sont pas finalement les dterminants
qui structurent la distribution spatiale des membres dAn. gambiae s.s. ? Cest lobjet de cette section.

V.3.1

ANALYSE DES CORRELATIONS ENTRE LA DISTRIBUTION DES


VECTEURS ET LES PARAMETRES ENVIRONNEMENTAUX

Si lespace dans sa dimension gomtrique est insuffisant pour expliquer la distribution des
frquences observes, certaines de ses caractristiques peuvent tre plus pertinentes. Il convient donc
de vrifier la relation entre les attributs de lespace en tant que milieu de vie, environnement des
formes molculaires M et S d'An. gambiae s.s., et les frquences observes. Lenvironnement se
positionne dans cette perspective comme facteur susceptible dexpliquer la distribution observe. Il
joue donc le rle de variable explicative.
Lenvironnement est la rsultante de plusieurs facteurs physiques et humains qui jouent de faon
diffrentielle sur la qualit de vie des espces. Analyser les rapports entre une espce et
lenvironnement devient peu confortable si lon se situe au niveau global, car le concept nest pas
opratoire. Le retour sur lanalyse des relations entre le complexe despces et les diffrents facteurs

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

140

Chapitre V : Distribution spatiale des membres du complexe An. gambiae : structures globales et configurations locale
________________________________________________________________________________________________________________

de lenvironnement se prsente comme une alternative pour identifier linfluence des diffrents
facteurs et valuer la qualit globale de lenvironnement par rapport au complexe despces.
Lenvironnement se dcline travers 11 paramtres. Ces derniers sont classs en deux groupes
de variables : les variables quantitatives et les variables qualitatives. Les variables quantitatives au
nombre de 9 reprsentent 84,61% des variables contre 15,39% pour les variables qualitatives. De
plus, les variables expliquer sont quantitatives. Elles ont t transformes pour tre continues par le
calcul des abondances relatives (frquences relatives). En raison de cette forte prdominance des
variables quantitatives, lanalyse en composante principale avec variables complmentaires a t
utilise.

V.3.2

CARACTERISATION DES DONNEES ET PARAMETRES DE


LANALYSE

Lanalyse en elle-mme est une analyse en composante principale (ACP norme avec une variance
en 1/n), sans axe de rotation. Le coefficient de corrlation est celui de Pearson. Le seuil de
signification est de 0,05.
Le tableau soumis lanalyse compte 13 variables quantitatives et 2 variables qualitatives
supplmentaires. Le nombre de variables associes une valeur propre non triviale est de 13.
La premire variable complmentaire, relative la pdologie, compte 6 modalits que sont : sols
hydromorphes, sols isohumiques, sols ferrugineux tropicaux, sols peu volus et les minraux bruts
ou dgrads, sols mull, vertisols.
La seconde variable complmentaire, relative loccupation des terres, compte 8 modalits : champ,
fort sche, habitat rural, savane, steppe, territoire agro-forestier, zone humide et zone nue. Les
variables quantitatives prsentent les caractristiques statistiques suivantes (Tableau 9).

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

141

Chapitre V : Distribution spatiale des membres du complexe An. gambiae : structures globales et configurations locale
________________________________________________________________________________________________________________

Tableau 9 : statistiques descriptives sur les variables quantitatives


VARIABLE\

Contenu

STATISTIQUES

Moyenne

Ecart - type Minimum

Maximum

PERCENT_S

Pourcentage dAn. gambiae de forme molculaire S

44,42

37,23

100

PERCENT_M

Pourcentage dAn. gambiae de forme molculaire S

26,58

28,39

100

ETP

Evapo - transpiration potentielle moyenne annuelle

168,52

13,24

143,86

218,51

VENT

Vitesse moyenne annuelle du vent

1,83

0,22

1,17

2,72

TOPO

Topographie/ altitude

320

56

157

556

TEMPER

Temprature moyenne

28,01

0,42

26,9

28,9

PRESSION

Pression de vapeur moyenne annuelle

18,31

1,26

15,17

21,24

POP

Densit de population

81

93

4,12

1152

PLUIE

Prcipitation moyenne annuelle

783

183

327

1133

LOCALITE

Distance par rapport aux localits

1489

2012

10510

SOLEIL

Insolation

0,68

0,03

0,61

0,73

HYDRO

Distance par rapport au cours deau

492

446

3324

135,87

22,39

75

173

Vgtation / Intensit moyenne de lactivit

NDVI

chlorophyllienne

Conformment lchantillon, le nombre dindividus est de 300 pour les variables quantitatives. Les
modalits des variables qualitatives dans ce type danalyse interviennent comme individus. Il y a de
ce fait, respectivement 6 et 8 individus supplmentaires provenant des variables qualitatives
associes aux sols et loccupation des terres.

V.3.3

RESULTATS ET INTERPRETATION DE LANALYSE EN


COMPOSANTE PRINCIPALE

Le test de sphricit de Bartlett sur lensemble des donnes donne les valeurs suivantes (Tableau 10) :
Tableau 10 : Les rsultats des tests de sphricit de Bartlett
Khi (valeur observe)
Khi (valeur critique)
ddl
p-value unilatrale
Seuil de signification Alpha

4138,618
99,617
78
< 0,0001
0,05

Ce test permet de vrifier lhypothse nulle selon laquelle toutes les corrlations seraient gales
zro. Il permet donc de savoir si les donnes sont factorisables ou pas. Il assure par un test de khi2
que les variables sont suffisamment corrles pour autoriser lanalyse en composante principale. Les
rsultats de ce test permettent de rejeter lhypothse nulle au seuil de signification de 0,05. Cela
__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

142

Chapitre V : Distribution spatiale des membres du complexe An. gambiae : structures globales et configurations locale
________________________________________________________________________________________________________________

permet daccepter lhypothse dexistence de corrlation significative entre les variables. En dautres
termes, les corrlations qui existent entre les variables sont significatives.
V.3.3.1

Analyse des corrlations

Le Tableau 11 permet dobserver les corrlations. Elles sont positives plus de 0,8 entre le
pourcentage dAn. gambiae forme molculaire S, les prcipitations, la vgtation et les pressions. A
loppos, elles sont ngatives entre les mmes pourcentages et les variables insolation (-0,82),
temprature (-0,70) et ETP (-0,55).
Tableau 11 : Matrice des corrlations entre les variables
1

PERCENT_S
PERCENT_M

-0,73

ETP

-0,55

0,65

VENT

-0,33

0,19

0,39

TOPO

0,36

-0,25

-0,22

-0,18

TEMPER

-0,70

0,57

0,68

0,20

-0,56

PRESSION

0,80

-0,71

-0,75

-0,42

0,23

-0,74

POP

-0,20

0,04

-0,00

0,03

-0,09

0,22

-0,14

PLUIE

0,80

-0,69

-0,75

-0,37

0,39

-0,85

0,96

-0,15

LOCALITE

0,05

0,00

0,11

0,05

-0,16

0,092

-0,04

-0,16

-0,08

SOLEIL

-0,82

0,2

0,73

0,46

-0,42

0,84

-0,92

0,21

-0,95

0,01

HYDRO

-0,19

0,04

0,04

0,16

-0,08

0,10

-0,18

0,11

-0,18

-0,07

0,19

NDVI

0,803

-0,75

-0,73

-0,31

0,28

-0,79

0,88

-0,15

0,89

-0,03

-0,86

-0,18

PERCENT_S

PERCENT_M ETP

VENT

TOPO

TEMPER

PRESSION

POP

PLUIE

LOCALITE SOLEIL HYDRO

1
NDVI

En fond jaune, valeurs significatives (hors diagonale) au seuil alpha de 0,050 (test bilatral)

A loppos dAn. gambiae forme molculaire S, An. gambiae forme molculaire M a une forte
corrlation positive avec lETP (0,65), linsolation (0,62) et les tempratures (0, 57). Le niveau de
corrlation avec ces variables natteint pas celui dAn. gambiae de forme molculaire S. En
corrlation ngative, ce sont la vgtation (-0,75), les pressions (-0,71) et les prcipitations
(-0,69) qui sont les plus leves pour An. gambiae forme molculaire M.
Nous remarquons que la corrlation entre lETP, linsolation, les tempratures et la forme
molculaire M est dautant plus leve que la zone est aride. Cela laisse prsager une association de
la forme molculaire M laridit. A loppos, la forme molculaire S semble sassocier aux facteurs
voquant plutt lhumidit comme la pression, la prcipitation, la vgtation. Il y a donc, en premire
analyse des corrlations, une opposition entre la forme molculaire M et la forme molculaire S.
Cette opposition semble se construire le long dun axe aridit humidit. Nous constatons cependant
que les corrlations entre le ple de lhumidit et la forme molculaire S sont plus leves que celles
entre le ple de laridit et la forme molculaire M.

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

143

Chapitre V : Distribution spatiale des membres du complexe An. gambiae : structures globales et configurations locale
________________________________________________________________________________________________________________

V.3.3.2
Le Tableau 12

Analyse des valeurs propres

contient, pour 13 facteurs issus de lanalyse, les valeurs propres, les pourcentages de

variances simples et les pourcentages de variances cumuls. La


Figure 47 en

fournit une reprsentation graphique. La moyenne des valeurs propres est gale 1.

Tableau 12 : les valeurs propres des axes factoriels


F1

F2

F3

F4

F5

F6

F7

F8

F9

F10

F11

F12

F13

Valeur propre

6,84

% variance

52,63

9,90

8,27

7,93

6,11

5,58

3,45

2,80

1,14

1,03

0,74

0,25

0,09

% cumul

52,63

62,54

70,82

78,75

84,87

90,46

93,91

96,71

97,86

98,89

99,64

99,90

100,00

1,28

1,07

1,03

0,79

0,72

0,44

0,36

0,14

0,13

0,09

0,03

0,01

Figure 47 : Histogramme des valeurs propres

Le premier axe reprsente 52,63 % de linertie. Les deux premiers axes reprsentent eux seuls
62,54% de linertie. En nous rfrant au critre empirique de Cattel, le critre du Coude, nous
retenons comme pertinents les 4 premiers facteurs. Il y a, en effet, une forte rupture de la variation
entre laxe 4 et laxe 5 comparativement la pente entre les axes 2, 3 et 4. Le critre de Kayser, qui
veut que soient considrs les axes dont les valeurs propres sont suprieures la moyenne, conduit
retenir les axes 1, 2, 3 et 4. Il confirme galement la dcision prendre daprs le critre du coude de
Cattel.

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

144

Chapitre V : Distribution spatiale des membres du complexe An. gambiae : structures globales et configurations locale
________________________________________________________________________________________________________________

V.3.3.3

Analyse de coordonnes des variables

Le Tableau 13 contient les coordonnes des variables sur les quatre premiers axes factoriels retenus au
terme de critre de Cattel et de Kayser Lebart et al., (2006). Ces quatre premiers axes comptent
78,75% des variances. Les coordonnes centres rduites reprsentent les corrlations entre les
variables et les diffrents axes factoriels.
Tableau 13 : Coordonnes des variables
F1

F2

F3

F4

PERCENT_S

VARIABLE \ AXE

0,870

0,144

-0,041

0,057

PERCENT_M

-0,776

0,074

0,271

-0,174

ETP

-0,803

0,224

0,219

0,057

VENT

-0,438

0,019

-0,027

0,656

TOPO

0,441

-0,157

0,723

0,136

TEMPER

-0,872

0,042

-0,226

-0,227

PRESSION

0,943

0,012

-0,168

-0,065

POP

-0,189

-0,652

-0,347

-0,308

PLUIE

0,968

-0,028

-0,005

0,009

LOCALITE

-0,060

0,732

-0,384

0,132

SOLEIL

-0,961

-0,054

-0,041

0,036

HYDRO

-0,201

-0,467

-0,252

0,612

NDVI

0,929

0,019

-0,130

0,054

A la lecture des valeurs absolues des coordonnes des variables, nous observons que les variables
Pourcentage (abondance relative) dAn. gambiae forme molculaire M, Pourcentage
(abondance relative) dAn. gambiae forme molculaire S, ETP, temprature, pression, prcipitation
et vgtation sont fortement corrles laxe 1 avec des coefficients allant en valeur absolue de
0,776 0,968. En dehors de la variable pourcentage dAn. gambiae forme molculaire M , les
coordonnes sont toutes suprieures 0,8.
A laxe factoriel 2 sont corrls les facteurs population (0,652) et localits (0,732). laxe factoriel 3
est corrl la topographie (laltitude) avec un coefficient de 0,723 et laxe factoriel 4, les vents
(0,656) et lhydrographie (0,612).
La prise en compte du signe dans linterprtation met en lumire des oppositions entre les variables
sur les diffrents axes. La Figure 48 montre bien ces oppositions sur les axes factoriels 1et 2
lintrieur du cercle de corrlation.

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

145

Chapitre V : Distribution spatiale des membres du complexe An. gambiae : structures globales et configurations locale
________________________________________________________________________________________________________________
Variables (axes F1 et F2 : 62,54 % )
1

LOCALITE

-- axe F2 (9,90 %) -->

0,5

ETP
PERCENT_S
PERCENT_M
TEMPER

VENT

PRESSION

NDVI
PLUIE

SOLEIL
TOPO

HYDRO

-0,5

POP

-1
-1

-0,5

0
-- axe F1 (52,64 % ) -->

0,5

Figure 48 : Reprsentation des variables sur les plans factoriels 1 et 2

Ainsi, sur laxe factoriel 1, sopposent les abondances relatives des 2 formes molculaires dAn.
gambiae s.s.. Sy opposent galement deux groupes de facteurs environnementaux. Le premier est
constitu de la prcipitation, de la pression de vapeur et de la vgtation. Le second groupe runit
lETP, la temprature, linsolation et le vent. Le premier groupe de facteurs fait penser aux zones
humidit assez leve o les tempratures sont assez fraches. A loppos, se trouvent les facteurs
climatiques qui voquent lasschement, laridit. Sur laxe 2 sopposent les localits et les densits
de population.
Sur laxe 3 reprsent sur la Figure 49 avec laxe 1, nous observons la forte corrlation avec la
topographie (altitude).

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

146

Chapitre V : Distribution spatiale des membres du complexe An. gambiae : structures globales et configurations locale
________________________________________________________________________________________________________________
Variables (axes F1 et F3 : 60,92 % )
1

TOPO

0,5

-- axe F3 (8,28 %) -->

PERCENT_M
ETP

PLUIE

VENT

PERCENT_S
NDVI

SOLEIL

TEMPER

PRESSION

HYDRO
POP
LOCALITE

-0,5

-1
-1

-0,5

0
-- axe F1 (52,64 % ) -->

0,5

Figure 49 : Reprsentation des variables sur les plans factoriels 1 et 3Enfin, sur laxe 4 reprsent
laxe 1 sur la Figure 50, les vents et lhydrographie sont trs corrls.

avec

Variables (axes F1 et F4 : 60,57 % )


1

VENT

HYDRO

-- axe F4 (7,94 %) -->

0,5

LOCALITE

TOPO

SOLEIL ETP
0

NDVI
PERCENT_S
PLUIE
PRESSION

PERCENT_M
TEMPER
POP

-0,5

-1
-1

-0,5

0
-- axe F1 (52,64 % ) -->

0,5

Figure 50 : Reprsentation des variables sur le plan factoriel 1 et 4

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

147

Chapitre V : Distribution spatiale des membres du complexe An. gambiae : structures globales et configurations locale
________________________________________________________________________________________________________________

Nous retenons lopposition entre la forme molculaire M et la forme molculaire S dAn. gambiae
s.s., trs remarquable sur laxe factoriel 1. Cet axe factoriel constitue un axe sur lequel sopposent
galement deux ples de facteurs environnementaux. Le premier ple regroupe les facteurs NDVI,
pluie, pression, topographie (altitude), constitue le ple humide et est associ An. gambiae forme
molculaire S. Le second ple regroupe les facteurs ETP, insolation, temprature, vent et constitue le
ple aride.
Laxe factoriel 2, semble ne pas influencer tellement les deux formes molculaires. Il oppose les
localits lhydrographie et aux densits de population. Nous en dduisons que ces trois derniers
facteurs environnementaux ne sont pas associs la distribution des membres du complexe
An. gambiae s.s..
Laxe factoriel 3 semble avoir la mme structure que laxe factoriel 2, la seule diffrence, que la
topographie (altitude) nest plus associe la rpartition des membres du complexe An. gambiae.
Laxe factoriel 4 exclut les vents comme facteur environnemental associ aux membres du complexe
An gambiae.
V.3.3.4

Analyse de la qualit de la reprsentation des variables par rapport


aux diffrents axes factoriels

La qualit de la reprsentation des diffrentes variables par rapport laxe factoriel sexprime
travers les valeurs de cosinus de variables qui sont consignes dans le Tableau 14.
Tableau 14 : Cosinus carrs des variables
VARIABLES \ AXES

F1

F2

F3

F4

PERCENT_S

0,756

0,021

0,002

0,003

PERCENT_M

0,602

0,005

0,074

0,030

ETP

0,645

0,050

0,048

0,003

VENT

0,192

0,000

0,001

0,430

TOPO

0,194

0,025

0,523

0,019

TEMPER

0,761

0,002

0,051

0,052

PRESSION

0,890

0,000

0,028

0,004

POP

0,036

0,426

0,120

0,095

PLUIE

0,938

0,001

0,000

0,000

LOCALITE

0,004

0,536

0,148

0,018

SOLEIL

0,923

0,003

0,002

0,001

HYDRO

0,040

0,218

0,063

0,374

NDVI

0,862

0,000

0,017

0,003

Lanalyse de ce tableau rvle que les pourcentages (abondance relative) dAn. gambiae forme
molculaire S, la temprature, la pression, les prcipitations, linsolation, la vgtation sont trs bien
reprsents sur laxe 1, les carrs de leurs cosinus tant suprieurs 0,6 sur cet axe. Les variables

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

148

Chapitre V : Distribution spatiale des membres du complexe An. gambiae : structures globales et configurations locale
________________________________________________________________________________________________________________

pourcentage dAn. gambiae forme molculaire M et ETP y sont moyennement bien reprsentes
avec des carrs de cosinus compris entre 0,4 et 0,65. Sur laxe factoriel 2, les localits avec un
cosinus carr gale 0,536 et les densits de population avec un cosinus carr de 0,426 sont
moyennement bien reprsentes. Aucune variable ny est bien reprsente. Cette mauvaise
reprsentation de variables sobserve sur les deux autres axes : laxe 3 et laxe 4. Sur ces deux
derniers axes, la variable topographie (altitude) a une bonne reprsentation sur laxe factoriel 3 et les
vents sur laxe factoriel 4.
V.3.3.5

Analyse de la contribution des variables la formation des axes


factoriels

Les contributions des variables aux axes factoriels sont consignes dans le Tableau 15. La Figure 51 en
donne une reprsentation graphique.

Tableau 15 : Contributions des variables (%)


VARIABLES \ AXES

F1

F2

F3

F4

LOCALITE

0,052

41,646

13,727

1,696

POP

0,524

33,059

11,160

9,221

HYDRO

0,591

16,962

5,880

36,255

VENT

2,804

0,028

0,066

41,645

TOPO

2,837

1,904

48,610

1,797

PERCENT_M

8,801

0,426

6,849

2,926

ETP

9,421

3,905

4,438

0,320

PERCENT_S

11,053

1,605

0,155

0,310

TEMPER

11,117

0,139

4,754

5,007

NDVI

12,600

0,027

1,577

0,281

PRESSION

13,004

0,011

2,624

0,408

SOLEIL

13,493

0,223

0,158

0,125

PLUIE

13,702

0,062

0,003

0,009

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

149

Chapitre V : Distribution spatiale des membres du complexe An. gambiae : structures globales et configurations locale
________________________________________________________________________________________________________________

50
F1

F2

F3

F4

45
40
35
30
25
20
15
10
5
0
PLU IE

SO LEIL

PR ESSION

NDV I

T EM PER

PER C EN T _ S

ET P

PER C EN T _ M

T O PO

V EN T

HY D R O

PO P

LO C A LIT E

VARIABLES

Figure 51 : contribution des variables aux axes factoriels

Les contributions maximales laxe factoriel 1 ne dpassent gure 13,5%. De nombreux facteurs
contribuent donc la dfinition de cet axe. Nous distinguons trois groupes de variables sur laxe 1 :
-

les variables dont les contributions varient entre 15% et 12,5% constitues des prcipitations,
de linsolation, la pression et la vgtation ;

les variables dont les contributions varient entre 12,5% et 7,5% avec les variables
tempratures, pourcentage dAn. gambiae forme molculaire S, ETP, pourcentage dAn.
gambiae forme molculaire M ;

les variables avec des contributions trs faibles, infrieures 7,5%, que sont, la topographie
(altitude), les vents, lhydrographie, les densits de population et les localits.

Nous considrons donc que les variables prcipitation, insolation, pression et temprature contribuent
au premier axe factoriel et auquel sont galement associes les formes molculaires M et S.
Les autres axes factoriels disposent de deux ou trois variables aux contributions trs leves par
rapport aux restes de variables dpassant parfois les 40% des contributions. Ainsi, sur laxe factoriel
2, les localits reprsentent plus de 40% des contributions. Celles-ci, associes lhydrographie et
la population, reprsentent plus de 90% des contributions. Pour laxe factoriel 3, prs de la moiti des
contributions est dtenue par la topographie (altitude). Aprs la topographie (altitude), les
contributions les plus leves des autres variables natteignent pas les 15% et concernent seulement
deux variables : localit et population. Sur laxe factoriel 4, des vents (41,64%) et de lhydrographie
(36,25%) sont dominants. Les variables hydrographie, population, localit et vent ont des
__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

150

Chapitre V : Distribution spatiale des membres du complexe An. gambiae : structures globales et configurations locale
________________________________________________________________________________________________________________

contributions intressantes sur les axes sur lesquels la contribution des formes molculaires M et S
dAn. gambiae s.s. sont trs faibles. Nous en dduisons que les formes molculaires M et S ne sont
pas associes ces axes. Les variables qui contribuent aux axes 2, 3, 4 contribuent donc peu la
dtermination de la distribution des formes molculaires M et S dAn. gambiae s.s.. Loccupation des
terres a t prsente comme un facteur cologique pouvant influencer la distribution spatiale dAn.
gambiae s.s.. Aussi, est-il important dapprcier le positionnement des modalits de cette variable
qualitative par rapport aux diffrents axes factoriels.
V.3.3.6

Contribution des variables supplmentaires aux diffrents axes


factoriels

Les coordonnes des variables supplmentaires sur les 4 premiers axes factoriels sont reprsentes
dans le Tableau 16.
Tableau 16 : Les coordonnes des variables supplmentaires
VARIABLES \ AXES

F1

F2

F3

F4

Champ

0,065

-0,006

-0,117

0,034

Fort sche

2,449

-0,007

1,123

0,455

Habitat rural

-0,072

-0,564

0,943

-0,186

Savane

0,644

0,103

-0,172

0,081

Steppe

-3,572

0,755

0,359

-0,276

Territoire agro-forestier

0,755

-0,113

0,055

-0,027

Zone humide

-0,737

0,237

-0,640

-1,424

Zone nue

-3,980

0,334

1,121

-0,363

Les Figure 52, Figure 53 et Figure 54, ci-dessous prsentent la distribution des individus supplmentaires
(puisque la variable supplmentaire est nominale) sur les 4 axes factoriels.

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

151

Chapitre V : Distribution spatiale des membres du complexe An. gambiae : structures globales et configurations locale
________________________________________________________________________________________________________________

Individus (axes F1 et F2 : 62,54 %)

Champ

Fort sche
4

Habitat rural
Savane

Steppe
Territoire agroforestier

-- axeF2(9,90%
) -->

Zone humide
Zone nu
-2
Barycentre de
Champ
Barycentre de
Fort sche

-4

Barycentre de
Habitat rural
Barycentre de
Savane

-6

Barycentre de
Steppe
Barycentre de
Territoire agroforestier
Barycentre de
Zone humide

-8

-10

Barycentre de
Zone nu

-12
-10

-8

-6

-4

-2
0
-- axe F1 (52,64 %) -->

Figure 52 : Positionnement de nominales supplmentaires sur les plans factoriels 1 et 2


Individus (axes F1 et F3 : 60,92 %)

Champ

8
Fort sche
Habitat rural
6
Savane
Steppe
4
Territoire agroforestier
Zone humide

-- axe F3 (8,28 %) -->

Zone nu
Barycentre de
Champ

Barycentre de
Fort sche
-2

Barycentre de
Habitat rural
Barycentre de
Savane

-4
Barycentre de
Steppe
Barycentre de
Territoire agroforestier
Barycentre de
Zone humide

-6

Barycentre de
Zone nu

-8
-8

-6

-4

-2

-- axe F1 (52,64 %) -->

Figure 53 : Positionnement de nominales supplmentaires sur les plans factoriels 1 et 3

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

152

Chapitre V : Distribution spatiale des membres du complexe An. gambiae : structures globales et configurations locale
________________________________________________________________________________________________________________
Individus (axes F1 et F4 : 60,57 %)

Champ

Fort sche
6

Habitat rural
Savane

4
Steppe
Territoire agroforestier

Zone humide
0

Zone nu
Barycentre de
Champ

-2
Barycentre de
Fort sche
Barycentre de
Habitat rural

-4

Barycentre de
Savane
Barycentre de
Steppe

-6

-8
-8

-6

-4

-2

- - a xe F 1 ( 5 2 ,6 4 %) - - >

Barycentre de
Territoire agroforestier
Barycentre de
Zone humide

Figure 54 : Positionnement de nominales supplmentaire sur les plans factoriels 1 et 4

La position des barycentres des individus supplmentaires issus de la variable nominale occupation
des terres le long de laxe factoriel 1, et lopposition entre steppe, zone nue et fort sche,
confirment laridit comme lment fondamental de sparation des variables. Elle met aussi et
surtout en exergue l'opposition entre An. gambiae forme molculaire M et An. gambiae forme
molculaire S.
De cette analyse en composantes principales, nous dduisons :
1. quil existe des relations entre les facteurs de lenvironnement et la distribution des formes
molculaires M et S dAn. gambiae s.s. ;
2. quil existe une opposition entre les prfrences des formes molculaires M et S dAn.
gambiae. La forme molculaire M est associe aux facteurs environnementaux voquant
laridit comme la temprature, lETP, linsolation et la steppe. Elle prfre visiblement les
rgions les plus arides, correspondant au nord du Burkina Faso. An. gambiae forme
molculaire S quant lui est associ aux facteurs environnementaux qui voquent lhumidit
comme la prcipitation, la pression, les savanes et le NDVI. Il prfre donc les rgions
humides du pays c'est--dure le sud-ouest du Burkina Faso. Le ple de laridit et celui de
lhumidit constituent les extrmits dun axe qui se prsente premire vue comme le
paramtre dterminant de cette opposition ;
3. que la liaison entre les facteurs environnementaux et An. gambiae forme molculaire S est
plus vidente que celle davec An. gambiae forme molculaire M ;

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

153

Chapitre V : Distribution spatiale des membres du complexe An. gambiae : structures globales et configurations locale
________________________________________________________________________________________________________________

4. que les facteurs cologiques hydrographie et densit de population ne prsentent pas


un intrt dans la dtermination de la distribution ; leurs contributions sont donc diffrentes
des autres paramtres dj cits et associs laxe factoriel 1, laxe humidit aridit ;
5. que loccupation des terres prsente des modalits qui pourraient apporter un plus dans la
modlisation de la distribution spatiale des vecteurs.
En somme, la deuxime hypothse est vrifie. En effet, tous les facteurs cologiques ne contribuent
pas de la mme faon la dtermination de la structure spatiale observe. Certains facteurs
environnementaux peuvent devenir plus facilement une contrainte importante, un facteur limitant au
dveloppement et la propagation de lespce.
Daprs les rsultats de lanalyse, nous pouvons :
-

procder la rduction du nombre de variables explicatives par exclusion des variables


hydrographie et densit de population ;

procder une modlisation spare des deux membres du complexe ;

retenir lanalyse des covariances (ANCOVA) comme technique de modlisation. Elle est
adapte la modlisation incluant des variables qualitatives. Toutefois, elle est remplace si
la contribution de ces variables qualitatives la modlisation est faible et insuffisante.

CONCLUSION DU CHAPITRE V
Les donnes entomologiques collectes sont analyses trois niveaux : le niveau An. gambiae sl, le
niveau An. gambiae forme molculaire S et le niveau An. gambiae forme molculaire M. La
distribution des frquences observes dAn. gambiae sl est assez normale. Celle dAn. gambiae forme
molculaire M est centre au nord-est tandis que celle dAn. gambiae forme molculaire S est plutt
centre au sud-ouest. Toutes ces distributions sont spatialement indpendantes lchelle de collecte
des donnes. Toutefois, elles prsentent localement des dpendances spatiales. Lanalyse des agrgats
et des configurations spatiales rvle une homognit spatiale au nord pour An. gambiae forme
molculaire M et au sud pour An. gambiae forme molculaire S.
Les statistiques spatiales descriptives, en loccurrence les ellipses de dviation standard, les
barycentres et les centrodes ont permis de mettre en exergue le caractre orient et non alatoire de
la distribution spatiale des frquences du complexe et de ses membres. Lutilisation des indices
locaux dassociation spatiale, en loccurrence lindice dAnselin et Moran et Gi*de Getis et Ord ont
permis de montrer l'existance d'agrgats spatiaux orients dans la mme direction que celle des
ellipses de dviation standard pour les membres du complexe pris individuellement. Ces indices ont
rvl galement trois niveaux de structuration spatiale des frquences :

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

154

Chapitre V : Distribution spatiale des membres du complexe An. gambiae : structures globales et configurations locale
________________________________________________________________________________________________________________

An. gambiae forme molculaire S est trs bien structur avec des agrgats marqus et bien
repartis dans lespace ;

An. gambiae forme molculaire M est galement bien structur mais il y a quelques bruits
dans la zone sud-ouest;

pour An. gambiae s.l., les agrgats sont disperss.

Ces rsultats permettent de dire que lhypothse de distribution spatiale non alatoire des formes
molculaires S et M d'An. gambiae s.s. est vrifie. Une direction et des agrgats ont t galement
identifis. Les tests dautocorrelation montre lindpendance spatiale et le fait que lespace (absolu)
est insuffisant pour expliquer la distribution observe.
Les principaux rsultats de lanalyse des relations entre la distribution spatiale des frquences
observes et la distribution spatiale des facteurs environnementaux obtenus sont la mise en exergue
des zones de colonisation prfrentielle opposes entre la forme molculaire M et la forme
molculaire S dAn. gambiae au Burkina Faso. La forme molculaire S prfre les rgions du sud les
plus humides tandis que la forme molculaire M prfre les rgions du nord arides.
Les facteurs les plus dterminants de la distribution spatiale de la forme molculaire S sont : lETP,
linsolation et le NDVI. Les deux premiers sont ngativement corrls avec labondance de la forme
molculaire S. Labondance relative de S est positivement corrle au NDVI et exprime la prfrence
de cette forme pour les milieux les plus humides du pays.
Pour la forme molculaire M, les facteurs les plus dterminants dans la distribution spatiale sont :
laltitude, la pression, linsolation et la densit de vgtation (NDVI). Laltitude, la pression et le
NDVI sont tous dautant plus levs que le milieu est humide et sont tous en corrlation ngative
avec labondance de la forme molculaire M. Linsolation qui voque laridit est en liaison positive
avec labondance de la forme molculaire M, indiquant la prfrence de cette forme pour les milieux
arides.
Compte tenu de la lisibilit de ces tendances observes, il est tout fait possible que cette distribution
des formes molculaires puisse tre dcrite de faon formelle par une fonction. Cest lobjet du
chapitre 6 dans lequel nous procdons lexpression des abondances relatives des deux formes
molculaires M et S en fonction des facteurs environnementaux.

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

155

Chapitre VI : Modlisation de la distribution spatiale des formes molculaires M et S dAn. gambiae


________________________________________________________________________________________________________________

CHAPITRE VI : MODELISATION DE LA DISTRIBUTION SPATIALE


Lanalyse des relations entre lenvironnement et la distribution de chaque forme molculaire d'An.
gambiae s.s., laisse penser une possibilit de formalisation mathmatique de leur distribution en
sappuyant sur les facteurs environnementaux. De plus, il est apparu ncessaire de considrer
sparment chaque membre du complexe, compte tenu des diffrences observes dans leurs relations
avec lenvironnement.
Plusieurs techniques statistiques peuvent tre utilises pour formaliser les relations entre
lenvironnement et les diffrents membres du complexe. Dans le cadre de cette tude, lanalyse de la
covariance (ANCOVA) et la rgression multiple sont utilises pour permettre de prendre en compte la
fois les variables quantitatives et les variables qualitatives.

VI.1

MODELISATION PAR ANALYSE DE COVARIANCE (ANCOVA)

CONFIGURATION DE LANCOVA ET DESCRIPTION DES DONNEES


Lanalyse est sans contrainte (contrainte : a1 = 0), les donnes contribuent de faon uniforme la
modlisation. Aucune contrainte particulire nest ajoute. Deux tests statistiques sont effectus pour
valuer la contribution des variables au modle. Il sagit du test Fisher Type I SS et du Test de Fisher
type III SS.
Les donnes dentre dans cette analyse de covariance se prsentent comme suit :
Les variables expliquer sont les pourcentages, dAn. gambiae forme molculaire S (pourcent_S) et les
pourcentages dAn. gambiae forme molculaire M (pourcent_M).
Les deux variables expliquer sont caractrises dans le Tableau 17.
Tableau 17 : Statistiques descriptives sur les variables expliquer

Variable

Nbre de

Nbre de

Nbre de valeurs

valeurs totale valeurs utilises ignores

Somme
des poids

Moyenne

Ecart-type

POURCENT_M

255

255

255

27,755

28,448

POURCENT_S

255

255

255

42,066

37,135

Les variables explicatives sont au nombre de 13, dont 11 quantitatives et 2 qualitatives. Le rsum des

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

156

Chapitre VI : Modlisation de la distribution spatiale des formes molculaires M et S dAn. gambiae


________________________________________________________________________________________________________________

variables explicatives quantitatives59 pour les deux variables expliquer est contenu dans le Tableau 18.
Tableau 18 : Statistiques descriptives sur les variables explicatives
VARIABLE

PARAMETRE REPRESENTE

MOYENNE

ECARTTYPE

169

13

ETP

Evapo - transpiration potentielle moyenne annuelle

VENT

Vitesse moyenne annuelle du vent

1,841

0,221

TOPO

Topographie/ altitude

320

54

TEMPER

Temprature moyenne

28

0,41

PRESSION

Pression moyenne annuelle

18,257

1,264

POP

Densit de population

79

72

PLUIE

Prcipitation moyenne annuelle

776

183

LOCALITE

Distance par rapport aux localits

1543

2083

SOLEIL

Insolation

0,68

0,03

HYDRO

Distance par rapport au cours deau

496

452

NDVI

Vgtation / Intensit moyenne de lactivit chlorophyllienne

134

22

Quant aux variables explicatives qualitatives, elles sont rsums dans le Tableau 19.
Tableau 19 : Statistiques descriptives sur les variables qualitatives
VARIABLE

OCTER_NOMA

NOMBRE DE

PARAMETRE REPRESENTE

MODALITES

Occupation des terres

15

Champ

180

Territoire agro-forestier

27

Steppe

10

Zone nue

Savane

17

Zone humide

Fort sche

Sols Hydromorphes
Sols peu volus, minraux bruts o
Formation pdologique

DOBSERVATION

Habitat rural

Sols ferrugineux tropicaux

SOL

FREQUENCES

MODALITES

dgrads

93
68
67

Sols Mull

14

Vertisols

12

Sols Isohumiques

RESULTATS ET INTERPRETATION DE LANCOVA

59

Volontairement, les variables identifies comme peu dterminantes par lanalyse en

composantes principales ont t maintenues comme variables, car les modules de calcul
disposent de test danalyse de leur contribution aux modles.
__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

157

Chapitre VI : Modlisation de la distribution spatiale des formes molculaires M et S dAn. gambiae


________________________________________________________________________________________________________________

LANCOVA est effectue de faon spare pour chaque forme molculaire dAn. gambiae s.s.. Aussi, la
prsentation des rsultats est-elle faite de manire reflter cette sparation entre les deux formes
molculaires.
VI.1.2.1

Rsultats et interprtation de lANCOVA pour An. gambiae


forme molculaire S

LANCOVA donne les rsultats suivants pour An. gambiae forme molculaire S :
Pour An. gambiae forme molculaire S, nous obtenons, un coefficient de corrlation R = 0,880, un
coefficient de dtermination R2 = 0,774, un coefficient de dtermination ajust Raj.= 0,751 et un
SCR = 79193,944. Nous retenons de ce rsultat que 77% de la variance observe dans la distribution
dAn. gambiae forme molculaire S sexplique par les 11 variables dentres quantitatives.
Le test de Fisher associ lANCOVA dans son ensemble permet dvaluer dabord la significativit de
la quantit des informations fournies par les 13 variables (quantitative et qualitative) au modle. Les
rsultats du test sont contenus dans le Tableau 20.

Tableau 20 : Test de significativit de la quantit dinformation apporte par les variables

Source

ddl

Somme des carrs

Carr moyen

F de Fisher

Probabilit > F

Modle

23

271070,777

11785,686

34,378

< 0,0001

Rsidus

231

79193,944

342,831

Total

254

350264,722

La probabilit associe au test de Fisher est infrieure 0,0001. Il y a donc moins de 0,1% de chance de
se tromper en disant que les variables explicatives utilises sont pertinentes pour expliquer la variance de
pourcentages dAn. gambiae forme molculaire S.
Les tests prcdents permettent de vrifier que les variables prises dans leur globalit apportent une
quantit dinformations significatives au modle. Si cela est avr au niveau global, en est-il de mme
vrai pour chacune delles ? Lvaluation de la significativit de lapport de chaque variable au modle
est effectue avec le test de Fisher type I SS et type III SS et les rsultats sont contenus dans les

Tableau 21

et Tableau 22

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

158

Chapitre VI : Modlisation de la distribution spatiale des formes molculaires M et S dAn. gambiae


________________________________________________________________________________________________________________

Tableau 21 : Analyse du modle (Type I SS) : test de Fisher sur les variables dans lordre de slection
Source

ddl

Somme des carr Carr moyen

F de Fisher

Probabilit > F

ETP

108868,911

108868,911

317,559

< 0,0001

VENT

7289,890

7289,890

21,264

< 0,0001

TOPO

16962,617

16962,617

49,478

< 0,0001

TEMPER

49930,813

49930,813

145,643

< 0,0001

PRESSION

58172,652

58172,652

169,683

< 0,0001

POP

2697,595

2697,595

7,869

0,005

PLUIE

334,621

334,621

0,976

0,324

LOCALITE

3414,847

3414,847

9,961

0,002

SOLEIL

8582,472

8582,472

25,034

< 0,0001

HYDRO

236,964

236,964

0,691

0,407

NDVI

10486,994

10486,994

30,589

< 0,0001

OCTER_NOMA

803,819

114,831

0,335

0,937

SOL

3288,584

657,717

1,918

0,092

Tableau 22 : Analyse du modle (Type III SS) : test de Fisher sur les variables quel que soit lordre de slection
ddl

Somme des carr

Carr moyen

F de Fisher

Probabilit > F

ETP

3377,367

3377,367

9,851

0,002

VENT

624,765

624,765

1,822

0,178

TOPO

3695,415

3695,415

10,779

0,001

TEMPER

182,119

182,119

0,531

0,467

PRESSION

2041,856

2041,856

5,956

0,015

POP

14,189

14,189

0,041

0,839

PLUIE

893,095

893,095

2,605

0,108

LOCALITE

1512,114

1512,114

4,411

0,037

SOLEIL

3252,624

3252,624

9,488

0,002

HYDRO

7,962

7,962

0,023

0,879

NDVI

11368,180

11368,180

33,160

< 0,0001

OCTER_NOMA

1254,919

179,274

0,523

0,817

SOL

3288,584

657,717

1,918

0,092

Source

Daprs les rsultats de ces tests, les variables qualitatives, (occupation des terres et sols) napportent pas
une quantit dinformation significative au modle. Pour le premier test, il y a respectivement 93 % et
9,2 % de chance de se tromper en disant que loccupation des terres et les sols apportent une information

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

159

Chapitre VI : Modlisation de la distribution spatiale des formes molculaires M et S dAn. gambiae


________________________________________________________________________________________________________________

significative au modle. Pour le second, il y a respectivement 81 % et 9 % de chance de se tromper en


disant que ces variables qualitatives apportent une quantit dinformations significative au modle.
Puisque ces variables qualitatives qui ont justifi lutilisation de lANCOVA, napportent pas une
quantit dinformations significatives au modle, elles sont retires du processus de modlisation.
Une rgression multiple est utilise en remplacement de lANCOVA pour la modlisation de la
distribution des An. gambiae forme molculaire S, puisquil sagit dune ANCOVA sans variable
qualitative .
VI.1.2.2

Rsultats et interprtation de lANCOVA pour An. gambiae


forme molculaire M
Pour An. gambiae forme molculaire M, les coefficients dajustement sont consigns dans le Tableau 23
ci-dessous :
Tableau 23 : Coefficients dajustement du modle
R (coefficient de corrlation)

0,835

R (coefficient de dtermination)

0,697

Raj. (coefficient de dtermination ajust)

0,666

SCR

62372,707

Au regard de ces coefficients, les variables retenues expliquent 70% de la variabilit observe. Les 30%
restant sont lis dautres facteurs ou des erreurs de mesure. La significativit des informations
fournies par les variables dans leur ensemble est galement bonne comme le confirment les rsultats du
test de Fisher consigns dans le Tableau 24 ci-dessous.
Tableau 24 : test de Fisher sur la significativit de la quantit de donnes par rapport au modle
Source

ddl

Somme des carrs

Carr moyen

F de Fisher

Probabilit > F

23,057

< 0,0001

Modle

23

143188,133

6225,571

Rsidus

231

62372,707

270,012

Total

254

205560,840

Ainsi, y a-t-il plus de 99% de chance que les variables apportent une information de quantit
significative au modle, car la probabilit associe au test de Fisher est de 0,0001.
La pertinence des variables prises individuellement par rapport au modle a fait lobjet dun test de
Fisher de Type I SS et dun test de Fisher de Type III SS. Les rsultats de ces tests sont consigns dans
les Tableau 25 et Tableau 26.
Tableau 25 : Analyse du modle (Type I SS) : test de Fisher sur les variables dans lordre de slection
Somme des
Source

ddl

carrs

Carr moyen

F de Fisher

Probabilit > F

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

160

Chapitre VI : Modlisation de la distribution spatiale des formes molculaires M et S dAn. gambiae


________________________________________________________________________________________________________________

ETP

87770,956

87770,956

325,064

< 0,0001

VENT

712,121

712,121

2,637

0,106

TOPO

2174,481

2174,481

8,053

0,005

TEMPER

3517,021

3517,021

13,025

0,000

PRESSION

25029,875

25029,875

92,699

< 0,0001

POP

35,273

35,273

0,131

0,718

PLUIE

1365,148

1365,148

5,056

0,025

LOCALITE

652,732

652,732

2,417

0,121

SOLEIL

4146,747

4146,747

15,358

0,000

HYDRO

582,817

582,817

2,158

0,143

NDVI

13339,163

13339,163

49,402

< 0,0001

OCTER_NOMA

2506,583

358,083

1,326

0,239

SOL

1355,217

271,043

1,004

0,416

Tableau 26 : Analyse du modle (Type III SS) : test de Fisher sur les variables quel que soit lordre de slection
Somme des
Source

ddl

carrs

Carr moyen

F de Fisher

Probabilit > F

ETP

2639,968

2639,968

9,777

0,002

VENT

826,599

826,599

3,061

0,082

TOPO

6677,828

6677,828

24,732

< 0,0001

TEMPER

513,079

513,079

1,900

0,169

PRESSION

3408,675

3408,675

12,624

0,000

POP

301,586

301,586

1,117

0,292

PLUIE

4,016

4,016

0,015

0,903

LOCALITE

1596,891

1596,891

5,914

0,016

SOLEIL

5345,737

5345,737

19,798

< 0,0001

HYDRO

1048,351

1048,351

3,883

0,050

NDVI

12245,092

12245,092

45,350

< 0,0001

OCTER_NOMA

2374,138

339,163

1,256

0,273

SOL

1355,217

271,043

1,004

0,416

La contribution des variables en rouge dans les deux tableaux ci-avant nest pas significative. Lapport
de ces variables nest donc pas significatif dans la qualit du modle. Les deux variables qualitatives
(loccupation des terres et sols) font partie des variables contribution faible, peu significative au
modle. Puisque ce sont elles qui ont justifi lutilisation de lANCOVA comme technique de
modlisation, leurs faibles contributions autorisent utiliser seulement les variables quantitatives. Ainsi,
plutt que lANCOVA, une rgression multiple est utilise pour la modlisation dAn. gambiae forme
molculaire M.

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

161

Chapitre VI : Modlisation de la distribution spatiale des formes molculaires M et S dAn. gambiae


________________________________________________________________________________________________________________

VI.2

MODELISATION PAR REGRESSION MULTIPLE


VI.2.1 CONFIGURATION DE LA REGRESSION ET DESCRIPTION DES
DONNEES

LANCOVA a mis en exergue la contribution non significative des variables qualitatives la


modlisation des relations entre les formes molculaires M et S dAn. gambiae s.s.. LANCOVA sen
trouve donc rduite peu dintrt, do lutilisation de la rgression60.
La rgression ralise est de type linaire trois variables minimum et quatre variables maximum. Elle
est excute une premire fois avec le pourcentage dAn. gambiae forme molculaire S comme variable
dpendante et une seconde fois avec An. gambiae forme molculaire M comme variable dpendante. Sur
les 300 individus que constitue lchantillon, 255 soit 85% ont t tirs de faon alatoire pour la
modlisation. Les 45 autres individus, soit 15% de lchantillon, ont t rservs pour tester la qualit du
modle avec des donnes empiriques.
Les variables expliquer, les variables dpendantes, prsentent les caractristiques suivantes (Tableau 27).
Tableau 27 : Statistiques descriptives sur les variables expliquer
Variable

Nbr. de valeurs tot

Nbr. de valeurs utilise

Nbr. de valeurs ignores

Somme des poid

Moyenne

Ecart-type

POURCENT_S

255

255

255

42,066

37,135

POURCENT_M

255

255

255

27,755

28,448

Les variables explicatives retenues sont toutes les variables quantitatives de lANCOVA. Le Tableau 28
ci-dessous contient la liste des variables explicatives et leurs rsums statistiques.
Tableau 28 : Rsum pour les variables explicatives
Variable

60

Signifiant de la variable

Moyenne

Ecart-type

ETP

Evapo-transpiration

169

13

VENT

Vitesse du vent

1,84

0,22

TOPO

Topographie / Altitude

320

54

TEMPER

Temprature moyenne

28

0,41

PRESSION

Pression

18,25

1,26

POP

Densit

79

72

PLUIE

Pluviomtrie

776

183

La rgression linaire semble avoir les meilleurs rsultats en terme de dtermination de la relation entre lenvironnement et la distribution molculaire M

et S dAn. gambiae ss.

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

162

Chapitre VI : Modlisation de la distribution spatiale des formes molculaires M et S dAn. gambiae


________________________________________________________________________________________________________________

SOLEIL

Insolation

0,68

0,03

LOCALITE

Distance aux localits

1543

2083

HYDRO

Distance aux cours

496

NDVI

Vgtation/intensit de lactivit chlorophylle

134

22

Chaque rgression utilise un minimum de deux variables. Le maximum de variables utilises par
rgression est de 3 pour An. gambiae forme molculaire S et de 4 pour An. gambiae forme molculaire
M. Le seuil de confiance est de 95% et le critre dvaluation de la rgression est le coefficient de
dtermination (R2). Les tests de Fisher de type I SS et type III SS sont associs au traitement pour
lvaluation de la significativit de la quantit de linformation apporte par les diffrentes variables la
modlisation.

VI.2.2 RESULTATS DE LA REGRESSION


La prsentation des rsultats de la rgression est faite galement de faon spare pour chaque forme
molculaire dAn.gambiae s.s. afin de conserver ce caractre individualis de la modlisation. Chaque
forme molculaire fait donc lobjet dun sous paragraphe qui prsente les paramtres de la modlisation
et une analyse de la qualit des variables explicatives la qualit des modles.
VI.2.2.1 Modle de distribution dAn. gambiae forme molculaire S
Les rsultats de la rgression sont les suivants pour An. gambiae forme molculaire S. Daprs le critre
retenu pour lvaluation de la rgression, le R2, les deux meilleurs modles pour An. gambiae forme
molculaire S sont consigns dans leTableau 29.

Tableau 29 : Valeur du coefficient de dtermination pour les 2 meilleurs modles

Modle Nombre de variables dans le modle

Nom des Variable

SOLEIL, NDVI

0,720

ETP, SOLEIL, NDVI

0,746

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

163

Chapitre VI : Modlisation de la distribution spatiale des formes molculaires M et S dAn. gambiae


________________________________________________________________________________________________________________

Daprs ce Tableau 29, les trois meilleures variables qui permettent dexpliquer la variance observe sont :
linsolation, la vgtation et lvapotranspiration potentielle, en dpit de la colinarit61. Le Tableau 30, cidessous, donne les coefficients dajustement du meilleur modle, le modle 2.
Tableau 30 : Coefficients d'ajustement du modle 2

R (coefficient de corrlation)

0,864

R (coefficient de dtermination)

0,746

Raj. (coefficient de dtermination ajust)

0,743

SCR

89081,950

Le coefficient de dtermination atteint jusqu 0,746. Cela signifie que 74,6% de la variance sont
expliqus par la combinaison linaire des trois variables que sont linsolation, lETP et la vgtation. Le
test de Fisher sur lanalyse de la significativit de la quantit dinformation apporte par les variables
prises dans leur globalit confirme que les variables fournissent suffisamment dinformations
llaboration du modle (Tableau 31).

Tableau 31 : Le test de Fisher sur lanalyse de la significativit de la quantit dinformation apporte par les variables
la rgression pour Anopheles gambiae forme molculaire S
Source

ddl

Somme des carrs

Carr moyen

Modle

261182,772

87060,924

Rsidus

251

89081,950

354,908

Total

254

350264,722

F de Fisher

Probabilit > F

245,305

< 0,0001

La probabilit associe au test F de Fisher est de 0,0001 soit moins de 1% de chance de se tromper en
considrant que la quantit dinformation apporte par lETP, linsolation et la vgtation est
significative pour le modle.
Les Tableau 32 et Tableau 33 contiennent les rsultats de test de Fisher de type I SS et de type III SS.
Tableau 32 : Test de Fisher de type I SS
Source

ddl

Somme des carrs

Carr moyen

F de Fisher

Pr > F

ETP

108868,911

108868,911

306,752

< 0,0001

SOLEIL

138071,254

138071,254

389,034

< 0,0001

61

La rgression repose sur des postulats dont labsence colinarit entre les variables explicatives. Toutefois, ce postulat est
viol mais la qualit du modle et sa conformit au terrain ont conduit conserver dans la fonction des variables lies sans
altrer la pertinence du modle. Cette situation est bien connue dans la littrature scientifique avec par exemple Kennedy,
P., 1992, A Guide to Econometrics, Blackwell Publishers, 410 p. et Conlisk, J., 1971, When collinearity is desirable:
Western Economic Journal, v. 9, p. 393-407.
__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

164

Chapitre VI : Modlisation de la distribution spatiale des formes molculaires M et S dAn. gambiae


________________________________________________________________________________________________________________

NDVI

14242,607

14242,607

40,130

< 0,0001

Tableau 33 : Analyse du modle (Type III SS)


Source

ddl

Somme des carrs

Carr moyen

F de Fisher

Pr > F

ETP

8839,892

8839,892

24,908

< 0,0001

SOLEIL

34816,671

34816,671

98,101

< 0,0001

NDVI

14242,607

14242,607

40,130

< 0,0001

Les probabilits associes ces tests sont toutes infrieures 0,0001. Ce qui permet de dire que les trois
variables, dans un ordre ou non, apportent chacune une quantit dinformations significatives au modle.
Puisque les variables sont pertinentes par rapport au modle du fait de la significativit de la quantit
dinformations apportes, les paramtres du modle peuvent tre prsents (Tableau 34).

Tableau 34 : Paramtres du modle de distribution dAn. gambiae forme molculaire S


Paramtre

Valeur

Ecart-type t de Student

Pr > t

Borne infrieure 95 %

Borne suprieure 95 %

Constante

382,484

67,080

5,702

< 0,0001

250,372

514,596

ETP

0,713

0,143

4,991

< 0,0001

0,431

0,994

SOLEIL

-813,672

82,151

-9,905

< 0,0001

-975,465

-651,878

NDVI

0,701

0,111

6,335

< 0,0001

0,483

0,919

Le modle scrit : S = 382,484 + 0,713 x ETP -813,672 x SOLEIL + 0,701 x NDVI


Le pourcentage dAn. gambiae forme molculaire S dans lintervalle de variation de lETP, de
linsolation et de lactivit chlorophyllienne, peut sobtenir en additionnant la valeur de lactivit
chlorophyllienne multiplie par 0,701 linsolation, multiplie par -813,672 et lvapotranspiration
potentielle, multiplie par 0,713 une constante gale 382,484. Lensemble des paramtres
environnementaux intervenant dans le modle sont ceux associs laxe factoriel humidit aridit. Le
sud-ouest du Burkina Faso se prsente donc comme la zone prfrentielle pour An. gambiae forme
molculaire S.

VI.2.2.2 Le modle de distribution dAn. gambiae forme molculaire M

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

165

Chapitre VI : Modlisation de la distribution spatiale des formes molculaires M et S dAn. gambiae


________________________________________________________________________________________________________________

De la rgression ralise entre les pourcentages de la forme molculaire M dAn. gambiae et les donnes
environnementales, les trois modles se dgagent (le Tableau 35).

Tableau 35 : Valeur du coefficient de dtermination pour les 2 meilleurs modles


Modle

Nbr. dans le modle

Variable(s)

ETP NDVI

0,594

PRESSION SOLEIL NDVI

0,617

TOPO PRESSION SOLEIL NDVI

0,641

Le meilleur modle est le modle 3 avec un coefficient de dtermination de 0,641, car il a le


coefficient de dtermination le plus lev. Les coefficients associs ce modle sont consigns dans
le
Tableau 36 :

Tableau 36 : les coefficients dajustement pour le modle 3.


R (coefficient de corrlation)

0,800

R (coefficient de dtermination)

0,641

Raj. (coefficient de dtermination ajust)

0,635

SCR

73851,489

Il savre, la lecture de ce tableau, que 64,1% de la variance observe dans les pourcentages dAn.
gambiae forme molculaire S sexpliquent par la combinaison linaire de quatre variables que sont la
topographie (altitude), la pression, la vgtation et linsolation. Ces variables apportent une quantit
dinformations statistiquement significatives au modle. En tmoigne le test de Fisher ralis pour
valuer la qualit de linformation apporte par les variables. Les rsultats sont consigns dans le Tableau
37.

Tableau 37 : Evaluation de la valeur de l'information apporte par les variables (H0 = Y=Moy(Y))
Source

ddl

Somme des carrs

Carr moyen

F de Fisher

Pr > F

Modle

131709,350

32927,338

111,465

< 0,0001

Rsidus

250

73851,489

295,406

Total

254

205560,840

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

166

Chapitre VI : Modlisation de la distribution spatiale des formes molculaires M et S dAn. gambiae


________________________________________________________________________________________________________________

Il ressort, la lecture de ce tableau, que la probabilit associe au test de Fisher est infrieure 1%. Les
variables apportent une quantit dinformations significatives au modle plus de 99%.
Cette apprciation gnrale de la contribution des variables dans leur globalit pourrait cacher la faible
contribution dune des quatre variables intervenant dans le modle. Les tests de Fisher de Type I SS et
de Type III SS sont effectus pour valuer la contribution de chaque variable, dabord, dans lordre puis
de faon quelconque. Les rsultats de ces tests sont reports dans les Tableau 38 et Tableau 39.
Tableau 38 : Analyse du modle (Type I SS)
Somme des
Source

ddl

carrs

Carr moyen

F de Fisher

Pr > F

TOPO

13648,055

13648,055

46,201

< 0,0001

PRESSION

94782,658

94782,658

320,856

< 0,0001

SOLEIL

5452,629

5452,629

18,458

< 0,0001

NDVI

17826,008

17826,008

60,344

< 0,0001

Tableau 39 : Analyse du modle (Type III SS)


Somme des
Source

ddl

carrs

Carr moyen

F de Fisher

Pr > F

TOPO

4907,930

4907,930

16,614

< 0,0001

PRESSION

11375,484

11375,484

38,508

< 0,0001

SOLEIL

10053,822

10053,822

34,034

< 0,0001

NDVI

17826,008

17826,008

60,344

< 0,0001

Ils nous permettent de conclure, au regard des probabilits associes au test de Fisher, que les variables,
prises individuellement et quelque soit lordre, apportent une quantit dinformation significative au
modle. En effet, le test de probabilit associe chacune des variables prises dans lordre ou non est
infrieur 1%. Nous affirmons plus de 99%, que les variables altitude, pression, insolation et
vgtation apportent une quantit dinformations significatives llaboration du modle.
Fort de cette significativit de linformation utilise et de la contribution de chacune des variables, les
paramtres du modle sont les suivants (Tableau 40).

Tableau 40 : Paramtres du modle


Paramtre

Valeur

Ecart type

t de Student

Pr > t

Borne infrieure 95 %

Borne suprieure 95 %

958,241

128,165

7,477

< 0,0001

705,820

1210,662

TOPO

-0,098

0,024

-4,076

< 0,0001

-0,146

-0,051

PRESSION

-17,389

2,802

-6,205

< 0,0001

-22,908

-11,870

Constante

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

167

Chapitre VI : Modlisation de la distribution spatiale des formes molculaires M et S dAn. gambiae


________________________________________________________________________________________________________________

SOLEIL
NDVI

-687,661

117,874

-5,834

< 0,0001

-919,814

-455,508

-0,832

0,107

-7,768

< 0,0001

-1,042

-0,621

L'quation du modle scrit de la faon suivante :


M = 958,241 -0,098 x TOPO -17,389 x PRESSION -687,661 x SOLEIL -0,832 x NDVI
Le pourcentage dAn. gambiae forme molculaire M peut tre dduit en additionnant la constante
958,241 laltitude, la pression, linsolation et la vgtation respectivement multiplies par -0,098 ;
-17,389 ; -687,661 et -0,832 (dans lintervalle de variation dfini dans le tableau consacr aux
paramtres du modle, au seuil de confiance de 95%). Nous constatons aussi que les paramtres utiliss
sont ceux associs laxe factoriel 1, laxe humidit aridit. La topographie (altitude) est associe
laxe factoriel 1 mais aussi laxe factoriel 4 o elle a la meilleure contribution.
Laugmentation du nombre de variable dans le modle doubl dune diminution du coefficient de
dtermination de plus 10 points par rapport au modle dAn. gambiae forme molculaire S, montre quil
a t plus difficile de modliser An. gambiae forme molculaire S que An. gambiae forme molculaire
M. La forme molculaire M est plus htrogne que la forme S (Manguin et al., 1999; Tour et al.,
1991).

VI.3

EVALUATION DES MODELES

Lanalyse de la contribution globale puis individuelle des variables et celle des coefficients permettent
dapprcier la qualit de linformation par rapport au modle. Lvaluation du modle aide apprcier la
compatibilit du modle par rapport la ralit du terrain. Cette valuation va se faire de deux
manires : lanalyse des rsidus et la comparaison des rsultats du modle thorique avec des donnes
empiriques.

VI.3.1 ANALYSE DES RESIDUS


Lvaluation par analyse de rsidus est une valuation statistique. La validit dun modle linaire
suppose au plan statistique que les rsidus suivent une loi normale. Le seuil de confiance retenu est de
95%. A ce seuil, les individus ayant des valeurs de rsidus centrs rduits situes en dehors de
lintervalle ]1,96 et -1,96[ doivent reprsenter au plus 5% de lensemble de lchantillon

VI.3.1.1 Analyse des rsidus pour An. gambiae forme molculaire S


__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

168

Chapitre VI : Modlisation de la distribution spatiale des formes molculaires M et S dAn. gambiae


________________________________________________________________________________________________________________

Pour An. gambiae forme molculaire S, les valeurs de rsidus centrs rduits sont reprsentes sur la
Figure 55.
Rsidus centrs-rduits
Ouezzindo ug
Tchemo ko
Salbisgo
Ouo lo nko to
M o gueya
Lao le
Kaniagara
Gado
Danpan
B o ro mo
B adado ugo u
Yibi
Tapo a
B o uno u
P o uytenga
M atiaco ali
Ko ualo u
Go udrin
Dwana
B o umtenga
B assambili
To nga
P issiga
Lere
Gassel P art
A ribinda
-5

-4

-3

-2

-1

R s idus c e nt r s - r duit s

Figure 55 : Histogramme des rsidus centrs rduits pour An. gambiae forme molculaire S

Le Tableau 41 contient la liste des localits qui ont des pourcentages dAn. gambiae forme molculaire S
anormaux.
Tableau 41 : Liste des localits ayant des rsidus anormaux pour An. gambiae forme molculaire S
Rsidus
%S
Individus Poids empirique % S (Modle)

Rsidus

centrs- Interv. Inf.

Interv. Sup. Interv. Inf. Interv. Su

rduits

Moy.

Moy.

Ind.

Ind.

Koassa

88,235

34,459

53,776

2,854

32,001

36,918

-2,725

71,644

Lantaogo

88,889

35,321

53,568

2,843

32,840

37,801

-1,865

72,506

Tapoa

19,231

77,968

-58,737

-3,118

70,792

85,143

40,177

115,758

Zinekwe

84,211

42,301

41,910

2,225

38,870

45,731

5,040

79,562

Alana

44,444

91,558

-47,114

-2,501

84,254

98,862

53,743

129,373

Mogueya

4,348

83,045

-78,697

-4,177

79,093

86,997

45,732

120,358

Monkui

0,000

53,876

-53,876

-2,860

50,905

56,846

16,654

91,097

Rabyiri

77,778

30,941

46,837

2,486

27,796

34,085

-6,295

68,176

Tomo

92,857

39,354

53,503

2,840

35,508

43,200

2,052

76,655

Timba

54,167

95,185

-41,018

-2,177

87,977

102,393

57,389

132,981

Sur les 255 individus de lchantillon, 10 ont des rsidus centrs rduits situs en dehors de lintervalle
]-1,96 ; 1,96[, soit 4%. Puisque 4% est infrieure 5%, le modle est donc une bonne approximation de
la distribution et reste valable au seuil de confiance de 95%.
__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

169

Chapitre VI : Modlisation de la distribution spatiale des formes molculaires M et S dAn. gambiae


________________________________________________________________________________________________________________

Ce premier niveau de validation du modle donne la possibilit de production dune carte thorique de la
distribution de la forme molculaire S dAn. gambiae s.s. au Burkina Faso (Figure 56). Nous observons
sur cette carte des zones trs homognes de pourcentage de la forme molculaire S dAn. gambiae s.s..
En dehors de quelques lots trs restreints, surtout dans la partie nord du pays, les pourcentages prdits
sont disposs en bandes, avec une augmentation quasi rgulire du nord vers le sud-ouest. Cette
structure rubane est trs semblable celle que prsentent certains lments du milieu physique comme
les

tempratures,

les

prcipitations,

la

vgtation

(Figure

6,

Figure

8,

Figure 9, Figure 10, Figure 11, Figure 13 et Figure 14).

Figure 56 : Prdiction de la distribution spatiale des abondances relatives dAn. gambiae forme molculaire S

Nous pouvons donc dire que lenvironnement prsente une qualit dcroissante pour An. gambiae forme
molculaire S au fur mesure que lon va du nord vers le sud-ouest. Le nord nest donc pas favorable
la prolifration de la forme molculaire S. Toutefois, une mosaque de peuplements isols se trouve dans
certaines parties du nord (Figure 57).

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

170

Chapitre VI : Modlisation de la distribution spatiale des formes molculaires M et S dAn. gambiae


________________________________________________________________________________________________________________

Figure 57 : les zones de discontinuit dans la rpartition de la forme molculaire S et hydrographie.

Ces discontinuits observes correspondent lexistence de bas-fonds importants. Lhumidit est ainsi
confirme comme le facteur dterminant de la distribution dAn. gambiae forme molculaire S. Cette
mme continuit sera-t-elle observable pour An. gambiae forme molculaire M, si le modle est valid
au plan statistique ?

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

171

Chapitre VI : Modlisation de la distribution spatiale des formes molculaires M et S dAn. gambiae


________________________________________________________________________________________________________________

VI.3.1.2 Analyse des rsidus pour An. gambiae forme molculaire M


Pour An. gambiae forme molculaire M, la Figure 58 prsente le diagramme des rsidus centrs rduits.
Rsidus centrs-rduits pour An. gambiae type M
Ouezzindo ug
Tchemo ko
Salbisgo
Ouo lo nko to
M o gueya
Lao le
Kaniagara
Gado
Danpan
B o ro mo
B adado ugo u
Yibi
Tapo a
B o uno u
P o uytenga
M atiaco ali
Ko ualo u
Go udrin
Dwana
B o umtenga
B assambili
To nga
P issiga
Lere
Gassel P art
A ribinda
-3

-2

-1

R s idus c e nt r s - r duit s

Figure 58 : Histogramme des rsidus centrs rduits pour An. gambiae forme molculaire M

Certains individus, sur ce graphique, ont des valeurs situes lextrieur de lintervalle de]-1,96 ; 1,96[.
Le tableau suivant contient les informations sur les individus de la distribution qui ont des valeurs
anormalement leves ou anormalement basses.

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

172

Chapitre VI : Modlisation de la distribution spatiale des formes molculaires M et S dAn. gambiae


________________________________________________________________________________________________________________

Tableau 42 : Liste des localits ayant des rsidus anormaux pour An. gambiae forme molculaire M
Rsidus

Individus

Poids

%_M

%_M (Modle)

Rsidus

centrs-

Interv. Inf.

Interv. Sup.

rduits

Moy.

Moy.

Interv. Sup.
Interv. Inf. In Ind.

Niounougou

90,909

44,819

46,090

2,682

41,698

47,941

10,825

78,813

Ouenbouloug

81,250

40,459

40,791

2,373

37,270

Tougouri

88,000

52,946

35,054

2,040

49,591

43,647

6,459

74,459

56,300

18,930

86,962

Belmin

60,870

26,633

34,237

1,992

22,693

Fingla

63,158

19,286

43,872

2,553

15,219

30,572

-7,446

60,712

23,354

-14,808

53,380

Goumaogo

44,444

-0,599

45,044

2,621

-5,824

4,626

-34,850

33,652

Tamassogo

88,000

53,826

34,174

1,988

50,278

57,374

19,790

87,862

Tapoa

53,846

16,480

37,366

2,174

9,674

23,287

-18,048

51,008

You

5,263

47,106

-41,843

-2,434

41,362

52,849

12,771

81,440

Alana

55,556

21,248

34,308

1,996

14,379

28,117

-13,293

55,788

Badara

88,235

45,372

42,863

2,494

40,279

50,465

11,140

79,603

Iboudie

66,667

32,399

34,268

1,994

29,362

35,435

-1,588

66,385

Monkui

71,429

36,709

34,720

2,020

32,116

41,302

2,548

70,870

Sandimisso

43,750

6,104

37,646

2,190

1,363

10,845

-28,077

40,285

Sur les 255 individus que compte la distribution, 14 ont des valeurs hors de lintervalle de confiance soit
5%. Nous retenons donc que le modle, dans lintervalle de confiance retenu, est une bonne
approximation de la distribution. Ce rsultat en validant statistiquement le modle permet de produire
une carte de distribution de la forme molculaire M dAn. gambiae s.s. (Figure 59).

Figure 59 : Prdiction de la distribution spatiale des abondances relatives dAn. gambiae forme molculaire M

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

173

Chapitre VI : Modlisation de la distribution spatiale des formes molculaires M et S dAn. gambiae


________________________________________________________________________________________________________________

La distribution des abondances relatives de la forme molculaire M dAn. gambiae s.s. prsente
galement une forme rubane mais moins lisse, comparativement An. gambiae forme molculaire S. Il
y a, en effet, beaucoup plus de poches de peuplement dans la zone dfavorable du sud-ouest. Au regard
de la densit des poches observes, le sud-ouest nest pas totalement dfavorable la forme molculaire
M dAn. gambiae. Une observation plus pousse permet de remarquer que ce sont les zones daltitudes
les plus leves du pays qui ont des valeurs nulles. Ces poches correspondent galement des rserves
(forts classes). Elles prsentent les conditions les moins favorables lcologie de la forme
molculaire M, puisque le modle y prdit des abondances relatives nulles. Au fond, il sagit des zones
les plus humides. Cela suggre une plus grande plasticit cologique de la forme molculaire M par
rapport la forme molculaire S. Cela montre galement la sensibilit de la forme molculaire M par
rapport des conditions dhumidit trs leves. En effet, les facis introduient par la topographie
(altitude) et la vgtation (les zones de rserve ont les NDVI les plus levs) voquent les conditions
dhumidit les plus fortes (Figure 60).

Figure 60 : Discontinuit de la rpartition de la forme molculaire M dAn. gambiae s.s., Altitude et NDVI

Cette situation permet de comprendre la prise en compte des altitudes dans la dtermination de la
distribution. Elle montre galement que les facteurs cologiques invoquant lhumidit/aridit demeurent
__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

174

Chapitre VI : Modlisation de la distribution spatiale des formes molculaires M et S dAn. gambiae


________________________________________________________________________________________________________________

les dterminants les plus importants dans la rpartition des formes molculaires S et M dAn. gambiae
s.s.. Toutefois, la forme molculaire M prsente une plus grande capacit dadaptation lhumidit que
la forme molculaire S laridit.
Lanalyse des rsidus a conduit une validation statistique de fonctions qui modlisent la distribution
spatiale des formes molculaire S et M dAn. gambiae s.s.. Lanalyse des cartes issues de ces modles
confirme les paramtres associs laridit et lhumidit comme les facteurs cologiques les plus
dterminants dans la distribution spatiale de ces vecteurs du paludisme. Il apparat galement lanalyse
que la forme molculaire M est plus rsistante la variabilit du milieu que la forme S.
Sur le plan statistique, ces modles sont valables. Mais cette validit peut-elle tre confirme par les
donnes empiriques, non utilises dans la modlisation. Comment se comportent les modles face aux
donnes de terrain ?
VI.3.2 CONFRONTATION DES DONNEES DES MODELES AUX DONNEES
EMPIRIQUES
Pour confronter les rsultats aux modles, 45 points ont t tirs au hasard sur les 300 points que
comptait le transect. Ces 45 points, soit 15% de lchantillon, ont t rservs pour confronter les
modles aux donnes empiriques.
VI.3.2.1

Confrontation du modle dAn. gambiae forme molculaire S la

vrit terrain
Pour An. gambiae forme molculaire S (Figure 61), le coefficient de corrlation entre la distribution
observe et la distribution prdite est de 0,81. Le coefficient de corrlation est positif et trs lev. Ce
qui signifie que les valeurs voluent dans le mme sens que les valeurs observes.

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

175

Chapitre VI : Modlisation de la distribution spatiale des formes molculaires M et S dAn. gambiae


________________________________________________________________________________________________________________

120
100
DONNEES OBSERVEES

M PREDIT X S PREDIT

REGRESSION ENTRE S PREDIT ET S OBSERVE

80
60
40
20

R = 0,816
0
0

10

20

30

40

50

60

70

80

90

100

DONNEES PREDITES PAR LE MODELE

-20

Figure 61 : Corrlation entre pourcentage de S prdit par le modle et pourcentage S observ.

Aprs observation du coefficient de corrlation, le Test de Kolmogorov-Smirnov sur deux chantillons /


Test bilatral a t effectu pour vrifier si la distribution empirique tait significativement diffrente de
la distribution prdite par le modle ou pas.
Les donnes dentre dans le test prsentent les caractristiques suivantes (Tableau 43).
Tableau 43 : Caractristiques des donnes utilises pour le test de Kolmogorov-Smirov

Variable
POURC_S

Observation
45

Obs. avec donnes


manquantes
0

S_PREDIT

45

Obs. sans
donnes
manquantes
45

Minimum
0,000

45

-12,573

EcartMaximum Moyenne type


100,000
57,784
35,324
101,954

50,874

33,473

Les rsultats du test sont les suivants (Tableau 44 et la Figure 62).


Tableau 44 : Test de Kolmogorov-Smirnov pour la forme molculaire S
D

0,244

P-value
alpha

0,115
0,05

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

176

Chapitre VI : Modlisation de la distribution spatiale des formes molculaires M et S dAn. gambiae


________________________________________________________________________________________________________________

1
0,9

Frquence cumule

0,8
0,7
0,6
0,5
0,4
0,3
0,2
0,1
0
-10

10

30

50
POURC_S

70

90

S_PREDIT x OBSERVE

Figure 62 : Comparaison des pourcentages observs avec des pourcentages prdits de la forme molculaire S

La diffrence D entre les deux chantillons est 0,244 sur une chelle de 0 1. La diffrence est proche
de 0, le niveau de ressemblance maximum, le niveau didentit parfaite. La p-Value est aussi suprieure
au seuil de confiance. Les carts entre la distribution calcule et la distribution observe ne sont donc
pas significatifs. Ce dernier contrle confirme la validit du modle pour la forme molculaire S dAn.
gambiae s.s..

VI.3.2.2

Confrontation du modle dAn. gambiae forme molculaire M la

vrit terrain
100

DONNEES OBSERVEES

90
80
M PREDIT X M OBSERVE

REGRESSION ENTRE M PREDIT ET M OBSERVE

70
60
50
40
30
20

R = 0,737

10
0
-10

10

20

30

40

50

60

70

80

90

100

DONNEES PREDITES PAR LE MODELE

Figure 63 : Corrlation entre pourcentages de M prdits par le modle et pourcentages M observs

Pour la forme molculaire M (Figure 63), la corrlation entre les valeurs de pourcentages prdits par le
modle et celles observes sur le terrain est de 0,73.
__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

177

Chapitre VI : Modlisation de la distribution spatiale des formes molculaires M et S dAn. gambiae


________________________________________________________________________________________________________________

Ce coefficient est galement positif. Les donnes prdites sont trs bien corrles avec les donnes
observes. Les modles sont donc de bons prdicateurs des valeurs observes. Le Test de KolmogorovSmirnov sur deux chantillons / test bilatral effectu entre les donnes calcules avec le modle et les
donnes empiriques est effectu. Lobjectif de ce test est de vrifier sil y a une diffrence significative
entre elles. Les donnes utilises pour ce test prsentent les caractristiques suivantes (Tableau 45).

Tableau 45 : Caractristiques des donnes test de Kolmogorov-Smirnov pour la forme molculaire M

Variable

Observations

POURC_M
M_PREDIT x
OBSERVE

Obs. avec
Obs. sans
donnes
donnes
manquantes manquantes

Minimum

Maximum

Moyenne

Ecart-type

45

45

100

19

27

45

45

-2,8

87,5

20,5

22,5

Le test de Kolmogorov-Smirnov donne les rsultats suivants (Tableau 46 et Figure 64)


Tableau 46 : Test de Kolmogorov-Smirnov pour la forme molculaire M
D
p-value
alpha

0,200
0,295
0,05

1
0,9
0,8
Frquence cumule

0,7
0,6
0,5
0,4
0,3
0,2
0,1
0
-5

15

35

55
POURC_M

75

95

M_PREDIT x OBSERVE

Figure 64 : Comparaison des pourcentages observs avec les frquences prdites de la forme molculaire M

La diffrence D sur une chelle de 0 1, entre les deux chantillons est 0,244. Cette diffrence est faible
car plus proche de 0 (valeur au cas didentit parfaite). La P-value est de 0,295 et est suprieure au seuil
de confiance qui est de 0,05. La diffrence entre les donnes calcules et les donnes observes nest pas
significative. Ce test confirme que le modle est valable pour lvaluation de la distribution spatiale de la
forme molculaire M dAn. gambiae s.s..
__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

178

Chapitre VI : Modlisation de la distribution spatiale des formes molculaires M et S dAn. gambiae


________________________________________________________________________________________________________________

Il est bon dobserver (Figure 65) que les valeurs prdites par le modle de S et celles prdites par le
modle M ont un coefficient de corrlation de -0,84.

90
80
70
M PREDIT x S PREDIT

TENDANCE ENTRE M PREDIT ET S PREDIT

PREDIT S

60
50

R = - 0,848

40
30
20
10
0
-10

10

30

-10

PREDIT M

50

70

90

Figure 65 : Corrlation entre pourcentages de S prdits et pourcentage de M prdits

Cela signifie que le modle produit pour la forme molculaire S dAn. gambiae s.s. est pratiquement
loppos de celui produit pour la forme molculaire M dAn. gambiae s.s.. Lorsque le pourcentage dAn.
gambiae forme molculaire S augmente en un lieu, celui dAn. gambiae forme molculaire M diminue.
Nous en dduisons une opposition des prfrences cologiques entre les formes molculaires M et S
dAn. gambiae s.s.. La forme molculaire S prfre les milieux humides alors que la forme molculaire
M prfre les milieux plus arides.
Ces derniers rsultats confirment lhypothse de dpart selon laquelle il est possible de prdire la
population des deux formes molculaires M et S dAn. gambiae s.s., partir dune connaissance des
facteurs environnementaux les plus dterminants dans leur distribution spatiale. Ces paramtres sont le
NDVI, linsolation, lETP, la pression et la topographie (altitude). Ils confirment galement lopposition
entre les deux formes molculaires dAn. gambiae s.s. comme nous la montr la forte corrlation
ngative entre les valeurs prdites par les deux modles ainsi que la distribution spatiale oppose.

CONCLUSION DU CHAPITRE VI
Ce chapitre rvle lexpression des abondances relatives des formes molculaires M et S en fonction de
quatre et trois facteurs environnementaux. Il a cependant t plus difficile de modliser la forme

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

179

Chapitre VI : Modlisation de la distribution spatiale des formes molculaires M et S dAn. gambiae


________________________________________________________________________________________________________________

molculaire M par rapport la forme molculaire S. Il a fallu plus des paramtres pour modliser la
distribution spatiale de la forme molculaire

M que

pour la forme molculaire S. Malgr

laugmentation du nombre de variables pour la forme molculaire M, le modle de S a un coefficient de


dtermination plus lev. Il est probable que la relative difficult de modlisation de forme molculaire
M dAn. gambiae s.s. par rapport la forme molculaire S provienne de la forte variabilit quon
observe en son sein ainsi que sa capacit coloniser une grande variabilit, quil soit en zone sche ou
en zone humide Manguin et al., (1999); Tour et al., (1991). Ces fonctions de rpartition de la
distribution spatiale ont t inverses et des cartes de distribution spatiale de chacune des formes
molculaires M et S dAn. gambiae s.s. ont t produites. Lvaluation de la qualit des modles partir
de lanalyse de rsidus tait satisfaisante. La comparaison entre les donnes prdites par le modle et les
donnes de terrain, non utilises pour la modlisation ne prsente pas de diffrence significative. Le
modle est donc valid par confrontation avec les donnes observes. Ces rsultats confirment la
troisime hypothse selon laquelle il est possible, connaissant certains paramtres dun milieu,
danticiper sur les frquences de population de forme molculaire M et S dans ce milieu.

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

180

Conclusion Gnrale
________________________________________________________________________________________________________________

CONCLUSION GENERALE
Lintrt de ce travail est de contribuer la lutte contre lune des maladies les plus meurtrires de
notre temps, en menant des investigations sur lun des maillons de sa chane de transmission : les
vecteurs. Maladie parasitaire, maladie transmission vectorielle, la stratgie de lutte contre le
paludisme ne peut se soustraire du contrle de la faune anophlienne, qui elle dpend, pour une part
importante, de la capacit de lenvironnement lui offrir les conditions cologiques favorables sa
survie et sa reproduction.
Cette tude a eu pour objectifs de dcrire lorganisation spatiale des formes molculaires M et S
dAn. gambiae au Burkina Faso et den identifier les facteurs dterminants. Elle visait galement
produire des modles de distribution spatiale des espces vises.
Le paradigme de la biogographie, enrichi des apports indispensables de lentomologie et des outils
et mthodes de lanalyse spatiale, de lanalyse de donnes statistiques et des systmes dinformation
gographique, a permis de structurer la rflexion autour de la distribution spatiale des formes
molculaires M et S dAn. gambiae s.s. dans une perspective pluridisciplinaire.
Ce travail de recherche a montr que les formes molculaires M et S dAn. gambiae s.s. sont reparties
au Burkina Faso en trois grandes zones. Le nord et le nord-est du pays, correspondant aux rgions
administratives du Sahel, du Centre-Nord et du Nord, est la zone o prdomine la molculaire M.
Dans le sud-ouest et le sud du Faso ouvrant les rgions du Sud-Ouest, des Cascades et des HautsBassins, la forme molculaire S est largement dominante. Entre ces deux zones de concentrations
stend une zone de transition.
Deux groupes de facteurs environnementaux opposs caractrisent les zones de concentration et
influencent de faon significative la distribution spatiale des deux formes molculaires. Le premier
groupe de facteurs est li lhumidit et se compose de la prcipitation, de la vgtation et de la
pression. Le second groupe voque plutt laridit et se compose de linsolation, de la temprature,
de lvapotranspiration potentielle et du vent. Les deux formes molculaires prsentent des gradients
opposs dans leurs abondances relatives le long de laxe humidit aridit.

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

181

Conclusion Gnrale
________________________________________________________________________________________________________________

A partir de ces facteurs dterminants de lorganisation spatiale des deux formes molculaires, deux
modles de distribution spatiale (un modle pour chaque forme molculaire) ont t raliss. Ces
modles ont permis, par inversion des fonctions, la ralisation dune carte de distribution spatiale des
abondances relatives des formes molculaires M et S sur lensemble du Burkina Faso.
Au regard de ces rsultats, nous pouvons affirmer que lhypothse de distribution non alatoire de
formes molculaires M et S est prouve. Les facteurs environnementaux sont les dterminants de
cette distribution. Ils y contribuent toutefois de faon diffrentielle, certains facteurs tant moins
dterminants que dautres. Ceci confirme la seconde hypothse de cette tude. La troisime
hypothse, celle de la possibilit de mise en quation des abondances et des facteurs
environnementaux est aussi dmontre. Lopposition entre prfrences cologiques des formes
molculaires M et S est galement vrifie, mme si la fonction de rpartition de lun nest pas
loppos sensu stricto de lautre. Les objectifs fixs au dpart de ce travail de recherche sont atteints.
Des descriptions cartographiques et statistiques de la distribution spatiale des deux formes
molculaires M et S, sont disponibles. Des modles de distribution spatiale valids la fois au plan
statistique et au plan empirique ont t mis au point.
Le niveau datteinte des objectifs et de validation des hypothses voudrait que lon regarde la
mthodologie utilise avec intrt. Elle met en uvre un ensemble de processus qui pourraient tre
rpliqus bon escient sur dautres sites et pour dautres vecteurs de maladies. En combinant dans
une dmarche gographique, lanalyse spatiale, lanalyse de donnes, les systmes dinformation
gographique et lentomologie, ce travail constitue un point de renouvellement

des mthodes

gographiques dans lanalyse des problmes de sant, particulirement dans leurs aspects
environnementaux.
En dpit de ces rsultats, ce travail a des limites quil convient de relever. La premire porte sur la
temporalit et la seconde sur la variation des chelles. Pour ce qui concerne la temporalit, une
question simple portant sur la validit du modle en saison sche peut tre pose. En effet, les
conditions environnementales de la zone nord du pays pendant la saison pluvieuse pourraient tre
ralises en saison sche dans certaines rgions du sud-ouest. Il pourrait tre intressant denvisager
un suivi dans le temps et de prendre en compte la variable temporelle dans la modlisation. Pour ce
qui concerne les niveaux gographiques, la mise en vidence dagrgats spatiaux sur des tendues de
superficie rduite mrite que lon sinterroge sur les conditions particulires qui justifient de telles
singularits. En effet les rsidus du modle ont mis en exergue des localits atypiques qui

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

182

Conclusion Gnrale
________________________________________________________________________________________________________________

mriteraient une attention particulire et cela nest pas envisageable au niveau dchelle auquel cette
tude a t ralise.
Ce travail, au del des limites qui viennent dtre voques, ouvre des perspectives de recherche
aussi bien en entomologie quen gographie. Il sagit dune rflexion sur les possibilits d'adaptation
des mthodes de lutte antivectorielle en fonction des espces en prsence. En dautres termes, une
rgionalisation des techniques est envisageable. Cela suppose des tudes plus approfondies sur
lthologie des vecteurs, sur la sensibilit des formes molculaires aux diffrentes mthodes de lutte,
depuis le choix des insecticides pour la pulvrisation intra domiciliaire jusquaux moustiquaires
imprgnes en passant par les priodes de pulvrisation, la gestion des plans deau, etc.
Sans vouloir sinstaller dans un mirage dradication du paludisme et de contrle immdiat de la
population anophlienne au Burkina Faso, cette tude veut apporter un autre regard sur les questions
environnement et sant en clairant, sous un angle gographique, les dcideurs et les chercheurs
qui sinvestissent dans la lutte antivectorielle.

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

183

Bibliographie
________________________________________________________________________________________________________________

BIBLIOGRAPHIE
Anyamba, A., Linthicum, K.J., et Tucker, C.J., 2001, Climate-disease connections: Rift Valley Fever in Kenya. :
Cadernos de Sade Pblica, v. 17, p. 133-140.
Arnaud, M., et Emery, X., 2000, Estimation et interpolation spatiale, Mthodes dterministes et mthodes
gostatistiques, 221 p.
Aubry, P., 2000, Le traitement des variables rgionalises en cologie apports de la gomatique et de la gostatistique:
Thse de Doctorat, Universit Claude Bernard - Lyon 1, p. 480.
Balenghien, T., 2006, De l'identification des vecteurs du virus West Nile la modlisation du risque d'infection dans le
sud de la France [Thse de doctorat, thesis], Universit Des Sciences Des Technologies et De La Sant De
Grenoble, 223 p.
Banos, A., 2001, A propos de l'analyse spatiale exploratoire des donnes: Cybergeo : European Journal of Geography,
v. document 197.
Barrett, A., et Frank, 2000, Finke's 1792 map of human diseases: the first world disease map?: Social Science &
Medicine, v. 50, p. 915-921.
Bavoux, J.-J., 2007, La gographie Objet, mthodes, dbats, p. 239.
Bedard, Y., et Valliere, D., 1995, Qualit des donnes Rfrence Spatiale dans un contexte gouvernemental: Laval
Canada, Universit de Laval.
Binka, F.N., Kubaje, A., Adjuik, M., Williams, L.A., Lengeler, C., Maude, G.E., Kajihara, B., Adjamah, J.H., et
P.G.Smith, 1996, Impact of permethrin impregnated bednets on child mortality in Kassena-Nankana district,
Ghana: a randomized controlled trial: Trop Med int Health, v. 1, p. 147-154.
Biteau, F.C.., 2006, Surveillance et valuation du risque de transmission des maladies vectorielles mergentes : apport
de la capacit vectorielle Exemple de la fivre catarrhale du mouton [Epidmiologie thesis], Doctorat de
L'Universit Montpellier II
Bonn, F., 1991, Prcis de tldtection, Principes et mthodes, Presse Universitaire du Qubec, 485 pages p.
Bouyer, J., 2006, Ecologie des glossines du Mouhoun au Burkina Faso : intrt pour l'pidmiologie et le contrle des
trypanosomoses africaines [Thse de Doctorat thesis], Universit Montpellier II, 204 p
Bouzou, I.M., Som, C.Y.S., Nonguierma, A., et Royer, A., 2001, Evaluation et suivi des plans deau de surface par
tldtection dans le bassin de Loumbila au Burkina Faso: Revue Scheresse v. 12, p. 31-36.
Bruce-Chwatt, L.J., et Zulueta, J.D., 1985, Essential Malariology: W. Heinemann med. Books Ldt, London, v. chap. 8,
p. 166-209.
Brunet, R., 2000a, Des modles en gographie ? Sens d'une recherche,: Bulletin de la Socit de Gographie de Lige,
v. n2, p. 21-30.
, 2000b, Des modles en gographie ? Sens d'une recherche, Bulletin de la Socit de Gographie de Lige, v. Vol.2,
p. Pages 21-30.
Brunet, R., Ferras, R., et Thery, H., 1993, Les mots de la gographie : dictionnaire critique: Montpellier-Paris, DDIPR
franaise, 470 p.
Carlson, J., Olson, K., Higgs, S., et Beaty, B., 1995, Molecular genetic manipulation of mosquito vectors: Annual
Review of Entomology, v. 40, p. 359-388.
Chamussy, J., Charre, J., Durand, M.G., et Le-Berre, M., 1977, Espace, que de brouillons commet-on en son nom:
Brouillon Dupont, v. n1.
Charlwood, J.D., et Edoh, D., 1996, Polymerase chain reaction used to describe larval habitat use by Anopheles
gambiae complex (Diptera, Culicidae) in the environs of Ifakara, Tanzania: Journal of Medical Entomology,
v. 33, p. 202-204.
Charmot, G., 1987, La chimoirsitance de Plasmodium falciparum: Bull. Soc. Path Ex, v. 80, p. 411-413.
Chauvet, G., Davidson, G., et Coz, J., 1969, Le complexe Anopheles gambiae en Afrique Continentale et
Madagascar: Cah. ORSTOM, Srie Ent. Md. et Parasitologie, , v. 7, p. 9-12.
Ciattoni, A., Beucher, S., et Reghezza, M., 2005, La gographie : pourquoi ? Comment ?
Objets et dmarches de la gographie d'aujourd'hui, Hatier.
Claritas, 2002, Aides en ligne de Vertical Mapper pour Mapinfo.
Collins, F.H., Mendez, M.A., Rasmussen, M.O., Mehaffey, P.C., Besansky, N.J., et Finnerty, V., 1987, A ribosomal
RNA gene probe differentiates member species of the Anopheles gambiae complex: Am. J. Trop. Med. Hyg.,
v. 37(1), p. 37-41.
Coluzzi, M., 2002, Plasmodium falciparum en Afrique subsaharienne. Spciation rcente des vecteurs, transmissibilit,
volution de la pathogense contrle de la malaria et capacit vectorielle. : Ann. Inst. Pasteur Actualites, p.
81-99.
Coluzzi, M., et Sabatini, A., 1967, Cytogenetic observations on sp. A and B of the Anopheles gambiae complex:
Parassitologia, v. 9, p. 73-88.
, 1968a, Cytogenetic observations on species C, merus and melas of the Anopheles gambiae complex.: Cah.
ORSTOM Ent. Md.
, v. 6: , p. 211-213.
__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

184

Bibliographie
________________________________________________________________________________________________________________

, 1968b, Cytogenetic observations on species C of the Anopheles gambiae complex: Parassitologia v. 10, p. 155165.
Coluzzi, M., Sabatini, A., Petrarca, V., et Deco, M.A.D., 1979, Chromosomal differentiation and adaptation to human
environnements in the Anopheles gambiae complex. : Trans. Of the Roy. Soc. Of Trop. Med. and Hyg., v. 73:,
p. 483-497.
Conlisk, J., 1971, When collinearity is desirable: Western Economic Journal, v. 9, p. 393-407.
Costantini, C., Ayala, D., Guelbeogo, W.M., Pombi, M., Som, C.Y., Bassole, I.H., Ose, K., Fotsing, J.-M., Sagnon,
N.F., Fontenille, D., Besansky, N.J., et Simard, F., 2009, Living at the edge: biogeographic patterns of habitat
segregation conform to speciation by niche expansion in Anopheles gambiae: BioMed Center Ecology, v.
9:16.
Costantini, C., Sagnon, N.F., Della, T.A., M., D., J., B., Gibson, G., et M., C., 1998, Odor-mediated host preference of
West Africa mosquitoes, with particular preferences to malaria vectors: Am J Trop Med Hyg, v. 58, p. 56-63.
Coz, J., 1973, Contribution ltude du complexe Anopheles gambiae. Rpartition gographique et saisonnire en
Afrique de louest: Cahier ORSTOM, Srie Ent. Md. et Parasitologie, v. 9, p. 3-31.
Crampton, J.M., et Hill, S.M., 1993, DNA probes for identification of malaria vectors: Parassitologia, v. 35, p. 31-44.
Curtis, C.F., 1996, Impregnated bed nets, malaria control and child mortality in Africa: Tropical medicine and
international Health, v. 1, p. 137 - 138.
Dajoz, R., 2006, Prcis d'cologie, 631 p.
Davidson, G., 1964, Anopheles gambiae, a complex of species: Bull. Wld. Hlth. Org., p. 625.
Davidson, G., et Jakson, C., 1962, Incipient speciation in Anopheles gambiae Giles: Bull. Wld. Hlth. Org., v. 27, p.
303-305.
Davies, F.G., Kileulu, E., Linthicum, K.J., et Pegram, R.G., 1992, Patterns of Rift Valley fever activity in Zambia:
Epidemiology and Infections, v. 108, p. 185-191.
Devilliers, R., et Jeansoulin, R., 2005, Qualit de l'information gographique : Concepts gnraux: Qualit de
l'information gographique, v. IGAT, p. Pages 37-47.
Diabat, A., 1999, Evaluation de la rsistance des vecteurs du paludisme vis--vis des pyrthnodes au Burkina Faso
[Doctorat 3me Cycle thesis]: Ouagadougou, Universit de Ouagadougou.
Droesbeke, J.-J., Michel, L., et Gilbert, S., 2006, Analyse statistiques des donnes spatiales, 468 p.
Durand-Dasts, F., 2001, Les concepts de la modlisation en analyse spatiale: Modles en analyse spatiale, v. IGAT, p.
Pages 31-57.
ESRI, 2006, ArcGIS 9, Using ArcGIS Desktop.
Favia, G., Della, T.A., Bagayoko, M., Lanfrancotti, A., Sagnon, N.F., Tour, Y.T., et Coluzzi, M., 1997, Molecular
identification of sympatric chromosomal forms of Anopheles gambiae and further evidence of their
isolation. : Insect Molecular Biology v. 6(4), p. 377-383.
Favia, G., Lanfrancotti, A., Spanos, L.,et Coll, 2001, Molecular characterization of ribosomal DNA (rDNA)
polymorphisms discriminating chromosomal forms of Anopheles gambiea s.s. : Insect Mol Biol., v. 10, p. 1923.
Fontenille, D., Faye, O., Konate, L., Sy, N., et Collins, F., 1993, Comparaison des techniques PCR et cytogntique
pour la dtermination des membres du complexe Anopheles gambiae au Sngal. : Ann.Parasitol. Hum.
Comp. : . v. 68(5/6), p. 239-240.
Fontes, J., Diallo, A., et Compaor, J.A., 1994, Carte de la Vgtation Naturelle et de lOccupation du Sol - Burkina
Faso chelle 1 : 1.000.000.
.
Fontes, J., et Guinko, S., 1995, Carte de vgtation et d'occupation du sol du Burkina Faso. Notice explicative.,
Ministre de la coopration franaise projet Campus ICIV, IDR, 53 p.
Fotsing, J.-M., 2003, Qu'apportent les SIG la recherche scientifique ?: Colloque International Gomatique et
application,, v. Presses Universitaire d'Orlans N1, p. 13-14.
Franc, A., 2001, Formalisation mathmatique des interactions spatiales, Modles en analyse spatiale, Volume IGAT, p.
Pages 283-299.
Gillies, M.T., et Coetzee, M.C., 1987, A supplement to the Anophelinae of Africa south of the sahara (Afrotropical
region): publication of the south African institute for Medical Research, Johannesburg, v. volume 55 p.
143pp.
Gillies, M.T., et Meillon, B.D., 1968, The Anophelinae of Africa south of the sahara (Ethiopian Zoogeographical
region): The south African institute for Medical Research, Johannesburg, , v. 2nd Ed. , p. 343p.
Green, C., 1972, Cytological maps for the practical identification of females of the three freshwater species of the
Anopheles gambiae complex.: Ann. Trop. Med. Parasitol., v. 66, p. 143-147.
Guelbeogo, W.M., 1999, Etude du comportement des larves du complexe Anopheles gambiae et son impact sur les
interactions inter et intra-spcifiques [Mmoire de DEA. thesis]: Ouagadougou Burkina Faso, Universit de
Ouagadougou Burkina Faso,.
Guermond, Y., 2005, Modlisations en gographie, dterminisme et complexit, p. 389.
Guinko, S., 1984, Vgtation de Haute Volta [Doctorat d'Etat thesis]: Bordeaux, Bordeaux III.

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

185

Bibliographie
________________________________________________________________________________________________________________

Guisan, A., et Zimmermann, N.E., 2000, Prdictive habitat distribution models in ecology: Elsevier Ecological
modelling, v. 135, p. 147-186.
Gumuchian, H., et Marois, C., 2000, Initiation la recherche en gographie, Amnagement, dveloppement territorial,
environnement, p. 425.
Haggett, 1965, Locational Analysis in Human Geography.
Hamon, J., Adam, J.P., et Grjebine, A., 1956, Observation sur la rpartition et le comportement des anophles de
lAfrique Equatoriale franaise, du Cameroun et de lAfrique Occidentale. : Bulletin de lOrganisation
mondiale de la sant, , v. 15, p. 549-591.
Hendrickx, G., de-La-Rocque, S., Reid, R., et Wint, W., 2001, Spatial trypanosomosis management: from data-layers to
decision making. Trends Parasitology, v. 17, p. 35-41.
Hendrickx, G., Napala, A., Dao, B., Batawui, D., De-Deken, R., Vermeilen, A., Slingenbergh, J.H.W., et 1989, A
systematic approach to area-wide tsetse distribution and abundance maps. : Bulletin of Entomological
Research, v. 89, p. 231-244.
Holt, R.A., Subramanian, G.M., Halpern, A., Granger G. Sutton, Rosane Charlab, Nusskern, D.R., Wincker, P., Clark,
A.G., Ribeiro, J.M.C., Wides, R., Salzberg, S.L., Loftus, B., Yandell, M., Majoros, W.H., Rusch, D.B., Lai,
Z., Kraft, C.L., Abril, J.F., Anthouard, V., Arensburger, P., Atkinson, P.W., Baden, H., Berardinis, V.d.,
Baldwin, D., Benes, V., Biedler, J., Blass, C., Bolanos, R., Boscus, D., Barnstead, M., Cai, S., Center, A.,
Chatuverdi, K., Christophides, G.K., Chrystal, M.A., Clamp, M., Cravchik, A., Curwen, V., Dana, A.,
Delcher, A., Dew, I., Evans, C.A., Flanigan, M., Grundschober-Freimoser, A., Friedli, L., Gu, Z., Guan, P.,
Guigo, R., Hillenmeyer, M.E., Hladun, S.L., Hogan, J.R., Hong, Y.S., Hoover, J., Jaillon, O., Ke, Z., Kodira,
C., Kokoza, E., Koutsos, A., Letunic, I., Levitsky, A., Liang, Y., Lin, J.-J., Lobo, N.F., Lopez, J.R., Malek,
J.A., McIntosh, T.C., Meister, S., Miller, J., Mobarry, C., Mongin, E., Murphy, S.D., O'Brochta, D.A.,
Pfannkoch, C., Qi, R., Regier, M.A., Remington, K., Shao, H., Sharakhova, M.V., Sitter, C.D., Shetty, J.,
Smith, T.J., Strong, R., Sun, J., Thomasova, D., Ton, L.Q., Topalis, P., Tu, Z., Unger, M.F., Walenz, B.,
Wang, A., Wang, J., Wang, M., Wang, X., Woodford, K.J., Wortman, J.R., Wu, M., Yao, A., Zdobnov, E.M.,
Zhang, H., Zhao, Q., et al., 2002, The Genome Sequence of the Malaria Mosquito Anopheles gambiae
Science v. 298, p. 129 - 149.
Hunt, R.H., Coetzee, M., et Fettene, M., 1998, The Anopheles gambiae complex a new species from Ethiopia: Trans.
Of the Roy. Soc. Of Trop. Med. and Hyg., v. 92, p. 231-235.
Ilboudo-Sanogo, E., 2001, Influence des rideaux imprgns dinsecticides sur les paramtres entomologiques de la
transmission du paludisme en zone rurale au Burkina Faso. [Doctorat Unique thesis]: Ouagadougou,
Universit de Ouagadougou
Jambou M., 1999, Mthodes de base de l'analyse des donnes, p. 412.
Joost, S., 2006, The geographical dimension of genetic diversity: a giscience contribution for the conservation, of
animal genetic resources: Thse de Doctorat, cole Polytechnique Fdrale de Lausanne, p. 178.
Kennedy, P., 1992, A Guide to Econometrics, Blackwell Publishers, 410 p.
Koenraadt, C.J.M., Githeko, A.K., et Takken, W., 2004, The effect of rainfall and evapotranspiration on the temporal
dynamics of Anopheles gambiae s.s and Anopheles arabiensis in a Kenyan village: Acta Tropica, v. 90, p.
141-153.
Lacey, L.A., Urbina, M.J., et Heizman, C.M., 1984, Sustained-release formulations of Bacillus sphaericus and Bacillus
thuringiensis (H-14) for control of container-breeding Culex quinquefasciatus.: Mosquito news, v. 44, p. 2632.
Lacoste, A., et Salanon, R., 2006, Elmnt de biogograpie et d'cologie, Une comprhension de la biosphre par
l'analyse des composantes majeures des cosystmes.
Langlois, P., 2005, Compexit et systme spatiaux: Modlisations en gographie, dterminisme et complexit, v.
IGAT, p. Pages 299-319.
Langlois, P., et Reguer, D., 2005, La place du modle et de la modlisation en sciences humaines: Modlisations en
gographie, dterminisme et complexit, v. IGAT, p. Pages 35-48.
Le-Bras, M., et Malvy, J.-M.D., 2004, Le complexe pathogne tropical : Regard nouveau sur un concept ancien:
Mdecine tropicale, v. vol. 64, p. 613-618.
Le-Moigne, J.-L., 1990, La modlisation des systmes complexes: Paris, Dunod, 180 p.
Le-Sueur, D., et Sharp, B.L., 1988, The breeding requirements of three members of the Anopheles gambiae Giles
complex (Diptera: Culicidae) in the endemic malaria area of Natal, : south Africa. Bull. Ent. Res., v. 78, p.
549-560.
Lebart, L., Piron, M., et Morineau, A., 2006, Statistique exploratoire mutlidimensionnelle. Visualisation et infrence en
fouilles de donnes, 464 p.
Linthicum, K.J., Anyamba, A., Tucker, C.J., Kelley, P.W., Myers, M.F., et Peters, C.J., 1999, Climate and satellite
indicators to forecast Rift Valley Fever epidemics in Kenya: Science, v. 285, p. 397-400.
Linthicum, K.J., Bailey, C.L., Davies, F.G., et Tucker, C.J., 1987, Detection of Rift Valley fever viral activity in Kenya
by satellite remote sensing imagery. : Science, v. 235, p. 1656-1659.
Linthicum, K.J., Bailey, C.L., Tucker, C.J., Mitchell, K.D., Logan, T.M., Davies, F.G., Kamau, C.W., Thande, P.C., et
Wagateh, J.N., 1990, Application of polar-orbiting, meteorological satellite data to detect flooding of Rift
__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

186

Bibliographie
________________________________________________________________________________________________________________

Valley Fever virus vector mosquito habitats in Kenya. : Medical and Veterinary Entomology, . v. 4, p. 433438.
Manguin, S., Fontenille, D., F.Chandre, Lochouarn, L., Mouchet, J., Kengne, P., et Guillet, P., 1999, Interactions
gntiques entre population vectrices parasitaires et humains: l'exemple du paludisme Plasmodium
falciparum, Journe SPE du 13 octobre 1999 : Gntique et maladies infectueuses dans l'environnement
tropical.: Institut Pasteur Paris, p. 7.
Mathian, H., et Piron, M., 2001, Echelles gographiques et mthodes statistiques multidimentionnelle: Modles en
analyse spatiale, v. IGAT, p. Pages 61-101.
MC-Crae, A.W.R., 1984, Ovoposition by African malaria vector mosquitoes. II Effects of site tone, water type and
conspecific immatures on target selection by freshwater Anopheles gambiae Giles sensu lato: Annals of
Tropical Medicine and Parasitology, v. 78, p. 307-318.
MEE-Burkina, M.d.l.E.e.d.l.E., 2002, Rapport sur l'tat de l'environnement au Burkina Faso (REEB).
Minakawa, N., Mutero, C.M., Githure, J.I., Beier, J., et Yan, G., 1999, Spatial distribution and habitat caracterization of
Anopheline mosquito larvae in Western Kenya. : American Tropical Medicine Hygiene, v. 61, p. 1010-1016.
Mouchet, J., et Carnevale, P., 1991, Les vecteurs et la transmission: Paludisme M. Danis et J. Mouchet coord, v.
ELLIPSES Ed, p. 35-59.
Mouchet, J., Carnevale, P., Coosemans, M., Julvez, J., Manguin, S., Richard-Lenoble, D., et Sircoulon, J., 2004,
Biodiversit du paludisme dans le monde: Paris, Pages 428 p.
Muirhead-Thomson, R., 1951, Studies on salt-water and fresh-water Anopheles gambiae on the East African coast:
Bull. Entomol. : , v. Res. 41, p. 487-502.
Mushinzimana, E., Munga, S., Minakawa, N., Li, L., Feng, C.-c., Bian, L., Kitron, U., Schmidt, C., Beck, L., Zhou, G.,
Githeko, A.K., et Yan, G., 2006, Landscape determinants and remote sensing of anopheline mosquito larval
habitats in the western Kenya highlands: Malaria Journal, v. 5:13.
Nbi, I., 2002, Influence long terme des rideaux imprgns dinsecticide sur limmunit anti-palustre chez des
enfants vivant en zone rurale au Burkina Faso [ Doctorat unique thesis], Universit de Ouagadougou.
O.M.S., 2006, Prvenir les maladies par des environnements salubres - vers une valuation de la charge des maladies
environnementales: Gnve, OMS.
O.R.S.T.O.M., C.O.d.D., 1969-1973, Carte pdologique de reconnaissance de la Rpublique de Haute-Volta. . chelle:
1 : 500 000.
Paterson, H., 1964, Direct evidence for the specific distinctness of Forms A, B and C of the Anopheles gambiae
complex.: Riv. Malar, v. 43, p. 191-196.
Petrarca, V., Petrangeli, G., Rossi, P., et Sabatinelli, G., 1986, Etude Chromosomique dAnopheles gambiae et
Anopheles arabiensis Ouagadougou (Burkina Faso) et dans quelques villages voisins: Parassitologia, v. 28,
p. 41-61.
Pin-Diop, R., 2006, Spatialisation du risque de transmission de la Fivre de la Vall du Rift en milieu agropastoral
sahlien du Sngal septentrional [Gographie - Espace, Dveloppement et Sant thesis], 238p.
PNLP, 2007, Plan stratgique de lutte contre le paludisme 2006-2010: Ministre de la Sant Burkina Faso, p. 80.
Pumain, D., et Saint-julien Thrse., 1997, Lanalyse Spatiale. 1. La localisation dans lespace: Paris, Page 158 p.
Quinones, M.L., Lines, J.D., Thomson, M.C., Jawara, M., Morris, J., et Greenwood, B.M., 1997, Anopheles gambiae
gonotrophic cycle duration, biting and exiting behaviour unafflected by permethrin impregnated bednets in
the Gambia, : Medical and Veterinary Entomology, , v. 11, p. 71-78.
Rajagopalan, P.K., Das, K.N., Panicker, R., D., R.R., L.S., S., et Lines, J.D., 1991, Environnental and water
management for mosquito control: Control of disease vectors in community, v. Ed C.F. Curtis Wolfe.
Ratana, S., Lee, W.J., Ugsang, D.M., et Linthicum, K.J., 2005, Identification and characterization of larval and adult
anopheline mosquito habitats in the Republic of Korea: potential use of remotely sensed data to estimate
mosquito distributions: International Journal of Health Geographics, v. 4:17.
Robert, V., Awono-Ambene, H.P., et Thioulouse, J., 1998, Ecology of larval mosquitoes, with special reference to
Anopheles arabiensis (Diptera: Culcidae) in market-garden wells in urban Dakar, Senegal. : J Med Entomol,
v. 35(6), p. 948-55.
Robert, V., et Carnevale, P., 1984, Les vecteurs des paludismes en Afrique subsaharienne: Etudes Mdicales, v. 2, p.
79-90.
Robert, V., Petrarca, V., Carnevale, P., Ovazza, L., et Coluzzi, M., 1989, Analyse cytogntique du complexe
Anopheles gambiae dans la rgion de Bobo Dioulasso (Burkina Faso). Annales de Parasitologie humaine
Compare, v. 64, p. 290-311.
Robinson, T.P., Rogers, D.J., et Williams, B.G., 1997, Mapping tsetse habitat suitability in the common fly belt of
Southern Africa using multivariate analysis of climate and remotely sensed vegetation data: Medical and
Veterinary Entomology,, v. 11, p. 235-245.
Rodhain, F., et Perez, C., 1985, Prcis dentomologie mdicale et vtrinaire: Paris France, diteur Maloine S.A., 485
p.
Rodolphe, D., et Robert, J., 2005, Qualit de l'information gographique, p. 302.
Rogers, D.J., et Randolph, S.E., 1993, Distribution of tsetse and ticks in Africa: past, present, future.: Parasitology
today, v. 9, p. 266-271.
__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

187

Bibliographie
________________________________________________________________________________________________________________

Rogers, D.J., et Williams, B.G., 1993, Monitoring trypanosomiasis in space and time Parasitology, v. 106, p. S77-S92.
Sabatier, P., Babouchkine, J.-M., Morvan, J., Polidori, L., Lacaux, J.-P., Braak, L., Dubois, M.A., et Chaude, H., 2004,
S2.Dengue. Surveillance spatiale et de la dengue. Conception doutils dacquisition, de cheminement,
danalyse et de prvision pidmiologique: ITBM-RBM v. 25 (2004) p. 292-296.
Sagnon, N.F., 1999, Identification molculaire dans lEtude de la distribution spatiale et de la structure de la population
primaginale des taxa du complexe Anopheles gambiae vecteurs du paludisme au Burkina Faso [PhD thesis]:
Rome, Universit de Rome la Sapienza
Sagnon, N.F., Costantini, C., Torre, A.d., et M., C., 2000, Random distribution of larval populations of sympatric
members of Anopheles gambiae complex in Burkina Faso: Parassitologia, v. 42, p. 157.
Sanders, L., 2001, Modles en analyse spatiale, p. 329.
Sangar, D., 2000, Dynamique des populations d'Anopheles gambiaes.l., d'Anopheles fenestus et Plasmodium
falcipharum dans le systme de transmission par relais du paludisme Dongubougou Arrondissement de
Kati, Universit du Mali.
Sirima SB, Konat A, Tiono AB, Convelbo, Cousens S, Pagnoni F, 2003, early traitment of childhood fevers with prepackaged antimalarial drug in the home reduces severe malaria morbidify in Burkina Faso, Tropical medecine
and International Health;, 2003,8(2), pp 133-9,
Scott, J.A., Brogdon, W.G., et Collins, F.H., 1993, Identification of single specimens of Anopheles gambiae complex
by the polymerase chain reaction. . Am. J. Trop. Med. Hyg., v. 49, p. 520-529.
Service, M.W., 1993, Mosquitoes(culicidae): Lane R.P. et Crosskey R.W.(eds), Medical insects and Arachnids.
Chapman and Hall, London., p. 51-77.
Service, M.W., Joshi, G.P., et Prodhan, G.D., 1978, A Survey of Anopheles gambae (species A) and An.arabiensis
(Species B) of the An. gambiae Giles complex in the Kisumu aera of Kenya following insecticidal spraying
with OMS-43 (fenitrothion): Annales of Tropical Medicine and Parasitology, v. Vol. 72, No.4, p. 377-386.
Snow, R.W., et Marsh, K., 1995, Will reducing Plasmodium falciparum transmission alter malaria mortality among
African children? : Parasitology Today, v. 11, p. 188-190.
Som, Y.S.C., 2000, Suivi et Evaluation des plans deau de surface par tldtection dans le bassin de Loumbila au
Burkina Faso [DESS thesis]: Niamey Niger, Centre Rgional dEnseignement Spcialis en Agriculture
(CRESA) ; Universit Abdou Moumouni.
, 2006, De la pratique la conception, pour une utilisation des locigiciels comme moyens de formation en SIG et en
tldtection: Cahiers du CERLSHS, v. Edition Spciale, p. 81-96.
Souris, M., 2006, Contraintes d'intgrit spatiales Trait IGAT, Herms, v. Fondements des bases de donnes spatiales,
sous la direction de Sylvie Servigne et Thrse Libourel,, p. 99-123.
Sysbase, 1994, Aide en ligne de Power AMC Designor.
Thriault, M., 1995, Systme dInformation gographique, concept fondamentaux, notes de cours LATG: Qubec,
Universit de Laval.
Thomas, E.P., Keating, J., Swalm, C., Mbogo, C.M., Githeko, A.K., Regens, J.L., Githure, J.I., Andrews, L., et Beier,
J.C., 2003, Linking field-based ecological data with remotely sensed data using a geographic information
system in two malaria endemic urban areas of Kenya: Malaria Journal, v. 2:44.
Tour, Y.T., 1988, Les indicateurs des situations pidmiologiques: Confrence internationale sur les stratgies de lutte
contre les paludismes OCCGE - Centre Muraz Bobo-Dioulasso, p. 31-35.
Tour, Y.T., Petrarca, V., M., C., Coulibaly, S.F., Sankar, O., Maga, H., et Sow, M., 1991, The gambiae gambiae
complex in West Africa: Science in Africa, v. Achievement and Prospectus AAAS, p. 55 - 75.
Tour, Y.T., Petrarca, V., Traor, S.F., Coulibaly, A., Maga, H.M., Sankar, O., Sow, M., et Dideco, 1998,
polymorphism of chromosomally recognized taxa of the Anopheles gambiae complex in Mali,: West Africa
Parassitologia v. 40, p. 477-511.
Tran, A., 2004, Tldtection et pidmiologie : Modlisation de la dynamique de populations d'insectes et application
au contrle de maladies transmission vectorielle [Thse de Doctorat, thesis], Universit Louis Pasteur
Strasbourg 1.
Tran, A., Biteau-Coroller, F., Guis, H., et Roger, F., 2005, Modlisation des maladies vectorielles: Epidmiol et sant
anim, v. 47, p. 35-51.
Trape, J.F., et Roger, C., 1996, Combating malaria morbidity by reducing transmission. : Parasitology today, v. 12, p.
236-240.
Valle, J., Souris, M., Fournet, F., Bochaton, A., Mobillion, V., Peyronnie, K., et Salem, G., 2007, Sampling in health
geography: reconciling geographical objectives and probabilistic methods. An example of a health survey in
Vientiane (Lao PDR): Emerging Themes in Epidemiology, v. 4:6.
Wernsdorfer, W.H., 1991, The development and Spread of drug resistant malaria: Parasitology Today, v. 7, p. 297-303.
White, G.B., 1974, Anopheles gambiae complex and disease transmission in Africa: Transactions of the Royal Society
of Tropical Medicine and hygiene, v. 68, p. 278-301.
White, G.B., et Rosen, P., 1973, Comparative studies on sibling species of the Anopheles gambiae Giles complex
(Diptera., Culicidae). II. Ecology of species A and B in savanna around Kaduna, Nigeria, during transition
from wet to dry season. : Bull. Ent. Res., v. 62, p. 613-625.

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

188

Bibliographie
________________________________________________________________________________________________________________

Ye-Ebiyo, Y., Pollack, R., A.Kiszewski, et A., S., 2003, Enhancement of development of larval Anopheles arabiensis
by proximity and when crowded Am. J. Trop. Med. Hyg., v. 68 (6), p. 748 - 52.
Y, Y., 2005, Incorporating environmental factors in modelling malaria transmission in under five children in Rural
Burkina Faso: Doctor scientiarum humanarum, Ruprecht-Karls-University Heidelberg,, p. 170.
Zaninetti, J.-M., 2005, Statistique spatiale. Mthodes et applications gomatiques, 320 p.

SITES INTERNET CITES DANS LE TEXTE62


http://www.fnh.org/francais/doc/en_ligne/sante/dossier1_intro.htm
http://www.fnh.org/francais/doc/en_ligne/sante/dossier1_art1.htm
http://www.who.int/mediacentre/news/releases/2006/pr32/fr/index.html
http://www.aidh.org/sante/sante-environn.htm
http://www.scienceshumaines.com/-0ales-sciences-humaines-et-la-sante-0a_fr_13795.html
http://www.csiss.org/classics/content/106
http://fr.wikipedia.org/wiki/John_Snow
http://cat.inist.fr/?aModele=afficheN&cpsidt=16594466
http://www.cybergeo.eu/index4056.html
http://www.techno-science.net/?onglet=glossaire&definition=2569
http://agora.qc.ca/mot.nsf/Dossiers/Justus_von_Liebig
http://fr.wikipedia.org/wiki/Justus_von_Liebig
http://web.worldbank.org/WBSITE/EXTERNAL/ACCUEILEXTN/PAYSEXTN/AFRICAINFRE
NCHEXT/BURKINAFASOINFRENCHEXTN/0,,contentMDK:21744044~pagePK:1497618~piP
K:217854~theSitePK:463455,00.html
http://209.85.129.132/search?q=cache:T1SAeMEEo0YJ:www.rollbackmalaria.org/countryaction/
nsp/burkina.pdf+PNLP+Burkina+p%C3%A9riode+de+transmission&cd=7&hl=fr&ct=clnk&gl=fr
&client=firefox-a
http://www.traveldoctor.co.uk/malaria.htm
http://www.primature.gov.bf/burkina/infopratique/fsites.htm
http://www.inforoute-communale.gov.bf/col_cadre1.htm
http://www.insd.bf/
http://www.insd.bf/donnees/donnees_structurelles/T0317.htm
http://www2.unil.ch/biomapper/
http://openmodeller.sourceforge.net/index.php?option=com_frontpage&Itemid=1
http://www.mbr-pwrc.usgs.gov/software/comdyn.html
http://www.biomedcentral.com/1472-6785/9/16
http://www.th.ird.fr/publications/publications_auteurs_souris.html
62

Tous les liens ont t contrls actif pour la derrire fois le 1er aot 2009

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

189

Bibliographie
________________________________________________________________________________________________________________

http://www.ete-online.com/content/4/1/6
http://france.elsevier.com/direct/RBMRET/

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

190

Annexes
________________________________________________________________________________________________________________

ANNEXES

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

191

Annexes
________________________________________________________________________________________________________________

ANNEXE 1 : METHODES DE COLLECTE DES MOUSTIQUES SUR LE


TERRAIN

CAPTURE PAR PULVERISATION INTRA-DOMICILIAIRE DINSECTICIDES


Elle consiste pulvriser une solution dinsecticide faible rmanence (d-phenothrin et pyrthre)
vers les parois intrieures et le toit des habitations afin de collecter les moustiques au repos.
Aprs avoir vacu les vivres des habitations humaines, des draps sont tals lintrieur des
maisons afin de recouvrir tout le plancher. Une solution dinsecticide est ensuite pulvrise
simultanment par deux agents, lun l'intrieur et lautre l'extrieur sur les issues, par lesquelles
les moustiques peuvent s'chapper. Aprs une dizaine de minutes d'attente, les moustiques sous
leffet knock-down des insecticides sont disperss sur les draps. Les draps sont ensuite retirs
des maisons avec prcaution afin de ne pas endommager les moustiques morts. Ces derniers sont
alors rcuprs et placs dans des botes ptri portant des indications sur le lieu, la date de
collecte, le numro de la concession et de la maison (Photo 1 Photo 1& 2). Les habitations sont
ares quelques minutes aprs le retrait des draps afin dliminer les effluves rsiduels de
linsecticide.

Photo 1 : Sance de capture par pulvrisation intradomicilaire : Etape de nbulisation

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

192

Annexes
________________________________________________________________________________________________________________

Photo 2 : Sance de capture par pulvrisation intradomicilaire : Etape de ramassage des moustiques

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

193

Annexes
________________________________________________________________________________________________________________

ANNEXE 2 : IDENTIFICATION DES FORMES MOLECULAIRES

PROTOCOLE DIDENTIFICATION DES FORMES MOLECULAIRES


CENTRE NATIONAL DE RECHERCHE ET DE FORMATION SUR LE PALUDISME

PRINCIPE DE LIDENTIFICATION DES MEMBRES DU COMPLEXE AN. GAMBIAE


PAR LA PCR (Polymerized Chain Reaction)
Le squenage complet du gnome dAn. gambiae a dbut en 2001 et est achever en octobre
2002. Ce gnome contient environ 14000 gnes. Seul un petit nombre de ces gnes ont t
identifis. Lapplication de la PCR lidentification des membres du complexe An. gambiae est
base sur lanalyse des mutations nuclotidiques au niveau de ces gnes. Grce la technique de la
PCR-FRLP (Restriction Fragment Length Polymorphisms), la structure de lADN ribosomal dAn.
gambiaes.l. a t dtermine. Cette structure contient des mutations nuclotidiques permettant de
distinguer les membres du complexe An. gambiae. Une illustration des mutations de lADNr des
membres du complexe An. gambiae est prsente la Figure 66.
561

600

An. gambiae forme S GTGCCCCTTCCTCGATGGCGCAACGAACCATCTTGGTCTG


An. gambiae forme M . AT ..
An. arabiensis

An. melas

.TT..TTC

An. merus

T..TTT

An. quadriannulatus

T.TT.

...ATT..

Figure 66 : Structure de lADN ribosomal des membres du complexe An. gambiae (Scott et al, 1993).

LADN ribosomal de certains membres du complexe An. gambiae comporte galement des sites
de restrictions reconnus par des enzymes, tel que HhaI et CfoI. Ces dernires qui sont des enzymes
de restriction capables de cliver lADNr dAn. gambiae s.s.. Cet ADNr est organis en tandem.
Chaque unit rptitive est forme dans lordre de lextrmit 5vers 3, dun espace transcrit
externe (ETS), des rgions codant pour les acides ribonucliques ribosomaux (ARNr) 18S et 28S
qui sont spars par un espace transcrit interne (ITS) contenant la rgion codante pour lARNr
5,8S (Figure 67). Ces motifs sont spars entre eux par des espaces inter gniques (IGS).
La PCR permet une identification des membres du complexe An. gambiae, mais aussi des formes
molculaires dAn. gambiae s.s.. Les amorces utiliss pour lidentification des diffrentes espces
dAn. gambiaes.l. sont :
-

lamorce Universelle (UN) commune toutes les espces, dont la squence est
(5-GTG TGC CCC TTC CTC GAT GT-3).

lamorce gambi (GA) spcifique An. gambiae s.s. dont la squence est
(5-CTG GTT TGG TCG GCA CGT TT-3).

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

194

Annexes
________________________________________________________________________________________________________________

Enfin lamorce arabiensis (AR) spcifique An. arabiensis, qui a pour squence (5AAG TGT CCT TCT CCA TCC TA-3)

UNITE REPETEE
CISTRON
ETS

ITS

18 S

ITS

5,8 S

IGS ETS

28 S

Figure 67 : Schma dune unit rpte en tandem

MODE OPERATOIRE
Ces techniques didentification molculaire ncessitent trois grandes tapes : lextraction de
lADN, lamplification de lADN et llectrophorse.

EXTRACTION DE LADN
LADN de la tte, des pattes et des ailes a t extrait. Le matriel biologique est broy dans 50l
de solution tampon de cassage (grinding buffer) dont la composition est la suivante 5M de NaCl,
0,5M dEDTA, 1M deTris-HCl, 10% de SDS pH 7,5. Lhomognat obtenu est incub 65C au
bain marie pendant 30mn. Puis 7l dactate de potassium 8M est ajout pour prcipiter les
protines. Aprs agitation la solution est incube -20C pendant 30mn. La temprature basse
acclre la prcipitation des protines. Le mlange est ensuite centrifug 14000 rpm pendant
15mn. Le surnageant obtenu est alors transvas dans un tube contenant 100l dthanol absolue
(100%) pralablement prpar (portant le numro didentification du moustique). Lalcool
solubilise les lipides et facilite la prcipitation des acides nucliques. Le mlange obtenu est incub
-20C pendant 30mn, puis centrifug 14000 rpm pendant 15mn. Le surnageant est vid sur du
papier buvard et 100l dthanol (70%) sont ajouts au culot. Cette solution est centrifuge
14000rpm pendant 5mn. Le surnageant est encore vid sur du papier buvard et les tubes sont
schs dans un dcicateur sous vide pendant 10 15mn. Le culot obtenu est dissout dans 300l
deau distille strile et incub 65C pendant 10mn. La solution finale obtenue est conserve
4C jusqu lamplification de lADN.

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

195

Annexes
________________________________________________________________________________________________________________

LAMPLIFICATION DE LADN
Pour lidentification des espces, An. gambiae s.s. et An. arabiensis, lADN extrait est amplifi
dans 9.2l dune solution mixte compos dun tampon PCR (10X), du chlorure de magnsium
MgCl2 (25mM), de desoxyribonuclotides triphosphate dNTPs (10mM), dune amorce universelle
UN, dune amorce GA spcifique lespce An. gambiae s.s. (2pM), dune amorce AR spcifique
lespce An arabiensis (6,2pM) et 0,35 unit de Taq polymrase. A cette solution mixte 0,8 l
dADN amplifier est ajout et le mlange est incub dans un thermocycleur de type PTC100,
PTC200 ou Mastercycler. Le programme damplification est le suivant : 2mn 95C pour activer
la DNApolymrase suivies de 30 cycles dont chacun consist en 30 secondes de dnaturation
95C, 30secondes 50C pour lappariement des amorces et enfin 30 secondes dlongation
72C. Les produits de lamplification sont maintenus 72C pendant 7mn pour parfaire les
diffrentes phases dlongation (Figure 68).
3
5

5
3
Dissociation des
brins parentaux
5

3
B

Brin

Dnaturation de
lADN

Ajout des
amorces

Amorces
3

Hybridation des
amorces

Elongation par la
Taq polymrase
70-72C

Figure 68 : Schma damplification dune squence dADN

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

196

Annexes
________________________________________________________________________________________________________________

LA RESTRICTION
Pour lidentification des formes molculaires dAn. gambiae s.s, une enzyme de restriction a t
ajout aux produits damplification. Cet enzyme est appel CfoI et est utilis selon le protocole
tabli par Fanello et al,( 2002). Pour cela, 1l dune solution mixte contenant un tampon buffer
(b4), de leau distille strile et de lenzyme (CfoI) a t ajout chaque produit damplification.
Les tubes ont t ensuite incubs 37C pendant 3heures.

LELECTROPHORESE
Les produits obtenus ont t soumis une lectrophorse sur gel dagarose 1,5% contenant du
bromide dthidium 3%.
Pour la prparation du gel, 1,5g dagarose est dissout dans 100ml de tampon TEB 0,5M. le
mlange est chauff jusqu' bullition dans un four micro-onde. Le gel est refroidi environ
45C et 3l de bromide dthidium est ajout. Le bromide dthidium se fixe sur les ponts
hydrognes des acides nucliques, ce qui rend les bandes dADN fluorescentes. Le mlange est
ensuite coul dans un bac lectrophorse contenant des peignes et laiss la temprature
ambiante pour la solidification.
Aprs la solidification du gel, les peignes sont retirs. Le gel est dpos dans un bac rempli de
TBE 0.5M et 12l de mlange (2l de tampon de migration plus 10l de lADN amplifi) est log
dans chaque puits. Le tampon de migration est appel loading buffer. Les puits extrmes (le
premier et le dernier puits) sont chargs avec un marqueur de poids molculaire qui est la
rfrence. Le gel est alors soumis une tension lectrique de 80mV pendant 45mn.
La lecture des bandes dADN se fait par rvlation aux rayons UV 460nm. Pour cela le gel est
plac sur un appareil qui met des rayons ultraviolets. Grce la fluorescence du bromide
dthidium, des bandes dADN apparaissent sur le gel. Une photographie du gel est prise et
transfr dans lordinateur pour interprtation.

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

197

Annexes
________________________________________________________________________________________________________________

LINTERPRETATION DES BANDES DADN


Les espces du complexe An. gambiaes.l. sont caractrises par des bandes dADN spcifiques
qui permettent de les identifier. Ainsi lespce An. gambiae s.s. a une bande de 390 paires de bases
(pb) et An arabiensis 315pb.
Pour lidentification des formes molculaires dAn. gambiae s.s, la bande de 390pb est clive pour
donner deux bandes (110pb et 280pb) qui caractrisent la forme molculaire (S). La forme
molculaire (M) se caractrise par la bande de390pb, elle nest pas digre par lenzyme de
restriction.

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

198

Liste des figures


________________________________________________________________________________________________________________

LISTE DES FIGURES


Figure 1 : cycle du plasmodium, http://www.traveldoctor.co.uk/malaria.htm _______________ 44
Figure 2 : Cycle de dveloppement de lAnophle In Y (2005) __________________________ 47
Figure 3 : Situation du Burkina Faso ______________________________________________ 52
Figure 4 : Rpartition des ethnies au Burkina Faso ___________________________________ 53
Figure 5 : Densits des populations par provinces ____________________________________ 54
Figure 6 : Les grands ensembles topographiques du Burkina Faso _______________________ 56
Figure 7 : gomorphologie du Burkina Faso ________________________________________ 57
Figure 8 : Profils de distribution des tempratures et prcipitations au Burkina Faso ________ 59
Figure 9 : Diagrammes ombrothermiques de quelques stations de rfrences au Burkina Faso 60
Figure 10 : Climogramme de quelques stations de rfrence au Burkina Faso ______________ 61
Figure 11 : Dbuts et fins de saison pluvieuse au Burkina Faso _________________________ 61
Figure 12 : Les principaux cours deau et leur bassins versants au Burkina Faso ___________ 63
Figure 13 : Domaines phytogographiques du Burkina Faso ___________________________ 64
Figure 14 : Formations vgtales du Burkina Faso ___________________________________ 66
Figure 15 : Diagramme dIshikawa des facteurs environnementaux influenant les frquences
dAnopheles gambiae s.s., ralisation SOME Y. S. Corentin ____________________________ 79
Figure 16 : Transect, circuits et points de collecte des donnes entomologiques ____________ 85
Figure 17 : Modle conceptuel de donne __________________________________________ 99
Figure 18 : Modle conceptuel de traitement _______________________________________ 103
Figure 19 : Variogramme et fonction de rgression pour linterpolation des prcipitations___ 109
Figure 20 : Rpartition des prcipitations au Burkina Faso ___________________________ 109
Figure 21 : Fonction de rgression de linterpolation des tempratures moyennes annuelles _ 110
Figure 22 : Rpartition des tempratures moyennes annuelles au Burkina Faso ___________ 111
Figure 23 : Variogramme et droite de rgression de linterpolation de lvapotranspiration
potentielle moyenne annuelle ___________________________________________________ 112
Figure 24 : Rpartition des lvapotranspiration potentielle annuelle au Burkina Faso ______ 112
Figure 25 : Droite de rgression des pressions de vapeur moyennes annelles au Burkina Faso 113
Figure 26 : Rpartition des pressions de vapeurs moyennes annuelles au Burkina Faso _____ 114
Figure 27 : Droite de rgression de linsolation ____________________________________ 115
Figure 28 : Rpartition de linsolation moyenne annuelle au Burkina Faso _______________ 115
Figure 29 : Droite de rgression de la vitesse des vents_______________________________ 116
Figure 30 : Rpartition des vitesses moyennes annuelles des vents au Burkina Faso ________ 116
Figure 31 : Droite de rgression des altitudes ______________________________________ 117
__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

199

Liste des figures


________________________________________________________________________________________________________________

Figure 32 : Rpartition des altitudes au Burkina Faso________________________________ 117


Figure 33 : Rpartition des densits de population au Burkina Faso en 2005 ______________ 119
Figure 34 : Rpartition des densits vgtales au Burkina Faso ________________________ 120
Figure 35 : Rpartition des distances en tout point par rapport lhydrographie __________ 121
Figure 36 : Rpartition des distances par rapport aux localits ________________________ 121
Figure 37 : Rpartition des captures dAnopheles gambiaes.l. au Burkina Faso de juillet octobre
2005 _______________________________________________________________________ 124
Figure 38 : Structure spatiale de distribution dAn. gambiae s.s. _______________________ 125
Figure 39: Structure spatiale de distribution dAnopheles gambiae forme molculaire S _____ 128
Figure 40 : Structure spatiale de distribution dAn. gambiae forme molculaire M _________ 129
Figure 41 : configuration spatiale dAnopheles gambiaes.l. ___________________________ 132
Figure 42 : configuration spatiale dAnopheles gambiae de forme molculaire S __________ 133
Figure 43 : configuration spatiale dAnopheles gambiae forme molculaire M ____________ 134
Figure 44 : configuration spatiale dAnopheles gambiaes.l. selon lindice Getis et Ord _____ 136
Figure 45 : Configuration spatiale dAnopheles gambiae forme molculaire S selon lindice Getis
et Ord______________________________________________________________________ 137
Figure 46 : configuration spatiale dAnopheles gambiae forme molculaire M selon lindice Getis
et Ord______________________________________________________________________ 138
Figure 47 : Histogramme des valeurs propres ______________________________________ 144
Figure 48 : Reprsentation des variables sur les plans factoriels 1 et 2 __________________ 146
Figure 49 : Reprsentation des variables sur les plans factoriels 1 et 3 __________________ 147
Figure 50 : Reprsentation des variables sur le plan factoriel 1 et 4 _____________________ 147
Figure 51 : contribution des variables aux axes factoriels _____________________________ 150
Figure 52 : Positionnement de nominales supplmentaires sur les plans factoriels 1 et 2 ____ 152
Figure 53 : Positionnement de nominales supplmentaires sur les plans factoriels 1 et 3 ____ 152
Figure 54 : Positionnement de nominales supplmentaire sur les plans factoriels 1 et 4 _____ 153
Figure 55 : Histogramme des rsidus centrs rduits pour An. gambiae forme molculaire S _ 169
Figure 56 : Prdiction de la distribution spatiale des abondances relatives dAn. gambiae forme
molculaire S ________________________________________________________________ 170
Figure 57 : les zones de discontinuit dans la rpartition de la forme molculaire S et
hydrographie. _______________________________________________________________ 171
Figure 58 : Histogramme des rsidus centrs rduits pour An. gambiae forme molculaire M 172
Figure 59 : Prdiction de la distribution spatiale des abondances relatives dAn. gambiae forme
molculaire M _______________________________________________________________ 173

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

200

Liste des figures


________________________________________________________________________________________________________________

Figure 60 : Discontinuit de la rpartition de la forme molculaire M dAn. gambiae s.s., Altitude


et NDVI ____________________________________________________________________ 174
Figure 61 : Corrlation entre pourcentage de S prdit par le modle et pourcentage S observ. 176
Figure 62 : Comparaison des pourcentages observs avec les pourcentage prdits de la forme
molculaire S ________________________________________________________________ 177
Figure 63 : Corrlation entre pourcentages de M prdits par le modle et pourcentages M
observs ____________________________________________________________________ 177
Figure 64 : Comparaison des pourcentages observs avec les frquences prdites de la forme
molculaire M _______________________________________________________________ 178
Figure 65 : Corrlation entre pourcentages de S prdits et pourcentage de M prdits ______ 179
Figure 66 : Structure de lADN ribosomal des membres du complexe An. gambiae (Scott et al,
1993).______________________________________________________________________ 194
Figure 67 : Schma dune unit rpte en tandem __________________________________ 195

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

201

Liste des Tableaux


________________________________________________________________________________________________________________

LISTE DES TABLEAUX


Tableau 1 : Les sols au Burkina Faso _____________________________________________ 58
Tableau 2 : Les bassins hydrographique du Burkina Faso______________________________ 62
Tableau 3 : les variables, leurs units de rfrence et leurs dfinitions ____________________ 82
Tableau 4 : Evaluation de la qualit des donnes collectes ____________________________ 89
Tableau 5 : Liste des informations ________________________________________________ 99
Tableau 6 : Liste des entits ____________________________________________________ 100
Tableau 7 : Liste des associations ________________________________________________ 100
Tableau 8 : Proprit de lentit variable __________________________________________ 101
Tableau 9 : statistiques descriptives sur les variables quantitatives _____________________ 142
Tableau 10 : Les rsultats des tests de sphricit de Bartlett ___________________________ 142
Tableau 11 : Matrice des corrlations entre les variables _____________________________ 143
Tableau 12 : les valeurs propres des axes factoriels _________________________________ 144
Tableau 13 : Coordonnes des variables __________________________________________ 145
Tableau 14 : Cosinus carrs des variables _________________________________________ 148
Tableau 15 : Contributions des variables (%) ______________________________________ 149
Tableau 16 : Les coordonnes des variables supplmentaires __________________________ 151
Tableau 17 : Statistiques descriptives sur les variables expliquer______________________ 156
Tableau 18 : Statistiques descriptives sur les variables explicatives _____________________ 157
Tableau 19 : Statistiques descriptives sur les variables qualitatives _____________________ 157
Tableau 20 : Test de significativit de la quantit dinformation apporte par les variables __ 158
Tableau 21 : Analyse du modle (Type I SS) : test de Fisher sur les variables dans lordre de
slection ____________________________________________________________________ 159
Tableau 22 : Analyse du modle (Type III SS) : test de Fisher sur les variables quel que soit
lordre de slection ___________________________________________________________ 159
Tableau 23 : Coefficients dajustement du modle ___________________________________ 160
Tableau 24 : test de Fisher sur la significativit de la quantit de donnes par rapport au modle
___________________________________________________________________________ 160
Tableau 25 : Analyse du modle (Type I SS) : test de Fisher sur les variables dans lordre de
slection ____________________________________________________________________ 160
Tableau 26 : Analyse du modle (Type III SS) : test de Fisher sur les variables quel que soit
lordre de slection ___________________________________________________________ 161
Tableau 27 : Statistiques descriptives sur les variables expliquer______________________ 162
Tableau 28 : Rsum pour les variables explicatives _________________________________ 162
__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

202

Liste des Tableaux


________________________________________________________________________________________________________________

Tableau 29 : Valeur du coefficient de dtermination pour les 2 meilleurs modles __________ 163
Tableau 30 : Coefficients d'ajustement du modle 2 __________________________________ 164
Tableau 31 : Le test de Fisher sur lanalyse de la significativit de la quantit dinformation
apporte par les variables la rgression pour Anopheles gambiae forme molculaire S ____ 164
Tableau 32 : Test de Fisher de type I SS ___________________________________________ 164
Tableau 33 : Analyse du modle (Type III SS) ______________________________________ 165
Tableau 34 : Paramtres du modle de distribution dAn. gambiae forme molculaire S _____ 165
Tableau 35 : Valeur du coefficient de dtermination pour les 2 meilleurs modles __________ 166
Tableau 36 : les coefficients dajustement pour le modle 3. ___________________________ 166
Tableau 37 : Evaluation de la valeur de l'information apporte par les variables (H0 =
Y=Moy(Y)) __________________________________________________________________ 166
Tableau 38 : Analyse du modle (Type I SS)________________________________________ 167
Tableau 39 : Analyse du modle (Type III SS) ______________________________________ 167
Tableau 40 : Paramtres du modle ______________________________________________ 167
Tableau 41 : Liste des localits ayant des rsidus anormaux pour An. gambiae forme molculaire
S __________________________________________________________________________ 169
Tableau 42 : Liste des localits ayant des rsidus anormaux pour An. gambiae forme molculaire
M _________________________________________________________________________ 173
Tableau 43 : Caractristiques des donnes utilises pour le test de Kolmogorov-Smirov _____ 176
Tableau 44 : Test de Kolmogorov-Smirnov pour la forme molculaire S _________________ 176
Tableau 45 : Caractristiques des donnes test de Kolmogorov-Smirnov pour la forme molculaire
M _________________________________________________________________________ 178
Tableau 46 : Test de Kolmogorov-Smirnov pour la forme molculaire M _________________ 178

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

203

Table des matires


______________________________________________________________________________________________________________

TABLE DES MATIERES


Liste des abrviations ___________________________________________________________ 3
Ddicace _____________________________________________________________________ 5
REMERCIEMENTS ____________________________________________________________ 6
INTRODUCTION GENERALE ___________________________________________________ 9
PREMIERE PARTIE :CADRAGE THEMATIQUE, DEMARCHE SCIENTIFIQUE ET METHODE
___________________________________________________________________________ 15
Chapitre I : Etat de lart, dfinition du champ conceptuel et positionnement scientifique _____ 17
I.1.

Gographie et tude des relations entre environnement et sante _________________ 17

I.1.1

Gographie et lutte contre les maladies __________________________________ 18

I.1.1.1

Lobjet de la gographie : lespace _________________________________ 18

I.1.1.2

Relation entre espace et lutte contre les maladies ______________________ 19

I.1.2

Contribution de la gographie la lutte contre les maladies __________________ 21

I.1.2.1

Lespace dans lanalyse gographique ______________________________ 22

I.1.2.2

Analyse spatiale et analyse des problmes de sant ____________________ 23

I.1.2.3

Techniques gographiques et tude des problmes de sant______________ 24

I.2.

dfinition du champ conceptuel et positionnement scientifique _________________ 27

I.2.1

Modlisation : definition et type _______________________________________ 28

I.2.2

LAnalyse spatiale __________________________________________________ 30

I.2.3

Le Systme dInformation Gographique (SIG). __________________________ 31

I.2.4

Paradigme biogographique : une matrice conceptuelle pour la construction du

projet de modlisation _____________________________________________________ 31


I.2.4.1

Objectifs de recherche ___________________________________________ 32

I.2.4.2

Paradigme biogographique et conceptualisation de la modlisation de la

distribution spatiale _____________________________________________________ 33


I.2.4.3

Les hypothses de la recherche ____________________________________ 36

I.2.4.4

Les indicateurs retenus pour la vrification des hypothses de recherche ___ 37

Chapitre II : Bio-cologie dAn. gambiae au Burkina Faso : une relation formaliser_______ 40


II.1

Le paludisme une maladie de sant publique dont lanophle est le vecteur _______ 40

II.1.1 Le paludisme dans le monde et au Burkina Faso __________________________ 40


II.1.2 La lutte contre le paludisme __________________________________________ 41
II.1.2.1

La lutte contre le Parasite ________________________________________ 42

II.1.2.2

La lutte contre les vecteurs _______________________________________ 42

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

204

Table des matires


______________________________________________________________________________________________________________

II.1.2.3

Les perspectives de la lutte contre le paludisme _______________________ 43

II.1.3 Le cycle de transmission du paludisme __________________________________ 43


II.2

Bio-ecologie dAnopheles gambiae _______________________________________ 44


II.2.1 La position zoologique ____________________________________________ 44
II.2.2 Prsentation du complexe Anopheles gambiae __________________________ 45
II.2.3 Le cycle de dveloppement des Anophles _____________________________ 46
II.2.3.1

La phase de vie aquatique ________________________________________ 47

II.2.3.2

La phase de vie arienne _________________________________________ 48

II.2.4 Lcologie des adultes _____________________________________________ 48


II.2.5 Lcologie des larves (stades pr-imaginaux) : Caractristiques des habitats
larvaires ______________________________________________________________ 49
II.2.6 Lenvironnement du complexe An. gambiae ___________________________ 50
II.3

Presentation de la zone detude __________________________________________ 52

II.3.1 La population ______________________________________________________ 53


II.3.2 Le relief __________________________________________________________ 55
II.3.3 Les sols __________________________________________________________ 57
II.3.4 Le climat _________________________________________________________ 58
II.3.5 Lhydrographie ____________________________________________________ 62
II.3.6 La vgtation ______________________________________________________ 64
Chapitre III : Approche methodologique de ltude __________________________________ 68
III.1

Aperu des methodes de modelisation de la distribution spatiale des especes vivantes

utilisant lanalyse spatiale et les SIG ____________________________________________ 68


III.1.1

Limpact des usages des modles sur la modlisation ____________________ 69

III.1.1.1 Les usages des modles pour llaboration des politiques et dfinition de
stratgies 69
III.1.1.2 Limpact des usages des modles pour laction _______________________ 70
III.1.2

Les modles classs daprs les mthodes _____________________________ 71

III.1.2.1 Les modles rhtoriques _________________________________________ 72


III.1.2.2 Les modles mathmatiques ______________________________________ 72
III.1.2.3 Les modles iconiques __________________________________________ 75
III.2

La dmarche, mthodes et matriels ______________________________________ 77

III.2.1

Demarche densemble de la recherche ________________________________ 77

III.2.2

Univers des variables et entits / objets geographiques ___________________ 78

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

205

Table des matires


______________________________________________________________________________________________________________

III.2.3

Linventaire des variables __________________________________________ 80

III.2.4

Entites / objets geographiques _______________________________________ 83

III.2.5

Les methodes de collecte de donnees _________________________________ 84

III. 2.5.1 Le transect ____________________________________________________ 84


III. 2.5.2 La revue de littrature scientifique _________________________________ 85
III.2.6

Evaluation de la qualit des donnees __________________________________ 86

III.2.6.1 Mthode dvaluation utilise _____________________________________ 86


III.2.6.2 Terrain nominal ________________________________________________ 87
III.2.6.3 Apprciation de la qualit des donnes ______________________________ 88
III.2.7

Les methodes de traitement des donnees ______________________________ 90

III.2.7.1 les traitements de type spatial _____________________________________ 90


III.2.7.2 Les traitements de type temporel __________________________________ 92
III.2.8

Matriels / logiciels utilises _________________________________________ 93

Conclusion de la premire partie _________________________________________________ 95


DEUXIEME PARTIE : STRUCTURATION DES DONNEES, ELABORATION ET EVALUATION
DES MODELES ______________________________________________________________ 96
Chapitre IV : Organisation et structuration de la base de donnes_______________________ 98
IV.1.1

Lentit catgorie _____________________________________________ 100

IV.1.2

Lentit Sites ________________________________________________ 100

IV.1.3

Lentit Priode ______________________________________________ 101

IV.1.4

Lentit Variables ____________________________________________ 101

IV.2.1

Le processus de collecte et de traitement des donnes entomologiques ______ 104

IV.2.2

Le processus de collecte et de traitement des donnes environnementales____ 105

IV.2.3

Le processus de modlisation et de ralisation de carte de distribution prdictive


106

IV.3.1

Interpolation des donnes _________________________________________ 107

IV.3.1.1 Les prcipitations : des donnes sources aux donnes interpoles ________ 108
IV.3.1.2 Les tempratures : des donnes sources aux donnes interpoles_________ 110
IV.3.1.3 LEvapotranspiration potentielle : des donnes sources aux donnes interpoles
111
IV.3.1.4 La pression de vapeur : des donnes sources aux donnes interpoles _____ 113
IV.3.1.5 Linsolation : des donnes sources aux donnes interpoles ____________ 114
IV.3.1.6 La vitesse du vent : des donnes sources aux donnes interpoles ________ 115
IV.3.1.7 Laltitude: des donnes sources aux donnes interpoles _______________ 116
__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

206

Table des matires


______________________________________________________________________________________________________________

IV.3.2

Estimation des donnes ___________________________________________ 117

IV.3.3

Les donnes classifies ___________________________________________ 122

Chapitre V : Distribution spatiale des membres du complexe An. gambiae : structures globales et
configurations locales ________________________________________________________ 123
V.1.1 les statistiques gnrales sur les donnes entomologiques collectes. _________ 124
V.1.2 la structure spatiale dAnopheles gambiaes.l. ____________________________ 125
V.1.3 La structure spatiale dAnopheles gambiae forme molculaire S _____________ 127
V.1.4 La structure spatiale dAnopheles gambiae forme molecuLaire M ____________ 129
V.2.1 Analyse des configurations spatiales locales dAnopheles gambiaes.l. ________ 131
V.2.2 Analyse des configurations spatiales locales dAnopheles gambiae forme molculaire
S

132

V.2.3 Analyse des configurations spatiales locales dAnopheles gambiae forme


moleculAire M __________________________________________________________ 134
V.2.4 Configurations spatiales selon lindice GI* de Getis-Ord pour Anopheles gambiaes.l.
135
V.2.5 Configurations spatiales selon lindice GI* de Getis-Ord pour Anopheles gambiae
forme moleculaire S ______________________________________________________ 136
V.2.6 Configurations spatiales selon lindice GI* de Getis-Ord pour Anopheles gambiae
forme moleculaire M _____________________________________________________ 138
V.3.1 Analyse des corrlations entre la distribution des vecteurs et les paramtres
environnementaux _______________________________________________________ 140
V.3.2 Caracterisation des donnees et parametres de lanalyse ____________________ 141
V.3.3 Resultats et interprtation de lanalyse en composante Principale ____________ 142
V.3.3.1 Analyse des corrlations __________________________________________ 143
V.3.3.2 Analyse des valeurs propres _______________________________________ 144
V.3.3.3 Analyse de coordonnes des variables _______________________________ 145
V.3.3.4 Analyse de la qualit de la reprsentation des variables par rapport aux diffrents
axes factoriels___________________________________________________________ 148
V.3.3.5 Analyse de la contribution des variables la formation des axes factoriels ___ 149
V.3.3.6 Contribution des variables supplmentaires aux diffrents axes factoriels ____ 151
Chapitre VI : Modlisation de la distribution spatiale _______________________________ 156
VI.1

Modelisation par analyse de covariance (ANCOVA) _______________________ 156

Configuration de lANCOVA et description des donnes _________________________ 156


Rsultats et interpretation de lANCOVA _____________________________________ 157
__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

207

Table des matires


______________________________________________________________________________________________________________

VI.2

Modlisation par regression multiple ____________________________________ 162

VI.2.1

Configuration de la rgression et description des donnes ________________ 162

VI.2.2

Rsultats de la rgression _________________________________________ 163

VI.2.2.1 Modle de distribution dAn. gambiae forme molculaire S ____________ 163


VI.2.2.2 Le modle de distribution dAn. gambiae forme molculaire M _________ 165
VI.3

Evaluation des modles _______________________________________________ 168

VI.3.1

Analyse des residus ______________________________________________ 168

VI.3.1.1 Analyse des rsidus pour An. gambiae forme molculaire S ____________ 168
VI.3.1.2 Analyse des rsidus pour An. gambiae forme molculaire M____________ 172
VI.3.2

Confrontation des donnes des modles ux donnes empiriques __________ 175

VI.3.2.1 Confrontation du modle dAn. gambiae forme molculaire S la vrit terrain


175
VI.3.2.2 Confrontation du modle dAn. gambiae forme molculaire M la vrit terrain
177
Conclusion du chapitre VI _____________________________________________________ 179
CONCLUSION GENERALE ___________________________________________________ 181
Bibliographie _______________________________________________________________ 184
ANNEXES __________________________________________________________________ 191
ANNEXE 1 : Mthodes de collecte des moustiques sur le terrain _______________________ 192
ANNEXE 2 : Identification des formes moleculaires _________________________________ 194
Liste des figures _____________________________________________________________ 199
Liste des tableaux ____________________________________________________________ 202

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

208

Rsume / Abstract
________________________________________________________________________________________________________________

RESUME
MODELISATION DE LA DISTRIBUTION SPATIALE DES FORMES MOLECULAIRES M ET S
Danopheles gambiae sensu stricto AU BURKINA FASO AVEC LES SIG ET LANALYSE SPATIALE
La lutte anti-vectorielle est une composante importante de la lutte contre les maladies transmission vectorielle. La
connaissance des populations vectorielles, tant dans leur composition spcifique que dans leur rpartition spatiotemporelle, est fondamentale pour la conception des stratgies de lutte contre ce type de maladie.
Cette thse a modlis la distribution spatiale des formes molculaires M et S dAnopheles gambiae s.s., des vecteurs
majeurs du paludisme au Burkina Faso. La modlisation a t faite partir de lanalyse dune srie dobservations portant
la fois sur les vecteurs et lenvironnement. Elle procde dune combinaison de concepts et mthodes de biogographie
avec des techniques et outils danalyse spatiale, danalyse des donnes et des systmes dinformations gographiques.
Nous retenons de ce travail de recherche que labondance de la forme molculaire S dAnopheles gambiae s.s., diminue au
fur et mesure que lon volue des rgions humides du sud et du sud-ouest vers celles les plus arides du nord et du nordest. Le NDVI, lETP, et linsolation sont les facteurs les plus dterminants de sa distribution spatiale. Par contre,
labondance de la forme molculaire M dAnopheles gambiae s.s. augmente des rgions humides du sud et du sud-ouest
vers celles plus arides du nord et du nord-est. Laltitude, la pression, linsolation, la densit de vgtation sont les facteurs
les plus dterminants de cette rpartition spatiale. De ces rsultats, ont t drivs deux modles qui ont servi
llaboration des cartes de distribution des formes molculaires M et S dAnopheles gambiae s.s.
Enfin, cette thse rvle le rle de lapproche gographique dans la rflexion sur les questions de sant et sa mthodologie
pourrait tre teste sur dautres sites et pour dautres vecteurs de maladies.
Elle peut senrichir dune analyse multi chelle et dune modlisation de la variabilit temporelle.
Mots Cls : Anopheles gambiae, Modlisation, Analyse spatiale, SIG, Burkina Faso
ABSTRACT
MODELLING THE SPATIAL DISTRIBUTION OF THE MOLECULAR FORM M AND S OF Anopheles
gambiae s.s. IN BURKINA FASO WITH GIS AND SPATIAL ANALYST
The anti-vectorial fight is an important constituent for vectorial borne diseases control. The knowledge of the vectors
populations as well as their specific composition and spatiotemporal distribution is fundamental for the conception of the
strategies of fight against this type of disease.
This thesis modeled the spatial distribution of the molecular forms M and S of Anopheles gambiae s.s., major vectors of
malaria in Burkina Faso. The modeling was made from the analysis of a series of observations concerning both the vectors
and the environment.
It proceeds of a combination of concepts and methods of biogeography with techniques and tools of spatial analysis, data
analysis and the geographical information systems.
We retain of this research work that the abundance of the molecular form S of Anopheles gambiae s.s., decreases as we
move from wet regions of the south and the southwest to those the driest of the north and the northeast. The NDVI, the
ETP, and the sunshine are the most determining factors of its spatial distribution.
In contrast, the abundance of the molecular form M of Anopheles gambiae s.s. increases from the wet regions of the South
and the southwest to those drier of the north and the northeast. The temperatures, the pressure, the sunshine and the NDVI
are the most determining factors of this spatial distribution.
Of these results, were diverted two models which we use to elaborate the Maps of distribution of the molecular forms M
and S of Anopheles gambiae s.s.
This thesis highlights also the role of the geographical approach in the reflection on health issues and its methodology
could be tested on the other sites and for the other vectors of diseases. This methodology could be improved by multi-scale
analysis and of temporal variability modeling.
Key Words: Anopheles gambiae, Modeling, spatial analyst, GIS, Burkina Faso

Centre dEtudes pour le Dveloppement des Territoires et lEnvironnement


cole Doctorale Sciences de lHomme et de la Socit
UFR Lettres, Langues et Sciences Humaines
10 Rue de Tours, BP 46 527
45065 Orlans CEDEX 2

__________________________________________________________________________________________________________________________________
Modlisation de la distribution spatiale des formes molculaires M et S d'Anopheles gambiae s.s. par les SIG et l'analyse spatiale au Burkina Faso

SOME Ylzouomin Stphane Corentin

209