Exploring The Evolutionary Route of The Acquisition of Betaine Aldehyde Dehydrogenase Activity by Plant ALDH10 Enzymes

Muoz-Clares et al.
BMC Plant Biology 2014, 14:149

http://www.biomedcentral.com/1471-2229/14/149
RESEARCH ARTICLE
Open Access
Exploring the evolutionary route of the acquisition

of betaine aldehyde dehydrogenase activity by
plant ALDH10 enzymes: implications for the
synthesis of the osmoprotectant glycine betaine
Rosario A Muoz-Clares1*, Hctor Riveros-Rosas2, Georgina Garza-Ramos2, Lilian Gonzlez-Segura1,
Carlos Mjica-Jimnez1 and Adriana Julin-Snchez2
Abstract
Background: Plant ALDH10 enzymes are aminoaldehyde dehydrogenases (AMADHs) that oxidize different -amino
or trimethylammonium aldehydes, but only some of them have betaine aldehyde dehydrogenase (BADH) activity
and produce the osmoprotectant glycine betaine (GB). The latter enzymes possess alanine or cysteine at position
441 (numbering of the spinach enzyme, SoBADH), while those ALDH10s that cannot oxidize betaine aldehyde (BAL)
have isoleucine at this position. Only the plants that contain A441- or C441-type ALDH10 isoenzymes accumulate
GB in response to osmotic stress. In this work we explored the evolutionary history of the acquisition of BAL
specificity by plant ALDH10s.
Results: We performed extensive phylogenetic analyses and constructed and characterized, kinetically and
structurally, four SoBADH variants that simulate the parsimonious intermediates in the evolutionary pathway from
I441-type to A441- or C441-type enzymes. All mutants had a correct folding, average thermal stabilities and similar
activity with aminopropionaldehyde, but whereas A441S and A441T exhibited significant activity with BAL, A441V
and A441F did not. The kinetics of the mutants were consistent with their predicted structural features obtained by
modeling, and confirmed the importance of position 441 for BAL specificity. The acquisition of BADH activity could
have happened through any of these intermediates without detriment of the original function or protein stability.
Phylogenetic studies showed that this event occurred independently several times during angiosperms evolution
when an ALDH10 gene duplicate changed the critical Ile residue for Ala or Cys in two consecutive single mutations.
ALDH10 isoenzymes frequently group in two clades within a plant family: one includes peroxisomal I441-type, the
other peroxisomal and non-peroxisomal I441-, A441- or C441-type. Interestingly, high GB-accumulators plants have
non-peroxisomal A441- or C441-type isoenzymes, while low-GB accumulators have the peroxisomal C441-type,
suggesting some limitations in the peroxisomal GB synthesis.
Conclusion: Our findings shed light on the evolution of the synthesis of GB in plants, a metabolic trait of most
ecological and physiological relevance for their tolerance to drought, hypersaline soils and cold. Together, our
results are consistent with smooth evolutionary pathways for the acquisition of the BADH function from ancestral
I441-type AMADHs, thus explaining the relatively high occurrence of this event.
Keywords: Osmoprotection, Osmotic stress, Aminoaldehyde dehydrogenase, Enzyme kinetics, Substrate specificity,
Enzyme subcellular location, Protein stability, Protein structure, Protein evolution
* Correspondence: clares@unam.mx
1
Departamento de Bioqumica, Facultad de Qumica, Universidad Nacional
Autnoma de Mxico, Mxico D.F., Mxico
Full list of author information is available at the end of the article
2014 Muoz-Clares et al.; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the
Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0), which permits unrestricted use,
distribution, and reproduction in any medium, provided the original work is properly credited. The Creative Commons Public
Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this
article, unless otherwise stated.
Muoz-Clares et al. BMC Plant Biology 2014, 14:149

Background
The synthesis of the osmoprotectant glycine betaine
(GB) is a metabolic trait of great adaptive importance
that allows the plants possessing it to contend with osmotic stress caused by drought, salinity or low temperatures. Since these adverse environmental conditions are
the major limitations of agricultural production, engineering the synthesis of GB in crops that naturally lack
this ability has been, and still is, a biotechnological goal
for improving their tolerance to osmotic stress (reviewed
in [1]). Also, it is becoming increasingly appreciated that
the GB content of an edible plant is valuable for human
and animal nutrition [2].
In plants, GB is formed by the NAD+-dependent oxidation
of betaine aldehyde (BAL) catalyzed by betaine aldehyde dehydrogenases (BADHs). Within the aldehyde dehydrogenase
(ALDH) superfamily, plant BADHs belong to the family 10
[3] whose members are -aminoaldehyde dehydrogenases
(AMADHs) that in vitro can oxidize small aldehydes possessing an -primary amine group, such as 3-aminopropionaldehyde (APAL) and 4-aminobutyraldehyde (ABAL) [4-12], a
trimethylammonium group, such as 4-trimethylaminobutyraldehyde (TMABAL) [9,12], or a dimethylsulfonium group,
such as 3-dimethylsulfoniopropionaldehyde [4,5]. In vivo, depending of the substrate used, these enzymes may participate
in diverse biochemical processes, which range from the
catabolism of polyamines to the synthesis of several osmoprotectants (alanine betaine, 4-aminobutyrate, carnitine or
3-dimethylsulfoniopropionate) in addition to GB. Although
the biochemically characterized plant ALDH10s oxidize all
the above-mentioned aldehydes, only some of them efficiently use BAL as substrate [9,13-18] and therefore can participate in the synthesis of GB. The difference in BAL
specificity among the plant ALDH10s was puzzling given
the high structural similarity between BAL and the other
-aminoaldehydes, as well as between the plant ALDH10
enzymes. Recently, by means of X-ray crystallography, in
silico model building, site-directed mutagenesis, and kinetic
studies of the ALDH10 enzyme from spinach (SoBADH), we
found that only an amino acid residue at position 441 is critical for an ALDH10 enzyme being able to accept or reject
BAL as a substrate [19]. This residue, located in the second
sphere of interaction with the substrate behind the indole
group of the tryptophan equivalent to W456 in SoBADH, determines the size of the pocket formed by the Trp and Tyr
residues equivalent to Y160 and W456 (SoBADH numbering) where the bulky trimethylammonium group of BAL
binds. If this residue is an Ile it pushes the Trp against the
Tyr, thus hindering the binding of BAL, whereas if it is an
Ala or a Cys the Trp adopts a conformation that leaves
enough room for productive BAL binding [19]. This conclusion was drawn by Daz-Snchez et al. [19] by comparing the
crystal structures of the SoBADH (PDB code 4A0M) with
those of the two pea AMADH enzymes, which do not have
Page 2 of 16
BADH activity (PsAMADH1 and PsAMADH2, PDB codes

3IWK and 3IWJ, respectively, [12]), and was later confirmed
by Kopcn et al. [20] when they reported the crystal structures of the maize ALDH10 isoenzyme, which contains Cys
at position equivalent to 441 (SoBADH numbering) and exhibits BADH activity (ZmAMADH1a; PDB code 4I8P), and
of a tomato ALDH10 isoenzyme, which contains Ile at this
position and is devoid of BADH activity (SlAMADH1; PDB
code 4I9B). Moreover, by correlating the reported level of
BADH activity of ALDH10 enzymes with the presence of either of these residues, Daz-Snchez et al. [19] predicted that
those enzymes that have an Ile at position 441which we
will name hereafter as I441-type isoenzymeswould have
only AMADH activity while those that have either Ala or
Cyswhich we will name hereafter as A441- or C441-type
isoenzymeswould exhibit also BADH activity. And since
an almost perfect correlation was found between the reported ability of the plant to accumulate GB and the presence of an ALDH10 isoenzyme with proved or predicted
BADH activity, it was proposed that the absence of this kind
of isoenzyme is a major limitation for the synthesis of GB in
plants [19]. Indeed, a significant BADH activity would be necessary not only to produce significant levels of GB but also
to prevent the accumulation of BAL, which is formed in the
oxidation of choline by choline monooxygenase (CMO), up
to toxic concentrations.
Amino acid sequence analysis showed that most plants
have two ALDH10 isoenzymes, probably as a consequence of gene duplication, and that the I441-type isoenzyme was the commonest [19]. The latter observation
led to the suggestions that this residue corresponds to
the ancestral feature in the plant ALDH10 family, and
that a functional specialization occurred in some plants
when the Ile at position equivalent to 441 of SoBADH
mutated to Ala or Cys in one of the two copies of the
duplicated gene [19]. Since the codons for Ile differ from
those for Ala or Cys in two positions, we reasoned that
any of these changes had to occur through an intermediate. To explore the evolutionary history of the synthesis
of GB in plants, we generated and characterized the
SoBADH mutants A441V, A441S, A441T and A441F,
which simulate the four parsimonious intermediates in
the pathway from the plant ALDH10 isoenzymes exhibiting only AMADH activity, exemplified by the A441I
SoBADH mutant, to those that also exhibited BADH
activity, exemplified by the wild-type SoBADH or the
A441C mutant. In this work, by comparing the kinetic
properties and the thermo-stabilities of the mutants
with those of the wild-type enzyme, we confirm that
the size of the residue at position 441 greatly affect the
specificity for betaine aldehyde, and conclude that the
acquisition of the new BADH function occurred without detriment of either the oxidation of other aminoaldehydes or the protein stability. Also, we present here

strong phylogenetic evidence that confirms that peroxisomal I441-type isoenzymes correspond to the ALDH10
ancestral form and that independent duplication events
occurred in monocots and eudicots plants. Indeed, the
change to A441-type isoenzymes was the commonest in
eudicots, whereas the change to C441-type isoenzymes
was in monocots.
Results
Phylogenetic analysis of the ALDH10 enzymes
We expanded the amino acid sequence alignments of

plant ALDH10 enzymes, including in this phylogenetic
study three times more sequences than in previous
works [19,20]. The retrieved non-redundant sequences
belong mainly to plants (122 sequences), but ALDH10
proteins were also found in fungi, protists, and proteobacteria; none in animals or archea (Additional file 1:
Table S1). Figure 1 shows an unrooted phylogenetic tree
that includes all identified ALDH10 sequences (panel A),
as well as detailed phylogenetic trees from monocots
(panel B) and eudicots (panel C). As expected, land plants
(Embriophytes) form a well-supported monophyletic group,
as well as Spermatophytes (seed plants) and Angiosperms
(flowering plants). In Figure 1B it can be observed that
primitive plants with a known genome like Ostrococcus
tauri, O. lucimarinus, Micromonas pusilla, Chlamydomonas reinhardtii, Volvox carteri (Chlorophyta), Physcomitrella patents (Briophyta) and Selaginella moellendorffii
(Lycopodiophyta) contain only one ALDH10 enzyme. Interestingly, all these enzymes possess Ile at position equivalent
to 441 (SoBADH numbering), which is also the residue
most frequently found in ALDH10 enzymes of the
other plant families (Figures 1B and 1C). Thus, among
the 122 non-redundant plant ALDH10 sequences analyzed,
88 possess Ile, 19 Ala, and 10 Cys. Only three ALDH10 isoenzymesfrom Vitis vinifera, Solanum tuberosum and
Pandanus amaryllifolius have Val at this position, and
twofrom Auluropus lagopoides and Theobroma cacao
have Thr. These data strongly support the previous proposal [19] that I441-type isoenzymes correspond to the
ancestral protein of the ALDH10 family.
Figure 1B also shows that all known monocot ALDH10
genes cluster together, which suggests that the duplicated ALDH10 genes in monocots originated after the
monocot-eudicot divergence. All monocot plants of
known genome possess two genes coding for ALDH10
proteins, except maize that possesses three genes. As
previously found [20], in the Poaceae familywhich includes most of the known sequences from monocots
each of the two ALDH10 genes forms a different clade
in the phylogenetic tree: one (which we name Poaceae 1)
exclusively includes I441-type isoenzymes while the second (which we name Poaceae 2) mainly contains C441type. Because the limited number of monocot ALDH10
Page 3 of 16
sequences available, it is not yet possible to know whether

or not every monocot family, besides Poaceae, possess two
ALDH10 isoenzymes.
Eudicots of known genomes have a variable number of
genes coding for ALDH10 proteins (Figure 1C). Some species have only one geneRicinus communis (Euphorbiaceae), Citrus clementina (Rutaceae), Aquilegia coerulea
(Ranunculaceae), Fragaria vesca (Rosaceae), Cucumis sativus (Cucurbitaceae), and Mimulus guttatus (Phrymaceae),
others two genesArabidopsis thaliana, A. lyrata, Capsella
rubella, Brassica rapa (Brassicaceae), Glycine max, Medicago truncatula (Fabaceae), Gossypium raimondii, Theobroma cacao (Malvaceae), Populus trichocarpa (Salicaceae),
Solanum lycopersicum, S. tuberosum (Solanaceae), and Beta
vulgaris (Amaranthaceae), and anotherVitis vinifera
(Vitaceae)three genes. Glycine max, in addition to the
two ALDH10 genes, possesses an additional copy that corresponds to a pseudogene. The complex distribution pattern exhibited by ALDH10 genes in eudicots strongly
suggests that several independent gene-duplication events
occurred during their evolution after monocot-eudicot divergence (Figure 1C). Thus, at least four independent duplication events, those that took place in Fabaceae, Salicaceae,
Solanaceae and Amaranthaceae, exhibit a very high bootstrap support (>90%). In species of the Brassicaceae, Fabaceae, Salicaceae, Rosaceae, and Solanaceae families the
protein coded by the duplicate gene conserved the Ile at the
position equivalent to 441, but in plants of the Amaranthaceae and Acanthaceae this residue was changed to an Ala,
in Malvaceae to an Ala or Thr, and in the only sequenced
species of Vitaceae to a Val. As in the case of monocots,
two different clades can be observed in the phylogenetic
tree of several eudicot families: the first includes the original
I441-type isoenzymes, with the only exception of Solanum
tuberosum where this Ile mutated to a Val; the second includes the duplicate I441-type isoenzymes or the A441-,
V441- or T441-type derived from the I441-type. Interestingly, the majority of the A441-type isoenzymes are clustered in the Amaranthaceae 2 clade, with the exception of
the A441-type of Amaranthus hypochondriacus, which is
phylogenetically very close to the I441-type of the same
plant, suggesting a recent duplication event. The genome of
this plant has not been yet completely sequenced, so it
could be that this plant possesses another A441-type isoenzyme that groups with the Amaranthaceae 2. Also, we cannot yet explain the unexpected position of the A441-type
isoenzyme from Ophiopogon japonicus (a monocot), which
clustered with the A441-type isoenzymes in the Amaranthaceae 2 clade. Since the A441-type isoenzymes are predicted
to have BADH activity, i.e. the ability to oxidize BAL [19], it
is interesting that O. japonicus CMO also has higher amino
acid sequence identity with CMO proteins from the Amaranthaceae family than with CMO from monocots [21]. One
possible explanation to this anomalous behavior is that both

Figure 1 (See legend on next page.)
Page 4 of 16

Page 5 of 16
(See figure on previous page.)

Figure 1 Phylogenetic analysis of plant ALDH10 enzymes. A) Unrooted phylogenetic tree that includes all identified ALDH10 protein
sequences showing the taxonomic group to which they belong. B) Monocot and non-flowering plant ALDH10 sequences. C) Eudicot ALDH10
sequences. Indicated are the presence/absence of a peroxisomal-targeting signal PST1 that fits to the consensus sequence (S/A/C)-(K/R/H)-(L/M)
(in red and underlined) as well as the amino acid residue and codon at position equivalent to 441 of SoBADH. The tree was inferred from 500
replicates using the ML method [61]. The best tree with the highest log likelihood (32886.4851) is shown. Similar trees were obtained with MP,
ME and NJ methods. The analysis involved 131 amino acid sequences (122 from plants and 9 from non-plants). In panel A the branches of the
unrooted tree are drawn to scale, with the bar length indicating the number of substitutions per site. In panels B and C only the branch topology
is shown. The proportion of replicate trees in which the associated taxa clustered together in a bootstrap test (500 replicates) is given next to the
branches. Branches with a very low bootstrap value (<20%) are collapsed. For each sequence, the accession number and the name assigned in
published papers (in the case of proteins previously studied) are given. X indicates an unidentified amino acid/nucleotide.
genes were acquired by O. japonicus by horizontal gene

transfer, which is a significant force in the evolution of plant
genomes [22,23]. Further studies are needed to provide evidence in favor or against this possibility.
We confirmed the previous observation [19,20] that
the majority of the I441-type isoenzymes possesses a
peroxisomal targeting signal type 1 (PST1) that fits to
the consensus sequence (S/A)-(K/R)-(L/M/I) [24,25]
whereas all the A441-type and the majority of C441-type
isoenzymes lacks it (Figure 1). In the case of the C441type the exceptions are those from maize, shorghum and
foxtail millet (Setaria italica), which have the SKL signal
and that of Zoysia, which have an SKI signal. The peroxisomal targeting signal was lost by the change of a
residue or by truncation of the C-terminal region. The
codon that encodes the missing Leu in the peroxisomal
targeting signal of some of the C441-type isoenzymes of
Poaceae 2 can be changed with only one punctual mutation to a stop codon. The same occurs with the genes
that code for A441-type isoenzymes from the Amaranthaceae family, where the codons for the first missing
Ser can be transformed with just one punctual mutation
to a stop codon. The sequence divergence pattern of the
Amaranthaceae supports the proposal that the loss of
the peroxisomal signal PST1 occurred in this family before the gene duplication that gave rise to the A441-type
isoenzymes. In other eudicot and monocot families, the
enzymes with a truncated or mutated C-terminus cluster
in the phylogenetic clades 2, a finding that gives additional support to the idea that these enzymes derived
from the peroxisomal I441-type of clades 1.
Possible ALDH10 evolutionary intermediates
The phylogenetic analysis described above strongly supports that A441- and C441-type isoenzymes evolved from
the I441-type ones. Ile can be coded by three different
triplets, ATT, ATC and ATA, and of these the most frequently found in monocots and eudicots ALDH10 genes
is ATT and the least frequent ATA, which indeed was not
found in monocots; alanine is coded by four, GCT, GCC,
GCA, and GCG, of which GCT is the most used in eudicot ALDH10 genes; and cysteine is coded by two, TGT
and TGC, and both are present in monocots ALDH10
genes. The observed frequency of each of these codons in

monocots and eudicots is given in Figure 2A. From these
data it can be observed that the triplet ATT at this position is more frequent than the ATC one.
Since the most parsimonious pathways from Ile to either
Ala or Cys involve two nucleotide substitutions, there
should have been intermediates in the evolution from the
I441-type to the A441- or C441-type ALDH10 isoenzymes. Several pathways could be followed depending on
the Ile codon of the original enzyme, but in all cases the
amino acid substitution in the evolutive intermediate has
to be either Val or Thr in the pathway from Ile to Ala, and
Phe or Ser in that from Ile to Cys (Figure 2B). This is consistent with the five different amino acids found at the
critical position 441 in the ALDH10 enzymes of known
sequence (Figure 1). Ile is the most frequently coded
amino acid (71.9%), followed by Ala (15.7%), Cys (8.3%),
Val (2.5%), and Thr (1.6%). Interestingly, ALDH10 isoenzymes containing Ser or Phe at position equivalent to 441,
which are the possible intermediates in the pathway from
I441 to C441, have not been found so far. Since C441-type
isoenzymes are present in monocots, and the number
of available ALDH10 sequences from monocots is still
low (30 sequences) when compared with the number
of available eudicot sequences (82 sequences), it is to
be expected that the missing intermediates will be
found when the number of known monocots ALDH10
sequences increases.
Construction and kinetic characterization of the SoBADH
A441 mutants
To simulate the possible evolutionary intermediates we

generated four SoBADH variants: A441V, A441S, A441T,
and A441F, and we characterized them, both kinetically
and structurally. In a previous work [19] we had constructed the A441I mutant, which represents the putative
original ALDH10 isoenzyme with only AMADH activity,
i.e., devoid of significant BADH activity, and the A441C
mutant, which, together with the wild-type SoBADH, represents those isoenzymes that in addition to the AMADH
activity also have BADH activity. The kinetics of the wildtype SoBADH and of the A441I and A441C mutant enzymes were previously studied using BAL, APAL, ABAL

Figure 2 Evolutionary pathways for the acquisition of BADH

activity by plant ALDH10 enzymes. Possible nucleotide changes
in the pathway from the isoenzymes containing Ile at position 441
(SoBADH numbering) to those containing Ala (A) or Cys (B) at this
position. The frequency of the observed codons for monocots (M;
30 sequences), and eudicots (E; 82 sequences) is given. Experimentally
observed codons and amino acids are underlined.
and TMABAL as substrates [19], at pH 8.0 and at fixed

0.2 mM NAD+, conditions both that are nearly physiological [26,27]. Now we extend that work by studying the
steady-state kinetics of the other four mutants with BAL
or APAL as substrates. APAL can be used as representative of the other -aminoaldehydes that do not have a
bulky trimethylammonium group close to the carbonyl
group, and therefore their binding is not sterically constrained by the size of the cavity formed by the residues
equivalent to Y160 and W456 (PaBADH numbering).
Consequently, the kinetics of these aldehydes are similar
and very different from the kinetics of BAL, as previously
found not only in the wild-type SoBADH but also in the
A441C and A441I mutants [19].
Taking the kinetics of BAL as the criterion, two groups
of enzymes were observed: one that includes the wildtype and the A441C, A441S and A441T mutants, which
had a relatively high kcat, low Km(BAL) and high kcat/Km
(BAL) values, and another formed by the A441V, A441F
and A441I mutants, which exhibited low kcat, high Km
(BAL), and very low kcat/Km(BAL), particularly the A441I
mutant (Figure 3 and Table 1). The enzymes in the first
group have, therefore, significant BADH activity, while the
enzymes in the second group will be devoid of this activity
at the expected intracellular BAL levels, which should not
Page 6 of 16
be high given the known toxicity of this aldehyde [28]. It

has to be noted that the BADH activity of the enzymes in
the first group is achieved not only by their much smaller
Km(BAL) values, which most likely reflect a much better
binding of the aldehyde, but also, although not so importantly, by their significantly higher kcat(BAL) values when
compared with the enzymes of the second group. We also
found clear differences between these two groups in their
Km(NAD+) values, which were higher in the enzymes
exhibiting BADH activity than in the enzymes with only
AMADH activity, with the exception of the A441F
(Table 1). As the Km value for the first substrate in a bi-bi
ordered steady-state kinetic mechanism depends not only
on the second-order rate constant of the binding of this
substrate but also in first-order rate constants associated
with the steps after the central ternary complex is formed,
the finding that the BADHs enzymes have higher Km
(NAD+) values than those of the only-AMADHs ones
could be due to the higher kcat values of the former.
The differences between the two groups of enzymes
vanish when their kinetics with APAL as substrate are
compared (Table 2), indicating that APAL oxidation was
hardly affected by the kind of residue at position 441.
The exception was the A441F mutant, which showed
lower kcat/Km values for both BAL and APAL than the
wild-type and the other mutant enzymes, which suggest
important structural alterations in the active site of this
mutant. The catalytic efficiencies (kcat/Km) for APAL of
the wild-type and mutants SoBADH enzymes are higher
than that for BAL (Table 2), as it has been found with
other A441- or C441-type ALDH10 isoenzymes that in
addition to the AMADH activity exhibit BADH activity
[7,9,20]. Another difference between the kinetics with
BAL and APAL is that APAL produced a small but clear
substrate inhibition in the wild-type and mutant SoBADHs,
while this inhibition was not observed in the saturation
kinetics with BAL in the concentration range studied.
The observed degree of inhibition by high APAL concentrations was roughly the same in all the enzymes,
but the highest APAL concentration used in our experiments, 0.2 mM, did not allow the accurate estimation
of the substrate inhibition constant, KIS, values, which are
not given in Table 2 for this reason. As previously shown
[29], substrate inhibition arises from the non-productive
binding of the aldehyde to the enzyme-NADH complex.
Therefore, these results suggest that the enzyme-NADH
complexes have lower affinity for BAL than for APAL, as
it also the case of the productive enzyme-NAD+ complexes, as judged by the Km values for the aldehydes.
Structural characterization of the SoBADH A441 mutants
Since the two main aspects that determine the evolution

of a protein are function and protein stability, we investigated whether the changes made at position 441 affect

Page 7 of 16
Figure 3 Effects of mutation of A441 on the steady-state kinetic parameters of SoBADH. Wild-type and mutant SoBADH enzymes were
assayed at pH 8.0 and 30C with BAL as variable substrate at fixed 0.2 mM NAD+. Other conditions are given in the Methods section. The kinetic
parameter values were calculated from the best fit of initial velocity data to the Michaelis-Menten equation by non-linear regression. Each saturation
curve was determined at least in duplicate using enzymes from two different purification batches. Bars indicate standard deviations. In the inset the
kcat/Km values of A441V, A441F and A441I are plotted using a scale smaller than that of the main figure.
the structure and/or thermal stability of the mutant enzymes. The amino acid substitutions made at position
441 were well tolerated, and the levels of expression of
soluble mutant proteins were similar to that of the wildtype enzyme (results nor shown). The mutations did not
affect either the native dimeric state of the enzymes, as
judged by gel filtration experiments (results not shown),
or the protein secondary structure, as judged by their
almost identical far-UV CD spectra (Figure 4A). Changes
in the protein tertiary structure could be detected in
their CD spectra in the near-UV range (Figure 4B), where
the signals originate from aromatic residues. The nearUV-CD spectrum of wild-type SoBADH shows well-
defined positive maximum bands at 284 and 291 nm,

characteristic of tryptophan residues, and a minimum between 260 to 280 nm [30], which were also observed in
the mutant enzymes. The exception was A441F, which exhibited an altered near-UV CD spectrum with a pronounced decrease in the intensity of the peaks at 284 and
291 nm and a reduction of the deep of the trough between
260 to 280 nm. These changes probably are the result of
the interaction of the Phe benzyl ring with the neighbor
side chain of W456, as will be discussed below.
The stability of the mutant SoBADH enzymes was measured by thermal denaturation, which was monitored by
following the far-UV CD signal at 222 nm. As previously
Table 1 Steady-state kinetic parameters of wild-type and mutant SoBADH enzymes in the oxidation of BAL
Kinetic parameters
kcat (s-1)
Km (M)
Wild type
3.36 0.13
98 15
35 4
A441C
2.99 0.19
90 6
33 2
A441S
3.29 0.12
119 8
28 3
A441T
2.64 0.16
180 6
15 1
A441V
0.54 0.05
512 79
1.1 0.3
A441F
0.29 0.02
605 26
0.48 0.05
0.74 0.05
1791 115
0.41 0.05
Wild type
4.25 0.16
22 2
195 8
A441C
2.20 0.09
14 1
179 17
A441S
3.27 0.18
29 3
114 20
A441T
2.39 0.00
24 4
100 15
A441V
0.51 0.00
6.4 0.5
80 5
A441F
0.39 0.02
18 1
22 0
A441I
0.68 0.03
2.8 0.0
243 11
Enzyme
Variable substrate
kcat/Km (mM-1s-1)
BAL
A441I
NAD+
Initial velocities were obtained at 30C in 50 mM HEPES-KOH buffer, pH 8.0, containing 0.1 mM EDTA. In the experiments with variable BAL, the fixed concentration
of NAD+ was 0.2 mM, and in the experiments with variable NAD+ the fixed BAL concentrations were at least 10-times their appKm values estimated for each enzyme at
fixed 0.2 mM NAD+. The apparent kinetic parameters were estimated by non-linear regression fit of the experimental data to the Michaelis-Menten equation. The values
given in the Table are the mean standard deviation of the kinetic parameters estimated in two duplicate saturation experiments performed with enzymes from two
different purification batches. Values for kcat are expressed per subunit.

Page 8 of 16
Table 2 Steady-state kinetic parameters of wild-type and mutant SoBADH enzymes in the oxidation of APAL
Kinetic parameters
Enzyme
Variable substrate
kcat (s-1)
Km (M)
kcat/Km (mM-1s-1)
APAL
Wild type
0.99 0.04
3.9 0.1
256 5
A441C
0.67 0.02
0.72 0.16
931 188
A441S
1.12 0.00
2.0 0.5
550 142
A441T
1.50 0.12
4.6 0.5
326 13
A441V
0.52 0.10
1.1 0.3
473 216
A441F
0.34 0.04
3.7 0.0
92 11
A441I
1.85 0.06
4.8 1.3
375 80
Wild type
0.99 0.04
4.0 0.1
250 7
A441C
0.89 0.00
2.6 0.5
342 76
A441S
0.88 0.02
2.8 0.0
314 13
NAD+
A441T
0.76 0.02
4.0 0.4
190 16
A441V
0.54 0.06
1.7 0.2
318 2
A441F
0.43 0.01
5.9 1.4
73 17
A441I
2.11 0.01
5.5 0.1
382 9
Initial velocities were obtained at 30C in 50 mM HEPES-KOH buffer, pH 8.0, containing 0.1 mM EDTA. In the experiments with variable APAL, the fixed concentration of NAD+ was 0.2 mM, and in the experiments with variable NAD+ the fixed APAL concentrations were at least 10-times their appKm values estimated for each
enzyme at fixed 0.2 mM NAD+. The apparent kinetic parameters were estimated by non-linear regression fit of the experimental data to the Michaelis-Menten equation
(saturation by NAD+ at fixed APAL) or to Equation 1 given in the main text (saturation by APAL at fixed NAD+). The values given in the Table are the mean standard
deviation of the kinetic parameters estimated in two duplicate saturation experiments performed with enzymes from two different purification batches. Values for kcat
are expressed per enzyme subunit. Substrate inhibition constants for APAL are not given because they could not be accurately estimated in the concentration range
used in these experiments, but the observed degree of inhibition by high APAL concentrations was roughly the same in all the enzymes.
found with the wild-type enzyme [30], all mutant proteins

were irreversibly denatured at 90C and the melting
curves exhibited monophasic transitions (Figure 4C). The
irreversibility of the thermal denaturation of all enzymes
precludes equilibrium thermodynamic analysis of the
process. However, the use of the same measurement parameters and of the same experimental conditions allowed
us to evaluate the possible effect of the changed amino
acid on the mutant enzymes stability by comparing the
transitions midpoints of their thermal transitions, i.e. their
apparent Tm values. The estimated apparent Tm values of
the A441C, A441S, A441T and A441F mutants were similar to that of the wild-type enzyme, around 50C, but
those of A441V and A441I were approximately 10C
higher (Figure 4C). These findings clearly indicate the
stabilizing effect of the presence of a hydrophobic sidechain of medium or large volume inside the protein at
position 441. In the case of the A441F mutant, although
the side chain introduced is highly hydrophobic and the
minimized model of this mutant indicates that it may
make -stacking interactions with the side chain of
W456 (see below), the strain exerted on the protein to
accommodate the bulky benzyl ring of Phe, also indicated by the model, probably causes a decrease in the
stability of this enzyme when compared with that of the
A441I or A441V mutants. Not considering the A441F

mutant, it is interesting that the differences in thermostability of the enzymes also indicate the existence of
the same two groups identified by the differences in the
kinetic parameters of the reaction with BAL as substrate.
Clearly both effects depend on the packing of the sidechains in the region surrounding the position 441.
Models of the SoBADH A441 mutants
To interpret the observed kinetic and stability properties

of the SoBADH mutants, we got an estimation of the
possible position and contacts in the SoBADH structure
of the changed 441 residue by performing in silico mutations followed by energy minimizations of the mutated
structures. The results of these simulations are consistent with the known crystal structures of the ALDH10
enzymes from pea and tomato, which have Ile at position 441, and maize, which has a Cys at this position
(Figure 5). This support the validity of the models of the
mutant enzymes for which there is no a homolog crystal
structure. When compared with the wild-type enzyme,
the models of A441V and, particularly, of A441I show a
similar displacement of W456 to that observed in the
crystal structures of the I441-type isoenzymes of pea and
tomato. This displacement causes the narrowing of the

Page 9 of 16
Figure 5 Structural comparisons of the A441 region of ALDH10

isoenzymes. A) Superimposition of the side-chains of residues at
position 441, 443 and 456 (SoBADH numbering) in the known crystal
structures of plant ALDH10 enzymes. Side-chains are shown as sticks
with oxygen atoms in red, nitrogen in blue, and sulphur in yellow.
Carbon atoms are green in SoBADH (PDB code 4A0M), cyan in
PsAMADH2 (PDB code 3IWJ), magenta in ZmAMADH1a (PDB code
4I8P), and black in SlAMADH1 (PDB code 4I9B). B) Superimposition
of the same region in the minimized models of the in silico SoBADH
mutants in which the residue at position 441 was changed. Side-chains
are shown as sticks with oxygen atoms in red, nitrogen in blue, and
sulphur in yellow. Carbon atoms are green in the wild-type enzyme,
magenta in A441C, grey in A441S, yellow in A441T, brown in A441V,
salmon in A441F, and cyan in A441I. In the figure, the wild-type and
A441T models mask the A441C and A441S models, respectively. The
figure was generated using PyMOL (www.pymol.org).
Figure 4 Effects of mutation of A441 on the structural properties
of SoBADH. Conformational characteristics of wild-type and
mutant SoBADH enzymes examined by near- (A) and far-UV (B)
CD spectra. (C) Thermal denaturation followed by changes at 222 nm
in the far-UV CD signal. The temperature range was 2090C and
the scan rate 1.5C/min. The solid lines represent the best fit of
the thermal transition data to a sigmoidal Boltzman function by
non-linear regression.
cavity where the trimethylammonium group of BAL

binds, thus explaining the low BADH activity of these
two mutants. On the contrary, W456 occupies almost
the same position in the models of A441C, A441S and
A441T than in the wild-type spinach and maize enzymes
(Figure 5A and B), which is consistent with the significant BADH activity exhibited by these three mutants.
In the crystal structure of SoBADH the side chain
of A441 interacts only with the active site residue W456,
but in the known structures of the other three plant

ALDH10s the residue at this position also makes contacts with W443 (SoBADH numbering) (Additional
file 2: Figure S1A and Table S2). In all plant ALDH10s
of known sequence, W456 is highly conserved (97.5%)
and W443 strictly (100%) conserved. W433 is located at
the interface between monomers and has a similar conformation in the ALDH10 crystal structures so far determined. The models of the SoBADH A441 mutants show
that the number of contacts made by the side chain
of the residue at position 441 considerably increases
when the size of its side chain increases (Additional file
2: Figure S1B and Table S2). Regardless of the position
of the thiol group at the start of the simulation, we always obtained a model of A441C that has the thiol

group pointing at W443, as in the ZmAMADH1a crystal

structure where the sulphur of the cysteine residue at
position 441 makes closer contacts with W448 (equivalent to W443 in SoBADH) than with W461 (equivalent
to W456 in SoBADH). The serine residue in A441S can
have two alternative positions: one in which the hydroxyl
group is pointing at W443 and another where the hydroxyl points to W456. The first of these two possible
conformations, which is similar to that adopted by Cys,
is less stable since the hydroxyl in this conformation
would be too far from the aromatic ring of W443 to
make any interaction with it. The second conformation,
which is the one of the model shown in Additional file
2: Figure S1B, is favored because the hydroxyl group
makes van der Waals contacts, and possibly polar- interactions, with the ring of W456. In the A441T mutant,
the hydroxyl group has only one possible conformation,
the one that points to W456, similarly to that of the Ser
in the A441S mutant model. In the A441T minimized
model the distance of the hydrogen atom of the hydroxyl
group from the centroid of the aromatic face of W456
ring is of 2.96 , suggesting the possible existence of a
hydroxyl-aromatic-ring hydrogen bond of the kind described by Levitt and Perutz [31]. The Val side chain in
A441V fits well in this position and makes contacts with
W456. The side chain of the Ile in the mutant A441I
makes almost the same contacts that those observed in
the crystal structures of the pea and tomato enzymes
(PDB codes 3IWJ and 4I9B, respectively), and similarly
pushes the side-chain of W456. Finally, in the mutant
A441F, the only possible way to accommodate the bulky
benzyl group is by stacking against the aromatic ring of
W456. However, the A441F model showed a clash of the
F441 ring with the main chain in the region of residues
P455, W456 and G457, which causes this region to move
in order to accommodate the phenylalanine residue, thus
narrowing the aldehyde entrance tunnel (not shown).
Discussion
Importance of size, polarity and conformation of the side
chain at position 441 of SoBADH for the kinetics and
stability
All data in this work agree with our previous proposal that
only one amino acid residue at position 441 is critical for
ALDH10 enzymes to accept or reject BAL as substrate
[19]. I441-type isoenzymes posses low or very low activity
with BAL whereas A441- and C441-type isoenzymes exhibit high activity with BAL [19]. The SoBADH mutants
that have a residue of similar size to Ala or Cys, as A441S
or A441T, exhibit a high activity with BAL, but the mutants with a bulky nonpolar residue, as A441V or A441I,
have a very low activity with BAL (Figure 3). The exquisite
sensitivity of SoBADH affinity for BAL to the size of the
side chain of the residue at position 441 is reflected in the
Page 10 of 16
finding of a Km(BAL) of the A441T mutant lower than

that of the A441V. Val and Thr have similar sizes but the
methyl group of Val pointing at W456 is a hydroxyl group
in Thr. Since the van der Waals radius of oxygen is 0.27
lower than that of carbon [32], this difference would result
in a lesser steric impediment of W456 to the binding of
the trimethylammonium group of BAL in the A441T than
in the A441V mutant. Also, the polar -interaction between the hydroxyl group of T441 and the aromatic ring
of W456 suggested by the model would reduce the distance between these two groups, thus widening the
trimethylammonium-binding cavity when compared with
that of the A441V mutant. Although the van der Waals
radius of oxygen is 0.39 lower than that of sulphur [32],
the A441C mutant has a slightly but significantly lower
Km(BAL) than A441S, which can be explained by the different conformation adopted by their side chains according to the models (Figure 5B and Additional file 2: Figure
S1B). In the A441C mutant the atom closer to the W456
ring is a hydrogen, as is in the wild-type enzyme, whereas
in the A441S mutant the position of this hydrogen is occupied by a bulkier hydroxyl group. This could explain
that the A441C SoBADH mutant has similar kinetic parameters for BAL than the wild-type enzyme. Regarding
the mutant A441F, which has the bulkiest of the side
chains introduced at this position, it was surprising to us
that it had a lower Km(BAL) than the mutant A441I. This
may be due to the stacking of the aromatic ring of F441
with that of W456, as suggested by the model, which
would result in a more compact packing of both side
chains, and therefore in a lesser steric impediment of
W456 to the binding of the trimethylammonium group of
BAL that in the A441I mutant. The movement of the
main chain, also suggested by our model, and the consequent narrowing of the aldehyde-binding tunnel could explain the low kcat/Km(APAL) exhibited by this enzyme. In
summary, it is not only the size but also the conformation
adopted by the side chain of residue 441 what matters in
determining the position of the side chain of W456, and
therefore the size of the pocket where the trimethylammonium group of BAL binds and the affinity for BAL. Assuming that Km values are an indication of affinity, the
size of the residue at position 441 also appears to affect
the binding of the nucleotide, although to a much lesser
extent than the binding of the aldehyde, for as yet not
clear reasons.
The acquisition of new functions by proteins is limited
because most mutations have destabilizing effects, particularly if the mutated residue is buried [33], as is the
residue at position 441. However, the findings that the
variants of SoBADH with six different residues at position 441 were correctly folded and have thermal stabilities in the range expected for mesophilic enzymes,
indicate that this position is highly evolvable and able

to accommodate several mutations, some of them giving rise to a new function: the BADH activity and
therefore, the capacity to participate in the synthesis of
the osmoprotectant GB. The higher thermal stability of
the A441V and A441I mutants relative to that of the
wild-type and A441C, A441S, and A441T is consistent
with the extensive interactions made by the side chains
of Val and Ile, as indicated by our models and the
known crystal structures of ALDH10 enzymes that contain Ile at this position, and with the hydrophobicity of
these two residues. In the case of the A441F mutant the
strain exerted on the protein by the bulky benzyl ring
of Phe probably causes a decrease in the stability of this
enzyme when compared with that of the A441I or
A441V mutants.
Evolution of plant ALDH10 enzymes
One of the strategies used by plants to respond to the

demands of their environment involves the evolution of
novel metabolic pathways by recruiting enzymes from
old ones. The phylogenetic evidence presented here indicates that this is the case of the enzymes exhibiting
BADH activity that participate in the synthesis of the
osmoprotectant glycine betaine (GB), which in angiosperms evolved from I441-type ALDH10 enzymes.
Our results show that non-flowering plants possess
only one ALDH10 gene expressing an I441-type enzyme,
but flowering plants (monocots plus eudicots) have a
variable number of ALDH10 genes coding for I441-,
A441- or C441-type isoenzymes. The presence of additional gene copies in monocots and eudicots can be explained by several small- and large-scale duplications,
which were accompanied by gene losses and genome
rearrangements [34]. Indeed, the distribution of the duplicated ALDH10 enzymes that can be seen in the
phylogenetic tree in Figure 1 is in agreement with previous observations: (i) various eudicot families independently underwent genome duplication [35,36]; (ii) one
whole-genome duplication occurred early in the monocot lineage after its divergence from the eudicot lineage
[37]; and (iii) recent duplication events took place in
maize, soybean and grape [34]. Duplication is a prominent feature of the plant genomic architecture, and much
of plant diversity may have arisen following the duplication and adaptive specialization of pre-existing genes
[38]. In this context, duplication of the ALDH10 gene in
some plants allowed a functional specialization when
I441 mutated to A441 or C441 in one of the two copies
of the duplicated gene, as proposed by Daz-Snchez
et al. [19]. The ancient enzymes most probably had the
same AMADH activity that the present-time I441-type
isoenzymes, but they may have had also a vestigial
BADH activity, which was improved during the evolution of plants via an evolutionary pathway of sequential
Page 11 of 16
single mutations of the duplicates. In this way, the A441or C441-type isoenzymes acquired an extra BADH activity,
necessary for GB synthesis, while the original peroxisomal
I441-type isoenzymes remained as AMADHs devoid of
BADH activity and most likely retained their metabolic
role. Although the gain of the BADH activity does not
imply the loss of the other AMADH activities when
assayed in vitro ([19]; this work), the above observations indicate that the physiological functions of these
isoenzymes are not interchangeable. Indeed, in many plant
species the duplication of the ALDH10 gene did not result
in functional redundancy, since the duplicated genes not
only derived in enzymes with BADH activity but also in
non-peroxisomal I441-type AMADH isoenzymes, as in
the Solanaceae, Malvaceae, Rosacease and Brassicaceae
families, whose different cellular location probably allows
them to perform a different physiological function than
the peroxisomal ones. This is one possible reason for the
permanence of the duplicate genes that encode nonperoxisomal I441-type isoenzymes.
Our phylogenetic analysis also shows that all known
plant genomes contain at least one ADH10 gene coding
for a peroxisomal I441-type isoenzyme, which is the one
present even in those plants with a sequenced genome
that possess only one ALDH10 gene. This underscores the
importance of the biochemical processes in which these
peroxisomal I441-type isoenzymes participate, and indicate that, as mentioned above, in vivo they cannot be replaced by the ALDH10 isoenzymes that have gained the
extra BADH activity, i.e. the A441- or C441-type isoenzymes. Together, our findings strongly support that the
activity of the peroxisomal I441-type isoenzymes is essential for the plant, which is not unexpected considering that
the AMADH activity of these enzymes is involved in the
catabolism of polyamines taking place in the peroxisome
[39]. As mentioned above, the cytosolic I441-type isoenzyme may be involved in other physiological processes, for
instance the synthesis of several osmoprotectants, such as
4-aminobutyrate, -alanine, or carnitine by oxidizing
ABAL, APAL or TMABAL. The different intracellular location of the ALDH10 isoenzymes, predicted and in some
cases experimentally proven, suggest that there are two
kinds of the I441-typeperoxisomal (the commonest)
and cytosolic, both devoid of significant BADH activity,
and possibly two kinds of the A441- and C441-type
chloroplastic and cytosolic in the first case, and peroxisomal and cytosolic in the second, all of them having
BADH activity.
Regarding the intracellular location, the Amaranthaceae
A441-type isoenzymes most likely are chloroplastic, as
those from spinach [40] and sugarbeet [28], although they
lack a typical chloroplast-targeting signal [14]. Therefore,
in the Amaranthaceae the synthesis of GB most likely
takes place in the chloroplasts, as experimentally proven

for spinach [13]. This is in accordance with the chloroplastic location of the CMO enzyme in this plant [41] and
with the fact that the CMO activity requires the electrons
provided by reduced ferredoxin [17] and plant ferredoxins
are plastidic proteins [42]. But in the Poaceae plants that
have the C441-type isoenzyme, GB synthesis may take
place in the cytosolsince some of these isoenzymes are
non-peroxisomal and do not have a clear chloroplastleading signalor in peroxisomes, since other C441-type
isoenzymes have the peroxisomal signal. Indeed, it has
been suggested that in barley the synthesis of GB may take
place in the peroxisome, given the finding of a peroxisomal CMO in this plant [43]. But this proposal is at odds
with the proven non-peroxisomal location of the C441type ALDH10 isoenzyme of barley [9], and with the fact
that peroxisomal plant ferredoxins have not been
so far reported. Regardless of the peroxisomal or nonperoxisomal CMO location, it seems probable that the
need of transport into the peroxisomes of either choline
or BAL limits the synthesis of GB in those plants with
C441-type peroxisomal isoenzymes in comparison with
those in which this isoenzyme is non-peroxisomal. This is
in full agreement with the finding that the level of GB accumulation observed in cereal plants that have a predicted
peroxisomal C441-type isoenzymemaize, sorghum and
foxtail milletis much lower than that in plants that have
the non-peroxisomal C441-type, as wheat and barley
[44-46]. It could be predicted that other Poaceae species
which have a moderate ability to accumulate GB, such
as Pennisetum [44] and Panicum [46], have peroxisomal
C441-type isoenzymes, while those that are high GB accumulators, such as Secale [44,46], have the non-peroxisomal
C441-type isoenzyme.
Since the ability to synthesize the osmoprotectant GB
protects the plant against the most frequent environmental stresses such as salinity, drought, and low temperatures, as well as indirectly against other stresses that
usually accompany the formers, such as oxidative stress
and high temperatures (rev. in [47,48]), it is clear that
the presence of A441- or C441-type isoenzymes provides
a strong adaptive advantage. And not only to halophytes,
which grow in habitats where saline soils are prevalent,
but also to mesophytes, which may experience sporadic
episodes of water deficit or freezing temperatures. This,
together with the relatively easiness of the evolutionary
process, explains why the A441- and C441-type isoenzymes evolved independently several times through the
evolution of flowering plants. However, the A441- or
C441-type isoenzymes exhibit a limited phyletic distribution (Figures 1B and 1C), which agrees with the finding
that GB accumulation is also restricted to some eudicot
and monocot families [19]. This finding further support
the proposal that a significant BADH activity is essential
for GB accumulation [19]. Indeed, a significant BADH
Page 12 of 16
activity would be necessary not only to produce the

levels of GB needed for an osmoprotectant, but also to
prevent the accumulation of the BALwhich is produced by CMOup to toxic concentrations. But although the BADH activity is a sine qua non condition
for the plant to become a GB-accumulator, the current
experimental evidence, obtained studying wild-type GBaccumulator plants and transgenic non-accumulator
plants that express BADH or CMO genes (rev in [1]),
suggests that the acquisition of the ability to synthesize
GB by evolving a BADH activity in some plant ALDH10
enzymes should have been accompanied by other adaptations, such as: (i) the gain of a significant CMO activity; (ii) the adequate intracellular targeting of both the
CMO and BADH enzymes; (iii) the regulation by osmotic stress signals of the expression of the CMO and
BADH genes, as well as of those coding for critical enzymes of the choline biosynthetic pathway; and (iv)
probably also, the development of an efficient choline
and GB transport through intracellular membranes.
Evolutionary pathway for the acquisition of BADH activity
by plant ALDH10 enzymes
Our results indicate that plant ALDH10 enzymes may

have followed several evolutionary pathways for the acquisition of BADH activity, particularly the ones involving
any of the parsimonious intermediates with Val, Thr, Ser
at position equivalent to 441 of SoBADH. The evolutionary intermediate carrying F441 would have a diminished
AMADH activity, as judged by the low kcat/Km values of
the SoBADH A441F mutant, which could make the route
though it less probable. But as the enzymes that undergo
these mutations were coded by gene duplicates and the
original I441-type enzymes were conserved, the plant
would not have experienced any deleterious effect even if
the mutation to Phe took place. But this mutation would
have not provided any advantage to the plant either, in
contrast to the Ala o Ser mutations, and even to the mutation that led to non-peroxisomal I441-type isoenzymes.
Thus, the Phe441 mutation could have been eliminated
during evolution. Interestingly, natural ALDH10s of the
T441-type (2 sequences) and V441-type (3 sequences),
which the intermediary mutants in the parsimonious
pathway to A441 from I441, were found within the plant
ALDH10 protein sequences retrieved from public databases. We anticipate that enzymes of the S441-type will be
found when more monocot sequences are known. The
relatively high frequency of A441-type ALDH10 isoenzymes may result from a bias in the available reports, since
most of the studies have been carried out in halophytic
plants in which these enzymes participate in their osmotolerance mechanisms. Regarding the C441-type isoenzymes, they are present in cereal plants, which have been
extensively studied for their high agronomical interest.

Indeed, in cereals an evolutionary process directed by

humans to increase their tolerance to drought or saline
stress may have occurred.
The mutation of the original Ile residue at this position
to Val, Thr or Ser could be considered as neutral since it
would not have had any deleterious effect on the primitive AMADH function, as judged by the kcat/Km(APAL)
values of the mutant enzymes studied here. But while in
the case of the mutation to Val the resulting enzyme
would still be an AMADH devoid of significant BADH
activity, in the case of the mutation to Thr or Ser the enzyme would have experienced an important increase in
the vestigial BADH activity of the original enzyme,
which would make these enzymes true BADHs. The kinetic data of the mutant enzymes suggest that the BADH
activity of the T441-type or the S441-type intermediates
would be increased if a second mutation to Ala or Cys
took place. The same BADH activity would be gained
after the mutation of Val to Ala. These increases could
be of enough physiological importance to explain the selection of the enzymes with this second mutation to either Ala or Cys, which in turn would explain, at least in
part, the relatively higher frequency of the A441- or
C441-type isoenzymes over that of the V441-, T441-, or
S441-type.
The decrease in the thermal stability of those ALDH10
enzymes that underwent the mutational event by which
they acquire BADH activityas suggested by our results
with the SoBADH mutants at position 441would not
compromise their stability under physiological conditions.
Neither would be the folding affected, as judged by the
similar level of expression of these mutant enzymes as soluble proteins in E. coli. As a summary, Figure 6 shows the
comparison of the thermal stabilities and catalytic efficiencies of the seven SoBADH proteins studied in this work
the wild type and six mutants to illustrate the possible
fitness landscape of the evolution of the BADH activity
within the ALDH10 family. As can be seen, the change of
the Ile at position 441 does not affect the catalytic efficiency with APAL as substrate but it has a profound effect
on the catalytic efficiency with BAL. The thermostability
cost of this change would be surpassed by the advantage
of the gain of the BADH activity. Indeed, this may be the
reason for the scarcity of V441-type isoenzymes in the
present-time plant ALDH10s, which is rather surprising
given that the change of I441 for V441 has almost no effect either on AMADH activity or protein stability. It can
be speculated that a subsequent mutation to A441 is so
advantageous for the plant that most of the V441 enzymes
evolved to this final stage.
Page 13 of 16
Figure 6 Comparison of thermal stabilities and catalytic

efficiencies of wild-type and A441 SoBADH mutants. The
percentage of catalytic efficiency for the oxidation of BAL (green
down triangles) or APAL (red up triangles) was calculated from the
kcat/Km values given in Table 1 and Table 2, respectively, taking as
100% the values of the A441I mutant, which was assumed to
represent the ancestral AMADH enzyme. Thermal stability data
(apparent Tm values) are those given in Figure 4. SoBADH Enzymes:
A, wild-type; C, A441C; S, A441S; T, A441T; V, A441V; F, A441F; I, A441I.
processes for the gain of the BADH activity in plants,

and therefore for the acquisition of the potential to
synthesize the osmoprotectant GB, since evolution took
place in duplicated genes and the four parsimonious
evolutionary intermediates are functionally and structurally feasible, particularly three of them. Our results
strongly support that ancestral genes encoding peroxisomal I441-type isoenzymes devoid of BADH activity
mutated in several occasions during terrestrial plant
evolution, so that the present time A441- or C441-type
isoenzymes that exhibit BADH activity do not form a
monophyletic group inside the ALDH10 protein family.
We also provide additional evidence of the critical role
played by the residue at position 441 (SoBADH numbering) in the affinity for BAL of plant ALDH10 enzymes. Finally, our findings about the differences in
intracellular location of the isoenzymes with BADH activity indicate that the peroxisomal synthesis of GB is
constrained by some factor(s), and explain the known
fact that there are high and medium-GB accumulator
plants, the former having non-peroxisomal A441- or
C441-type isoenzymes, the latter being those with a
peroxisomal C441-type.
Methods
Conclusions
The phylogenetic, biochemical, and structural evidence
presented here support relatively smooth evolutionary
Chemicals and biochemicals
Betaine aldehyde chloride, the diethylacetal of APAL and

NAD+ were obtained from Sigma-Aldrich Qumica, S.A.

de C.V. (Toluca, Mxico). APAL was freshly prepared by

hydrolyzing its diethylacetal form as described by Flores
and Filner [49]. The exact concentration of the resulting
free APAL was determined in each experiment by the
amount of NADH produced after its complete oxidation
in the reaction catalyzed by SoBADH in the presence of
an excess of NAD+.
Site-directed mutagenesis, production and purification of
wild-type and mutant SoBADH enzymes
The plasmid pET28-SoBADH, containing the full sequence of the spinach BADH gene and a N-terminal
His-tag [19], was used as template for site-directed mutagenesis, which was performed via polymerase chain
reaction (PCR) using the Quick Change XL-II Site Directed Mutagenesis system (Agilent) and the following
mutagenic primers: A441V, GAAGGCTCTAGAAGTT
GGAGTTGTTTGGGTTAATTGCTCAC (forward) and
TTGTGAGCAATTAACCCAAACAACTCCAACTTCTA
GAGCC (reverse); A441S, GAAGGCTCTAGAAGTTGG
AACTGTTTGGGTTAATTGCTCAC (forward) and TTG
TGAGCAATTAACCCAAACAGTTCCAACTTCTAGAG
CC (reverse); A441T, GAAGGCTCTAGAAGTTGGAA
CCGTTTGGGTTAATTGCTCAC (forward) and TTGTG
AGCAATTAACCCAAACGGTTCCAACTTCTAGAGCC
(reverse); A441F, GAAGGCTCTAGAAGTTGGATTTGT
TTGGGTTAATTGCTCAC (forward) and TTGTGAGC
AATTAACCCAAACAAATCCAACTTCTAGAGCC (reverse);. The non-complementary mutagenic codons are in
italics. Mutagenesis was confirmed by DNA sequencing.
The expression and purification of the recombinant proteins were carried out as reported [19]. Protein concentrations were determined spectrophotometrically, using the
molar absorptivity at 280 nm of 86,400 M1 cm1 deduced
from the amino acid sequence by the method of Gill and
von Hippel [50].
Activity assay and kinetic characterization of the wildtype and mutant SoBADH enzymes
Steady-state initial velocities of wild-type SoBADH and

its mutants were measured spectrophotometrically as
reported [19] at pH 8.0 using 0.2 mM NAD+ and variable concentrations of BAL or APAL. The fixed concentration of NAD+ used in these experiments was
saturating, as indicated by the finding of very close kcat
values in experiments where the nucleotide was the
variable substrate and the aldehyde kept constant at a
concentration ten times its Km value. All assays were
initiated by addition of the enzyme. Each saturation
curve was determined at least in duplicate using enzymes
from two different purification batches. Initial velocity
data were analyzed by non-linear regression calculations
using the Michaelis-Menten equation. Equation 1 was
Page 14 of 16
used for the APAL saturation data, which exhibited substrate inhibition:
v=E k cat S=fK m S1 S=K IS g
where v is the experimentally determined initial velocity,

[E] is the enzyme concentration, kcat is the first order
rate constant for product formation at saturating substrate (equal to the maximal velocity, Vmax, divided by
the enzyme concentration), [S] is the concentration of
the variable substrate, Km is the concentration of substrate at half-maximal velocity, and KIS is the substrate
inhibition constant. Although substrate inhibition of
SoBADH by aminoaldehydes is partial [19], the highest
substrate concentration used in our experiments did not
allow distinguishing between total and partial inhibition,
and therefore Equation 1 for total inhibition was used.
Circular dichroism spectroscopy
CD signals were recorded with a Jasco J-715 spectropolarimeter (Jasco Inc., Easton, MD) equipped with a Peltiertype temperature control system (Model PTC-423S) and
calibrated with d-10-(+)-camphorsulfonic acid. Near-UV
(250320 nm) and far-UV (200250 nm) CD spectra were
recorded for samples of 0.25 or 1.0 mg/mL protein concentration, respectively, placed in quartz cuvettes of
1.0-cm and 0.1-cm path length, respectively. Data were
collected at 0.5 nm (near-UV) or 1.0 nm (far-UV) intervals, a bandwidth of 1.0 nm and at a scan rate of 20 nm/
min. Spectra were averaged over 5 scans and the average
spectrum of a reference sample without protein was subtracted. The observed ellipticities were converted to mean
residue ellipticities [] on the basis of a mean molecular
mass per residue of 109.1. Thermal-induced protein denaturation was monitored by following the changes in ellipticity at 222 nm by increasing the temperature from 20
to 90C at a constant rate of 1.5C/min. Determination of
apparent Tm values was performed by non-linear regression fit of the data to a single Bolztman sigmoidal function. ORIGIN software (OriginLab Corp.) was used for
data analysis and display.
In silico mutagenesis and modeling
Mutations in the crystal structure of the SoBADH (PDB

code 4A0M) at position 441 were generated in silico using
the standard rotamer library of Coot [51]. Mutant models
were subjected to a 1000-step energy-minimization process
using the Amber force field parameters in the UCSF
Chimera [52].
Sequence analyses
ALDH10 amino acid and nucleotide sequences were retrieved by Blast searches at the NCBI site [53] (http://blast.
ncbi.nlm.nih.gov/Blast.cgi) or Phytozome v9.1 database ([54];

http://www.phytozome.net/). Progressive multiple amino acid

sequence alignments were performed with ClustalX
version 2 ([55], http://www.clustal.org/clustal2/) using
as a guide a structural alignment constructed with the VAST
algorithm [56] that included all non-redundantALDH10
protein structures in the PDB [57]. Amino acid sequence
alignments were corrected manually using BioEdit ([58],
http://www.mbio.ncsu.edu/bioedit/bioedit.html) according to gapped BLASTP results. To identify protein sequences
as members of the ALDH10 family the phylogenetic
analyses previously performed by Julin-Snchez et al.
[59] were used as a reference. Phylogenetic analyses were
conducted using the MEGA5 software ([60]; http://www.
megasoftware.net). Four methods were used to infer phylogenetic relationships: maximum likelihood (ML), maximum
parsimony (MP), minimum evolution (ME), and neighbor
joining (NJ). The amino acids substitution model described by Whelan and Goldman [61] using a discrete
Gamma distribution with five categories, was chosen as
the best substitution model, since it gave the lowest
Bayesian Information Criterion values and corrected
Akaike Information Criterion values [62] in MEGA5
[60]. The gamma shape parameter value (+G parameter
= 1.1824) was estimated directly from the data with
MEGA5. Confidence for the internal branches of the
phylogenetic tree, obtained using ML method, was determined through bootstrap analysis (500 replicates each).
Additional files
Additional file 1: Table S1. Aldehyde dehydrogenases identified as
members of the ALDH10 family.
Additional file 2: Figure S1. Interactions of the residue at position
equivalent to A441 of SoBADH. Table S2. Distances of the side-chain
atoms of the residue at position 441 to their closest neighbors.
Abbreviations
ALDH: Aldehyde dehydrogenase; ABAL: 4-Aminobutyraldehyde;
AMADH: Aminoaldehyde dehydrogenase; APAL: 3-Aminopropionaldehyde;
BADH: Betaine aldehyde dehydrogenase; BAL: Betaine aldehyde;
CMO: Choline monooxygenase; GB: Glycine betaine; PDB: Protein data bank;
PsAMADH: Pea AMADH; SlAMADH: Tomato AMADH; SoBADH: Spinach BADH;
TMABAL: 4-Trimethylaminobutyraldehyde; WT: Wild type; ZmAMADH: Maize
AMADH.
Competing interests
All the authors declare that they have no competing interests.
Authors contributions
RAMC conceived, designed and coordinated the study, analyzed kinetic and
structural data, and wrote the manuscript. HRR and AJS carried out the
phylogenetic analysis, interpreted and wrote the results of this analysis, and
contributed to the general discussion and writing of the manuscript. CMJ
constructed and purified the mutant proteins and performed the kinetic
experiments. GGR carried out the CD and thermostability experiments and
analyzed these data. LGS made the in silico mutants, constructed their
models and helped with the making of the figures. All authors read and
approved the final manuscript.
Page 15 of 16
Acknowledgements
This work was supported by UNAM-PAPIIT grants IN217814 to RAMC and
IN216513 to HRR. We thank Dr. LP Martnez-Castilla (Faculty of Chemistry,
UNAM) for helpful discussions and to Dr. I. Chvez-Bjar (Faculty of Chemistry,
UNAM) for her help with the sequencing of the recombinant mutant enzymes.
Author details
Departamento de Bioqumica, Facultad de Qumica, Universidad Nacional
Autnoma de Mxico, Mxico D.F., Mxico. 2Departamento de Bioqumica,
Facultad de Medicina, Universidad Nacional Autnoma de Mxico, Mxico D.
F., Mxico.
1
Received: 27 March 2014 Accepted: 22 May 2014

Published: 29 May 2014
References
1. Chen THH, Murata N: Glycinebetaine protects plants against abiotic
stress: mechanisms and biotechnological applications. Plant Cell Environ
2011, 34(1):120.
2. Craig SA: Betaine in human nutrition. Am J Clin Nutr 2004, 80(3):539549.
3. Vasiliou V, Bairoch A, Tipton KF, Nebert DW: Eukaryotic aldehyde
dehydrogenase (ALDH) genes: human polymorphisms, and
recommended nomenclature based on divergent evolution and
chromosomal mapping. Pharmacogenetics 1999, 9(4):421434.
4. Vojtechov M, Hanson AD, Muoz-Clares RA: Betaine-aldehyde
dehydrogenase from amaranth leaves efficiently catalyzes the
NAD-dependent oxidation of dimethylsulfoniopropionaldehyde to
dimethylsulfoniopropionate. Arch Biochem Biophys 1997, 337(1):8188.
5. Trossat C, Rathinasabapathi B, Hanson AD: Transgenically expressed
betaine aldehyde dehydrogenase efficiently catalyzes oxidation of
dimethylsulfoniopropionaldehyde and -aminoaldehydes. Plant Physiol
1997, 113(4):14571461.
6. ebela M, Brauner F, Radov A, Jacobsen S, Havli J, Galuszka P, Pe P:
Characterisation of a homogeneous plant aminoaldehyde
dehydrogenase. Biochim Biophys Acta 2000, 1480(12):329341.
7. Livingstone JR, Maruo T, Yoshida I, Tarui Y, Hirooka K, Yamamoto Y, Tsutui N,
Hirasawa E: Purification and properties of betaine aldehyde dehydrogenase
from Avena sativa. J Plant Res 2003, 116(2):133140.
8. Oishi H, Ebina M: Isolation of cDNA and enzymatic properties of betaine
aldehyde dehydrogenase from Zoysia tenuifolia. J Plant Physiol 2005,
162(10):10771086.
9. Fujiwara T, Horia K, Ozaki K, Yokota Y, Mitsuya S, Ichiyanagi T, Hattori T, Takabe T:
Enzymatic characterization of peroxisomal and cytosolic betaine aldehyde
dehydrogenases in barley. Physiol Plant 2008, 134(1):2230.
10. Bradbury LMT, Gillies SA, Brushett D, Waters DLE, Henry RJ: Inactivation of
an aminoaldehyde dehydrogenase is responsible for fragrance in rice.
Plant Mol Biol 2008, 68(45):439449.
11. Brauner F, ebela M, Sngaroff J, Pe P, Meunier J-C: Pea seedling aminoaldehyde
dehydrogenase: primary structure and active site residues. Plant Physiol Biochem
2003, 41(1):110.
12. Tylichov M, Kopen D, Morra S, Briozzo P, Lenobel R, Sngaroff J,
ebela M: Structural and functional characterization of plant
aminoaldehyde dehydrogenase from Pisum sativum with a broad
specificity for natural and synthetic aminoaldehydes. J Mol Biol 2010,
396(4):870882.
13. Hanson AD, May AM, Grumet R, Bode J, Jamieson GC, Rhodes D: Betaine
synthesis in chenopods: localization in chloroplasts. Proc Natl Acad Sci U S
A 1985, 82(11):36783682.
14. Weretilnyk EA, Hanson AD: Betaine aldehyde dehydrogenase from
spinach leaves: purification, in vitro translation of the mRNA, and
regulation by salinity. Arch Biochem Biophys 1989, 271(1):5663.
15. Arakawa K, Takabe T, Sugiyama T, Akazawa T: Purification of betaine-aldehyde
dehydrogenase from spinach leaves and preparation of its antibody.
J Biochem 1987, 101(6):14851488.
16. Valenzuela-Soto E, Muoz-Clares RA: Purification and properties of
betaine aldehyde dehydrogenase extracted from detached leaves of
Amaranthus hypocondriacus L. subjected to water deficit. J Plant Physiol
1994, 143(2):145152.
17. Burnet M, Lafontaine PJ, Hanson AD: Assay, purification, and partial
characterization of choline monooxygenase from spinach. Plant Physiol
1995, 108(2):581588.

18. Hibino T, Meng YL, Kawamitsu Y, Uehara N, Matsuda N, Tanaka Y, Ishikawa

H, Baba S, Takabe T, Wada K, Ishii T, Takabe T: Molecular cloning and
functional characterization of two kinds of betaine-aldehyde dehydrogenase in betaine-accumulating mangrove Avicennia marina (Forsk.)
Vierh. Plant Mol Biol 2001, 45(3):353363.
19. Daz-Snchez AG, Gonzlez-Segura L, Mjica-Jimnez C, Rudio-Piera E,
Montiel C, Martnez-Castilla LP, Muoz-Clares RA: Amino acid residues
critical for the specificity for betaine aldehyde of the plant ALDH10
isoenzyme involved in the synthesis of glycine betaine. Plant Physiol
2012, 158(4):15701582.
20. Kopcn D, Koneitkov R, Tylichov M, Vigouroux A, Moskalkov H, Soural
M, ebela M, Morra S: Plant ALDH10 family. identifying critical residues
for substrate specificity and trapping a thiohemiacetal intermediate.
J Biol Chem 2013, 288(13):94919507.
21. Joseph S, Murphy D, Bhave M: Glycine betaine biosynthesis in saltbushes
(Atriplex spp.) under salinity stress. Biologia 2013, 68(5):879895.
22. Richardson AO, Palmer JD: Horizontal gene transfer in plants. J Exp Bot
2007, 58(1):19.
23. Bock R: The give-and-take of DNA: horizontal gene transfer in plants.
Trends Plant Sci 2010, 15(1):1122.
24. Lingner T, Kataya AR, Antonicelli GE, Benichou A, Nilssen K, Chen X-Y, Siemsen T,
Morgenstern B, Meinicke P, Reumann S: Identification of novel plant
peroxisomal targeting signals by a combination of machine learning
methods and in vivo subcellular targeting analyses. Plant Cell 2011,
23(4):15561572.
25. Chowdhary G, Kataya ARA, Lingner T, Reumann S: Non-canonical
peroxisome targeting signals: identification of novel PTS1 tripeptides
and characterization of enhancer elements by computational
permutation analysis. BMC Plant Biol 2012, 12:142.
26. Werdan K, Heldt HW: Accumulation of bicarbonate in intact chloroplasts
following a pH gradient. Biochim Biophys Acta 1972, 283(3):430441.
27. Heineke D, Riens B, Grosse H, Hoferichter P, Peter U, Flugge U, Heldt HW:
Redox transfer across the inner chloroplast envelope membrane.
Plant Physiol 1991, 95(4):11311137.
28. Rathinasabapathi B, McCue KF, Gage DA, Hanson AD: Metabolic
engineering of glycine betaine synthesis: plant betaine aldehyde
dehydrogenases lacking typical transit peptides are targeted to tobacco
chloroplasts where they confer betaine aldehyde resistance. Planta 1994,
193(2):155162.
29. Vojtechov M, Rodrguez-Sotres R, Valenzuela-Soto EM, Muoz-Clares RA:
Substrate inhibition by betaine aldehyde dehydrogenase from
leaves of Amaranthus hypochondriacus L. Biochim Biophys Acta 1997,
1341(1):4957.
30. Garza-Ramos G, Mjica-Jimnez C, Muoz-Clares RA: Potassium and ionic
strength effects on the conformational and thermal stability of two aldehyde
dehydrogenases reveal structural and functional roles of K+-binding sites.
PLoS One 2013, 8(1):e54899.
31. Levitt M, Perutz MF: Aromatic rings act as hydrogen bond acceptors.
J Mol Biol 1988, 201(4):751754.
32. Alvarez S: A cartography of the van der Waals territories. Dalton Trans
2013, 42(24):86178636.
33. Tokuriki N, Stricher F, Serrano L, Tawfik DS: How protein stability and new
functions trade off. PLoS Comput Biol 2008, 4(2):e1000002.
34. Van de Peer Y, Fawcett JA, Proost S, Sterck L, Vandepoele K: The flowering
world: a tale of duplications. Trends Plant Sci 2009, 14(12):680688.
35. Van de Peer Y, Maere S, Meyer A: The evolutionary significance of ancient
genome duplications. Nat Rev Genet 2009, 10(10):725732.
36. Fawcett JA, Maere S, Van de Peer Y: Plants with double genomes might
have had a better chance to survive the CretaceousTertiary extinction
event. Proc Natl Acad Sci U S A 2009, 106(14):57375742.
37. Tang H, Bowers JE, Wang X, Paterson AH: Angiosperm genome
comparisons reveal early polyploidy in the monocot lineage. Proc Natl
Acad Sci U S A 2010, 107(1):472477.
38. Flagel LE, Wendel JF: Gene duplication and evolutionary novelty in
plants. New Phytol 2009, 183(3):557564.
39. Moschou PN, Sanmartin M, Andriopoulou AH, Rojo E, Sanchez-Serrano JJ,
Roubelakis-Angelakis KA: Polyamine oxidase responsible for a full
back-conversion pathway in Arabidopsis. Plant Physiol 2008,
147(4):18451857.
40. Weigel P, Weretilnyk EA, Hanson AD: Betaine aldehyde oxidation by
spinach chloroplasts. Plant Physiol 1986, 82(3):753759.
Page 16 of 16
41. Brouquisse R, Weigel P, Rhodes D, Yocum CF, Hanson AD: Evidence for a
ferredoxin-dependent choline monooxygenase from spinach chloroplast
stroma. Plant Physiol 1989, 90(1):322329.
42. Hanke G, Mulo P: Plant type ferredoxins and ferredoxin-dependent
metabolism. Plant Cell Environ 2013, 36(6):10711084.
43. Mitsuya S, Kuwahara J, Ozaki K, Saeki E, Fujiwara T, Takabe T: Isolation and
characterization of a novel peroxisomal choline monooxygenase in
barley. Planta 2011, 234(6):12151226.
44. Hitz WD, Hanson AD: Determination of glycine betaine by pyrolysis-gas
chromatography in cereals and grasses. Phytochemistry 1980, 19(11):23712374.
45. Lerma C, Rich PJ, Ju GC, Yang W-J, Hanson AD, Rhodes D: Betaine deficiency
in maize: complementation tests and metabolic basis. Plant Physiol 1991,
95(4):1131119.
46. Ishitani M, Arakawa K, Mizuno N, Kishitani S, Takabe T: Betaine aldehyde
dehydrogenase in the gramineae: levels in leaves of both betaine-accumulating
and nonaccumulating cereal plants. Plant Cell Physiol 1993, 34(3):493495.
47. Chen THH, Murata N: Glycinebetaine: an effective protectant against
abiotic stress in plants. Trends Plant Sci 2008, 13(9):499505.
48. Ahmad R, Lim CJ, Kwon S-Y: Glycine betaine: a versatile compound with
great potential for gene pyramiding to improve crop plant performance
against environmental stresses. Plant Biotechnol Rep 2013, 7:4957.
49. Flores HE, Filner P: Polyamine catabolism in higher plants: characterization
of pyrroline dehydrogenase. Plant Growth Reg 1985, 3:277291.
50. Gill SC, von Hippel PH: Calculation of protein extinction coefficients from
amino acid sequence data. Anal Biochem 1989, 182(2):319326.
51. Emsley P, Cowtan K: Coot: model-building tools for molecular graphics.
Acta Crystallogr D Biol Crystallogr 2004, 60:21262132.
52. Pettersen EF, Goddard TD, Huang CC, Couch GS, Greenblatt DM, Meng EC,
Ferrin TE: UCSF Chimeraa visualization system for exploratory research
and analysis. Comput Chem 2004, 13:16051612.
53. Benson DA, Clark K, Karsch-Mizrachi I, Lipman DJ, Ostell J, Sayers EW: GenBank.
Nucl Acids Res 2014, 42:D32D37.
54. Goodstein DM, Shu S, Howson R, Neupane R, Hayes RD, Fazo J, Mitros T, Dirks
W, Hellsten U, Putnam N, Rokhsar DS: Phytozome: a comparative platform
for green plant genomics. Nucleic Acids Res 2012, 40:D1178D1186.
55. Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, McWilliam
H, Valentin F, Wallace IM, Wilm A, Lopez R, Thompson JD, Gibson TJ,
Higgins DG: Clustal W and Clustal X version 2.0. Bioinformatics 2007,
23(21):29472948.
56. Madej T, Lanczycki CJ, Zhang D, Thiessen PA, Geer RC, Marchler-Bauer A,
Bryant SH: MMDB and VAST+: tracking structural similarities between
macromolecular complexes. Nucleic Acids Res 2013, 42:D297D303.
57. Rose PW, Bi C, Bluhm WF, Christie CH, Dimitropoulos D, Dutta S, Green RK,
Goodsell DS, Prlic A, Quesada M, Quinn GB, Ramos AG, Westbrook JD,
Young J, Zardecki C, Berman HM, Bourne PE: The RCSB protein data
bank: new resources for research and education. Nucleic Acids Res 2013,
41:D475D482.
58. Hall TA: BioEdit: a user-friendly biological sequence alignment editor and
analysis program for Windows 95/98/NT. Nucl Acids Symp Ser 1999, 41:9598.
59. Julin-Snchez A, Riveros-Rosas H, Martnez-Castilla LP, Velasco-Garca R,
Muoz-Clares RA: Phylogenetic and structural relationships of the
betaine aldehyde dehydrogenases. In Enzymology and Molecular Biology of
Carbonyl Metabolism. 13th edition. Edited by Weiner H, Plapp B, Lindahl R,
Maser E. West Lafayette, IN: Purdue University Press; 2007:6476.
60. Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S: MEGA5:
molecular evolutionary genetics analysis using maximum likelihood,
evolutionary distance, and maximum parsimony methods. Mol Biol Evol
2011, 28(10):27312739.
61. Whelan S, Goldman N: A general empirical model of protein evolution
derived from multiple protein families using a maximum-likelihood
approach. Mol Biol Evol 2001, 18(5):691699.
62. Posada D, Buckley TR: Model selection and model averaging in
phylogenetics: advantages of Akaike information criterion and Bayesian
approaches over likelihood ratio tests. Syst Biol 2004, 53(5):793808.
doi:10.1186/1471-2229-14-149
Cite this article as: Muoz-Clares et al.: Exploring the evolutionary route
of the acquisition of betaine aldehyde dehydrogenase activity by plant
ALDH10 enzymes: implications for the synthesis of the osmoprotectant
glycine betaine. BMC Plant Biology 2014 14:149.
Table S1. Aldehyde dehydrogenases identified as members of ALDH10 family

Organisms with a complete sequenced genome are shaded in light blue. Phytozome data are colored green and
NCBI data black.
Organism
ALDH10
Lineage
Protein accession number
Genome assembly
Gene locus
Number of genes
Amino acid sequence length
Plants
Chlorophyta
Mamiellophyceae
Micromonas pusilla CCMP1545
XP_003064309
Chlorophyta; Mamiellophyceae; Mamiellales
(C1N8N9)
Phytozome: partially finished v3 genome assembly and annotation
MicpuC2.e_gw1.17.47.1
10 660 total loci containing protein-coding transcripts
(MICPUCDRAFT_23534)
505 aa
Micromonas pusilla RCC299
Absent
Phytozome: finished v3 genome assembly and annotation
17 chromosomes
Ostreococcus lucimarinus CCE9901
XP_001420154
estExt_Genewise_ext.C_Chr_100439
Phytozome: finished v.2 genome assembly and annotation
OSTLU_50750
21 chromosomes
Chromosome 10
7,796 total loci containing protein-coding transcripts
523 aa
Ostreococcus tauri
CAL56178
XP_003081654
8 110 genes
Ot10g02210
Chromosome 10
506 aa
Trebouxiophyceae
Coccomyxa subellipsoidea C-169
EIE20955
Chlorophyta; Trebouxiophyceae; Coccomyxaceae
I0YRD6
Phytozome: improved v2 genome assembly and annotation
fgenesh1_pm.14_#_152
COCSUDRAFT_37718
498 aa
Chlorophyceae
Chlamydomonas reinhardtii (strain: CC-503 cw92 mt+)
XP_001699134
(Chlamydomonas smithii)
A8JAX9
Chlorophyta; Chlorophyceae; Chlamydomonadales;
Cre13.g605650
Chlamydomonadaceae
CHLREDRAFT_24394
Phytozome: v5.3.1 of Chlamydomonas annotations
504 aa
17 linkage groups (chromosomes)
12,264 stable gene (13,450 stable transcript)
Volvox carteri f. nagariensis (strain: Eve, forma: nagariensis)
XP_002947147
(Green alga)
D8TLH8
Chlorophyta; Chlorophyceae; Chlamydomonadales; Volvocaceae
Vocar20010574m.g
Phytozome: version 2, 8x genome assembly and annotation
VOLCADRAFT_73155
503 aa
(314 total alternatively spliced transcripts)
Streptophyta
Organism
Lineage
Genome assembly
Number of genes
Embriophyta
Physcomitrella patens subsp. patens (Moss)
Streptophyta; Embryophyta; Bryophyta; Bryophytina; Bryopsida;
Funariidae; Funariales; Funariaceae
Phytozome: v3.0 assembly (preliminary)
27 chromosomes
26610 loci containing protein-coding transcripts
Selaginella moellendorffii (Spikemoss)
Streptophyta; Embryophyta; Tracheophyta; Lycopodiophyta;
Isoetopsida; Selaginellales; Selaginellaceae
Phytozome: v1.0 Dec 20, 2007 FilteredModels3 annotation
27 chromosomes
22 285 protein-coding transcripts
ALDH10
Gene locus
XP_001756623
A9RQZ4
PHYPADRAFT_204867
507 aa
XP_002974519
D8RTU8
174224
SELMODRAFT_174224
503 aa
XP_002990779
D8T5B3
SELMODRAFT_272160
503 aa
(redundant copy because the
assembled genome includes two
haplotypes)
Gymnosperm
Picea sitchensis (Sitka spruce) (Pinus sitchensis)
Tracheophyta; Spermatophyta; Coniferopsida; Coniferales; Pinaceae
Angiosperm
Liliopsida (monocots)
Aegilops tauschii (Tausch's goatgrass)
Tracheophyta; Spermatophyta; Magnoliophyta; Liliopsida; Poales;
Poaceae; BEP clade; Pooideae; Triticeae
Aeluropus lagopoides
Liliopsida; Poales; Poaceae; PACMAD clade; Chloridoideae;
Cynodonteae; Aeluropinae
Agropyron cristatum
(Crested wheatgrass) (Bromus cristatus)
Liliopsida; Poales; Poaceae; BEP clade; Pooideae; Triticeae
Brachypodium distachyon
Liliopsida; Poales; Poaceae; BEP clade; Pooideae; Brachypodieae
BioProject PRNJ74771
v1.0 8x assembly
5 chromosomes
26,552 loci containing protein-coding transcripts
ABK24463
A9NV02
(ABK24261)
503aa
EMT10403
M8C5I2
F775_31015
503 aa
AEV53927
G9JNB0
334 aa (fragment)
ACZ67850
D2K6H6
394 aa (fragment)
XP_003579919
LOC100826926
Chromosome 5
506 aa
XP_003574495
LOC100845613
Chromosome 3
501 aa
Organism
Lineage
Genome assembly
Number of genes
Hordeum brevisubulatum
Hordeum vulgare subsp. vulgare (domesticated barley)
Poaceae; BEP clade; Pooideae; Triticeae /cultivar="Haruna-nijyo
Hordeum vulgare
Liliopsida; Poales; Poaceae; BEP clade; Pooideae; Triticeae /cultivar:
116 Jeonju Native Korca
Leymus chinensis
Lolium perenne (Perennial ryegrass)

Liliopsida; Poales; Poaceae; BEP clade; Pooideae; Poeae; Loliinae
Ophiopogon japonicus
Liliopsida; Asparagales; Asparagaceae; Nolinoideae
Oryza sativa Japonica Group

Poaceae; BEP clade; Ehrhartoideae; Oryzeae
BioProject PRJNA13141:
30534 genes (12 chromosomes)
28555 proteins
BioProject PRJNA13139
35394 proteins
ALDH10
Gene locus
AAS66641
505aa
BAB62846
BBD2
503 aa
BAB62847
BBD1
506 aa
Q40024
LOC548296
505 aa
(BAB62847 ortolog)
BAD86758
LcBADH2
502 aa
BAM10432
BAD86757
LcBADH1
506 aa
AFA36547
288aa (fragment)
ABG34273
Q153G6
BADH
500 aa
XP_482470
NP_001061833
BADH2
Os08g0424500
(Phytozome: LOC_Os08g32870)
Chromosome 8
503 aa
O24174
NP_001053016
Os04g0464200
BADH1
(Phytozome: LOC_Os04g39020)
Chromosome 4
505 aa
Organism
Lineage
Genome assembly
Number of genes
Oryza sativa Indica Group (long-grained rice)
Tracheophyta;Spermatophyta; Magnoliophyta; Liliopsida; Poales;
Poaceae; BEP clade; Ehrhartoideae; Oryzeae
BioProject PRJN361
37358 proteins
Pandanus amaryllifolius
Liliopsida; Pandanales; Pandanaceae
Setaria italica (foxtail millet)

Liliopsida; Poales; Poaceae; PACMAD clade; Panicoideae; Paniceae
chromosome-scale release of the 8.3x whole genome shotgun
assembly (98.9% of the sequence data is represented in the 9
pseudomolecules).
Sorghum bicolor (sorghum)
Liliopsida; Poales; Poaceae; PACMAD clade; Panicoideae;
Andropogoneae
NCBI: BioProject PRJNA38691, PRJNA13876; Assembly: Sorbi1
10 chromosomes
33,080 genes
Phytozome: v1.0 release, comprising the Sbi1 assembly and Sbi1.4
gene set
20 chromosomes
Triticum aestivum (bread wheat)
Triticum urartu (Red wild einkorn)
Poaceae; BEP clade; Pooideae; Triticeae
ALDH10
Gene locus
CM000133
Chromosome 8
503 aa
(unreported gen)
EEC77423
B8AV58
OsI_16212
Chromosome 4
505 aa
Almost identical to:
ABB83473
505 aa
AFD62259
H9BS79
BADH2
387 aa (fragment)
Si009902m
Si009902m.g
505 aa
Si013592m
Si013592m.g
505 aa
AAC49268_NC012875
SORBIDRAFT_06q019200
Chromosome 6
506 aa
XP_002444357
SORBIDRAFT_07g020650
Chromosome 7
505 aa
AAL05264
CBK51339
503 aa
EMS68665
M8ATW1
TRIUR3_04819
417 aa
EMS48376
M7YN64
TRIUR3_05640
544 aa
Organism
Lineage
Genome assembly
Number of genes
Zea mays
Liliopsida; Poales; Poaceae; PACMAD clade; Panicoideae;
Andropogoneae
BioProject B73RefGen_V2
10 chromosomes
39 454 genes
ALDH10
Gene locus
AAT70230
NP_001105781
LOC606443
AMADH1B
505 aa
NP_001157807
(PDB: 4I8P)
C0P9J6
gpm154
AMADH1A
LOC100302679
505 aa
Zoysia tenuifolia
Liliopsida; Poales; Poaceae; PACMAD clade; Chloridoideae;
Zoysieae; Zoysiinae
NP_001157804
AMADH2
506 aa
BAD34955
clone="18
BAD34954
BAD34947
504 aa
BAD34957
clone="ZBD1"
BAD34952
BAD34953
507 aa
Eudicotyledons
Amaranthus hypochondriacus (grain amaranth)
eudicotyledons; core eudicotyledons; Caryophyllales; Amaranthaceae
Ammopiptanthus mongolicus
eudicotyledons; core eudicotyledons; rosids; fabids; Fabales;
Fabaceae; Papilionoideae; Thermopsideae
O04895
AAB58165
BADH4
Chloroplastic
501 aa
AAB70010
O22467
BADH17
500 aa
ABC86862
Q2I693
241aa (fragment)
Organism
Lineage
Genome assembly
Number of genes
Aquilegia coerulea Goldsmith (Rocky mountain columbine;
Colorado blue columbine)
Streptophyta; Embryophyta; Tracheophyta; Spermatophyta;
Magnoliophyta; eudicotyledons; Ranunculales; Ranunculaceae
Phytozome: initial 8X unmapped genome assembly and the version
1.1 annotation
Arabidopsis lyrata subsp. lyrata (Lyre-leaved rock-cress)
eudicotyledons; core eudicotyledons; rosids; malvids; Brassicales;
Brassicaceae
Phytozome: includes JGI release v1.0
32670 protein-coding transcripts
Arabidopsis thaliana (thale cress)

Brassicaceae; Camelineae
Phytozome; includes TAIR annotation release 10 of the Arabidopsis
thaliana genome release 9
Atriplex centralasiatica
Atriplex hortensis
(Mountain spinach)
ALDH10
Gene locus
Aquca_002_00337
503 aa
XP_002877599
D7LRJ5
ARALYDRAFT_906054
937567
ALDH10A9
503 aa
XP_002889000
D7KSI7
ARALYDRAFT_895359
926872
ALDH10A8
501 aa
AAL34161
NP_190400
ALDH10A9
AT3G48170
Chromosome 3
Peroxisome
503 aa
Q9S795
NP_565094
NP_001185399
ALDH10A8
AT1G74920
ALDH10A8
Chromosome 1
501 aa
AAM19157
Q8L8I3
BADH
500aa
ABF72123
Q19QV8
(P42575; same gene)
500 aa
Organism
Lineage
Genome assembly
Number of genes
Atriplex micrantha
Atriplex prostrata
(Spear-leaved orache) (Atriplex triangularis)
Atriplex tatarica
Avicennia marina (betaine-accumulating mangrove) (Grey

mangrove) (Sceura marina)
eudicotyledons; core eudicotyledons; asterids; lamiids; Lamiales;
Acanthaceae; Avicennioideae
Beta vulgaris (sugar beet)

NCBI: BioProject PRJNA176558, assembly BwSeq-1
9 chromosomes
Brassica napus (rape)

Brassicaceae; Brassiceae
Brassica rapa (field mustard; Turnip)
eudicotyledons; core eu dicotyledons; rosids; malvids; Brassicales;
Brassicaceae; Brassiceae
Phytozome: v1.2 annotation is on assembly v1.1.
ALDH10
Gene locus
ABM97658
A2TJX7
BADH
500 aa
AAM08913
Q8RX99
BADH1
(AAP13999)
500 aa
AAM08914
Q8RX98
BADH2
424 aa (fragment)
ABQ18317
A5HMM5
BADH
500 aa
BAB18544
Q9FRY2
Clone 13
502 aa
BAB18543
Q9FRY3
Clone 2
503 aa
P28237
CAA41377
CAA41376
Chloroplastic
500 aa
(not reported yet at NCBI)
Locus 1572
500 aa
AAQ55493
503 aa
Bra003781
Bra003781
501 aa
Bra019528
Bra019528
503 aa
Organism
Lineage
Genome assembly
Number of genes
Camellia sinensis (tea)
eudicotyledons; core eudicotyledons; asterids; Ericales; Theaceae
Capsella rubella
Tracheophyta; Spermatophyta; Magnoliophyta; eudicotyledons; core
eudicotyledons; rosids; malvids; Brassicales; Brassicaceae;
Camelineae
Phytozome: initial 22x genome assembly and a preliminary
annotation
Carthamus tinctorius (safflower)
eudicotyledons; core eudicotyledons; asterids; campanulids;
Asterales; Asteraceae; Carduoideae; Cardueae; Centaureinae
Chorispora bungeana
Brassicaceae; Chorisporeae
Chrysanthemum lavandulifolium (Daisy) (Dendranthema
lavandulifolium)
Asterales; Asteraceae; Asteroideae; Anthemideae; Artemisiinae
ALDH10
Gene locus
AFP19449
I7F760
505 aa
EOA23841
CARUB_v10017058mg
503 aa
EOA35065
CARUB_v10020176mg
501 aa
ADW80905
G8D1H1
510 aa
AAV67891
Q5Q033
502 aa
AAY33871
Q4U5F2
DlBADH1
503 aa
Cicer arietinum (chickpea) (garbanzo)

eudicotyledons; rosids; fabids; Fabales; Fabaceae; Papilionoideae;
Cicereae
AAY33872
Q4U5F1
DlBADH2
506 aa
XP_004508822
LOC101506136
Chromosome Ca7
503 aa
Citrus clementina (clementine mandarin)

eudicotyledons; rosids; malvids; Sapindales; Rutaceae
XP_004501961
LOC101507930
Chromosome Ca5
503 aa
Ciclev10019800m
Ciclev10019800m.g
505 aa
Phytozome: (clementine1.0) integrates 1.560 M ESTs with homology

and ab initio-based gene predictions.
9 chromosomes
24,533 protein-coding loci
Ciclev10019822m
Ciclev10019800m.g
501 aa
(same locus, alternative transcript)
Organism
Lineage
Genome assembly
Number of genes
Citrus sinensis (sweet orange)
eudicotyledons; rosids; malvids; Sapindales; Rutaceae
Phytozome: (v.1) of the assembly is 319 Mb spread over 12,574
scaffolds
25,376 protein-coding loci
Corylus heterophylla
eudicotyledons; core eudicotyledons; rosids; fabids; Fagales;
Betulaceae
Cucumis melo (muskmelon)
eudicotyledons; core eudicotyledons; rosids; fabids; Cucurbitales;
Cucurbitaceae; Benincaseae
Cucumis sativus (cucumber)
eudicotyledons; core eudicotyledons; rosids; fabids; Cucurbitales;
Cucurbitaceae; Benincaseae
Phytozome: Roche/JGI v1 annotation
Fragaria vesca subsp. Vesca (woodland strawberry)
eudicotyledons; rosids; fabids; Rosales; Rosaceae; Rosoideae;
Potentilleae; Fragariinae
ALDH10
Gene locus
Located in scaffold_0016_14
(non-reported gene)
ADW80331
E9NRZ9
503 aa
AEK81574
G1EH68
503 aa
XP_004138132
LOC101213657
Cucsa.197230
503 aa
XP_004299590
mrna09492.1-v1.0-hybrid
LOC101300913
gene09492-v1.0-hybrid
505 aa
NCBI BioProject: PRJNA66853, PRJNA60037; assembly:

FraVesHawaii_1.0
7 chromosomes
25,247 genes
23,319 proteins
Phytozome: includes gene annotation of genome release 1.1.
7 chromosomes
Organism
Lineage
Genome assembly
Number of genes
Glycine max (Soybean) (Glycine hispida)
Fabaceae; Papilionoideae; Phaseoleae
44642 proteins
Phytozome: Soybean Glyma1.0 annotation; 20 chromosomes, with a
small additional amount of mostly repetitive sequence in unmapped
scaffolds.
54,175 protein-coding loci and 73,320 transcripts have been
predicted
Gossypium hirsutum (upland cotton)

eudicotyledons; core eudicotyledons; rosids; malvids; Malvales;
Malvaceae; Malvoideae
Gossypium raimondii (cotton)
eudicotyledons; core eudicotyledons; rosids; malvids; Malvales;
Malvaceae; Malvoideae
Phytozome: v2.1 annotation release is on genome assembly v2.0
13 chromosomes
37,505 protein coding genes
Halocnemum strobilaceum
Halostachys caspica
Haloxylon ammodendron
Haloxylon persicum
ALDH10
Gene locus
NP_001234990
BADH1
B0M1A6
Glyma06g19820
Chromosome 6
503 aa
NP_001238427
B0M1A5
ADN03184
BADH2
Glyma05g01770
Chromosome 5
503 aa
XP_003550754
LOC100795267
Glyma17g10120
Chromosome 17
315 aa (pseudogene)
AAR23816
503 aa
Gorai.001G071200.2
Gorai.001G071200
503 aa
Gorai.007G047400.1
Gorai.007G047400
502 aa
AFB74193
H6VX92
BADH
500 aa
ABO45931
A4LAP2
500 aa
ACS96437
D0E0H5
BADH
500 aa
AEW31327
G9I1P9
BADH
500 aa
10
Organism
Lineage
Genome assembly
Number of genes
Helianthus annuus (common sunflower)
Asterales; Asteraceae; Asteroideae; Heliantheae alliance; Heliantheae
Jatropha curcas
eudicotyledons; core eudicotyledons; rosids; fabids; Malpighiales;
Euphorbiaceae; Crotonoideae; Jatropheae
Kalidium foliatum
Ligusticum sinense
eudicotyledons; core eudicotyledons; asterids; campanulids; Apiales;
Apiaceae; Apioideae; apioid superclade; Selineae
Lycium barbarum (Matrimony vine)
eudicotyledons; core eudicotyledons; asterids; lamiids; Solanales;
Solanaceae; Solanoideae; Lycieae
Medicago sativa (alfalfa)
Fabaceae; Papilionoideae; Trifolieae
Medicago truncatula (barrel medic)
Fabaceae; Papilionoideae; Trifolieae
45000 genes (8chromosomes)
46092 proteins
Mimulus guttatus (spotted monkey flower; Yellow monkey flower)

eudicotyledons; asterids; lamiids; Lamiales; Phrymaceae
Phytozome: includes the JGI gene annotation v1.1 of assembly v1.0
26718 loci containing protein-coding genes
Morus alba var. Multicaulis (mulberry)
eudicotyledons; rosids; fabids; Rosales; Moraceae
ALDH10
Gene locus
ACU65243
C8CBI9
BADH
503 aa
ABO69575
B2BBY6
BADH
503 aa
(AFY98894-521aa, incorrect
insertion)
ABI95806
Q06AI9
500 aa
ADL61811
H2KKR8
508 aa
ACQ99195
D2DEK8
503 aa
AFS33786
J9XXT4
BADH
505 aa
ABE82378
XP_003608928
G7JNS2
(AFK34878)
(AFK43263)
MTR_4g106510
Chromosome 4
503 aa
(ACJ85836; fragment)
AFK44601
(NC_016409)
Chromosome 3
503 aa
mgv1a004929m
mgv1a004929m.g
504 aa
AGG82698
M4NDU5
501 aa
11
Organism
Lineage
Genome assembly
Number of genes
Panax ginseng (Korean ginseng)
eudicotyledons; core eudicotyledons; asterids; campanulids; Apiales;
Araliaceae
Phaseolus vulgaris (Kidney bean; French bean)
Fabaceae; Papilionoideae; Phaseoleae
Phytozome: release of V1.0, the first chromosome scale version
11 chromosomes
Pisum sativum (pea)

Fabaceae; Papilionoideae; Fabeae
ALDH10
Gene locus
AAQ76705
Q6JSK3
BADH1
503 aa
Phvul.009G182300.1
Phvul.009G182300
Chromosome 9
503 aa
Phvul.003G196700.1
Phvul.003G196700
Chromosome 3
503 aa
CAC48393
Q93YB2
(PDB: 3IWJ)
AMADH2
503 aa
CAC48392
(PDB: 3IWK)
AMADH1
503 aa
Populus euphratica (Euphrates poplar)

Salicaceae; Saliceae
Populus trichocarpa (Populus balsamifera subsp. trichocarpa) (black

cottonwood tree; Western balsam poplar))
Salicaceae; Saliceae
JGI v3.0 gene annotation of assembly v3
73013 protein-coding trancripts
45555 protein-coding genes (19 chromosomes)
AFA53117
H6V966
BADH2
503 aa
AFA53116
H6V965
BADH1
503 aa
XP_002322147
(B9IEL4)
Potri.015G070600
(POPTRDRAFT_666405)
Chromosome LGXV
503 aa
XP_002318630
(B9I351)
Potri.012G075600
(POPTRDRAFT_661953)
Chromosome LGXII
503 aa
12
Organism
Lineage
Genome assembly
Number of genes
Prunus persica (peach)
eudicotyledons; rosids; fabids; Rosales; Rosaceae; Maloideae;
Amygdaleae
Pyrus betulifolia (birch-leaf pear)

eudicotyledons; core eudicotyledons; rosids; fabids; Rosales;
Rosaceae; Amygdaloideae; Maleae
Ricinus communis (Castor bean)
Euphorbiaceae; Acalyphoideae; Acalypheae
Phytozome: includes TIGR/JCVI release v0.1
31221 protein-coding transcripts
Sesuvium portulacastrum (Shoreline sea purslane) (Portulaca
portulacastrum)
eudicotyledons; core eudicotyledons; Caryophyllales; Aizoaceae
Solanum lycopersicum (tomato) (Lycopersicon esculentum)
Solanaceae; Solanoideae; Solaneae
NCBI BioProject: PRJNA66163, assembly SL2.40
12 chromosomes
27,466 genes
Phytozome: ITAG2.3 made by International Tomato Annotation
Group (ITAG) on assembly ITAG2.3
12 chromosomes
Solanum torvum
Solanum tuberosum (Potato) (SOLTU)
Phytozome: Solanum tuberosum Group Phureja DM1-3 516R44
(CIP801092) Genome Annotation v3.4 mapped to pseudomolecule
sequence
12 chromosomes
ALDH10
Gene locus
EMJ18033
M5X943
PRUPE_ppa022568mg
503 aa
EMJ11127
M5WBJ6
PRUPE_ppa004563mg
503 aa
AER10508
G8EWJ4
503 aa
XP_002511463
B9R8Y8
RCOM_1512620
30147.t000284
503 aa
AEK98521
G1FG21
500aa
AAX73303
Q56R04
(PDB: 4I8Q; 4I9B)
Chromosome 6
AMADH1
Solyc06g071290.2
504 aa
NP_001234235
B6ECN9
Chromosome 3
AMADH2
Solyc03g113800.2
505 aa
AFA37976
H6V8T9
BADH
505 aa
PGSC0003DMP400055759
PGSC0003DMT400083025
PGSC0003DMG400033028
504 aa
PGSC0003DMP400042549
PGSC0003DMT400063205
PGSC0003DMG400024582
505 aa
13
Organism
Lineage
Genome assembly
Number of genes
Spinacia oleracea (spinach)
eudicotyledons; Caryophyllales; Amaranthaceae; Chenopodioideae;
Anserineae
Suaeda liaotungensis
Suaeda maritima (Annual sea blite) (Suaeda spicata)

Suaeda salsa (Seepweed) (Chenopodium salsum)
Theobroma cacao cultivar="Matina 1-6" (cacao) (cocoa)

eudicotyledons; rosids; malvids; Malvales; Malvaceae;
Byttnerioideae
Phytozome: V1.1 release
ALDH10
Gene locus
P17202
(PDB: 4A0M)
chloroplastic
497 aa
AAL33906
Q8W5A1
BADH
501aa
AFW04226
K7T3P2
501 aa
ABG23669
Q155V4
BADH
501 aa
EOY20585
Domain 1
TCM_011968
Chromosome 3
503 aa
EOY20585
Domain 2
TCM_011968
Chromosome 3
511 aa
Comprise two adjacent ALDH10
genes
14
Organism
Lineage
Genome assembly
Number of genes
Vitis vinifera (wine grape)
eudicotyledons; core eudicotyledons; rosids; Vitales; Vitaceae
NCBI BioProject: PRJNA34679
19 chromosomes
24,508 genes
Phytozome: 12X March 2010 release of the draft genome and
annotation of Vitis vinifera by the French-Italian Public Consortium
for Grapevine Genome Characterization
19 chromosomes
ALDH10
Gene locus
XP_003634296
LOC100251899
Chromosome 17
497 aa
(CBI15092) fragment
XP_002283690
D7SHY3
GSVIVT01007829001
LOC100246770
GSVIVT01007829001
Chromosome 17
503 aa
XP_002281984
GSVIVG01032588001
LOC100250859
GSVIVG01032588001
Chromosome 14
499 aa
Fungi
Ascomycota
Schizosaccharomyces pombe (fission yeast)
Fungi; Dikarya; Ascomycota; Taphrinomycotina;
Schizosaccharomycetes; Schizosaccharomycetales;
Schizosaccharomycetaceae
Bioproject: PRJNA127, PRJNA13836, PRJNA20755
3 chromosomes
5133 protein coding genes
Protist
Alveolata
Perkinsus marinus ATCC 50983
Eukaryota; Alveolata; Perkinsea; Perkinsida; Perkinsidae
Bioproject: PRJNA46451, PRJNA12737
Cryptophyta
Guillardia theta CCMP2712
Eukaryota; Cryptophyta; Pyrenomonadales; Geminigeraceae
Bioproject: PRJNA223305, PRJNA53577
Stramenopiles
Ectocarpus siliculosus (brown alga)
Eukaryota; Stramenopiles; PX clade; Phaeophyceae; Ectocarpales;
Ectocarpaceae
Bioproject: PRJEA42625
O59808
NP_588102
SPCC550.10
Chromosome III
500 aa
XP_002784436
Pmar_PMAR003695
394aa (fragment)
incomplete on both ends
EKX35999
GUITHDRAFT_117911
542 aa
CBN79171
Esi_0010_0069
517 aa
15
Organism
Lineage
Genome assembly
Number of genes
Phytophthora sojae
Eukaryota; Stramenopiles; Oomycetes; Peronosporales
Bioproject: PRJNA17989
ALDH10
Gene locus
EGZ28599
G4YMH3
PHYSODRAFT_248120
473 aa
EGZ28472
G4YIQ2
PHYSODRAFT_284276
418 aa
Bacteria
Alphaproteobacteria
Rhizobium leguminosarum bv. trifolii WSM2297
Bacteria; Proteobacteria; Alphaproteobacteria; Rhizobiales;
Rhizobiaceae; Rhizobium/Agrobacterium group
Rhizobium sp. CCGE 510

Bacteria; Proteobacteria; Alphaproteobacteria; Rhizobiales;
Rhizobiaceae; Rhizobium/Agrobacterium group
Betaproteobacteria
Burkholderia ambifaria MC40-6
Betaproteobacteria; Burkholderiales; Burkholderiaceae; Burkholderia
6784 genes
Burkholderia multivorans ATCC 17616

6373 genes
Burkholderia pseudomallei 305

Burkholderia sp. 383
Burkholderia cepacia R18194
7824 genes
Gammaproteobacteria
Colwellia psychrerythraea 34H (COLPS)
5054 genes (chromosome)
WP_003575619
EJC83393
ZP_18315655
Rleg4DRAFT_5155
496 aa
EJT02404
ZP_10838419
J6DKY5
RCCGE510_27926
plasmid="pRspCCGE510d"
496 aa
ZP_01555907
YP_001809915
BamMC406_3226
Chromosome 2
493 aa
ZP_01568328
YP_001585229
Bmul_5267
Chromosome 2
493 aa
ZP_01765086
BURPS305_6395
482 aa
YP_366413
Bcep18194_C6720
Chromosome 3
490 aa
YP_266864
CPS_0096
491 aa
16
Organism
Lineage
Genome assembly
Number of genes
Pseudomonas fluorescens Pf0-1
Gammaproteobacteria; Pseudomonadales; Pseudomonadaceae;
Pseudomonas
Pseudomonas protegens Pf-5 (PSEF5)
Gammaproteobacteria; Pseudomonadales; Pseudomonadaceae;
Pseudomonas
Pseudomonas putida W619 (PSEPW)

ALDH10
Gene locus
YP_350198
Pfl01_4470
483 aa
YP_261892
PFL_4811
482 aa
YP_260018
PFL_2912
476 aa
ZP_01639992
YP_001751324
PputW619_4475
476 aa
17
SoBADH
ZmAMADH1a
W461
W456
W443
W448
A441
C446
PsAMADH2
SlAMADH1
W460
W459
W446
W447
I444
I445
W456
W456
W443
W443
S441
C441
W456
W456
W443
W443
T441
V441
W456
W456
W443
F441
W443
I441
Figure S1 Interactions of the

residue at position equivalent
to Ala441 of SoBADH. (A)
Molecular surface
representations showing the sidechains of residues at position
441, 443 and 456 (SoBADH
numbering) in the known crystal
structures of plant ALDH10
enzymes. (B) Molecular surface
representations of the same
residues in the minimized
models of the in silico SoBADH
mutants in which A441 was
changed. Side-chains are shown
as sticks with oxygen atoms in
red, nitrogen in blue, and sulfur
in yellow. Carbon atoms are
colored as shown. The following
PDB codes were used:
SoBADH, 4A0M; PsAMADH2,
3IWJ; ZmAMADH1a, 4I8P;
SlAMADH1, 4I9B. The figure
was generated using PyMOL
(www.pymol.org).
Table S2. Distances of the side-chain atoms of residue at position 441 to their closets neighbor
Enzyme (residue)
Atoms
Distance ()
SoBADH (A441)
CB A441-CZ3 W456
3.71
ZmAMADH1 (C446)
CB C446-CZ3 W461
SG C446-CZ3 W461
SG C446-CZ2 W448
SG C446-CE2 W448
SG C446-NE1 W448
3.90
3.94
3.62
3.52
3.76
PsAMADH2b (I444)
CD1 I444-CG W459

CD1 I444-CD2 W459
CD1 I444-CE2 W459
CD1 I444-CZ2 W459
CD1 I444-CZ3 W459
CD1 I444-CE3 W459
CG2 I444-CH2 W446
CG2 I444-CZ2 W446
CG2 I444-CE2 W446
3.90
3.39
3.54
3.85
3.84
3.55
3.74
3.59
3.81
SlAMADH (I445)
CD1 I445-CH2 W460

CD1 I445-CD2 W460
CD1 I445-CE2 W460
CD1 I445-CZ2 W460
CD1 I445-CZ3 W460
CD1 I445-CE3 W460
CG2 I445-CH2 W447
CG2 I445-CZ2 W447
CG2 I445-CE2 W447
3.81
3.51
3.56
3.74
3.76
3.62
3.81
3.54
3.67
SoBADH A441C mutant
CB C441-CZ3 W456
SG C441-CZ3 W456
SG C441-CE2 W443
3.67
3.94
3.74
SoBADH A441S mutant
CB S441-CZ3 W456
OG S441-CZ3 W456
OG S441-CE3 W456
3.67
3.56
3.50
SoBADH A441T mutant
CB T441-CZ3 W456
CG2 T441-CZ3 W456
OG1 T441-CZ3 W456
OG1 T441-CE3 W456
3.69
3.72
3.34
3.30
SoBADH A441V mutant
CG2 V441-CZ3 W456

CG2 V441-CE3 W456
3.73
3.70
SoBADH A441F mutant
CG F441-CZ3 W456
CG F441-CE3 W456
CD1 F441-CE3 W456
CE1 F441-CE3 W456
CZ F441-CE3 W456
CZ F441-CD2 W456
CZ F441-CG W456
CD2 F441-CZ3 W456
CD2 F441-CE3 W456
CE2 F441-CE3 W456
CE2 F441-CD2 W456
CE2 F441-CG W456
CZ F441-CE3 W456
CZ F441-CD2 W456
CZ F441-CG W456
3.60
3.56
3.70
3.67
3.48
3.70
3.74
3.59
3.36
3.32
3.40
3.71
3.48
3.70
3.74
SoBADH A441I mutant
CD1 I441-CZ3 W456

CD1 I441-CH2 W456
3.41
3.86
CD1 I441-CE3 W456
3.17
CD1 I441-CD2 W456
3.41
CD1 I441-CE2 W456
3.85
The distances given are the average of those observed in the two monomers of each crystal structure or model. The cutoff was made at 4.0 . bThe crystal
structure of the PsAMDH2 enzyme is very similar in this region to that of PsAMDH1, which is not included here for this reason. The PDB codes of the crystal
structures are: SoBADH, 4A0M; ZmAMADH1a, 4I8P; PsAMADH2, 3IWJ; SlAMADH1, 4I9B.

Exploring The Evolutionary Route of The Acquisition of Betaine Aldehyde Dehydrogenase Activity by Plant ALDH10 Enzymes

Transféré par

Informations du document

Titre original

Copyright

Formats disponibles

Partager ce document

Partager ou intégrer le document

Options de partage

Avez-vous trouvé ce document utile ?

Ce contenu est-il inapproprié ?

Droits d'auteur :

Formats disponibles

Exploring The Evolutionary Route of The Acquisition of Betaine Aldehyde Dehydrogenase Activity by Plant ALDH10 Enzymes

Transféré par

Droits d'auteur :

Formats disponibles

Muoz-Clares et al.

BMC Plant Biology 2014, 14:149

Exploring the evolutionary route of the acquisition

Muoz-Clares et al. BMC Plant Biology 2014, 14:149

BADH activity (PsAMADH1 and PsAMADH2, PDB codes

Muoz-Clares et al. BMC Plant Biology 2014, 14:149

We expanded the amino acid sequence alignments of

sequences available, it is not yet possible to know whether

Muoz-Clares et al. BMC Plant Biology 2014, 14:149

Figure 1 (See legend on next page.)

Muoz-Clares et al. BMC Plant Biology 2014, 14:149

(See figure on previous page.)

genes were acquired by O. japonicus by horizontal gene

genes. The observed frequency of each of these codons in

To simulate the possible evolutionary intermediates we

Muoz-Clares et al. BMC Plant Biology 2014, 14:149

Figure 2 Evolutionary pathways for the acquisition of BADH

and TMABAL as substrates [19], at pH 8.0 and at fixed

be high given the known toxicity of this aldehyde [28]. It

Since the two main aspects that determine the evolution

Muoz-Clares et al. BMC Plant Biology 2014, 14:149

defined positive maximum bands at 284 and 291 nm,

Muoz-Clares et al. BMC Plant Biology 2014, 14:149

found with the wild-type enzyme [30], all mutant proteins

A441I or A441V mutants. Not considering the A441F

To interpret the observed kinetic and stability properties

Muoz-Clares et al. BMC Plant Biology 2014, 14:149

Figure 5 Structural comparisons of the A441 region of ALDH10

cavity where the trimethylammonium group of BAL

but in the known structures of the other three plant

Muoz-Clares et al. BMC Plant Biology 2014, 14:149

group pointing at W443, as in the ZmAMADH1a crystal

finding of a Km(BAL) of the A441T mutant lower than

Muoz-Clares et al. BMC Plant Biology 2014, 14:149

One of the strategies used by plants to respond to the

Muoz-Clares et al. BMC Plant Biology 2014, 14:149

activity would be necessary not only to produce the

Our results indicate that plant ALDH10 enzymes may

Muoz-Clares et al. BMC Plant Biology 2014, 14:149

Indeed, in cereals an evolutionary process directed by

Figure 6 Comparison of thermal stabilities and catalytic

processes for the gain of the BADH activity in plants,

Chemicals and biochemicals

Betaine aldehyde chloride, the diethylacetal of APAL and

Muoz-Clares et al. BMC Plant Biology 2014, 14:149

de C.V. (Toluca, Mxico). APAL was freshly prepared by

Steady-state initial velocities of wild-type SoBADH and

where v is the experimentally determined initial velocity,

Mutations in the crystal structure of the SoBADH (PDB

Muoz-Clares et al. BMC Plant Biology 2014, 14:149

http://www.phytozome.net/). Progressive multiple amino acid

Received: 27 March 2014 Accepted: 22 May 2014

Muoz-Clares et al. BMC Plant Biology 2014, 14:149

18. Hibino T, Meng YL, Kawamitsu Y, Uehara N, Matsuda N, Tanaka Y, Ishikawa

Table S1. Aldehyde dehydrogenases identified as members of ALDH10 family

Lolium perenne (Perennial ryegrass)

Oryza sativa Japonica Group

Setaria italica (foxtail millet)

Arabidopsis thaliana (thale cress)

Avicennia marina (betaine-accumulating mangrove) (Grey

Beta vulgaris (sugar beet)

Brassica napus (rape)

Cicer arietinum (chickpea) (garbanzo)