Vous êtes sur la page 1sur 13

NEBNext Multiplex Oligos for Illumina

(Index Primers Set 1)

Table of Contents:
Applications...................................................................................................3
NEBNext Adaptor for Illumina........................................................................5
USER Enzyme.......................................................................................................6
NEBNext Universal PCR Primer for Illumina..........................................................7
NEBNext Index 112 Primers for Illumina..................................................8-9
Revision History..........................................................................................10

The NEBNext Multiplex Oligos for Illumina


(Index Primers Set 1) Includes:
The volumes provided are sufficient for preparation of up to 24 reactions (NEB #E7335S)
and 96 reactions (NEB #E7335L). All reagents should be stored at 20C.

Note: Concentrations of Universal PCR Primer and the Index Primers have
changed from 25 M to 10 M. Please refer to the most recent protocol
revisions for use.

NEBNext Adaptor for Illumina


USER Enzyme
NEBNext Universal PCR Primer for Illumina
NEBNext Index 1 Primer for Illumina
NEBNext Index 2 Primer for Illumina
NEBNext Index 3 Primer for Illumina
NEBNext Index 4 Primer for Illumina
NEBNext Index 5 Primer for Illumina
NEBNext Index 6 Primer for Illumina
NEBNext Index 7 Primer for Illumina
NEBNext Index 8 Primer for Illumina
NEBNext Index 9 Primer for Illumina
NEBNext Index 10 Primer for Illumina
NEBNext Index 11 Primer for Illumina
NEBNext Index 12 Primer for Illumina

Required Materials Not Included:


Enzymes and buffers appropriate for DNA, ChIP or mRNA Library Preparation
(NEB #E6000, E6040, E6056, E6100, E6110, E6200, E6240, E7420, E7445,
E7530, E7370)

AMPure XP Beads (Beckman Coulter, Inc.) or PCR Column Purification Kit


(Qiagen or other)
Size Selection Materials [E-Gel (Life Technologies, Inc.), Agarose Gel or AMPure
XP Beads]
DNA LoBind Tubes (Eppendorf)/PCR Plates
Magnetic Stand
Bioanalyzer (Agilent Technologies, Inc.)
Freshly Prepared 80% Ethanol

Applications:
The NEBNext Multiplex Oligos for Illumina (Index Primers Set 1) contains
adaptors and primers that are ideally suited for multiplex sample
preparation for next-generation sequencing on the Illumina platform
(Illumina, Inc.). Each of these components must pass rigorous quality control
standards and is lot controlled, both individually and as a set of reagents.
Lot Control: The lots provided in the NEBNext Multiplex Oligos for Illumina
(Index Primers Set 1) are managed separately and are qualified by
additional functional validation. Individual reagents undergo standard
enzyme activity and quality control assays, and also meet stringent criteria
in the additional quality controls listed on each individual component page.
Functionally Validated: Each set of reagents is functionally validated together
through construction and sequencing of genomic DNA libraries as well as
human mRNA libraries and ChIP seq libraries on the Illumina platform.
For larger volume requirements, customized and bulk packaging is available by
purchasing through the OEM/Bulks department at NEB. Please contact OEM@
neb.com for further information.

Figure 1: Workflow.
A
A

End repaired,
dA-tailed DNA fragments

Ligated to loop adaptors

T
A
USER treatment

USER

PCR amplification

Please Refer to the Kit Specific Protocol for


using the NEBNext Multiplex Oligos for
Illumina:
The following kits are designed for use with the NEBNext Multiplex
Oligos for Illumina:

#E7420, NEBNext Ultra Directional RNA Library Prep Kit for Illumina

#E7530, NEBNext Ultra RNA Library Prep Kit for Illumina

#E7370, NEBNext Ultra DNA Library Prep Kit for Illumina

#E7445, NEBNext Ultra Ligation Module

#E6040, NEBNext DNA Library Prep Master Mix Set for Illumina

#E6110, NEBNext mRNA Library Prep Master Mix Set for Illumina

#E6240, NEBNext ChIP-Seq Library Prep Master Mix Set for Illumina

#E6056, NEBNext Quick Ligation Module

#E6000, NEBNext DNA Library Prep Reagent Set for Illumina

#E6200, NEBNext ChIP-Seq Library Prep Reagent Set for Illumina

#E6100, NEBNext mRNA Library Prep Reagent Set for Illumina

NEBNext Adaptor for Illumina


#E7337A:
#E7337AA:

0.24 ml
0.96 ml

Concentration: 15 M

5-/5Phos/GAT CGG AAG AGC ACA CGT CTG AAC TCC AGT C/ideoxyU/A CAC TCT TTC CCT ACA CGA
CGC TCT TCC GAT C*T-3

Store at 20C

Quality Control Assays


16-Hour Incubation: 50 l reactions containing this adaptor and 1 g of
HindIII digested Lambda DNA incubated for 16 hours at 37C results in
no detectable non-specific nuclease degradation as determined by
agarose gel electrophoresis. 50 l reactions containing this reaction
buffer at 1X
concentration and 1 g T3 DNA incubated for 16 hours at 37C also results
in no detectable non-specific nuclease degradation as determined by
agarose gel electrophoresis.
Endonuclease Activity: Incubation of a minimum of 5 l of this adaptor
with 1 g of X174 RF 1 DNA in assay buffer for 4 hours at 37C in 50 l
reactions results in < 10% conversion to RF II as determined by agarose
gel electrophoresis.
Phosphatase Activity: Incubation of a minimum of 10 l of this adaptor in
protein phosphatase assay buffer (1 M diethanolamine @ pH 9.8 and 0.5 mM
MgCl2) containing 2.5 mM p-nitrophenyl phosphate at 37C for 4 hours yields
no detectable p-nitrophenylene anion as determined by spectrophotometric
analysis at 405 nm.
RNase Activity: Incubation of this adaptor with 40 ng of a FAM-labeled
RNA transcript for 16 hours at 37C results in no detectable RNase activity
as determined by polyacrylamide gel electrophoresis.
Lot Controlled

U.S. PATENTS: 8,420,319, 8,288,097. PENDING U.S. AND FOREIGN APPLICATIONS: US 20120244525, US
20120238738, WO 2012012037.

USER Enzyme
#E7338A: 0.072 ml
#E7338AA: 0.288 ml
Store at 20C
Supplied in: 50 mM KCl, 5 mM NaCl, 10 mM Tris-HCl (pH 7.4 @ 25C),
0.1 mM EDTA, 1 mM DTT, 175 g/ml BSA and 50% Glycerol

Quality Control Assays


Non-Specific DNase Activity (16 Hour): A 50 l reaction in NEBuffer 1
containing 1 g of Lambda DNA and a minimum of 50 units of Uracil DNA
Glycosylase incubated for 16 hours at 37C results in a DNA pattern free of
detectable nuclease degradation as determined by agarose gel
electrophoresis. A 50 l reaction in Endonuclease VIII Reaction Buffer
containing 1 g of Lambda-HindIII DNA and a minimum of 25 units of
Endonuclease VIII incubated for 16 hours at 37C results in a DNA pattern free
of detectable nuclease degradation as determined by agarose gel
electrophoresis.
Exonuclease Activity (Radioactivity Release): A 50 l reaction in NEBuffer
1 containing 1 g of a mixture of single and double-stranded [3H] E. coli DNA
and a minimum of 50 units of Uracil DNA Glycosylase incubated for 4 hours at
37C releases < 0.1% of the total radioactivity. A 50 l reaction in
Endonuclease VIII Reaction Buffer containing 1 g of a mixture of single and
double-stranded [3H]
E. coli DNA and a minimum of 10 units of Endonuclease VIII incubated for 4
hours at 37C releases < 0.5% of the total radioactivity.
Endonuclease Activity (Nicking): A 50 l reaction in UDG Reaction Buffer
containing 1 g of supercoiled X174 DNA and a minimum of 50 units of
Uracil DNA Glycosylase incubated for 4 hours at 37C results in < 10%
conversion to the nicked form as determined by agarose gel electrophoresis.
Phosphatase Activity: Incubation of a minimum of 10 l of USER at a 1X
concentration in protein phosphatase assay buffer (1 M diethanolamine @ pH
9.8 and 0.5 mM MgCl2) containing 2.5 mM p-nitrophenyl phosphate at
37C for 4 hours yields no detectable p-nitrophenylene anion as
determined by spectrophotometric analysis at 405 nm.
Lot Controlled

NEBNext Universal PCR Primer for Illumina


#E6861A:
0.120 ml
#E6861AA: 0.480 ml

Concentration: 10 M

5-AAT GAT ACG GCG ACC ACC GAG ATC TAC ACT CTT TCC CTA CAC GAC GCT CTT CCG ATC*T-3

Store at 20C

Quality Control Assays


16-Hour Incubation: 50 l reactions containing this primer and 1 g of
HindIII digested Lambda DNA incubated for 16 hours at 37C results in no
detectable non-specific nuclease degradation as determined by agarose
gel electrophoresis. 50 l reactions containing 1 l primer and 1 g T3 DNA
incubated for 16 hours at 37C also results in no detectable non-specific
nuclease degradation as determined by agarose gel electrophoresis.
Endonuclease Activity: Incubation of a minimum of 5 l of primer with 1 g of
X174 RF I DNA in assay buffer for 4 hours at 37C in 50 l reactions results in
< 10% conversion to RF II as determined by agarose gel electrophoresis.
RNase Activity: Incubation of 1 l of primer with 40 ng of a FAM-labeled
RNA transcript for 16 hours at 37C results in no detectable RNase Activity
as determined by polyacrylamide gel electrophoresis.
Phosphatase Activity: Incubation of a minimum of 10 l of this primer in
protein phosphatase assay buffer (1 M diethanolamine @ pH 9.8 and 0.5 mM
MgCl2) containing 2.5 mM p-nitrophenyl phosphate at 37C for 4 hours yields
no detectable p-nitrophenylene anion as determined by spectrophotometric
analysis at 405 nm.
Lot Controlled

NEBNext Index 112 Primers for Illumina


Description: 12 Index Primers are included for producing barcoded libraries.

#E7311A:
ml
#E7311AA:
ml
#E7312A:
ml
#E7312AA:
ml
#E7313A:
ml
#E7313AA:
ml
#E7314A:
ml
#E7314AA:
ml
#E7315A:
ml
#E7315AA:
ml
#E7316A:
ml
#E7316AA:
ml
#E7317A:
ml
#E7317AA:
ml
#E7318A:
ml
#E7318AA:
ml
#E7319A:
ml
#E7319AA:
ml
#E7320A:
ml
#E7320AA:
ml
#E7321A:
ml
#E7321AA:
ml
#E7322A:
ml
#E7322AA:
ml

0.010
0.040
0.010
0.040
0.010
0.040
0.010
0.040
0.010
0.040
0.010
0.040
0.010
0.040
0.010
0.040
0.010
0.040
0.010
0.040
0.010
0.040
0.010
0.040

NEBNext
Index 1
Primer for
Illumina
NEBNext
Index 2
Primer for
Illumina
NEBNext
Index 3
Primer for
Illumina
NEBNext
Index 4
Primer for
Illumina
NEBNext
Index 5
Primer for
Illumina
NEBNext
Index 6
Primer for
Illumina
NEBNext
Index 7
Primer for
Illumina
NEBNext
Index 8
Primer for
Illumina
NEBNext
Index 9
Primer for
Illumina
NEBNext
Index 10
Primer for
Illumina
NEBNext
Index 11
Primer for
Illumina
NEBNext
Index 12
Primer for
Illumina

5CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC-s-T-3
5CAAGCAGAAGACGGCATACGAGATACATCGGTGACTGGAGTTCAGACGT
- GTGCTCTTCCGATC-s-T-3
5CAAGCAGAAGACGGCATACGAGATGCCTAAGTGACTGGAGTTCAGACG
T- GTGCTCTTCCGATC-s-T-3
5CAAGCAGAAGACGGCATACGAGATTGGTCAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC-s-T-3
5CAAGCAGAAGACGGCATACGAGATCACTGTGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC-s-T-3
5CAAGCAGAAGACGGCATACGAGATATTGGCGTGACTGGAGTTCAGA
CGT- GTGCTCTTCCGATC-s-T-3
5CAAGCAGAAGACGGCATACGAGATGATCTGGTGACTGGAGTTCAGA
CGT- GTGCTCTTCCGATC-s-T-3
5CAAGCAGAAGACGGCATACGAGATTCAAGTGTGACTGGAGTTCAGA
CGT- GTGCTCTTCCGATC-s-T-3
5CAAGCAGAAGACGGCATACGAGA
TCTGATCGTGACTGGAGTTCAGA
5CAAGCAGAAGACGGCATACGAGATAAGCTAGTGACTGGAGTTCAGACGT
- GTGCTCTTCCGATC-s-T-3
5CAAGCAGAAGACGGCATACGAGATGTAGCCGTGACTGGAGTTCAGA
CGT- GTGCTCTTCCGATC-s-T-3
5CAAGCAGAAGACGGCATACGAGATTACAAGGTGACTGGAGTTCAGACGT
- GTGCTCTTCCGATC-s-T-3

Where -s- indicates phosphorothioate bond.

Note: If fewer than 12 indexes are used in a lane for sequencing, it is


recommended to use the following indexes:
Pool of 2 samples: Index #6 and 12
Pool of 3 samples: Index #4, 6 and 12
Pool of 6 samples: Index #2, 4, 5, 6, 7 and 12

Expe
cted
Inde
x
Prim
er
ATCACG

CGATGT

TTAGGC

TGACCA

ACAGT
G
GCCAAT

CAGATC

ACTTGA

GATCA
G
TAGCTT

GGCTA
C
CTTGTA

NEBNext Index 112 Primers for Illumina (Cont.)


Store at 20C

Concentration: 10 M

Quality Control Assays


16-Hour Incubation: 50 l reactions containing 1 l NEBNext Index [X] Primer
and 1 g of HindIII digested Lambda DNA incubated for 16 hours at 37C
results in no detectable non-specific nuclease degradation as determined by
agarose gel electrophoresis. 50 l reactions containing NEBNext Index [X]
Primer for Illu- mina and 1 g of T3 DNA incubated for 16 hours at 37C results
in no detectable non-specific nuclease degradation as determined by agarose
gel electrophoresis.
Endonuclease Activity: Incubation of a 50 l reaction containing 1 l
NEBNext Index [X] Primer with 1 g of X174 RF I supercoiled DNA for 4
hours at 37C results in less than 10% conversion to RF II (nicked
molecules) as determined by agarose gel electrophoresis.
RNase Activity: Incubation of a 10 l reaction containing 1 l NEBNext Index
[X] Primer with 40 ng of RNA transcript for 16 hours at 37C resulted in no
detect- able degradation of RNA as determined by gel electrophoresis.
Phosphatase Activity: Incubation of NEBNext Index [X] Primer in protein
phosphatase assay buffer (1 M diethanolamine @ pH 9.8 and 0.5 mM MgCl2)
containing 2.5 mM p-nitrophenyl phosphate at 37C for 4 hours yields no
detectable p-nitrophenylene anion as determined by spectrophotometric
analysis at 405 nm.
Lot Controlled

Revision History:

10

Revision #

Description

3.0

Change Index Primer and


Universal Primer concentration
from 25 M to 10 M. All part
#'s have changed.
Concentrations of Universal PCR
Primer and Index Primers have
changed from 25 M to 10 M.

11

DNA CLONING
DNA AMPLIFICATION & PCR
EPIGENETICS
RNA ANALYSIS
LIBRARY PREP FOR NEXT GEN SEQUENCING
PROTEIN EXPRESSION & ANALYSIS
CELLULAR ANALYSIS

USA

New England Biolabs,


Inc. 240 County Road
Ipswich, MA 01938-2723
Telephone: (978) 927-5054
Toll Free: (USA Orders) 1-800-6325227 Toll Free: (USA Tech) 1-800-6327799 Fax: (978) 921-1350
e-mail:
info@neb.com
www.neb.com
CANADA

New England Biolabs, Ltd.


Telephone: (905) 665-4632
Toll Free: 1-800-387-1095
Fax: (905) 665-4635
Fax Toll Free: 1-800-5633789 e-mail: info.ca@neb.com
www.neb.ca
CHINA, PEOPLES REPUBLIC

New England Biolabs (Beijing), Ltd.


Telephone:
010-82378265/82378266
Fax: 010-82378262
e-mail: info@neb-china.com
www.neb-china.com
FRANCE

New England Biolabs


France Free Call: 0800100-632
Free Fax: 0800-100-610
e-mail:
info.fr@neb.com
www.neb-online.fr

GERMANY & AUSTRIA

New England Biolabs GmbH


Telephone: +49/(0)69/305 23140
Free Call: 0800/246 5227
(Germany) Free Call: 00800/246
52277 (Austria) Fax: +49/(0)69/305
23149
Free Fax: 0800/246 5229
(Germany) e-mail: info.de@neb.com
www.neb-online.de
JAPAN

New England Biolabs Japan, Inc.


Telephone: +81 (0)3 5669 6191
Fax: +81 (0)3 5669 6192
e-mail: info@neb-japan.com
www.nebj.jp
SINGAPORE

New England Biolabs Pte.


Ltd. Telephone: +65 6776
0903
Fax: +65 6778 9228
e-mail:
sales.sg@neb.com
www.neb.sg
UNITED KINGDOM

New England Biolabs (UK)


Ltd. Telephone: (01462)
420616
Call Free: 0800 318486
Fax: (01462) 421057
Fax Free: 0800 435682
e-mail:
info.uk@neb.com
www.neb.uk.com

Version 3.0

1/15