Vous êtes sur la page 1sur 408

Gentica Molecular y Citogentica Humana:

Fundamentos, Aplicaciones e Investigaciones en el Ecuador

a Ariane [CPyM]
a Pato, Paty, Richard, Nathy y Caro [ALC]

GENTICA MOLECULAR Y
CITOGENTICA HUMANA
Fundamentos, aplicaciones e investigaciones en el Ecuador

Csar Paz-y-Mio
Instituto de Investigaciones Biomdicas
Escuela de Medicina
Facultad de Ciencias de la Salud
Universidad de las Amricas

Andrs Lpez-Corts
Instituto de Investigaciones Biomdicas
Escuela de Medicina
Facultad de Ciencias de la Salud
Universidad de las Amricas

GENTICA MOLECULAR Y CITOGENTICA HUMANA: FUNDAMENTOS, APLICACIONES E


INVESTIGACIONES EN EL ECUADOR.
FORMA RECOMENDADA PARA CITAR:
Paz-y-Mio C & Lpez-Corts A (2014) Gentica Molecular y Citogentica Humana: Fundamentos, aplicaciones e
investigaciones en el Ecuador. (Universidad de las Amricas. Universidad Yachay). Quito, Ecuador. 400 pp.

ESTA PUBLICACIN PUEDE SER OBTENIDA EN:


Instituto de Investigaciones Biomdicas (IIB). Universidad de las Amricas (UDLA).
Direccin: Av. Eloy Alfaro y Jos Queri. Bloque 5. Quito, Ecuador.
Telfono: (593-2) 3970073. Pgina web: iib.udla.edu.ec

Empresa Pblica Yachay. Ciudad del Conocimiento Yachay.


Direccin: Av. Amazonas N26-146 y La Nia. Quito, Ecuador.
Telfono: (593-2) 3949100. Pgina web: www.yachay.gob.ec

AUTORES:
Csar Paz-y-Mio [CPyM]
Andrs Lpez-Corts [ALC]

cpazymino@udla.edu.ec
alopez@udla.edu.ec

@CesarPazyMino
@Andres_Lopez_C

DISEO GRFICO:
Andrs Lpez-Corts

DISEO DE PORTADA:
Figuras acerca de glbulos rojos, neurotransmisores, cromosomas y ribosoma. Archivos IIB.

DISEO DE CONTRAPORTADA:
Figura acerca de la doble hlice del ADN y ribosoma. Archivos IIB.

REVISIN CIENTFICA:
Jos Luis Garca-Prez, PhD.
Department of Human DNA Variability. Pfizer - Universidad de Granada - Junta de Andaluca Centre for Genomics and Oncological Research. Espaa.
Juan Luis Garca Hernndez, PhD.
Instituto de Estudios de Ciencias de la Salud de Castilla y Len. Instituto de Investigacin
Biomdica de Salamanca. Centro de Investigaciones del Cncer. Universidad de Salamanca. Espaa.
DERECHOS DE AUTOR No. 042851
EDITORIAL: YACHAY EP
ISBN- 978-9942-07-597-0
AO DE PUBLICACIN: 2014

Contenidobreve
CAPTULO I
Historia de la Gentica en el Ecuador

CAPTULO II
Impacto social de los trastornos genticos

15

CAPTULO III
Conceptos bsicos de la Gentica Molecular

31

CAPTULO IV
Poblacin de riesgo gentico

39

CAPTULO V
Nociones sobre Gentica de Poblaciones

49

CAPTULO VI
Patrones de la herencia

57

CAPTULO VII
Origen gentico de las discapacidades en el Ecuador

83

CAPTULO VIII
Biologa Molecular y caracterizacin de poblaciones humanas

103

CAPTULO IX
Investigaciones moleculares en el Ecuador: Enfermedades neurodegenerativas

145

CAPTULO X
Investigaciones moleculares en el Ecuador: Enfermedades congnitas

163

CAPTULO XI
Investigaciones moleculares en el Ecuador: Inmunologa

185

CAPTULO XII
Investigaciones moleculares en el Ecuador: Genotoxicologa

205

CAPTULO XIII
Citogentica

237

CAPTULO XIV
La gentica de la diferenciacin sexual

261

CAPTULO XV
Aspectos genticos del crecimiento y desarrollo

269

CAPTULO XVI
Aspectos bioticos en la investigacin

297

CAPTULO XVII
Biodiversidad y bioseguridad en la gentica

307

ndicedecontenido
EQUIPO DE INVESTIGACIN IIB
AGRADECIMIENTOS
NDICE DE TABLAS
NDICE DE FIGURAS
PRLOGO
RESUMEN
SUMMARY
ABREVIATURAS

XVI
XVII
XIX
XXII
XXIV
XXVI
XXVII
XXVIII

CAPTULO I. HISTORIA DE LA GENTICA EN EL ECUADOR


1. ETAPAS DEL DESARROLLO HISTRICO DE LA GENTICA HUMANA
1.1. PERODOANTIGUOOPRECITOGENTICO
1.2. PERODODELAGENTICAYCITOGENTICACLSICA
1.3. PERODOMODERNO,GENTICAMOLECULARYBIOTECNOLOGA

2. VISIN EPISTEMOLGICA

4
4
5
8
9

CAPTULO II. IMPACTO SOCIAL DE LOS TRASTORNOS GENTICOS


1. MALFORMACIONES CONGNITAS
1.1. FACTORESMATERNOS
1.1.1. Infecciones
1.1.2. Enfermedadescrnicas
1.2. FACTORESEXTERNOS
1.2.1. Agentesfsicos
1.2.2. Agentesqumicosymedicamentos
1.2.3. Hbitos
1.3. ALTERACIONESINDIVIDUALES
1.3.1. Malformacin
1.3.2. Deformacin
1.3.3. Disrupcin
1.3.4. Variacin
1.3.5. Defecto
1.3.6. Monstruosidad
1.4. ENTIDADESPOLIMALFORMATIVAS
1.4.1. Secuencias
1.4.2. Defectosdezonadedesarrollo
1.4.3. Asociacionesdealtafrecuencia
1.4.4. Espectros
1.4.5. Sndromes
1.5. POLIMALFORMADOSNOENCUADRABLES

2. DIAGNSTICO GENTICO DE MALFORMACIONES

19
19
19
19
21
21
21
22
22
22
22
22
22
23
23
23
23
23
24
24
24
25
25

CAPTULO III. CONCEPTOS BSICOS DE LA GENTICA MOLECULAR


1. ENROLLAMIENTO DEL ADN

32

2. TIPOS DE ADN PRESENTES EN EL GENOMA HUMANO


2.1. ADNDESECUENCIASNICAS
2.2. ADNDESECUENCIASREPETIDAS

33
34
34

2.2.1. ADNdesecuenciasmoderadamenterepetidas
2.2.2. ADNdesecuenciasaltamenterepetidas

3. HLICE G-CUDRUPLE DEL ADN

34
35
35

CAPTULO IV. POBLACIN DE RIESGO GENTICO


1. MUTACIONES
1.1. MUTACINSOMTICA
1.2. MUTACINGERMINAL

2. NIVELES DE PRESENCIA DE MUTACIONES


2.1.MUTACINGENMICA
2.2.MUTACINCROMOSMICA
2.3. MUTACINGENTICA
2.3.1. Mutacinsinsentido
2.3.2. Mutacinporprdidadelsentido
2.3.3. Mutacinporcorrimientodelalectura
2.3.4. Mutacinsilenciosa

3. TERATGENOS
3.1.TERATGENOSFSICOS
3.1.1.Radiacionesionizantes
3.1.2.Radiacionesnoionizantes
3.1.3.Otrosteratgenosfsicos
3.2.TERATGENOSINFECCIOSOS,FRMACOSYDROGAS

39
39
39
39
39
40
40
40
40
40
40
41
42
42
43
43
44

CAPTULO V. NOCIONES SOBRE GENTICA DE POBLACIONES


1. LEY DE HARDY-WEINBERG
1.1. PROCESOSQUEALTERANELEQUILIBRIODEHARDYWEINBERG
1.1.1. Seleccin
1.1.2. Mutaciones
1.1.3. Migracinoflujodegenes
1.1.4. Derivagnica
1.1.5. Consanguinidad

49
51
51
51
53
53
54

CAPTULO VI. PATRONES DE LA HERENCIA


62
62
63
63
64
64
65

1. HERENCIA MENDELIANA
1.1. HERENCIAAUTOSMICADOMINANTE
1.2. HERENCIAAUTOSMICARECESIVA
1.3. HERENCIARECESIVALIGADAALSEXO
1.4. HERENCIADOMINANTELIGADAALSEXO
1.5. HERENCIALIGADAALCROMOSOMAY
1.6. HERENCIAINTERMEDIAYCODOMINANCIA

2. HERENCIA NO MENDELIANA
2.1.HERENCIAMITOCONDRIAL
2.1.1.OrigendelADNmitocondrial
2.1.2.ADNmitocondrialyenfermedadesgenticas
2.1.3.VariacindelADNmitocondrial
3. HERENCIA POR IMPRONTA GENMICA

65
65
65
66
68
71

4. SNDROMES DE GENES CONTIGUOS

72

5. MOSAICISMO

72

6. HERENCIA POLIGNICA O MULTIFACTORIAL


6.1.FISURASFACIALES
6.1.1.Fisurapalatina
6.1.2.Fisuralabiopalatina
6.1.3.Fisuralabial
6.1.4.Asociacionesmalformativas
6.1.5.Anlisisestadsticocomparativo

73
75
77
77
77
78
78

CAPTULO VII. ORIGEN GENTICO DE LAS DISCAPACIDADES EN EL


ECUADOR
1. CRITERIOS DE INCLUSIN, EXCLUSIN Y ESTRATEGIA DE TRABAJO

84

2. EPIDEMIOLOGA DE LAS DISCAPACIDADES EN EL ECUADOR

85

3. FACTORES GENTICOS ASOCIADOS A LAS DISCAPACIDADES


3.1.AGENTESAMBIENTALESCOMOCAUSASPRENATALES
3.2.CAUSASPERINATALESYPOSTNATALESENLADISCAPACIDADINTELECTUAL

4. SNDROME DE DOWN EN EL ECUADOR

88
89
90

5. ETNIAS Y DISCAPACIDADES

97

95

CAPTULO VIII. BIOLOGA MOLECULAR Y CARACTERIZACIN DE LAS


POBLACIONES HUMANAS
1. POLIMORFISMOS DEL ADN
1.1. POLIMORFISMOSENLALONGITUDDELOSFRAGMENTOSDERESTRICCIN
1.2. REPETICIONESENTNDEMDENMEROVARIABLE
1.3. MICROSATLITESOSECUENCIASCORTASREPETIDASENTNDEM
1.3.1.Microsatlitesygrupotnico
1.4. POLIMORFISMOSDENUCLETIDOSIMPLE

2. ESTRUCTURA Y FUNCIONES DE LOS GENES


2.1.REPLICACINSEMICONSERVATIVAYBIDIRECCIONAL
2.2.TRANSCRIPCINDELAINFORMACINHEREDITARIA
2.3.TRADUCCINDELAINFORMACINGENTICA

3. REGULACIN DE LA ACTIVIDAD DE LOS GENES

107
107
107
107
110
112

4. TCNICAS DE BIOLOGA MOLECULAR


4.1.REACCINENCADENADELAPOLIMERASA
4.2.PCRCUANTITATIVAENTIEMPOREAL
4.2.1.Tiposdequmicas
4.2.2.Genesendgenosodereferencia
4.2.3.Mtodosdecuantificacindelaexpresingnica
4.3.SECUENCIACINDELOSGENES
4.3.1.Cartografagenticadeligamiento
4.3.2.Cartografafsicaeintegracindelosmapas

5. PROYECTOS DEL GENOMA HUMANO Y VARIOMA HUMANO

120
121
122
123
126
127
128
128
128

6. ENCICLOPEDIA DE LOS ELEMENTOS DEL ADN

136

7. PROCESOS DE INHIBICIN DE LA EXPRESIN GNICA


7.1.ARNDEINTERFERENCIA
7.1.1.ARNinterferentepequeo

137
137
138

113
114
114
117
118

135

7.1.2.MicroARN
7.1.3.PiwiARN
7.2.IMPORTANCIADELDESCUBRIMIENTODELOSARNi
7.3.PROTECCINDELARNiCONTRAINFECCIONESVIRALES
7.4.SILENCIAMIENTODEELEMENTOSMVILES
7.5.SNTESISPROTEICAYREGULACINDELDESARROLLOENORGANISMOS
7.6.ARNiMANTIENELACROMATINACONDENSADAYSUPRIMELATRANSCRIPCIN
7.7.ARNiCOMOHERRAMIENTAPARALATERAPIAGNICA

139
140
140
140
140
140
141
141

CAPTULO IX. INVESTIGACIONES MOLECULARES EN EL ECUADOR:


ENFERMEDADES NEURODEGENERATIVAS
1. ENFERMEDAD DE ALZHEIMER
1.1. GENApoE
1.2. GENGPX1
1.3. GENCTSD
1.4. GENCST3
1.5. GENMnSOD
1.6. RESULTADOSYDISCUSIN

2. ENFERMEDAD DE HUNTINGTON
2.1.GENHTT
2.2.TRATAMIENTO

145
146
147
148
148
149
150
154
156
158

CAPTULO X. INVESTIGACIONES MOLECULARES EN EL ECUADOR:


ENFERMEDADES CONGNITAS
1. ENFERMEDAD DE HIRSCHSPRUNG
1.1. GENRET
1.2. RESULTADOSYDISCUSIN

2. FIBROSIS QUSTICA DEL PNCREAS


2.1.GENCFTR
2.2.RESULTADOSYDISCUSIN

3. DISTROFIA MUSCULAR DE DUCHENNE Y BECKER


3.1.GENDMD
3.2.RESULTADOSYDISCUSIN

4. HEMOCROMATOSIS
4.1.GENHFE
4.2.RESULTADOSYDISCUSIN

5. HIPOACUSIA NO SINDRMICA RECESIVA


5.1.GENESGJB2YGJB6

163
164
165
168
168
169
171
172
173
174
175
176
176
177

CAPTULO XI. INVESTIGACIONES MOLECULARES EN EL ECUADOR:


INMUNOLOGA
1. RECEPTORES BACTERIANOS
1.1. GENESTLR
1.2. GENCD209
1.3. GENIFNGR1
1.4. RESULTADOSYDISCUSIN

2. VIRUS DE LA INMUNODEFICIENCIA HUMANA

185
186
187
188
189
194

2.1.GENESCCR5,CCR2YCXCL12
2.2.RESULTADOSYDISCUSIN

3. SISTEMA DE ANTGENOS LEUCOSITARIOS HUMANOS


3.1.RESULTADOSYDISCUSIN

195
197
198
200

CAPTULO XII. INVESTIGACIONES MOLECULARES EN EL ECUADOR:


GENOTOXICOLOGA
1. ASPERSIONES AREAS CON GLIFOSATO
1.1. GENXRCC1
1.2. GENGSTP1
1.3. RESULTADOSYDISCUSIN

2. OTROS PESTICIDAS
2.1.ENZIMASCYP
2.2.GENCYP1A1
2.3. RESULTADOSYDISCUSIN

3. HIDROCARBUROS
3.1.ELPETRLEOYSUSCOMPONENTES
3.1.1.Compuestosorgnicosvoltiles
3.1.2.Hidrocarburosaromticospolicclicos
3.1.3.Metalespesados
3.1.4.Gases
3.2.INVESTIGACIONESSOBREHIDROCARBUROSENELECUADOR

4. RADIACIN
4.1.RADIACINIONIZANTEMEDIANTERAYOSX
4.2.RADIACINSOLAR
4.2.1.Efectogenotxicodelaexposicinsolar
4.2.2.Cultivoestndar
4.2.3.Cultivoconafidicolina
4.2.4.Causa efecto

205
208
209
210
213
214
215
216
217
218
218
219
219
221
222
224
224
228
231
231
231
232

CAPTULO XIII. CITOGENTICA


1. NIVELES DE COMPACTACIN DEL ADN
1.1. NUCLEOSOMA
1.2. FIBRADECROMATINA
1.3. LAZOSDEADN

2. CROMOSOMAS, MORFOLOGA Y NOMENCLATURA

238
238
238
238

3. ANORMALIDADES CROMOSMICAS NUMRICAS


4. MOSAICO Y QUIMERA

243
244

5. ANORMALIDADES CROMOSMICAS ESTRUCTURALES


5.1.ESTABLES
5.1.1.Duplicacin
5.1.2.Delecin
5.1.3.Insercin
5.1.4.Translocacin
5.1.5.Inversin
5.1.6.Isocromosomas
5.2.INESTABLES
5.2.1.Anillo

244
244
245
245
245
245
248
248
248
248

241

5.2.2.Dicntricos

6. CASOS CLNICOS
6.1.CASO1:ANILLOENELCROMOSOMA4
6.1.1.Anlisisdelcromosoma4mediantelatcnicaFISH
6.2.CASO2:TRISOMAPARCIALENELCROMOSOMA8

248
252
252
254
254

CAPTULO XIV. LA GENTICA DE LA DIFERENCIACIN SEXUAL


261
261
263

1. DIFERENCIACIN SEXUAL
1.1. DIFERENCIACINSEXUALNORMAL
1.2. DIFERENCIACINSEXUALALTERADA

2. CLASIFICACIN DE LOS ESTADOS INTERSEXUALES


2.1.ALTERACINDELOSCONDUCTOSSEXUALES
2.1.1.Pseudohermafroditismofemenino
2.1.2.Pseudohermafroditismomasculino
2.2.ALTERACINDELSEXOGONADAL
2.2.1.Disgenesiagonadaldeorigencromosmico
2.2.2.Disgenesiagonadaldeorigengentico

CAPTULO

XV.

ASPECTOS

GENTICOS

263
263
263
263
264
264
264

DEL

CRECIMIENTO

DESARROLLO
1. FACTORES GENTICOS
1.1. FACTORESGENTICOSENELCRECIMIENTOYDESARROLLOINTRAUTERINO
1.2. FACTORESGENTICOSENELCRECIMIENTOYDESARROLLOPOSTNATAL

2. FACTORES QUE AUMENTAN LAS MUTACIONES


2.1.EDADAVANZADADELOSPROGENITORES
2.2.EDADMATERNAYSURELACINCONELSNDROMEDEDOWN
2.2.1.Teoradeladisgenesiaovular
2.2.2.Teoradelasobremaduracinovular
2.2.3.Teoraextrnseca
2.2.4.Teoradelaseleccinrelajada
2.2.5.Teoradelavariacindelasregionesorganizadorasnucleolares
2.2.6.Teoradeladuplicacindelaregin21q22
2.2.7.FactoresgenticosdelsndromedeDown
2.3.MADRESPORTADORASDEENFERMEDADESLIGADASALSEXO
2.4. AUTOINMUNIDAD
2.5. POLIMORFISMOSCROMOSMICOS
2.6. HISTORIAFAMILIARDEENFERMEDADESMETABLICAS
2.7. HISTORIAFAMILIARDEMALFORMACIONES
2.8. INFERTILIDADPREVIAABORTOSREPETIDOS
2.8.1.Infertilidadyesterilidaddeorigengentico
2.8.2.Infertilidaddeorigencromosmico
2.9. POLIHIDRAMIOSYOLIGOAMNIOS
2.10. ALTERACIONESFETALES
2.10.1.Crecimientofetalretardado
2.10.2.Presentacinfetalnormal
2.10.3.Anomalasdelritmocardiacofetal
2.11. ENFERMEDADMATERNACRNICA
2.12. GENESMUTANTES

3. DIAGNSTICO PRENATAL
3.1.PROCEDIMIENTOSIMPLICADOSENELDIAGNSTICO
3.1.1.Hematolgicoyanlisisurinario

269
269
269
272
272
273
274
274
274
274
274
274
275
276
276
277
278
278
279
279
279
281
281
281
281
281
282
282
282
282
282

3.1.2.Marcadoresbioqumicosmaternos
3.1.3.Estudiocromosmico
3.1.4.Anmiocentesisobiopsiacorial
3.1.5.Ultrasonografa
3.1.6.Fetoscopa

4. ALTERNATIVAS FRENTE AL RIESGO GENTICO


4.1.ESTERILIZACINOCONTRACEPCIN
4.2.INTERRUPCINTERAPUTICADELEMBARAZO
4.3.ASISTENCIANEONATALADECUADA
4.4.TERAPIAINTRAUTERINA
4.5.CONSEJOOASESORAMIENTOGENTICO

5. TCNICAS UTILIZADAS PARA EL DIAGNSTICO PRENATAL

283
283
285
285
286

6. NUEVA ERA DE DIAGNTICO PRENATAL EN EL ECUADOR

293

286
287
287
287
288
288
290

CAPTULO XVI. ASPECTOS BIOTICOS EN LA INVESTIGACIN


1. REGULACIN DE LAS INVESTIGACIONES A NIVEL MUNDIAL
1.1. NORMASDETIPOFSICO
1.1.1.NivelP1
1.1.2.NivelP2
1.1.3.NivelP3
1.1.4.NivelP4
1.2. NORMASDETIPOBIOLGICO
1.2.1.SistemaEK1
1.2.2.SistemaEK2
1.2.3.SistemaEK3

2. AVANCES EN LA TECNOLOGA DEL ADN RECOMBINANTE

297
298
298
298
299
299
299
299
299
299

3. ACCIONES DE LA GENTICA EN LA SALUD PBLICA

301

300

CAPTULO XVII. BIODIVERSIDAD Y BIOSEGURIDAD EN LA GENTICA


1. BIOPROTECCIN Y BIODIVERSIDAD

307

2.

ASPECTOS TERICOS DE LA BIODIVERSIDAD Y BIOPROTECCIN

308

3.

FUNDAMENTOS GENTICOS DE LA BIODIVERSIDAD HUMANA

310

4.

MITOS Y VERDADES DE LA MANIPULACIN GENTICA

312

5.

PROYECTOS PARA CONOCER LA TOTALIDAD DEL GENOMA HUMANO

312

6.

EL NUEVO NEGOCIO DEL CAPITALISMO

313

7.

BIOPIRATEO Y PATENTES

314

8.

BIOBOICOT

315

9.

CONCIENCIA BIOPROTECTORA

315

10. NORMAS DE BIOSEGURIDAD


10.1.RIESGOSQUEENTRAANLOSREACTIVOS
10.2.RIESGOSQUEENTRAANLASMUESTRAS
10.3.RIESGOSPARAELPERSONAL

316
316
316
317

REFERENCIAS EN INTERNET
NUESTRAS PUBLICACIONES CIENTFICAS
REFERENCIAS BIBLIOGRFICAS
GLOSARIO
NDICE ANALTICO

318
319
323
354
365

EQUIPO DE INVESTIGACIN IIB

XVI

EquipodeinvestigacinIIB
Paola E. Leone
Doctorado en Gentica en la Universidad Autnoma de Madrid.
Licenciatura en Ciencias Biolgicas de la Pontificia Universidad Catlica del Ecuador.
Especialista en Citogentica, Gentica Molecular y Microarrays.
Docente e investigadora de la Universidad de las Amricas.

Mara Eugenia Snchez


Maestra en Docencia Universitaria e Investigacin Educativa.
Licenciatura en Ciencias Biolgicas de la Pontificia Universidad Catlica del Ecuador.
Especialista en Genotoxicologa, Citogentica Convencional y Molecular.
Docente e investigadora de la Universidad de las Amricas.

Mara Jos Muoz


Maestra en Gentica Avanzada.
Licenciatura en Ciencias Biolgicas de la Pontificia Universidad Catlica del Ecuador.
Experiencia en el manejo de lneas celulares.
Docente e investigadora de la Universidad de las Amricas.

Alejandro Cabrera
Licenciatura en Ciencias Biolgicas de la Pontificia Universidad Catlica del Ecuador.
Experiencia en Genotoxicologa y Gentica Molecular.
Especialista en el diagnstico de rearreglos moleculares en pacientes con leucemias.
Docente e investigador de la Universidad de las Amricas.

Gabriela Jaramillo Koupermann


Maestra en Farmacogentica e Investigacin Clnica.
Bioqumica Farmacutica.
Especialista en Biologa Molecular y Secuenciacin Gentica.
Docente e investigadora de la Universidad de las Amricas.

Santiago Araujo
Licenciatura en Ciencias Biolgicas de la Universidad Central del Ecuador.
Diplomado en Gentica Toxicolgica en la Universidad Nacional de Colombia, sede Bogot.
Especialista en Evaluacin de genotxicos y sistema inmunolgico.
Docente e investigador de la Universidad de las Amricas.

AGRADECIMIENTOS

XVII

Agradecimientos
Universidad de las Amricas
Carlos Larretegui
Simn Cueva
Gonzalo Mendieta
Alfredo Borrero
Ral Jervis
Empresa Pblica Yachay
Hctor Rodrguez
Fernando Cornejo
Juan Carlos Moreno
Red Laureate
Manuel Krauskopf
Francisco Gutirrez
Instituto De Investigaciones Biomdicas
Doyle Beaty
Germn Burgos
Bernardo Castro
Carolina Echeverra
Beln Montesdeoca
David Narvez
Fabin Oa
Victor Pavn

Camilo Prez
Fabin Porras
Ana Proao
Paulo Robles
Maira Rojas
Stella Verdezoto
Tania Zurita

Otros
Andrs Acosta
Laura Arcos Tern
Melissa Arvalo
Crmen Ayuso
Mara Augusta Balden
Javier Bentez
Rubn Bucheli
Ramiro Burgos
Gabriela Bustamante
Oriol Cabr
Alex Camacho
Claudio Caizares
David Carpenter
Katy Carrera
Catherine Carrera
Francisco Cevallos
Osvaldo Chvez (t)
Juan Carlos Collantes
Augusta Crdoba
Amadeus Creus

Enrique Hermida
Jos Mara Hernndez
Catalina Herrera
Diana Jcome
Paola Jervis
Karina Lastra
Ramiro Lpez
Adolfo Maldonado
Ricardo Marcos
Santiago Morillo
Marco Neira
Ligia Ocampo
Reinaldo Pez
Lourdes Pazmio
Victor Penchaszadeh
Juan Peafiel
Mara Serena Peaherrera
Jos Cristian Prez
Mnica Prez
ngel Pestaa

AGRADECIMIENTOS

Nadia Cumbal
Vernica Dvalos
Mercedes del Pozo
Myriam Daz
Juan Esguirla
Victor Hugo Espn
Eduardo Estrella (t)
Fernanda Fiallo
Dolores Franco
Juan Luis Garca Hernndez
Jos Luis Garca-Prez
Anbal Gaviria
Patricia Gimnez
Fabricio Gonzlez
Mara Jos Guevara
Sara Gutirrez

XVIII

Indira Proao
Carla Rodrguez
Dayana Rosales
Felipe Rosales
Juan Carlos Ruz
Andrs Snchez-Cascos (t)
Fabricio Santos
Isabel Sarmiento
Andrs Tapia
Diego Torres
Carolina Valladares
Mara Elena Vega
Pedro Paulo Vieira
Nicols Vivar
Tania Witte

Instituciones

Academia Ecuatoriana de Medicina


Beth Israel Medical Center
Ciudad del Conocimiento Yachay
Consejo Nacional de Discapacidades
Consejo Nacional de Educacin Superior
Consejo Superior de Investigaciones Cientficas
Empresa Pblica Yachay
Fundacin Jimnez Daz
Fundacin para la Ciencia y Tecnologa
Hospital Baca Ortiz
Hospital Carlos Andrade Marn
Hospital Oncolgico Soln Espinoza Ayala
Hospital Universitario de Salamanca
Instituto Mexicano de la Seguridad Social
Ministerio de Salud Pblica
Misin Solidaria Manuela Espejo
Museo de Medicina Eduardo Estrella
National Geographic - Genographic Project
Pacific Basin Consortium
Pontificia Universidad Catlica del Ecuador
Red Hispano Latinoamericana de Genotoxicologa
Red Latinoamericana de Gentica Humana
Secretaria Nacional de Ciencia y Tecnologa
Secretara Nacional de Educacin Superior, Ciencia, Tecnologa e Innovacin
Sociedad Ecuatoriana de Biologa
Sociedad Ecuatoriana de Gentica Humana
Sociedad Ecuatoriana de Oncologa
Universidad Autnoma de Barcelona
Universidad Autnoma de Mxico
Universidad Central del Ecuador
Universidad de Crdoba (Espaa)
Universidad de Extremadura
Universidad de Oviedo
Universidad de Salamanca

NDICE DE TABLAS

XIX

ndicedetablas
Tabla II.1.
Tabla II.2.
Tabla II.3.
Tabla II.4.
Tabla II.5.
Tabla II.6.
Tabla II.7.
Tabla IV.1.
Tabla IV.2.
Tabla IV.3.
Tabla V.1.
Tabla V.2.
Tabla V.3.
Tabla VI.1.
Tabla VI.2.
Tabla VI.3.
Tabla VI.4.
Tabla VI.5.
Tabla VI.6.
Tabla VI.7.
Tabla VI.8.
Tabla VII.1.
Tabla VII.2.
Tabla VII.3.
Tabla VII.4.
Tabla VII.5.
Tabla VII.6.
Tabla VII.7.
Tabla VII.8.
Tabla VII.9.
Tabla VII.10.
Tabla VII.11.
Tabla VII.12.
Tabla VIII.1.
Tabla VIII.2.
Tabla VIII.3.
Tabla VIII.4a.
Tabla VIII.4b.
Tabla VIII.5.
Tabla VIII.6.
Tabla VIII.7.
Tabla VIII.8.
Tabla IX.1.
Tabla IX.2.
Tabla IX.3.
Tabla IX.4.
Tabla IX.5.
Tabla IX.6.

Causas de mortalidad referente a enfermedades


Estudios sobre frecuencias de malformaciones en Quito
Distribucin de malformaciones por sistemas en nacidos vivos en Quito
Centros que conforman el ECLAMC en Ecuador
Frecuencias de malformaciones del ECLAMC en el Ecuador
Alteraciones genticas, cromosmicas y multifactoriales
Alteracin monognica, polignica, multifactorial y cromosmica
Efecto de algunos agentes biolgicos sobre el feto en el embarazo
Relacin entre la cantidad de alcohol consumida diariamente y la
posibilidad de manifestacin de embriopata alcohlica
Efectos de frmacos y qumicos administrados durante el embarazo
Frecuencias allicas y genotpicas
Frecuencias de algunos marcadores genticos en poblacin ecuatoriana
expuesta a malaria
Entrecruzamiento y proporcin de genes compartidos
Anamnesis por aparatos
Caracteres fsicos y frecuencias allicas
Cebadores para la amplificacin del gen citocromo b
Frecuencias y variantes de citocromo b en grupos tnicos del Ecuador
Individuos con fisura palatina y sus familiares afectos
Individuos con fisura labio-palatina y sus familiares afectos
Individuos con fisura labial y sus familiares afectos
Recurrencia de fisura palatina, labial y labio-palatina
Nmero y tasa de prevalencia de discapacidad segn provincias
Prevalencia de personas segn tipo de discapacidad y provincia
Prevalencia y etapa de desarrollo de las discapacidades
Clasificacin de las causas genticas en personas con discapacidad
Nmero y tasa del grupo prenatal inespecfico
Grupo perinatal y causas asociadas al parto
Grupo postnatal y causas asociadas al parto
Otras patologas genticas presentes en personas con discapacidad
Tasa de personas con sndrome de Down en el Ecuador
Personas con sndrome de Down y edad materna en el embarazo
Comunidades indgenas y causas de discapacidad intelectual
Personas con discapacidad, diagnosticadas con parlisis cerebral
Frecuencias gnicas de dos sistemas de antgenos en ecuatorianos
Enfermedades y sus asociaciones a marcadores genticos
Loci utilizados en pruebas de paternidad y forense
Frecuencia de STRs en la poblacin mestiza ecuatoriana
Frecuencia de STRs en la poblacin mestiza ecuatoriana
Complejidad y variaciones del concepto de gen-enzima
Genes endgenos aplicados en la expresin gnica
Tecnologas de secuenciacin de prxima generacin
Informacin procesada por el proyecto ENCODE
Caractersticas del gen Apo E
Caractersticas del gen GPX-1
Caractersticas del gen CTSD
Caractersticas del gen CST3
Caractersticas del gen MnSOD
Frecuencias genotpicas y allicas de los genes Apo E y GPX-1

NDICE DE TABLAS

Tabla IX.7.
Tabla IX.8.
Tabla IX.9.
Tabla IX.10.
Tabla X.1.
Tabla X.2.
Tabla X.3.
Tabla X.4.
Tabla X.5.
Tabla X.6.
Tabla X.7.
Tabla X.8.
Tabla X.9.
Tabla X.10.
Tabla X.11.
Tabla X.12.
Tabla XI.1.
Tabla XI.2.
Tabla XI.3.
Tabla XI.4.
Tabla XI.5.
Tabla XI.6.
Tabla XI.7.
Tabla XI.8.
Tabla XI.9.
Tabla XI.10.
Tabla XI.11.
Tabla XI.12.
Tabla XI.13.
Tabla XI.14.
Tabla XII.1.
Tabla XII.2.
Tabla XII.3.
Tabla XII.4.
Tabla XII.5.
Tabla XII.6.
Tabla XII.7.
Tabla XII.8.
Tabla XII.9.
Tabla XII.10.
Tabla XII.11.
Tabla XIII.1.
Tabla XIII.2.
Tabla XIII.3.
Tabla XIII.4.
Tabla XIII.5.
Tabla XIII.6.
Tabla XIII.7.
Tabla XIII.8.
Tabla XIV.1.
Tabla XIV.2.
Tabla XV.1.

XX

Frecuencias genotpicas y allicas de los genes MnSOD, CST3 y CTSD


Rangos de repeticiones CAG en el gen HTT
Caractersticas del gen HTT
Medicamentos probados para la enfermedad de Huntington
Caractersticas del gen RET
Frecuencias genotpicas y allicas del gen RET
Caractersticas del gen CFTR
Genotipos FQ F508 encontrados en poblacin ecuatoriana
Caractersticas del gen DMD
Cebadores para la PCR mltiplex del gen DMD
Caractersticas del gen HFE
Frecuencias allicas del gen HFE en casos y controles
Caractersticas del gen GJB2
Caractersticas del gen GJB6
Porcentaje de alelos encontrados en las ocho mutaciones genticas
Nmero de afectos, sanos y familiares con cada genotipo
Caractersticas del gen TLR2
Caractersticas del gen TLR4
Caractersticas del gen CD209
Caractersticas del gen IFNGR1
Frecuencias allicas y genotpicas de TLR2, TLR4, CD209 e IFNGR1
Edad media en individuos infectados y sanos segn su histopatologa
Anlisis de la prueba estadstica chi-cuadrado
Anlisis de odds ratio y polimorfismos genticos
Anlisis de odds ratio y patologas gstricas
Caractersticas del gen CCR5
Caractersticas del gen CCR2
Caractersticas del gen CXCL12
Frecuencias de CCR532, CCR2-64I y SDF1-3A
Frecuencias allicas de HLA
Migracin del ADN en individuos expuestos al glifosato
Caractersticas del gen XRCC1
Caractersticas del gen GSTP1
Frecuencias genotpicas y allicas de GPX1, XRCC1 y GSTP1
Cariotipos y porcentaje de fragilidad cromosmica
Otros pesticidas utilizados en florcolas
Caractersticas del gen CYP1A1
Frecuencias genotpicas del gen CYP1A1
Niveles de migracin del ADN mediante ensayo cometa
Longitud de migracin del ADN mediante ensayo cometa
Aberraciones cromosmicas registradas en los cultivos celulares
Translocaciones robertsonianas y gametos
Incidencia de las anomalas cromosmicas en la poblacin general
Mecanismos que producen anomalas cromosmicas
Frecuencia de cromosomopatas en Quito, ao 1989
Autosomopatas cromosmicas
Anlisis de arrays
Gonosomopatas cromosmicas
Translocaciones y variantes
Caractersticas del gen SRY
Alteraciones de la diferenciacin sexual
Correlaciones para el crecimiento y desarrollo de caracteres fsicos y
fisiolgicos

NDICE DE TABLAS

Tabla XV.2.
Tabla XV.3.
Tabla XV.4.
Tabla XV.5.
Tabla XV.6.
Tabla XV.7.
Tabla XV.8.
Tabla XV.9.
Tabla XV.10.
Tabla XV.11.
Tabla XV.12.
Tabla XV.13.
Tabla XV.14.
Tabla XV.15.
Tabla XV.16.
Tabla XV.17.
Tabla XV.18.

XXI

Incidencia y riesgo de recurrencia de algunas anomalas fetales de causa


gentica
Frecuencia del sndrome de Down en relacin a la edad materna
Cifras estadsticas en riesgos genticos
Hallazgos citogenticos en el sndrome de Down
Variantes cromosmicas en la poblacin de Quito (RNCAVCH)
Hallazgos cromosmicos en individuos con infertilidad y esterilidad
Hallazgos cromosmicos en parejas con abortos repetidos
Malformaciones y cromosomopatas en el crecimiento intrauterino
Indicaciones del estudio cromosmico
Comparacin entre biopsia corial y lquido amnitico
Indicaciones del diagnstico prenatal citogentico
Frecuencia de cardiopatas congnitas segn parentesco
Indicaciones del asesoramiento gentico
Riesgo de recurrencia en el sndrome de Down
Probabilidad del diagnstico prenatal segn la causa del problema
Diagnstico prenatal en lquido amnitico y vellosidades coriales
Alternativas frente al riesgo gentico

NDICE DE FIGURAS

XXII

ndicedefiguras
Figura III.1.
Figura III.2.
Figura VI.1.
Figura VI.2.
Figura VI.3.
Figura VI.4.
Figura VI.5.
Figura VIII.1.
Figura VIII.2.
Figura VIII.3.
Figura VIII.4.
Figura VIII.5.
Figura VIII.6.
Figura VIII.7.
Figura VIII.8.
Figura VIII.9.
Figura VIII.10.
Figura VIII.11.
Figura VIII.12.
Figura VIII.13.
Figura VIII.14.
Figura VIII.15.
Figura VIII.16.
Figura VIII.17.
Figura IX.1.
Figura IX.2.
Figura IX.3.
Figura IX.4.
Figura IX.5.
Figura IX.6.
Figura IX.7.
Figura IX.8.
Figura IX.9.
Figura X.1.
Figura X.2.
Figura X.3.
Figura X.4.
Figura X.5.
Figura X.6.
Figura X.7.
Figura X.8.
Figura X.9.
Figura X.10.
Figura X.11.
Figura XI.1.
Figura XI.2.
Figura XI.3.
Figura XI.4.
Figura XI.5.
Figura XI.6.

Estructura del ADN


Estructura G-cudruple del ADN
Smbolos de genealogas
ADN mitocondrial
Variantes de Citocromo b identificados por SSCP
Distribucin de las variantes de Citocromo b en Ecuador
Relacin entre genes y ambiente
Formacin del ARN mensajero. Exn (E) - Intrn (I)
Proceso de transcripcin, traduccin y sntesis proteica
El cdigo gentico
Representacin de la amplificacin de ADN mediante PCR
Curva de amplificacin y lnea umbral de la qPCR
SYBR Green
Sondas TaqMan
Sondas Beacon
Sondas Scorpion
Curva estndar
Nucletidos fluoromarcados y su interpretacin digital
Esquema de pirosecuenciacin
Esquema de secuenciacin por terminadores reversibles
Esquema de secuenciacin por ligacin
Esquema de secuenciacin por semiconduccin inica
Proceso de funcionamiento del ARNsi
Proceso de funcionamiento del miARN
Cromosoma 19 humano
Cromosoma 3 humano
Cromosoma 11 humano
Cromosoma 20 humano
Cromosoma 6 humano
Diagnstico gentico mediante PCR y secuenciacin del gen HTT
Cromosoma 4 humano
Cadena de poliglutamato en la protena huntingtina
Efecto del estrs oxidativo en la enfermedad de Huntington
Cromosoma 10 humano
Microambiente intestinal y variantes genticas
Anlisis de secuencias del gen RET
Digestin con enzimas de restriccin del gen RET
Cromosoma 7 humano
Amplificacin del exn 10 del gen CFTR mediante PCR
Cromosoma X humano
Deteccin de deleciones del gen DMD
Cromosoma 6 humano
Cromosoma 13 humano
Mutaciones de la conexina membranal
Cromosoma 4 humano
Cromosoma 4 humano
Cromosoma 19 humano
Cromosoma 6 humano
Cromosoma 3 humano
Cromosoma 3 humano

NDICE DE FIGURAS

Figura XI.7.
Figura XI.8.
Figura XII.1.
Figura XII.2.
Figura XII.3.
Figura XII.4.
Figura XII.5.
Figura XIII.1.
Figura XIII.2.
Figura XIII.3.
Figura XIII.4.
Figura XIII.5.
Figura XIII.6.
Figura XIII.7.
Figura XIV.1.
Figura XIV.2.

XXIII

Cromosoma 10 humano
Cromosoma 6 humano
Ensayo cometa
Cromosoma 19 humano
Cromosoma 11 humano
Cromosoma 15 humano
Alteraciones cromosmicas estructurales
Niveles de organizacin del material hereditario
Clasificacin de los cromosomas por la posicin del centrmero
Cariotipo humano (mujer)
Anlisis citogentico convencional (caso 1)
Anlisis con FISH
Anlisis citogentico convencional (caso 2)
Genes asociados con fenotipo
Cromosoma Y humano
Anlisis molecular del gen SRY

PRLOGO

XXIV

Prlogo
La Gentica, una disciplina ligada de modo esencial a la vida, a su origen y
evolucin, es una ciencia joven que ha irrumpido en todos los rdenes de la medicina
y de la ciencia del siglo XXI.
Su impacto, a veces meditico y otras insensible, se debe a dos causas
fundamentales: al abaratamiento de la biotecnologa de gran precisin y al gran
avance del conocimiento originado por la publicacin de la secuenciacin del genoma
humano (borrador en 2001, secuencia completa en 2003), y por los proyectos
internacionales que le siguieron, HapMap, Encode, Proteoma Humano, Genoma del
Cncer, Genomas de mltiples organismos, entre otros.
La informacin cientfica derivada de la labor colectiva desarrollada por esos
programas ha arrojado luz sobre numerosos campos de inters: la evolucin, las
migraciones de las poblaciones humanas y de otros seres vivos, y en el campo de la
biomedicina no solo han ayudado a comprender la base biolgica de procesos tales
como el desarrollo o el envejecimiento sino tambin las causas y procesos
patolgicos de numerosas enfermedades hereditarias o comunes.
La medicina del siglo XXI es predictiva, en cierto modo personalizada y desde
luego genmica.
La Gentica ha permitido el descubrimiento de medicamentos dirigidos contra
mutaciones, variantes genticas en los individuos que les hacen sensibles o
resistentes a los frmacos o que les predisponen a padecer o les protegen contra
ciertas enfermedades.
Un amplio grupo de la sociedad, hasta un 6 a 8% padece o padecer una
enfermedad gentica, o rara (minoritaria), que estar completamente determinada
genticamente. Estas enfermedades adems producen una gran mortalidad y
morbilidad y un alto grado de discapacidad, adems de impactar no solo socialmente
sino mdicamente, afectando con frecuencia a varios miembros de la familia. Los
programas de cribado pre y postnatal y el estudio de las personas y familias con
enfermedades genticas son el primer paso para la prevencin, diagnostico y
eventual tratamiento de estos problemas
Por otra parte el conocimiento de la base gentica de una poblacin tan
variada demogrficamente como es la ecuatoriana es del mayor inters por sus
connotaciones histricas y sociales. Pero adems, el estudio mutacional que permite
la caracterizacin precisa de las enfermedades en esta poblacin resulta
imprescindible para implementar programas comunitarios de prevencin o
establecer pautas diagnsticas ajustadas a la realidad clnica gentica en Ecuador.
As, el presente texto que se inicia con un repaso de la historia de la Gentica
(Captulo I) desarrolla numerosos aspectos terico-prcticos de la Gentica Mdica y
tambin revela caractersticas importantes genticas en el Ecuador, derivadas de los
registros de malformaciones y de estudios gentico-epidemiolgicos, y otros que todo
mdico que practique la medicina en este pas debiera conocer.
Entre ellos cabe destacar el Captulo VII acerca de las causas genticas de las
discapacidades en el Ecuador, con diferencias importantes en la prevalencia

PRLOGO

XXV

de discapacidad intelectual, psicomotora, auditiva o visual entre las distintas regiones


ecuatorianas, as como la frecuencia de las causas ambientales prenatales ms
frecuentes (hipertensin, infecciones fetales, alcoholismo e hipertermia).
A modo de ejemplo, algunos datos genticos caractersticos de inters en la
poblacin ecuatoriana son (Capitulo XV) la elevada frecuencia de mosaicismos de
trisoma 21 entre los pacientes ecuatorianos con sndrome de Down (10%), la baja
prevalencia de la fibrosis qustica en Ecuador as como de su mutacin causante
F508, que por el contrario es muy frecuente en las personas con fibrosis qustica
en poblaciones de origen centro europeo.
Esta informacin es de un gran valor no solo demogrfico, al caracterizar el
espectro mutacional propio de la poblacin ecuatoriana, y de sus distintas etnias y
provincias, resulta imprescindible para aplicar en el futuro la llamada medicina
individualizada o estratificada
Debido al grado de penetracin que tiene hoy en da la Gentica en la prctica
mdica, existe en estos momentos una gran necesidad formativa por parte de la
sociedad en el rea de la Gentica. Para adquirir los conocimientos esenciales que
permitan distinguir los grandes retos y capacidades reales de esta ciencia de
fantasas inalcanzables o riesgos desmedidos e inexistentes. Al mismo tiempo,
debemos reflexionar en profundidad para dotar a los sistemas sanitarios y a los
pases de los recursos necesarios en un ambiente de equidad y de justicia que
permita acercar estos logros a los ciudadanos, de un modo racional y sostenible,
acorde a sus necesidades.
Una parte esencial de este proceso radica en la formacin de los cientficos y
mdicos que han de poder usar la tecnologa y el conocimiento para mejorar la salud
de la poblacin.
Es por ello de la gran importancia en la publicacin de un texto como el
presente, en el que se combinan la actualizacin cientfica y mdica en gentica,
adaptndola al entorno geogrfico y temporal del pas en el que se publica, Ecuador.
El cumplimiento de esta responsabilidad por parte sus autores y del equipo de
colaboradores que han participado en esta obra, prctica pero rigurosa, da
respuesta a esta necesidad formativa y ser con certeza acogida con el mayor
inters por sus lectores.

Carmen Ayuso MD, PhD.


Mdico Genetista
Jefe del rea de Investigacin
Jefe del Departamento de Gentica Clnica
Hospital Universitario Fundacin Jimnez Daz
Madrid - Espaa

RESUMEN

XXVI

Resumen
El libro Gentica Molecular y Citogentica Humana se encuentra conformado
por diecisiete captulos que explican los fundamentos tericos de la Biomedicina, las
aplicaciones de las tcnicas moleculares, y las investigaciones de varias enfermedades
genticas analizadas durante los ltimos veinte aos en el Ecuador.
Los primeros siete captulos son tratados con un enfoque gentico, siendo los
siguientes: Historia de la Gentica en el Ecuador. Impacto social de los trastornos
genticos. Conceptos bsicos de la Gentica Molecular. Poblacin de riesgo gentico.
Nociones sobre Gentica de poblaciones. Patrones de la herencia. Origen gentico de
las discapacidades en el Ecuador. En estos captulos se explica la estructura del ADN
nuclear y mitocondrial, el origen y tipo de mutaciones, las malformaciones congnitas;
el diagnstico gentico, las herencias mendelianas y no mendelianas, la herencia
polignica multifactorial, los sndromes de genes contiguos, el mosaicismo, la impronta
genmica, y los factores genticos y epidemiolgicos de las discapacidades en el
Ecuador.
Los siguientes cinco captulos se enfocan en las diferentes investigaciones
realizadas por nuestro grupo de trabajo sobre la asociacin de genes con el desarrollo de
enfermedades: Biologa Molecular y caracterizacin de poblaciones humanas.
Investigaciones moleculares en el Ecuador: Enfermedades neurodegenerativas.
Investigaciones moleculares en el Ecuador: Enfermedades congnitas. Investigaciones
moleculares en el Ecuador: Inmunologa. Investigaciones moleculares en el Ecuador:
Genotoxicologa. Estos captulos profundizan la concepcin de los polimorfismos del
ADN, la estructura, funcin y regulacin de los genes; la inhibicin de la expresin
gnica, las tcnicas de biologa molecular aplicadas al estudio del genoma y varioma
humano; de igual forma, se analizan enfermedades como Alzheimer, Huntington,
Hirschsprung, fibrosis qustica, distrofia muscular, hemocromatosis; y patrones
carcinognicos como el glifosato, los hidrocarburos y la radiacin.
Los ltimos cinco captulos son: Citogentica. La gentica de la diferenciacin
sexual. Aspectos genticos del crecimiento y desarrollo. Aspectos bioticos en la
investigacin. Biodiversidad y bioseguridad en la Gentica. Estos captulos explican la
organizacin, estructura y compactacin de los cromosomas, el anlisis de los cariotipos
en el diagnstico de las enfermedades genticas, citando casos clnicos analizados con
tecnologa molecular de punta.
Este libro refleja el perseverante trabajo en equipo ejercido por genetistas,
bilogos, mdicos, biotecnlogos y bioqumicos, comprometidos a lo largo de los
ltimos viente aos, con la investigacin de los factores genticos, clnicos y
ambientales asociados al desarrollo de diversas enfermedades genticas. De igual forma,
este libro es un valioso aporte que nuestro grupo de investigacin brinda a la sociedad
ecuatoriana, para que se involucre en el mbito de la Biomedicina y comprenda que la
investigacin es un pilar fundamental para el desarrollo cientfico, cultural y social del
Ecuador.

SUMMARY

XXVII

Summary
The current book Molecular Genetics and Human Cytogenetics is made up of
seventeen chapters which explain the theoretical basis of biomedicine, the applications
of molecular techniques, and the research in several genetic disorders that have been
analyzed over the last twenty years in Ecuador.
The first seven chapters are focused on Genetics, such as the following: History
of Genetics in Ecuador. Social Impact of Genetic Disorders. Basic Concepts of
Molecular Genetics. Population with Genetic Risk. Knowledge in Populations Genetics.
Inheritance Patters. Genetic Origin of the Disability in Ecuador. These chapters explain
the structure of the nuclear and mitochondrial DNA, the origin and types of mutations,
the congenital malformation, the genetic testing, the mendelian and non-mendelian
inheritances, the multifactorial polygenic inheritance, the contiguous gene syndromes,
mosaicism, genomic imprinting, and the genetic and epidemiologic factors for disability
in Ecuador.
The following five chapters focus on the different research in gene association
with the development of diseases that have been conducted by our working group:
Molecular Biology and Characterization of Human Populations. Molecular Research in
Ecuador: Neurodegenerative Diseases. Molecular Research in Ecuador: Congenital
Diseases. Molecular Research in Ecuador: Immunology. Molecular Research in
Ecuador: Genotoxicology. These chapters delve into the concept of DNA
polymorphisms, the gene structure, function, and regulation, the inhibition of geneexpression, the techniques of molecular biology applied to the analysis of human
genome and variome. Likewise, diseases such as Alzheimer, Huntington, Hirschsprung,
cystic fibrosis, muscular dystrophy, and hemochromatosis are analyzed, as well as the
carcinogenic patterns such as glyphosate, hydrocarbon, and radiation.
The last five chapters are: Cytogenetics. Genetics of Sex Differentiation. Gene
Aspects of Growth. Bioethics in Research. Biodiversity and Biosafety in Genetics. These
chapters deal with chromosome organization, structure, and compaction, the analysis of
the karyotypes while testing the genetic disorders, citing clinical cases that have been
analyzed with state-of-the-art molecular technology.
To conclude, this book captures the persistent team work carried out by
geneticists, biologists, doctors, biotechnologists, and biochemists that are committed to
the research in genetic, clinical, and environmental factors associated with the
development of several genetic disorders over the last twenty years. Additionally, this
book is a valuable work that our research team contributes to the Ecuadorian society, so
that it can have some knowledge in biomedicine, and it can understand that research is
an essential base for Ecuadors scientific, cultural, and social development.

ABREVIATURAS

XXVIII

Abreviaturas
L
M
m
A
AA
aa
ACE
ACN
ADI
ADN
ADNc
ADP
AEP
AFP
AMPc
Apo E
AR
ARN
ARNds
ARNhm
ARNi
ARNm
ARNpi
ARNr
ARNsi
ARNt
ATC
ATP
AU-K
BCE
BCS
BCT
BDNF
C
CAP
CD
CDs
CECC
CEEA
CF
CFTR
CGH
CH
CHFR
CHR
CIR
Cl
cm
CK

Microlitro
Micromolar
Micrometros
Adenina
Antes de la actualidad
Aminocido
Aberracin cromosmica estructural
Aberracin cromosmica numrica
Organizacin Internacional de la Enfermedad de Alzheimer
cido desoxirribonucleico
ADN complementario
Adenosn difosfato
cido etileicosa pentanico
Alfa feto protena
Adenosn monofosfato cclico
Apolipoprotena E
Protena receptora de andrgenos
cido ribonucleico
ARN de doble cadena
ARN heterlogo nuclear
ARN de interferencia
ARN mensajero
ARN piwi
ARN ribosomal
ARN de interferencia pequeo
ARN transferencia
Agangliognesis total del colon
Adenosn trifosfato
Aurora quinasa (Aurora kinase)
Banco Central del Ecuador
Rotura cromosmica
Rotura cromatdica
Factor neurotrfico derivado del cerebro (Brain-derived neurotrophic factor)
Citosina
Colegio Americano de Patlogos
Enfermedades comunes
Clulas dendrticas
Comit Estadounidense Conjunto sobre el Cncer
Comisin Ecuatoriana de Energa Atmica
Creatina fosfoquinasa
Gen regulador transmembranal de la fibrosis qustica (Cystic fibrosis
transmembrane conductance regulator)
Hibridacin genmica comparativa
Corea de Huntington
Checkpoint with forkhead and ring finger domains
Cromosoma
Crecimiento intrauterino retardado
Cloro
Centmetro
Creatina fosfoquinasa

ABREVIATURAS

CODIS
COV
CP
Cp
CST3
Ct
CTSD
CV
Da
ddNTP
DE
DHT
DMB
DMD
dNTP
E
ECLAMC
EGFR
END
EPA
F
FAH
FDA
FISH
FL
FLb
FLP
FLu
FP
FQ
FW
G
GCS
GCT
GJB2
GJB6
G6PDH
GPX-1
GSTP1
Gy
H2O2
HAP
Hb
HCAM
HCl
HIP
HL
HLA
HPB
HPSP
HSCR
HTT
HUGO

XXIX

Sistema de ndice de ADN Combinado


Compuestos orgnicos voltiles
Cncer de pulmn
Punto de cruce (Crossing point)
Cistatina 3
Ciclo umbral (Cycle threshold)
Catepsina D precursor
Variaciones comunes (Common variations)
Daltons
Di-desoxinucletido trifosfato
Desviacin estndar
5-dihidrotestosterona
Distrofia muscular de Becker
Distrofia muscular de Duchenne
Desoxinucletido trifosfato
Exn
Estudio Colaborativo Latinoamericano de Malformaciones Congnitas
Receptor del factor de crecimiento epidermal (Epidermal growth factor
receptor)
Endorreduplicacin
Agencia de Proteccin Ambiental (Environmental Protection Agency)
Fenotipo
Fumarilacetoacetato hidrolasa
Agencia de Drogas y Alimentos (Food and Drug Administration)
Hibridacin in situ con fluorescencia (Fluorescent in situ hybridization)
Fisura labial
Fisura labial bilateral
Fisura labial palatina
Fisura labial unilateral
Fisura palatina
Fibrosis qustica
Cebador sentido
Guanina
Gap cromosmico
Gap cromatdico
Protena de unin gap, conexina 26 (Gap junction protein, connexin 26)
Protena de unin gap, conexina 30 (Gap junction protein, connexin 30)
Glucosa-6-fosfato deshidrogenasa
Glutatin peroxidasa 1
Glutatin S-transferasa pi 1
Gray
Perxido de hidrgeno
Protenas asociadas a huntingtina (Huntingting associated proteins)
Hemoglobina
Hospital Carlos Andrade Marn
cido clorhdrico
Protenas que interaccionan con huntingtina
Hormona luteinizante
Antgenos leucocitarios humanos (Human lymphocyte antigen)
Hiperplasia prosttica benigna
Hipospadia pseudovaginal periescrotal
Hirschsprung
Huntingtina
Organizacin del Genoma Humano (Human Genome Organization)

ABREVIATURAS

I
IASCL
ICPEMC

IH
IIB
INEC
IP
IRC
ITQ
Kb
KCl
Kg
LD
LINE
LLA
LMC
MAPK
MED
Mb
MgCl2
MHC
miARN
Mn
MPTE
MSME
n
Na
NADH
NCBI
ng
nm
NOR
NS
nv
OMIM
OMS
ONG
OPS
OR
PAH
pb
PCR
PDGH
PGH
PI3K
PLK
PMAP
POEA

XXX

Intrn
Asociacin Internacional para el Estudio del Cncer de Pulmn
Comisin Internacional para la Proteccin Contra Mutgenos y Cancergenos
Ambientales (International Commission for Protection against
Environmental Mutagens and Carcinogens)
ndice de homocigosidad
Instituto de Investigaciones Biomdicas
Instituto Nacional de Estadsticas y Censos
ndice de paternidad
Insuficiencia renal crnica
Inhibidores de tirosina quinasa (Tyrosine kinase inhibitors)
Kilobases
Cloruro de potasio
Kilogramo
Dosis letal
Elementos nucleares intercalados en largas distancias (Long interspersed
nuclear element)
Leucemia linfoblstica aguda
Leucemia mieloide crnica
Protena quinasa activada por mitgenos (Mitogen-activated protein kinase)
Dosis mnima para eritema
Megabases
Cloruro de magnesio
Complejo mayor de histocompatibilidad (Major histocompatibility complex)
Micro ARN
Manganeso
Madre portadora de translocacin equilibrada
Misin Solidaria Manuela Espejo
Individuos
Sodio
Nicotinamida adenina dinucletido reducido
Centro Nacional de Informacin Biotecnolgica (National Center for
Biotechnology Information)
Nanogramos
Nanmetros
Regiones organizadoras nucleolares (Nucleolus organizer region)
Estadsticamente no significativo
Nacidos vivos
Enfermedades mendelianas de humanos en lnea (Online Mendelian
Inheritance in Man)
Organizacin Mundial de la Salud (World Health Organization)
Organizacin no gubernamental
Organizacin Panamericana de la Salud (Pan American Health Organization)
Odds ratio
Hidrocarburos aromticos policclicos (Polycyclic aromatic hydrocarbons)
Pares de bases
Reaccin en cadena de la polimerasa (Polymerase chain reaction)
Proyecto de Diversidad del Genoma Humano
Proyecto del Genoma Humano (Human Genome Project)
Fosfatidilinositol 3 quinasa
Polo-like kinase
Patrones moleculares asociados a patgenos (Pathogen-associated molecular
patterns)
Polioxietileno amina

ABREVIATURAS

Poli
PPi
ppm
PPTE
PUCE
PVH
qPCR
Rad
RFLP
RISC
RLC
RNCAVCH
ROS
RV
S
S.
SEGH
SENESCYT
SH2
SIDA
SINE
SNC
SNP
SO2
SO4H2
SOD
SRD5A2
SSCP
STR
t
T
Taq
TDF
TGF
TGS
TLR
UDLA
UVA
UVB
UV
Va
Vc
Vg
VIH
VNTR
Vp
VPH
W

XXXI

Poliploida
Pirofosfato inorgnico
Partes por milln
Padre portador de translocacin equilibrada
Pontificia Universidad Catlica del Ecuador
Proyecto del Varioma Humano (Human Variome Project)
PCR cuantitativa (Quantitative PCR)
Unidad de radin
Polimorfismos en la longitud de los fragmentos de restriccin (Restriction
fragment length polymorphism)
Complejo inductor del silenciamiento del ARN (RNA-induced silencing
complex)
Receptores de lectina
Registro Nacional Colaborativo de Alteraciones y Variantes Cromosmicas
Humanas
Especies xido reactivas (Reactive oxygen species)
Cebador antisentido
Coeficiente de seleccin
Sndrome
Sociedad Ecuatoriana de Gentica Humana
Secretara de Educacin Superior, Ciencia, Tecnologa e Innovacin
cido sulfhdrico
Sndrome de inmunodeficiencia adquirida
Elementos nucleares intercalados en distancias cortas (Short interspersed
nuclear element)
Sistema nervioso central
Polimorfismo de nucletido simple (Single nucleotide polymorphism)
Dixido de azufre
cido sulfrico
Superxido dismutasa
5-reductasa tipo II
Polimorfismo en la conformacin de la cadena simple (Single-strand
conformation polymorphism)
Repeticiones cortas en tndem (Short tandem repeats)
Translocacin
Timina
Thermus aquaticus
Factor de determinacin testicular (Testis-determining factor)
Factor de crecimiento transformante (Transforming growth factor )
Lugar a nivel transcripcional
Receptores similares a toll (Toll-like receptors)
Universidad de las Amricas
Ultravioleta A
Ultravioleta B
Ultravioleta
Variabilidad ambiental
Variabilidad correlacionada
Variabilidad gentica
Virus de inmunodeficiencia humana (Human immunodeficiency virus)
Repeticiones en tndem de nmero variable (Variable number tandem repeat)
Variabilidad fenotpica poblacional
Virus del papiloma humano (Human papillomavirus)
Adaptabilidad

ABREVIATURAS

WAOPD
Wt
Zn
2

XXXII

Organizacin Mundial para la Prevencin de Defectos del Nacimiento (World


Alliance of Organizations for the Prevention of Birth Defects)
Tipo salvaje (Wild type)
Zinc
Chi-cuadrado

Captulo I
Historia de la Gentica en el Ecuador
Lo ms importante al estudiar la historia de una ciencia es entender con rapidez
el nivel que esta ha alcanzado y apreciar los conocimientos en su verdadera dimensin,
dentro de los contextos de desarrollo de la sociedad y de la ciencia en general. Adems,
este estudio permitir dilucidar los intrincados caminos filosficos a los que nos
enfrenta el conocimiento. Asimismo, el estar al tanto de los hechos cientficos nos
alejar de teoras caducas, previnindonos de repetir ensayos o descubrimientos ny
brindndonos la posibilidad de romper con mitos o acabar con lo pseudocientfico. La
historia de la ciencia nos ayudar a apreciar sus interrelaciones y a concatenar hechos,
nos introducir a terminologas nuevas que se convertirn de por s en aprendizajes y
nos llevarn a profundizar la propia ciencia. En especial, nos permitir descubrir a
personas egregias, que con su trabajo constante han contribuido al bienestar de la
humanidad, cuyos nombres servirn no solo de estmulo y ejemplo, sino que aportarn a
la valoracin de la humildad frente a nosotros mismos y a la grandeza del saber. Si el
lector o lectora concuerda con ello, estar preparado para sumergirse en el maravilloso y
apasionante mundo de la Gentica Humana.
En la actualidad, el inters por la Gentica Humana se ha acrecentado en forma
acelerada, debido a los sorprendentes descubrimientos e investigaciones que est
aportando, y que revolucionan las concepciones que con anterioridad han dominado el
quehacer cientfico. En la presente poca, las ramas de la Gentica Humana se han
diversificado a tal punto que existe una verdadera superespecializacin. As, se habla de
Citogentica y Gentica Clsica, Citogentica y Gentica Molecular,
Micromanipulacin, Ingeniera Gentica, Biotecnologa, Nanotecnologa Genmica,
Protemica y Transcriptmica. En este contexto, el Ecuador se ha desarrollado con
mayor lentitud frente a otros pases de la regin, ocupando lastimosamente puestos muy
retrasados. Si se revisa la historia del trabajo cientfico gentico en el Ecuador, se
aprecia que no ha existido una lnea de investigacin conformada o con tradicin. Los
aportes han sido escasos y ms bien provienen de estudios aislados y de temas muy
puntuales, que los autores han informado alrededor de uno u otro problema gentico
observado. Nos proponemos, por lo tanto, explicar de forma global los fundamentos
tericos, los avances cientficos y los resultados de investigaciones ecuatorianas
relacionadas a la Gentica Humana.
De los documentos histricos existentes se puede recuperar valiosa informacin
sobre Biopatologa Gentica en el Ecuador, lo cual indica que, al parecer, los autores
coinciden con una visin particular de la Gentica; esto es, la de una ciencia que estudia
pluralidad de niveles de organizacin de la realidad, desde molculas hasta organismos
complejos, pasando por organismos celulares, comportamiento social de las clulas e
incluso enfermedades. Es que lo fascinante de la Gentica radica en que su estudio no
excluye a estructura alguna: virus, bacterias, plantas, animales y seres humanos. Todos
han sido y son idneos para la investigacin, y en cualquiera de los niveles de
organizacin de la materia, los frutos y avances siguen siendo sorprendentes. De ah
que, a la luz de los conocimientos actuales, incluso hasta cabra presumir que los seres
vivientes son tan slo una expresin caprichosa del cido desoxirribonucleico (ADN)
en interaccin armnica con el medio natural.

HISTORIA DE LA GENTICA EN EL ECUADOR

Nos toca pues, a los seres humanos, estudiar y tratar de entender los complicados
mecanismos de la evolucin biolgico-gentica, sus leyes y caminos, precisamente por
estar, de manera circunstancial, en el nivel superior de la escala biolgica.

1.ETAPASDELDESARROLLOHISTRICODELAGENTICAHUMANA
Los orgenes empricos de la Gentica son tan antiguos como el hombre mismo.
Desde que a los primeros Homo sapiens les preocup la existencia y organizacin del
entorno, se empez a sacar conclusiones sobre las similitudes entre diferentes especies y
dentro de la propia descendencia. Los celtas y egipcios se ocuparon del cuidado de las
especies vegetales y animales, los rabes de la bsqueda de la pureza de sangre en los
caballos, los griegos de la eugenesia, las monarquas e imperios antiguos guardaron
celosamente sus genealogas y, en Amrica, se celebraban matrimonios entre el Inca y
su hermana en busca del primognito puro. Todas estas son muestras de la inquietud
universal y milenaria por la herencia.
Por otra parte, la Paleogentica es una valiosa ayuda para la revisin de la
patologa malformativa precolombina. En esta rea, Hermida ha analizado la Venus
dicephalus de la cultura Valdivia (7000 aos antes de la actualidad (AA)), polidactilia,
ectrodactilia y posiblemente un malformado de la cultura Chorrera (1500 aos AA);
examina los enanos y gigantes de la cultura La Tolita y Jama-Coaque (500 aos AA),
entre otros. En estas piezas arqueolgicas se evidencia el inters que sobre las
malformaciones tuvieron nuestros antepasados (Hermida, 1986; 1991; 1992).
En la historia de la humanidad, el estudio de los seres vivos ha inquietado a
muchos filsofos como Aristteles, Descartes, Diderot, Spencer, Bergson o como en la
actualidad, por ejemplo, al tratadista Bunge. As, se han conformado teoras por dems
interesantes con relacin a la esencia de lo vivo, a su dinmica y sus interrelaciones.
En un principio, el desarrollo de las ciencias estuvo siempre supeditado a falsas
creencias dominadas por el animismo, la falta de sistematizacin y de conocimientos. Se
especulaba ms all de la realidad. Pese a ello, hasta fines del siglo XVII, las ciencias
naturales, con una concepcin materialista, se abrieron paso en medio del idealismo, la
metafsica y el agnosticismo. A partir de este siglo, la Biologa, y la Gentica como tal,
avanzaron por tres revoluciones cientficas conocidas como: 1) Teora Celular, 2) Teora
Evolucionista y Mendeliana, 3) Gentica Molecular y Biotecnologa. Las tres dan como
resultado la siguiente periodizacin del desarrollo de la Gentica cientfica:
1.1.Perodoantiguooprecitogentico

Va desde el descubrimiento de la clula por Hooke, en 1666, y finaliza con la


publicacin de la famosa obra de Wilson, La clula en el desarrollo y la herencia, en
1896. En este perodo la ciencia estuvo influenciada por muchos mitos; se pensaba que
los fenmenos biolgicos se producan al azar y que su estudio era imposible. El
mtodo cientfico era muy incipiente y existan pocas sistematizaciones de la realidad.
La Gentica como ciencia se desarroll muy tardamente. La modernizacin de
la sociedad y sus exigencias industriales, agroalimentarias, farmacuticas, econmicas y
militares, ejercieron influencias determinantes en la potenciacin de la Biologa. El

HISTORIA DE LA GENTICA EN EL ECUADOR

avance de la Gentica estuvo ligado a los coleccionistas y observadores. Las tendencias


vitalistas de Uesekull, Driesch y Wenzl, quienes sostenan que los organismos se
adaptaban fatalmente al medio por poseer nimas, estuvieron fuertemente presentes
hasta muy avanzado el siglo XVIII.
Para emprender las investigaciones biogenticas se debi adelantar en la
clasificacin de las especies. El descubrimiento del Nuevo Mundo cuestion muchas
creencias pseudocientficas e hizo reclasificar las especies. Recin en el siglo XVIII,
Linneo propuso una clasificacin rigurosamente cientfica y esto fue trascendental, ya
que posibilit saber con certeza la especie o familia que se estaba estudiando.
El desarrollo de la Morfologa y la Anatoma Comparada, marc diferencias
esenciales entre lo normal y lo patolgico. La construccin del microscopio y la
observacin de la clula por Hooke, dieron inicio a la Teora Celular.
Con una nueva visin filosfica del mundo, los naturalistas profundizaron el
estudio de los linajes y rboles genealgicos. En 1739 Buffon destac las interrelaciones
de los organismos antes clasificados. Y estos fueron los cimientos fundamentales para
el criterio actual acerca del mismo origen molecular de las especies (hoy se sabe que el
cdigo gentico es nico y universal). En 1809 el naturalismo de Lamarck, con su teora
de que una especie proviene de sus antecesoras, pone las bases de la revolucin
biolgica de Darwin. En 1771 la Teora Celular de la herencia queda totalmente
conformada con los trabajos de Bichat, quien inici la Patologa Celular. Con los
estudios de Embriologa hechos por Von Baer (1792), quien observ que los
organismos se desarrollaban a partir del cruce de un espermatocito con un vulo; y, con
los trabajos de Amici (1827) sobre Histologa que dan una globalidad perfecta a esta
teora, pues hasta ese momento era poco objetiva y no demostrable.
A partir de aqu, las teoras empiezan a polarizarse. El fijismo preformista de
Weismann (1834), la teora del homnculo (el fenotipo completo del hombre est
almacenado como un ser minsculo en el espermatozoide), y la teora metafsica de De
Vries sobre la evolucin por saltos catastrficos (aparicin de nuevas especies por
accidentes, sin evolucin), se contraponen a las tendencias naturalistas y evolucionistas
de Darwin y sus seguidores.
En el Ecuador, el desarrollo cientfico biogentico estuvo vinculado a las ideas
biolgicas del padre Solano (1839), sobre las especies zoolgicas de nuestro territorio.
Apareci la primera obra de Anatoma microscpica de Sotomayor (1896). Se
describieron ciertas malformaciones cardiacas y se hicieron presentes las ideas de
proteccin de la descendencia, mediante la promulgacin de varias leyes de divorcio
justificadas por causas biolgicas que atentaran contra la salud y bienestar tanto de la
madre como de sus hijos (1899).
1.2.PerododelaGenticayCitogenticaclsica
Se inicia con el redescubrimiento de las leyes de Mendel por Tschermak, De
Vries y Correns (recurdese, que Mendel postul sus leyes en 1865 y debieron pasar 45
aos para que fuesen valorizadas en su verdadera dimensin), contina con el surgir del
darwinismo y el evolucionismo. Darwin introdujo criterios nuevos acerca de la
adecuacin de los organismos al medio; sostena que el medio influye en la variacin de

HISTORIA DE LA GENTICA EN EL ECUADOR

las especies (neolamarckismo), sin que experimentalmente lo pudiera demostrar; pero,


la seleccin natural, la variabilidad, la supervivencia del ms apto, marcan las bases
tericas materiales de la adecuacin de las especies al medio. El mrito de Darwin al
implantar la teora evolucionista fue expulsar de la ciencia a las teoras metafsicas y
vitalistas. La controversia con los postulados de Lamarck, Michurin y Lisenko, son
notables en este perodo.
Los trabajos de Mende, con guisantes, hicieron posible que se determine
matemticamente las leyes bsicas de la herencia, hoy aplicables a la herencia
monognica: autosmica dominante, recesiva y ligada al sexo. Mendel inaugur los
conceptos de herencia de los caracteres unitarios, cuya consecuencia fue la Teora
Gentica de la Herencia. Lo estudiado por l fue corroborado citolgicamente en 1910
por Morgan, quien observ que en ncleos celulares se presentaban los cromosomas y
sus alteraciones estaban relacionadas con alteraciones del fenotipo del individuo, con lo
cual se conforma la Teora Cromosmica de la Herencia. A partir de entonces, la
Citogentica tiene un gran avance como ciencia objetiva y experimental, ponindose de
manifiesto la interrelacin dialctica de la unidad entre causa y efecto. El desarrollo de
la Citogentica se debi al descubrimiento de tcnicas y a la readecuacin de otras ya
existentes, as:

a)

Desarrollo de las tcnicas de cultivo celular por suspensin, perfeccionamiento de la


tcnica directa para preparar cromosomas e introduccin de los agentes mitticos, como
la fitohemaglutinina.

b)

Introduccin de bloqueadores del huso acromtico (colchicina), descencadenando un


bloqueo de la mitosis.

c)

Pretratamiento de las clulas cultivadas en soluciones acuosas hipotnicas, cuyo efecto


osmtico separa los cromosomas y los hace observables al microscopio.

d)

Tcnica de extensin de cromosomas.

Tras dcadas de discusin, en 1956, Tjio y Levan asignaron el nmero


cromosmico humano en 46. Pocos aos despus, Lejeune describe las primeras
alteraciones cromosmicas: el sndrome de Down y el sndrome de Turner. En este
perodo son importantes adems: el descubrimiento de la tcnica de cultivo de linfocitos
estimulados con fitohemaglutinina, por Nowell, en 1960; y el desarrollo de las tcnicas
de diagnstico prenatal citogentico en el lquido amnitico, que permiten la prevencin
de enfermedades genticas y cromosmicas, por Breg y Steel, en 1966.
Aunque el perodo citogentico contina en la actualidad con aportes
importantes, fue trascendental el descubrimiento de las tcnicas de bandeamiento
cromosmico hechas por Caspersson en 1970, con las cuales fue posible la descripcin
de sndromes por reestructuraciones cromosmicas y la citogentica del cncer. Otros
hechos importantes en este perodo fueron el ensayo de tcnicas nuevas de tincin de los
cromosomas y de sus diferentes porciones telomricas, centromricas y satlites.
Este perodo tiene aportes interesantes en el Ecuador: Los cientficos
influenciados por el darwinismo (Darwin llega a las islas Galpagos en 1835) retoman
diferentes temas como la persistencia en el impedimento de matrimonios con linajes
aberrantes y se da importancia a las anomalas anatmicas. Gracias a Torres, en 1921, y

HISTORIA DE LA GENTICA EN EL ECUADOR

a Hidalgo, en 1915, la Embriologa toma un gran auge, y se empieza a discutir sobre los
problemas de la herencia patolgica.
Existen referencias sobre la herencia, los dermatoglifos, los grupos sanguneos y
los efectos de los rayos X sobre las clulas sanguneas. En 1931 Garzn propone
Ligeras anotaciones sobre la herencia. En 1939 Arauz habla sobre la Clula y la
Teora Celular. En 1940, se discute los mecanismos de la determinacin del sexo, su
evolucin y sus modificaciones. En 1945 Herdoiza escribe sobre La herencia
consangunea. En 1946 Espinosa publica Significado de la Gentica y posibles
aplicaciones de esta ciencia. En 1949 se cobra importancia el estudio del feto, y se
empieza a debatir temas que en la actualidad abarca la Biotica, tales como la eugenesia
y esterilizacin.
Los estudios sobre biologa del cncer se hacen presentes en 1947. En el mismo
ao, se publica el primer libro de gentica denominado La gentica y el hombre, de
Hoffstetter. Por otra parte, en 1954, Endara y Espinosa hablan de la patognesis del
mongolismo. Arias dedica algunos trabajos a las malformaciones congnitas como la
fisura labio-palatina y malformaciones del tubo digestivo. Hay publicaciones acerca de
las malformaciones congnitas del corazn. En 1962, Amen y Weilbauer informan,
respectivamente, sobre la herencia y en torno a la herencia de los trastornos sanguneos.
En 1965 Prez habla del estudio cromosmico en mdula sea para diagnstico de
leucemias. En 1967, Semiglia se informa sobre un caso de sndrome de Klinefelter;
mientras que, en 1968, Torres realiza un estudio sobre el sndrome de Down.
En esa dcada se desarrolla la Biologa y la Gentica experimental en las
facultades de Biologa de las universidades del pas, con el trabajo de Arcos. A partir de
1984 se potencia la citogentica mdica en el Ecuador con la experiencia de Paredes,
Santilln, Paz-y-Mio, Chaw y Moreta. En 1986 se hace el primer diagnstico prenatal
en lquido amnitico. Varios hospitales de Quito incluyen la Gentica en servicios
asistenciales. En 1987 Paz-y-Mio inicia los estudios cromosmicos en cncer y realiza
la primera biopsia corial para diagnstico prenatal. En 1990 Varas realiza el primer
estudio de incidencia de malformaciones congnitas en el que se incluye el estudio
cromosmico de los polimalformados.
A partir de aqu, la discusin mdica en torno a la Gentica se establece;
empiezan a presentarse investigaciones y resultados interesantes sobre variantes y
anomalas cromosmicas, malformaciones y citogentica del cncer. En 1990 Paz-yMio organiza el Registro Nacional Colaborativo de Alteraciones y Variantes
Cromosmicas Humanas (RNCAVCH). Por consiguiente, el quehacer cientfico en
Gentica logra tener alguna representacin con publicaciones nacionales,
internacionales, y participaciones en congresos, talleres, cursos y conferencias.
La Gentica irrumpe en el campo de la mutagnesis, analizando los efectos de
los genotxicos en los seres humanos: radiaciones, pesticidas, metales pesados,
luminoterapia, antibiticos, y se procuran los primeros pasos en la Gentica de
poblaciones con estudios de frecuencias gnicas de marcadores sanguneos.
En el 2002 se desarrollan los primeros ensayos con varias tcnicas de
citogentica molecular. La hibridacin in situ fluorescente (FISH) es la prueba con la
cual se empez a detectar alteraciones cromosmicas pequeas, sndromes y patologas

HISTORIA DE LA GENTICA EN EL ECUADOR

que antes no eran detectables. Tambin se hizo posible evidenciar las aberraciones
mediante la tincin de los cromosomas, cobrando auge el concepto de sndromes por
microdeleciones de cromosomas.
1.3.Perodomoderno,GenticaMolecularyBiotecnologa
Se inicia con las pruebas de transformacin bacteriana hechas por Griffit en
1928, que son la base de la Teora Molecular de la Herencia. En 1953, Watson, Crick y
Wilkins, postulan la estructura en doble cadena del material hereditario (ADN); en 1963
Nieremberg describe el cdigo gentico. En 1970 Khorana hace la primera sntesis de
un gen in vitro y Kan, en 1979, el primer diagnstico gentico por medio del anlisis del
ADN. En 1979 Goeddel produce por primera vez la insulina mediante ingeniera
gentica. Todas las tcnicas moleculares como la secuenciacin del ADN, la
hibridizacin celular y del ADN, la reaccin en cadena de la polimerasa (PCR) y la
manipulacin biotecnolgica continan con gran mpetu en la actualidad. Se ha llegado
a formar importantes convenios internacionales para el estudio del genoma humano.
Existe un estrecho vnculo entre la Gentica Molecular y la Citogentica,
desarrollndose la llamada Citogentica Molecular, que introduce tinciones selectivas
de porciones de genes presentes en cromosomas o de genes precisos.
Tanto la Teora Gentica de la Herencia como la Teora Cromosmica de la
Herencia conforman la llamada Gentica Cualitativa, para la cual los caracteres
cumplen la ley del todo o nada; es decir, que la alteracin de un gen o de un cromosoma
produce un efecto discernible (sndromes). Se dan los primeros pasos para relacionar un
fenotipo especfico con un gen especfico.
En el Ecuador, Beadle y Froehlich publicaron sobre el ADN en 1967, pero
debieron pasar casi tres dcadas hasta que existiera un creciente inters en la tecnologa
del ADN humano. Gutirrez, bajo el ttulo Milagros de la Gentica, hace una
interesante revisin de los aspectos actuales de la Gentica Molecular.
En 1995 Paz-y-Mio inicia, de forma pionera en el Ecuador, el Laboratorio de
Gentica Molecular y Citogentica Humana en el Departamento de Ciencias Biolgicas
de la PUCE, y se comienza el trabajo en tcnicas de Gentica Molecular Humana, con
la extraccin de ADN de clulas sanguneas, tumores slidos y leucemias, para anlisis
de mutaciones de genes especficos, como el gen de la hemocromatosis, genes
reparadores, el gen de la fibrosis qustica del pncreas, etc. Se utiliza la PCR y la tcnica
de polimorfismo en la conformacin de la cadena simple (SSCP), para el estudio
indirecto de mutaciones genticas. A partir de 1999 se trabaja con las tcnicas de
secuenciacin manual y automtica de genes. Para el estudio de daos del ADN se
desarrollan tcnicas de inestabilidad cromosmicas y determinacin de la fragmentacin
del ADN, como el ensayo cometa.
En el ao 2005 se formaron varios laboratorios que operaron ya con tcnicas
moleculares para diagnstico de enfermedades como acondroplastia, distrofia muscular
de Duchenne y Becker, corea de Huntington, sndrome de X frgil, entre otras. As
mismo, los conocimientos del ADN han permitido desarrollar las tcnicas de Gentica
Forense para identificacin de individuos y pruebas de paternidad (Hospital
Metropolitano y Cruz Roja Ecuatoriana de Quito). Estas pruebas se realizan a travs del

HISTORIA DE LA GENTICA EN EL ECUADOR

estudio de marcadores moleculares denominados repeticiones cortas en tndem (short


tandem repeats) (STRs), seleccionados segn los estndares internacionales.
El Instituto de Investigaciones Biomdicas (IIB) de la Universidad de las
Amricas (UDLA) se inici en octubre del 2008. El grupo de investigadores del IIB ha
efectuado un considerable nmero de publicaciones cientficas mediante libros y
artculos, ha organizado las conferencias cientficas BioScientis y ha brindado
asesoramiento y diagnstico de enfermedades genticas. El IIB lidera en el Ecuador los
estudios del genoma asociados a diversas patologas como el cncer, enfermedades
neurodegenerativas, enfermedades infecciosas, sndromes malformativos y alteraciones
cromosmicas; ha contribuido con el pas caracterizando genticamente a la poblacin
ancestral ecuatoriana y a varias especies de animales como el tapir, la vizcacha y el
cndor; de igual forma, ha analizando los efectos de genotxicos en poblacin expuesta
a pesticidas, hidrocarburos y radiacin ionizante (Paz-y-Mio et al., 2008a; 2012a).
En el ao 2013, el IIB expande sus reas de investigacin, trazndose como
objetivo el entendimiento de enfermedades relevantes para el Ecuador, mediante el
anlisis de la expresin de cascadas genticas, la aplicacin de microarreglos de ADN,
de vectores y de la secuenciacin genmica. Gracias al esfuerzo de los miembros del
IIB, este laboratorio es un referente de la investigacin biomdica en el pas.

2.VISINEPISTEMOLGICA

Lo mencionado anteriormente indica que el ltimo siglo ha sido el de mayores


aportes cientficos en el rea de la Gentica Humana, y esto favorece algunos
comentarios desde planos filosficos.
La Gentica inicial se fundament, entre otros, en Galton y Pearson, que
introdujeron los anlisis matemticos y estadsticos. As mismo, se inicia la Gentica
Cuantitativa con las tesis del efecto umbral en las patologas genticas y la acumulacin
de riesgos individuales, familiares o tnicos, y la llamada herencia de caracteres de
grado, continua o multifactorial.
En 1908 se postula la ley de Hardy-Weinberg sobre la Gentica de Poblaciones,
tomando en consideracin las variables de endogamia, migracin, mutacin y seleccin.
Hoy en da esta ley se aplica ampliamente en el asesoramiento y consejo gentico.
En el Ecuador, bajo una concepcin neodarwinista, Sykes y Blum retoman el
tema de la eutanasia y en los escritos aparecen argumentaciones con tintes racistas. En
1971, influido por el biologismo social, Amarista habla de los factores genticos y el
origen de la delincuencia.
Los postulados de la Gentica de poblaciones inquietaban a los cientficos.
Existan serias dudas sobre el comportamiento de los genes, sus cambios, estabilidad,
etc. En 1901, De Vries descubri las mutaciones. En 1927 Muller demostr la
produccin de las mismas con agentes fsicos (rayos X); de ah en adelante, muchos
qumicos, frmacos y agentes biolgicos han estado implicados en la induccin de
mutaciones que han acarreado efectos malformativos. Histricamente han existido
varios eventos que han desencadenado enfermedades genticas, como las bombas

HISTORIA DE LA GENTICA EN EL ECUADOR

10

atmicas en la Segunda Guerra Mundial, la talidomida, el sndrome de rubeola


congnita, la catstrofe de Chernbil, el sndrome de SIDA fetal. En nuestro medio se
pone atencin a los problemas de los rayos X y sus efectos en los cromosomas
humanos, y su evaluacin con el ensayo cometa.
Descubiertas y confirmadas las mutaciones, los trabajos cientficos pronto
llamaron la atencin sobre fenmenos muy interesantes relacionados con los cambios
del material hereditario, como la tendencia de las especies a mantener las mutaciones en
sus genomas, primero mediante los polimorfismos genticos o cromosmicos
(hemoglobinas, haptoglobinas, regiones heterocromticas de los cromosomas) y luego
por la manera en que estos se integran a la especie para ser posteriormente heredadas.
Con estas bases, el estudio comparativo de las especies en el mbito de la Gentica
Molecular, Bioqumica y Citogentica demuestran y reafirman la Teora Cromosmica
y Gentica de la Evolucin.
En 1909, acerca de la Teora Cromosmica de la Herencia, Johannsen postul
que los genes, que son la unidad de la herencia, ocupan lugares especficos en los
cromosomas. En 1915 Morgan denomin loci a las regiones especficas de los genes en
los cromosomas, denominando alelos a las variantes del mismo gen. La diferente
combinacin de estos alelos posibilita la presencia de individuos homocigotos o
heterocigotos. Con tal concepcin, Haldane y Penrose construyeron los primeros mapas
genticos, en los cuales asignaban diferentes genes a sitios cromosmicos especficos.
Sobre la base de los trabajos de Garrod, que demostraron que las enfermedades
bioqumicas son producto de alteraciones genticas, en 1902 se conform el concepto
de que un gen es una enzima. Los organismos se consideraron sistemas biolgicos
cerrados y los genes la ltima unidad, indivisible, del material hereditario,
autoperpetuables y poco modificables en cuanto a su relacin con el medio, lo que se
denomin la Teora Autogentica de la Herencia. As, el avance de la Gentica
Molecular hizo que los conceptos genticos se afinaran. En 1957 Benzer lanza el
concepto del cistrn, y se modifica el anterior concepto esttico del gen. El cistrn es
una secuencia de ADN con capacidad de produccin de un polipptido.
Los conceptos genticos, bajo influencias filosficas nuevas, adquieren otras
dimensiones. Se demuestra que el gen es divisible y, an ms, se descubre que un
mismo gen puede codificar dos y posiblemente ms protenas (un cistrn varios
polipptidos), mediante el empalme alternativo de exones (secuencias codificables) e
intrones (secuencias no codificadoras) (Krebs et al., 2009). En la actualidad se presta
atencin a ciertos patrones de herencia atpicos o raros, no mendelianos, agrupados en
lo que se denomina herencia mitocondrial y herencia por impresin gnica (genomic
imprinting).
Con la finalidad de conocer todo el patrimonio gentico de los seres humanos,
se inici a escala internacional el Proyecto Genoma Humano en 1988. La secuenciacin
del genoma humano fue fruto de un consorcio estatal y privado comandado por Estados
Unidos y la empresa Celera Genomics, apoyado por Alemania, Francia, Japn,
Inglaterra, Brasil, entre otros. Este conocimiento determin que la Gentica Humana
cambiara drsticamente, incluyendo en sus propsitos los experimentos de terapia
gnica, clonacin de individuos, clulas madres, manipulacin de embriones y seleccin
gentica; aspectos nuevos para la tendencia investigativa, alrededor de los cuales ha

HISTORIA DE LA GENTICA EN EL ECUADOR

11

cobrado un valor importante la discusin biotica de las nuevas tecnologas, se han


conformado comits y se han abierto foros para expertos y no expertos.
Lo curioso es que pese al despliegue informativo dado sobre dicho proyecto y
sus logros, los estudios que hemos realizado en poblacin urbano-marginal y en los
chamanes del Ecuador, hacen ver que los avances ms bien son limitados en el campo
de la Gentica y que a la poblacin general llegan muy pocos o mal interpretados. Puede
consultarse ms sobre este asunto en el artculo titulado Genetics and congenital
malformations: Interpretations, attitudes and practices in suburban communities and
the shamans of Ecuador publicado en la revista Community Genetics, en el ao 2006
(Paz-y-Mio et al., 2006a).
A principios del presente siglo, la aplicacin mecnica del materialismo
histrico hizo que Michurin y Lisenko desarrollaran el concepto de que la herencia
gnica no era la responsable del fenotipo y atribuyeran al medio ambiente un valor
primordial en la gnesis de los caracteres. Con sus experimentos neolamarkianos,
postularon que la manipulacin del ambiente resultaba en fenotipos deseados; es decir,
que las mutaciones eran controlables. La Gentica moderna demuestra que la
capacidad de adaptacin a las condiciones adversas del medio se debe a la seleccin de
genes favorables preexistentes en las especies, en funcin de la presin de mutacin
(valor preadaptativo de la mutacin), lo cual se sustent en los experimentos de Avery
en 1944, que mostraron el rol primordial del ADN en la herencia. Actualmente, se sabe
que las caractersticas somticas o fenotipo son el resultado de la relacin sumatoria de
las caractersticas genticas ms la influencia ambiental (epigentica). En esta frmula,
el genotipo proporciona la base fsica para las funciones y reacciones orgnicas frente al
medio.
A la luz de nuevas concepciones cientfico-filosficas, los organismos se
constituyen en sistemas biolgicos abiertos al medio, de existencia integral y armnica
del ADN, ARN y protenas; adems, son individualizados, autoregulados, con
propiedades de reproducir formas de informacin compleja (genes) y de perpetuar esa
informacin que est sujeta a presiones y cambios en el desarrollo individual, social, e
histrico. Se inaugura as la tendencia ecogentica, que se refuerza ms e imprime su
influencia en la mayora de tendencias en Gentica General y Humana. Muchos de los
movimientos ecologistas y personalidades cientficas, abanderan sus posiciones en la
defensa del patrimonio gentico de las poblaciones y del mantenimiento de la
biodiversidad.
La experiencia en Gentica Mdica nos muestra que muchos de los conceptos y
bases filosficas de la ciencia son descuidados en la actividad profesional ecuatoriana.
Existe una mezcla de razones: por un lado, el criterio individualista y comercial de la
medicina ha descuidado el trabajo cientfico sistematizado y ms bien consumimos
conocimientos antes que producirlos. Por otro lado, las exigencias de la poblacin de
enfermos son diversas a las de otras geografas y el criterio de curacin prima sobre el
de prevencin, por lo tanto, a un enfermo le interesa poco una prueba gentica de
deteccin temprana, pues esta no le servir para curarse de su mal. En este marco, las
acciones preventivas de la Medicina Gentica tienen poco espacio en la sociedad, a lo
que se agregan escasa formacin cientfica y limitaciones de acceso o preferencia por el
conocimiento.

Captulo II
Impacto social de los trastornos genticos

Entre los antiguos objetivos de la Organizacin Mundial de la Salud (OMS) se


observaba el eslogan La salud para todos en el ao 2000, es decir, el acceso de toda la
poblacin a la salud, empezando por los grupos prioritarios: nios, mujeres en edad
fecunda e impedidos. En el momento actual esto no ha ocurrido, al menos no en el
Ecuador. Los problemas de salud se han mantenido en muchos aspectos de similar
forma que hace veinte aos. Igualmente, la Organizacin Panamericana de la Salud
(OPS), en su reunin en Washington (1982), estim necesario que en Amrica Latina se
inicien actividades en el campo de la Gentica, con un enfoque particular en los
defectos congnitos (OPS, 1984). Es importante subrayar los planteamientos que las
mximas autoridades han mencionado hace dcadas y analizar la realidad de la salud en
cada uno de los pases, ya sea en el rea de la Gentica o en otras.
Se conoce que del total de recin nacidos, las enfermedades genticas y defectos
congnitos representan el 5%. Estos defectos constituyen una de las diez causas de
mortalidad infantil; oscilan entre 2 y 27%, segn la regin. Adicionalmente, los defectos
congnitos y genticos son la causa del 10 al 25% del total de hospitalizaciones. Por
otro lado, las anomalas cromosmicas representan entre el 0,5 al l% del total de
nacimientos, mientras que estudios en abortos tempranos revelan que el 50% de estos
casos presentan alguna anormalidad cromosmica (OPS, 1987).
Los problemas de infertilidad y esterilidad son explicables entre el 0,59 al 5,3%
de los casos, por cromosomopatas. Otras enfermedades de clara predisposicin gentica
manifestadas en los adultos representan un 15%. Gran proporcin de impedimentos
fsicos y mentales, como retraso, sordera, ceguera, problemas motores y de lenguaje,
son de origen gentico en el 11% de la poblacin de Amrica Latina. Algunos estudios
llegan a la conclusin de que al menos el 7% de concepciones humanas tienen
cromosomopatas, de estas, el 90% no sobreviven luego del nacimiento; del 10% que
sobrevive, la mitad padece de gonosomopatas (afeccin de los cromosomas sexuales).
Un dato digno de tomar en cuenta es que el 2% de embarazos que cursan sin
complicaciones y que llegan a trmino sin problemas obsttricos, resultan en un hijo con
anomalas (Paz-y-Mio, 1991).
Estudios poblacionales indican que 1 de cada 500 individuos posee una
alteracin cromosmica estructural balanceada, es decir, translocaciones e inversiones.
Si bien no producen alteraciones fenotpicas en el portador, pueden originar alteraciones
en la descendencia (Ballesta & Baldellou, 1971), debido a que si las alteraciones
cromosmicas se asocian con un cambio en la lectura del ADN, esta informacin
alterara la sntesis de protenas, y por ende se desencadenaran problemas a nivel
fisiolgico en los diferentes sistemas del cuerpo humano.
En el Ecuador las anomalas congnitas estn comprendidas entre las 17
primeras causas de mortalidad referente a enfermedades, con una tasa de 4,9 por cada
100000 habitantes. Las causas de mortalidad con los ms altos porcentajes son las
enfermedades hipersensitivas (7%), la diabetes mellitus (6,5%), la influenza y neumona
(5,4%), y las enfermedades cerebrovasculares (5,3%) (Tabla II.1).

IMPACTO SOCIAL DE LOS TRASTORNOS GENTICOS

16

Tabla II.1. Causas de mortalidad referente a enfermedades


Enfermedades
Porcentaje (%) del total de defunciones
Enfermedades hipertensivas
7
Diabetes mellitus
6,5
Influenza y neumona
5,4
Enfermedades cerebrovasculares
5,3
Enfermedades isqumicas del corazn
3,2
Cirrosis y otras enfermedades del hgado
3,1
Insuficiencia cardiaca
3
Enfermedades sistema urinario
2,6
Neoplasia maligna del estmago
2,5
Enfermedades crnicas en vas respiratorias
2
Neoplasias en tejido linftico
1,6
Neoplasia maligna de prstata
1,4
Septicemia
1,3
Enfermedad virus VIH
1,2
Neoplasia maligna en tero
1,2
Neoplasia maligna pulmn
1,1
Malformaciones congnitas y anomalas cromosmicas
1,1

Adems, en Ecuador los datos de malformaciones son variables a pesar de que


todos se encuentran dentro de las cifras aceptadas para incidencia y frecuencia de estas
patologas (Varas, 1989; Romero & Carrin, 1990) (Tabla II.2), as:
Tabla II.2. Estudios sobre frecuencias de malformaciones en Quito
Malformaciones (%)
1,08
4,90
0,82
2,12
1,7

Casos (nacidos vivos)


25125
54079
7527
12112
66843*

(*) Se registraron en los 12 hospitales ecuatorianos de la red ECLAMC, 66843 nacimientos de los
cuales: 7 hospitales se localizan por encima de los 2000 msnm, con 41218 nacimientos y 5
hospitales por debajo de los 2000 msnm, con 25625 nacimientos.

La investigacin realizada por Varas en 1989 establece que el 1,5% de casos


analizados presentaron malformaciones congnitas. Tuvimos la oportunidad de seguir
de cerca este estudio y constituye el nico informe en el cual constan resultados de
cromosomopatas. Este estudio, siguiendo los criterios de clasificacin del Estudio
Colaborativo Latinoamericano de Malformaciones Congnitas (ECLAMC), constituye
una contribucin sobre frecuencias e incidencias de malformaciones congnitas. Las
cifras informativas son las siguientes: sobre los 12112 nacidos vivos estudiados, 257
(2,12%) presentaron malformaciones; de estas, 144 (56,0%) corresponden a varones;
112 (43,6%) a mujeres y 1 caso (0,4%) a sexo indeterminado (razn sexual H:M = 1,3)
(Varas, 1989; Paz-y-Mio, 1993a; ECLAMC, 2013).
Con respecto a las malformaciones por sistemas en nacidos vivos en Quito, se
realiz un anlisis por sistema afectado, obteniendo como resultado que de los 211
nios estudiados, el 22,8% present afectado el sistema esqueltico, el 20,9% present
problemas en el sistema auditivo, y el 14,2% present cromosomopatas. Estos datos se
los detalla en la Tabla II.3.

IMPACTO SOCIAL DE LOS TRASTORNOS GENTICOS

17

Tabla II.3. Distribucin de malformaciones por sistemas en nacidos vivos en Quito


Sistema afecto
Sistema esqueltico
Sistema auditivo
Cromosomopatas
Sistema maxilofacial
Sistema nervioso
Sistema digestivo
Sistema gnito-urinario
Sistema circulatorio
Sistema epitelial y anexos
Tumores
Sistema respiratorio
Aparato ocular
Total

Casos (%)
48 (22,8)
44 (20,9)
30 (14,2)
19
(9,0)
16
(7,6)
15
(7,1)
13
(6,2)
10
(4,7)
6
(2,8)
5
(2,4)
3
(1,4)
2
(0,9)
211 (100)

Frecuencias
0,40
0,36
0,25
0,16
0,13
0,12
0,11
0,08
0,05
0,04
0,03
0,02

Uno de los estudios ms importantes en Ecuador, sobre malformaciones fue el


realizado por el ECLAMC, coordinado por el Hospital del Seguro Social Carlos
Andrade Marn. El registro aglutin por primera vez en el Ecuador a doce centros con la
misma metodologa. El estudio de malformaciones hace referencia a 60 diferentes tipos
de problemas, contemplados en la clasificacin internacional de enfermedades. Los
centros que aportaron a este estudio se detallan en la Tabla II.4 (ECLAMC, 2013).
Tabla II.4. Centros que conforman el ECLAMC en Ecuador
Hospital
Andrade Marn
Isidro Ayora
Rodrguez Zambrano
Napolen Dvila
Miguel Alcvar
Luis Martnez
Fundacin Mano Amiga
Verdi Cevallos Balda
Isidro Ayora
San Vicente de Paul
Homero Castanier
Tefilo Dvila

Provincia

Ciudad

Pichincha
Pichincha
Manab
Manab
Manab
Caar
Caar
Manab
Loja
Imbabura
Caar
El Oro

Quito
Quito
Manta
Chone
Baha de Carquez
Caar
Caar
Portoviejo
Loja
Ibarra
Azogues
Machala

Altitud
(msnm)
2880
2880
13
110
3
3050
3050
36
2310
2215
2520
6

Nacidos/ao
3500
12000
2200
1600
1200
600
600
2800
2900
3000
1500
1900

Con respecto a los resultados del estudio, las 15 mayores frecuencias de


malformaciones en el ECLAMC (Ecuador) se presenta en la Tabla II.5.
Un aspecto fundamental del estudio del ECLAMC es que, al hacer una revisin
de los problemas ms frecuentes, en trminos generales se observa una baja frecuencia
de onfalocele, gastrosquisis, anencefalia, espina bfida, hidrocefalia, cefalocele, defecto
conotruncal, defecto septal, persistencia de ductus, otras cardiopatias, hipospadias,
agenesia renal, hidronefrosis, pie equinovaro, pie talovalgo, polidactilia postaxial,
polidactilia preaxial, artrogriposis, sndrome de Down, sndromes etiolgicos,
sndromes patognicos. Hay una alta frecuencia de an-microtia y labio leporino
anotia/microtia es el nico tipo de malformacin ms frecuente en hospitales
ecuatorianos (10,68/10000) que en el resto del ECLAMC (5,08/10000). Posiblemente
esta diferencia sea an mayor de no existir las deficiencias de registro mencionadas
anteriormente. Este dato confirma la observacin realizada en el ao 1970, cuando se

IMPACTO SOCIAL DE LOS TRASTORNOS GENTICOS

18

particip en el inicio del ECLAMC y que ubic al Ecuador como uno de los pases con
ms alta patologa a nivel de odo externo (seis veces ms alta). Situacin similar
ocurri con la dislocacin congnita de cadera, que el ECLAMC de aquella poca
detect cuatro veces ms alta en Ecuador que en el resto de Amrica Latina, y que el
ECLAMC (Ecuador) tambin la ubic como tres veces ms alta, al compararla con el
resto del registro. La observacin fue realizada a ms de los 2000 msnm (Tabla II.5)
(Paz-y-Mio et al., 2002a; Montalvo et al., 2005; ECLAMC, 2013).
Tabla II.5. Frecuencias de malformaciones del ECLAMC en el Ecuador
Malformacin
Labio fisurado ms paladar hendido
Subluxacin de cadera
Sndrome de Down
Pie varo
Polidactilia
Hidrocefalia
Espina bfida
Paladar hendido
Atresia esofgica
Hipospadias
Anencefalia
Defectos septales
Microftalmia
Defectos conotruncales

Frecuencia
18,84
14,44
13,50
11,62
11,62
7,54
4,71
4,40
4,08
3,77
3,77
3,45
3,14
2,51

< 2000 msnm


11,08
3,08
11,70
9,85
9,85
2,46
4,93
6,16
2,46
1,23
1,23
0,00
2,46
0,62

> 2000 msnm


20,18
15,41
13,94
9,54
12,85
8,70
4,77
2,94
3,30
3,67
4,40
4,40
2,94
2,94

(Montalvo et al., 2005)


Actualmente se discute mucho la relacin entre la altura geogrfica y la
variabilidad de las patologas, y muchos estudios relacionan la altura con enfermedades.
En relacin a la altura, existe alguna evidencia interesante sobre esta asociacin, los
estudios de tumor de cuerpo carotideo hablan de un umbral de activacin a partir de los
1800 msnm.
La influencia de la altura ha sido estudiada desde muchos puntos de vista:
fisiolgicos, fenotpicos, adaptativos, enzimticos, bioqumicos, inmunolgicos, entre
otros. Estudios en lugares altos como los Himalayas, los Andes, algunos sitios altos de
Europa y otros de Asia postulan hiptesis bien respaldadas, pero no logran descifrar
satisfactoriamente qu y cules ventajas son clave para entender los mecanismos de la
adaptacin a la altura (Moore, 2000; Rupert & Hochachka 2001). La discusin
actualmente, se centra en si los hallazgos son simplemente adaptaciones naturales o
genticas y se aborda las limitaciones de los diversos estudios y su metodologa
(Brutsaert, 2001).
Por otro lado, hay que considerar que las enfermedades tambin tienen
comportamientos diferentes segn el grupo poblacional, lo que se denomina
heterogeneidad geogrfica. Por ejemplo, variaciones en el complejo mayor de
histocompatibilidad (MHC) se asocian a una mayor predisposicin a edema pulmonar
en poblacin de altura (Hanaoka et al., 1998). Estudios sobre alelos del betafibringeno en poblaciones nativas de altura revelan polimorfismos del gen, asociados a
una mejor adaptacin a la altura, especficamente a mayores concentraciones de
fibringeno (Rupert et al., 1999), as mismo, estudios de polimorfismos de los
receptores beta 2 adrenrgicos, en poblaciones que viven entre 3200 y 4200 metros

IMPACTO SOCIAL DE LOS TRASTORNOS GENTICOS

19

sobre el nivel del mar, muestran un polimorfismo mayor asociado a un mejor


funcionamiento bronquial (Rupert et al., 1999). Las malformaciones a nivel
latinoamericano muestran diferentes incidencias segn los pases. La microtia y la
dislocacin congnita de cadera tienen un mayor ndice de presentacin en poblacin de
altura, especialmente en Quito (Castilla & Orioli, 1986). Los estudios de la distribucin
del cncer por grupos poblacionales muestran que existe diferente incidencia segn
sexo, regin geogrfica y grupo poblacional con caractersticas genticas comunes.
Estudios realizados en Hait, Bolivia, Rusia y Ecuador muestran que la incidencia del
cncer es mayor en la poblacin de montaa (Ros-Dalenz et al., 1981; Akhtiamov &
Karakbaev, 1983; Mitacek et al., 1986). Fenmeno similar con relacin a la altura,
ocurre con los tumores, como el del cuerpo carotideo.

1.MALFORMACIONESCONGNITAS
Dentro del concepto de malformaciones se debe incluir tambin los trastornos
funcionales, por lo que se puede definir una malformacin congnita como una
anormalidad de estructura, funcin o metabolismo, ya sea genticamente determinada o
por el resultado de la interferencia ambiental durante la vida embrionaria, fetal o
postnatal, y que puede manifestarse en el momento del nacimiento o posteriormente.
Otros autores prefieren llamarlas anomalas congnitas, porque esta denominacin
incluye tanto las malformaciones como las alteraciones cromosmicas y metablicas,
englobando toda irregularidad o discrepancia en el desarrollo normal. Las
anormalidades funcionales son ejemplificadas por errores innatos del metabolismo,
hemoglobinopatas, o retraso mental.
El estudio de las malformaciones congnitas suele designarse como Teratologa,
pero es preferible utilizar el trmino Dismorfologa, que se refiere al estudio de las
anormalidades del desarrollo morfolgico, incluyendo las pequeas malformaciones.
La frecuencia de las malformaciones congnitas es bastante elevada; si se tiene
en cuenta los nacidos muertos, los nios que mueren en el perodo neonatal y los que
sobreviven ms all del primer ao de vida, se obtiene una cifra de un 6% de los recin
nacidos. Colectivamente, todos los desrdenes genticos y defectos del nacimiento
tienen una predominancia mnima de 50 por 1000, en el nacimiento. La predominancia
promedio de malformaciones congnitas, en el nacimiento, en los pases en desarrollo es
aproximadamente del 2 al 3%, dato similar al de los pases industrializados (Lian et al.,
1987; Mutchinick et al., 1988). Algunas malformaciones muestran amplias variaciones
geogrficas. Por ejemplo, los defectos del tubo neural, al nacer, son muy prevalentes en
Egipto, China, Mxico y Amrica Central (Lian et al., 1987; Mutchinik et al., 1988).
Mientras que las fisuras labial y palatina son frecuentes en las poblaciones amerindias y
asiticas, y microtia en Ecuador (Castilla Orioli, 1986). Las interacciones entre el
ambiente y los factores constitucionales fundamentan las variaciones observadas en la
frecuencia entre poblaciones. Sin embargo, los factores ambientales tambin cumplen
un rol importante, tal como el sndrome de alcoholismo fetal en frica del Sur.
Se entiende por etiologa el punto de partida de la cadena de acontecimientos
que llevarn finalmente a la aparicin de uno o varios defectos congnitos en un feto. La
cadena de acontecimientos es la patogenia y el cuadro final ser la manifestacin clnica
del proceso.

IMPACTO SOCIAL DE LOS TRASTORNOS GENTICOS

20

Los defectos congnitos se dividen en tres grandes grupos segn su etiologa:


gentica 13% (monognica 3% o cromosmica 10%), ambiental 5% y desconocida
82%. Aproximadamente 6 de cada 1000 nv tiene anormalidades cromosmicas que
conducen a malformaciones congnitas, retraso mental y desrdenes de la
diferenciacin sexual. Aunque la mayora de cuadros dismrficos de etiologa gentica
se producen como consecuencia de errores no reparados en la replicacin del ADN, se
debe considerar tambin que la etiologa de algunos casos producidos por la presencia
de un gen o un cromosoma alterado puede ser tambin ambiental (agentes
mutagnicos). En estos casos, la alteracin gentica es el inicio de la patogenia.
Existe heterogeneidad tanto etiolgica como clnica en el proceso
dismorfognico: un factor etiolgico puede dar lugar a cuadros clnicos diversos
(dependiendo de la dosis y la susceptibilidad gentica del embrin), y un cuadro clnico
puede ser producido por la accin de factores etiolgicos distintos. El esfuerzo conjunto
de la teratologa y la embriologa est ayudando a la comprensin del fenmeno
dismorfognico. Este conocimiento, importante desde el punto de vista biomdico,
puede abrir nuevas vas en el reconocimiento de agentes teratognicos desconocidos.
1.1.Factoresmaternos
Existen factores maternos relacionados a infecciones y a enfermedades crnicas.
1.1.1.Infecciones

Rubola (aborto, malformaciones mltiples, ceguera, cardiopatas, prematuridad).


Citomegalovirus (retardo mental, microcefalia, calcificacin intracraneal,
corioretinitis, prdida de la audicin, dificultad del aprendizaje).
Parvovirus (edema fetal).
Poliovirus (abortos espontneos, en algunos casos malformaciones congnitas, peso
bajo, nios prematuros).
Toxoplasmosis (abortos, infeccin congnita severa con efectos teratognicos,
crecimiento anormal, en algunos casos se presenta calcificacin intracerebral,
corioretinitis, hidrocefalia o microcefalia, fluido espinal anormal, anemia,
esplenomegalia, ictericia, fiebre, linfoadenopata, convulsiones y vmito, retraso
mental, deficiencias visuales y auditivas, ataques).
VIH (microcefalia, retardo del crecimiento, dismorfismo craneofacial).
Herpes simple (abortos espontneos, nios con una enfermedad localizada no muy
severa, mientras que otros nios experimentan una enfermedad frecuentemente fatal
afectando a mltiples rganos).
Papiloma virus humano (papilomatosis fetal de la laringe asociado con tracto genital
materno condilomatoso).
Varicela-zoster (lesiones de la piel, hipoplasia de los miembros, atrofia cortical,
retardo mental, microcefalia, corioretinitis, microftalmos, nistagmus y cataratas).
Sfilis (infeccin congnita, muerte neonatal, hepatoplenomegalia, linfoadenopata,
pseudoparlisis).
Paperas (abortos espontneos).
1.1.2.Enfermedadescrnicas

Diabetes mellitus.

IMPACTO SOCIAL DE LOS TRASTORNOS GENTICOS

21

Fenilcetonuria.
Hipotiroidismo.
Hiperplasia suprarrenal.

1.2.Factoresexternos
Existen factores externos como agentes fsicos, qumicos y hbitos.
1.2.1.Agentesfsicos

Radiaciones ionizantes (infertilidad, microcefalia, retraso mental, aberraciones


estructurales cromosmicas, mosaicismo, mutaciones gnicas, predisposicin al
cncer, nusea, vmito, dao a la vejiga o al tracto gastrointestinal. En dosis altas:
destruccin del sistema inmune, del tejido nervioso y del cerebro).
Rayos ultravioleta (mutaciones puntuales, cncer de piel).
Hipertermia (en organismos experimentales se ha revelado embriotoxicidad durante
el estadio de preimplantacin, efectos fsicos similares a aquellos de fiebre alta y la
induccin de cataratas).
Fuerzas mecnicas.
Ultrasonido (puede afectar material biolgico por hipertermia; cavitacin, que puede
daar estructuras subcelulares; o estrs mecnico directo).
1.2.2.Agentesqumicosymedicamentos

Talidomida (deformidades de los miembros, anomalas auditivas, anormalidades


nasales, defectos del lbulo medio del pulmn derecho, malformacin cardiaca,
estenosis duodenal o pilrica y atresias gastrointestinales).
Estreptomicina (deficiencias auditivas y dao en el octavo nervio craneal,
ototoxicidad fetal del 3 al 11%).
Tetraciclina (afecta al color de la dentadura).
Ciclofosfamida (defectos en las extremidades).
Antagonistas del cido flico: aminopterina, metotrexato (desarrollo seo alterado,
cabezas globulares, facies triangulares anormales, orejas pequeas, retraso del
crecimiento).
Anticonvulsivantes: hidantonas (retardo del crecimiento intrauterino, microcefalia,
retardo mental, pliegues internos del epicanto, ptosis del prpado, puente nasal
ancho deprimido, hipoplasia de las falanges distales y hernias), cido valproico
(defectos del tubo neural lumbosacro), trimetadiona (retardo del crecimiento y
desarrollo, cejas en forma de V, implantacin baja de las orejas, anomalas del
paladar, pliegues del epicanto y dentadura irregular, anomalas cardiovasculares y
viscerales).
Andrgenos (masculinizacin del feto femenino, fusin labioescrotal antes de la
doceava semana de gestacin).
Anticoagulantes: warfarina (hemorragia fetal, hipoplasia nasal, atrofia ptica,
microcefalia), dicumarnicos.
cido retinoico (microcefalia, anormalidades auditivas, defectos cardiacos y
lesiones del sistema nervioso central).
Busulfan (malformaciones y retardo del crecimiento intrauterino).
Clorambucil (agenesis renal unilateral y ureteral).

IMPACTO SOCIAL DE LOS TRASTORNOS GENTICOS

22

1.2.3.Hbitos

Alcohol (Sndrome del alcoholismo fetal incluye disminucin del coeficiente


intelectual, retraso del crecimiento intrauterino, anomalas oculares, anomalas de
las articulaciones y problemas cardacos).
Cocana (disminucin del comportamiento interactivo y pobre respuesta
organizacional a los estmulos del medio ambiente).
Cigarrillo (retraso del crecimiento intrauterino).
Sustancias industriales y ocupacionales.
Mercurio orgnico (toxicidad fetal, dao del sistema nervioso central).
Habitualmente los defectos congnitos se clasifican en dos grupos: alteraciones
individuales de la forma o la estructura, y patrones o entidades polimalformativos.
1.3.Alteracionesindividuales
Segn la terminologa de Spranger, se manejan los siguientes conceptos a nivel
mundial (Spranger et al., 1982):
1.3.1.Malformacin
Defecto estructural macroscpico de un rgano, parte de un rgano o una regin
del organismo, que resulta de un proceso de desarrollo intrnsecamente anormal. Ej.
Ectropa de la vejiga, raquisquisis.
1.3.2.Deformacin
Anomala de la forma o la posicin de una parte del organismo, causada por
fuerzas mecnicas intrauterinas, que distorsionan las estructuras normales. Ej.
Deformacin del oligohidramnios.
1.3.3.Disrupcin
Defecto morfolgico o estructural de un rgano, parte de un rgano o una regin
del organismo, resultante de una interferencia en un proceso de desarrollo que
originalmente era normal. Ej. Amioplasia congnita, disrupcin de tejidos normalmente
desarrollados por bandas amniticas.
Si bien el concepto de deformacin no ofrece dudas, en algunos casos puede no
ser evidente la diferencia entre malformacin y disrupcin. El concepto de disrupcin
surge para explicar cuadros como los producidos por bridas amniticas o por
interrupciones en el aporte sanguneo a una zona embrionaria determinada, pero si se es
estricto con la definicin, cualquier defecto congnito producido por la accin de un
agente teratognico, sea cual fuere su mecanismo patognico, ser una disrupcin.
1.3.4.Variacin
Desviacin o fluctuacin dentro de lo que se considera normal, es decir cambios
que no comprometen ni la morfologa, ni la funcin. Por ejemplo: nariz chata o
aguilea; talla pequea o talla alta.

IMPACTO SOCIAL DE LOS TRASTORNOS GENTICOS

23

1.3.5.Defecto
Es la imperfeccin o la falta de cualidades normales, es decir todo lo que se
aparta de lo normal y de sus variaciones. Se refiere tambin a las desviaciones celulares
o metablicas que alteran la funcin. Ejemplos: el albinismo, la alcaptonuria.
1.3.6.Monstruosidad
Deformacin inslita o grave, generalmente incompatible con la vida. Por
ejemplo: acrneo, acardio, anencfalo.
La frecuencia de las anomalas es mayor de la que se puede imaginar; se estima
que las posibilidades de malformaciones en el recin nacido son de alrededor de 1 por
cada 165. Esta incidencia es mucho mayor si se agregan las anomalas menores y
alteraciones congnitas del metabolismo. Sin embargo, las estadsticas no son
concordantes y dependen de muchos factores como los raciales, geogrficos y
ambientales, lo que ocasiona que mientras para algunos investigadores el nmero de
anomalas congnitas al momento del nacimiento es de 1 por cada 165, para otros llegue
a 1 por cada 44; y si a estas cifras se suman las halladas en los abortos, las posteriores al
nacimiento y las que se presentan durante el desarrollo, las cifras se elevan al 7% y
hasta el 14% (Cordero, 1975).
1.4.Entidadespolimalformativas
Si se pudiese seguir todo el proceso patognico, desde la accin del agente
etiolgico hasta la manifestacin clnica, nicamente existira un tipo de entidad
malformativa: la secuencia. Se puede diferenciar dos tipos de secuencias: la
monotrpica y la pleiotrpica, dependiendo de si la molcula, clulas o tejido alterado
en primera instancia por la accin del agente causal presentan durante el perodo
embrionario una accin local (en clulas, tejidos u rganos prximos entre s),
multifocal o espectro de accin.
Los cuadros con mltiples defectos congnitos pueden ser clasificados en alguna
de las siguientes seis entidades polimalformativas que no son excluyentes entre s:
1.4.1.Secuencias
Es el conjunto de cambios funcionales o defectos estructurales derivados de un
nico, conocido o supuesto factor mecnico, malformacin. Es decir, se trata
bsicamente de un concepto patognico.
1.4.2.Defectosdezonadedesarrollo
Se definen como "regiones o partes del embrin que responden como una unidad
coordinada a un fenmeno de interaccin embrinica, dando lugar a alteraciones
mltiples que afectan diversas estructuras anatmicas". Segn John Opitz las "zonas"
son aquellas partes del embrin en las que el proceso de desarrollo est controlado y
coordinado de una forma sincronizada en el tiempo y en el espacio. Ejemplos de estas
zonas son el mesodermo axial, los arcos branquiales o la cresta neural.

IMPACTO SOCIAL DE LOS TRASTORNOS GENTICOS

24

1.4.3.Asociacionesdealtafrecuencia
Presentacin no debida al azar, en dos o ms individuos, de mltiples anomalas
no catalogadas como secuencia, sndrome o zona. Por lo tanto, es una combinacin
estadstica de manifestaciones (no patognica ni causal).
1.4.4.Espectros
Un espectro engloba patologas que anteriormente se consideraban de forma
separada y que, probablemente, no representan ms que distintas manifestaciones o
diversos grados de severidad de un error comn o similar durante el perodo de
morfognesis. Este hipottico error, que dara lugar a un proceso patognico similar,
puede tener etiologas diferentes.
1.4.5.Sndromes
De forma general se definen como un patrn de mltiples anomalas
(malformaciones, disrupciones, deformidades) que afectan mltiples reas del
desarrollo, y que estn relacionadas etiopatogenticamente. Su etiologa puede ser:
1.4.5.1.Sndromesdeetiologaconocida
Incluye todos los cuadros clnicos en los que se ha podido identificar una causa:
a)Sndromesteratognicos
El embrin ha estado expuesto a un agente teratognico durante un perodo
susceptible de la gestacin.
b)Sndromescromosmicos
Existe una alteracin en el nmero o la forma de alguno de los cromosomas del
producto de la gestacin.
c)Sndromesgnicos
Se detecta (anlisis de ADN), deduce (anlisis genealgico) o infiere
(identificacin clnica por similitud con casos publicados) una mutacin gnica.
1.4.5.2.Sndromesdeetiologaheterognea
Se trata de entidades puramente clnicas. Este grupo y el siguiente contienen
cuadros que se acercan mucho a la definicin del diagnstico.
1.4.5.3.Sndromesdeetiologadesconocida
Se trata de entidades clnicas. Cuando se tengan datos sobre su posible etiologa
pasarn a formar parte de alguno de los dos grupos anteriores de sndromes,
dependiendo de si su etiologa es comn (sndromes de etiologa conocida) o no puede
asumirse que lo sea para todos los cuadros (sndromes de etiologa heterognea).

IMPACTO SOCIAL DE LOS TRASTORNOS GENTICOS

25

1.5.Polimalformadosnoencuadrables
En este grupo se incluyen a todos aquellos polimalformados que no pueden ser
clasificados en ninguno de los grupos anteriores.

2.DIAGNSTICOGENTICODEMALFORMACIONES
Ante un paciente con un cuadro de defectos congnitos solo hay una manera de
intentar obtener un diagnstico: acumular toda la informacin descriptiva necesaria, la
misma que debe incluir datos sobre la historia familiar, la historia gestacional, la propia
descripcin pormenorizada del cuadro y los resultados de los anlisis complementarios
(cariotipo, necropsia, serologa). Luego del proceso de diagnstico, los hechos mdicos
disponibles son discutidos con el paciente yo la familia, en el proceso del consejo
gentico, el cual debe ser no solamente retrospectivo, sino tambin prospectivo.
Finalmente si el caso as lo requiere se har la intervencin teraputica adecuada y el
respectivo apoyo psicosocial.
Entre los estudios de malformaciones congnitas realizados en el Ecuador se
puede citar el llevado a cabo en la maternidad del Hospital Docente San Vicente de
Pal, de la ciudad de Cuenca, cuyos datos fueron publicados en 1975. Durante los 15
aos de recopilacin de informacin se atendieron 3990 partos, se encontr mortalidad
perinatal de 130 nios; 106 de ellos fueron necropsiados, de estos, 75 fueron mortinatos
y 31 fallecieron durante los cinco primeros das de vida. En los 106 casos estudiados se
encontraron 20 malformaciones, de las cuales, 13 fueron de importancia y 7 de menor
significacin, simples variaciones o malformaciones que no comprometan la funcin
orgnica, por lo que fueron descartadas. Despus de algunos anlisis se lleg a la
conclusin de que la hiponutricin y la anoxia fueron los dos factores etiolgicos de
mayor importancia.
Se conoce que en los pases en desarrollo han nacido ms de dos tercios de nios
en el mbito mundial. Si la incidencia de los defectos de nacimiento en estos pases es al
menos igual a aquella de los pases industrializados, se puede estimar que al menos 3,3
millones de nios con defectos de nacimiento, nacen anualmente en los pases en
desarrollo. Por lo que es indispensable que los gobiernos, ONGs, y otras instituciones
de salud, reconozcan la necesidad de establecer servicios integrados de gentica,
incluyendo vigilancia de defectos de nacimiento en todos los sistemas de cuidado de la
salud (OMSWAOPBD, 1999).
Con el objetivo de valorar el estado de los servicios de gentica en los pases en
vas de desarrollo, la Organizacin Mundial de la Salud y la Alianza de las
Organizaciones Mundiales para la Prevencin de Defectos del Nacimiento (WAOPD)
reunieron a un grupo de expertos en Gentica Mdica, quienes trabajan o estn
familiarizados con los problemas sociales, econmicos y de salud de los pases en
desarrollo. Su propsito fue hacer recomendaciones para la futura implementacin de
programas, para el manejo y prevencin de desrdenes genticos y defectos del
nacimiento en la atencin primaria de salud y niveles comunitarios en dichos pases
(OMSWAOPBD, 1999).

IMPACTO SOCIAL DE LOS TRASTORNOS GENTICOS

26

Este grupo de consultores recomend que los ministerios de Salud de los pases
en desarrollo distribuyan recursos para los programas de Gentica y establezcan una
oficina de servicios genticos dentro de su estructura administrativa, con el fin de
determinar la existencia de desrdenes genticos, defectos del nacimiento en la
poblacin y el estado de los programas existentes para su control. La investigacin
deber ser incentivada para proveer mejores datos de la predominancia y los tipos de
defectos del nacimiento, enfermedades genticas y predisposiciones a enfermedades
comunes a nivel nacional. Adicionalmente, debe considerarse la informacin acerca del
impacto que los desrdenes genticos y los defectos del nacimiento tienen en los
individuos, en su familia y en las comunidades. El currculo a nivel de pregrado debe
modernizarse y la Gentica debe incluirse en la formacin mdica. La educacin en este
aspecto debera comenzar en el colegio (OMSWAOPBD, 1999).
En nuestra consulta de Gentica Peditrica se han evaluado 3584 personas con
problemas genticos y cromosmicos. Las 1924 alteraciones cromosmicas halladas
forman parte del Registro Nacional Colaborativo de Alteraciones y Variantes
Cromosmica Humanas (RNCAVCH) (Paz-y-Mio, 1993a), mientras que 513
alteraciones monognicas, polignicas o multifactoriales, divididas en los diferentes
tipos de herencia, se las recoge en la Tabla II.6:
Tabla II.6. Alteraciones genticas, cromosmicas y multifactoriales
Tipo de alteracin en consulta gentica
Alteraciones cromosmicas
Enfermedades autosmicas dominantes
Enfermedades autosmicas recesivas
Enfermedades ligadas al sexo
Enfermedades multifactoriales o polignicas
Enfermedades de origen ambiental
Total

No. personas estudiadas


1924
393
395
191
583
98
3584

A continuacin se detallan 1302 casos de sndromes y alteraciones


cromosmicas hallados en la consulta gentica por nuestro equipo de genetistas (Paz-yMio, 1993a). Del total de casos analizados en la consulta gentica, 524
correspondieron a cromosomopatas, 22 presentaron estatura pequea sin displasia
esqueltica, 23 con estatura moderadamente corta, 3 presentaron crecimiento acelerado
con defectos asociados, 27 con cerebro inusual y hallazgos neuromusculares con
defectos asociados, 69 presentaron defectos faciales con componente mayor, 11
tuvieron afeccin facial y de miembros como componente mayor, 19 tuvieron
alteraciones de miembros como componente mayor, 16 se hallaron con
osteocondrodisplasias, 7 con craniosinostosis, 22 presentaron enfermedades de depsito,
12 tuvieron alteraciones del tejido conectivo, 16 estuvieron con hamartosis, 5 con
displasias ectodrmicas, 17 presentaron alteraciones debido a agentes ambientales, 35
presentaron sndromes miscelneos, 6 tuvieron alteraciones generales, 216 con
anormalidades varias, 250 pacientes presentaron dismorfas y polimalformaciones no
tipificadas y 2 con sndromes miscelneos.
La agrupacin sindrmica se ha conformado con base en las investigaciones de
Smith (Smith, 1984) (Tabla II.7).

Tabla II.7. Alteracin monognica, polignica, multifactorial y cromosmica


Alteraciones genticas
Cromosomopatas
Trisomas (todos los tipos)
Alteraciones estructurales
Monosomas
X frgil o sndrome de Martin Bell
Triple X
Otras alteraciones
Estructura pequea sin displasia esqueltica
S. Cornelia de Lange
S. Rubinstein-Taybi
S. Russel-Silver
S. Dubowitz
S. Bloom
S. Johanson-Bizzard
S. Seckel
Estructura moderadamente corta, facial +/- genital
S. Smith-Limli-Optiz
S. Williams
S. Noonan

Casos
402
17
87
6
4
8
12
2
2
1
1
1
3

Alteraciones genticas
Defectos faciales como componente mayor
S. Blefarofimosis
S. Pierre Robin
S. Blefarofimosis
S. Pierre Robin
Fisura labio-palatina
Fisura palatina
Displasia frontonasal
Sndromes de primer arco Treacher Collins
Afeccin facial y de miembros como componente mayor
S. Oto-palato-digital
S. Trico-rino-falange
S. Oculo-rino-falange
Displasia ectodrmica
S. Roberts
S. Townes

Crecimiento acelerado con defectos asociados


S. Sotos
S. Beckwith-Wiedemann

3 Alteraciones de miembros como componente mayor


2 S. Poland y cardio-digital
18
Craniosintostosis
S. Carpenter
2 S. Kleebattschdel
1 S. Crouzon

Cerebro inusual
S. Artrogriposis distal
S. Pena-Shokeir II
Hidrocefalia ligada al sexo
S. Prader Willi

4
3
10
10

Enfermedades de depsito
Gangliosidosis tipo 1
Mucolipidosis tipo II
Mucopolisacaridosis tipo II
Mucopolisacaridosis tipo IV

Casos
3
15
3
15
21
6
6

1
3
1
1
3
2
19
1
1
5
1
7
9
5

Tabla II.7. Alteracin monognica, polignica, multifactorial y cromosmica (continuacin)


Alteraciones genticas
Osteocondrodisplasias
Displasia tanatofrica
Displasia torxica asfixiante
Acondroplasia
Displasia metatrfica
Ellis-Van Creveld
Hipofosfatemia

Casos

Alteraciones genticas
2
1
9
2
1
1

Alteraciones del tejido conectivo

S. Marfan y Elhers-Danlons

Holoprocencefalia
Mielomeningocele
S. Klippel-Feil
Onfalocele
Vater y Charge

9
9
4
7
4

Alteraciones generales
Ruptura de amnios (S. bridas amniticas)
S. Facio-aurculo-ventral y alteracin facial-miembro

4
2

12

Hamartosis
Sturge Weber
Esclerosis tuberosa
Neurofibromatosis
S. Peutz-Jeghers

1
4
9
2

Displasias ectodrmicas
Displasia ectodrmica hipohidrtica

Agentes ambientales
S. rubeola congnita
S. toxoplasmosis congnita
S. alcoholismo fetal
S. sfilis congnita

5
6
5
1

Sndromes miscelneos
S. Laurence-moon-bield
S. cerebro-costo-mandibular
(S.) Sndromes

Casos

Anormalidades varias
Indiferenciacin sexual (genitales ambiguos)
Microsoma hemifacial
Anencefalia, microcefalia y macrocefalia
Microtia
Retinoblastoma
Fibrosis qustica del pncreas
Metabolopatas (no tipificadas)
Distrofias musculares
S. Norrie, Saethre-Chotzen y Fraser
Atrofia muscular infantil (Werdning-Hoffmann)
Ataxia de Friederich
Retinitis pigmentosa
Freman Sheldon
Polidactilia postaxial

Dismorfas y polimarlformaciones no tipificadas


1 Polimalformados, dismorfas y retardo mental
1

60
6
17
20
20
20
30
17
4
2
6
4
1
9

TOTAL

250
1302

Captulo III
Conceptos bsicos de la Gentica Molecular
Desde el descubrimiento de la clula por Hooke, en 1666, el desarrollo cientfico
en muchas reas no ha tenido la celeridad deseada. El caso de la Gentica es especial.
En sus primeros momentos tuvo un avance lento, pero actualmente la avalancha de
datos es tan espectacular, que no existe rea alguna de la Biomedicina, en la que los
conceptos y conocimientos de esta ciencia dejen de influir. Se la considera la ciencia del
siglo XXI, pero por lo poco conocida crea muchos recelos y dudas en los no entendidos,
lo cual determina una interesante discusin biotica e ideolgica (Borgaonkar, 1987).
La actividad de la Gentica se ubica en al menos tres reas claras: gentica
cualitativa o herencia discontinua, caracterizada porque el efecto individual de los genes
es discernible (todo o nada), los caracteres son de clase (se manifiestan o no), las
variantes fenotpicas son discretas entre los individuos afectados y, sobre todo, se
conocen los patrones hereditarios y su comportamiento matemtico preciso (herencia
autosmica dominante, recesiva o ligada al sexo) (Baraitser & Winter, 1983). La
Gentica cuantitativa o herencia continua presenta caractersticas que coordinadamente
permiten identificar el patrn hereditario polignico o tambin llamado multifactorial;
aqu el efecto de los genes individualizados no es discernible pues existe un
enmascaramiento ambiental y se habla de un efecto sumatorio de genes, con un efecto
umbral en la manifestacin o no del fenotipo. Los caracteres que producen estos
poligenes son de grado (desde alto, pasando por medio y llegando a bajo), es decir, que
la variacin fenotpica puede ser espectral. Los patrones hereditarios no son tpicos ni
matemticamente demostrables y ms bien se desprenden de la experiencia, y aun los
riesgos de recurrencia de las patologas son empricos. La ltima rea se enmarca en la
llamada herencia atpica o no mendeliana, en la cual se presentan transmisiones de los
caracteres en forma especial. Aqu se encuentra la impresin gnica, la herencia
mitocondrial y un fenmeno especial de inclusin o exclusin de genes aledaos a
genes principales, que constituyen los genes contiguos. El comprender uno u otro tipo
de herencia se fundamenta en el entendimiento del material de la herencia, el ADN, su
organizacin y funciones (Ayala & Kiger, 1984).
En el proceso de comprensin del ADN y sus complicadas funciones,
transcurren 199 aos desde que Hooke descubre la clula y Mendel describe las leyes de
la herencia, y slo 45 aos ms para que Tschemark, De Vries y Correns redescubran
dichas leyes y se reconozca su revolucionario significado. En adelante, la descripcin de
enfermedades genticas y sus patrones hereditarios cobraron importancia (Egozcue et
al., 1987).
Hacia 1953, Watson, Crick y Wilkins postularon la estructura en doble cadena
del material hereditario (ADN), donde se almacena la informacin gentica. A inicios
de la dcada de los setenta se conocan los fundamentos de la Gentica Molecular de
procariontes, en especial de la Escherichia coli y del fago lambda. La secuencia de
bases en el ADN de estos microorganismos es colineal y casi la totalidad codifica para
protenas. El ADN de los distintos organismos vara en su cantidad y tamao, y
normalmente es mayor mientras ms alta es la escala evolutiva. El ADN humano
contiene aproximadamente 3 x 109 pares de bases (pb) y se estima que existen unos

CONCEPTOS BSICOS DE LA GENTICA MOLECULAR

32

23000 genes de tamaos diversos entre 1000 y 200000 pb nitrogenadas (Krebs et al.,
2009).
Adicionalmente, la posibilidad de variacin de la informacin gentica humana
es extremadamente amplia; no existen individuos iguales y ni siquiera los posibles
clones son exactamente iguales. La mezcla de 23 cromosomas de origen paterno y 23
maternos durante la fecundacin, asegura una variabilidad de 2 x 1023; ms an, la
variabilidad aumenta si se considera que los 46 cromosomas humanos contienen veinte
mil millones de bits de informacin; es decir, unos cuatro mil volmenes de quinientas
pginas, lo que equivaldra a unas quinientas millones de palabras; de ah que la
informacin gentica del hombre sea asombrosamente enorme. Pero esta aparente y
gran variacin de la informacin hereditaria no es muy real, ms bien tiende a
mantenerse estable en toda la especie y los cambios (mutaciones genticas) se presentan
en proporciones muy bajas (1 x 10-8), y cuando aparecen, se producen enfermedades
genticas (8000 conocidas). Entre los seres humanos existen pequeas variaciones que
provienen de diferencias en su material de la herencia, llamadas polimorfismos
genticos, pero que no atentan contra la uniformidad e igualdad de la especie y que han
ayudado a comprender algunos fenmenos humanos interesantes, como riesgos de
predisposicin, resistencia y desarrollo de enfermedades. Los datos del genoma humano
dan cuenta de que la informacin gentica es parecida en poblacin caucasoide,
negroide, asitica e hispana. Esta informacin difiere en algo menos al 1% y con
seguridad ello se debe a polimorfismos que posiblemente determinan las diferencias
intertnicas. Recordemos que los polimorfismos genticos se presentan por variacin en
la ltima base nitrogenada de los nucletidos del cdigo gentico o por repeticiones de
nucletidos, las cuales pueden ser evaluadas a travs de estudios moleculares del ADN
(Krebs et al., 2009).
El 90% del ADN est concentrado en el ncleo, el resto corresponde al ADN
mitocondrial. El ADN nuclear es una doble cadena de desoxirribosa, fsforo y bases
nitrogenadas, purinas (adenina, guanina) y pirimidinas (citosina, timina), apareadas en
forma de escalera (A-T y G-C), con una orientacin elctrica antiparalela 5-3 y 3-5
originada en los enlaces de los carbonos de la desoxirribosa con el fsforo. La unin AT es de dos enlaces qumicos, mientras que la unin C-G es de tres, lo que confiere al
ADN diferentes propiedades citogenticas. Se conoce que la eucromatina es funcional y
rica en C-G, adems, sus triples enlaces dificultan la entrada de colorantes, por lo que
no se tie, en cambio la heterocromatina es no funcional, rica en A-T y se colorea. Esta
generalizacin es aplicable a los cromosomas metafsicos bandeados, en los cuales las
bandas claras o reversas (R) sern eucromatina rica en genes activos y las bandas
obscuras (G o Q) heterocromatina rica en genes inactivos (Alberts et al., 2002). La
estructura del ADN se detalla en la Figura III.1.

1.ENROLLAMIENTODELADN
El ADN es una molcula tridimensional en la cual los nucletidos (base-fsforoazcar), dispuestos a manera de escalera, se autoenrollan sobre s mismos en forma
antiparalela. Esta descripcin corresponde a la forma B que tiene 10 pb por vuelta.
Existen algunas alomorfas dextrgiras y levgiras de ADN, sean in vitro o in vivo. La
forma Z es sper enrollada, presenta 12 pb por vuelta y tiene un giro hacia la izquierda.
La forma relajada es la A y tiene 11 pb por vuelta. Al parecer, las formas espaciales,

CONCEPTOS BSICOS DE LA GENTICA MOLECULAR

33

tienen que ver con el estado de funcin del mismo, as: si la porcin sper relajada
replica sus zonas aledaas, se presentan sper enrolladas; adems, la conformacin del
ADN en Z lo protege. Se ha descrito una conformacin especial en triple cadena o pares
de Hoogsteen (H-ADN), formada por polipirimidinas y polipurinas. Esta estructuracin
poco estudiada se la encuentra in vivo, en momentos en que la replicacin del ADN est
bloqueada (Lodish et al., 2008).

FIGURA III.1. ESTRUCTURA DEL ADN. Material gentico conformado por un grupo
fosfato, un azcar y una base nitrogenada (Modificado de Lodish et al., 2008; IIB,
2014).

2.TIPOSDEADNPRESENTESENELGENOMAHUMANO

El ADN est constituido por secuencias, que luego de ser desnaturalizadas al


calor y renaturalizadas, presentan diferente velocidad de reasociacin. Mientras ms
compleja la secuencia menor velocidad; as, las secuencias ricas en adenina y timina
renaturalizan ms rpidamente que las ricas en guanina y citosina. La reasociacin se
observa que es muy lenta en secuencias grandes y con una sola representacin, mientras
otras secuencias se reasocian muy rpido por tener fracciones cortas, pero repetidas
muchas veces en el genoma.
De acuerdo con esto, el ADN se clasifica en:

CONCEPTOS BSICOS DE LA GENTICA MOLECULAR

34

2.1.ADNdesecuenciasnicas
El 30-50% del total de ADN codifica protenas estructurales y est presente una
sola vez en todo el genoma, mientras que el 10% lo constituyen los genes estructurales y
el ADN espaciador intergnico.
2.2.ADNdesecuenciasrepetidas
Formado por duplicacin de genes en la evolucin y se subclasifica en:
2.2.1.ADNdesecuenciasmoderadamenterepetitivas
Integra del 24 al 40% del genoma. Encargado de formar, en grandes cantidades
de productos como ADN ribosmico (ADNr), ADN de transferencia (ADNt), ADN
para protenas histonas (ADNh), y ADN para produccin de anticuerpos (ADNa). Estas
secuencias estn presentes entre 10 a 300000 copias en el genoma y pueden estar
dispersas o agrupadas.
El ADN moderadamente repetitivo lo constituyen tambin secuencias dispersas
en el genoma, que pueden variar de una generacin a otra y muchos de estos no
transcriben y si lo hacen es para producir sustancias tiles para su propia movilidad;
entre stos estn:
2.2.1.1.Retrotransposones
Las secuencias repetidas dispersas largas (LINEs) entre 10 mil y 50 mil copias
de 1 a 3 Mb, pueden producir enfermedades humanas por integrarse en algn gen.
Retrotransposones, como las secuencias repetidas dispersas cortas (SINEs), presentan
de 70 a 300 pb repetidas hasta unas 100 mil veces. La familia Alu proporciona un buen
ejemplo; constituye el 3% del genoma y consiste en un grupo de 300 pb repetidas unas
300 mil veces a lo largo del genoma; su funcin ha sido relacionada con la produccin
de protenas de membrana.
2.2.1.2.Transposones
En eucariontes, incluido el hombre, se ha descrito los transposones tipo I y II.
Los de tipo I son similares a retrovirus pero no encapsulan y no tienen una fase de vida
extracelular. Tambin se encuentran genes que producen retrotranscriptasa y difieren de
los retrovirus, por lo que se los llama no retrovirales. Los tipo II, codifican de ADN a
ADN con repeticiones inversas en los extremos del gen; se presentan en especies
diferentes a la humana.
2.2.1.3.ADNtelomrico
Ubicado en los telmeros de los cromosomas, est formado por secuencias en
tndem de 6 a 10 pb con 250 a 2000 repeticiones. Puede disminuir con la edad de la
clula. Los telmeros confieren estabilidad a los cromosomas, protegindolos de
fusiones y degradaciones. Se ha observado que algunos procesos malignos presentan
asociaciones telomricas, lo que significa una mayor inestabilidad del genoma

CONCEPTOS BSICOS DE LA GENTICA MOLECULAR

35

cancergeno. El estudio de los telmeros o de las secuencias telomricas podra servir


para evaluar riesgos de desarrollo, progresin o comportamiento del cncer.
2.2.1.4.ADNminisatlite
Son secuencias cortas de 9 a 64 pb, ricas en G-C repetidas en tndem (una tras
otra) entre 0,1 a 20 Kb (al menos cuatro copias); estn dispersas por todo el genoma.
Son de gran inters, ya que son repeticiones de gran variedad allica en los cromosomas
y presentan altas diferencias interindividuales, por lo que constituyen regiones
hipervariables, posiblemente involucradas en recombinaciones. Su utilidad radica en su
alta especificidad para identificacin humana.
2.2.2.ADNdesecuenciasaltamenterepetidas
Comprende el 10% del genoma y est formado por secuencias que no se
transcriben, pudiendo repetirse cientos, miles o millones de veces. Las repeticiones
presentan 4 a 8 pb, una a continuacin de otra en tndem. Son frecuentes tanto en los
cromosomas 1, 9, 16 e Y, como en los centrmeros y telmeros; se les conoce tambin
como ADN satlite, que se localizan en lugares concretos del genoma, y as forman los
centrmeros de los cromosomas y ADN espaciador rico en G y C.

3.HLICEGCUDRUPLEDELADN
En enero del 2013, Shakar Balasubramanian del Departamento de Qumica y
Giulia Biffi del Cancer Research UK, ambos de la Universidad de Cambridge,
publicaron una investigacin en Nature Chemistry, relacionada al descubrimiento de
una estructura G-cudruple del ADN en clulas humanas. Se logr comprobar la
existencia de una estructura G-cudruple en clulas cancergenas de la especie humana.
La estructura G-cudruple del ADN est conformada por dos o ms G-tetraedros que se
forman cuando cuatro guaninas se conectan mediante los enlaces de hidrgeno
denominados enlaces Hoogsteen (Figura III.2). Esta estructura se asocia con aspectos
importantes de la funcin del genoma. Los anlisis computacionales comprueban la
presencia de patrones de estructura cudruple en regiones reguladoras importantes del
genoma humano como son los promotores, genes y regiones no codificantes. A nivel
cromosmico, la estructura G-cudruple puede estar envuelta en mantener la estabilidad
cromosmica debido a que se la ha ubicado en las regiones telomricas. En este estudio
se diseo un anticuerpo especfico (BG4) que se enlaza a la estructura G-cudruple del
ADN genmico de las clulas humanas con alta sensibilidad y baja afinidad nanomolar.
Adems, se caracteriz la relacin entre la fase S del ciclo celular y la formacin de
estructuras cudruples (Biffi et al., 2013).
La importancia de este estudio, adems de comprobar visualmente la presencia
de estas estructuras en el ADN de clulas humanas, es la de generar ligandos
teraputicos que controlen la formacin de las estructuras G-cudruples y as controlar
de raz la posible replicacin de clulas cancergenas. Las clulas cancergenas con
hlice cudruple en su ADN pueden estar presentes cuando la clula tiene cierto
genotipo o estado disfuncional, y el atacarlas con molculas sintticas podra ser una va
interesante de tratar de forma selectiva este tipo de clulas con alto potencial daino. Es

CONCEPTOS BSICOS DE LA GENTICA MOLECULAR

36

por ello que las empresas farmacuticas deben llevar estas molculas a sus metas de
investigacin y as desarrollar objetivos teraputicamente viables (Biffi et al., 2013).

FIGURA III.2. ESTRUCTURA G-CUDRUPLE DEL ADN. Complementaridad de


guaninas en las clulas cancergenas humanas y su catin monovalente M+ (Ej: Sodio,
potasio) (Modificado de Biffi et al., 2013; IIB, 2014).

Captulo IV
Poblacin de riesgo gentico

En toda poblacin humana existe una determinada frecuencia de enfermedades


genticas y cromosmicas. Por ejemplo, la hemofilia tiene una frecuencia mundial de
1/2500 nacidos vivos (nv), el sndrome de Down de 1/650 nv, el sndrome de Martin
Bell o X frgil de 1,8/1000 varones con retraso mental. Esta frecuencia de afectos en las
poblaciones de recin nacidos est ms o menos establecida para cada regin. En las
regiones donde no existen datos, se maneja la llamada frecuencia esperada de la
enfermedad, es decir los datos empricos extrados del nmero de enfermos espontneos
o espordicos afectos de una patologa en una poblacin especfica (OMIM, 2013). Los
casos espordicos que se presentan, se considera que se deben a mutaciones espontneas
o neomutaciones. Una de las explicaciones biofsicas sobre este tipo de mutaciones
podra resumirse en el efecto mun o mesn mu, segn el cual se produce una mutacin
cuando partculas csmicas de radiacin que se desplazan a velocidades vertiginosas y
que estn sometidas al efecto fsico de la relatividad, especficamente a la dilatacin del
tiempo, chocan con las molculas del ADN producindole una alteracin. La radiacin
csmica en calidad de protones choca con el aire de la atmsfera formndose los
mesones piones o mesones pi, que luego se desintegrarn en mesones mu, que son los
que alcanzan la superficie de la tierra y afectan a las especies, influenciando en su
evolucin y en el aparecimiento de patologas a travs de los cambios que provocaran
en el ADN (Bernstein, 2011).

1.MUTACIONES
Son cambios del material gentico heredable, no debido a segregacin o
recombinacin gentica. Estas pueden ser:
1.1.Mutacinsomtica
Afecta a todo el soma individual, no se trasmite por herencia, se produce en
etapas postcigticas y da como resultado mosaicismos y quimeras.
1.2.Mutacingerminal
Afecta a los gametos y se transmite a la descendencia, causando las
enfermedades genticas o cromosmicas.

2.NIVELESDEPRESENCIADEMUTACIONES
Las mutaciones pueden afectar a los niveles genmico, cromosmico y gentico.
2.1.Mutacingenmica
Mutacin de todo el genoma o juego cromosmico completo, sea en conjunto
provocando una duplicacin completa de todo el ADN (poliploida 2n + n 2n + 2n), o

POBLACIN DE RIESGO GENTICO

40

afectando el material gentico concentrado en un cromosoma, produciendo ganancias o


prdidas de cromosomas individuales (aneuploida).
2.2.Mutacincromosmica
Afectacin de un segmento cromosmico con implicacin de ms de un gen; dan
como resultado alteraciones estructurales (trisomas o monosomas parciales,
duplicaciones, deleciones, translocaciones).
2.3.Mutacingentica
Afecta a un gen o una parte del mismo, provocando cambios en su producto
final. Las mutaciones genticas son la base de muchas enfermedades humanas.
Mutaciones de un solo gen han sido descritas aproximadamente en ocho mil
enfermedades. De estas, en tres mil se conoce la posicin del gen en el genoma y slo
de mil se tiene diagnstico. Las mutaciones de un solo gen se producen por deleciones,
duplicaciones, transposiciones, inserciones, etc., pero el resultado final de la mutacin
se la puede resumir en cuatro manifestaciones:
2.3.1.Mutacionessinsentido
Es aquella en que se produce un codn de parada y el producto termina
abruptamente. Conocida tambin como mutacin nonsense.
2.3.2.Mutacinporprdidadelsentido
Es en la que se produce el cambio de un aminocido por otro, en muchos casos
el producto existe, aunque es defectuoso, por ejemplo en las hemoglobinopatas.
Conocida tambin como mutacin missense.
2.3.3.Mutacinporcorrimientodelalectura
Desaparece el codn de parada del gen o este es desplazado por repeticiones de
secciones, por lo que se producen productos extensos con o sin funcin alterada. Es
conocido tambin como mutacin frameshift.
2.3.4.Mutacinsilenciosa
Un mismo aminocido puede ser codificado por uno o varios codones, la
variacin en la tercera letra del codn y que no altera la lectura del aminocido, se
puede considerar una mutacin silenciosa. Muchos genes o secuencias genticas tienen
cambios de un solo nucletido sin alterar la esencia del gen, tambin estos cambios se
los llama variantes o polimorfismos genticos. Aunque por mucho tiempo no se los ha
considerado alteraciones propiamente dichas, en la actualidad existe evidencia de que
estos cambios estaran asociados al desarrollo de enfermedades, como el cncer en
particular, o al comportamiento o evolucin de una enfermedad ya instaurada. Los
polimorfismos de un solo nucletido o SNPs, tambin son la base de la evolucin
humana y de las variantes genotpicas y fenotpicas que manifiestan las poblaciones
(Nussbaum et al., 2008).

POBLACIN DE RIESGO GENTICO

41

En general, existen agentes fsicos, qumicos y biolgicos que producen


alteraciones del ADN, denominados clastgenos. Los clastgenos ms importantes son
los agentes qumicos producto de sustancias mdicas, aditivos o derivados alimenticios,
pesticidas, productos fotodinmicos, metales y solventes inorgnicos, que se encuentran
ampliamente distribuidos en el ambiente. Segn los informes de la Comisin
Internacional para la Proteccin Contra Mutgenos y Cancergenos Ambientales,
existen unos 946 elementos qumicos que han sido estudiados en laboratorios de
gentica y, tras su evaluacin, se ha comprobado que son agentes clastgenos
(ICPEMC, 2005).
Los agentes clastgenos inducen varios tipos de alteraciones genticas y
cromosmicas: activacin de oncogenes, prdida de antioncogenes, espaciamiento de
las cromtides, roturas cromosmicas, figuras, intercambio de cromtides hermanas y
asociaciones cromosmicas, entre las ms importantes. Los agentes clastgenos que
producen daos inespecficos del ADN se denominan genotxicos, otro tipo de agentes
que provocan un cambio claro en el material gentico, en muchos casos especficos, se
los denomina mutagnicos y dentro de estos estn los carcingenos. Los agentes
clastgenos pueden tener una actividad aguda con efectos graves (intoxicaciones o
muerte); pueden actuar lentamente produciendo su accin por exposicin crnica
persistente (enfermedades degenerativas); o, finalmente se manifiestan desencadenando
problemas malformativos o genticos; se los llama teratgenos, cuando su exposicin es
en dosis bajas, sea por cortos o largos perodos.
Adems de la gran cantidad de agentes qumicos con efecto genotxico o
mutagnico, como son los desechos industriales, materiales de uso cotidiano para la
construccin (asbesto, plomo, pegamentos, entre otros), hidrocarburos (gasolina, pegas,
cosmticos), alimentos enlatados, fertilizantes, pesticidas, insecticidas, frmacos, entre
otros, existen igualmente agentes fsicos genotxicos y mutagnicos como los rayos
ultravioleta, la radiacin ionizante y los rayos X, o los flujos electromagnticos y el
aumento de la temperatura de la bisfera. As mismo, se han detectado algunos agentes
biolgicos implicados en genotoxicidad y mutagnesis (virus, parsitos intracelulares,
entre otros) (Paz-y-Mio et al., 2008a; Paz-y-Mio & Lpez-Corts, 2011; Henkler &
Luch, 2011).

3.TERATGENOS
En uno u otro sentido, en los acpites anteriores se ha tratado sobre los procesos
que aumentan la frecuencia de mutaciones espontneas. Interesa revisar las mutaciones
inducidas, como causa de malformaciones y fenocopias o subnormalidad. Existen cuatro
categoras de teratgenos o factores de mutaciones inducidas:

a)

Fsicos.

b)

Biolgicos.

c)

Qumicos, frmacos y drogas.

d)

Ecolgico, intrauterino y materno.

POBLACIN DE RIESGO GENTICO

42

Los factores teratgenos que producen fenocopias o sndromes similares a los


genticos o cromosmicos, pueden producir su efecto morfogentico por cuatro
fenmenos:

a)

Muerte celular.

b)

Falla del crecimiento celular.

c)

Falla en la migracin celular.

d)

Errores en la diferenciacin celular.

Un factor es teratgeno o inductor de mutaciones si produce:

a)

Infertilidad o prdida fetal.

b)

Desarrollo prenatal deficiente.

c)

Alteracin de la morfognesis.

d)

Alteracin del desarrollo y conformacin del sistema nervioso.

e)

Carcinognesis.

Para que un factor produzca teratogenicidad o induzca una mutacin, debe actuar
con ciertas caractersticas: considerable dosis y tiempo de exposicin, susceptibilidad
individual e interaccin con otros agentes. A continuacin se revisarn los principales
teratgenos:
3.1.Teratgenosfsicos
Existen varios teratgenos fsicos como la radiacin, el calor trmico y los
efectos mecnicos por compresin o presin.
3.1.1.Radiacionesionizantes

Producirn efecto dependiendo de la influencia directa o no sobre los genes,


cromosomas o procesos fisiolgicos. Se ha visto que las radiaciones naturales solo
incrementan la razn normal de mutacin, mientras que las artificiales pueden tener
efecto directo en la clula, segn la dosis sea aguda o acumulada. En los individuos que
trabajan con rayos X o estn expuestos a ellos, no se ha visto un cambio celular
importante cuando estn bien controlados y protegidos. Dosis altas de radiacin
producirn efecto solo s "impactan certeramente" en un punto de mutacin (gen o
cromosoma caliente).
A nivel gnico, una unidad de radin (Rad) aumenta la constante de mutacin
por gameto en 10-8, y se elevan en 0,7% las alteraciones autosmicas dominantes, en
0,25 las autosmicas recesivas y en 0,05 las recesivas ligadas al sexo. A nivel
citogentico se pueden producir aglutinaciones cromosmicas en mitosis, roturas,
deleciones o fusiones, sea en una cromtide o en todo el cromosoma. La misma dosis (1

POBLACIN DE RIESGO GENTICO

43

Rad) aumenta en 5% las translocaciones desbalanceadas, y en 0,6% las trisomas y la


monosoma del X (sndrome de Turner). Por ltimo, a nivel fisiolgico, se alteran
procesos enzimticos, migraciones celulares y puede ocurrir muerte celular, dando
como resultado malformaciones (Muoz et al., 2008).
Pese a los datos acumulados sobre los efectos mutantes de las radiaciones, estos
han sido obtenidos, en su mayora, de hechos accidentales o violentos en los que la
poblacin humana ha sido expuesta a la radiacin o, en su defecto, los efectos han sido
estudiados en animales o cultivos celulares y extrapolados al hombre. Los datos ms
confiables han sido extrados de sobrevivientes de las bombas atmicas en Japn,
durante la Segunda Guerra Mundial; se vio entonces que toda mujer con embarazo
menor a las 15 semanas y que recibi una dosis de radiacin de 0,8 Gy (Gray), tuvo
hijos con microcefalia y retardo mental; un pequeo porcentaje de los embarazos
presentaron leves malformaciones cuando la dosis vari entre 0,01 y 0,1 Gy; con una
dosis inferior a 0,01 Gy, ningn embarazo present anomalas. Desde el punto de vista
mdico, el efecto patognico de las radiaciones sobre la descendencia ha sido
cuestionado. Un estudio de 2000 mujeres embarazadas que han recibido radiaciones
demuestran que con una dosis inferior a 0,01 Gy (Gray), promedio de 12 radiografas de
diferentes regiones del cuerpo, el ndice de malformaciones no subi significativamente
en comparacin con el de la poblacin general (de 0,1 a 0,6 veces ms). Por esto, el
manejo del asesoramiento gentico frente a una exposicin a radiacin durante el
embarazo, tiende en la actualidad a restar importancia a este factor como teratgeno. De
todas maneras, muchos autores sostienen, con buenos criterios, que es preferible evitar
las radiaciones al mximo posible durante el embarazo y an ms entre 8 a 12 semanas
previas a la concepcin, ya que las radiaciones afectaran a las clulas en las ltimas
fases de la meiosis o mitosis, especialmente a las clulas "madres". El efecto
acumulativo de las radiaciones produce: teratogenicidad, mutagnesis y carcinognesis
(Daz-Valecillos et al., 2004; Muoz et al., 2008).
3.1.2.Radiacionesnoionizantes
Los rayos ultravioleta producen alteraciones en plantas, granos y cultivos
celulares in vitro. Por su bajo poder de penetracin in vivo, en el hombre no se han
comprobado efectos mutantes teratgenos; s, en cambio, a nivel somtico, en el que se
los relaciona con la etiologa del cncer de piel (Everall & Dowd, 1978).
3.1.3.Otrosteratgenosfsicos
El calor trmico de saunas, as como el aumento de temperatura gonadal
masculina por el uso de prendas interiores apretadas, han sido factores implicados en la
etiologa de fiebre neonatal idioptica, defectos de cierre del tubo neural y mayor riesgo
mutagnico en los gametos.
Otros factores fsicos son los efectos mecnicos que producen, por compresin o
presin, deformaciones o malformaciones ms o menos graves, de acuerdo a la zona
corporal comprometida. Ejemplos importantes son: los miomas uterinos maternos, el
sndrome de bridas amniticas o constricciones anulares, con una incidencia de 1/18000
nacidos vivos, que pueden producir graves alteraciones fetales como son las
amputaciones de miembros, deformaciones faciales, etc. Torpin ha postulado como
etiologa, la rotura traumtica del saco amnitico, con la consiguiente salida de parte del

POBLACIN DE RIESGO GENTICO

44

feto por la "ventana" amnitica y la posterior constriccin fetal a medida que crece el
tero gravdico y se tensa el amnios.
3.2.Teratgenosinfecciosos,frmacosydrogas
La posibilidad de que estos factores induzcan malformaciones depende de la
poca de exposicin en el perodo prenatal; los primeros tres meses de embarazo son las
fases ms crticas. Las posibles afecciones que se presentan, segn el estadio de
influencia de estos agentes, son: gametos (esterilidad); nidacin, gastrulacin hasta
embrin (muerte del producto); embrin (malformaciones mayores de cerebro, corazn,
ojos, extremidades, genitales y gnadas); tercer mes o ms (malformaciones menores);
feto maduro (alteraciones funcionales).
En relacin a los agentes infecciosos, la Tabla IV.1 hace meditar sobre ciertas
cuestiones, como son: la mayora de agentes producen prematuridad o aborto y
enfermedad congnita; el riesgo de que un agente infeccioso produzca afeccin
congnita grave es de alrededor del 10 al 25%, lo que significa, que no toda infeccin
durante el embarazo ser la causa de malformaciones; esto es importante tomar en
consideracin al momento del asesoramiento gentico. La decisin de informar a una
pareja sobre la probabilidad de tener un hijo con malformaciones por un problema
infeccioso ser muy meditada, analizando la situacin epidemiolgica del contagio.
A los qumicos responsables de mutagnesis o genotoxicidad, en general
(incluidos frmacos y drogas) se los clasifica en: qumicos del ambiente, drogas o
frmacos prescritos o no. Dentro de los ltimos existen tres categoras de productos que
son: teratgenos seguros, teratgenos potenciales y teratgenos dudosos.
Tabla IV.1. Efecto de algunos agentes biolgicos sobre el feto en el embarazo
Agente
Bacterias
Treponema
Tuberculosis
Micoplasma
Listeria
Parsitos
Toxoplasma
Trypanosoma
Virus
Rubeola
Citomegalovirus
Varicela Zoster
Herpes
Hepatitis
Viruela
VIH

PoA

RC

EC

PPN

Probabilidad de afeccin en
el 1er trimestre (%)

+
+
+
+

?
-

+
+
+

+
+
+
-

10

15-20 grave
25-65 2do trimestre leve

+
+
+
+
+

+
+
?
+

+
+
?
+

+
+
+
+
?
+
+

+
+
+
+
?
+
+

15-20
3-5
10

20-60

(P) Prematuridad; (A) Aborto; (RC) Retardo en el crecimiento; (M) Malformaciones; (EC) Enfermedad
congnita; (PPN) Persistencia post-natal.

En la prctica mdica es importante ubicar a qu tipo de agente nos enfrentamos,


para poder realizar un buen asesoramiento gentico. Los qumicos con accin

POBLACIN DE RIESGO GENTICO

45

teratognica pueden producir alteraciones por su efecto de accin retardada,


produciendo trastornos en el crecimiento celular, muerte celular y otras
dismorfognesis; muchos pueden producir desarreglos cromosmicos inespecficos, con
el consiguiente riesgo de segregacin mittica o meitica anormal, determinando
diversos sndromes cromosmicos. Entre estos estn: alquilantes, nitrogenados,
fosforados, pesticidas, aditivos alimenticios, cafena, nicotina, etc. Nuestra sociedad
manifiesta una alta tendencia al consumo de alcohol (alcoholismo social), lo que
representa un riesgo mayor de malformaciones en la descendencia (Tabla IV.2).

Tabla IV.2. Relacin entre la cantidad de alcohol consumida diariamente y la


posibilidad de manifestacin de embriopata alcohlica
Cantidad de alcohol mL/da
Riesgo de embriopata (%)

0
-

30
10

60
20

90
30

120
30 a 50

En la siguiente tabla se presentan algunas sustancias y frmacos con sus efectos


malformativos.
Tabla IV.3. Efectos de frmacos y qumicos administrados durante el embarazo
Frmacos
Alquilantes
Anticonvulsivantes
Ametopterina
Antagonistas cido flico
Andrgenos
Cefalotina
Clomifeno
Clorambucil
Cloranfenicol
Coumadin
Diurticos
Estreptomicina
Fenobarbital
Herona
Hexametonio
Hipoglucemiantes
Methimazole
Metotrexate
Morfina
Novobiocina
Progestgenos
Protiltiouracilo
Reserpina
Salicilatos (exceso)
Sulfamidas
Talidomida
Tetraciclinas
Tiacidas
Tabaco (nicotina)
Vacuna de la viruela
Vitamina K (exceso)
Warfarina
Yoduro potsico

Efecto
Malformaciones aparato urinario y esqueltico
Anomalas del desarrollo, malformaciones
Malformaciones o aborto
Anencefalia, palatosquisis
Masculinizacin
Test de Coombs directo positivo
Anomalas cromosmicas, malformaciones
Malformaciones, abortos
Sndrome del recin nacido gris
Muerte fetal, hemorragias
Desequilibrio electroltico
Lesin del nervio acstico
Hemorragia neonatal
Muerte neonatal, convulsiones
Ileo neonatal
Malformaciones varias
Bocio, retraso mental
Malformaciones congnitas
Muerte neonatal, convulsiones
Hiperbilirrubinemia
Masculinizacin
Bocio, retraso mental
Congestin nasal, depresin neonatal
Malformaciones del sistema nervioso
Quernctero
Focomelia, atresia esofgica
Problemas dentales, inhibicin crecimiento seo
Trombocitopenia
Bajo peso, muerte fetal o neonatal, prematuridad
Vacuna fetal
Hiperbilirrubinemia
Malformaciones esquelticas, atrofia tica
Bocio, retraso mental

(Dexeus et al., 1989)

Captulo V
Nociones sobre Gentica de Poblaciones
Si el fenotipo de los individuos est determinado por el genotipo, es correcto
afirmar que las variaciones genticas (polimorfismos genticos) de los individuos y de
las poblaciones humanas estn dadas por variaciones o cambios en su ADN. El humano
posee variabilidad gentica; tericamente, un individuo, al provenir de dos padres,
recibe el 50% de informacin gentica de cada uno de ellos a travs de los gametos, lo
que supone 223 x 223 posibilidades combinatorias solamente en su informacin
cromosmica, ms an si se considera la posibilidad combinatoria de 23000 genes. Esto
en realidad no ocurre y los individuos en las poblaciones tienden a mantener la
informacin gentica estable, determinndose que la probabilidad real de que ocurra un
cambio (mutacin) en el material gentico sea muy baja, dando como resultado una
variacin entre el ADN parental y del hijo, en el orden de 10 a 100 nucletidos, es decir
una probabilidad muy baja.
De lo expuesto se puede deducir que la Gentica de Poblaciones estudia la
distribucin y variacin de los genes (alelos) en las poblaciones, su frecuencia de
presentacin, su evolucin y sus mecanismos de cambio, concretndose a tres puntos
(Motulsky, 1991; Nussbaum et al., 2008):

a) Origen de la diversidad gentica.

b) Estructuramiento de la diversidad: Seleccin natural, migracin y deriva gnica.

c) Segregacin de la diversidad: Especiacin y evolucin.

1.LEYDEHARDYWEINBERG
La Gentica de Poblaciones puede ser estudiada por modelos matemticos o
anlisis de grupos humanos dispersos, endogmicos o familiares. Por cualquiera de
estos mtodos interesa estudiar la frecuencia de los genes (alelos) en las poblaciones. En
1908, Hardy y Weinberg enunciaron una ley de gentica de poblaciones que expresa lo
siguiente: En una poblacin grande con matrimonios al azar (panmixia) las frecuencias
genticas permanecen constantes de generacin en generacin, en ausencia de factores
que la alteren, tales como migracin, mutacin, seleccin, deriva gentica y flujo de
genes, entre otros. Las frecuencias fenotpicas, estn determinadas por las frecuencias
genotpicas.
Para las poblaciones humanas, esta ley no sera aplicable, ya que sabemos que
existen muchos factores que hacen desaparecer o mantienen los alelos a los que hace
referencia la ley. Se esperara que la distribucin de los genes sea matemtica, pero en
la prctica los genes pueden estar aislados o asociados; algunos se asocian con mayor
frecuencia que la esperada, presumindose que esta asociacin no es al azar, por lo que
debe haber uno o varios factores de presin que desequilibran la distribucin de genes.
Como los factores de desequilibrio podran alterar la comprensin lgica-matemtica de
la dinmica poblacional, se presume con fines prcticos que la poblacin humana es

NOCIONES SOBRE GENTICA DE POBLACIONES

50

panmxtica, lo que significa que cualquier genotipo existente tiene la misma


probabilidad de mezclarse al azar con otro cualquiera (Negrete et al., 1974; Fontdervila,
1978).
Si tomamos en cuenta un par de alelos A y a, los cuales aparecen en una
poblacin con una frecuencia A = p y a = q, y esta poblacin se encuentra en equilibrio,
la suma de las frecuencias de estos alelos ser la unidad, es decir p + q = 1, al igual que
la frecuencia de los genotipos, que se presentan por la combinacin de los alelos ser
tambin igual a 1; en otras palabras, la frecuencia de fenotipos posibles hallados en una
poblacin es la totalidad de sus genotipos posibles. Entonces, si tenemos dos alelos A
y a en un individuo y se mezcla con otro individuo A y a, la frecuencia fenotpica ser
(Nussbaum et al., 2008):

AA = Homocigoto dominante
AA + 2Aa + aa = 1

2Aa = Heterocigoto
aa = Homocigoto recesivo

Si reemplazamos con los valores de la frmula anterior p + q = 1, tendremos:

pp + 2pq + qq = 1

p2 = Homocigoto dominante

p2 + 2pq + q2 = 1

2pq = Heterocigoto

(p + q)2 = 1

q2 = Homocigoto recesivo

Si por ejemplo las frecuencias de un par de genes son p = 0,1 y q = 0,9, al


reemplazar en la frmula tendremos:
Tabla V.1. Frecuencias allicas y genotpicas
Frecuencias allicas
p
q
0,1
0,9
0,3
0,7
0,5
0,5
0,7
0,3
0,9
0,1

p2
0,01
0,09
0,25
0,49
0,81

Frecuencias genotpicas
2pq
0,18
0,42
0,50
0,42
0,18

q2
0,81
0,49
0,25
0,09
0,01

Si consideramos que en los datos anteriores el alelo p es normal y el q raro,


vemos que a medida que la frecuencia de p aumenta, la de q disminuye, llegando
siempre a existir ms genotipos normales que anormales, ms an, si sumamos la
frecuencia de los genotipos normales p y 2pq. En trminos generales los individuos
sanos son 2/3 de la poblacin (pp y 2pq) y los enfermos solo 1/3 (qq), anotando adems
que los heterocigotos tienden a ser el doble (2pq). La poblacin total de individuos (n),
ser el resultado de todos los tipos de genotipos, as:

n(p2) + n(2pq) + n(q2) = Poblacin total

NOCIONES SOBRE GENTICA DE POBLACIONES

51

De la frmula se puede desprender que, mantenindose el equilibrio de HardyWeinberg, los individuos heterocigotos siempre sern el doble, esto ocurre en la
poblacin humana normal, por lo que las uniones de individuos heterocigotos son
frecuentes. Se ha calculado que cada individuo tiene de 3 a 5 genes letales recesivos,
por esto, en los cruces de heterocigotos, las posibilidades de tener descendencia anormal
son bajas. En las poblaciones humanas las anormalidades se presentan en las cifras de
frecuencias e incidencias de las enfermedades, sea p2 para las enfermedades dominantes
o sea q2 para las recesivas.
1.1.ProcesosquealteranelequilibriodeHardyWeinberg

Procesos sistemticos

Procesos selectivos

1.1.1.Seleccin

Seleccin
Mutacin
Migracin
Deriva gnica
Consanguinidad

El equilibrio de Hardy-Weinberg est sujeto a fuerzas que lo hacen variar


alterando la informacin gentica; estas fuerzas son:
a)Estabilizadoras
Incrementan los individuos promedio, tendiendo a disminuir los extremos.
b)Orientadorasodireccionales
Incrementan los individuos de un grupo extremo al promedio.
c)Disruptivas
Incrementan los individuos extremos por igual, tendiendo a disminuir los
medios. Esta fuerza de presin para incrementar unos alelos u otros se llama seleccin.
En la seleccin actan dos mecanismos. Se dice que la adaptabilidad es una fuerza
positiva que incrementa genes aptos, mientras que la seleccin es su contraria porque
disminuye genes anormales.
1.1.2.Mutaciones
Otros fenmenos que intervienen en la variabilidad gentica son las mutaciones.
Estas pueden ser:
a)Mutacionesbeneficiosas
Se producen en baja frecuencia y, de ocurrir la seleccin, se mantendrn, por lo
que la capacidad reproductiva no se ve afectada, logrando que los individuos adquieran
una ventaja adaptativa para un determinado medio. El ejemplo de la variabilidad de las

NOCIONES SOBRE GENTICA DE POBLACIONES

52

hemoglobinas (Hb) aclara este punto, as: los alelos normales de la Hb en los individuos
adultos son AA, por una mutacin, uno de los alelos cambia al estado falciforme AS.
Los individuos AS son ms aptos para defenderse de la malaria producida por el
Plasmodium falciparum (este fenmeno se da porque los eritrocitos con Hb AS tienen
mayor resistencia de su membrana a la entrada del parsito). La malaria acta como una
presin selectiva que hace que los individuos AA desaparezcan y los AS sean ms
aptos. Por probabilidad de cruces (AS x AS), los individuos heterocigotos llegarn a ser
la mayora (deriva gnica), pero as mismo, como el alelo S no es normal, la seleccin
actuar en contra de los individuos SS que sern inviables; el gen normal entonces
siempre estar presente en la poblacin y tericamente volver a ser frecuente cuando la
presin de seleccin (malaria) desaparezca. La poblacin tender a mantenerse en
equilibrio (AA + 2AS + SS), 2/3 de individuos normales frente a 1/3 de anormales.
Otros marcadores genticos presentes en poblacin expuesta a la malaria y que
proporcionan alguna resistencia a la enfermedad son la deficiencia de glucosa-6-fosfato
deshidrogenasa (G6PDH) y la ausencia del grupo sanguneo Duffy (Fya-b-) (Koch et al.,
2002). En la Tabla V.2 se presentan algunos datos hallados en una poblacin negra
ecuatoriana, expuesta endmicamente a malaria.
Se discute actualmente si las mutaciones beneficiosas existen realmente en el
genoma humano. Los datos al respecto hablan a favor de que existen mutaciones
recientes (5 mil aos atrs) que habran ocurrido por presiones selectivas y adaptaciones
al ambiente. El caso del gen de tolerancia a la lactosa es un buen ejemplo. Normalmente
los mamferos, incluidos los humanos, dejan de producir lactasa, la enzima que degrada
la leche, al terminar la infancia. Se ha demostrado que el caso de los humanos es
especial. Durante el desarrollo de la humanidad y el aparecimiento de la agricultura, la
poca de abundancia era ventajosa evolutivamente, pero la escasez vena con un
problema biolgico concomitante. El punto es que para los primeros humanos dedicados
a la agricultura y ganadera, el almacenar leche o sus derivados les aseguraba una mejor
supervivencia, pero al mismo tiempo tenan el problema de que genticamente los
adultos eran intolerantes a la lactosa; una mutacin del gen produjo individuos
tolerantes a la lactosa, esto los hizo mejor adaptados, incluso se ha llegado a comprobar
que les proporcion una gran ventaja reproductiva, por lo tanto, el gen mutante
beneficioso se seleccion en las poblaciones de agricultores primitivos, esto podra
haber ocurrido en los ltimos 5 mil aos. Similares hallazgos se han hecho en otros
genes, que sobre todo proporcionaran resistencia a las enfermedades, tal es el caso del
gen CCR5 y la resistencia a la infeccin por VIH (Paz-y-Mio et al., 2005a).
b)Mutacionesnegativas
Cuando se producen, los individuos son por lo general inviables y el gen
anormal desaparece, ya que el individuo afecto no llega a reproducirse.
c)Mutacionessinsentidoaparente
Los padres portan genes letales que aparentemente no producen disfuncin
alguna en ellos, pero que en las generaciones siguientes y al azar, estos genes letales
pueden manifestarse como enfermedades, 2/3 de estos cambios desaparecen y 1/3
reaparecen. En este grupo de mutaciones se encuentran las enfermedades monognicas
con patrones mendelianos.

NOCIONES SOBRE GENTICA DE POBLACIONES

53

Existe un aspecto ms a considerar en el origen de las mutaciones. La


informacin gentica, en trminos generales, se mantiene estable de generacin en
generacin durante la sntesis de ADN y la divisin celular, pero existen ocasiones en
que se producen cambios espontneos o al azar de la informacin, pudiendo coadyuvar
en este fenmeno agentes fsicos, qumicos y biolgicos.
Tabla V.2. Frecuencias de algunos marcadores genticos en poblacin
ecuatoriana expuesta a malaria
Sistema
Duffy

Fenotipo
Fya+
Fya+b+
Fyb+
Fya-b-

15
14
5
131
165

AA
AS
SS

126
39
0
165

Total
HbS
Total
G6PD

No.

Gd +
Gd +/Gd -

127
18
20

p
0,100

Frecuencia allica
q

0,060
0,840
0,882
0,118
p
0,775

2pq

q
0,139

0,086

En un ambiente determinado, la seleccin natural juega un papel importante en


la seleccin de genes mejor adaptados, pero para esto, es indispensable que el
organismo tenga, en su carga gentica, las diferentes posibilidades combinatorias; esto
significa que el ambiente no cambia la informacin gentica, esta ya existe en el ADN,
el medio solamente la selecciona; esto se conoce como valor preadaptativo de la
mutacin. En muchos casos, los conocimientos actuales no pueden explicar en qu
momento se seleccionaron los genes o en qu momento se produjo una mutacin al azar
que determin un cambio del ADN. Lo que s se puede asegurar es que la poblacin
humana evoluciona y la naturaleza realiza pruebas biolgicas acierto-error, con lo que la
evolucin se podra definir como un fenmeno en el que determinados alelos de los
genes tienden a alcanzar frecuencias mayores que otros.
1.1.3.Migracinoflujodegenes
La introduccin o cambio de individuos de una poblacin a otra modifica las
frecuencias gnicas originales.
1.1.4.Derivagnica
Tericamente, una poblacin o un individuo tiene todo el juego de genes aptos
para cruzarse, pero durante la vida, ciertas clulas gonadales con sus genes se pierden
por no llegar a fecundar; la prdida de estas es al azar, es decir que, dependiendo del
tamao de la poblacin y de la frecuencia de entrecruzamientos (crossing over), se
pierden ciertos genes y se mantienen otros; esta forma de seleccin gentica se llama
deriva gnica o empobrecimiento gentico. La deriva gnica homogeniza los genes en la
poblacin; est favorecida por los cruces consanguneos o endogmicos y se ve

NOCIONES SOBRE GENTICA DE POBLACIONES

54

modificada por el entrecruzamiento gentico y las migraciones que promueven el flujo e


intercambio de genes.
1.1.5.Consanguinidad
Es el apareamiento de individuos relacionados entre s por sus antecesores, lo
que promueve el cruce entre alelos homlogos, es decir aumenta el nmero de
homocigotos. Si se considera que en cada nueva generacin el entrecruce de individuos
reduce a la mitad la proporcin de genes tendramos que:
Tabla V.3. Entrecruzamiento y proporcin de genes compartidos
Individuos
Yo
Hermano
Padres
Abuelos
Tos
Primos

Proporcin de genes compartidos


1/1
1/2
1/2
1/4
1/8
1/16

As, entre primos hermanos, la probabilidad de aparecimiento de un individuo


anormal por el cruce de alelos idnticos es 1/16 x 2 esto es igual a 1/32 posibilidades de
tener un hijo con genes comunes de los padres, que en trminos prcticos en gentica se
traduce en un 3% ms de riesgos malformativos, es decir un 1% ms que el riesgo de la
poblacin general. Durante el asesoramiento gentico a parejas consanguneas, la cifra
de 3% es la que se maneja para matrimonios sin antecedentes de problemas genticos,
los cuales podran cambiar esta proporcin.

Captulo VI
Patrones de la herencia
Para realizar un diagnstico adecuado en gentica, la accin bsica que se
necesita es realizar una historia clnica adecuada y rpidamente orientada a los
problemas genticos. En la consulta que se realiza en los casos presentados en este libro,
se utiliza a modo de gua la siguiente estrategia para llegar a los diagnsticos. No hay
que olvidar que el llegar a un diagnstico suele ser un proceso complicado en ocasiones
y requiere de exmenes complejos en algunos pacientes. Lo interesante es considerar al
diagnstico en s como un desafo cientfico, en el cual las evidencias que obtengamos
se convierten en una ayuda para resolver el problema que enfrentamos. Esta es
justamente la nueva metodologa en medicina basada en evidencias.
Muchos sndromes son relativamente raros y la Gentica es una gran ayuda
durante el diagnstico y el asesoramiento gentico de los individuos afectados y de su
familia. Es por esto la importancia de consultar al mdico genetista como una ayuda
para el manejo de pacientes con sndromes que presentan mltiples anomalas. Para dar
un asesoramiento gentico correcto es indispensable tener el diagnstico exacto
(siempre y cuando sea posible). La informacin que se proporcione debe ser clara y
concisa, y es aconsejable que se cuestione a la persona que est consultando sobre sus
conocimientos de gentica, lo cual facilitar la explicacin de la naturaleza de la
enfermedad (Ej. Entiende usted lo que es un cromosoma o un gen?), y tambin ayudar
a despejar cualquier tipo de sentimiento de culpa o angustia.
Durante la consulta gentica se debe evitar dar juicios de valor e influir en las
decisiones de los consultados. El objetivo es informar sobre el diagnstico y sus
implicaciones no solamente para el individuo (prognosis) sino tambin para la familia, y
que las personas sean conscientes del riesgo que implica tener otro hijo (riesgo
reproductivo), las diferentes alternativas de prevencin (como el diagnstico prenatal y
la deteccin de portadores) y el tratamiento de la enfermedad.
En la elaboracin de la historia gentica se debe realizar un rbol genealgico en
el que se incluya la mayor cantidad de informacin posible para demostrar cmo se ha
transmitido el trastorno a travs de la familia o para poder determinar si no hay
antecedentes de la enfermedad o alteracin. Un rbol genealgico preciso debe revelar
el tipo de herencia de la enfermedad gentica, su penetrancia y expresividad y,
posiblemente en qu miembro de la familia se origin el trastorno. Esto permitir
realizar clculos de la probabilidad de riesgo (Delgado et al., 2012). Es importante:

a)

Muertes de lactantes, nacidos muertos y abortos, ya que estas influyen en los riesgos de
recurrencia (Ej. La espina bfida tiene un mayor riesgo de defectos del tubo neural en los
siguientes hijos).

b)

Consanguinidad.

c) Trastornos previos de inters mdico.

d) Antecedentes obsttricos.
e)

Antecedentes de consumo de frmacos y drogas.

PATRONES DE LA HERENCIA

58

El interrogatorio debera ser bidireccional y dinmico, recabar informacin de


ambos lados de la familia, lo que puede revelar informacin til y evitar sentimientos de
culpabilidad.
Es importante poner cierto nfasis en encontrar cualquier anomala que pueda
tener un componente gentico o que pueda ser sugestiva de un sndrome o asociacin
relevante. En la siguiente tabla se detalla un tipo de anamnesis por aparatos para la
elaboracin de la historia gentica:
Tabla VI.1. Anamnesis por aparatos
Sistema / aparato
Cardiovascular
Respiratorio
Gastrointestinal
Genitourinario
Msculo esqueltico
Neurolgico

Detalles a indagar
Cardiopatas congnitas, hipertensin, hiperlipidemia, enfermedades
vasculares, cardiopata isqumica, ictus
Infecciones respiratorias recidivantes, asma, bronquitis
Atresia, fstulas, diarrea recidivante, estreimiento crnico
Genitales ambiguos, anomalas de la funcin renal
Caquexia o debilidad muscular
Alteraciones del desarrollo, audicin, visin

Un aspecto importante dentro del asesoramiento gentico es el relacionado con


la deteccin, tratamiento y prevencin del cncer. Este proceso frecuentemente se inicia
con el relato por parte del paciente de la historia del cncer en el mbito individual
como familiar, es decir los sntomas que le llevaron a sospechar de cncer, la forma en
la cual el diagnstico finalmente fue realizado, y el xito o el fracaso del tratamiento. El
propsito de obtener esta informacin es determinar la probabilidad de que el paciente
tenga un sndrome hereditario de cncer. Aunque la informacin ms relevante en
trminos de riesgo tiene que ver con la presencia de cncer entre parientes de primer y
segundo grado de consanguinidad, la historia gentica en cncer tpicamente se extiende
a tres o ms generaciones y frecuentemente incluyen parientes de tercer grado de
consanguinidad. Algunas estrategias generales para elaborar una historia de cncer son
las siguientes:

a)

Obtener la confirmacin del diagnstico del tumor.

b)

Incluir hallazgos catalogados como no malignos.

c)

Extender el rbol genealgico detallando en lo posible cada diagnstico del cncer.

d)

No descuidar a los parientes no afectados.

e)

Tomar en consideracin la exactitud del individuo al relatar la historia del cncer.

f)

Ayudar a los individuos a identificar estrategias para ampliar la historia.

g)

Utilizar la historia como una herramienta psicosocial.

Con esta pequea introduccin, nos centraremos en las caractersticas genticas


humanas que se transmiten de padres a hijos en varias modalidades hereditarias. Las
principales formas de trasmisin hereditaria tienen patrones mendelianos conocidos:
autosmicos dominantes, autosmicos recesivos y recesivos ligados al cromosoma X;
otros tipos de herencia mendeliana no son comunes, como la dominante ligada al X y la

PATRONES DE LA HERENCIA

59

ligada al Y. Otro tipo de herencia es la polignica, determinada por la interaccin de


varios genes. Adicionalmente, se presentan casos inusuales como la herencia por
impresin gnica, mitocondrial y un tipo especial de caractersticas que conforman los
sndromes de genes contiguos (Nussbaum et al., 2008).
En el caso de la Gentica Mdica, los pacientes no acuden a consulta con el
patrn de herencia definido; es labor del experto dilucidarlo. Para esto existen algunos
criterios que deberan tomarse en cuenta en cada tipo de herencia. El paso inicial ser
realizar una genealoga, para lo cual existen estndares. La genealoga conocida tambin
como patrn de pedigr, linaje genealgico o rbol gentico, es una lista de antepasados
o un registro familiar. Gracias a los trabajos realizados en conejos, ganado vacuno y
otros, se ha podido generalizar las leyes de la herencia para la especie humana, cuyos
estudios se dificultan por el reducido nmero de hijos, el largo perodo de gestacin, el
tiempo requerido para llegar a ser fecundables y, por supuesto, las lgicas limitaciones
bioticas. Por lo tanto, los genetistas humanos utilizan las historias familiares y el linaje,
para lograr establecer que muchos caracteres se heredan de padres a hijos siguiendo las
leyes de Mendel (Delgado et al., 2012).
Las caractersticas fenotpicas de un individuo proceden de la herencia de sus
genotipos aun cuando algunas veces la influencia del ambiente hace variar el fenotipo
esperado. Algunos rasgos humanos son determinados por genes dominantes, recesivos,
ligados al sexo, y otros. Los rasgos debido a genes dominantes, generalmente se
encuentran con mayor frecuencia que los que se deben a genes recesivos. Los datos
familiares se pueden resumir en un rbol gentico, que es un mtodo abreviado para
clasificarlos y facilitar su referencia.
Existen diagramas de pedigr que se usan frecuentemente en Gentica Humana
para el anlisis de la herencia mendeliana. Los smbolos que aparecen en la Figura VI.1
son los ms utilizados por los genetistas.
La observacin de las genealogas es uno de los mtodos principales del estudio
gentico en el hombre, puesto que en los seres humanos no es posible realizar
apareamientos diseados. Tambin es utilizada para deducir el modo de transmisin de
una enfermedad hereditaria o para realizar diagnsticos diferenciales ante afecciones
humanas parecidas.
Cuando se realizan genealogas humanas con el fin de determinar el origen
hereditario de una afeccin o carcter, se debe considerar cinco cuestiones que son de
difcil evaluacin y requieren un conocimiento profundo de la Gentica Humana, sus
conceptos, leyes, comportamientos y excepciones.

a)

El fenotipo a analizar es uno solo, se reconoce una causa o varias.

b)

El fenotipo puede ser resultado de causas no hereditarias.

c)

En los parientes que no presentan el fenotipo problema, se demuestra que no lo poseen.

d) Se conoce la ubicacin del gen en el cariotipo humano, ya sea en autosomas o gonosomas.

e) De tratarse efectivamente de un problema gentico, su comportamiento es dominante,


recesivo, ligado al sexo, codominante, tiene expresividad o penetrancia variable.

PATRONES DE LA HERENCIA

60

FIGURA VI.1. SMBOLOS DE GENEALOGAS. Existen varios smbolos comnmente


utilizados y otros pueden ser creados en casos especiales (IIB, 2014).

La genealoga constituye un patrn de distribucin de caracteres controlados


genticamente en grupos emparentados, esto es, grupos de personas relacionadas por

PATRONES DE LA HERENCIA

61

unin y descendencia (cnyuges, hijos, hermanos), que proporciona informacin sobre


los principios mendelianos de la herencia.
Una aplicacin sencilla de las genealogas y de los tipos de herencia est en el
estudio de caracteres fenotpicos comunes: forma de implantacin del pelo, forma de los
labios, y otros; algunos expuestos en este trabajo, fueron utilizados por la antropologa
fsica en la deteccin de trastornos genticos y en la distribucin tnica. Durante algn
tiempo incluso hubo una invasin de nociones no cientficas sobre la directa relacin
entre fenotipo y comportamiento, fenotipo e inteligencia. Hoy se sabe que distintas
poblaciones pueden tener diversas caractersticas fenotpicas, bioqumicas y
moleculares, que no significan diferencias esenciales entre los grupos poblacionales; por
eso los conceptos de raza y an de etnia cada vez son menos utilizados y se los est
reemplazando por el de poblaciones con similar base gentica.
Se analizaron 21 caractersticas fenotpicas de transmisin mendeliana simple en
447 individuos pertenecientes a dos Facultades de Medicina de la ciudad de Quito,
durante el lapso de tres aos. Estos datos se procesaron utilizando la siguiente frmula
p2 + 2pq + q2 = 1, donde p + q = 1 (Tabla VI.2).
Tabla VI.2. Caracteres fsicos y frecuencias allicas
Carcter

Dominante

Recesivo

Lnea del pelo


Forma de nariz
Hoyuelos-mejilla
Pecas
Lbulos-oreja
Pestaas 1cm
Lengua enrollada
Lengua doblada
Uso manual
Forma de falanges
Separacin pulgar
Vello en falanges
Pulgar sobrepuesto
Estatura
Produccin insulina
Orificios nasales
Labio superior
Orejas
Canas
Dedos
Factor Rh

Pico de viuda (V)


Convexa (N)
Presencia (H)
Presencia (P)
Libres (L)
Largas (G)
Forma U (E)
Presencia (U)
Diestro (Z)
Curva (F)
ngulo 45 (I)
Presencia (B)
Izquierdo(K)
Baja (S)
Normal (Y)
Anchos (O)
Recto (M)
Grandes (Q)
Prematuras (T)
Cortos (X)
Rh+ (W)

Recta (v)
Recta (n)
Ausencia (h)
Ausencia (p)
Adheridos (l)
Cortas (g)
Ausencia (e)
Ausencia (u)
Zurdo (z)
Recta (f)
Escuadra (i)
Ausencia (b)
Derecho (k)
Alta (s)
Diabetes (y)
Estrecho(o)
Hendido (m)
Pequeas (q)
No canoso(t)
Largos (x)
Rh- (w)

p2

2pq

0,0195
0,0105
0,0160
0,0187
0,1074
0,0536
0,1870
0,4613
0,6389
0,0298
0,0756
0,1141
0,0674
0,1042
1,0000
0,1904
0,0275
0,0674
0,0065
0,1722
0,5019

0,2401
0,1841
0,2211
0,2363
0,4407
0,3558
0,4909
0,4358
0,3208
0,2856
0,3987
0,4474
0,3845
0,4372
0,0000
0,4919
0,2767
0,3845
0,1479
0,4855
0,4131

q2
0,7405
0,8054
0,7629
0,7450
0,4519
0,5906
0,3221
0,1029
0,0403
0,6846
0,5257
0,4385
0,5481
0,4586
0,0000
0,3177
0,6957
0,5481
0,8456
0,3423
0,0850

Adems, se utiliz la ecuacin de tendencia lineal Y = mx + b, donde m es la


pendiente y b la interseccin. Los resultados mostraron que de los 447 individuos el
15% fueron homocigotos dominantes para los caracteres, el 27% heterocigotos y el 58%

PATRONES DE LA HERENCIA

62

homocigotos recesivos. Las caractersticas dominantes ms comunes para el grupo


estudiado son la produccin normal de insulina, el uso manual diestro, la capacidad de
doblar la lengua y el factor Rh positivo. Entre los fenotipos recesivos ms frecuentes
tenemos la ausencia de canas, la nariz recta y la ausencia de hoyuelos en las mejillas.
Los individuos heterocigotos tienen como caractersticas ms comunes los orificios
nasales anchos, los dedos cortos, la capacidad de enrollar la lengua y la presencia de
vello en falanges intermedias. En las frecuencias allicas se encuentra una relacin
inversamente proporcional entre los homocigotos dominantes y recesivos.

1.HERENCIAMENDELIANA

La herencia mendeliana explica objetivamente el patrn hereditario de los


caracteres entre padres a hijos. Los diferentes tipos de herencias se diferencian en la
forma en que estos son expresados o silenciados en las poblaciones. A continuacin se
explican las caractersticas de cada tipo de herencia, relacionndolos con diferentes
enfermedades genticas estudiadas en el Ecuador.

1.1.Herenciaautosmicadominante
Los afectados deben llevar un alelo (variante de un gen) alterado o los dos
alterados. Las caractersticas de la herencia dominante incluyen: el carcter aparece en
cada generacin (herencia vertical), sin pasar por alto ninguno de ellas. Se transmite por
un individuo que lo presente con una probabilidad del 50% para cada nuevo embarazo,
en el cruce ms frecuente (heterocigoto afecto con homocigoto normal). Las personas
sanas no transmiten la enfermedad ni el carcter a sus hijos. El sexo no influye en la
aparicin y transmisin del carcter o la enfermedad; los hombres y las mujeres tienen
las mismas probabilidades de presentar o transmitir el carcter. En condiciones
dominantes un padre aparentemente normal podra ocasionalmente portar una mutacin
en su lnea germinal, lo cual se asocia con un riesgo considerable de recurrencia.
Algunos desrdenes dominantes tienen penetrancia y expresividad variable. La
penetrancia se refiere a la frecuencia con que se manifiesta un gen o combinacin de
genes en el fenotipo de un individuo y es completa cuando los individuos homocigotos
u heterocigotos para el carcter, muestran el fenotipo alterado. La penetrancia es
incompleta cuando los portadores de un genotipo presentan el carcter en menos del
100%. Por lo general, la penetrancia se observa en familias o poblaciones completas,
donde existen diferentes manifestaciones y aun diferencias entre mujeres y varones; se
la mide en porcentaje uno a cien. La expresividad variable hace relacin a la gravedad
de una caracterstica o enfermedad y se la mide entre cero y uno; puede mostrar
variaciones intersexuales. Es importante considerar que la expresividad diferente exige
un detallado anlisis y examen de parientes de los afectos, en busca de fenotipos
truncados.
Tanto la penetrancia como la expresividad podran ser moduladas por el
ambiente. Muchos trastornos incluso tienen una franca influencia de uno de los sexos o
estn limitados a uno. La alopecia prematura, autosmica dominante, aunque el gen
puede presentarse en mujeres, es muy raro que lo haga antes de la menopausia,
posiblemente por influencia hormonal femenina. Tanto la expresividad como la

PATRONES DE LA HERENCIA

63

penetrancia probablemente se deban a la accin del alelo normal que portan los afectos
heterocigotos.
Un trmino adicional es el de pleiotropa, esto es, que el efecto de un gen puede
difundirse hacia muchas caractersticas y alteraciones orgnicas o titulares (un gen varios efectos). As, en la osteognesis imperfecta, aparte de existir anomalas en los
genes del colgeno, los pacientes presentan sordera, esclerticas azuladas, problemas en
vlvulas cardacas e hiperlaxitud de articulaciones. El trmino contrario es
heterogeneidad, que se refiere a que una misma enfermedad puede ser determinada por
varios genes y tipos de herencia, por ejemplo la sordera o retinosis pigmentosa puede
ser por herencia dominante, recesiva o ligada al sexo (Nussbaum et al., 2008; Delgado
et al., 2012).
Un ejemplo de herencia autosmica dominante es la enfermedad de Huntington,
tambin denominada corea de Huntingto, la cual se explica con ms detalle en el
Captulo IX. Investigaciones moleculares en el Ecuador: Enfermedades
neurodegenerativas.
1.2.Herenciaautosmicarecesiva
Para que se presente la enfermedad los individuos deben portar sus dos alelos
mutados. Los rasgos tpicos del carcter slo se manifiestan en los hermanos, pero no en
sus padres, progenie u otros familiares (herencia horizontal). La recurrencia es del 25%
para los hermanos del individuo afecto, en el cruce ms frecuente (heterocigotos
recesivos). Los padres del afecto por lo general son consanguneos o endogmicos. Los
hombres y las mujeres tienen las mismas probabilidades de ser afectos. Los fenotipos de
los afectos suelen ser similares, ya que sus dos alelos estn alterados, pero se puede
encontrar heterogeneidad clnica, dependiendo de las zonas del gen alteradas. En los
casos en que el defecto gentico afecte a una protena especfica (enzimas), los
heterocigotos pueden mostrar cantidades reducidas de la enzima (Scriver et al., 2000;
Rimoin et al., 2007; Nussbaum et al., 2008; Delgado et al., 2012).
Ejemplos de la herencia autosmica recesiva son la fibrosis qustica del pncreas
y la hipoacusia no sindrmica recesiva, las cuales se explican con ms detalle en el
captulo Investigaciones moleculares en el Ecuador: Enfermedades congnitas.
1.3.Herenciarecesivaligadaalsexo
En este tipo de herencia hay que considerar que los genes presentes en los
cromosomas X, tendrn dos posibilidades de manifestacin. En el caso de las mujeres,
que tienen dos cromosomas X, si uno de ellos est alterado, sern tan slo portadoras
del carcter y el otro ser el que comande el fenotipo, que suele ser normal o con
presentaciones truncadas de las afecciones; la mayora de ocasiones, el cromosoma X
alterado ser el que se inactive (heterocromatina - corpsculo de Barr). Los varones, al
tener un solo cromosoma X, presentarn siempre la enfermedad en caso de que el gen
est alterado.
Los criterios de reconocimiento de este tipo de herencia tomarn en cuenta un
predominio de varones afectos en las genealogas, donde el desorden suele ser
transmitido a travs de mujeres sanas que son portadoras. En el cruce ms frecuente, el

PATRONES DE LA HERENCIA

64

carcter es transmitido por un hombre afectado, a todas sus hijas mujeres (que sern
portadoras) y nunca a sus hijos varones. Las portadoras transmiten el carcter al 50% de
sus hijas, quienes sern igualmente portadoras, y al 50% de sus hijos, quienes sern
enfermos. Una mujer puede ser afecta si se origina de un cruce entre un varn afecto y
una mujer portadora. Por ejemplo, la hemofilia, afecta a 1/25000 nv varones y 1/250000
nv mujeres (Scriver et al., 2000; Rimoin et al., 2007).
Otros ejemplos de enfermedades recesivas ligadas al cromosoma X son las
distrofias musculares de Duchenne (DMD) y Becker (DMB). Estas enfermedades se las
explica con mayor profundidad en el captulo Investigaciones moleculares en el
Ecuador: Enfermedades congnitas.
1.4.Herenciadominanteligadaalsexo
Algunas enfermedades se originan por este tipo de herencia, aunque no es
comn. Basta con que uno de los cromosomas X est mutado, para que se presenten las
caractersticas de la enfermedad. En las genealogas es frecuente encontrar muchos
afectos de ambos sexos, pero predominan mujeres y en ellas la enfermedad suele ser
menos grave. As, la incontinencia pigmenti es letal en los varones, mientras que en las
mujeres aparecen sntomas abigarrados de pigmentacin melnica en piel, alteraciones
de dientes, ojos, retina y sistema nervioso central. Los sntomas inician muy temprano
en las mujeres (6 semanas de nacidas).
En la consulta gentica evaluamos tres pacientes varones con incontinencia
pigmenti, que presentaban una alteracin cromosmica que explicara su trastorno y en
ellos se encontr un sndrome de Klinefelter (47, XXY). Otra de las caractersticas de
este tipo de herencia es que los varones afectados transmiten el carcter patolgico a
todas sus hijas y a ninguno de sus hijos. No existe transmisin de varn a varn. Si una
mujer est afecta en forma heterogamtica, transmitir la enfermedad con un riesgo de
50% a su descendencia, sea a mujeres o a varones; en cambio si es homogamtica
transmitir la enfermedad a toda sus descendencia. Un gen dominante ligado al X dar
lugar a un desorden tanto en varones hemicigotos como en mujeres heterocigotas. El
gen es transmitido en las familias de la misma manera que los genes recesivos ligados al
X, dando lugar a un exceso de mujeres afectadas. En algunos desrdenes la enfermedad
es letal en hombres hemicigotos. En este caso habr menos varones que lo esperado en
la familia, los cuales sern sanos, y un exceso de mujeres, la mitad de las cuales sern
enfermas. La inactivacin del X produce fenotipos variables. El detectar este tipo de
herencia es complicado y se la confunde con herencia autosmica dominante, lo cual
demanda realizar pruebas genticas y de laboratorio exhaustivas (Scriver et al., 2000;
Rimoin et al., 2007; Nussbaum et al., 2008; Delgado et al., 2012).
1.5.HerencialigadaalcromosomaY
En el cromosoma Y se han ubicado unos 280 loci, pero slo unos 20 han sido
asignados o asociados a funciones, es decir, genes. En caso de una enfermedad de este
tipo, solamente los varones son afectos, siendo la transmisin directa de padre a hijo
varn a travs del cromosoma Y. El modo de transmisin probablemente sea el de una
herencia similar a la autosmica dominante. Ha sido cuestionada esta herencia, ya que
existen muy pocos genes en el cromosoma Y, y su accin podra estar limitada a
problemas de fertilidad e indiferenciacin sexual.

PATRONES DE LA HERENCIA

65

Un trmino que se debe considerar concomitantemente con la herencia ligada al


Y, es el de herencia limitada a un sexo. Esto es, la presencia de ciertas enfermedades
que por la propia naturaleza masculina o femenina se presentan de forma exclusiva en
uno de los dos sexos; as, la testotoxicosis, afecta slo a varones aunque la herencia sea
dominante, y los problemas de tero u ovarios, slo a mujeres.
1.6.Herenciaintermediaycodominancia
Si ambos alelos de un par se expresan totalmente en el estado heterocigtico,
entonces los alelos (o los rasgos determinados por ellos o ambos) son codominantes.
Algunos ejemplos de codominancia se observan en varios grupos sanguneos y en los
sistemas enzimticos. Si el heterocigoto es diferente de ambos homocigotos, los genes
involucrados muestran herencia intermedia. Por ejemplo, los portadores de los alelos
para la anemia drepanoctica o de clulas falciformes (Scriver et al., 2000; Rimoin et al.,
2007; Nussbaum et al., 2008; Delgado et al., 2012).

2.HERENCIANOMENDELIANA

La herencia no mendeliana descrita a continuacin se relaciona con la herencia


mitocondrial, el origen y las enfermedades corelacionadas.

2.1.Herenciamitocondrial
Las mitocondrias son organelas celulares donde ocurre la respiracin celular
(degradacin de combustible con liberacin de energa). Su nmero en cada clula est
determinado por la cantidad de energa requerida por esta. Si la requiere en gran
cantidad (como las clulas musculares) entonces contienen bastantes mitocondrias. El
estudio de las mitocondrias es de inters dentro del campo de la gentica porque estas
contienen su propio material gentico. Muchas enfermedades humanas se deben a
defectos o alteraciones en el ADN mitocondrial (ADNmt) (Figura VI.2) (Wallace, 1989;
Thomas et al., 1994).
2.1.1.OrigendelADNmitocondrial
Hace 150 200 aos cuando el oxgeno escaseaba en la Tierra, una bacteria
primitiva que sacaba la energa de la fermentacin anaerobia absorbi una clula menor,
la mitocondria, que se especializ en la respiracin. Desde entonces las dos clulas
adquirieron una relacin simbitica, en la que una le proporcionaba energa a cambio de
refugio y sustento por parte de la otra.
Cada clula humana contiene miles de molculas de ADNmt circular, el mismo
que est conformado por 16567 pb que constituyen 37 genes. Cada ADNmt codifica
para un ARN ribosomal (ARNr) grande y otro ARNr pequeo, 22 ARN de transferencia
(ARNt) y 13 cadenas polipeptdicas de enzimas que participan en la fosforilacin
oxidativa la cual genera ATP. El ADNmt est casi exclusivamente constituido por genes
que contienen exones. Dentro de una clula diploide podra haber ms de 1000 copias
del genoma mitocondrial, ya que cada mitocondria contiene hasta 10 copias de su ADN
circular y cada clula contiene cientos de mitocondrias. Las mutaciones dentro del
ADNmt parecen ser 5 a 10 veces ms comunes que las mutaciones en el ADN nuclear,

PATRONES DE LA HERENCIA

66

y la acumulacin de mutaciones mitocondriales se ha sugerido que tienen un rol


importante en el envejecimiento (Merriwether et al., 1991).
Entre las diferencias del ADN nuclear y el mitocondrial estn algunas ya
anotadas, el nuclear es lineal, el mitocondrial circular; el cdigo gentico en la
mitocondria es diferente que en el ncleo, as: los codones de los 22 ARNs de la
mitocondria pueden ser reconocidos por 60 codones; cuatro codones extras UAG, UAA,
AGA y AGG, son reconocidos como parada; el codn UGA se lee como triptfano en
vez de codn de parada; el codn AUA se lee como metionina y no isoleucina como en
el ncleo (Shay & Werbin, 1992).

FIGURA VI.2. ADN MITOCONDRIAL. Doble cadena de ADN conformado por 37


genes y 16568 pb (IIB, 2014).

2.1.2.ADNmitocondrialyenfermedadesgenticas
Desde que el genoma mitocondrial humano fue secuenciado en 1981, se ha
observado enfermedades genticas que muestran un patrn de herencia materna, tales
como las miopatas mitocondriales. A diferencia del ADN nuclear, hay miles de copias
de ADN mitocondrial en cada clula nucleada. Cada mitocondria contiene de 2 a 10
copias. En los individuos normales son idnticas.

PATRONES DE LA HERENCIA

67

La primera evidencia de que rearreglos en el ADN mitocondrial podan ser causa


de enfermedades genticas fue obtenida por estudios con southern blot, que demostraron
largas deleciones en ADNmt proveniente de clulas de msculo de individuos con
enfermedades musculares. Al comparar el ADN muscular con el de clulas sanguneas
no se hallaron dichas deleciones. En estos pacientes se encontraron tanto mitocondrias
defectuosas como normales. La existencia de ms de un tipo mitocondrial en la misma
clula, en el mismo tejido o en el mismo individuo, se conoce como heteroplasmia.
La delecin que ms frecuentemente es encontrada se denomina delecin comn
y consiste en una prdida de aproximadamente 4,9 Kb de longitud (Thomas et al.,
1994). La primera pregunta que surge en relacin a esta prdida, es: Cmo se da el
rearreglo? Parece ser que la recombinacin no es comn en ADNmt de organismos
superiores. En estudios poblacionales no se han detectado individuos sanos que
presenten niveles altos de rearreglos. El anlisis de secuencias revela que hay una
homologa exacta en cualquiera de las partes terminales de los segmentos delecionados,
que consta de 13 pb en longitud. El desprendimiento de la zona de delecin puede ser
una caracterstica de la replicacin del ADNmt, durante la cual la cadena pesada es
especialmente vulnerable, ya que se encuentra en forma de cadena simple. De ah que
esta cadena simple pesada pueda aparearse de forma desigual con partes de la cadena
ligera por medio de lazos en regiones ricas en A y T, dando como resultado final la
prdida de material gentico y la consecuente enfermedad.
La segunda pregunta es: La distribucin del ADNmt mutante y silvestre es
uniforme dentro de un individuo? Deleciones de ADNmt pueden ser encontradas no
solo en msculos, sino tambin en tejidos tales como cerebro, hgado, riones y sangre.
La proporcin de ADN mutado con respecto al normal parece depender del tipo de
tejido en estudio y de la edad del individuo. Lneas celulares que han sido clonadas de
tales individuos, indican que clulas individuales pertenecientes al mismo tejido pueden
tener proporciones diferentes entre el tipo silvestre y el mutante, lo cual explicara la
diferencia de sntomas y la gravedad de las afecciones.
La tercera pregunta es: Cada mitocondria puede tener varios tipos de ADN? Y
si es que la respuesta es negativa, existe entonces una comunicacin entre mitocondrias
para que los genomas salvajes puedan complementar a los mutantes? Parece que esto es
verdad. En primer lugar, se ha encontrado evidencias de que cada mitocondria, como se
anot anteriormente, posee de 2 a 10 copias del genoma; en segundo lugar, al estudiar
clulas hbridas expuestas a cloranfenicol, se ha observado que las clulas contenan dos
tipos de mitocondrias: un tipo cuya cubierta era resistente al cloranfenicol y otro cuya
cubierta era sensible. Los resultados revelaron que las mitocondrias sensibles fueron
capaces de sintetizar polipptidos en presencia de las mitocondrias con cubierta
resistente, lo que sugiere que debe existir un tipo de interaccin entre los dos tipos de
mitocondrias. Igualmente esto explicara la heterogeneidad de las manifestaciones
clnicas.
La cuarta pregunta es: Cmo las deleciones y los rearreglos se relacionan con
las caractersticas clnicas? Se ha detectado que no existe una relacin clara del fenotipo
con la regin delecionada del genoma, la longitud del ADNmt delecionado y el
porcentaje de ADNmt que ha sido delecionado. Deleciones idnticas pueden dar lugar a
varios fenotipos. Cuando se tom varias biopsias de un mismo paciente, se pudo
observar que la proporcin de genoma delecionado aumentaba con el tiempo. Cuando se

PATRONES DE LA HERENCIA

68

tomaron biopsias de diferentes sitios dentro del mismo individuo, no se observaron


diferencias. Puede ser que exista un efecto de dosificacin en el que la severidad clnica
aumenta con el aumento de la proporcin de genoma delecionado, dentro de un
individuo, o dentro de un tejido. Sin embargo, es posible que la distribucin de ADNmt
mutante relativa al tipo silvestre sea de crucial importancia en la determinacin del
fenotipo.
Un amplio espectro de enfermedades neuromusculares han sido asociadas con
mutaciones en el ADNmt. Siempre el genotipo de la madre es el que se hereda, por eso
se denomina herencia materna. Esta puede predecirse suponiendo que el vulo ha
aportado todas las mitocondrias, debido a que si bien las mitocondrias del
espermatozoide ingresan en el vulo, estas son degradadas; por tanto, los genes
mitocondriales derivan exclusivamente de la madre y los de los progenitores masculinos
son descartados en cada generacin. Lo importante es que predomina el genotipo
aportado por el progenitor de un determinado sexo, en contraste con el comportamiento
de la herencia mendeliana en la que los cruzamientos recprocos muestran que la
contribucin de ambos progenitores se hereda por igual.
Algunas investigaciones han demostrado que fragmentos del ADNmt podran
integrarse en el ADN nuclear, y podran ser neutras o producir mutaciones y
enfermedades. Las mutaciones de las mitocondrias estaran tambin relacionadas con el
envejecimiento y el origen del cncer. Existen algunos principios que explicaran el
origen de las enfermedades mitocondriales, el cncer y el envejecimiento: Una mutacin
en el ADNmt puede proveer a la clula que la contiene una ventaja selectiva de
crecimiento en un medio ambiente en particular. La eliminacin de mitocondrias
mutadas puede resultar en la insercin de un fragmento de ADNmt en el ncleo. La
reduccin del nmero total de molculas de ADNmt en la clula puede afectar el
balance homeosttico entre el ncleo y el citoplasma.
Debido a que mltiples copias de ADNmt estn presentes en la clula, las
mutaciones mitocondriales son frecuentemente heteroplsmicas, es decir, que una sola
clula contendr una mezcla de ADNmt mutante y normal. La severidad de la
enfermedad causada por mutaciones mitocondriales probablemente depende de la
presencia de proporciones relativas de ADN mutante y normal, pero es muy difcil
predecir en un determinado sujeto.
Para determinar cules protenas son codificadas por el ADN nuclear y cules
por el mitocondrial, se puede inhibir uno de los dos sistemas. Se puede bloquear la
sntesis mitocondrial utilizando algunos antibiticos como la tetraciclina y el
cloranfenicol. De esta manera las protenas que se produzcan durante el bloqueo
necesariamente van a ser codificadas por el ADN nuclear. A su vez, se puede bloquear
la actividad de los ribosomas del ncleo. Las protenas producidas mientras uno de los
sistemas est bloqueado, pueden ser marcadas con istopos radioactivos para as
distinguir a qu sistema corresponden.

2.1.3.VariacindelADNmitocondrial

Los estudios con ADNmt provenientes de varias poblaciones han mostrado 149
haplotipos y 81 sitios polimrficos, lo cual sirve para estudiar los aspectos evolutivos de

PATRONES DE LA HERENCIA

69

la especie humana. As, se ha demostrado que en la poblacin africana existe la mayor


diversidad de genomas mitocondriales, y se concluye que la especie humana es de
origen africano. Los datos de las investigaciones con ADN mitocondrial indican
tambin que los individuos difieren en un 0,4% en su ADN mitocondrial, valor ms alto
del que se esperaba. Adems, el ADNmt es ms heterogneo interpoblacionalmente a
diferencia del ADN nuclear.
Los estudios sugieren que existe un haplotipo ancestral que existi en frica
hace aproximadamente 200000 aos, del cual provienen todos los genomas
mitocondriales humanos. A partir de aqu los genomas se han ido ramificando. Esto se
determin al estudiar el nivel de variacin de los sitios de restriccin del ADNmt y la
tasa de divergencia de las secuencias (de 2 a 4% por cada milln de aos). La
suposicin de que la divergencia empez hace 200000 aos, proviene de estudios
paleoantropolgicos. Los humanos ms antiguos, encontrados en frica, tienen
aproximadamente 3 millones de aos. Esto indica que el origen humano es mucho ms
antiguo que la divergencia del ADNmt y los procesos evolutivos han permitido que las
protenas codificadas por este ADN sean importantes en la fisiologa humana.
Se han presentado evidencias de que el ADNmt tiene origen africano, sobre la
base de que la raz africana es la ms profunda en los dendrogramas de ADNmt.
Tambin se observ en el dendrograma que los ADNmt asiticos y los caucsicos se
derivan seguidamente de los ADNmt africanos.
Estudios realizados en el Ecuador por nuestro grupo, slo para uno de los genes
analizados, citocromo b, han demostrado que existen al menos 6 tipos de variantes de
este gen mitocondrial, de las 64 descritas en poblaciones humanas (Paz-y-Mio et al.,
2008b).
El citocromo b, es un gen mitocondrial que codifica para la protena citocromo
b, que es parte de la cadena de transporte electrnico de la fosforilacin oxidativa. Tiene
aproximadamente 1100 pb y entre 8 dominios transmembranales. Como todo gen
mitocondrial no presenta intrones, se hereda principalmente por lnea materna y no hay
recombinacin. Al ser parte del genoma mitocondrial presenta adems una evolucin
muy rpida y su tasa de mutacin es alta (Ej. variantes heteroplsmicas) (Berg et al.,
2002).
El segmento estudiado que amplific por PCR corresponde a 3 dominios
transmembranales que son de rpida evolucin porque contienen principalmente
aminocidos hidrofbicos y ningn centro activo importante en el transporte de
electrones. El tamao es de aproximadamente 356 pb y se amplific utilizando 2
cebadores universales comnmente utilizados en diversos grupos de vertebrados. La
utilidad del gen se enmarca principalmente en la deteccin de variantes poblacionales y
divergencias infraespecficas recientes (variaciones poblacionales y entre especies
hermanas). Los cebadores utilizados constan en la Tabla VI.3.

Tabla VI.3. Cebadores para la amplificacin del gen citocromo b


Nombre
CB1-L
CB2-H

Secuencia (5 - 3)
CCA TCC AAC ATC TCA GCA TGA TGA AA
CCC TCA GAA TGA TAT TTG TCC TCA

PATRONES DE LA HERENCIA

70

El estudio analiz un total de 108 ADNs diferentes para citocromo b. Las


variantes se las encontr realizado la tcnica denominada polimorfismo en la
conformacin de la cadena simple (SSCP). La Figura VI.3 muestra los diferentes tipos
de variantes del gen citocromo b, detectadas por SSCP, estando cada variante
identificada por un nmero.

FIGURA VI.3. VARIANTES DE CITOCROMO B IDENTIFICADOS POR SSCP. La


tcnica SSCP (Single-strand conformation polymorphism) permite analizar los
polimorfismos de conformaciones monocatenarias (Modificado de Paz-y-Mio et al.,
2008b; IIB, 2014).

Se estudiaron diversos grupos tnicos del Ecuador: poblacin mestiza, negra e


indgena. Las frecuencias encontradas para cada variante se las detalla en la siguiente
tabla:
Tabla VI.4. Frecuencias y variantes de citocromo b en grupos tnicos del Ecuador
Variante
1
2
3
4
5
6

Muestras
63
5
34
1
4
1

Porcentaje (%)
58,55
4,67
31,78
0,93
3,74
0,93

Frecuencia
0,55
0,04
0,30
0,01
0,03
0,01

La distribucin de los diferentes tipos de citocromo b por poblacin estudiada se


observa en la Figura VI.4. Las variantes 1 y 3 son las ms frecuentes, sumando un 91%
del total de individuos. Las variantes 2 y 5 tienen frecuencias bajas, sumando para el
8,4% del total. La variante 1 se asume como el tipo salvaje por su alta frecuencia. El
producto ms corto incluye el final del extremo N-terminal hasta el dominio C. Las seis
variantes pueden ser incluidas en las 19 reportadas en la literatura (Scharfe et al., 2000).
Estas variantes del segmento incluyen 7 cambios no sinnimos y 12 sinnimos. La
mayora de los cambios se acumulan en el dominio C, B y en el interdominio AB. Los
cambios no sinnimos reportados incluyen 5 transiciones y 2 transversiones. Todos los
cambios sinnimos reportados son transiciones; 4 de ellos envuelven purinas y 8 en
pirimidinas. El anlisis del SSCP para este segmento fue muy confiable pero la
identidad de cada variante no fue revelada hasta la secuenciacin.

PATRONES DE LA HERENCIA

71

90
80
70
60
Otavaleos

50

Morenos

40

Pun

30

Mestizos

20
10
0
1

FIGURA VI.4. DISTRIBUCIN DE LAS VARIANTES DE CITOCROMO B EN


ECUADOR. El anlisis de las variantes del citocromo b se realiz mediante la tcnica
SSCP y la secuenciacin genmica (Paz-y-Mio et al., 2008b; IIB, 2014).

Este segmento tiene 25 variantes reportadas en la literatura (Scharfe et al., 2000),


y es mucho ms polimrfico que el producto corto. Las variantes incluyen 14 cambios
no sinnimos y 11 sinnimos. La mayora de cambios se acumulan en el dominio D, E y
en el interdominio CD. Los cambios no sinnimos reportados incluyen 9 transiciones y
2 transversiones; los sinnimos reportados incluyen 12 transiciones y 2 transversiones.
Para las transiciones sinnimas, 5 envuelven purinas y 6 para pirimidinas.
Por ahora no se sabe con exactitud qu papel juegan los polimorfismos
encontrados en el ADNmt, pero el estudio de las variantes mitocondriales permite
establecer una relacin entre los diferentes grupos poblacionales del Ecuador, as como
entender la diversidad tnica de nuestro pas, que se debe a la variabilidad gentica dada
por polimorfismos genticos en general y mitocondriales en particular. Utilizando la
informacin del ADNmt, se puede sugerir una clasificacin poblacional basada en las
variantes de este ADN y, aparte de la utilidad filogentica, se puede establecer
asociacin con enfermedades.

3.HERENCIAPORIMPRONTAGENMICA
La herencia por impronta genmica (genomic imprinting) empez a tomar
importancia hacia la mitad de este siglo, cuando se observ que en ciertas ocasiones el
sexo de los padres tena influencia en la expresin gentica de los hijos. Efectivamente,
existe una expresin gentica diferente tanto a nivel cromosmico como allico,
dependiendo de si el material gentico proviene de la madre o del padre; en otras
palabras, el mismo gen puede comportarse de forma diferente en la descendencia, segn
se transmita por va espermtica u ovular. El siguiente ejemplo sirve para aclarar el
fenmeno: El sndrome de Prader-Willi, heredado por impronta genmica, est asociado

PATRONES DE LA HERENCIA

72

a una delecin del cromosoma 15 en su brazo largo (15q11-13); el cromosoma alterado


proviene en la mitad de casos del padre. El sndrome de Angelman tambin est
asociado, en la mitad de casos, a una delecin 15q11-13, o sea similar al de PraderWilli, pero a travs del anlisis gentico por ligamiento se ha detectado que el
cromosoma alterado se origina en la madre. Entonces ocurre que uno u otro sndrome
gentico, sea el Prader-Willi o el Angelman, puede presentarse cuando est implicada la
informacin gentica que transmita el padre o la madre respectivamente. Aunque no se
sabe si la regin del ADN que se encuentra implicada en los dos sndromes es la misma,
parece cierto que podra existir solapamiento de unos genes sobre otros. Este
solapamiento podra depender del grado de metilacin del gen (Da Rocha & FergusonSmith, 1984; Sha, 2008; Wolf et al., 2008).
Inquietan otros casos de enfermedades relacionadas con esta nueva forma de
herencia por impronta genmica, como la distrofia miotnica cuyo gen es transmitido
por va materna y que de presentarse, ocasiona que entre el 10 al 20% de hijos afectos,
tengan la forma congnita severa; o como la enfermedad de Huntington, cuyo gen,
cuando es transmitido por el padre, desencadena la forma severa juvenil de la
enfermedad (Hall, 1990; Sha, 2008).
Actualmente, se ha puesto atencin a variantes fenotpicas en ciertos sndromes
que, con seguridad, tendran origen en la herencia por impronta genmica y se ha
planteado que muchas de estas diferencias se deben a una disoma uniparental, esto
significa que el par cromosmico de un descendiente es producto del mismo padre;
hecho que resultara de la presencia de un alto nmero de clulas germinales
aneuploides. Este fenmeno de disoma uniparental, podra conducir a la
homocigocidad de una serie de alelos contiguos en un par de cromosomas, fenmeno
denominado isodisoma y podra ser explicado por un alto ndice de recombinacin de
los cromosomas meiticos. La existencia de la disoma uniparental, con o sin
isodisoma, podra explicar variedades fenotpicas en el mismo sndrome (Horsthemke
& Buiting, 2008).

4.SNDROMESDEGENESCONTIGUOS
Existen algunos sndromes con patrones fsicos reconocibles que son causados
por fallas en la organizacin de los genes en el cromosoma, como los sndromes de
genes contiguos, estos se producen por inclusin o exclusin de genes prximos a los
que producen fenotipos clsicos, determinando variaciones en los fenotipos del mismo
sndrome. Los sndromes proveen gran informacin sobre el ordenamiento gentico y
ayudan a entender el control gentico; adems, estn incluidos en el grupo de defectos
del desarrollo.

5.MOSAICISMO
Se refiere a la presencia de dos o ms lneas celulares, las cuales difieren en la
constitucin cromosmica o en el genotipo pero que han sido derivadas de un solo
cigoto. El mosaicismo es un evento postcigtico que podra originarse durante el
desarrollo embrinico temprano, durante la etapa fetal tarda o en la vida postnatal. El
momento durante el cual se desarrolla el mosaicismo determinar las proporciones
relativas de las dos lneas celulares, y por lo tanto la severidad de la anormalidad del

PATRONES DE LA HERENCIA

73

fenotipo causado por la lnea celular anormal. El mosaicismo funcional ocurre en


mujeres cuando uno de los cromosomas X permanece activo en cada clula. El proceso
de inactivacin del X ocurre en la embriognesis temprana y es al azar. Por tanto, los
alelos que difieren entre los dos cromosomas sern expresados en forma de mosaico
(Zlotogora, 1998).
El mosaicismo cromosmico no es infrecuente y se produce por errores
postcigticos durante la mitosis. Ha sido documentado en algunas anormalidades
cromosmicas numricas y estructurales que habran sido letales si no hubieran estado
en forma de mosaico.

6.HERENCIAPOLIGNICAOMULTIFACTORIAL
El trmino polign hace referencia a un grupo de genes que determinan un
carcter o enfermedad, mientras que el trmino multifactorial, se refiere a que un
carcter est determinado por varios factores incluidos los genticos (uni o polignicos)
bajo la influencia de un ambiente determinado. Es por esta razn que los trminos
podran estar superpuestos y hemos preferido describirlos en conjunto (Marazita &
Mooney, 2004).
Si se considera la relacin genes-ambiente con respecto al fenotipo que se
evala, se tiene una curva de Gauss normal. Analizando los extremos de esa
distribucin tendramos tres tipos bsicos de relacin:

FIGURA VI.5. RELACIN ENTRE GENES Y AMBIENTE. La epigentica consiste en la


asociacin entre los factores genticos con los ambientales para explicar un patrn
presente en un individuo. El fenotipo es igual al genotipo ms el ambiente (IIB, 2014).

El primer grfico muestra la manera como la carga gentica (G) comanda al


fenotipo (F), mientras que la carga ambiental (A) es ms bien pequea. El tercer grfico
muestra lo contrario, es decir, la carga ambiental (A) es la que prima y los genes (G)
tienen poco efecto. El segundo grfico, representa la relacin igual de genes (G) y
ambiente (A). Este fenmeno ocurre en los individuos y un ejemplo lo aclara: La carga
gentica que impone el gen mutado que produce la fibrosis qustica del pncreas es
completa, pero el ambiente en que los afectos desarrollan su vida es determinante para
la sobrevida; en pocas palabras, si los individuos mantienen un tratamiento adecuado y

PATRONES DE LA HERENCIA

74

oportuno, viven por aos. Al otro lado estara el ejemplo de la infeccin por VIH: Si un
individuo tiene la forma normal del gen CCR5 en homocigosis y est en contacto con el
virus, el contagio es casi seguro, pero si existe una forma mutante del gen en
homocigosis, el virus no puede entrar a los linfocitos del individuo, y se podra decir
que este sujeto es inmune al VIH. Los individuos heterocigotos gen normal/mutado, si
bien se contagian del virus, parece que el desarrollo de la enfermedad es ms lento. Este
mismo fenmeno de resistencia o susceptibilidad se ha descrito para muchas
enfermedades: tuberculosis, lepra, malaria, e incluso infecciones bacterianas como la
del estreptococo beta hemoltico del grupo A, hongos como la Candida albicans y
algunos parsitos como la ameba, o la leishmania. El punto entonces, es que los
individuos pueden tener genes que les proporcionan unas caractersticas favorables en
un ambiente contrario, o viceversa, genes de susceptibilidad (Paz-y-Mio et al., 2005a;
Nussbaum et al., 2008).
De la misma forma, se conoce que existen individuos con resistencia natural
(gentica) a fenmenos como la radiacin, la gravedad o las aptitudes para deportes,
msica, etc. Entonces, los genes comandaran la estructura del individuo con sus
ventajas y desventajas, y el desempeo o la relacin con el medio seran una forma de
adaptacin o seleccin natural.
Muchas enfermedades no tienen un patrn hereditario definido, como las
heredadas en forma dominante, recesiva o ligada al sexo. Aqu la carga gentica del
individuo interacciona con los factores ambientales (fenotipo = genotipo + ambiente)
que tienen un efecto de umbral de susceptibilidad para producir una anomala. Este tipo
de herencia es responsable de un gran nmero de caractersticas fenotpicas del ser
humano (color de la piel) y de desrdenes del desarrollo que dan como resultado ciertas
malformaciones congnitas (fisura labial con o sin fisura del paladar, defectos de cierre
del tubo neural, dislocacin congnita de cadera, microtia) y muchos desrdenes de la
vida adulta (algunas formas de cncer y enfermedades de las arterias coronarias). Al
parecer las caractersticas y defectos polignicos no son resultado de un simple error en
la informacin gentica sino una combinacin de pequeas variaciones genticas. Los
factores ambientales podran estar involucrados en este tipo de herencia. Desrdenes
multifactoriales tienden a ocurrir en familias pero no muestran los patrones
genealgicos de la herencia monognica (Baird et al., 1988; Busby et al., 2005).
El polign abarcara un conjunto de genes que ejercen un efecto sumatorio para
manifestar un carcter, dentro de un ambiente determinado (regin geogrfica, nicho
ecolgico), que tambin tendra una influencia importante. En este tipo de herencia se
ha visto un ndice de consanguinidad o endogamia aumentado entre los padres de los
individuos afectos, como tambin las patologas se concentran en grupos poblacionales
familiares o tnicos especficos y an en un sexo en particular. Cuando la afeccin se
presenta en el sexo menos expuesto, el riesgo de recurrencia y de transmisin
hereditaria es mucho mayor para los siguientes hijos o hermanos del afecto, que si el
afecto es del sexo comnmente ms enfermo. Esto significa por ejemplo que si la
dislocacin congnita de cadera con incidencia de 1/1000 nacidos vivos, que es ms
frecuente en las mujeres, se presenta en un varn, el riesgo de que este hecho se repita
en el siguiente embarazo, para un feto masculino, es de aproximadamente 2%, es decir
unas 20 veces mayor que el de la poblacin general. Existen varios aspectos importantes
sobre la herencia polignica en relacin con los riesgos de recurrencia de problemas
malformativos:

PATRONES DE LA HERENCIA

a)

Cuanto ms grave es la afeccin, mayor ser el riesgo de recurrencia familiar.

b)

Si la afeccin est presente en uno de los progenitores, la recurrencia ser mayor.

c)

El riesgo de recurrencia es mayor mientras mayor nmero de afectos exista en la familia.

d)

El riesgo para los familiares ms lejanos, aunque es mayor que el de la poblacin general,
se va reduciendo aproximadamente a la mitad, a medida que se aleja el grado de
parentesco: para los tos del individuo y para los primos.

e)

Los defectos polignicos tienen una recurrencia emprica mayor en las familias que
presentan mayor nmero de enfermos.

f)

La recurrencia es mayor para los parientes o descendientes de los enfermos del sexo con
menor posibilidad de afeccin.

75

El estudio de las patologas multifactoriales resulta inquietante ya que concentra


muchos criterios cientficos y aun epistemolgicos dignos de revisin. El efecto umbral
de la enfermedad, por ejemplo, parece que se debe a la interaccin dialctica de varios
genes con efecto acumulativo que, bajo un ambiente determinado, en un momento
determinado y con ciertas condiciones (a veces no detectables), confluyen dando un
salto de sus efectos cuantitativos, sobrepasando el lmite o umbral de la normalidad y
produciendo un efecto cualitativo diferente, que desencadena malformaciones. A cada
lado del punto de umbral existen sendos tipos de poblaciones: una sana pero de mayor
predisposicin a tener descendencia con malformaciones, y otra enferma, con mayor
probabilidad de presentar malformaciones ms graves a medida que se aleja del lmite
de normalidad. La discusin terica entre la relacin fenotipo-genotipo-ambiente
permanece abierta. A continuacin se explica a profundidad uno de los ejemplos ms
relevantes en la herencia polignica, las fisuras faciales.
6.1.Fisurasfaciales
Las fisuras faciales se encuentran entre las anormalidades ms frecuentes que se
presentan en el nacimiento. Dependiendo de la poblacin estudiada, la prevalencia de las
fisuras oscila entre 0,79 a 4,04 por cada 1000 nacidos vivos, o como lo citan en otros
trabajos, su incidencia vara entre 1 en 500 y 1 en 1000 nacidos vivos.
Se ha sugerido que los nios con fisuras faciales usualmente no presentan otras
anomalas. Sin embargo, algunos estudios indican que dichas fisuras podran representar
solamente una de las caractersticas que forman parte de un sndrome de malformaciones
mltiples. As, un gran nmero de sndromes reconocibles involucran a las fisuras en su
espectro fenotpico (Murray, 2002).
La evidencia epidemiolgica sugiere que la fisura palatina aislada es una entidad
etiolgica diferente al labio fisurado con o sin fisura palatina, es decir que son desrdenes
genticos separados, cada uno siguiendo un patrn monognico de herencia dominante con
penetrancia reducida y limitado por el sexo. Adems segn varios autores existen las
siguientes subdivisiones: fisuras completas e incompletas, unilaterales y bilaterales. Los
tres tipos de fisuras faciales pueden constituir parte del cuadro fenotpico en ms de 200
sndromes claramente establecidos. Preferentemente la fisura labial (FL) o la fisura labial

PATRONES DE LA HERENCIA

76

con fisura palatina (FLP) afectan al lado izquierdo, y existen graduaciones en su


manifestacin (Rimoin et al., 2007).
El labio y paladar fisurado representa cerca del 50% de todos los casos de fisuras
faciales, mientras que cualquiera de las dos en forma aislada representa cada una el 25% de
todas las fisuras. Sin embargo, reportes recientes han documentado que el 35% de recin
nacidos presentan labio fisurado con o sin paladar fisurado, como parte de un patrn ms
amplio de morfognesis alterada. Existen tambin diferencias patolgicas segn ciertas
variantes como el sexo, en donde la mayora de autores coinciden en que es ms frecuente
en el masculino; rea geogrfica; bajo peso de la madre (deficiente alimentacin materna),
edad materna, clase social, antecedentes patolgicos maternos, poca de concepcin o
nacimiento y etnia, habiendo mayor frecuencia entre los orientales y americanos nativos,
menor entre los negros y una intermedia en los caucsicos. El ndice de recurrencia de las
fisuras faciales es variable y se lo infiere empricamente.
En ocasiones, las fisuras forman parte de sndromes poco comunes atribuibles a
genes autosmicos dominantes, recesivos, ligados al sexo y anormalidades cromosmicas.
Se ha presentado suficiente evidencia de que tanto la fisura labial como la palatina, cuando
no forman parte de otros sndromes, se deben a herencia polignica modificada por el sexo,
con manifestacin frecuente en el sexo masculino para la primera y en el femenino para la
segunda.
Las fisuras labio-palatinas constituyen una de las malformaciones congnitas ms
frecuentes en el Ecuador. En 1970 se efectu un estudio estadstico de los 10 aos previos
a esa fecha, de los nacimientos de la Maternidad Isidro Ayora, encontrando un caso de
fisura por cada 613 nacimientos. En 1975, encontraron en la misma casa asistencial 1 caso
por cada 580 nacimientos; en 1978, 1 caso por cada 537 y en 1979, 1 caso por cada 500.
Como se puede observar, en poco tiempo y por causas an no explicadas ampliamente, la
incidencia en Quito ha subido de una manera muy notoria.
En 1996 se realiz un estudio en la Maternidad Isidro Ayora observando que de
161 neonatos con malformaciones mltiples, hubo 26 casos (16,1%) con labio y paladar
hendido. En el presente estudio se analizaron las fisuras faciales (labial, labio-palatina y
palatina) como un modelo para entender la mecnica del anlisis gentico de un
determinado carcter humano, que en ltima instancia nos llevara a la comprobacin de su
posible origen o a plantear nuevas interpretaciones de su modelo de herencia. Se puso
atencin en la relacin entre la severidad de la afeccin y el sexo del individuo; grado de
severidad, antecedentes familiares, recurrencia y heredabilidad versus el grado de
parentesco.
Para analizar las fisuras orales en el Ecuador, estudiamos individuos que
presentaron diversas alteraciones: fisura labial con fisura palatina (FLP), fisura labial sin
fisura palatina (FL) o fisura palatina aislada (FP). A todos se les realiz una evaluacin
clnica-gentica, y por inters investigativo se realiz un estudio citogentico para detectar
la presencia de alguna anomala cromosmica y poder establecer relaciones con las fisuras
faciales. Para esto se us la tcnica citogentica estndar.
Se estudi la frecuencia de presentacin de fisuras en todos los casos evaluados
genticamente. A los afectos se los dividi en 4 grupos de estudio: fisura aislada, fisura
asociada con otras malformaciones, fisura sindrmica (como componente de un sndrome
establecido o cuando existen 3 o ms malformaciones asociadas sin conformar un

PATRONES DE LA HERENCIA

77

sndrome definido) y fisuras dentro de cromosomopatas. Se han diferenciado tambin 4


tipos de fisuras: fisura palatina (FP), fisura labial unilateral (FLu), fisura labial bilateral
(FLb) y fisura labial ms fisura palatina (FLP).
Adicionalmente, se realizaron genealogas de los individuos afectos dividindolos
de acuerdo al sexo y analizando la incidencia de la afeccin segn el grado de parentesco.
En 64 individuos afectos pertenecientes a 60 familias, se calcul, las frecuencias de los
diferentes tipos de fisuras. Entre parntesis se encuentra los datos del total de familiares
de los afectos de acuerdo al grado de parentesco. Es importante aclarar que en cuanto a
los datos de parientes de primer grado solamente constan los datos de los hermanos de
los individuos afectos estudiados.
6.1.1.Fisurapalatina

La fisura palatina fue la ms frecuente con 32 afectos que representan el 50% del
total. Se encontr un mayor porcentaje en mujeres, 18 (56,3%) frente a 14 varones
(43,7%). Al analizar los datos con mayor detalle se observaron 13 casos aislados (8
mujeres y 5 varones), 10 casos como parte de sndromes conocidos, 6 asociados con
otras malformaciones y 3 casos relacionados con alteraciones cromosmicas (Tabla
VI.5).
Tabla VI.5. Individuos con fisura palatina y sus familiares afectos
Afeccin
Aislada
Asociadas a malformaciones
Fisura facial y alteracin
cromosmica
Fisura facial en sndrome
Total

#
13
6
3
10
32

Grado 1
3 (48)
2 (17)
0 (7)
0 (29)
5 (101)

Grado 2
4 (156)
1 (84)
0 (31)

Grado 3
2 (208)
0 (118
0 (25)

Total familias
27
7
7

1 (44)
6 (315)

0 (40)
2 (391)

19
60

6.1.2.Fisuralabiopalatina
Se encontraron 27 individuos afectos (42%), de los cuales fueron 15 varones
(55,5%) y 12 mujeres (44,5%). De estos, 13 casos fueron aislados (7 varones y 6
mujeres), 9 asociados con sndromes, 3 con alteraciones cromosmicas y 2 con otras
malformaciones (Tabla VI.6).
Tabla VI.6. Individuos con fisura labio-palatina y sus familiares afectos
Afeccin
Aislada
Asociadas a malformaciones
Fisura facial y alteracin
cromosmica
Fisura facial en sndrome
Total

#
13
2
3

Grado 1
4 (48)
1 (17)
0 (7)

Grado 2
0 (156)
1 (84)
0 (31)

Grado 3
0 (208)
0 (118
0 (25)

Total familias
27
7
7

9
27

0 (29)
5 (101)

1 (44)
2 (315)

0 (40)
0 (391)

19
60

6.1.3.Fisuralabial
Se encontraron 5 individuos afectos, 3 con FLu y 2 con FLb, de los cuales 4
fueron varones (80%) y 1 mujer (20%); de estos 1 caso relacionado con alteraciones

PATRONES DE LA HERENCIA

78

cromosmicas y 4 casos aislados (Tabla VI.7). Segn Oliver & Jones, el labio fisurado
es ms probable que aparezca en los varones, lo que de alguna manera corrobora los
datos de este estudio que, aunque son pocos, muestran un mayor porcentaje de afectos
entre los varones (Oliver & Jones, 1997).
Tabla VI.7. Individuos con fisura labial y sus familiares afectos
Afeccin
Aislada
Asociadas a
malformaciones
Fisura facial y alteracin
cromosmica
Fisura facial en sndrome
Total

FLu
3
0

FLb
1
0

0
3

0
2

Grado 1
1 (48)
0 (17)

Grado 2
2 (156)
1 (84)

Grado 3
0 (208)
0 (118

Total familias
27
7

0 (7)

0 (31)

0 (25)

0 (29)
1 (101)

0 (44)
3 (315)

0 (40)
1 (391)

19
60

6.1.4.Asociacionesmalformativas
En cuanto a las malformaciones asociados a las fisuras faciales se pudo observar
que 6 casos se asociaron con FP y 2 casos con FLP; 3 de las 4 cardiopatas encontradas
se presentaron en FP, lo que sugiere que ante tal presencia puede haber un riesgo mayor
a otras malformaciones y en especial un 42,8% a una cardiopata. En lo que a sndromes
asociados a fisuras faciales se refiere, se encontr que de los 19 hallados, 9 presentaron
FLP (47,3%) y 10 FP (52,7%). Dentro de estos sndromes, 6 presentaron cardiopatas
(31,5%), 3 con trastornos del sistema nervioso central (15,7%), 3 con alteraciones en
miembros inferiores (15,7%), 3 con alteraciones craneofaciales (15,7%) y 2 en genitales
(10,5%).
6.1.5.Anlisisestadsticocomparativo
Al comparar el nmero total de casos de FLP + FL (cuyo resultado es la suma de
datos de FLu y FLb) con la FP total, no existen diferencias significativas (p > 0,05). En
el caso de la FP aislada, al ser comparada con los otros tipos de fisuras palatinas, no se
observaron diferencias significativas ni con la asociada ni con la sindrmica (p > 0,05),
pero s hay diferencias con la FP en cromosomopatas (p < 0,01). Esta diferencia podra
deberse a que los casos de cromosomopatas son muy pocos o debido a que la
etiopatogenia es diferente, lo que sera ms probable.
Al comparar la FLP aislada con los otros grupos, ocurre todo lo contrario con las
fisuras asociadas y cromosmicas, ya que las diferencias encontradas son significativas
(p < 0,001 y p < 0,01 respectivamente), mientras que con las sindrmicas no existen
diferencias (p > 0,05). La explicacin puede ser similar a la anterior ya que en el caso de
FLP asociada slo se registraron 2 casos.
Finalmente, al comparar el comportamiento de la FP y la FLP no se encontr
diferencia alguna en los grupos (p > 0,05).
El clculo de la recurrencia se lo realiz considerando el nmero de afectos
sobre el total de parientes por grado de consanguinidad, los resultados de la recurrencia
se los presenta en la Tabla VI.8. Se conoce que la frecuencia y recurrencia de las fisuras

PATRONES DE LA HERENCIA

79

orales, labiopalatina y palatina, es diferente para cada grupo tnico, encontrndose que
la presente poblacin estudiada est dentro de los datos informados en la literatura.
Tabla VI.8. Recurrencia de fisura palatina, labial y labio-palatina
Afeccin
Aislada
Asociadas a
malformaciones
Fisura facial en
sndrome
Fisura facial y
alteracin
cromosmica

Recurrencia fisura palatina


Grado parentesco (%)
No.
1ro
2do
3ro
familia
5/24 4/61 2/54
11
(20,8)
(6,5)
(3,7)
3/14 1/67 2/92
5
(21,4)
(1,4)
(2,1)
0/16 1/24 0/18
10
(0)
(4,1)
(0)
0/7
0/12 0/10
(0)
(0)
(0)
3

Recurrencia fisura labial


Grado parentesco (%)
1ro
2do
3ro
1/4
(25)

2/24
(8,3)

0/63
(0)

No.
familia
4

No existen afectos
No existen afectos
0/1
(0)

0/8
(0)

0/7
(0)

Recurrencia fisura labio-palatina


Grado parentesco (%)
No.
1ro
2do
3ro
familia
5/28
0/67
0/92
12
(17,8)
(0)
(0)
1/5
2/17
0/23
2
(20)
(11,7)
(0)
0/13
1/18
0/22
9
(0)
(5,5)
(0)
0/4
0/11
0/8
(0)
(0)
(0)
3

Adicionalmente, el anlisis de los datos revela que cuando se encuentra la FP


como patologa en los ascendientes, en la generacin analizada se presenta mayor
nmero de afectos de fisuras (probandus). Cuando hay antecedentes de FL (5 afectos)
solo se encontraron 3 probandus. Cuando hay antecedentes de FP (3 casos) hay mayor
riesgo de recurrencia en las familias (10 afectos); en cambio cuando los antecedentes de
FL o FLP (7 casos) estn presentes, proporcionalmente de forma mayor a los de FP
(3/7), la recurrencia parece ser menor o igual (6 casos). Lo que proporcionara a la FP
las caractersticas de una mayor penetrancia y severidad que la FLP.
Cuando se observa antecedentes familiares en la rama materna, especialmente
por consanguinidad (7 afectos en las familias maternas), hay mayor nmero de
probandus (7/14 con FLP y 7 con FP) que cuando los antecedentes estn en la rama
paterna (2 afectos) y 2 afectos probandi (1 con FP y 1 con FLP).
De 15 familias con antecedentes de fisuras de todos los tipos, en la rama materna
se encontr 11 afectos (7 con FLP y 4 con FP) y 4 afectos en la rama paterna (2 con
FLP y 2 con FP).
Cuando la consanguinidad est en la rama materna, se ha encontrado un mayor
nmero de casos de FLP (50%) y cuando la consanguinidad est en la rama paterna, el
otro 50% de casos son de FP. En otras palabras, la recurrencia familiar es 2,75 veces
mayor en la rama materna que en la paterna y la FLP es 1,5 veces mayor que la FP.
Al analizar los factores ambientales que podran intervenir en la etiopatogenia de
las fisuras, y a los cuales se tuvo acceso, en las familias estudiadas se encontraron 2
individuos (3,3%) con antecedentes de importancia. Un caso de exposicin a rayos X en
el primer trimestre de embarazo (FL). Un caso de contagio con rubola durante el
embarazo (FP). Tambin se observaron 9 familias (15%) con abortos por causa
desconocida, los cuales se presentaron antes del nacimiento del probandus.
En conclusin, los datos de la investigacin sobre heredabilidad, antecedentes
familiares y recurrencia, apoyan los presentados en la literatura. Los resultados
encontrados son vlidos para esta poblacin estudiada, existiendo, como se observa, una
heterogeneidad geogrfica ya descrita anteriormente en otros trabajos similares.

PATRONES DE LA HERENCIA

80

La incidencia de fisura palatina aislada fue ms elevada con relacin a las fisuras
labio-palatinas y a las labiales. As mismo, se encontr que la fisura palatina aislada es
ms frecuente en mujeres, mientras que la fisura labial aislada y labio-palatina fueron
ms frecuentes en hombres.
De acuerdo con la relacin entre fisuras y otras afecciones, las fisuras palatinas
aisladas son las que presentan mayor asociacin con otro tipo de malformaciones,
mientras que las labio-palatinas se asocian con menor frecuencia y las labiales aisladas
en ningn caso; datos que concuerdan con otras investigaciones. De igual manera, esto
est en mayor relacin a una herencia con caractersticas ms estables, como sera la
dominante con penetrancia y expresividad variable, o un polign (grupo de genes
ligados transmitidos en conjunto) con herencia mendeliana. De todas maneras, el
espectro de asociaciones es variado para los diferentes sistemas y rganos, lo que
conduce a pensar que existira un nmero de genes especficos que provocan las fisuras
faciales clsicas y a stos, se agregaran otros genes que producen la gran variacin de
fenotipos asociados o sindrmicos. Como sugieren los estudios de Shields, esto no
contradice la herencia polignica, en pacientes con fisura palatina aislada, aunque se
agrega que ni un modelo multifactorial ni el de un solo locus principal es
completamente compatible con la distribucin de casos estudiados (Shields et al., 1981).
Los autores propusieron la existencia de dos clases de fisura palatina no sindrmica:

a) Fisura palatina familiar, la cual parece tener un componente autosmico dominante para su

etiologa.

b) Fisura palatina no familiar, al demostrarse una frecuencia incrementada con el tiempo y un


efecto de la edad materna, lo que parece estar relacionado con factores ambientales o

herencia polignica. Sin embargo, se sugiri que la etiologa es probablemente heterognea


con algunas familias, mostrando herencia dominante modificada.

Finalmente, se considera el estudio de la afeccin humana: fisura oral, como un


excelente modelo para comprender la distribucin de los genes en las poblaciones y la
manera en que las frecuencias de los mismos y sus genotipos se mantienen o cambian.
A partir de este tipo de estudios se puede determinar los posibles genotipos de otros
miembros de la familia del afecto y calcular los riesgos de recurrencia para los
hermanos, hijos y otros familiares lejanos del individuo afecto, lo que sera de mucha
utilidad en el consejo gentico.

Captulo VII
Origen gentico de las discapacidades en el
Ecuador
La Organizacin Mundial de la Salud estima que ms de mil millones de
personas a nivel mundial viven con algn tipo de discapacidad, correspondiendo al 15%
de individuos de la poblacin mundial en el ao 2010. Esta cifra es superior a las
estimaciones previas, 10% en el ao 1970. El aumento de la prevalencia de los
discapacitados con el paso del tiempo se debe a que la poblacin est envejeciendo y el
riesgo de discapacidad es superior en adultos mayores, y tambin al aumento mundial
de enfermedades crnicas tales como los trastornos de la salud mental, las enfermedades
cardiovasculares, la diabetes y el cncer (OMS, 2011).
Estas cifras generan retos a la sociedad actual, las cuales se enfocan en la
prevencin, mejoramiento de la calidad de vida e integracin social en igualdad de
derechos de los discapacitados. Al amparo de este principio, as como cumpliendo las
disposiciones legales ecuatorianas, se llev a cabo en el Ecuador el Primer estudio
biopsicosocial clnico gentico de las personas con discapacidad dentro del programa
gubernamental Misin Solidaria Manuela Espejo (MSME).
Histricamente, en el Ecuador, el tema de las discapacidades ha sido trabajado
desde los aportes de las ciencias mdicas; sin embargo, las personas con discapacidad
han estado, en su mayora, relegadas y excluidas del desarrollo social debido, por un
lado, a la ausencia de una poltica pblica integral orientada al reconocimiento de sus
derechos y, por otro, a una visin medicalizada y segmentada. Era necesario, por tanto,
conocer las causas y factores que provocan y agravan una discapacidad, al igual que
disponer de datos precisos, actuales y reales de la situacin de las discapacidades en
pases como el Ecuador (Vzquez, 2011).
El Gobierno del Ecuador, en el ao 2008, declar el estado de emergencia para
crear el sistema de prevencin de discapacidades, atencin y provisin de ayudas
tcnicas e insumos mdicos, prestacin de servicios de salud, capacitacin y
accesibilidad a travs del mejoramiento e implementacin de la infraestructura pblica;
tambin se declar en emergencia al proceso de registro e identificacin de las personas
con discapacidad, y, en general, a todos los sectores que trabajan, llevan y ejecutan
programas de discapacidad. Esta declaratoria de emergencia tuvo adems, como
objetivos, la articulacin de los servicios que se encontraban segmentados y dispersos, e
iniciar en el pas la Convencin sobre los derechos humanos de las personas con
discapacidad, adems de reconocerlos como sujetos con atencin prioritaria y promover
su inclusin integral en la esfera social.
Comprometido con la Constitucin y la Convencin sobre los derechos de las
personas con discapacidad, el Gobierno del Ecuador declara la validez de la
reivindicacin de este grupo de individuos bajo la premisa de que es necesario generar
en actores sociales, gobierno, organismos no gubernamentales y sociedad en general, la
voluntad social y poltica de disear, observar e implementar todos los mecanismos que
viabilicen el ejercicio y aplicacin de los preceptos contenidos en ambos cuerpos
jurdicos y, por ende, la reivindicacin de los derechos de las personas con discapacidad

ORIGEN GENTICO DE LAS DISCAPACIDADES EN EL ECUADOR

84

y sus respectivas familias. Para materializar en hechos esta poltica, se implementa el


programa Ecuador sin Barreras (Decreto Ejecutivo 1188).
Durante los aos 2007 y 2008, la planificacin de este programa se orient a la
solucin de los problemas que agravan la situacin de discapacidad, entre los que se
identificaron: la falta de servicios de salud especializados, una mnima e inadecuada
inclusin laboral, insuficiente accesibilidad al medio fsico, transporte, comunicacin y
al entorno cultural; y, deficiencias en el sistema educativo (INEC, 2013).
En este contexto, en el ao 2009 naci la Misin Solidaria Manuela Espejo,
estableciendo un Convenio Marco de Cooperacin en materia de salud, e
implementando el estudio y metodologa ya realizado en Cuba (2001 2003) y
Venezuela (2007 2008) (Ruz et al., 2011).

1.CRITERIOSDEINCLUSIN,EXCLUSINYESTRATEGIADETRABAJO
Se realiz una investigacin de carcter descriptivo, transversal entre los aos
2009 y 2010 en el Ecuador. En el estudio se combinaron los mtodos clnicos,
epidemiolgicos, pedaggicos y sociales, con el propsito de caracterizar a las personas
con discapacidad que cumplan con los criterios de inclusin.
A efectos de la investigacin, se considera discapacidad a toda limitacin grave
para realizar actividades que tenga una persona en la actualidad, siempre que su
duracin total, es decir el tiempo que la padece o espera padecer, sea superior a un ao.
Se incluyen las personas que han atenuado o eliminado su discapacidad con el uso de
ayudas tcnicas extras, pero que tendran dificultades importantes si no dispusieran de
dicha ayuda. Forman parte del estudio las personas con discapacidades: fsico motoras
(parlisis de una extremidad superior o inferior, hemiplejia, hemiparesia, paraplejia,
paraparesia, tetraplejia o tetraparesia, amputacin de miembros, trastornos en la
coordinacin de movimientos, trastornos del sistema nervioso central u alteraciones del
sistema osteoamioarticular); auditivas (sorderas, hipoacstica); visuales (ceguera total,
debilidad visual); mentales (psicosis crnica, demencia); mixtas o mltiples; orgnicas o
viscerales (slo la insuficiencia renal crnica con criterio de dilisis) y discapacidad
intelectual (grado leve o ligero, moderado, severo y profundo). Excluyendo las personas
con discapacidad menor y con discapacidades temporales.
La Misin Solidaria Manuela Espejo conform brigadas de trabajo compuestas
por quintetos profesionales: mdico, trabajador social, genetista, militar y psiclogo. La
distribucin de las brigadas se realiz atendiendo al estimado de personas con
discapacidad a estudiar, que fue alrededor del 3% de la poblacin total de cada una de
las 24 provincias ecuatorianas segn el censo del ao 2001.
Los especialistas visitaron a las personas con discapacidad en sus propias
viviendas, tanto en sectores rurales como en sectores urbanos. En la marcha, a toda
persona identificada con discapacidad, que cumpla con los criterios de inclusin, se le
realizaron entrevistas, historiales clnicos y revisiones mdicas, abarcando las reas
psicopedaggica, social y clnico gentica, segn el caso particular de cada individuo y
su discapacidad. Particularmente, las personas con afeccin intelectual requirieron de

ORIGEN GENTICO DE LAS DISCAPACIDADES EN EL ECUADOR

85

una segunda visita del mdico especialista para precisar su diagnstico mientras que, las
enfermeras tomaron muestras de sangre y orina para el anlisis en el laboratorio.
Uno de los objetivos complementarios en la investigacin fue la realizacin de
estudios de laboratorio a todas aquellas personas que presentaron una discapacidad
intelectual de la cual se sospechaba podra tener como causa una enfermedad gentica;
estos estudios fueron de carcter cromosmico, molecular y metablico, segn el caso.
Las muestras de sangre u orina se extrajeron, preferentemente, en los lugares
donde residan las personas con discapacidad, pues en su mayora son personas que
viven en lugares alejados y en condiciones de pobreza. No obstante, siempre que fue
posible, se traslad al paciente a los subcentros de salud para la toma de las muestras en
condiciones higinicas de mxima asepsia. Todos los individuos o sus representantes
legales firmaron el respectivo consentimiento informado y aceptaron su participacin en
este estudio.
Realizadas las tomas de las muestras de sangre u orina, estas fueron trasladadas
al Centro Nacional de Gentica Mdica de Cuba, donde fueron procesadas. Con los
resultados, el grupo de especialistas liderados por el Ministerio de Salud Pblica,
programaron el protocolo de atencin para cada una de las personas.

2.EPIDEMIOLOGADELASDISCAPACIDADESENELECUADOR
Hasta el ao 2010, en el Ecuador se determin un total de 293743 personas con
discapacidad, lo que corresponde a una prevalencia del pas de 20,3 por cada 1000
habitantes. Del total de individuos afectos, 71417 presentaron discapacidad intelectual
(24%) y 222326 otros tipos de discapacidades (76%).
A nivel territorial, el 49,5% de discapacitados estuvo presente en la regin
Costa, el 45,4% en la regin Sierra, el 5% en la regin de la Amazona y el 0,1% en la
regin Insular. Probablemente, las diferencias porcentuales de discapacidades en las
diferentes regiones del Ecuador se deban al nmero poblacional, a los problemas de
seguridad laboral y a la complejidad en el tratamiento de los problemas fsicos debido a
escasos recursos.
En la Tabla VII.1 se detalla la prevalencia de discapacidad de las 24 provincias
que conforman el territorio ecuatoriano. La provincia de Bolvar, perteneciente a la
regin Sierra, present la prevalencia ms alta con 30,4 por cada 1000 habitantes,
seguida en orden descendente por Cotopaxi (27,0), Chimborazo (26,9), Caar (26,8),
Carchi (26,4), Zamora Chinchipe (25,1). Las provincias que mayor nmero de
discapacitados presentaron fueron: Guayas (74833), Pichincha (44675) y Manab
(27723).
Con respecto a la discapacidad intelectual, las provincias con mayor distribucin
proporcional son: Guayas (2,6), Manab (1,1), Pichincha (1), El Oro (0,5), Los Ros
(0,5), Azuay (0,4), Esmeraldas (0,4) y Loja (0,4). Mientras que las provincias con
mayor distribucin proporcional en otras discapacidades son: Guayas (8), Pichincha (5),
Manab (2,8), El Oro (1,5) y Los Ros (1,4).

ORIGEN GENTICO DE LAS DISCAPACIDADES EN EL ECUADOR

86

Tabla VII.1. Nmero y tasa de prevalencia de discapacidad segn provincias

Provincias
Azuay
Bolvar
Caar
Carchi
Chimborazo
Cotopaxi
El Oro
Esmeraldas
Galpagos
Guayas
Imbabura
Loja
Los Ros
Manab
Morona Santiago
Napo
Orellana
Pastaza
Pichincha
Santa Elena
Santo Domingo
Sucumbos
Tungurahua
Zamora Chinchipe
Total
Porcentaje

Clasificacin
Discapacidad intelectual
Otras discapacidades
Total
Distribucin
Distribucin
No.
No.
proporcional
proporcional
3035
0,4
9930
1,4
12965
1311
0,2
4280
0,6
5591
1384
0,2
4654
0,7
6038
774
0,1
3573
0,5
4347
2261
0,3
10067
1,4
12328
2299
0,3
8742
1,2
11041
3529
0,5
10332
1,5
13861
3004
0,4
6492
0,9
9496
85
0
187
0
272
18352
2,6
56481
8
74833
1464
0,2
5924
0,8
7388
2897
0,4
7799
1,1
10696
3462
0,5
9621
1,4
13083
7957
1,1
19766
2,8
27723
756
0,1
2107
0,3
2863
635
0,1
1427
0,2
2062
720
0,1
1570
0,2
2290
431
0,1
1303
0,2
1734
9481
1
35194
5
44675
1625
0,2
4728
0,7
6353
1953
0,3
5167
0,7
7120
1096
0,2
2396
0,3
3492
2194
0,3
9004
1,3
11198
712
0,1
1582
0,2
2294
71417
222326
293743
24
76
100
Tasa / 1000 habitantes

Tasa / 1000
habitantes
18,2
30,4
26,8
26,4
26,9
27,0
23,1
17,8
10,8
20,5
18,6
23,8
16,8
20,2
19,4
13,9
16,8
20,6
17,3
20,6
19,3
19,8
23,2
25,1

20,3

(MSME, 2013)
Con respecto a la prevalencia de personas con discapacidad segn grupos de
edades, el grupo de 60 y ms aos de edad present un total de 127616 individuos
discapacitados y una prevalencia de 95 por cada 1000 habitantes, seguido por los grupos
de 40 a 59 aos (20,9), de 30 a 39 aos (12,4), de 15 a 19 aos (11,5), de 5 a 14 aos
(11) y de 0 a 4 aos (6,2). Las provincias que mayor nmero de individuos
discapacitados presentaron entre los 60 y ms aos de edad fueron Guayas (31351),
Pichincha (20835), Manab (10242) y Tungurahua (6369).
En la Tabla VII.2 se detalla el nmero y la prevalencia segn el tipo de
discapacidad en las 24 provincias. La discapacidad fsico motora se present en el
Ecuador como la causa ms frecuente de discapacidad con un total de 107522 afectos y
una prevalencia de 7,4 por cada 1000 habitantes. Los otros tipos de discapacidad desde
la mayor hasta la menor prevalencia encontrada fueron: intelectual (4,9), mltiple (2,7),
auditiva (2,3), visual (1,9), mental (0,8) e insuficiencia renal crnica (0,2). En relacin a
la discapacidad fsico motora, las provincias con mayor prevalencia de individuos
afectos fueron Chimborazo (11,5), Caar (9,7) y Bolvar (9,66). Sobre la discapacidad
intelectual, las provincias con mayor prevalencia fueron Zamora Chinchipe (7,8),
Bolvar (7,1) y Loja (6,5) por cada 1000 habitantes.

Tabla VII.2. Prevalencia de personas segn tipo de discapacidad y provincia


Provincia

Intelectual
Azuay
3035
Bolvar
1311
Caar
1384
Carchi
774
Chimborazo
2261
Cotopaxi
2229
El Oro
3529
Esmeraldas
3004
Galpagos
85
Guayas
18353
Imbabura
1464
Loja
2897
Los Ros
3462
Manab
7957
Morona Santiago
756
Napo
635
Orellana
720
Pastaza
431
Pichincha
9481
Santa Elena
1625
Santo Domingo
1953
Sucumbos
1096
Tungurahua
2194
Zamora Chinchipe
712
Total
71417
Tasa / 1000 habitantes
4,9
(IRC) Insuficiencia renal crnica.

Tasa Fsico motora


4,2
4743
7,1
1774
6,2
2188
4,7
1500
5,5
4708
4,9
3837
5,9
5113
5,6
3523
3,4
94
5,0
28893
3,7
2285
6,5
3551
4,5
5393
5,8
10508
5,1
1052
6,1
681
5,2
782
5,1
572
3,7
15162
5,3
2460
5,3
2842
6,2
1087
4,4
4037
7,8
737
4,9
107522
7,4

Tasa Mltiple
6,7
2138
9,7
868
9,7
873
9,1
642
11,5
2111
8,4
1562
8,5
1760
6,6
658
3,7
25
7,9
9368
5,7
912
7,9
1367
6,9
1246
7,7
2572
7,1
315
6,6
149
5,7
168
6,8
234
5,9
7887
8,0
670
7,7
724
6,2
221
8,0
1954
8,1
257
7,4 38681
2,7

Discapacidades
Tasa Auditiva Tasa Visual Tasa Mental Tasa
IRC
3,0
1368 1,9 1034 1,5
489 0,7 158
4,7
946 5,2
488 2,7
189 1,0
15
3,9
839 3,7
502 2,2
225 1,0
27
3,9
817 5,0
422 2,6
177 1,1
15
5,2
2092 5,1
872 2,1
258 0,6
26
3,4
2120 4,6
955 2,1
250 0,6
18
2,9
1199 2,0 1339 2,2
795 1,3 126
1,2
863 1,6 1126 2,1
292 0,6
30
1,0
20 0,8
30 1,2
17 0,7
1
2,5
5930 1,6 7228 2,0 4224 1,2 838
2,3
1869 4,7
580 1,5
256 0,6
22
3,0
1291 2,9
926 2,1
616 1,4
48
1,6
1135 1,5 1261 1,6
474 0,6 112
1,9
2622 1,9 2768 2,0
992 0,7 304
2,1
319 2,2
317 2,1
97 0,7
7
1,4
343 3,3
206 2,0
41 0,4
7
1,2
299 2,2
252 1,9
63 0,5
6
2,8
247 2,9
194 2,3
44 0,5
12
3,1
5398 2,1 4358 1,7 1947 0,8 442
2,2
656 2,1
632 2,1
266 0,9
44
2,0
694 1,9
551 1,5
288 0,8
68
1,3
537 3,0
420 2,4
125 0,7
6
3,9
1933 3,8
702 1,4
337 0,7
41
2,8
291 3,2
196 2,1
90 1,0
11
2,7 33828 2,3 27359 1,9 12552 0,9 2384
2,3
1,9
0,8
0,2

Tasa
0,2
0,1
0,1
0,1
0,1
0,04
0,2
0,1
0,04
0,2
0,1
0,1
0,1
0,2
0,1
0,1
0,04
0,1
0,2
0,1
0,2
0,03
0,1
0,1
0,2

(MSME, 2013)

ORIGEN GENTICO DE LAS DISCAPACIDADES EN EL ECUADOR

88

En la Tabla VII.3 se detalla el nmero de individuos con discapacidad segn la


clasificacin etiopatognica y sus respectivas prevalencias. En el grupo postnatal se
observ la prevalencia ms alta con 11,9 por cada 1000 habitantes correspondiendo a un
total de 172680 individuos con discapacidad. Los siguientes grupos con mayor
prevalencia fueron prenatal (5,8) y perinatal (1,9).
Con respecto al grupo postnatal, las provincias que ms individuos
discapacitados presentaron fueron Guayas (44328), Pichincha (26267) y Manab
(15524).
Tabla VII.3. Prevalencia y etapa de desarrollo de las discapacidades
Provincias
Azuay
Bolvar
Caar
Carchi
Chimborazo
Cotopaxi
El Oro
Esmeraldas
Galpagos
Guayas
Imbabura
Loja
Los Ros
Manab
Morona Santiago
Napo
Orellana
Pastaza
Pichincha
Santa Elena
Santo Domingo
Sucumbos
Tungurahua
Zamora Chinchipe
Total
Porcentaje
Tasa /
1000 habitantes

Prenatal
3546
1689
1673
1115
2981
2872
4251
2985
94
20611
2134
3520
3624
8656
850
710
739
490
12782
2107
2149
1175
3168
735
84656
28,8
5,8

Perinatal
1234
472
528
271
849
670
1427
902
36
7972
590
1124
1270
2861
304
203
265
172
4226
724
724
341
838
287
28290
9,6
1,9

Postnatal
7847
3167
3695
2823
8190
7175
7872
5223
135
44328
4364
5823
7817
15524
1648
1090
1218
1037
26267
3366
4096
1874
6873
1228
172680
58,8
11,9

Psicosis
44
15
17
11
23
24
56
36
1
383
25
31
33
87
11
7
11
3
157
24
28
11
23
6
1067
0,4
0,1

Inclasificado
294
248
125
127
285
300
255
350
6
1539
275
198
339
595
50
52
57
32
1243
132
123
91
296
38
7050
2,4
0,5

Total
12965
5591
6038
4347
12328
11041
13861
9496
272
74833
7388
10696
13083
27723
2863
2062
2290
1734
44675
6353
7120
3492
11198
2294
293743
100
20,3

Porcentaje
4,4
1,9
2,1
1,5
4,2
3,8
4,7
3,2
0,1
25,5
2,5
3,6
4,5
9,4
1,0
0,7
0,8
0,6
15,2
2,2
2,4
1,2
3,8
0,8
100

(MSME, 2013)

3.FACTORESGENTICOSASOCIADOSALASDISCAPACIDADES
El estudio de la Misin Solidaria Manuela Espejo permiti identificar los
defectos congnitos y enfermedades genticas que aquejan a las personas con
discapacidad intelectual.
Existen diversos factores, entre ellos los ambientales, que al actuar en etapas
tempranas del desarrollo del embrin pueden desencadenar defectos malformativos
debido a la alteracin del material gentico.

ORIGEN GENTICO DE LAS DISCAPACIDADES EN EL ECUADOR

89

Con respecto a las causas prenatales de 20285 personas con discapacidad


intelectual en el Ecuador, se observ un predominio de las etiologas multifactoriales
(42%) y cromosmicas (42%). Las provincias con mayor prevalencia de etiologa
prenatal gentica encontrada son Zamora Chinchipe (2,41), Bolvar (2,28) y Loja (2,11).
No se posee informacin de los otros 51132 casos (Tabla VII.4).
En la etiologa prenatal gentica multifactorial, adems del perfil gentico de
cada individuo, se asocian otros factores ambientales que permite el desarrollo de un
fenotipo especfico que presente discapacidad cognitiva. Se evidenci antecedente
familiar de retraso mental y la existencia de consanguinidad parental en 8526 personas.
La consanguinidad es el fenmeno responsable de las altas frecuencias de
enfermedades genticas asociadas a las discapacidades en varias provincias del pas.
Con respecto a la etiologa cromosmica, 8450 personas presentaron este problema,
correspondiendo la gran mayora al diagnstico con el sndrome de Down.
Tabla VII.4. Clasificacin de las causas genticas en personas con discapacidad
Provincias

Clasificacin etiolgica
Monognico

Azuay
Bolvar
Caar
Carchi
Cotopaxi
Chimborazo
El Oro
Esmeraldas
Galpagos
Guayas
Imbabura
Loja
Los Ros
Manab
Morona Santiago

Napo
Orellana
Pastaza
Pichincha
Santa Elena
Santo Domingo
Sucumbos
Tungurahua
Zamora
Chinchipe
Total
Porcentaje

Tasa

Cromosmico

Tasa

Multifactorial

Tasa

Total

Tasa

179
54
94
102
252
123
151
164
2
402
82
232
128
553
36
51
61
34
296
34
53
78
87
61

0,25
0,29
0,42
0,62
0,62
0,27
0,25
0,31
0,08
0,11
0,21
0,52
0,16
0,40
0,24
0,49
0,45
0,41
0,11
0,11
0,14
0,44
0,17
0,67

298
109
118
54
155
146
446
318
10
2446
136
328
551
1050
87
68
75
44
1120
187
286
128
218
72

0,42
0,59
0,52
0,33
0,38
0,32
0,74
0,60
0,40
0,67
0,34
0,73
0,71
0,77
0,59
0,66
0,55
0,52
0,43
0,61
0,78
0,73
0,43
0,79

449
256
219
101
262
420
509
363
12
1910
129
389
282
642
96
51
85
41
1202
221
280
128
392
87

0,63
1,39
0,97
0,61
0,64
0,92
0,85
0,68
0,48
0,52
0,32
0,87
0,36
0,47
0,65
0,49
0,62
0,49
0,47
0,72
0,76
0,73
0,78
0,95

926
419
431
257
669
689
1106
845
24
4758
347
949
961
2245
219
170
221
119
2618
442
619
334
697
220

1,30
2,28
1,91
1,56
1,63
1,50
1,84
1,58
0,96
1,31
0,87
2,11
1,24
1,64
1,48
1,64
1,62
1,42
1,02
1,43
1,68
1,89
1,38
2,41

3309
16

0,23

8450
42

0,58

8526
42

0,59

20285

1,40

100

(MSME, 2013)
3.1.Agentesambientalescomocausasprenatales

La exposicin a ciertos factores ambientales desencadena un importante nmero


de defectos congnitos y fetopatas asociadas con discapacidad. Ejemplos histricos de
alteracin del material gentico son las bombas atmicas en Hiroshima y Nagasaki, las

ORIGEN GENTICO DE LAS DISCAPACIDADES EN EL ECUADOR

90

sustancias txicas en Chernbil y Fukushima, la ingestin de talidomina y el uso


indiscriminado de pesticidas como el glifosato (Paz-y-Mio & Lpez-Corts, 2011).
En relacin a los agentes ambientales en personas con discapacidad intelectual,
se puede observar una asociacin en 4716 personas del Ecuador. La hipertensin se
encuentra presente en el 27% de los individuos, seguido de las infecciones fetales
(26%), alcoholismo (9%), hipertermia (7%), afecciones fetales (5%) y drogas (2%).
En cuanto a las provincias del Ecuador, las tasas ms altas de individuos
afectados con agentes ambientales son Esmeraldas (0,67), Sucumbos (0,57), Orellana
(0,52), Cotopaxi (0,50), Pastaza (0,48), Napo (0,47), Carchi (0,43), Caar (0,41),
Manab (0,39), Bolvar (0,38), Guayas (0,36), Los Ros (0,35), El Oro (0,32), Zamora
Chinchipe (0,31), Loja (0,29), Morona Santiago (0,29), Santa Elena (0,28), Santo
Domingo (0,28), Azuay (0,23), Imbabura (0,22), Pichincha (0,20), Chimborazo (0,20),
Tungurahua (0,19) y Galpagos (0,16).
Con respecto al grupo prenatal inespecfico, se observ que 3567 personas
presentaron epilepsia, 3005 presentaron antecedentes de discapacidad de parientes
lejanos, 1207 mostraron patrones dismrficos que no especifican una enfermedad
gentica encuadrable o atribuida a otros factores (Tabla VII.5).

Los mdicos brigadistas observaron que la mayora de las madres cuyos hijos se
encuentran en el grupo crecimiento intrauterino retardado, mencionaron que no
tuvieron conocimiento ni control de su gestacin. Las provincias con mayor frecuencia
de causas prenatales inespecficas fueron Guayas (2225), Manab (1123) y Pichincha
(1034).

3.2.Causasperinatalesypostnatalesenladiscapacidadintelectual

En la Tabla VII.6 se detallan los eventos relacionados con el parto y los siete
das posteriores al mismo como causa de discapacidad intelectual mediante
recordatorio. Los eventos que ocurrieron con mayor frecuencia fueron la hipoxia
(14652), la prematuridad (5405), los traumas perinatales (798) y la sepsis (256).
Mientras que las provincias con mayor tasa fueron Zamora Chinchipe (2,85), Bolvar
(2,30) y Loja (2,23).

Con respecto a los factores postnatales evidenciados por recordatorio, las


infecciones del SNC afectan a 3853 personas (especialmente meningoencefalitis), los
traumas o accidentes ocurrieron en 2290 personas y las infecciones en 1753 individuos
(TablaVII.7). Las medidas sanitarias en todas las regiones del Ecuador son de extrema
importancia, y van a la par del proceso de educacin de la poblacin. Los programas de
salud con respecto a la vacunacin han tenido bastante xito a nivel nacional, pero an
existen zonas rurales con condiciones higinicas extremadamente desfavorables.

En conclusin, todos los factores ambientales, perinatales y postnatales, en su gran


mayora son prevenibles, por lo que, si se reduciran a cero, las cifras de discapacidad
intelectual podra llegar a ser inferiores. Esta labor es clave siempre y cuando las
diferentes instituciones pblicas, privadas y sociedad se unan para trabajar por un
mismo beneficio.

Tabla VII.5. Nmero y tasa del grupo prenatal inespecfico

Provincias
Dismorfias
Tasa
MCA
Tasa
AF
Tasa
Epilepsia
Tasa
CIR
Azuay
72
0,10
17
0,02
157
0,22
145
0,20
22
Bolvar
25
0,14
3
0,02
68
0,37
45
0,25
16
Caar
13
0,06
5
0,02
51
0,23
56
0,25
16
Carchi
16
0,10
2
0,01
18
0,11
26
0,16
18
Chimborazo
38
0,09
9
0,02
148
0,36
79
0,19
28
Cotopaxi
57
0,12
5
0,01
155
0,34
98
0,21
30
El Oro
57
0,09
20
0,03
162
0,27
183
0,30
30
Esmeraldas
66
0,12
22
0,04
147
0,28
131
0,25
30
Galpagos
2
0,08
0,00
2
0,08
6
0,24
Guayas
256
0,07
107
0,03
590
0,16
1014
0,28
258
Imbabura
40
0,10
6
0,02
116
0,29
59
0,15
22
Loja
49
0,11
16
0,04
139
0,31
129
0,29
30
Los Ros
82
0,11
20
0,03
143
0,18
174
0,22
30
Manab
111
0,08
31
0,02
429
0,31
485
0,35
67
Morona Santiago
15
0,10
2
0,01
22
0,15
34
0,23
11
Napo
21
0,20
1
0,01
35
0,34
34
0,33
7
Orellana
27
0,20
3
0,02
23
0,17
28
0,21
3
Pastaza
9
0,11
1
0,01
6
0,07
18
0,21
4
Pichincha
149
0,06
52
0,02
277
0,11
427
0,17
129
Santa Elena
28
0,09
8
0,03
55
0,18
113
0,37
25
Santo Domingo
25
0,07
6
0,02
87
0,24
100
0,27
25
Sucumbos
19
0,11
6
0,03
53
0,30
48
0,27
26
Tungurahua
23
0,05
6
0,01
95
0,19
91
0,18
27
Zamora Chinchipe
7
0,08
4
0,04
27
0,30
44
0,48
7
Total
1207
0,08
352
0,02 3005
0,21
3567
0,25
861
Porcentaje
13
4
33
40
10
(MCA) Malformaciones congnitas asociadas; (AF) Antecedentes familiares; (CIR) Crecimiento intrauterino retardado.

Tasa
0,03
0,09
0,07
0,11
0,07
0,07
0,05
0,06
0,00
0,07
0,06
0,07
0,04
0,05
0,07
0,07
0,02
0,05
0,05
0,08
0,07
0,15
0,05
0,08
0,06

Total
413
157
141
80
302
345
452
396
10
2225
243
363
449
1123
84
98
84
38
1034
229
243
152
242
89
8992
100

Tasa
0,58
0,85
0,63
0,49
0,74
0,75
0,75
0,74
0,40
0,61
0,61
0,81
0,58
0,82
0,57
0,95
0,62
0,45
0,40
0,74
0,66
0,86
0,48
0,97
0,68

(MSME, 2013)

Tabla VII.6. Grupo perinatal y causas asociadas al parto

Provincias
Hipoxia
Azuay
642
Bolvar
288
Caar
318
Carchi
176
Chimborazo
463
Cotopaxi
445
El Oro
809
Esmeraldas
461
Galpagos
21
Guayas
3678
Imbabura
269
Loja
673
Los Ros
612
Manab
1602
Morona Santiago
160
Napo
118
Orellana
138
Pastaza
84
Pichincha
2211
Santa Elena
352
Santo Domingo
369
Sucumbos
182
Tungurahua
415
Zamora Chinchipe
166
Total
14652
Porcentaje
60
(TP) Traumas perinatales.

Tasa
0,90
1,57
1,41
1,07
0,97
1,13
1,35
0,86
0,84
1,01
0,68
1,50
0,79
1,17
1,08
1,14
1,01
1,00
0,86
1,14
1,00
1,03
0,82
1,82
1,01

TP
34
12
24
6
22
22
33
33
200
22
22
41
99
8
3
6
4
114
17
23
12
27
14
798
3

Tasa
0,048
0,065
0,107
0,036
0,048
0,054
0,055
0,062
0,055
0,055
0,049
0,053
0,072
0,054
0,029
0,044
0,048
0,044
0,055
0,062
0,068
0,054
0,153
0,055

Prematuridad
218
59
71
25
106
53
247
105
7
1960
100
162
237
516
43
23
50
34
841
158
139
59
134
58
5405
22

Tasa
0,31
0,32
0,32
0,15
0,12
0,26
0,41
0,20
0,28
0,54
0,25
0,36
0,30
0,38
0,29
0,22
0,37
0,41
0,33
0,51
0,38
0,33
0,27
0,63
0,37

Sepsis
7
4
1
1
6
6
6
17
2
66
4
9
16
46
2
4
3
4
24
9
6
5
7
1
256
1

Tasa
0,010
0,022
0,004
0,006
0,013
0,015
0,010
0,032
0,080
0,018
0,010
0,020
0,021
0,034
0,014
0,039
0,022
0,048
0,009
0,029
0,016
0,028
0,014
0,011
0,018

Otras
162
59
30
21
87
54
128
151
3
1030
84
133
193
216
45
21
23
18
323
79
95
30
130
21
3136
13

Tasa
0,23
0,32
0,13
0,13
0,12
0,21
0,21
0,28
0,12
0,28
0,21
0,30
0,25
0,16
0,30
0,20
0,17
0,21
0,13
0,26
0,26
0,17
0,26
0,23
0,22

Total
1063
422
444
229
684
580
1223
767
33
6934
479
999
1099
2479
258
169
220
144
3513
615
632
288
713
260
24247
100

Tasa
1,49
2,30
1,97
1,39
1,26
1,67
2,04
1,44
1,31
1,90
1,20
2,23
1,41
1,81
1,74
1,63
1,61
1,72
1,36
1,99
1,72
1,63
1,41
2,85
1,67

(MSME, 2013)

Tabla VII.7. Grupo postnatal y causas asociadas al parto


Provincias
Infecciones
Azuay
46
Bolvar
28
Caar
32
Carchi
17
Chimborazo
43
Cotopaxi
52
El Oro
69
Esmeraldas
112
Galpagos
Guayas
416
Imbabura
23
Loja
62
Los Ros
144
Manab
338
Morona Santiago
26
Napo
18
Orellana
24
Pastaza
13
Pichincha
126
Santa Elena
41
Santo Domingo
46
Sucumbos
33
Tungurahua
29
Zamora Chinchipe
15
Total
1753
Porcentaje
21
(SNC) Sistema nervioso central.

Tasa
0,06
0,15
0,14
0,10
0,11
0,11
0,11
0,21
0,11
0,06
0,14
0,19
0,25
0,18
0,17
0,18
0,15
0,05
0,13
0,12
0,19
0,06
0,16
0,12

Infeccin SNC
89
40
61
28
90
111
157
210
7
993
74
137
260
587
54
52
39
27
468
76
107
76
82
28
3853
46

Tasa
0,12
0,22
0,27
0,17
0,24
0,22
0,26
0,39
0,28
0,27
0,19
0,31
0,33
0,43
0,37
0,50
0,29
0,32
0,18
0,25
0,29
0,43
0,16
0,31
0,27

Traumas
107
44
64
23
103
81
113
92
540
58
83
81
223
23
26
14
21
341
51
71
42
60
29
2290
27

Tasa
0,15
0,24
0,28
0,14
0,18
0,25
0,19
0,17
0,15
0,15
0,18
0,10
0,16
0,16
0,25
0,10
0,25
0,13
0,17
0,19
0,24
0,12
0,32
0,16

Otros
19
7
8
5
14
17
26
26
1
114
11
12
30
61
8
11
9
3
48
14
16
10
8
10
488
6

Tasa
0,03
0,04
0,04
0,03
0,04
0,03
0,04
0,05
0,04
0,03
0,03
0,03
0,04
0,04
0,05
0,11
0,07
0,04
0,02
0,05
0,04
0,06
0,02
0,11
0,03

Total
261
119
165
73
250
266
365
470
8
2067
166
294
515
1209
111
107
86
64
983
182
240
165
179
82
8427
100

Tasa
0,37
0,65
0,73
0,44
0,61
0,58
0,61
0,88
0,32
0,57
0,42
0,65
0,66
0,88
0,75
1,03
0,63
0,76
0,38
0,59
0,65
0,93
0,35
0,90
0,58

(MSME, 2013)

ORIGEN GENTICO DE LAS DISCAPACIDADES EN EL ECUADOR

94

Adems de todas las causas prenatales, perinatales y postnatales, las brigadas


mdicas han determinado diferentes patologas genticas presentes en un grupo de
personas con discapacidad. Las diferentes enfermedades se enlistan en la siguiente
tabla:
Tabla VII.8. Otras patologas genticas presentes en personas con discapacidad
Aarskog
Albinismo
Alcoholismo fetal
Aminoacidemia orgnica
Apert
Artrogiposis
Asimetras faciales
Ataxia cerebelosa
Atrofia espinal
Barden Bield
Corea de Huntington
Cornellia de Lange
Craniocinostosis
Crecimiento intrauterino retardado
Crouzon
Diabetes mellitus
Dismorfias faciales inclasificadas
Dismorfias inclasificables
Disostosis mandibulofacial
Displasia ectodrmica
Displasia esqueltica
Displasia frontometafisiaria
Displasia frontonasal
Distrofia miotnica de Steinert
Distrofia muscular Duchenne
Down
Dyggve-Melchior-Clausen
Elis Van Klever
Epilepsia
Retardo mental ligado al X
Esclerosis tuberosa
Fenilcetonuria
Genodermatosis
Hidrocefalia
Hipomelanosis de Ito
Hipotiroidismo congnito
Hunter
9qh+
Maullido de gato 5pPrader Willi
Turner
X frgil

Patologas genticas
Hurler
Incompatibilidad Rh
Incontinencia pigmentaria
Insensibilidad congnita al dolor
Kabuki
Klinefelter
Kniest
Laron
Leucodistrofia metacromtica
Marfan
Meningocele
Microftalmia de Lenz
Mielomeningocele
Miller Dieker
Morgan
Morquio
Neurofibromatosis tipo I
Noonan
Norrie
Olivier McFarlane
Otopalatodigital II
Pentasomia X
Polimalformaciones inclasificadas
Prader Willi
Preclamsia
Progeria
Proteus
Pubertad precoz
Retardo mental
Rett
Robinow
Rubeola congnita
Rubinstein Taybi
Seckel
Silver Russel
Sphrintzer
Williams
Cromosomopatas
del 17 (p11.2)
Pentasomia X
Trisoma 18
Wolf 4pTrisoma 21

(MSME, 2013)

ORIGEN GENTICO DE LAS DISCAPACIDADES EN EL ECUADOR

95

4.SNDROMEDEDOWNENELECUADOR

El sndrome de Down es un trastorno gentico que puede ser causado por varios
factores, siendo uno de ellos la presencia de una copia extra del cromosoma 21 (trisoma
21), y otro, la duplicacin de la regin 21q22. Los individuos con este sndrome
presentan un grado variable de retraso mental y rasgos fsicos peculiares que le dan un
aspecto reconocible. Es la causa ms frecuente de discapacidad psquica congnita y
debe su nombre a John Langdon Haydon Down, que fue el primero en describir esta
alteracin gentica en 1866.
Ms del 90% de casos con este sndrome deben el exceso del cromosoma 21 a
un error ocurrido durante la primera divisin meitica de la clula germinal (ovario o
espermatozoide). La generacin del cariotipo 47, XX, +21 en mujeres y 47, XY, +21 en
hombres se debe a una disyuncin incompleta del material gentico.
El mosaico es la forma menos frecuente del sndrome de Down. Esta mutacin
se produce tras la concepcin, por lo que la trisoma no est presente en todas las clulas
del individuo con sndrome de Down, sino slo en aquellas cuya estirpe procede de la
primera clula mutada.
A nivel citogentico se ha encontrado que una baja cantidad de oxgeno
predispone a la no disyuncin cromosmica. Por ello, es probable que el factor
ambiental predominante en sitios andinos de gran altura, de alguna forma incremente el
riesgo de presentar los rearreglos observados a nivel gentico y cromosmico en los
individuos ecuatorianos con sndromes (Paz-y-Mio et al., 2002a).
Con respecto a la Misin Solidaria Manuela Espejo, del total de personas con
sndrome de Down (7792) por grupo de edad, se evidencia que el mayor nmero de
casos (4937) se concentra en las edades peditricas (menores de 19 aos). Este dato es
relevante debido a que esta etapa se considerada como escolar, y es cuando se pueden
desarrollar las potencialidades y habilidades pedaggicas para un mejor desempeo en
la vida. Las provincias con mayor prevalencia de sndrome de Down son Manab (0,74),
Santo Domingo (0,72) y Zamora Chinchipe (0,67) (Tabla VII.9).

Tabla VII.9. Tasa de personas con sndrome de Down en el Ecuador


Provincias
Azuay
Bolvar
Caar
Carchi
Chimborazo
Cotopaxi
El Oro
Esmeraldas
Galpagos
Guayas
Imbabura
Loja
Los Ros
Manab
Morona Santiago
Napo
Orellana
Pastaza
Pichincha
Santa Elena
Santo Domingo
Sucumbos
Tungurahua
Zamora Chinchipe
Total
Porcentaje

0a4
59
15
25
8
18
18
70
42
1
438
29
42
68
109
13
15
18
10
220
30
51
19
40
10
1368
18,5

Tasa
0,86
0,80
1,09
0,52
0,40
0,42
1,25
0,65
0,47
1,22
0,74
0,95
0,81
0,78
0,59
1,10
0,97
0,93
0,93
0,82
1,26
0,89
0,88
0,90
0,94

5 a 14
84
28
32
15
42
50
121
104
4
777
40
97
154
297
27
23
24
18
326
64
88
43
67
21
2546
33

Tasa
0,57
0,65
0,63
0,44
0,42
0,53
0,97
0,78
0,83
1,06
0,45
0,99
0,88
9,78
0,66
0,85
0,69
0,85
0,67
0,95
1,05
0,99
0,69
0,88
0,84

15 a 19
30
19
18
6
18
25
54
46
305
17
39
74
117
14
10
9
1
131
17
26
12
27
9
1024
13

Tasa
0,40
1,01
0,72
0,37
0,37
0,59
0,91
0,83
0,90
0,43
0,83
0,96
0,86
0,85
0,88
0,63
0,11
0,55
0,57
0,68
0,62
0,54
0,89
0,72

Grupos de edad (aos)


20 a 29
Tasa
30 a 39
52
0,40
38
16
0,60
15
23
0,62
7
16
0,62
3
30
0,40
13
25
0,37
8
73
0,71
38
59
0,68
28
2
0,44
380
0,60
225
15
0,23
9
63
0,87
26
86
0,68
77
223
1,01
156
10
0,42
10
11
0,64
3
12
0,49
3
7
0,49
2
193
0,40
71
33
0,63
15
54
0,83
22
22
0,70
12
33
0,38
24
11
0,73
7
1449
0,58
812
19
10

Total
Tasa
0,42
0,71
0,28
0,13
0,24
0,16
0,44
0,43
0,42
0,18
0,49
0,72
0,84
0,63
0,23
0,16
0,19
0,18
0,35
0,44
0,50
0,34
0,67
0,40

40 a 59
14
10
3
1
7
2
19
21
1
184
5
18
42
103
1
4
3
2
58
11
21
3
11
3
547
7

Tasa
0,11
0,32
0,08
0,03
0,09
0,03
0,16
0,24
0,19
0,25
0,07
0,22
0,30
0,40
0,05
0,26
0,15
0,16
0,11
0,20
0,33
0,11
0,11
0,22
0,20

> 60
1
1
2
1
2
4
4
1
3
12
1
6
2
3
1
2
46
0.5

Tasa
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0
0

278
104
108
49
130
129
377
304
8
2313
116
285
504
1017
76
66
69
40
1005
172
265
112
204
61
7792
100

Tasa
0,39
0,57
0,48
0,30
0,32
0,28
0,63
0,57
0,32
0,63
0,29
0,63
0,65
0,74
0,51
0,64
0,51
0,48
0,39
0,56
0,72
0,63
0,40
0,67
0,54

(MSME, 2013)

ORIGEN GENTICO DE LAS DISCAPACIDADES EN EL ECUADOR

97

El riesgo de nacimientos con sndrome de Down se incrementa con la edad


materna avanzada (ver el Captulo XV. Aspectos genticos del crecimiento y
desarrollo). La prevalencia de este sndrome al nacimiento es de 1 por cada 1000 nv en
mujeres menores de 35 aos, mientras que a partir de los 35 aos se incrementa a 1 por
cada 275 nacimientos, y en mujeres mayores de 40 aos a 1 por cada 100.
En Ecuador, el 48% de las madres de los nacidos con sndrome de Down, los
tuvieron en edades inferiores a los 35 aos, mientras que el 52% de ellas tena 35 aos o
ms en el momento de la concepcin, sugiriendo que las madres con edad avanzada
presentan mayores riesgos de tener hijos con este sndrome debido al envejecimiento
celular o a problemas genticos adquiridos con la edad (Tabla VII.10).
Tabla VII.10. Personas con sndrome de Down y edad materna en el embarazo
Provincias
Azuay
Bolvar
Caar
Carchi
Chimborazo
Cotopaxi
El Oro
Esmeraldas
Galpagos
Guayas
Imbabura
Loja
Los Ros
Manab
Morona Santiago
Napo
Orellana
Pastaza
Pichincha
Santa Elena
Santo Domingo
Sucumbos
Tungurahua
Zamora Chinchipe
Total
Porcentaje

< 20
28
4
3
3
8
12
35
23
1
311
3
13
37
71
8
7
5
6
85
18
18
11
9
3
722
9

Grupos de edad (aos)


20 a 34
35 a 39
> 40
112
50
83
38
20
41
45
22
37
22
4
20
51
12
55
53
19
43
147
72
116
94
62
121
6
1
833
421
645
44
24
40
90
62
119
202
95
162
398
192
326
33
17
18
21
12
25
26
12
26
6
3
22
446
178
271
69
37
46
109
48
86
33
21
45
90
35
68
18
13
27
2986
1431
2443
38
18
31

Total
No sabe
5
1
1
4
2
7
4
103
5
1
8
30
1
3
25
2
4
2
2
210
3

278
104
108
49
130
129
377
304
8
2313
116
285
504
1017
76
66
69
40
1.005
172
265
112
204
61
7792
100

(MSME, 2013)
5.ETNIASYDISCAPACIDADES
En gentica, el trmino etnia se lo usa haciendo referencia a grupos
poblacionales que comparten caractersticas genticas comunes. Para este estudio se
habla de comunidades indgenas y se considera la referencia de pueblos y
nacionalidades existentes en el pas.
En la Tabla VII.11 se detalla las diferentes causas de personas con discapacidad
pertenecientes a las comunidades indgenas del Ecuador.

Tabla VII.11. Comunidades indgenas y causas de discapacidad intelectual


Grupos
Achuar
Awa
Kaari
Karanki
Chachi
Cofn
Waorani
Kichwa
Natabuela
No aclara
Otavalo
Panzaleo
Puruw
Salasaca
Saraguro
Shiwiar
Shuar
Siona
Tsachila
Total
Porcentaje

Monognico

Cromosmico

Multifactorial

1
5
3
1
4
2
146
4
4
8
14
8
29
229
8

1
2
1
1
1
3
136
1
5
2
6
1
35
1
1
197
7

4
2
9
1
3
288
11
4
10
22
1
15
1
36
2
2
411
14

Prenatal
ambiental
2
1
6
5
3
1
1
276
9
7
18
10
11
48
3
401
13

Prenatal
inespecfico
3
9
2
7
2
3
153
7
3
4
1
6
27
1
228
8

Perinatal Postnatal Psicosis Inclasificado


8
4
13
9
9
3
3
552
1
5
23
30
12
2
35
2
139
5
855
28

4
2
9
2
5
1
2
252
2
12
8
15
10
74
1
399
13

1
16
2
1
1
21
1

Total

1
20
2
15
7
61
5
28
3
32
1
13
14
203 2022
1
32
5
69
4
84
7
84
4
9
100
4
12
401
3
1
14
260 3001
9
100

(MSME, 2013)

ORIGEN GENTICO DE LAS DISCAPACIDADES EN EL ECUADOR

99

El factor perinatal est presente en el 28%, el multifactorial en el 14% y el factor


prenatal ambiental en el 13% del total de personas indgenas con discapacidad. El grupo
kichwa presenta mayor nmero de personas con discapacidad con un total de 2022
(67,4%), seguido del grupo shuar con 401 (13,4%) y del grupo kichwa-saraguro con 100
personas (3,3%).
Las comunidades indgenas kichwa y shuar presentan mayor frecuencia de
factores monognico, cromosmico, multifactorial, prenatal ambiental, prenatal
inespecfico, perinatal, postnatal y psicosis.
En relacin a las provincias del Ecuador, las que presentan la mayor tasa
estimada de discapacidad intelectual son Napo (3,66), Morona Santiago (2,02) y Pastaza
(1,87), siendo un total de 3001 personas indgenas discapacitadas en Ecuador.
Con respecto al diagnstico de parlisis cerebral, 125 individuos con
discapacidad lo presentaron (70%). Mientras que 294 individuos presentaron algn
familiar con antecedentes de discapacidad (30%).
En cuanto a las comunidades indgenas, los tres grupos que presentan mayor
nmero de antecedentes familiares de personas con discapacidad y diagnstico de
parlisis cerebral son los kichwa (189) (82), shuar (37) (14) y kichwa-saraguro (17) (5),
respectivamente.
Tabla VII.12. Personas con discapacidad, diagnosticadas con parlisis cerebral
Comunidades
Achuar
Awa
Kaari
Karanki
Chachi
Cofn
Waorani
Kichwa
Natabuela
No aclara
Otavalo
Panzaleo
Puruw
Salasaca
Saraguro
Shiwiar
Shuar
Siona
Tsachila
Total
Porcentaje

Antecedentes familiares
2
1
12
7
1
5
2
189
1
1
5
12
17
37
2
294
70

Diagnstico parlisis cerebral


1
3
4
1
1
1
82
2
4
5
1
5
14
1
125
30

Total
3
1
15
11
2
6
3
271
3
5
10
12
1
22
51
2
1
419
100

(MSME, 2013)

Captulo VIII
Biologa Molecular y caracterizacin de las
poblaciones humanas

La estructura gentica de una poblacin viene determinada por las frecuencias


allicas presentes en cada loci de los cromosomas. Muchas de estas frecuencias son
tpicas de ciertas poblaciones y se convierten en marcadores genticos, por la diversidad
de proporciones que presentan (polimorfismo).
Las poblaciones humanas son polimrficas para un gran nmero de loci gnicos,
siendo los sistemas de marcadores polimrficos ms conocidos, los siguientes:

a)

Antgenos de los eritrocitos (ABO, Rh, MNSc).

b)

Antgenos de los leucocitos (HLA).

c)

Protenas del plasma (Hp, Tt, Gc).

d)

Variantes enzimticas de los eritrocitos (G6PDH).

e)

Segmentos polimrficos del ADN (SNPs y ADNm).

f)

Grupo de diferenciacin de clulas hematopoyticas (CD).

g)

Polimorfismos del citocromo P450 (CYP).

El estudio de ciertas protenas humanas ha servido para comprender varios


aspectos genticos de las poblaciones. Se sabe que la variabilidad gentica de los
anticuerpos humanos, reside en mutaciones ancestrales ocurridas hace unos 20 o 30
millones de aos, producidas por duplicaciones de genes y cambios puntuales de
nucletidos del ADN, resultando en la formacin de las regiones V, C, H y L de las
cadenas proteicas, la versatilidad funcional de las inmunoglobulinas (anticuerpos), y la
formacin de subclases de las cadenas J, D, mu, alfa, beta, gamma, delta, psilon y
kappa (Matson et al., 1966).
La diferencia de las cadenas kappa de las inmunoglobulinas, entre el ratn y el
hombre, est en el aminocido: 43 para el ratn y 110 para el hombre. La diferencia
para las cadenas gamma entre el conejo y el hombre est en el aminocido: 38 para el
conejo y 120 para el hombre. Estos datos posibilitan estudiar mejor la evolucin de las
especies, sus semejanzas y diferencias.
Otro marcador gentico poblacional constituye el sistema ABO, responsable de
los grupos sanguneos. Este permite conocer las distancias genticas entre poblaciones
que, aun en caso de estar prximas geogrficamente, tienen una diferente evolucin
gentica, llegando a ser totalmente distintas. Grupos de poblaciones que migran y que
tienen por lo tanto unos pocos genes consigo en relacin al total de la poblacin de
origen, provocan, en las otras reas geogrficas donde han emigrado, un efecto fundador
que, por el aislamiento geogrfico, tradiciones culturales y los cruces consanguneos, se
han aislado en etnias con caractersticas biolgicas y biopatolgicas tpicas. Estos

BIOLOGA MOLECULAR Y CARACTERIZACIN DE LAS POBLACIONES HUMANAS

104

grupos poblacionales presentan una mayor frecuencia de ciertas enfermedades, de


grupos sanguneos, de fenotipos, etc. y se convierten en verdaderos laboratorios para la
investigacin y el entendimiento de muchos aspectos nuevos en gentica poblacional.
Otros grupos sanguneos importantes en este sentido son el M, N, MN, Lewis, entre
otros.
Tabla VIII.1. Frecuencias gnicas de dos sistemas de antgenos en ecuatorianos
Sistema
ABO

Fenotipo

303
96
8736
32
9167

M
N
MN

234
17
121
372

0,792

A
B
O
AB

7
2
155
1
165

0,025

M
N
MN

159
0
6
165

0,982

Total
ABO
(Negros)
Total
MNS
(Negros)

p
0,018

A
B
O
AB

Total
MNS

No.

Total

Frecuencia gnica
q

0,007
0,975

0,208

0,009
0,966

0,018

Uno de los sistemas polimrficos ms interesantes y mejor estudiados es el


sistema de histocompatibilidad HLA (antgenos leucositarios humanos), cuyos genes, en
el hombre, se encuentran en el brazo corto del cromosoma 6. De todos los alelos del
sistema HLA, se sabe que sus combinaciones determinan 165 posibilidades genotpicas
pero, al estudiar las poblaciones humanas se ha observado que solo 37 son los
frecuentes, variando de una poblacin a otra (Chang et al., 1997). Las poblaciones
indgenas latinoamericanas tienen fuertes asociaciones genticas por ligamiento entre
los sistemas A28 B7 y el A11 B21; en otras etnias se encuentran:

A1 B8
Aw36, Aw43 y Bw43
Bw22
HLA 21
Aw33 y Aw 43
A28 B7 y A11 B21

Caucasoide
Negroides
Australoides (Mongoloides)
Poblacin del mediterrneo
Indonesios
Indios latinoamericanos

Al contrario que en varias poblaciones europeas, la poblacin indgena


latinoamericana tiene una clara tendencia a manifestar los alelos A y B en el sistema
HLA y presentar un menor nmero de variantes antignicas.

BIOLOGA MOLECULAR Y CARACTERIZACIN DE LAS POBLACIONES HUMANAS

105

Se sabe que ciertos marcadores genticos (caractersticas proteicas, enzimticas,


cromosmicas, inmunolgicas) estn relacionados con enfermedades especficas; esto
significa que una persona que tenga un marcador gentico especfico tiene mayor
probabilidad de desarrollar una determinada enfermedad, que otra persona que no tenga
el marcador (Tabla VIII.2).

Tabla VIII.2. Enfermedades y sus asociaciones a marcadores genticos


Enfermedad
S. de fragilidad cromosmica
S. de Down
S. de Turner
S. de Klinefelter
S. Martin Bell
lcera gstrica
Hepatitis crnica autoinmune
Lupus (LES)
Artritis reumatoide
Diabetes

Asociacin
Leucemias cromosmicas
Leucemias
Gonadoblastoma
Gonadoblastoma
Neoplasias
Grupos sanguneos
HLA
HLA
HLA
HLA

Marcador
Fragilidad
Trisoma 21
Monosoma X y variantes
47, XXY
Xq27
Tipo O
B8, DR3
B8
DR4
Dw4, Dw3

Los seres vivos existen en grupos, para un estudio gentico el grupo ms


apropiado es la poblacin, que se define como una comunidad de individuos que viven
en una localidad geogrfica determinada y que, real o potencialmente, son capaces de
cruzarse entre s, compartiendo un acervo comn de genes. Las poblaciones naturales
son difciles de estudiar porque sobre ellas actan simultneamente muchas fuerzas
genticas y ambientales que las pueden hacer variar (migracin, seleccin, deriva,
mutacin); por lo que al estudiar poblaciones humanas en particular, es clave utilizar
modelos matemticos.
Cuando se busca describir la distribucin de un locus con efecto fenotpico
distinguible en una poblacin natural, se empieza determinando la frecuencia de los
diferentes fenotipos en una muestra de la poblacin y, a continuacin, a partir de las
frecuencias fenotpicas, determinar las frecuencias genotpicas y las frecuencias allicas.
Resulta interesante estimar las frecuencias allicas porque la variacin de estas, a lo
largo del tiempo, determina el destino de la poblacin. Los modelos de gentica de
poblaciones se refieren casi siempre a la variacin de las frecuencias allicas a lo largo
del tiempo.
Las frecuencias allicas se pueden encontrar a partir de las fenotpicas, pero
stas no se pueden encontrar a partir de las frecuencias genotpicas. Por definicin, la
frecuencia de un alelo tiene un valor de 0 a 1. Si un alelo no existe en una poblacin, su
valor es 0; si ste est presente en la totalidad de la poblacin ser 1. La suma de las
frecuencias allicas presentes en una poblacin siempre es igual a 1. As, si existen dos
alelos A1 y A2, con frecuencias p y q, se puede deducir que p = 1 - q o q = 1 - p. Si en un
locus existen varios alelos, A1, A2, A3, con frecuencias p, q, r.....z, se cumple p + q + r
+......z = 1. Estas frmulas resultan de la aplicacin de la Ley de Hardy-Weinberg
(Nussbaum et al., 2008).
La estructura gentica de la poblacin se puede cuantificar no solo mediante las
frecuencias allicas y fenotpicas, se cuantifica mediante otros dos parmetros
denominados polimorfismos, que es una medida de la variacin de las frecuencias
allicas, y heterocigosis que es una medida de la variacin de los genotipos.

BIOLOGA MOLECULAR Y CARACTERIZACIN DE LAS POBLACIONES HUMANAS

106

Se dice que un locus es polimrfico cuando la frecuencia del alelo ms raro en la


poblacin es mayor a 0,01. El polimorfismo de una poblacin se estima como el nmero
de loci polimrficos dividido por el nmero total de loci. La heterocigosidad de la
poblacin es la frecuencia media de individuos heterocigotos y se estima calculando la
frecuencia de heterocigotos para cada locus y dividiendo para el nmero total de loci.
Ecuador es un pas con una poblacin con caractersticas fenotpicas diversas,
debido al gran entrecruzamiento intertnico sobre todo de origen hispnico y amerindio.
Esta poblacin est compuesta el 60% por mestizos, el 30% por nativos amerindios, el
8% por negros y el 2% por otros grupos tnicos como caucsicos, mongoloides y
rabes. La mezcla poblacional por lo tanto determina un flujo gentico importante que
induce a la aparicin de caractersticas complejas que se ven influenciadas por
determinantes geogrficos y ambientales que permiten la adaptacin del individuo al
medio donde este se desarrolla. Estos cambios evolutivos, muchos de ellos sutiles,
trazan un perfil poblacional tpico y colaboraran en la elaboracin de un patrn de
caracteres que podran ayudar en la deteccin de mutaciones o alteraciones genticas.
El modelo de Hardy-Weinberg demuestra matemticamente la distribucin de
alelos en una poblacin, preservando la variacin mendeliana, consiguiendo as
describir la distribucin de los genotipos y sus frecuencias para dos alelos alternantes
mediante la ecuacin p2 + 2pq + q2 = 1.
Ciertas caractersticas fenotpicas, algunas de las cuales son descritas en la
presente obra, fueron utilizadas por la Antropologa Fsica en la deteccin de trastornos
genticos y su distribucin tnica, y durante algn tiempo fueron invadidas por nociones
no cientficas sobre la directa relacin entre fenotipo y comportamiento, fenotipo e
inteligencia, entre otros. Hoy se sabe que diferentes poblaciones pueden tener diversas
caractersticas fenotpicas, bioqumicas y moleculares, que no significan diferencias
esenciales entre los grupos poblacionales, los conceptos de raza y aun los de etnia, que
cada vez son menos utilizados y se los est reemplazando por el de poblaciones con
similar base gentica.
En el Ecuador no existen estudios que describan la distribucin de las
frecuencias allicas de diferentes caractersticas de herencia mendeliana, por lo que
interesa documentar los datos sobre algunas de estas, y que a la vez puedan ser
relacionadas con alteraciones o variantes genticas.
En un estudio se evaluaron 15 caractersticas fenotpicas a 447 estudiantes de
Medicina de dos universidades de la ciudad de Quito durante el lapso de tres aos. Los
valores obtenidos fueron analizados con frmulas estndares de Gentica de
Poblaciones y ecuaciones de tendencia lineal. Se obtuvo las siguientes frecuencias: 15%
homocigotos dominantes, 27% heterocigotos y 58% homocigotos recesivos. En las
frecuencias allicas se observa una relacin inversamente proporcional entre los
individuos dominantes y recesivos, destacando que la tendencia para los heterocigotos
no presenta variaciones significativas. Las caractersticas dominantes ms comunes en
la poblacin estudiada son la produccin normal de insulina, el uso manual diestro, la
capacidad de doblar la lengua y el factor Rh positivo. Entre los fenotipos recesivos ms
frecuentes estn la ausencia de canas, la nariz recta y la ausencia de hoyuelos en las
mejillas. Los individuos heterocigotos tienen como caractersticas ms comunes los
orificios nasales anchos, los dedos cortos, la capacidad de enrollar la lengua y la

BIOLOGA MOLECULAR Y CARACTERIZACIN DE LAS POBLACIONES HUMANAS

107

presencia de vello en falanges intermedias. En las frecuencias allicas se encuentra una


relacin inversamente proporcional entre los individuos homocigotos dominantes y
recesivos. Se espera que estos datos puedan servir para evaluaciones fenotpicas de
pacientes dismrficos.

1.POLIMORFISMOSDELADN
Se conoce que existen variaciones interindividuales y poblacionales de ciertas
secuencias genticas. Dichas variaciones provocan diferencias genticas inespecficas
en los seres humanos y pueden estar concentradas en poblaciones con el mismo ancestro
histrico y geogrfico, determinando por lo tanto evidentes distinciones fenotpicas
(negro, blanco, amarillo, rojo). En esencia, la calidad de los genes de todos los
individuos es la misma. Las diferencias observables tienen ms bien inters biomdico.
Cuando una caracterstica, informacin o secuencia gentica se presenta en una
proporcin mayor al 1%, en una poblacin, se la denomina polimrfica (Nussbaum et
al., 2008). Los polimorfismos constituyen secuencias importantes que pueden
predisponer a los individuos y a las poblaciones a ciertas caractersticas patognicas y
anmalas. Entre los polimorfismos ms importantes estn:
1.1.Polimorfismosenlalongituddelosfragmentosderestriccin
Los polimorfismos en la longitud de los fragmentos de restriccin (RFLP) son
fragmentos de ADN de diversos tamaos obtenidos al digerirlo con enzimas de
restriccin (ADNasa de otras especies), que cortan al ADN en secuencias especficas.
Pueden ser observados en una simple electroforesis en geles de agarosa, como una
escalera en que cada peldao corresponde a un RFLP. Aproximadamente, un fragmento
se presenta por cada kilobase. Estos marcadores han sido de gran utilidad, pero su uso
ha decado al tener solo dos posibles alelos por cada fragmento (Krebs et al., 2009).
1.2.Repeticionesentndemdenmerovariable
Las repeticiones en tndem de nmero variable (VNTR) constituyen parte de los
minisatlites. Son secuencias de ADN pequeas (0,1 a 10 Kb), que se repiten en forma
continua en el genoma y son altamente polimrficas. Generalmente se encuentran en
regiones no codificantes, pero cuando se encuentran en regiones codificantes pueden ser
patognicos como en el caso de la enfermedad de Huntington y otras ataxias. En los
VNTR cortados por enzimas de restriccin pueden observarse hasta 100 variantes
allicas, pero al tener una densidad insuficiente en las poblaciones, su uso es limitado
para estudios poblacionales y de ubicacin de genes. Para su estudio se utiliza la
reaccin en cadena de la polimerasa (PCR) y se los observa en geles de agarosa y
acrilamida (Krebs et al., 2009).
1.3.Microsatlitesosecuenciascortasrepetidasentndem
Los microsatlites son secuencias cortas de ADN repetidas en el genoma (STR)
y se diferencian de los VNTR por el nmero de bases; las repeticiones ms comunes son
di, tri o tetranucletidos. Estn ampliamente diseminados en la poblacin y su uso es
clave en la identificacin de genes o variables poblacionales. Igualmente, se los analiza
mediante PCR y observacin en geles de acrilamida.

BIOLOGA MOLECULAR Y CARACTERIZACIN DE LAS POBLACIONES HUMANAS

108

Para la identificacin de un individuo se puede emplear varios mtodos basados


en caractersticas genticas; entre los ms utilizados se encuentran las isoenzimas, los
marcadores eritrocticos, el grupo sanguneo (ABO) y los STR. La eficacia depende de
la frecuencia con que se presenten en la poblacin.
Los loci STR estn dentro del grupo de ADN de secuencia repetitiva y se
caracterizan porque presentan un conjunto de bases especficas, el mismo que ir de 2
bases (dinucletidos) a 6 bases (hexanucletidos), pudiendo un alelo llegar a medir
hasta 500 bases. Los alelos de estos loci se reconocen por el nmero de veces en que la
secuencia base se encuentre presente, lo cual permite que los alelos se consideren como
unidades discretas, fcilmente diferenciables y se los pueda identificar de manera
sencilla. Los STR son frecuentes en el genoma humano (1 loci cada 300 a 500
kilobases), y muchos de ellos presentan un elevado polimorfismo, as como un alto
nivel de heterocigosis (entre 35 y 90%).
Diferentes loci han sido estudiados en diversas poblaciones humanas, de esta
manera se ha logrado establecer el nmero de alelos y sus frecuencias, as como el nivel
de heterocigosis de los loci. Estos datos son muy importantes pues nos permiten
establecer cules loci resultan ms informativos dentro de la poblacin estudiada. Los
actuales esfuerzos de los laboratorios estn encaminados a encontrar loci STR que,
usados en cualquier tipo de poblacin, nos aseguren individualizar a una persona por su
genotipo (haplotipo) y reducir la probabilidad de confusin a un mnimo porcentaje. Es
debido a ello que mientras mayor sea el nmero de loci empleados en un estudio, ser
menor la probabilidad de encontrar dos haplotipos que se asemejen.
En lo que se refiere al clculo de probabilidades, aplicable al estudio de STR,
ste se basa en el teorema de Bayes, el cual es una consecuencia inmediata de la ley de
la multiplicacin, que sirve para conocer las probabilidades finales de un suceso, a partir
de las probabilidades iniciales y dadas cierta informacin o informaciones adicionales
obtenidas. Este teorema nos da la probabilidad a posteriori de paternidad, a partir de
una probabilidad a priori (P0), dando como resultado la frmula de Essen-Moller que,
de manera simplificada, se expresa como Pp = X / X + Y, e indica la probabilidad que
tiene el probandus de ser el padre (X), comparado con un hombre al azar de la
poblacin (Y). Aqu el valor de X es el resultado del anlisis del caso, y el de Y la
frecuencia del alelo compartido por el imputado y el hijo. Sin embargo, la manera ms
adecuada de expresar la probabilidad de paternidad es a travs de una razn de
verosimilitudes, evitando as la circunstancia a priori; esta razn es conocida como
ndice de Paternidad (IP), que es simplemente X / Y. La conversin de ndice de
paternidad a probabilidad de paternidad es muy sencilla utilizando un a priori de 0,5, y
se expresa en las siguientes frmulas (Nussbaum et al., 2008):

P (w) = IP / (IP + 1) IP = P (w) / (1 P (w))

Nuestra experiencia al usar 17 loci STR de secuencia tetranucletida (4 bases)


nos ha dado como resultado la determinacin de la paternidad en 80% de casos en los
que la persona imputada apareci como posible padre, con un 99,999% de probabilidad,
mientras que en el 20% de los casos restantes se presentaron 4 y 6 exclusiones
respectivamente, con lo que se genera un descarte de primer orden. (Se descarta
paternidad si dos o ms STR no coinciden). De esta manera se determina que con un

BIOLOGA MOLECULAR Y CARACTERIZACIN DE LAS POBLACIONES HUMANAS

109

juego de cebadores para 12 loci STR se puede obtener una probabilidad de inclusin, en
casos de paternidad, superior al 99,9%; adems, un juego as nos permite reconocer 1
genotipo en 475 millones de genotipos. Los loci con los cuales hemos trabajado, se los
muestra en la siguiente tabla (Paz-y-Mio, 2006b).
Tabla VIII.3. Loci utilizados en pruebas de paternidad y forense
STR
D3S1358
HUMTH01
D21S11
D18S51
PENTA E
D5S818
D13S317
D7S820
D16S539
CSF1PO
PENTA D
VWA
D8S1179
TPOX
FGA
F13A1
FES/FPS
Amelogenina

Localizacin cromosmica
3p
11p15-15.5
21q
18q
15q
5q
13q22-q31
7q
16q22-q24
5q33-q34
21q
12p12pter
8p
2p23-2pter
4q28
6p24-p25
15q25
X
Y

No. de alelos descritos


10
9
17
15
21
9
13
12
11
12
16
18
10
11
21
8
6
1
2

Para el estudio descrito se obtuvo ADN de sangre perifrica de 404 individuos


no emparentados del grupo mestizo, a los cuales se les inform de la prueba y despus
de su consentimiento escrito, se amplific los exones de los 17 marcadores STR. Hay
una amplia discusin, sin acuerdo, sobre el tipo de poblacin seleccionada para el
estudio. Se decidi descartar la poblacin marcadamente negra, indgena o blanca,
considerando que la restante sera exclusivamente poblacin mestiza. Las muestras de
ADN se las someti a la PCR utilizando 34 juegos de cebadores especficos para cada
STR, incluyendo al gen amelogenina para determinar el sexo de los individuos. Se
realizaron 7676 reacciones y sus productos fueron evaluados en geles de acrilamida y
teidos con nitrato de plata.
Los resultados se muestran en las Tablas VIII.4a y VIII.4b, en donde se puede
observar las frecuencias para los diferentes STR. No se encontraron variantes nuevas de
STR. Al comparar estas frecuencias con poblaciones similares y diferentes a la
ecuatoriana, se aprecia mucha variacin. La poblacin estudiada es similar a unos y
diferente a otros grupos humanos, sean negroides, mongoloides o caucasoides. Los
datos confirman que la poblacin ecuatoriana estudiada es producto de varios cruces y
oleadas poblacionales, como lo sugieren estudios actuales con marcadores genticos de
mitocondrias y del cromosoma Y. La poblacin mestiza ecuatoriana, al menos la
estudiada, es polihbrida, como lo confirma el ndice de homocigocidad que est dentro
de los descritos para la poblacin mundial: entre el 29,4% para el marcador PENTA D
al 83,8% del D13S1317 (media de 53,64%), y con ndices bajos para el PENTA E
11,2% y el D18S51 con 21,2%. Mientras menor es el ndice de homocigocidad, se
encuentra mayor porcentaje de poblacin cruzada, dato a favor de un polihibridismo.

BIOLOGA MOLECULAR Y CARACTERIZACIN DE LAS POBLACIONES HUMANAS

110

De este estudio se desprenden otros datos poblacionales interesantes. El nmero


de individuos estudiados es importante. Se tiene una posibilidad de error de deteccin
de nuevas variantes en el orden de 0,002414 y, si se trata de aplicar los STR en estudios
de medicina forense, por ejemplo en paternidades, el poder de inclusin o exclusin o
de identificacin de individuos aplicando los 17 STR, llega al 99,997588%.
La experiencia de nuestro laboratorio en el uso de los STR para pruebas de
paternidad se inici en el ao 1999, y fue especial. Las pruebas se comenzaron con 12
STR hasta llegar a 17, aparte del gen de la amelogenina para tipificar el sexo. Lo
particular de estas pruebas es que el ndice de inclusin/exclusin de paternidad era
diferente al informado en la literatura, que llega al 30% para las exclusiones. Nuestros
datos mostraron un ndice de exclusin mucho ms alto: 41%. Esta diferencia se debe a
que esta prueba se inici por la necesidad social e institucional de contar con un
laboratorio de contraperitaje, lo que significa que las pruebas realizadas en otros
laboratorios del Ecuador y que no satisfacan a los implicados, solan ser reenviadas
para evaluacin a nuestro laboratorio, bajando notablemente el poder de inclusin de la
prueba a 59% y subiendo el de exclusin (Paz-y-Mio, 2006b). Actualmente existen
estndares de automatizacin mediante electroforesis capilar en relacin a 15 STR
dentro del Sistema de ndice de ADN Combinado (CODIS), los cuales estn siendo
aplicados en nuestro pas.
1.3.1.Microsatlitesygrupotnico
Interesa argumentar algo sobre el origen de la poblacin ecuatoriana desde el
punto de vista gentico y de los microsatlites en particular. Hace 500 aos los
conquistadores procedentes del sur de Espaa, con gran influencia gentica del norte de
frica y Oriente Medio, introdujeron nuevos elementos genticos en la poblacin
indgena americana. En ms de 1500 generaciones la presencia gentica en el Ecuador
es evidente. Dejando a un lado a la poblacin claramente caucasoide y claramente
negroide, el resto es blanco-mestiza, al punto de que se habla de un grupo tnico
sudamericano. Si aceptamos como vlidos estos conceptos, tendremos que aceptar que
cada grupo poblacional, por lo tanto, presentar variedad en la informacin gentica, lo
cual hace que los estudios actuales de la poblacin humana se encaminen a la diversidad
gentica y se centren en el Proyecto del Genoma Humano. Algunos estudios afirman
que los amerindios de toda Amrica provienen de un tronco comn asitico, segn lo
muestran los estudios de marcadores de ADN del cromosoma Y, especficamente el
microsatlite DYS19, que ha mostrado ms de cincuenta variantes, concentrndose en
los amerindios la variante IIA, que representa 13 repeticiones de la secuencia GATA,
distribuidas entre un 91% en Sudamrica, 87% en la Amazona brasilea y 38% en
Norteamrica. Estudios ms profundos con este mismo marcador microsatelital, una vez
descubierta una nueva variante, han mostrado que la poblacin amerindia proviene de
Asia; especficamente, se postula que los primeros habitantes de Amrica atravesaron el
estrecho de Bering y se produjo en ellos una mutacin en el microsatlite DYS19,
apareciendo un cambio de una T o una C en la secuencia, a la cual se la llam DYS199.
A este polimorfismo se lo ha encontrado exclusivamente en amerindios hasta una
proporcin del 91%, lo que hace suponer un efecto fundador de las poblaciones que
migraron desde Asia hace unos 30 mil aos (Paz-y-Mio, 2006b).
Entender el origen de la poblacin ecuatoriana es ms complejo por ahora, y
demanda estudios de otros marcadores que han mostrado ser ms informativos: ADN

BIOLOGA MOLECULAR Y CARACTERIZACIN DE LAS POBLACIONES HUMANAS

111

mitocondrial, polimorfismos de nucletidos simples y del cromosoma Y. De todas


maneras, aplicando los STR, el F13A1 en su alelo 5 y el D7S820 en su alelo 12, son los
marcadores que mostraron mayores diferencias con otras poblaciones de Latinoamrica
y podran ser los indicados para iniciar estudios ms profundos sobre cercanas o
lejanas poblacionales.
Tabla VIII.4a. Frecuencia de los STR en la poblacin mestiza ecuatoriana
Alelos
2,2
3,2
4
5
6
7
8
9
9,3
10
11
12
13
14
15
16
17
18
19
19,2
20
20,2
21
22
22,2
23
23,2
24
25
25,2
26
27
28
29
29,2
30
30,2
31
31,2
32
32,2
33
33,2
34,2
35
35,2
Suma
Alelos
IH

D3S1358

0,069
0,009
0,064
0,042
0,159
0,164
0,183
0,085
0,216
0,009

THO1

D21S11

0,001
0,001
0,102
0,261
0,212
0,059
0,102
0,136
0,013
0,112
0,001

D18S51

1
10
0,615

1
11
0,795

D5S818

0,022
0,001
0,069
0,029
0,009
0,003
0,018
0,079
0,118
0,244
0,153
0,112
0,142
0,058
0,032

0,047
0,062
0,163
0,068
0,058
0,131
0,102
0,058
0,064
0,034

0,017
0,011
0,005
0,005

0,028
0,032
0,015

0,003

0,005

0,002
0,001
0,011
0,068
0,193
0,005
0,241
0,031
0,077
0,151
0,006
0,141
0,002
0,062
0,003
0,005
0,001
1
16
0,760

PENTA E

D13S317

D7S820

0,118
0,036
0,097

0,058
0,107

0,002
0,005
0,049
0,041

0,057
0,321
0,229
0,087
0,047
0,008

0,074
0,163
0,276
0,163
0,141
0,018

0,189
0,262
0,352
0,076
0,023
0,001

1
9
0,808

1
8
0,838

1
10
0,570

0,001
0,002

1
15
0,212

1
20
0,112

Los STR nos brindarn la posibilidad de obtener un primer mapa gentico


ecuatoriano y aunque existen muchos grupos tnicos, es clave tener datos para poder
compararlos y sobre todo, que permitan una base para el anlisis de caractersticas
individuales o poblacionales.

BIOLOGA MOLECULAR Y CARACTERIZACIN DE LAS POBLACIONES HUMANAS

112

Tabla VIII.4b. Frecuencia de los STR en la poblacin mestiza ecuatoriana


Alelos
2,2
3,2
4
5
6
7
8
9
9,3
10
11
12
13
14
15
16
17
18
19
19,2
20
20,2
21
22
22,2
23
23,2
24
25
25,2
26
27
28
29
29,2
30
30,2
31
31,2
32
32,2
33
33,2
34,2
35
35,2
Suma
Alelos
H

D16S539

CSF1PO

PENTA D
0,005
0,001

VWA

D8S1179

TPOX

FGA

0,001
0,001
0,025
0129

0,003
0,002
0,011

0,006
0,012
0,168

0,159
0,198
0,214
0,121
0,101
0,052

0,176
0,301
0,211
0,285
0,011

0,216
0,125
0,146
0,173
0,056
0,063
0,026
0,002

0,012
0,009
0,001
0,002
0,001
0,002
0,036
0,067
0,328
0,289
0,108
0,036

0,003
0,007
0,386
0,051

0,069
0,049
0,153
0,326
0,239
0,079
0,053
0,011

0,043
0,212
0,111
0,176
0,011

1
10
0,406

1
9
0,344

0,009
0,006
0,007
0,005
0,056
0,004
0,091
0,086
0,054
0,226
0,008
0,132
0,185
0,008
0,067
0,032
0,011
0,013

0,021
0,068
0,041

1
9
0,765

1
8
0,567

1
16
0,294

1
13
0,695

1
18
0,386

F13A1

FES

0,009
0,001
0,214
0,146
0,180
0,054
0,043

0,002
0,003
0,004

0,002
0,008
0,001
0,004
0,001
0,001
0,169
0,167

0,242
0,126
0,375
0,123
0,125

1
15
0,639

1
8
0,542

1.4.Polimorfismosdenucletidosimple
En la dcada de los noventa, al digerir secuencias de ADN, guindolas hacia un
solo nucletido, se encontr la existencia de variaciones en los sitios de corte, que
correspondan exactamente a un simple nucletido. Posteriormente, se ha observado que
existen aproximadamente 1,2 millones de variaciones de nucletidos que stas estn
presentes en el genoma humano de todas las poblaciones (SNP database). Adems,
pueden estar presentes tanto en secuencias codificantes (exones) o no codificantes
(intrones) y podran ser las responsables de una predisposicin mayor o menor a
enfermedades comunes. El estudio de los SNP o snips ha conducido a plantear la
hiptesis de que las enfermedades comunes estaran determinadas por variaciones
comunes. Los snips pueden o no producir cambios en la informacin esencial del

BIOLOGA MOLECULAR Y CARACTERIZACIN DE LAS POBLACIONES HUMANAS

113

nucletido y por lo tanto del gen; pero sea cual sea el caso, su relacin con patologas
est siendo cada vez ms conocida. As, el alelo Apo E E4 muestra frecuencias de 10 a
20% en la poblacin y se asocia a la enfermedad de Alzheimer. La variacin que se
observa afecta por ejemplo al ltimo nucletido en el cdigo gentico, y aunque
produce el mismo aminocido, las evidencias investigativas lo relacionan con riesgos
altos de enfermedades genticas, como el cncer.
Algunos estudios muestran que los SNP son muy frecuentes en los genes. Hay
genes que presentan mayor nmero de snips que otros, lo cual determina que se los
clasifique como snips de alto grado de presentacin (> 15%), de grado medio (5-15%) y
de baja presentacin (< 5%). El nmero de alelos que se presentara por cada variacin
en cada gen sera muy alto, entre 12 a 50 alelos de SNP. Los estudios de SNP en
enfermedades habituales como la cardiopata coronaria, hipertensin, la diabetes y la
esquizofrenia, muestran variaciones de snips entre 36 al 52% de individuos analizados.
La pregunta clave que surge es: Sern estas variaciones responsables o estaran slo
asociadas a las enfermedades?
Desde el punto de vista evolutivo, los snips son interesantes. Primero, la
frecuencia de SNP en exones e intrones es muy similar: 1/346 pb y 1/354 pb
respectivamente. Los snips de exones podran estar relacionados a enfermedades,
mientras que los snips en intrones, sobre todo los perignicos, se relacionan a
variaciones en el empalme alternativo y a sitios de silenciamiento por miARN. Aunque
al comparar snips entre chimpancs y humanos, se ha encontrado pequeas variaciones
en el nmero (0,6%), al analizar su distribucin en el genoma las diferencias alcanzan
un 32%. Adicionalmente, se ha encontrado que los SNPs varan de poblacin a
poblacin. Los afroamericanos y africanos presentan mayor nmero de snips que los
europeos y asiticos en proporciones de 93 a 17. Los estudios del genoma calculan que
existiran entre 240 mil a 400 mil snips, un 40% de estos podran estar relacionados a
alteraciones de codificacin y por ende a patologas. Una persona tendra entre 24 mil a
40 mil snips en heterocigosis. Un 82% de los snips seran polimrficos. Existen
informes que los snips se los encontrara cada mil a dos mil pb.

2.ESTRUCTURAYFUNCIONESDELOSGENES

A inicios de 1977 se postulaba que el gen era una cadena larga de ADN, que
contena la informacin para codificar al lenguaje de protenas. Actualmente, para los
genes de eucariontes se conocen muchos detalles ms al respecto. El gen estara
compuesto por secuencias codificadoras o exones y secuencias no codificadoras o
intrones; tambin se encuentran secuencias flanqueantes involucradas en la regulacin
de la actividad gentica; as mismo, contiene una regin inicial de la transcripcin
constituida por una secuencia CCAAT o caja CAT y otra TATA o caja TATA, y una
regin final de secuencia conformada por las bases AATAAA, involucrada en la
transcripcin de ARNm. Por ejemplo, el gen de la fibrosis qustica del pncreas,
enfermedad autosmica recesiva, est ubicado en el cromosoma 7 en su brazo largo;
tiene una longitud de 250 Kb, pero solamente 6121 pb codifican la protena CFTR. Los
genes de las mitocondrias cuentan con variaciones que se las detalla ms adelante
(Krebs et al., 2009).

BIOLOGA MOLECULAR Y CARACTERIZACIN DE LAS POBLACIONES HUMANAS

114

Se puede decir que la estructura caracterstica de un gen, aparte de los exones e


intrones anotados, incluye a tres secuencias flanqueantes que intervienen en la
regulacin de la actividad del gen: Por una parte estn la caja CCAAT y la caja TATA;
al parecer estas dos iniciaran la transcripcin. Adicionalmente, existe una secuencia
flanqueante AATTAAA, que servira de sitio de reconocimiento de la cola poli-A, al
final de la cadena de ARNm, regin que es transcrita pero no traducida y que dara la
seal para que una nucleasa corte el ARN, terminando as la transcripcin.
El concepto de gen ha variado mucho, pues los nuevos conocimientos de sus
funciones han permitido redefinirlo. En un inicio se postulaba que el gen era una
enzima, pero luego adquiere otras funciones y propiedades. A continuacin se expone
algunas de las definiciones de gen:
Tabla VIII.5. Complejidad y variaciones del concepto de gen-enzima
Concepto
Un gen-una enzima
Un gen-una protena
Un gen-producto de ARN
La actividad de una enzima
requiere mltiples subunidades
de genes diferentes
Una cadena polipeptdica con
mltiples enzimas
La deficiencia de una enzima
causa mltiples deficiencias
enzimticas secundarias
Divisin post- traduccional de un
pptido
Promotores alternativos para la
transcripcin
Empalme alternativo de ARN
mensajero inmaduro
Rearreglos en el ADN antes de
la transcripcin
Modificacin posttranscripcional del ARNm
Sobreposicin en el marco de
lectura en ADN y ARN,
supresin, cambios en el marco
de lectura

Ejemplo
Fenilalanina-hidroxilasa
Hipoxantina guanina fosforibosil
transferasa
Colgeno
ARN mitocondrial de transferencia
Propionil CoA carboxilasa
Hexosaminidasa
Sub-unidad de la hexosaminidasa
AyB
Sub-unidad E3 de la
deshidrogenasa
Cobalamina C y D

Desorden
Fenilcetonuria
Sndrome de Lesch-Nyhan
Osteognesis imperfecta
MERRF/MELAS
Acidemia propinica
Enfermedad de Sandhoff
Deficiencia de E3
Acidemia metil-malnicas

ACTH
Distrofina

Distrofia de Duchenne

Calcitonina

Agamaglobulinemia

Inmunoglobulinas
Receptores de clulas T
Apolipoprotenas B-100 y B-48

Inmunodeficiencia
combinada
Hipobetalipoproteinemia

Factor de liberacin bacteriano


Retrovirus

La clula realiza sus principales funciones en la fase G1 del ciclo celular, en sta
el ADN, conformado en cromatina (solenoide de 30 nm), se abre para permitir las
actividades del ADN. Durante la fase S del ciclo la clula se prepara para dividirse, para
ello duplica su ADN y luego entra en una fase de actividad relativa que es la G2, para
inmediatamente continuar con la divisin (mitosis o meiosis). El ADN debe cumplir al
menos con tres funciones principales:
2.1.Replicacinsemiconservativaybidireccional
Con esta funcin la clula duplica su material gentico de 2n a 4n. La
replicacin se inicia en zonas del genoma llamados replicones, entre 20 mil a 100 mil

BIOLOGA MOLECULAR Y CARACTERIZACIN DE LAS POBLACIONES HUMANAS

115

por genoma humano, cada uno de stos mide unas 150 Kb y tiene una velocidad de
replicacin de 1 a 6 Kb/min, es decir, que de 5 a 10 horas se habr duplicado la totalidad
del genoma. La doble hlice dispuesta en direccin 5-3 se abre, por accin de enzimas
helicasas, y la alfa y delta polimerasas de ADN incorporan bases nitrogenadas en forma
complementaria a su cadena madre. La replicacin se la realiza en ambas cadenas. En
una de ellas, la principal 5-3, en forma continua y en su cadena antiparalela 3-5, en
forma discontinua a travs de los fragmentos de Okazaki, que luego son unidos entre si
por una enzima ligasa. La replicacin es un mecanismo complejo y por lo general muy
preciso, asegurndose as la fidelidad de la informacin gentica; adems, tiene su
finalidad en los procesos celulares de divisin mitosis y meiosis (Lodish et al., 2008).
Existen varios tipos de polimerasas:

a)

Alfa polimerasa implicada en la replicacin de la cadena complementaria.

b)

Beta polimerasa que interviene en procesos de replicacin del ADN.

c)

Delta polimerasa que interviene en la replicacin de la cadena madre.

d) Epsilon polimerasa que interviene en la replicacin.

e) Gamma polimerasa que replica el ADN mitocondrial.

Un mecanismo interesante adjunto a la replicacin, es la reparacin del dao del


ADN, sea dentro del proceso normal de duplicacin del genoma o producto de daos
inducidos. En el mecanismo bsico, enzimas de control de replicacin o dao, ubican
sectores alterados, luego una enzima endonucleasa corta las porciones daadas y una
polimerasa (sea la beta o epsilon) reproduce el sector malo. Normalmente todas las
personas producen daos en su ADN y por lo general reparan eficientemente, de lo
contrario las alteraciones se fijan y determinan mutaciones, las cuales a su vez conducen
a enfermedades. Existen enfermedades en las cuales los procesos de reparacin estn
disminuidos o alterados, por ejemplo la anemia de Fanconi. Los informes del Proyecto
del Genoma Humano dan cuenta de unos 130 genes involucrados en la reparacin del
ADN.
2.2.Transcripcindelainformacinhereditaria
La transcripcin consiste en la sntesis de ARNm a partir de ADN. El ARNm es
generalmente una molcula unicatenaria conformada por ribonucletidos, y en una
primera instancia intranuclear. Se copia en forma complementaria al ADN molde, con la
particularidad de que en la secuencia de bases, la timina es reemplazada por el uracilo.
Este primer ARN mensajero inmaduro o intrnico-exnico, sale del ncleo y madura,
pierde los intrones y solo presenta exones. El ARN mensajero maduro o exnico, es el
que se encargar de llevar la informacin gentica a la fbrica de protenas, los
ribosomas. Durante la transcripcin actan tres tipos de polimerasas de ARN (I, II y
III), que sintetizan el mensajero a una velocidad 20 veces mayor que la replicacin,
llegando a formar 200 millones de ribonucletidos por minuto. Cada polimerasa de
ARN es la responsable de transcribir un nmero igual de grupos de genes. La I,
transcribe slo una clase de genes (40 mil) y se localiza en el nucleolo, por lo que tiene

BIOLOGA MOLECULAR Y CARACTERIZACIN DE LAS POBLACIONES HUMANAS

116

que ver con la formacin de ARN de transferencia, mientras que la II y la III pueden
transcribir varios genes (40 mil y 20 mil respectivamente) y actan en el nucleoplasma.
Una vez formado el ARNm intranuclear, este deber salir al citoplasma para
completar su actividad. En su salida del ncleo, el ARNm inmaduro, pierde secuencias
no codificadoras o intrones y los exones son los nicos en salir y empalmarse
nuevamente. Este proceso de corte-empalme (empalme alternativo o splicing
alternativo) proporciona al ARN y a la propia clula alternativas funcionales
interesantes. As, un mismo gen puede producir dos o ms protenas, gracias al empalme
alternativo de uno u otro exn (Figura VIII.1).

FIGURA VIII.1. FORMACIN DEL ARN MENSAJERO. El proceso de empalme


(splicing) consiste en la eliminacin de los intrones, la unin de los exones y la
maduracin del ARNm para la posterior formacin de las protenas (IIB, 2014).

La presencia de exones e intrones parece deberse a un proceso evolutivo del


ADN. Se afirma que a los intrones se los habra adquirido en la evolucin, pero lo ms
probable es que ya estaban presentes en las clulas originales que evolucionaron y,
adems, proporcionaran una ventaja evolutiva ya que las mutaciones al azar y
beneficiosas habran afectado a zonas intrnicas, formndose empalmes alternativos de
exones e intrones, dando lugar a nuevas y diferentes protenas. Con ello la
conceptualizacin clsica de gen vara, pues un mismo gen por empalme alternativo
podra producir ms de una protena y el intrn representar tambin dominios
funcionales del gen. El caso de las hormonas tirosina y calcitonina humana, es un
ejemplo, de que el mismo gen produce dos ARNm diferentes y dos protenas diferentes.
Igual ocurre con varias protenas producidas por el mismo gen: protrombina,
plasmingeno, uroquinasa, factor VII y XII de la coagulacin. Este mismo proceso se
produce en algunas patologas en que los cromosomas se reestructuran y se producen
genes quimricos (empalme alternativo) que determinan protenas de tamaos diversos.
Un ejemplo es la leucemia mieloide crnica (LMC) y la leucemia linfoblstica aguda
(LLA), con presencia del cromosoma Filadelfia. La protena p210 de la LMC es de
mayor tamao que la protena p190 de la LLA, y ms agresiva desde el punto de vista
clnico. Como dato curioso, en las moscas de la fruta, el sexo est determinado tambin

BIOLOGA MOLECULAR Y CARACTERIZACIN DE LAS POBLACIONES HUMANAS

117

por empalme alternativo de exones, los machos tienen tres exones y las hembras dos del
mismo gen.
2.3.Traduccindelainformacingentica
El cambio de lenguaje de ADN a protenas permite desempear funciones vitales
para la clula y el individuo, para lo cual la clula utiliza el cdigo gentico o lenguaje
de tripletes de nucletidos. La protena se forma a partir de la estructuracin y unin de
aminocidos (gen-protena), el polipptido que se forma a partir del ARNm representa
una secuencia leda en lenguaje de tres letras (codn) (Figura VIII.2).

FIGURA VIII.2. PROCESO DE TRANSCRIPCIN, TRADUCCIN Y SNTESIS


PROTEICA. El ARNm se dirige hacia los ribosomas, los cuales van a permitir la
formacin de las diferentes cadenas polipeptdicas (Modificado de The Royal Swedish
Academy of Sciences, 2009; IIB, 2014).

BIOLOGA MOLECULAR Y CARACTERIZACIN DE LAS POBLACIONES HUMANAS

118

Cada aminocido de la secuencia est representado por uno o varios tripletes o


codones (cdigo gentico degenerado), cuya variacin para cada aminocido se puede
evaluar con tcnicas de gentica molecular (Figura VIII.3). A estas variaciones se las
conoce como polimorfismos de nucletidos y aunque no representan efectos nocivos, en
la actualidad s se ha relacionado a riesgos de enfermedades comunes, al polimorfismo
de ltimo nucletido o mutacin silenciosa.

En la traduccin de la informacin interviene tambin el ARN ribosmico


(ARNr), que formar parte de los ribosomas. El ARNr, est producido por comando del
ADN ribosmico (ADNr), que se encuentra en los organizadores nucleolares de los
cromosomas acrocntricos o satlites y conforman el nucleolo en la interfase. En la
traduccin participan tambin al menos unos 497 ARNs de transferencia (ARNt),
encargados de suplir los aminocidos citoplasmticos al ribosoma.

FIGURA VIII.3. EL CDIGO GENTICO. Los codones del ARNm se asocian con
anticodones especficos del ARNt para permitir la formacin de protenas (IIB, 2014).
3.REGULACINDELAACTIVIDADDELOSGENES
Uno de los asuntos importantes en la dinmica de los genes es comprender
cundo y cmo un gen inicia o no su actividad, y el momento que la termina. Algunos

BIOLOGA MOLECULAR Y CARACTERIZACIN DE LAS POBLACIONES HUMANAS

119

mecanismos han sido propuestos para entender al menos tres momentos de regulacin:
expresin, transcripcin y post-trascripcin.
Los genes estn controlados en su expresin por varios mecanismos, algunos
ms sencillos que otros, dentro de los cuales tenemos: la simple posicin celular, la
impresin o marcado diferente de genes, rearreglo de sectores de genes o de genes
completos (por ejemplo en las inmunoglobulinas), competencia a travs de genes
saltadores o silenciadores, simple efecto de posicin, supresin de actividad de genes
por dominios de la cromatina, inactivacin de genes o aun de cromosomas completos
(inactivacin del X), e interferencia con la expresin entre genes antagnicos (por
ejemplo los oncogenes y los genes supresores de tumores).
El primer paso para que un gen sea expresado es la transcripcin (sntesis de
ARN a partir de un modelo de ADN) que puede dar como resultado ARN mensajero
(ARNm), ARN ribosomal (ARNr), ARN heterlogo nuclear (ARNhn) o ARN de
transferencia (ARNt). Luego de ser transcrito, el gen sufre procesos de regulacin de la
expresin post-transcripcionales, tales como el empalme (splicing), la adicin de la cola
de poli adenina (poli A) y la adicin de CAP (capping); despus, existen procesos de
control de expresin a nivel traduccional y post-traduccional (Alberts et al., 2002).
La transcripcin de muchos de los genes humanos est restringida a una lnea
tisular y celular especfica, a un momento del desarrollo del tejido o a la respuesta hacia
un factor inductor ambiental especfico, como una hormona. Tambin hay genes que se
expresan constantemente, llamados genes endgenos o housekeeping y que son
suficientes para mantener la vida (entre 300 a 400 por clula). El control transcripcional
vendra dado principalmente a dos niveles: a) al nivel de la estructura cromosmica y b)
de las interacciones entre la ARN polimerasa, el ADN que le sirve de modelo y una
cantidad de protenas reguladoras de la transcripcin, especficas para cada tipo celular;
por ejemplo, las protenas con homodominios, hlice-enrollamiento-hlice, protenas de
dedos de zinc (Zn fingers). Otras formas de regulacin son la formacin de secuencias
reguladoras que actan en posicin cis-trans y producen protenas reguladoras en genes
alejados del regulado (Krebs et al., 2009).
El paso inicial de la sntesis de ARN, a partir de una plantilla o templado de
ADN, incluye la ubicacin de la ARN polimerasa (en eucariontes actan tres ARN
polimerasas) junto a una secuencia de ADN bicatenario a la altura del denominado
promotor del gen a ser transcrito. Esta secuencia promotora define el sitio de la
iniciacin de la transcripcin, aunque existe la posibilidad de que la clula utilice
promotores alternativos para un mismo gen. A diferencia de las ARN polimerasas
bacterianas, las eucariticas no entran en contacto directo con el ADN promotor, sino
que son reclutadas hacia ste por complejos de protenas especficas para cada ARN
polimerasa; complejos denominados SL1 para la ARN polimerasa I, TFIID para la ARN
polimerasa II y TFIIIB para la ARN polimerasa III, cuya funcin es la de reclutar a la
ARN polimerasa hacia la secuencia de ADN promotor. Estos factores interactan con el
ADN, los factores de transcripcin y las ARN polimerasas, para formar el Complejo
Basal de Transcripcin que est sujeto a la activacin o represin transcripcional por la
accin de protenas reguladoras de la transcripcin especfica de cada tejido.
Complementariamente, existe tambin una barrera natural de regulacin gnica,
y es la propia organizacin de la cromatina. La heterocromatina corresponde al ADN

BIOLOGA MOLECULAR Y CARACTERIZACIN DE LAS POBLACIONES HUMANAS

120

transcripcionalmente inactivo, ya que est tan condensado que la ARN polimerasa no


tiene acceso al ADN y aun si llegase a tener contacto con este, la transcripcin no se
dara debido a que otros elementos necesarios para la transcripcin, como los factores
de transcripcin, no tendran el acceso necesario para iniciarla. Inclusive si se llegara a
tener la combinacin correcta de elementos de transcripcin, estos no tendran acceso a
la secuencia promotora del ADN. Por otro lado, est la eucromatina, que corresponde al
ADN activamente transcrito debido a que est ms dispersa. Por lo tanto, la estructura
de la cromatina regula la accesibilidad del ADN a estos factores de transcripcin y de
esta manera representa un importante paso en la regulacin de la transcripcin
especfica de los diferentes tipos celulares.
Tambin la regulacin puede ser post-transcripcional e incluye: la regulacin del
transporte del ARNm hacia el ncleo, el empalme alternativo de exones e intrones, la
poliadenilacin del transcrito, la transcripcin del ARNm y su estabilidad, y la
produccin especfica de ARN en cada tejido.
Finalmente, se debe tomar en cuenta que la unidad funcional de la herencia es el
gen y tiene la capacidad de recombinacin, por lo cual se asegura la variacin
interindividual y de funciones. Tambin el gen constituye la unidad de mutacin, es
decir, es el sustrato cambiante de la evolucin y al mismo tiempo la base de las
enfermedades genticas.

4.TCNICASDEBIOLOGAMOLECULAR
La Biologa Molecular maneja diferentes tipos de tcnicas indispensables para el
estudio de genes asociados a las diversas enfermedades. Entre las tcnicas ms
relevantes y aplicadas en el Instituto de Investigaciones Biomdicas, est la reaccin en
cadena de la polimerasa, la PCR cuantitativa en tiempo real y la secuenciacin gentica.
4.1.Reaccinencadenadelapolimerasa
La reaccin en cadena de la polimerasa (PCR) es un proceso bioqumico in vitro
catalizado por una enzima, en la cual pequeas cantidades de un segmento especfico de
ADN, que se hallan entre dos regiones de ADN de secuencia conocida, son
amplificadas obtenindose una gran cantidad de ADN lineal de doble cadena. Debido a
que la PCR est basada en la accin enzimtica de una ADN polimerasa (la ms
comnmente utilizada es la Taq ADN pol I), inmediatamente en varias reas de
investigacin, incluyendo la tecnologa del ADN recombinante, la expresin gnica,
medicina general, medicina forense y evolucin. Actualmente, la PCR ha adquirido
mayor importancia con el desarrollo de las enzimas de restriccin, con el clonaje del
ADN y con el southern blot en el avance de la biologa molecular. Los primeros
experimentos de amplificacin con PCR fueron realizados por Mullis y Faloona,
quienes desarrollaron el primer dispositivo automtico regulador de la temperatura en
ciclos, conocido como termociclador (Mullis & Faloona, 1987).
La amplificacin del ADN se obtiene por ciclos repetidos de PCR, cada uno de
los cuales consta de tres estadios de temperatura distintos:

BIOLOGA MOLECULAR Y CARACTERIZACIN DE LAS POBLACIONES HUMANAS

a)

Denaturacin del templado de ADN (que servir de modelo para su amplificacin) a una
temperatura de 94 a 96C.

b)

Anillamiento de los cebadores o cebadores. Los cebadores son oligonucletidos,


formados por molculas de cadena simple de ADN, que son complementarios a ambos
extremos de una secuencia determinada de ADN que acta como templado o plantilla. Su
funcin es servir al ADN como punto de partida para la polimerizacin. Este paso requiere
una temperatura que vara entre los 42 a 60C.

c)

Elongacin o extensin del primer por la ADN polimerasa. Los cebadores son extendidos
de una cadena molde de ADN de cadena simple (previamente desnaturalizado). Gracias a
la enzima ADN polimerasa, en presencia de desoxinucletidos fosfato (dNTPs) y bajo
condiciones adecuadas de la reaccin, esto da como resultado la sntesis de nuevas
cadenas de ADN complementario, a partir de las cadenas templado. Para este paso se
requieren temperaturas entre los 60 y 72C.

121

La reaccin de amplificacin contiene dos cebadores dispuestos de tal manera


que puedan hibridizar con las cadenas opuestas de la secuencia "blanco" o secuencia a
amplificarse. Debido a que el producto extendido incluye la secuencia complementaria a
la del otro primer, el producto de cada reaccin sirve como templado en el nuevo ciclo
de PCR, verificndose as una reaccin bioqumica en cadena.
El impacto de la PCR ha sido particularmente importante en algunos campos
relacionados al anlisis del genoma humano, especialmente en el mapeo gentico y
fsico de los cromosomas y anlisis de la expresin gnica.

FIGURA VIII.4. REPRESENTACIN DE LA AMPLIFICACIN DE ADN MEDIANTE


PCR. La temperatura de anillamiento va a permitir que los cebadores se
complementen efectivamente en las cadenas del ADN para la posterior sntesis de
las cadenas hijas (IIB, 2014).

BIOLOGA MOLECULAR Y CARACTERIZACIN DE LAS POBLACIONES HUMANAS

122

4.2.PCRcuantitativaentiemporeal

La PCR cuantitativa en tiempo real (qPCR) es una variacin de la PCR estndar


utilizada para la cuantificacin de ADN o ARN mensajero de una muestra. Sus ventajas
al compararla con la PCR tradicional son: la eliminacin de la manipulacin post-PCR,
tiene mayor sensibilidad y especificidad, permite discriminar productos (dmeros de
cebadores o bandas inespecficas) mediante la curva melting, tiene la capacidad de
analizar mltiples productos, expresin gnica, anlisis de expresin de micro ARNs y
genotipaje de poblaciones para determinar frecuencias polimrficas.
Utilizando cebadores y sondas especficas de secuencia, es posible determinar el
nmero de copias o la cantidad inicial de una determinada secuencia de ADN o ARN.
La cuantificacin del material gentico puede darse a travs del anlisis absoluto o
relativo (Nolan et al., 2006).
El anlisis absoluto permite cuantificar una secuencia blanco y expresar el
resultado final como un valor absoluto. Este anlisis es muy utilizado en Virologa y
Microbiologa para determinar carga viral o nmero de copias de material gentico
bacteriano.
El anlisis relativo compara los niveles de una o varias secuencias blanco en una
misma muestra, con un control, y expresa el resultado final como el radio de las
secuencias de inters. La comparacin de diferentes genes en una misma muestra radica
en la normalizacin de la expresin gnica a travs del uso de genes endgenos
(housekeeping). Este anlisis es utilizado en oncologa molecular (Livak et al., 2001).
Cuando la qPCR se combina con una reaccin de retro-transcripcin (RT-PCR),
puede determinarse la cantidad de ARNm de una muestra mediante una cuantificacin
relativa. La cuantificacin relativa compara la cantidad del ARNm de un gen especfico
respecto a la cantidad de ARNm de un gen endgeno. Para la cuantificacin se mide en
cada ciclo de PCR la cantidad de amplicn producido. La cuantificacin del producto se
produce mediante la adicin de fluorforos que se unen al amplicn de forma especfica
o inespecfica, de manera que a mayor producto mayor fluorescencia producida y los
programas de anlisis representan dicha fluorescencia grficamente respecto al nmero
de ciclos. La cantidad de amplicn producido es ser proporcional al nmero de
molculas de ADN y ARN iniciales (r = 1), de forma que en aquellas muestras con
mayor expresin del gen el amplicn fluorescente aparecer en ciclos anteriores (Figura
VIII.5).
La qPCR presenta diferentes fases: linearizada o inicial, exponencial temprana,
logartmica lineal y latencia o final. En la fase exponencial temprana se expresa la
informacin de la lnea umbral denominada en ingls cycle threshold (Ct) o crossing
point (Cp). El Ct es un valor que nace de la interseccin entre la curva de amplificacin
y la lnea umbral; es un valor que denota cuando empieza la fase exponencial y es
utilizado para cuantificar el ADNc. En cambio, la cantidad absoluta de ADN (nmero
de copias o concentracin) es determinada por comparacin del valor Ct con estndares
externos conocidos.
Un esquema de las curvas de amplificacin se puede observar en la Figura
VIII.5.

BIOLOGA MOLECULAR Y CARACTERIZACIN DE LAS POBLACIONES HUMANAS

123

FIGURA VIII.5. CURVA DE AMPLIFICACIN Y LNEA UMBRAL DE LA qPCR.


Relacin entre el nivel de fluorescencia y el nmero de ciclos de una PCR (IIB, 2014).

4.2.1.Tiposdequmicas
En la PCR cuantitativa en tiempo real existen dos tipos de qumicas:
inespecficas y especficas. Estas qumicas pueden ser utilizadas para diversos fines
tales como la determinacin del genotipaje y la cuantificacin de la expresin gnica o
carga viral. La qumica inespecfica se activa mediante la presencia de dobles cadenas
de ADN y la qumica especfica utiliza transferencia energtica de fluorescencia por
resonancia (FRET).

4.2.1.1.SYBRGreen
Un mtodo inespecfico muy utilizado por su costo y efectividad es el SYBR
Green, el cual se intercala en el ADN de doble cadena emitiendo fluorescencia. El uso
de SYBR Green implica un diseo muy cuidadoso de los cebadores con el fin de evitar
la formacin de dmeros de cebadores o de la amplificacin de varias regiones del
genoma no propias del estudio. La Figura VIII.6 explica la activacin del SYBR Green
en presencia de cadenas dobles y la desactivacin en cadenas simples (Ponchel et al.,
2003).

FIGURA VIII.6. SYBR GREEN. Se activa al intercalarse en cadenas dobles y se


desactiva en cadenas simples de ADN (IIB, 2014).

BIOLOGA MOLECULAR Y CARACTERIZACIN DE LAS POBLACIONES HUMANAS

124

4.2.1.2.SondasTaqMan

Se puede mejorar la especificidad utilizando sondas fluorescentes


(oligonucletidos de alrededor de 25 pb) que se unen por complementariedad a
secuencias blanco del ADN. Las sondas TaqMan permiten la cuantificacin especfica
del ADN complementario (ADNc) de inters incluso en la presencia de amplificacin
inespecfica y dmeros de cebadores.
Estructuralmente las sondas TaqMan estn conformadas por un fluorforo en su
extremo 5 y un quencher o inactivador de seal en el extremo 3 de la sonda.
Funcionalmente las sondas se acoplan al ADN por complementariedad de bases en la
fase de anillamiento y en la fase de elongacin la ADN polimerasa degrada a la sonda y
cuando el fluorforo se distancia del quencher emite seal a una respectiva longitud de
onda la cual es captada por un fotoreceptor (Figura VIII.7).
Aplicativamente, las sondas TaqMan pueden ser utilizadas para la determinacin
de polimorfismos o mutaciones en el ADN. Cuando se realiza un anlisis genotpico se
debe utilizar dos sondas, la una con la presencia del nucletido del primer alelo y la otra
con la presencia del nucletido del segundo alelo, y as determinar si el individuo es
homocigoto normal, heterocigoto u homocigoto mutante. Adems, las sondas TaqMan
tambin pueden ser utilizadas para el anlisis de expresin gnica a partir del estudio del
ARNm.

FIGURA VIII.7. SONDAS TAQMAN. Sondas especficas que permiten determinar la


presencia de una determinada secuencia de ADN del genoma, cuya activacin ocurre
en el paso de elongacin de la PCR (IIB, 2014).

BIOLOGA MOLECULAR Y CARACTERIZACIN DE LAS POBLACIONES HUMANAS

125

4.2.1.3.SondasBeacon

Las sondas Beacon son especficas para una determinada regin del genoma.
Funcionalmente, el fluorforo emite seal cuando el agente bloqueador (quencher) se
encuentra alejado por efecto de la hibridacin (anillamiento) a la secuencia de inters.
Estructuralmente, esta sonda presenta una forma de horquilla con el fluorocromo
en su extremo 5 y el quencher en su extremo 3 (Figura VIII.8).
Aplicativamente, este mtodo sirve para realizar genotipaje y expresin gnica
de muestras de ADN o ADNc.

FIGURA VIII.8. SONDAS BEACON. Sondas especficas que permiten determinar la


presencia de una determinada secuencia de ADN del genoma, cuya activacin ocurre
en el paso de anillamiento de la PCR (IIB, 2014).

4.2.1.4.SondasScorpion
La sonda Scorpion presenta una forma de horquilla. El fluorforo se encuentra
acoplado al extremo 5y el bloqueador en el extremo 3. Adems, el extremo 3de la
sonda se encuentra enganchada al extremo 5 del primer (Figura VIII.9).
Funcionalmente la sonda se activa en la fase de denaturacin debido a que es el
momento en el que las dobles cadenas se abren, se abre la horquilla y se genera una
distancia para que el fluorocromo emita seal sin que esta sea bloqueada.

BIOLOGA MOLECULAR Y CARACTERIZACIN DE LAS POBLACIONES HUMANAS

126

Aplicativamente, y a pesar de su mayor complejidad con relacin a las otras


qumicas explicadas, esta puede ser utilizada para el anlisis de expresin gnica.

FIGURA VIII.9. SONDAS BEACON. Sondas especficas que permiten determinar la


presencia de una determinada secuencia de ADN del genoma, cuya activacin ocurre
en el paso de denaturacin de la PCR (IIB, 2014).

4.2.2. Genesendgenosodereferencia
La medida de la expresin gnica por medio de la PCR es una cuantificacin
relativa, en la que se compara entre las diferentes muestras la expresin del gen objeto
de estudio respecto a la expresin de un gen constitutivo cuya expresin no vara en las
condiciones del experimento (control endgeno). Es lo que se denomina como
normalizacin de la expresin del gen especfico, o normalizar respecto a la diferente
concentracin de ARN total de las muestras, ya que si la cantidad de control endgeno
vara, es debido a cambios en la cantidad del ARN total empleada en la sntesis de
ADNc, no a cambios en su expresin. Los genes ms utilizados como controles
endgenos son: ARNr 18S, GAPDH, beta-actina, TBP, HPRT, beta-2-microglobulina,
entre otros. No existe gen cuya expresin no vara en alguna de las condiciones, por lo

BIOLOGA MOLECULAR Y CARACTERIZACIN DE LAS POBLACIONES HUMANAS

127

que el usuario debe evaluar cual sera el mejor control endgeno para su experimento
(Livak et al., 2001).
Tabla VIII.6. Genes endgenos aplicados en la expresin gnica

Cdigo
18S ARNr
ABL
PO
B2M
ACTB
GUS
CYC
GAPDH
HPRT
PGK
PBGD
PBGD2
TBP
TFRC

Nombre
18S ARNr
Abelson
Protena acdica ribosomal
Beta 2 microglobulina
Beta actina
Beta glucorinidasa
Ciclofilina
Gliceraldehido 3 fosfato deshidrogenasa
Hipoxantina fosforibosiltransferasa
Fosfogliceroquinasa
Porfobilingeno deaminasa
Porfobilingeno deaminasa 2
Factor de transcripcin IID
Receptor transferrina

Cromosoma
12p12
9q34
11p15
15q21
7p15
7q21
7p13
12q13
Xq26
Xq13
11q23
11q23
6q27
3q26

4.2.3.Mtodosdecuantificacindelaexpresingnica
Existen principalmente dos mtodos de cuantificacin, dependiendo si la
eficiencia de amplificacin del gen objeto de estudio y del gen de referencia son
comparables:
4.2.3.1.CuantificacinrelativamedianteelmtodoLivak
En este mtodo se comparan directamente los cycle threshold (Ct) del gen
testado y del gen de referencia (Ct) en cada muestra, y posteriormente se comparan los
Ct de la muestra experimental con respecto a la muestra control, para aplicar dicho
mtodo es necesario que las eficiencias de ambos genes sean similares. La frmula
aplicada es la siguiente (Livak et al., 2001):

Ct

SANOS
2

= Tasa de expresin normalizada


ENFERMOS

- (Ct gen de inters Ct gen endgeno) (Ct gen de inters Ct gen endgeno)

4.2.3.2.Cuantificacinabsolutamediantelacurvaestndar

El otro mtodo se basa en la utilizacin de una recta estndar a partir de ADNc


de concentraciones conocidas, y extrapolar la concentracin del gen en la muestra
experimental a partir del Ct obtenido, posteriormente se calcula la relacin entre la
cantidad del gen testado y el gen de referencia, y se compara dicha relacin entre las
muestras (Figura VIII.10).
La cuantificacin absoluta mediante una curva estndar es ampliamente
utilizada en el anlisis de cargas virales y en la enfermedad mnima residual (leucemia).

BIOLOGA MOLECULAR Y CARACTERIZACIN DE LAS POBLACIONES HUMANAS

128

FIGURA VIII. 10. CURVA ESTNDAR. Diferentes concentraciones de una muestra


de ADN (control positivo) sirven como patrn para el anlisis absoluto de la muestra
de un paciente (IIB, 2014).

4.3.Secuenciacindelosgenes
La finalidad de esta prueba es descifrar una a una las letras qumicas que
componen el ADN. Para esto se utilizan dos tcnicas en conjunto, una que se encarga de
copiar millones de veces los genes (PCR) y, al mismo tiempo que se producen las
copias, se introducen bases nitrogenadas alteradas, lo que determina una interrupcin
momentnea y parcial de las copias del gen. stas luego se ven como escalera en una
gelatina y teidas o reveladas con nitrato de plata. Posteriormente, la secuencia de los
genes va develndose, sea en forma manual o con sofisticados aparatos, en forma
automtica, as se llega a conocer cmo estn dispuestas las letras del alfabeto de la
herencia; por ejemplo: ACGTGTAATTCGA... hasta todo el genoma. Cabe mencionar
que la tcnica manual ya no se aplica en la actualidad debido a los avances tecnolgicos
y a la bioseguridad.
Existen dos tcnicas bsicas para secuenciar el genoma:
4.3.1.Cartografagenticadeligamiento
La cartografa gentica se basa en el clculo de la frecuencia con la que se
coheredan formas alternativas (alelos) de dos loci genticos, ligados formando parte de
un mismo cromosoma. Es til para este propsito el uso de RFLP, VNTR, STR y SNP,
en forma progresiva. Muchas de estas secuencias repetidas del ADN son informativas,
ya que pueden estar asociadas a enfermedades especficas, con lo cual, al establecer un
mapa de ligamiento, se podr identificar el gen de la enfermedad.
4.3.2.Cartografafsicaeintegracindelosmapas
Los mapas fsicos tienen como objetivo especificar distancias fsicas
mensurables en pares de bases o alguno de sus mltiplos. Obviamente, el mapa fsico de
mayor detalle es la propia secuencia del genoma. Pero antes de llegar a obtenerla, hay
que elaborar mapas fsicos partiendo de resoluciones bajas y avanzando hacia las
resoluciones cada vez mayores. En cierta manera, los mapas fsicos de menor resolucin
son los propios cariotipos.
Las tcnicas de secuenciamiento se han desarrollado combinando efectos fsicos
con qumicos, como por ejemplo, el mtodo de Sanger.

BIOLOGA MOLECULAR Y CARACTERIZACIN DE LAS POBLACIONES HUMANAS

129

4.3.2.1.SecuenciacinautomticasegnelmtododeSanger
Cada base nitrogenada est marcada defectivamente, con lo cual la reaccin de
secuenciacin se detiene al encontrar una base defectiva, de tal forma que van
apareciendo bandas progresivamente ms extensas. Cada uno de los nucletidos
trifosfato, ddNTP defectivo (dideoxi), se marca con un colorante fluorescente diferente;
se puede tambin marcar con plata. Ello permite hacer la electroforesis en el mismo
callejn del gel. Las bandas de ADN son detectadas por su fluorescencia segn pasan
delante del detector lser, al cual si le hacemos mover en horizontal, podr leer varias
secuenciaciones al mismo tiempo. Los datos pasan a un sistema computarizado (Figura
VIII.11) (Wellcome Trust Sanger Institute, 2013).

FIGURA VIII. 11. NUCLETIDOS FLUOROMARCADOS Y SU INTERPRETACIN


DIGITAL. Cada nucletido (A, G, T, C) se encuentra marcado con un fluorocromo
especfico, el cual va a permitir su identificacin en el software (IIB, 2014).

4.3.2.2.Secuenciacindeltimageneracin
El genoma humano normal en todas las personas maneja prcticamente la misma
informacin, es decir, todos somos muy similares, pero debido a factores epigenticos y
a la presencia de polimorfismos de nucletido simple, cada genoma se comporta de
manera independiente y diferente.
Las tcnicas moleculares actuales son cada vez ms eficientes, produciendo
mucha ms informacin en menos tiempo y con un costo mucho menor. El genoma

BIOLOGA MOLECULAR Y CARACTERIZACIN DE LAS POBLACIONES HUMANAS

130

humano se secuenci en medio de un proyecto multimillonario que dur ms de diez


aos y utiliz miles de investigadores, cientos de centros y maquinaria sumamente
costosa. Con los avances tecnolgicos de la actualidad, mediante la llamada
secuenciacin de ltima generacin, es posible secuenciar un genoma completo en
menos de 8 horas, sin demasiado trabajo y a un costo totalmente accesible.
El primer genoma completo de un cncer fue reportado en el 2008, una
comparacin entre la secuencia nucleotdica de una leucemia mieloide aguda y el tejido
normal de la piel del mismo paciente (Ley et al., 2008). Desde ah, genomas de varios
organismos han sido publicados. La secuenciacin de genomas completos puede
representar una cantidad inmanejable de informacin, por lo cual se han creado algunos
enfoques ms especficos de la metodologa, como son el estudio del exoma (estudio de
la regin codificante de un genoma) o del transcriptoma (estudio de los genes
expresados en un tejido).
Mediante el estudio del exoma se han descubierto asociaciones no conocidas
entre ciertas mutaciones o polimorfismos y algunos genes. Una de las ventajas de la
tcnica es la gran cantidad de informacin por muestra; por esta razn no es necesario
tener grandes cantidades de especmenes para poder encontrar asociaciones
significativas. En un estudio realizado en 22 muestras de cncer gstrico, se encontraron
ms de 4000 mutaciones somticas en el exoma, pero despus de un anlisis
bioinformtico extenso se determin que una mutacin en el gen ARID1A se encuentra
de manera frecuente en las muestras analizadas. Dicha asociacin no haba sido descrita
anteriormente (Wang et al., 2011). Otros estudios han determinado la prdida de
molculas de adhesin y de control de cromatina en cncer gstrico y heptico (Zang et
al., 2012; Fujimoto et al., 2012).
La genmica se ha transformado con el pasar de los aos. Las metodologas de
ltima generacin estn aclarando cada vez ms los horizontes de entendimiento de las
enfermedades y sus mecanismos, y de esta manera cada vez ms molculas estn siendo
estudiadas como dianas para terapias dirigidas, las cuales determinan una mejor calidad
de vida del individuo afecto.
La tcnica de secuenciacin de prxima generacin se basa en la deteccin de la
secuencia especfica del material gentico en un acoplamiento con la metodologa de
arreglos genticos. Segn el avance en la tecnologa, las tcnicas de secuenciacin de
prxima generacin abarcan: la pirosecuenciacin, la secuenciacin por terminadores
reversibles, por ligacin, por semiconduccin de iones y por secuenciacin de una
molcula de ADN (Meyerson et al., 2010).
Tabla VIII.7. Tecnologas de secuenciacin de prxima generacin
Mtodo de secuenciacin
Pirosecuenciacin
Terminadores reversibles
Ligacin
Polimerasa
Semiconduccin de iones
Microscopia electrnica

Preparacin de muestra
PCR de emulsin
PCR en puente
PCR de emulsin
Molcula nica
PCR de emulsin/anlisis de pH
Molcula nica

Longitud de lectura (pb)


700
150
50
1000
201
No informacin

BIOLOGA MOLECULAR Y CARACTERIZACIN DE LAS POBLACIONES HUMANAS

131

La pirosecuenciacin es relativamente una nueva tcnica de secuenciacin del


ADN, desarrollada inicialmente por Mostafa Ronaghi a finales de los aos noventa
(Ronaghi et al., 1996; 1998; 2001). Esta tcnica est basada en la secuenciacin por
sntesis, acoplando la sntesis de ADN a una reaccin quimioluminiscente, lo que
permite una rpida determinacin de secuencias en tiempo real. La tcnica utiliza cuatro
reacciones enzimticas que tienen lugar en un nico tubo en el que se monitoriza la
sntesis de la cadena complementaria del ADN, usando como molde ADN de cadena
simple. Los nucletidos son aadidos de forma consecutiva a la reaccin y, en caso de
incorporacin, se libera pirofosfato inorgnico (PPi). PPi desencadena una serie de
reacciones que resultan en la produccin de luz, de forma proporcional a la cantidad de
ADN y el nmero de nucletidos incorporados. La generacin de luz se detecta en
forma de pico y se graba mediante un sistema de deteccin, reflejando la actividad de
las enzimas en la reaccin (Ronaghi et al., 1996; 1998; 2001).

FIGURA VIII. 12. ESQUEMA DE PIROSECUENCIACIN. Secuenciacin por sntesis,


acoplando el ADN a una reaccin quimioluminiscente, permitiendo la deteccin de
secuencias en tiempo real (Modificado de Margulies et al., 2005; IIB, 2014).

Al mismo tiempo que se desarrollaba la pirosecuenciacin, otras dos compaas


desarrollaron otro tipo de tecnologa para la secuenciacin masiva en paralelo del ADN:

BIOLOGA MOLECULAR Y CARACTERIZACIN DE LAS POBLACIONES HUMANAS

132

la tcnica de terminadores reversibles que utiliza un mtodo basado en la polimerizacin


del ADN, donde la incorporacin de un nucletido marcado con fluorescencia y
protegido en la cadena naciente impide que esta siga creciendo. Tras detectar la seal
fluorescente, se elimina el grupo protector y se puede incorporar otro nucletido
marcado, con lo que empieza de nuevo el ciclo (Figura VIII.13).

FIGURA VIII. 13. ESQUEMA DE SECUENCIACIN POR TERMINADORES


REVERSIBLES. Es un mtodo basado en la polimerizacin del ADN y en la
incorporacin de nucletidos marcados con fluorocromos (IIB, 2014).

De otro lado, el mtodo de secuenciacin por ligacin es una tcnica que


secuencia por ligacin de octmeros marcados a la cadena de ADN, con la posterior
deteccin de la seal fluorescente emitida tras cada ligacin (Figura VIII.14).
Ambas tcnicas (terminadores reversibles y ligacin) tienen la gran ventaja, con
respecto a la pirosecuenciacin, de resolver de forma fiable las regiones
homopolimricas. Sin embargo, su gran desventaja radica en que no pueden generar
lecturas superiores a 75 bases, por lo que no se puede utilizar en las secuencias de novo,
siendo especialmente diseadas para la resecuenciacin de genomas ya conocidos o
para estudiar la expresin de los transcritos (Metzker, 2010).

BIOLOGA MOLECULAR Y CARACTERIZACIN DE LAS POBLACIONES HUMANAS

133

FIGURA VIII. 14. ESQUEMA DE SECUENCIACIN POR LIGACIN. Consiste en la


ligacin de octmeros marcados a la secuencia madre de ADN (IIB, 2014).

Una innovadora tecnologa de secuenciacin es la que aplica la semiconduccin


inica, que consiste en la captacin de protones (H+) los cuales son eliminados cuando
los nucletidos se incorporan a la molcula de ADN que est siendo sintetizada por la
polimerasa. Para detectar el cambio en el pH, la mquina PGM (personal genome
machine) reconoce cuando el nucletido es incorporado o no. Cada vez el chip es
llenado con un nucletido despus de otro. Si se incorpora un nucletido incorrecto no
hay captacin de voltaje y si se incorporan dos nucletidos consecutivos hay doble
captacin de voltaje (Liu et al., 2012) (Figura VIII.15).
La necesidad de estudiar regiones de ADN ms extensas con alta fiabilidad y a
un menor costo, ha impulsado el desarrollo de otras tcnicas denominadas de tercera
generacin, basadas en la secuenciacin de una nica molcula de ADN (single
molecule real time sequencing). El primer secuenciador de esta generacin tiene como
base la secuenciacin a tiempo real de miles de millones de pequeas molculas nicas
de ADN adheridas a una superficie slida. Permite generar fragmentos fiables de entre
25 y 45 bases. Dada la pequeez de las lecturas generadas, esta tecnologa est

BIOLOGA MOLECULAR Y CARACTERIZACIN DE LAS POBLACIONES HUMANAS

134

recomendada para la resecuenciacin de genomas y no para la secuenciacin de novo.


En un paso ms adelante se sita otra tecnologa que permite leer de golpe hasta 1000
nucletidos, lo que resolvera el problema de las anteriores tecnologas mencionadas.
Otra tecnologa, encuadrada en los secuenciadores de tercera generacin, es la que
utiliza microscopa electrnica y permite leer la secuencia del ADN directamente sobre
una imagen electrnica. La lectura de la secuencia requiere de la replicacin previa de
una hebra molde de ADN para poder marcarla con bases modificadas con yodo, bromo
y triclorometilo antes de analizarlas (Metzker, 2010).

FIGURA VIII. 15. ESQUEMA DE SECUENCIACIN POR SEMICONDUCCIN INICA.


Esta tcnica permite captar los protones (H+) que son eliminados cuando los
nucletidos son incorporados al ADN (IIB, 2014).

Gracias al avance de la Nanotecnologa y la Microscopa Electrnica se ha


podido reducir, hasta lmites insospechados, la cantidad de reactivos necesarios para
lanzar las reacciones de secuenciacin, con el consiguiente abaratamiento de los costos.
Adems, no se debe olvidar que estas tecnologas ya se estn aplicando a campos como

BIOLOGA MOLECULAR Y CARACTERIZACIN DE LAS POBLACIONES HUMANAS

135

la transcriptmica, el anlisis de la variabilidad, la identificacin de SNP, los anlisis de


metagenmica y el estudio del exoma.
A partir del uso de los mtodos de Sanger y de secuenciacin de prxima
generacin se realiz y se est realizando el Proyecto del Genoma Humano y el
Proyecto del Varioma Humano, respectivamente. Mientras que el Proyecto ENCODE es
un anlisis de los elementos funcionales del genoma humano.

5.PROYECTOSDELGENOMAHUMANOYVARIOMAHUMANO
En el desarrollo de la Gentica, merece un tratamiento aparte la decisin tomada
por los cientficos con respecto a una de las ambiciones ms grandes e importantes de la
poca actual: secuenciar los aproximadamente 23000 genes que contiene el genoma
humano. Para ello, se ha desarrollado el Proyecto Genoma Humano (PGH); en el que se
han invertido 3 billones de dlares en el financiamiento de estudios durante 15 aos
(200 millones de dlares anuales), para descifrar 3000 millones de pares de bases que
constituiran la totalidad de los genes humanos. Este proyecto que se inici en 1988 bajo
la conduccin de James Watson, ha logrado ya conocer unos 4600 genes responsables
de enfermedades hereditarias mendelianas, 1500 de estos genes se ha logrado mapear en
lugares especficos de los cromosomas y tan solo unos 600 de estos han sido clonados y
secuenciados. La labor de secuenciar el genoma ha sido ardua y difcil; para su
culminacin, financiamiento y desarrollo, la comunidad cientfica internacional cre la
Human Genome Organization (HUGO), liderada desde Baltimore, Estados Unidos, por
Victor A. McKusick, y que aspira ser utilizada en la actualidad para resolver problemas
genticos como el cncer, la diabetes y otros males (Human Genome Organization,
2013).
La estrategia a seguir para alcanzar la meta del Proyecto Genoma Humano fue la
siguiente: En primer lugar, trazar el mapa gentico; es decir, ubicar genes para los
cuales existen marcadores genticos a travs del anlisis del ADN polimrfico. Se
aspiraba culminar esta primera etapa en 1995, ao en el que se sabran con certeza los
genes causantes de anormalidades mendelianas. En segundo lugar, desarrollar un mapa
fsico; es decir, secuenciar el gen previamente extrado del ADN total; para este mapa
fsico se consider la siguiente tecnologa del ADN:

a)

Identificacin gentica por hibridacin del ADN.

b)

Anlisis de fragmentos del ADN por separacin electrofortica.

c)

Identificacin de fragmentos del ADN por hibridacin in situ y con fluoresencia.

d)

Anlisis de fragmentos del ADN.

e)

Clonacin de genes.

f)

Secuenciacin del ADN.

g)

Aplicacin de la PCR para amplificacin de genes.

h)

Otros mtodos: Citometra de flujo; microscopa; rayos X.

BIOLOGA MOLECULAR Y CARACTERIZACIN DE LAS POBLACIONES HUMANAS

136

Los resultados del PGH han creado mucha polmica entre investigadores,
empresas farmacuticas y posibles usuarios. Hay grupos de personas que han tratado de
manejar la informacin gentica en forma restringida, secreta y han hecho lo posible por
patentarla. Frente a esto, grupos de investigadores dirigidos por Cavalli-Sforza,
impulsaron el Proyecto del Varioma Humano (PVH) para estudiar la diversidad del
genoma humano. Uno de sus primeros logros fue el descifrar la casi totalidad de
secuencias repetidas en el genoma y darlo a conocer a toda la comunidad cientfica, a
travs de las Naciones Unidas, lo que abri una gran oportunidad para los pases en vas
de desarrollo, para acceder a las nuevas tecnologas e implementarlas en el estudio de
sus propias poblaciones, que son muy ricas en grupos tnicos y posiblemente ofrecen
valiosa informacin de los polimorfismos del ADN (Human Variome Project, 2013).
Los polimorfismos del ADN, que son cambios en nuestros genes, manejan los
procesos evolutivos, introduciendo constantemente una variabilidad fenotpica en las
poblaciones, asegurando que nosotros, como especie, nos podamos adaptar a cambios
ambientales. A pesar de esto, las variaciones en el ADN tambin son causantes de
enfermedades genticas que pueden llegar a ser muy devastadoras personal y
socialmente. Entre ellas la fibrosis qustica, distrofia muscular, enfermedad de TaySachs, ictiosis, etc.
La expectativa sobre los dos proyectos (PGH y PVH) es muy grande debido a
que toda la informacin del genoma sirve para detectar marcadores moleculares, generar
frmacos especficos de cada tipo de enfermedad, y tambin es importante en el
entendimiento de la evolucin humana y de todas las especies.

6.ENCICLOPEDIADELOSELEMENTOSDELADN
El proyecto ENCODE o enciclopedia de los elementos del ADN (Encyclopedia
of DNA Elements) naci en el ao 2003 y se expandieron sus objetivos en el ao 2007,
cuyo enfoque actual es el de estudiar el genoma humano completo, capitalizando el
desarrollo tecnolgico para experimentos y para anlisis computacional. Su misin es el
brindar a la comunidad cientfica informacin comprensible y de alta calidad sobre los
elementos funcionales del genoma humano (Dunham et al., 2012).
El proyecto ENCODE ha sido fundado por el National Human Genome
Research Institute, para identificar todas las regiones de transcripcin, asociacin de
factores de transcripcin, estructura de la cromatina y modificaciones histnicas en la
secuencia del genoma humano. Gracias a la identificacin de los elementos funcionales,
el 80% de estos componentes del genoma humano tienen ahora al menos una funcin
bioqumica y toda la informacin recopilada ha brindado nuevos perfiles en cuanto a la
organizacin y regulacin de los genes y del genoma (National Human Genome
Research Institute, 2013).
La tabla a continuacin describe los diferentes tipos de informacin que han sido
producidos por este proyecto (Bnfai et al., 2012; Charos et al., 2012; Cheng et al.,
2012; Djebali et al., 2012; Gerstein et al., 2012; Ladewig et al., 2012; Neph et al., 2012;
Park et al., 2012; Sanyal et al., 2012; Thurman et al., 2012; Tilgner et al., 2012; Wang et
al., 2012) (Tabla VIII.8).

BIOLOGA MOLECULAR Y CARACTERIZACIN DE LAS POBLACIONES HUMANAS

137

Tabla VIII.8. Informacin procesada por el proyecto ENCODE


Gen / Anlisis de transcrito
Mtodo
GENCODE
RNA-seq; tilling DNA
Microarrays; PET
Regiones codificadoras de ARN total
RNA-seq; tilling DNA
Microarrays; PET
Regiones codificadoras en fracciones PET
de ARN subcelular
ARNs pequeos
Short RNA-seq
Lugares de inicio (5) y terminacin
CAGE; diTAGs
(3) de la transcripcin
Molculas largas de ARN
RACE

Regin / Caracterstica
Gen
Regiones codificadoras Poli A+

Regiones de ARN enlazadas a


protenas

RIP; CLIP

Grupo de investigacin
Wellcome Trust Sanger Institute
CSHL; Stanford/Yale/Harvard;
Caltech
CSHL
CSHL
CSHL
RIKEN; GIS
University of Geneva; University of
Lausanne
SUNY-Albany; CSHL

Factores de transcripcin / Cromatinas


Elementos / Regiones
Mtodos
Grupo de investigacin
Stanford/Yale/UCSitios de enlace de factores de
ChiP-seq
Davis/Harvard;
transcripcin
HudsonAlpha/Caltech;
Duke/UT-Austin; UW; U.
Chicago/Stanford
Estructura de cromatina
ADNasaI
UW; Duke; UNC
hipersensibilidad; FAIRE
Modificacin de la cromatina
ChiP-seq
Broad; UW
(H3K27ac, H3K27me3, H3K36me3)
Huellas ADNasaI
Huella genmica digital
UW
Caractersticas
Metilacin del ADN
Interaccin de cromatina
Genotipaje

Otros elementos
Mtodos
RRBS; Illumina Methyl27;
Methyl-seq
5C; CHIA-PET
Illumina 1M Duo

Grupo de investigacin
HudsonAlpha
UMass; UW; GIS
HudsonAlpha

7.PROCESOSDEINHIBICINDELAEXPRESINGNICA

Entre los diversos mecanismos que existen en la clula para el control de la


expresin gnica, los ARN de interferencia (ARNi) son molculas que actan
inhibiendo los ARN mensajeros ya sea por bloqueo o degradacin.

7.1.ARNdeinterferencia

Una nueva era en la Gentica de los eucariontes comenz con el descubrimiento


del ARNi, en la cual el ARN de doble cadena es introducido en la clula con el objetivo
de silenciar la expresin de genes homlogos. El ARNi representa uno de los ms
promisorios avances en la aplicacin de nuevas estrategias teraputicas en Medicina. La
interferencia de ARN es el proceso por el cual el ARN de interferencia pequeo
(ARNsi) y el micro ARN (miARN) silencian la expresin de genes, ya sea por inducir la
degradacin de una secuencia especfica de ARN mensajero (ARNm) o por inhibir su
traduccin. Los ARNs de interferencia son molculas pequeas de 20 a 25 nucletidos
que se generan por la fragmentacin de precursores ms largos (Fire et al., 1998).

BIOLOGA MOLECULAR Y CARACTERIZACIN DE LAS POBLACIONES HUMANAS

138

Las molculas de ARNi se clasifican en: ARN interferente pequeo, micro ARN
y ARN asociado a piwi (ARNpi).
7.1.1.ARNinterferentepequeo

El ARNsi es una molcula de ARN bicatenario, complementado entre s. Su


estructura est formada por 20 nucletidos, manteniendo dos nucletidos
desemparejados en el extremo 3 (Ghildiyal et al., 2008).
El ARN de doble cadena (ARNds) es cortado en pequeas molculas (ARNsi)
por la endoribonucleasa DICER. La cadena antisentido del ARNsi se engancha en el
complejo multiproteico denominado RISC (RNA-induced silencing complex), que
induce al silenciamiento del ARN mensajero. El complejo RISC utiliza la hebra de
ARNsi como gua para identificar el ARN mensajero especfico que va a ser cortado en
dos mitades y degradado, con el objetivo de inhibir la sntesis proteica. Este
procedimiento se lo puede observar en la siguiente figura (Watanabe et al., 2008).

FIGURA VIII. 16. PROCESO DE FUNCIONAMIENTO DEL ARNsi. Consiste en la


degradacin de molculas de ARNm a partir de molculas de ARNsi (IIB, 2014).

BIOLOGA MOLECULAR Y CARACTERIZACIN DE LAS POBLACIONES HUMANAS

139

7.1.2.MicroARN
El miARN es una molcula monocatenaria conformada por 21 a 25 nucletidos,
los cuales se generan a partir de precursores especficos codificados en el genoma.
Estructuralmente al transcribirse se pliegan en horquillas (hairpins).
Una vez que se transcribe el miARN en el ncleo, este sufre un proceso de
maduracin de pri-miARN a pre-miARN mediante el complejo proteico DROSHA
(enzima ARNasa III de clase 2). Una vez que se forma la molcula pre-miARN, esta se
dirige al complejo del citoplasma DICER en el cual se elimina la horquilla, se
mantienen los extremos 3 desemparejados y se hibridiza la cadena. Posteriormente, una
de las hebras del miARN se incorpora al complejo RISC, el cual direcciona la molcula
al ARN mensajero especfico para inhibir la sntesis proteica. A diferencia del ARNsi,
el miARN se inicia con la eliminacin de la cola poli A del ARN mensajero. Lo
mencionado anteriormente se detalla en la siguiente figura (Fire et al., 1998).

FIGURA VIII. 17. PROCESO DE FUNCIONAMIENTO DEL miARN. Consiste en la


maduracin del pri-miARN a pre-miARN y posterior inhibicin de las molculas de
ARNm para controlar la cantidad de protena en proceso de sntesis (IIB, 2014).

BIOLOGA MOLECULAR Y CARACTERIZACIN DE LAS POBLACIONES HUMANAS

140

7.1.3.PiwiARN

El ARNpi es una clase de molculas de ARN no codificante que se expresa en


las clulas animales. El complejo ARNpi interviene en el silenciamiento de
retrotransposones y otros elementos genticos en las clulas de la lnea germinal,
especialmente en la espermatognesis. El avance en el mejor entendimiento de la
estructura y funcin de los ARNpi se debe gracias a la tcnica de secuenciamiento de
prxima generacin (Klattenhoff & Theurkauf, 2008).

7.2.ImportanciadeldescubrimientodelosARNi

El descubrimiento de los ARNs de interferencia ha sido visto con una


excepcional perspectiva futura por parte de la comunidad cientfica. Entre los aspectos
ms destacados con respecto a la aplicacin de estas molculas de ribointerferencia se
pueden mencionar los siguientes:
7.3.ProteccindelARNicontrainfeccionesvirales
Las investigaciones de los cientficos Fire y Mello, sobre la capacidad que tienen
los ARNds de ser insertados en las clulas y de eliminar molculas homlogas de ARN
de cadena simple, sugirieron que los ARNi pueden constituir un mecanismo de defensa
contra los ataques virales (Fire et al., 1998).
7.4.Silenciamientodeelementosmviles
Primero se propuso la idea de que, el ARNi en Caenorhabditis elegans y su
molcula homloga en plantas PTGS, tienen la capacidad de bloquear la accin de los
transposones (elementos mviles en el genoma). Segundo, se pudo demostrar que los
componentes de la maquinaria de ARNi en C. elegans mutaron, activando los
transposones causando disturbios en la funcin del genoma (Ketting et al., 1999; Tabara
et al., 1999). Se propuso que en las regiones contenedoras de transposones del genoma
ambas cadenas del ADN se transcriben, los ARNds se forman y el proceso de ARNi se
activa eliminando productos indeseables.
7.5.Sntesisproteicayregulacindeldesarrolloenorganismos

Se descubri que una molcula de ARN pequeo present el mismo tamao en


la lombriz, mosca, ratn y humano; a esta molcula se le denomin microARN (LagosQuintana et al., 2001; Lee & Ambros, 2001). Los precursores de los micro ARNs
pequeos son molculas largas en forma de horquillas (Murchison & Hannon, 2004;
Zamore & Haley, 2005). Las molculas de miARN pueden regular la expresin gnica
mediante complementariedad de bases con el ARNm, degradndolo o suprimiendo la
traduccin.
Actualmente se han encontrado ms de 21200 miARNs y ms del 30% de genes
son regulados por estas endoribonucleasas. Se sabe que los miARNs juegan un papel
importante en el desarrollo de las plantas, C. elegans y mamferos. Por lo tanto, el
control de la expresin gnica dependiente de miARN representa un nuevo campo en la
regulacin gnica (Fire et al., 1998).

BIOLOGA MOLECULAR Y CARACTERIZACIN DE LAS POBLACIONES HUMANAS

141

7.6.ARNimantienelacromatinacondensadaysuprimelatranscripcin
Investigaciones en plantas han permitido conocer que el silenciamiento de genes
puede tomar lugar a nivel transcripcional (TGS). Despus del descubrimiento del ARNi,
se observ que el TGS en plantas opera mediante el mecanismo del ARN de
interferencia (Mette et al., 2000; Sijen et al., 2001). En la levadura
Schizosaccharomyces pombe (Hall et al., 2002; Volpe et al., 2002), y despus en la
Drosophila y vertebrados, se encontr que procesos similares mantienen las regiones
heterocromticas condensadas y transcripcionalmente suprimidas. Adems, la
maquinaria de ARNi regula la actividad de los genes en las regiones aledaas de los
bloques condensados de cromatina. Este fenmeno no se lo comprende totalmente a
nivel molecular aunque las histonas, protenas condensadores de protenas (HP1) y la
metilacin del ADN juegan importantes roles (Sharp, 2006).
7.7.ARNicomoherramientaparalaterapiagnica
La posibilidad de utilizar el ARN de interferencia como una herramienta para la
regulacin de genes en organismos transgnicos ha estimulado diversas investigaciones
en la terapia mdica (Dorsett & Tuschi, 2004; Hannon & Rose, 2004). Resultados
alentadores han sido reportados en varios modelos animales (Soutschek, 2004;
Morrissey, 2005; Palliser, 2006; Zimmermann, 2006), y el avance en la ciencia y la
tecnologa permitir perfeccionar las tcnicas de aplicacin a pacientes con
enfermedades genticas que requieran del silenciamiento en la traduccin de las
protenas que se sobreexpresan.

Captulo IX
Investigaciones moleculares en el Ecuador:
Enfermedades neurodegenerativas
Las enfermedades neurodegenerativas empeoran algunas de las actividades
corporales, incluyendo el equilibrio, el movimiento, el habla, la respiracin y la funcin
cardiaca. Muchas de estas enfermedades son genticas, lo que significa que son
hereditarias o que existe una mutacin gentica. Las enfermedades neurodegenerativas
pueden ser serias o poner la vida en peligro. El estudio profundizado a nivel gentico es
muy importante para entender el desarrollo de las diferentes enfermedades y generar
informacin para elaborar frmacos ms especficos.

1.ENFERMEDADDEALZHEIMER

La enfermedad de Alzheimer es la causa ms comn de demencia y representa


un complejo problema de salud pblica. Esta enfermedad es progresiva,
neurodegenerativa, irreversible, polignica y multifactorial, que se caracteriza por
alteraciones y deterioro paulatino de la funcin cognitiva (Bird, 2008).

La Alzheimers Disease International (ADI) calcula que 35 millones de personas


en el mundo padecen de demencia, y cada ao se reportan 4,6 millones de nuevos casos
(Ferri et al., 2009; ADI, 2012). La frecuencia en Estados Unidos es alrededor del 8% a
los 65 aos y del 30% en individuos mayores a 90 aos (Brookmeyer et al., 1998). En
Latinoamrica la prevalencia de demencia vara del 2,6 al 6,5% en poblacin mayor de
65 aos (Selkoe 2001; Rodrguez et al., 2008). En el Ecuador, segn el INEC, en el ao
2007 hubo un total de 58016 defunciones, de las cuales 161 habitantes fallecieron de
demencia y enfermedad de Alzheimer que corresponde al 0,27%. En el 2008 fallecieron
60023 personas de las cuales 177 presentaron demencia y Alzheimer, que corresponde
al 0,29%. En el 2010 increment el total de fallecidos a 61,681, por lo tanto, existe un
incremento tanto de la mortalidad general como de la mortalidad por demencia y
Alzheimer (INEC, 2013).
Los cerebros afectados por esta enfermedad se caracterizan por presentar placas
neurticas y ovillos neurofibrilares localizados de forma difusa en la corteza cerebral e
hipocampo; conjuntamente el depsito de amiloide suele encontrarse en arteriolas,
vnulas y capilares de la corteza cerebral (Bales et al., 2002). Los cambios
neuropatolgicos y bioqumicos encontrados en esta enfermedad incluyen mayor
produccin de protena amiloide; este proceso bloquea la sinapsis, altera la fisiologa y
provoca la muerte neuronal (Garca-Ruz et al., 2006).

La protena precursora amiloide es escindida normalmente por secretasa,


enzima que genera dos pptidos solubles, C83 y sAPP , que se producen en respuesta a
la actividad elctrica y colinrgica. Pero, si APP es cortada por las proteasas BACE y Y
secretasa, genera los pptidos C99 y amiloide (Thomas & Fenech, 2007), estos
depsitos insolubles junto con microglia, astrocitos, neuronas distrficas y
proteoglicanos se denominan placas neurticas, las cuales interrumpen la sinapsis
nerviosa, alteran los canales inicos, inducen respuesta inflamatoria y muerte neuronal

INVESTIGACIONES MOLECULARES EN EL ECUADOR: ENFERMEDADES NEURODEGENERATIVAS

146

(Corder et al., 1993; Mattson, 2004; Reddy, 2006). La amiloide puede causar estrs
oxidativo mitocondrial, lo que altera la regulacin del calcio (Paik et al., 1985), conduce
a la disminucin en la produccin de ATP, altera el transporte de electrones y crea
superxido, este ltimo es convertido en perxido de hidrgeno que interacta con
xido nitroso, hierro y cobre para generar peroxinitritos y radicales libres hidroxilo, que
alteran tanto la homeostasis de la membrana celular como la membrana del retculo
endoplasmtico estimulando un alto flujo de calcio al interior de la clula, que junto con
el dao de la membrana dejan a la neurona vulnerable (Huang et al., 2004).
En el desarrollo de la enfermedad de Alzheimer varios genes interactan con el
ambiente modulando el riesgo de presentar la enfermedad (Corder et al., 1993), como
son: APP, PS-1, PS-2 y Apo E (Hamanishi et al., 2004; Bird, 2010). Otros genes poco
estudiados son: GPX-1, CTSD, CST3 y MnSOD.

1.1.GenApoE

El gen Apo E se ubica en el locus 19q13, est conformado por cuatro exones y
presenta un polimorfismo comn en su exn 3 caracterizado por 3 isoformas diferentes
de la protena: 2, 3 y 4, consistiendo en la sustitucin de los aminocidos cistena y
arginina en los codones 112 y 158 (Cisneros et al., 1997). Apo E codifica una
glicoprotena (apolipoprotena E) de 36 KDa que se expresa en el hgado, cerebro,
rin, glndulas suprarrenales, ovarios y placenta (Cisneros et al., 1997; Garca-Ruz et
al., 2006; Power & Blumbergs 2009). Se libera al plasma, moviliza y redistribuye
colesterol durante el crecimiento y regeneracin neuronal (Sambrook et al., 1989;
Casado et al., 2008; Power & Blumbergs, 2009), pero en altas concentraciones esta
protena resulta txica, fomentando la muerte neuronal (Casado et al., 2008).
Tabla IX.1. Caractersticas del gen Apo E

Caractersticas
Smbolo oficial
Nombre
Otros alias
Cromosoma
Localizacin
# Acceso NCBI
Gen ID
Tamao secuencia
Tamao protena
Localizacin subcelular

Informacin
Apo E
Apolipoprotena E
19
19q13,2
NC_000019,9
348
3695 bases
317 aa; 36154 Da
Secretado

Estructura proteica

(Segelke et al., 2000; Sandelin, 2004)

Apo E 4 se une rpidamente al amiloide y facilita la fibrilizacin para la


formacin de la placa neurtica, por lo que el nmero y tamao de los depsitos
amiloides son mayores en los portadores de este polimorfismo (Garca-Ruz et al., 2006;
Casado et al., 2008).

FIGURA IX.1. CROMOSOMA 19 HUMANO. Ubicacin del gen APO E (GeneCards,


2014).

INVESTIGACIONES MOLECULARES EN EL ECUADOR: ENFERMEDADES NEURODEGENERATIVAS

147

Apo E 4 ha sido observado como gen de riesgo en varias poblaciones, por lo


cual se considera el factor de mayor susceptibilidad para la enfermedad de Alzheimer.
El riesgo de desarrollar esta enfermedad es del 30% en portadores del genotipo 44, el
cual aumenta a los 70 aos al 45% y 25%, en hombres y mujeres respectivamente
(Sambrook et al., 1989).
1.2.GenGPX1

La familia glutatin peroxidasa (GPX) se encuentra conformada por seis


isoenzimas (GPX-1, GPX-2, GPX-3, GPX-4, GPX-5, GPX-6). El gen GPX-1 se ubica
en el locus 3p21,3 (Tabla IX.2) (Figura IX.2). El polimorfismo Pro198Leu implica el
cambio de T por C, lo que da como resultado la sustitucin de leucina por prolina, cuyo
alelo recesivo leu/leu ha sido vinculado con la disminucin del 40% de la actividad
enzimtica (Hamanishi et al., 2004).
Tabla IX.2. Caractersticas del gen GPX-1

Caractersticas
Smbolo oficial
Nombre
Otros alias
Cromosoma
Localizacin
# Acceso NCBI
Gen ID
Tamao secuencia
Tamao protena
Localizacin subcelular

Informacin
GPX-1
Glutatin peroxidasa
GHSPX1
3
3p21,3
NC_000003,11
2878
1186 bases
201 aa; 21946 Da
Citoplasma

Estructura proteica

(Yang & Zhou, 2006)

El gen GPX-1 codifica una protena tetramrica de 22 KDa denominada


glutatin peroxidasa, que se expresa en los eritrocitos, hgado, rin, cerebro (Cisneros
et al., 1997; Power & Blumbergs 2009). Esta enzima es la reguladora final de la va
metablica que degrada especies xido reactivas y radicales perxido, limitando su
interaccin con xido ntrico, cobre o hierro, con lo cual se evita la formacin de
oxidantes celulares (Reddy 2006). La reaccin qumica requiere de glutatin reducido;
este sistema debe encontrarse intacto para la adecuada detoxificacin de
hidroxiperxidos y por tanto cumplir la funcin de protector celular. Adems, su
actividad se encuentra fuertemente vinculada con seales de apoptosis y fosforilacin de
proteinquinasas (Lei et al., 2007).
Adicionalmente, se ha encontrado valores disminuidos de la enzima GPX-1 en
pacientes con la enfermedad de Alzheimer, acompaados de niveles altos de
malondialdehido, un indicador de estrs oxidativo (Casado et al., 2008).

FIGURA IX.2. CROMOSOMA 3 HUMANO. Ubicacin del gen GPX-1 (GeneCards,


2014).

INVESTIGACIONES MOLECULARES EN EL ECUADOR: ENFERMEDADES NEURODEGENERATIVAS

148

1.3.GenCTSD

El gen CTSD codifica a la enzima catepsina D (RCSB-PDB, 2013). Este gen se


encuentra en el cromosoma 11, en la regin 15,5 y el polimorfismo Ala224Val est en
el exn 2 en la posicin 224 (Tabla IX.3) (Figura IX.3).
Tabla IX.3. Caractersticas del gen CTSD

Caractersticas
Smbolo oficial
Nombre
Otros alias
Cromosoma
Localizacin
# Acceso NCBI
Gen ID
Tamao secuencia
Tamao protena
Localizacin subcelular

Informacin
CTSD
Catepsina D
CPSD, CLN10
11
11p15,5
NC_000011,9
1509
11241 bases
412 aa; 44552 Da
Lisosoma

Estructura proteica

(Baldwin et al., 1993)

Esta variante gentica resulta en el cambio de C por T, que consiste en una


sustitucin de un residuo de alanina por valina. Este polimorfismo causa un aumento de
la secrecin pro-CTSD y la maduracin intracelular (Mariani et al., 2006). La expresin
aberrante de este gen puede llevar a una neurodegeneracin en modelos experimentales
en animales como en humanos (Steinfeld et al., 2006). La catepsina D ha demostrado
que presenta una funcin -secretasa, por lo que podra romper la protena precursora
beta amiloide (A) que genera las plaquetas seniles encontradas en la enfermedad de
Alzheimer (Hamazaki, 1996; Chevallier et al., 1997).

FIGURA IX.3. CROMOSOMA 11 HUMANO. Ubicacin del gen CTSD (GeneCards,


2014).

1.4.GenCST3

La cistatina es una familia de protenas, conformada por tres grupos: cistatinas


tipo 1, cistatinas tipo 2 y los quiningenos. Las protenas cistatinas de tipo 2 son una
clase de inhibidores de la proteasa cistena, encontrada en fluidos y secreciones donde
parece tener funcin protectora. El gen CST3 se encuentra en el locus cistatina del
cromosoma 20 y codifica la mayor parte de inhibidores extracelulares de las proteasas
cistenas (Tabla IX.4) (Figura IX.4). Una mutacin en este gen ha sido relacionada con
angiopata amiloide. La expresin de esta protena en las clulas vasculares del msculo
liso de las paredes es muy reducida en lesiones aterosclerticas y aneurisma artico,
estableciendo su rol en la enfermedad vascular (NCBI, 2013). La aspartil proteasa
lisosomal catepsina D est implicada en la patognesis de varias enfermedades
neurodegenerativas como el Alzheimer, Parkinson y Creutzfeldt-Jakob (NCBI, 2013).
La catepsina D es una proteasa acdica intracelular que tiene relacin con el desarrollo
del Alzheimer, ya que genera fragmentos de beta-amiloide (A) a partir de la divisin

INVESTIGACIONES MOLECULARES EN EL ECUADOR: ENFERMEDADES NEURODEGENERATIVAS

149

de la protena precursora amiloide APP y la degradacin de la protena TAU en varios


fragmentos (Chevallier et al., 1997; RCSB-PDB, 2013).
Tabla IX.4. Caractersticas del gen CST3

Caractersticas
Smbolo oficial
Nombre
Otros alias
Cromosoma
Localizacin
# Acceso NCBI
Gen ID
Tamao secuencia
Tamao protena
Localizacin subcelular

Informacin
CST3
Cistatina 3
AEMD11
20
20p11,21
NC_000020
1471
10577 bases
146 aa; 15799 Da
Secretado

Estructura proteica

(Janowski et al., 2001)

La variante Ile58Thr afecta la estabilidad de la interface de la protena


tetramrica y reduce la actividad biolgica de MnSOD. En este polimorfismo se
sustituye T por C, que produce un cambio de isoleucina por treonina, en el codn 58 del
exn 6 (6q25) (Borgstahl et al., 1996). Ala9Val es una sustitucin de T por C en el
codn 9 del exn 2 (6q25), que da un cambio de valina por alanina. Esta sustitucin
induce cambios de conformacin en la secuencia mitocondrial de orientacin de la hoja
plegada a la hlice , y por este cambio no se puede realizar bien el transporte a la
mitocondria (Shimoda-Matsubayashi et al., 1996). Segn Sutton, el transporte en la
matriz mitocondrial baja y se asocia al decaimiento de la estabilidad del ARNm (Sutton
et al., 2005).
Como la cistatina C es un inhibidor de la proteasa cistena lisosomal, interviene
en el envejecimiento neuronal o en la muerte celular de la enfermedad de Alzheimer. El
polimorfismo que causa este proceso corresponde al gen CST3 localizado en la posicin
73 del exn 1, resultando en un cambio de G por A, lo que lleva a una sustitucin de
alanina por treonina (Lin et al., 2003).

FIGURA IX.4. CROMOSOMA 20 HUMANO. Ubicacin del gen CST3 (GeneCards,


2014).

1.5.GenMnSOD

El gen MnSOD proviene de la familia hierro/manganeso superxido dismutasa.


Codifica una protena mitocondrial que forma un homotetrmero y une un ion
manganeso por cada subunidad. Esta protena se une a los subproductos de superxido
de la fosforilacin oxidativa y los convierte en perxido de hidrgeno y oxgeno
diatmico. Las mutaciones de este gen se han asociado con miocardiopata idioptica,
envejecimiento prematuro, enfermedades espordicas de las neuronas motoras y cncer
(NCBI, 2013). Las caractersticas del gen MnSOD se detallan en la Tabla IX.5.

INVESTIGACIONES MOLECULARES EN EL ECUADOR: ENFERMEDADES NEURODEGENERATIVAS

150

Tabla IX.5. Caractersticas del gen MnSOD

Caractersticas
Smbolo oficial
Nombre
Otros alias
Cromosoma
Localizacin
# Acceso NCBI
Gen ID
Tamao secuencia
Tamao protena
Localizacin subcelular

Informacin
MnSOD
Superxido
dismutasa Mn
MVCD6
6
6q25,3
NC_000006,11
6648
83466 bases
222 aa; 24722 Da
Matriz mitocondrial

Estructura proteica

(Quint et al., 2006)

El gen MnSOD, ubicado en el cromosoma 6, codifica la nica enzima


antioxidante primaria que ha demostrado ser esencial para la sobrevivencia de
organismos aerbicos (Figura IX.5). Esta enzima convierte radicales superxido a
oxgeno molecular y H2O2, que puede ser luego neutralizado por la glutatin peroxidasa,
peroxiredoxina reductasa y catalasa. Segn evidencias mostradas anteriormente,
MnSOD sugiere ser crtico para que las neuronas sobrevivan al dao oxidativo (Galecki
et al., 2010). MnSOD codifica una enzima por el ADN nuclear pero su actividad
biolgica est localizada en la mitocondria donde luego es transportado despus de un
proceso de traslacin (Church et al., 1992). Ya que SOD juega un papel importante
entre las enzimas antioxidantes, protege al cerebro contra ROS y si es que existe un
cambio en la actividad de esta enzima en la mitocondria, existirn disfunciones de los
mecanismos que es responsable la misma (Visner et al., 1991).

FIGURA IX.5. CROMOSOMA 6 HUMANO. Ubicacin del gen MnSOD (GeneCards,


2014).

1.6.Resultadosydiscusin
Con respecto al estudio de los genes Apo E y GPX-1, se realiz el anlisis a 78
individuos ecuatorianos; 39 de ellos presentaron Alzheimer y 39 personas sanas no
presentaron antecedentes clnicos de demencia.
En la Tabla IX.6 se muestran las frecuencias genotpicas y allicas de los genes
Apo E y GPX-1. Con respecto a Apo E, el genotipo 23 se present en el 5,1% de los
individuos sanos y el 2,6% de los individuos control; 24 solo se encontr en el 2,6%
de los afectos. El genotipo 33 se present con mayor frecuencia en controles (79,5%)
que en afectos (61,5%), seguido de 34 con 15,4% en controles y 25,6% en casos. La
variable 44 se encontr en el 2,6% de sanos y 5,1% de afectos. En cuanto a las
frecuencias allicas del gen Apo E, el alelo 3 fue el ms comn en afectos con el
76,9% y el 88,5% en controles. El alelo 4 estuvo presente en el 17,94% de casos y
10,3% de controles; mientras que el alelo 2 est en el 3.8% de pacientes y el 1.3% de
controles. Con respecto al gen GPX-1, el 61,5% de los individuos control y 25,6% de

INVESTIGACIONES MOLECULARES EN EL ECUADOR: ENFERMEDADES NEURODEGENERATIVAS

151

afectos presentaron el genotipo Pro/Pro; el 38,5% de casos y 25,6% de controles


presentaron genotipo Pro/Leu; mientras que el 38,5% de afectos y el 12,8% de controles
presentaron genotipo Leu/Leu. Las frecuencias allicas correspondientes al gen GPX-1
mostraron que el 56,4% de afectos y 25,6% de sanos presentaron el alelo Leu; el 43,6%
de casos y el 74,4% de controles presentaron el alelo Pro.
Tabla IX.6. Frecuencias genotpicas y allicas de los genes Apo E y GPX-1
Afectos (%)
Gen Apo E
Frecuencias genotpicas
5,2
23
2,6
24
61,5
33
25,6
34
5,1
44
Frecuencias allicas
3,8
2
76,9
3
17,9
4
Gen GPX-1
Frecuencias genotpicas
Leu/Leu
38,5
Pro/Leu
35,9
Pro/Pro
25,6
Frecuencias allicas
Leu
56,4
Pro
43,6

Sanos (%)
2,6
0
79,5
15,4
2,6
1,3
88,5
10,3

1,09

Valor de P

OR (95% IC)

0,58

2,58 (0,2-76,8)

0,29
0,58

Genotipo normal
2,15 (0,6-7,9)
2,58 (0,2-76,8)

0,34

3,45 (0,31-88,5)
Genotipo normal
2,01 (0,73-5,9)

1,57

0,21

12,8
25,6
61,5

8,77
3,73

0,003
7,2 (1,8-31,1)
0,053
3,4 (0,9-11,7)
Genotipo normal

25,6
74,4

22,8
14,02

0,000
0,000

5,05 (2,5-10,3)
0,27 (0,1-0,6)

La enfermedad de Alzheimer es un problema de salud que con el aumento de la


poblacin de adultos mayores conllevar un incremento de la prevalencia en los
siguientes aos. En este proceso patolgico intervienen mltiples eventos que incluyen
anormalidades en la fisiologa del amiloide, estrs oxidativo, inflamacin y
destruccin neuronal (Huang et al., 2004).
Apo E 4 se considera el factor de riesgo gentico ms importante descrito hasta
el momento, mientras que el alelo 2 puede considerarse un factor protector (Rao,
2009).
El cerebro demanda alta cantidad de oxgeno y posee lpidos, lo que le convierte
en un blanco de las especies oxgeno reactivas, las cuales interactan con el ADN
provocando mutaciones, por lo que una adecuada funcin de las enzimas
detoxificadoras como GPX-1, es un punto clave para impedir la neurodegeneracin y
alteracin en el ADN (Jimnez-Jimnez et al., 2006).
Ambos genes actan directamente en el proceso de neurotoxicidad: Apo E acta
como agresor directo de la neurona cuando se presenta en altas concentraciones y
modula el depsito amiloide tambin txico para la clula nerviosa, mientras que la
errada actividad de GPX-1 deja vulnerable a la neurona y propensa a desencadenar la
apoptosis (Farrer et al., 1997).

INVESTIGACIONES MOLECULARES EN EL ECUADOR: ENFERMEDADES NEURODEGENERATIVAS

152

En el presente estudio, en el que se investig genotipos asociados a la


enfermedad de Alzheimer en Ecuador, el genotipo 33 fue el ms frecuente tanto en
pacientes como en controles, asemejndose a la distribucin normal (Gamboa et al.,
2000), mientras que el genotipo 22 no se presenta en ningn individuo, como ocurre
en poblaciones indgenas y mestizas americanas en las que se ha reportado la ausencia
de este genotipo (Jacquier et al., 2001). La distribucin del alelo 3 es similar a las
reportadas en la poblacin caucsica e hispana (Almeida, 1997; Helisalmi, 1998), con
frecuencias allicas entre 71% a 78% en pacientes y 85% en controles.
Las frecuencias del alelo 4 son las ms bajas en Latinoamrica y en poblaciones
caucsicas, donde la frecuencia del alelo es 44% para el grupo de casos y 17% para el
grupo de controles (Nunomura et al., 1996), inclusive el estudio de poblacin espaola
indica frecuencias del 19 al 42% y 10% para casos y controles, respectivamente
(Ichimura et al., 2004). Este mismo alelo presenta frecuencias altas en poblaciones
negras afectas (33-51%), versus el 17% en poblacin sana; mientras en la poblacin
asitica se reporta, en afectos y sanos, frecuencias allicas de 29-40% y 10%,
respectivamente (Bufill et al., 2009). Estos hallazgos pueden ser atribuibles a la
contribucin amerindia de la poblacin ecuatoriana. Al analizar el alelo Apo E 4 se
pone de manifiesto la diferencia entre el grupo de pacientes y controles, pese a no
presentar diferencia significativa, probablemente por la muestra pequea de estudio. El
riesgo de desarrollar Alzheimer es 2,58 veces mayor en presencia del genotipo 44,
2,01 veces mayor en presencia del 4 y 2,29 mayor en presencia de 4. Los hallazgos
encontrados son similares a otras poblaciones analizadas como caucsicas, hispanas,
africanas y espaolas (Paz-y-Mio et al., 1998).
Con respecto a los genotipos encontrados del gen GPX-1, se encontr diferencia
significativa a nivel estadstico y un fuerte vnculo entre la presencia del alelo Leu como
factor de riesgo para desarrollar Alzheimer. El genotipo Leu/Leu provee 7,2 y Pro/Leu 5
veces ms riesgo en el desarrollo de esta enfermedad. El alelo Pro present un OR
significativo de 0,27, siendo este un factor protector de la enfermedad.
Cada genotipo modula el funcionamiento, metabolismo y accin de la enzima
glutatin peroxidasa, as el genotipo Leu/Leu ha demostrado disminuir en un 70% la
actividad enzimtica (Cisneros et al., 1997), y limita la capacidad detoxificadora, lo que
favorece la muerte neuronal temprana y podra intervenir en el desarrollo de la
enfermedad de Alzheimer.
Para mayor informacin, el estudio denominado Genetic Polymorphisms in
Apolipoprotein E and Glutathione Peroxidase 1 Genes in the Ecuadorian Population
Affected with Alzheimers Disease, se public en 2010, en la revista cientfica The
American Journal of the Medical Sciences (Paz-y-Mio et al., 2010b).
Con respecto a otro estudio gentico realizado en la enfermedad de Alzheimer,
se analizaron los genes CST3, CTSD y MnSOD en 111 individuos ecuatorianos. De
ellos, 56 presentaron la enfermedad y 55 no presentaron antecedentes clnicos de
demencia.
En la Tabla IX.7 se detallan las frecuencias genotpicas y allicas de los genes
MnSOD, CST3 y CTSD. Con respecto al gen MnSOD, el genotipo C/C present una
frecuencia genotpica de 0,34 y allica de 0,55 en afectos y una frecuencia genotpica de

INVESTIGACIONES MOLECULARES EN EL ECUADOR: ENFERMEDADES NEURODEGENERATIVAS

153

0,38 y allica de 0,62 en sanos. Referente al gen CST3, el genotipo A/A present una
frecuencia genotpica de 0,14 en afectos y 0,07 en controles. Por ltimo, el genotipo T/T
del gen CTSD present una frecuencia genotpica de 0,07 en enfermos y 0,02 en
individuos sanos de la poblacin ecuatoriana.
Tabla IX.7. Frecuencias genotpicas y allicas de los genes MnSOD, CST3 y CTSD
Afectos (%)
Gen MnSOD
Frecuencias genotpicas
T/T
23
T/C
43
C/C
34
T/C + C/C
Frecuencias allicas
T
45
C
55
Gen CST3
Frecuencias genotpicas
G/G
75
G/A
11
A/A
14
G/A + A/A
Frecuencias allicas
G
80
A
20
Gen CTSD
Frecuencias genotpicas
C/C
36
C/T
57
T/T
07
C/T + T/T
Frecuencias allicas
C
64
T
36

Sanos (%)

Valor de P

15
47
38
-

0,42
0,42
0,36

38
62

87
05
07
-

0,43
0,32
0,16

90
10

82
16
02
-

0,0001
0,08
0,0001

90
10

OR (95% IC)
Referencia
0,6 (0,2-1,6)
0,6 (0,2-1,6)
0,6 (0,2-1,5)
-

Referencia
2,3 (0,5-9,7)
2,3 (0,6-8,1)
2,3 (0,8-6,2)
-

Referencia
8 (3,2-19,8)
9 (0,9-85,7)
8,1 (3,4-19,5)
-

La superxido dismutasa es una importante enzima antioxidante que interviene


en la desintoxicacin de los radicales superxidos. El dao de los radicales de oxgeno
libre puede afectar a neuronas a travs de la va de peroxidacin lipdica del ADN
mitocondrial, la cadena respiratoria y la protena de reticulacin de los neurofilamentos.
De igual forma, se ha encontrado la presencia del polimorfismo Ala9Val en desrdenes
neurodegenerativos; as como del polimorfismo Ile58Thr, debido a que desestabiliza la
interface tetramrica de MnSOD y reduce su actividad enzimtica, adems de posibles
relaciones con enfermedades neurodegenerativas (Chistyakov et al., 2001). Estudios
realizados en la enfermedad de Parkinson y en desrdenes depresivos, demuestran
posible asociacin con la variante Ala9Val y ninguna asociacin con la variante
Ile58Thr (Galecki et al., 2010; Wang et al., 2010). En nuestro estudio no se observ
relacin estadsticamente significativa entre las variantes Ile58Thr y Ala9Val, y la
enfermedad de Alzheimer.
Varios estudios realizados en Italia (Nacmias et al., 2006), Japn (Maruyama et
al., 2003), Alemania (Dodel et al., 2002), y Holanda (Roks et al., 2001) no han

INVESTIGACIONES MOLECULARES EN EL ECUADOR: ENFERMEDADES NEURODEGENERATIVAS

154

encontrado asociacin significativa entre la variante Ala73Val, del gen CST3, y esta
enfermedad. En nuestro estudio se observ una mayor frecuencia del genotipo normal
GG, por ende, tambin se concluye que en la poblacin ecuatoriana el gen CST3 no
influye con esta enfermedad.
En pacientes fallecidos por la enfermedad de Alzheimer se ha visto que poseen
una gran acumulacin de placas seniles, conformadas por la protena -amiloide. El gen
CTSD sintetiza a la protena catepsina D, la cual interviene en la sntesis, depsito y
eliminacin de -amiloide. Esta protena se ha visto implicada en el proceso de
degradacin de la protena precursora amiloide APP y la protena TAU. Por esta razn,
la presencia de polimorfismos en el gen CTSD puede intervenir en la acumulacin de la
protena TAU y de los ovillos neurofibrilares, generando as la enfermedad de
Alzheimer (Mariani et al., 2006). En una publicacin realizada en demencia vascular, se
determin que el gen CTSD de la poblacin coreana no tena relacin con esta
enfermedad (Jeong et al., 2011).
Para mayor informacin, la investigacin denominada Estudio de variantes
genticas de genes asociados a la enfermedad de Alzheimer en poblacin ecuatoriana
se public en la Revista Ecuatoriana Mdica Eugenio Espejo el ao 2012 (Rodrguez et
al., 2012).

2.ENFERMEDADDEHUNTINGTON
Un ejemplo de herencia autosmica dominante es la enfermedad de Huntington,
tambin denominada corea de Huntington (CH), que ayuda a entender algunos detalles
expuestos. La CH fue descrita por primera vez en 1872 por el mdico estadounidense
George Huntington (Huntington et al., 1993). Se trata de una enfermedad de herencia
autosmica dominante con penetrancia completa, que afecta a 1/10000 individuos.
Produce degeneracin progresiva del sistema nervioso central (SNC), cuyas
manifestaciones clnicas inician generalmente en edad adulta (40 a 50 aos), aunque
pueden identificarse casos en ms jvenes (Gudesblatt et al., 2011).
Su gen, HTT, fue descrito a inicios de la dcada de los noventa; se encuentra en
el brazo corto del cromosoma 4 (4p16,3). Es responsable de la codificacin de una
protena intraneuronal de 340 KDa, la huntingtina, la cual participa en la recaptacin de
neurotransmisores postsinpticos manteniendo la integridad y fisiologa neuronal
(Mattson, 2002).
El defecto gentico que produce la enfermedad es una repeticin en tndem de
tripletes CAG en el exn 1 del gen HTT. Las repeticiones normales de estas islas CAG
en individuos sanos estn entre 6 y 29, mientras que en enfermos, entre 39 en adelante.
Individuos con 30 a 38 repeticiones podran presentar fenotipos truncados pero con alta
probabilidad de que su progenie gane repeticiones aumentando la posibilidad de
presentar la enfermedad (Nopoulos et al., 2011). Se ha visto que la edad de aparicin de
la enfermedad est relacionada al nmero de repeticiones de tripletes; as, mientras
mayores repeticiones menor edad de aparicin, llegando a darse casos infantiles cuando
existen ms de 50 repeticiones (Tabla IX.8) (Ersoy, 2007).

INVESTIGACIONES MOLECULARES EN EL ECUADOR: ENFERMEDADES NEURODEGENERATIVAS

155

Tabla IX.8. Rangos de repeticiones CAG en el gen HTT


Nmero de CAG
6-28
29-35
36-39
40 y ms
40-50
50

Fenotipo
Normal. El paciente no desarrolla CH.
Normal. El paciente no desarrolla CH. Su siguiente
generacin est en riesgo.
El paciente puede presentar CH. Su progenie est en
riesgo.
Paciente con CH. Siguientes generaciones con 50% de
probabilidad de herencia

Penetrancia
0%
25%
25-90%
100%

Corea en adultos.
Corea juvenil (Westphal 10%) Manifestacin ms rpida y agresiva.

Las caractersticas clnicas de la enfermedad inician con deterioro intelectual,


demencia progresiva, alteraciones psiquitricas como paranoia, psicosis y alucinaciones
y posteriormente se manifiestan los desrdenes motores, movimientos involuntarios o
coreicos. Los pacientes terminan perdiendo el juicio y la memoria a corto y largo plazo;
el fallecimiento se produce al cabo de 10 a 20 aos despus del inicio de los sntomas
(Gudesblatt et al., 2011).

FIGURA IX.6. DIAGNSTICO GENTICO MEDIANTE PCR Y SECUENCIACIN DEL


GEN HTT. La correcta amplificacin y anlisis de secuencias del gen HTT permiten
determinar el nmero de repeticiones del triplete CTG en el genoma (IIB, 2014).

INVESTIGACIONES MOLECULARES EN EL ECUADOR: ENFERMEDADES NEURODEGENERATIVAS

156

El dao neurolgico se produce por muerte de las clulas nerviosas,


especialmente en el ncleo caudado y el putamen. Los sntomas suelen aparecer luego
de la edad reproductiva, por eso el gen tiene mucha posibilidad de extenderse. Muchos
casos aparecen ms temprano que los de los padres que transmitieron la enfermedad
(fenmeno de anticipacin), y presentan el fenmeno de impresin gnica con tendencia
de aparecimiento ms temprano cuando el padre es quien transmite el alelo alterado. Se
ha observado tambin que este gen, al ser inestable en los gametos, provocara
amplificaciones que podran explicar la anticipacin (inestabilidad del gen). El
diagnstico de la enfermedad generalmente se lo hace a partir de sus caractersticas
clnicas y casi siempre cuando la enfermedad est en etapas avanzadas (OKeeffe et al.,
2009). En la mayora de los casos la confirmacin diagnstica se realiza por PCR y
electroforesis, donde se determina la amplificacin de un alelo frente al normal. La
secuenciacin gentica es una herramienta til en la cual se puede contar con mucho
ms eficacia el nmero de repeticiones.
2.1.GenHTT

El gen HTT, ubicado en el brazo corto del cromosoma 4 (4p16,3) desde la


posicin 3076408 a 3245687, est formado por 67 exones los cuales codifican la
protena Huntingtina de 340 KDa y cuya disfuncin causa la enfermedad de Huntington
(Figura IX.7) (Tabla IX.9) (The Huntington's Disease Collaborative Research Group,
1993; RCSB-PDB, 2013).
Tabla IX.9. Caractersticas del gen HTT
Caractersticas
Smbolo oficial
Nombre
Otros alias
Cromosoma
Localizacin
# Acceso NCBI
Gen ID
Tamao secuencia
Tamao protena
Localizacin subcelular

Informacin
HTT
Huntingtina
IT15, HD
4
4p16,3
NC_000004,11
3064
169280 pb
3142 aa;
347603 Da
Citoplasma, ncleo

Estructura proteica

(Kim, 2013)

Hacia el extremo 5 del gen, en el exn 1, existe una regin formada por el
triplete CAG, el cual, en estado normal, se encuentra repetido varias veces para producir
una cadena de poliglutamato en la protena funcional.

FIGURA IX.7. CROMOSOMA 4 HUMANO. Ubicacin del gen HTT (GeneCards,


2014).

Los pacientes con CH poseen una ampliacin anmala de tripletes donde las
repeticiones alteradas producen una protena disfuncional que contiene una secuencia

INVESTIGACIONES MOLECULARES EN EL ECUADOR: ENFERMEDADES NEURODEGENERATIVAS

157

expandida de glutamatos, los cuales se pliegan sobre s mismos provocando


aglomerados ubiquitinados de protena que se acumulan tanto en el ncleo como en el
citoplasma neuronal (Figura IX.8) (Sawa, 2001).

FIGURA IX.8. CADENA DE POLIGLUTAMATO EN LA PROTENA HUNTINGTINA.


Nmero de aminocidos glutamato entre individuos sanos y afectos con la
enfermedad de Huntington (Modificado de Sawa, 2001; IIB, 2014).

La huntingtina normal estimula la expresin del factor neurotrfico derivado del


cerebro (BDNF), el cual es un integrante del grupo de las neurotrofinas asociadas al
factor de crecimiento neuronal, cuya funcin es la manutencin de la integridad
nerviosa (Zuccato et al., 2001). Adems, se conoce ms de 100 protenas con las cuales
la huntingtina interacta, las protenas HIP (Huntingting interaction proteins), las
protenas HAP (Huntingting associated proteins), entre otras. Algunas de estas
protenas son factores de transcripcin, otras son molculas de sealizacin con posible
capacidad de integracin para apertura de los canales de recaptacin de
neurotransmisores a nivel neuronal (Mattson, 2002).
El mecanismo mediante el cual la huntingtina promueve la neurodegeneracin
no est claro. Se cree que al encontrarse expandida, la huntingtina pierde la capacidad
de acoplamiento normal a sus protenas y parece activar la va de la apoptosis por medio
de la caspasa-8, una protena de la familia de las proteasas encargadas en llevar a cabo
la muerte celular programada (Gervais et al., 2002).
Tambin se ha postulado otra forma en la cual la huntingtina promueve la
apoptosis, el estrs oxidativo. La disminucin del paso normal de protones en la

INVESTIGACIONES MOLECULARES EN EL ECUADOR: ENFERMEDADES NEURODEGENERATIVAS

158

mitocondria estimula la va de las caspasas (Browne & Beal, 2006). Al verse disminuida
la actividad de los complejos mitocondiales, habr un menor paso de protones a la
matriz y por ende una acumulacin de radicales de oxgeno. Este hecho oxidar las
protenas y lpidos de membrana disminuyendo la permeabilidad membranal y
provocando un desequilibrio electroltico, gliosis por acumulacin de interleuquinas,
dao en el ADN y estrs oxidativo, el cual activar la va de las caspasas (Figura IX.9)
(Prez & Arancibia, 2007), sin embargo, las hiptesis no han sido esclarecidas
completamente.

FIGURA IX.9. EFECTO DEL ESTRS OXIDATIVO EN LA ENFERMEDAD DE


HUNTINGTON. La oxidacin de lpidos y protenas disminuye la actividad selectiva
generando un equilibrio osmtico y desbalance electrnico, el cual desencadena en la
activacin del estrs oxidativo y activacin de la apoptosis (IIB, 2014).

2.2.Tratamiento
No existe tratamiento curativo para la CH, en general se tratan los sntomas mas
no la enfermedad. Se han utilizado antipsicticos bloqueadores dopaminrgicos, como

INVESTIGACIONES MOLECULARES EN EL ECUADOR: ENFERMEDADES NEURODEGENERATIVAS

159

el Haloperidol; ansiolticos inhibidores de la recaptacin de serotonina como la


Fluoxetina; benzodiacepinas bloqueadores GABA como el Clonazepan. Sin embargo,
ninguno ha demostrado tener resultados reversibles para el efecto neurodegenerativo,
solamente la Fluoxetina, al parecer, estimula el transporte de iones en la mitocondria y
posiblemente tenga un efecto neuroprotector (Mostert et al., 2013).
Muchas molculas han sido probadas con el fin de detener la apoptosis y
degeneracin neuronal, sin embargo los resultados no han sido concluyentes. Se ha
observado un leve bloqueo en el proceso neurodegenerativo al utilizar coenzima Q ms
Remacemida, al igual que cido etileicosa pentanoico (AEP), pero solo la Tetrabenazine
disminuye considerablemente la corea y es la nica droga aprobada por la FDA para el
tratamiento de la enfermedad (Tabla IX.10) (Mestre et al., 2009).
Tabla IX.10. Medicamentos probados para la enfermedad de Huntington
Droga
Dosis
Baclofen
60 mg/da
Vitamina E
3000 Ul/da
Lamotrigina
400 mg/da
Creatina
5 g/da
Coenzima Q + 300-600
Remacemida
mg/da + 400600 mg/da
cido etileicosa 2 g/da
pantotnico

Casos
60
81
64
42
347

Resultados
No significativo
No significativo
No significativo
No significativo
Baja velocidad de
degradacin

135

Riluzone
Tetrabenazina

537
84

Baja velocidad de Puri et al., 2005


degradacin

nmero de CAG
No significativo
Baja corea en un The Huntington Study
50% por hasta 8 Gropu, 2006
horas

100 mg/da
100 mg/da

Referencia
Shoulson et al., 1989
Peyser et al., 1995
Kremer et al., 1999
Verbessem et al., 2003
The Huntington Study
Group, 2001

(Mestre et al., 2009)


La terapia gentica podra ser una alternativa para el tratamiento de personas con
enfermedad de Huntington (Zhang & Friedlander, 2011). En los ltimos aos se ha
desarrollado frmacos denominados Zn finger, los cuales tienen la capacidad de
incrustarse en la doble cadena del ADN relacionada al gen HTT. Al complementarse la
molcula de Zn finger con los tripletes CAG, se evita la transcripcin del ARNm y, por
ende, la sobreexpresin de la protena huntingtina. Por otro lado, se ha observado que el
litio es capaz de proteger las neuronas de la muerte celular y, posiblemente, de estimular
su regeneracin.
Con todo lo mencionado anteriormente, es importante el consejo gentico y el
diagnstico de posibles portadores de la amplificacin de tripletes (familiares). Se tiene
opcin de diagnstico prenatal a travs de pruebas de ADN. Los conflictos ticos del
diagnstico se los debe considerar al momento del asesoramiento gentico.

Captulo X
Investigaciones moleculares en el Ecuador:
Enfermedades congnitas
Las anomalas congnitas son defectos que ocurren mientras un individuo se
desarrolla dentro del cuerpo de su madre. La mayora de defectos congnitos se
presentan en los primeros meses de embarazo Estos defectos pueden alterar el aspecto
corporal, su funcionamiento o ambos. Nuestro grupo de investigacin ha realizado
varios estudios relacionados con diferentes patologas congnitas, como la enfermedad
de Hirschsprung, la fibrosis qustica del pncreas, la distrofia muscular de Duchenne y
la hemocromatosis.

1.ENFERMEDADDEHIRSCHSPRUNG
La enfermedad de Hirschsprung (HSCR) presenta un patrn de herencia
autosmica recesiva. La HSCR es una anomala congnita del sistema nervioso
entrico, caracterizada por la aganglionosis (ausencia o falta de clulas ganglionares),
en el plexo mientrico de Auerbach y submucoso de Meissner, en una porcin variable
del tracto gastrointestinal, que da como resultado una obstruccin intestinal funcional
(Amiel et al., 2001; McInerny et al., 2011). HSCR corresponde a un 33% de los casos
de obstruccin neonatal del colon (Moore & Persaud, 2008).
Se estima que la incidencia global es de 1 por cada 5000 recin nacidos vivos,
sin embargo, la incidencia por cada 10000 individuos vara en los distintos grupos
tnicos: 2,8 en asiticos, 2,1 en afroamericanos, 1,5 en caucsicos y 1,0 en hispanos. En
hermanos la incidencia es de aproximadamente 3,5%, aumentando segn la longitud del
segmento del colon afectado hasta un 20% (Torfs, 1998; Haricharan & Georgeson,
2008).
Segn el segmento aganglinico afectado, esta enfermedad se clasifica en:
HSCR de segmento corto (S-HSCR 74-80% de los casos), que es la forma clsica de la
enfermedad, en la que se ve afectada una regin por debajo del sigmoides superior;
HSCR de segmento largo (L-HSCR 12-22% de los casos), en la que la aganglionosis se
extiende por encima del plexo esplnico (Chakravarti & Lyonnet, 2002), y hay una
tercera forma, que es a la vez rara y asociada con alta morbilidad y mortalidad: la
aganglionosis total de colon (ATC 4-13%), con ausencia de clulas ganglionares en
todo el colon (Haricharan & Georgeson, 2008; Kenny et al., 2010). El 80% de los casos
con HSCR son espordicos, el 20% restante puede ser de origen familiar con patrones
de herencia autosmica dominante y recesiva, penetrancia incompleta y expresin
variable (Lantieri et al., 2006a). La enfermedad se presenta con predominio en el sexo
masculino, siendo el ratio de hombres y mujeres de 4 a 1. Sin embargo, este valor es
significativamente ms alto para S-HSCR (hombre-mujer de 5 a 1), que para la forma
ms severa L-HSCR (aproximadamente hombre-mujer de 1 a 1) (Torfs, 1998). El
diagnstico se realiza en la mayora de los casos en el perodo neonatal (Teitelbaum et
al., 2000), pero en algunos casos, se realiza ms tarde en la infancia o incluso en la edad
adulta (Parc et al., 1984).

INVESTIGACIONES MOLECULARES EN EL ECUADOR: ENFERMEDADES CONGNITAS

164

La etiologa se basa en un fallo en la migracin, proliferacin, diferenciacin y


supervivencia de las clulas de la cresta neural durante el desarrollo embrionario del
sistema nervioso entrico. Hasta la fecha, el anlisis molecular de pacientes con HSCR
ha permitido identificar mutaciones en nueve genes que pueden estar relacionados con
la enfermedad: RET, GDNF, NRTN, PHOX2B, EDNRB, EDN3, ECE1, SOX10 y
ZFHX1B; la mayor parte de estos genes codifican protenas, relacionadas entre s, para
elementos de las vas de sealizacin ms importantes en la formacin del sistema
nervioso entrico (Fernndez, 2004; Tam & Garca-Barcel, 2009).
1.1.GenRET
Actualmente, se sabe que el proto-oncogn RET es el principal gen de
susceptibilidad para HSCR (Lyonnet et al., 1993), pero a pesar del papel central que
juega RET en HSCR y la extensa bsqueda de mutaciones que han llevado a cabo
diferentes grupos durante los ltimos aos, la tasa de mutacin todava resulta
demasiado baja, alrededor del 50% en los casos familiares y 7-35% en los casos
espordicos (Tabla X.1).
Tabla X.1. Caractersticas del gen RET
Caractersticas
Smbolo oficial
Nombre
Otros alias
Cromosoma
Localizacin
# Acceso NCBI
Gen ID
Tamao secuencia
Tamao protena
Localizacin subcelular

Informacin
RET
Proto-oncogn RET
MEN2A
10
10q11,2
NC_000010,10
5979
53325 bases
1114 aa;
124319 Da
Membrana celular

Estructura proteica

(Knowles et al., 2006)

En la Figura X.1 se seala la ubicacin del gen RET presente en el cromosoma


10.

FIGURA X.1. CROMOSOMA 10 HUMANO. Ubicacin del gen RET (GeneCards,


2014).

Nuestro grupo de investigacin realiz un estudio para determinar la frecuencia


de los polimorfismos presentes en los exones 2, 7 y 15 e intrn 1 del gen RET (Figura
X.2), en nios ecuatorianos afectos con la enfermedad de Hirschsprung.
En el estudio retrospectivo caso-control se analizaron 41 pacientes
diagnosticados con HSCR, basados en la ausencia de plexos entricos en el examen
histolgico de la biopsia o material quirrgico, y 41 individuos sanos, sin evidencia de
problemas entricos presentes y pasados.

INVESTIGACIONES MOLECULARES EN EL ECUADOR: ENFERMEDADES CONGNITAS

165

FIGURA X.2. MICROAMBIENTE INTESTINAL Y VARIANTES GENTICAS.


Polimorfismos genticos del receptor membranal RET en las clulas de la cresta
neural (Modificado de Tam & Garca-Barcel, 2009; IIB, 2014).
1.2.Resultadosydiscusin
Los polimorfismos analizados del gen RET fueron: c135 G>A en el exn 2,
c1296 G>A en el exn 7, c2712 C>G en el exn 15 y IVS1+1813 C>T, en el intrn 1.
De los 41 casos investigados con HSCR, la frecuencia de afectos hombre-mujer fue de
28 a 13 con edad promedio de 2,8 aos. La frecuencia en Ecuador de los alelos A
135G>A y T en IVS1+1813C>T fue superior en afectos (55% y 77%), que en los
controles (37% y 57%, respectivamente); mientras que la frecuencia de los alelos A en
c1296 G>A y G en c2712 C>G fue menor en afectos (23% y 4%), que en el grupo
control (59% y 29%), mostrando un comportamiento similar a los datos de
investigaciones en pases de Europa y Asia (Borrego et al., 1999; Fitze et al., 1999;
Lantieri et al., 2006b; Sancandi et al., 2003). Realizando el anlisis de 2, con dos
grados de libertad para los genotipos encontrados de cada polimorfismo estudiado c135

INVESTIGACIONES MOLECULARES EN EL ECUADOR: ENFERMEDADES CONGNITAS

166

G>A, c1296 G>A, c2712 C>G e IVS1+1813 C>T, se obtuvieron valores de 12,54,
20,21, 20,44 y 8,35 respectivamente. Los valores altos implica que existen diferencias
significativas entre los grupos afecto y control. El marcador 135 G>A se asocia con el
riesgo once veces mayor de desarrollar la enfermedad de HSCR. No se observaron
diferencias significativas en el polimorfismo IVS1+1813 C>T; mientras que 1296 G>A
y 2712 C>G, parecen jugar un papel protector en la patognesis de HSCR.
Tabla X.2. Frecuencias genotpicas y allicas del gen RET
Gen RET
Afectos (%)
Polimorfismo c135 G>A
Frecuencias genotpicas
G/G
05
G/A
80
A/A
15
Frecuencias allicas
G
45
A
55
Polimorfismo c1296 G>A
Frecuencias genotpicas
G/G
61
G/A
32
A/A
07
Frecuencias allicas
G
77
A
23
Polimorfismo c2712 C>G
Frecuencias genotpicas
C/C
95
C/G
2,5
G/G
2,5
Frecuencias allicas
C
96
G
04
Polimorfismo IVS1+1813 C>T
Frecuencias genotpicas
C/C
07
T/C
32
T/T
61
Frecuencias allicas
C
23
T
77

Sanos (%)

Valor de P

37
53
10

0,001
0,027

63
37

14
54
32

0,001
0,00001

41
59

51
39
10

0,0001
0,131

71
29

15
56
29

1
0,13

43
57

OR (95% IC)
Referencia
11,3 (2,3-54,1)
11,3 (1,6-78,6)
-

Referencia
0,14 (0,05-0,4)
0,06 (0,01-0,3)
-

Referencia
0,03 (0,0-0,3)
0,14 (0,0-1,2)
-

Referencia
0,03 (0,0-0,3)
0,14 (0,0-1,3)
-

El proto-oncogn RET es el principal gen de susceptibilidad para HSCR, ya que


se encuentra implicado en el desarrollo del sistema nervioso entrico durante la
embriognesis (Lyonnet et al., 1993). Desde 1994, se han asociado mutaciones
sinnimas e intrnicas del gen RET con la patognesis de HSCR (Lantieri et al., 2006a),
las cuales provocan una prdida de funcin por un mal plegamiento de protena, falta de
transporte en la superficie celular o supresin de su actividad biolgica (Carlomagno et
al., 1996; Martucciello et al 2007). Datos del Ecuador indican similitud con respecto a
datos descritos en otras poblaciones: espaola, alemana, italiana, china, polaca y
estadounidense (Borrego et al., 1999; Fitze et al., 1999; Emison et al., 2005; Liu et al.,

INVESTIGACIONES MOLECULARES EN EL ECUADOR: ENFERMEDADES CONGNITAS

167

2010), el alelo A del polimorfismo c135 G>A, est ms representado en los enfermos
HSCR, y los individuos que portan los genotipos GA/AA tendran un riesgo once veces
mayor de padecer la enfermedad de Hirschsprung. Se propuso que la variante A45A
podra estar en desequilibrio de ligamiento con algn locus funcional desconocido en
aquel momento (Fitze et al., 2003), aunque se desconoce el mecanismo exacto por el
cual la sustitucin silenciosa del codn 45 acta en el origen de HSCR. Se muestra que
la variante c135A est asociada fuertemente con el fenotipo de HSCR. Los
polimorfismos c1296 G>A y c2712 C>G parecen ser factores significativamente
protectores en la patognesis de HSCR, aunque el mecanismo que habra detrs de un
posible efecto protector an no se ha esclarecido (Liu et al., 2010). Por otra parte, en la
poblacin ecuatoriana no se encontr asociacin entre esta enfermedad y el
polimorfismo IVS1+1813 C>T, a diferencia de la investigacin realizada en China (Liu
et al., 2008).
En la Figura X.3 se observa el anlisis de secuencias de los polimorfismos c1296
G>A y IVS1+1813 C>T para la obtencin de los genotipos respectivos. G/G, G/A y
A/A para la variante gentica c1296 G>A; y, C/C, C/T y T/T para la variante gentica
IVS1+1813 C>T.

FIGURA X.3. ANLISIS DE SECUENCIAS DEL GEN RET. Electroferograma de los


polimorfismos genticos c1296 G > A y IVS1+1813 C > T (Modificado de Guevara et
al., 2012; IIB, 2014).
En la Figura X.4 se observa la digestin de los amplicones mediante la PCRRFLP para obtener el genotipo de los polimorfismos c135 G>A y c2712 C>G del gen
RET. Del polimorfismo c135 G>A, los individuos G/G presentan fragmentos de 134 pb
y 104 pb; los individuos heterocigotos A/G presentan fragmentos de 238 pb, 134 pb y
104 pb; y, los individuos A/A presentan un fragmento de 238 pb. Con respecto al
polimorfismo c2712 C>G, los individuos con genotipo G/C presentan fragmentos de

INVESTIGACIONES MOLECULARES EN EL ECUADOR: ENFERMEDADES CONGNITAS

168

323 pb, 197 pb y 126 pb; los individuos C/C presentan un fragmento de 323 pb; y, los
individuos con el genotipo G/G presentan fragmentos de 197 pb y 126 pb. Estos
resultados se obtuvieron a partir de la digestin con enzimas de restriccin especficas
para el anlisis de ambos polimorfismos.

FIGURA X.4. DIGESTIN CON ENZIMAS DE RESTRICCIN DEL GEN RET. Los
fragmentos obtenidos despus de la digestin enzimtica se observan en un gel de
agarosa al 5% con bromuro de etidio y bajo luz UV (Modificado de Guevara et al.,
2012; IIB, 2014).

Para mayor informacin el artculo titulado Polimorfismos genticos del protooncogn RET asociados con la enfermedad de Hirschsprung en nios ecuatorianos, se
public en la Revista Mdica Vozandes, en el ao 2012 (Guevara et al., 2012).

2.FIBROSISQUSTICADELPNCREAS
La fibrosis qustica del pncreas (FQ) es una enfermedad autosmica recesiva y
presenta mayor frecuencia en el grupo tnico caucasoide (1/2000 nv); en el grupo
negroide su incidencia es baja (1/15000 nv), y en la poblacin asitica es an ms baja
(1/50000 nv). En el Ecuador, se estima que el nmero de afectados llega a 150, por lo
tanto existe una baja incidencia (Estivill et al., 1997).
2.1.GenCFTR
El gen CFTR codifica la protena reguladora transmembranal de la fibrosis
qustica, la cual est involucrada en el transporte del cloro a la membrana celular,
mediada por la molcula adenosn monofosfato cclico (AMPc) (Tabla X.3).
El gen CFTR se ubica en el brazo largo del cromosoma 7 (7q31,2) (Figura X.5).
Una alteracin o delecin de la CFTR altera las funciones fisiolgicas de los epitelios
glandulares. La mala funcin del transporte de cloro se asocia a dao en las glndulas
exocrinas, que se obstruyen por material eosinfilo viscoso o slido, y secretan moco,
Cl y Na exageradamente. Suele haber infertilidad. Los sntomas se desarrollan a partir

INVESTIGACIONES MOLECULARES EN EL ECUADOR: ENFERMEDADES CONGNITAS

169

de estas obstrucciones y afectan al rea gastrointestinal y pulmonar, aunque es una


enfermedad generalizada. En la forma intestinal, se inicia con leo meconial en los
recin nacidos, atresia, vlvulo, perforaciones o prolapso rectal; se presentan problemas
de vas biliares e hgado, y puede desarrollarse diabetes. Existe un marcado retraso en la
ganancia de peso. En la forma pulmonar, se presenta con tos e infecciones bronquiales
recurrentes (Staphylococcus aureus y Pseudomona aeuroginosa), que evolucionan a
neumotrax, hemoptisis, hipertensin pulmonar. La mayora de pacientes presentan
insuficiencia pancretica y dficit de vitaminas liposolubles. Es usual realizar una
prueba de sudor, en la cual se hace evidente la prdida de cloro. La supervivencia media
es de 31 aos (Paz-y-Mio et al., 1999a).
Tabla X.3. Caractersticas del gen CFTR
Caractersticas
Smbolo oficial
Nombre
Otros alias
Cromosoma
Localizacin
# Acceso NCBI
Gen ID
Tamao secuencia
Tamao protena
Localizacin subcelular

Informacin
CFTR
Regulador
membranal FQ
CF
7
7q31,2
NC_000007,13
1080
202882 bases
1480 aa;
168142 Da
Membrana
endosomal

Estructura proteica

(Lewis et al., 2005)

La variedad de presentacin clnica de la FQ involucra el peculiar concepto de


heterogeneidad clnica, que se relaciona con el diferente exn mutado de los enfermos.
Los sntomas pulmonares se presentan con mayor agudeza en los afectos de la mutacin
delta F508 (F508), mientras que la prevalencia de otros sntomas se relaciona con
mutaciones de otros exones. Un mismo individuo puede tener la enfermedad, pero con
mutaciones de dos diversos exones heredados por sus respectivos padres, lo que se
denomina heterogeneidad allica (Paz-y-Mio et al., 1999a).

FIGURA X.5. CROMOSOMA 7 HUMANO. Ubicacin del gen CFTR (GeneCards,


2014).

2.2.Resultadosydiscusin
El anlisis del gen responsable de la enfermedad se hace mediante la tcnica
PCR. Esta prueba ha permitido detectar ms de 800 mutaciones en el gen CFTR. Este
gen tiene 27 exones y la mutacin F508 es la ms frecuente. En grupos humanos
diferentes al caucsico, la incidencia tanto de la FQ como de la mutacin F508 es
variable. Se ha estimado que la incidencia de la FQ entre los hispanos es de
aproximadamente 1/10000 nv, aunque en la mayor parte de pases de la regin no

INVESTIGACIONES MOLECULARES EN EL ECUADOR: ENFERMEDADES CONGNITAS

170

existen estadsticas. En Latinoamrica se han reportado datos sobre la frecuencia de


F508 nicamente en Mxico, Brasil y Argentina. En el Ecuador realizamos el estudio
gentico de 14 afectos ecuatorianos de FQ. En todos estos se realiz la deteccin de la
mutacin F508 mediante la PCR y en 6 de ellos se efectu adicionalmente el anlisis
de otras siete mutaciones frecuentes en la poblacin europea (G542X, N1303K, 1717-1,
W1282X, G551D, R553X, 1507), mediante un test de hibridacin INNO-Lipa. La
frecuencia encontrada de la mutacin F508 fue 26,92% y ninguna de las otras 7 fue
detectada, lo cual indica que al menos el 46,15% de las mutaciones en la poblacin
estudiada son diferentes a las ms comunes de Europa. Una incidencia baja de la
mutacin F508, as como un alto porcentaje de mutaciones diferentes a las ms
comunes en Europa, han sido reportados tambin en la poblacin de Mxico, pas con
poblacin similar a la ecuatoriana. Por lo tanto, es vlido pensar que la FQ en el
Ecuador y en Latinoamrica, tiene una etiologa diferente a la europea; esto puede
deberse a que los grupos tnicos son marcadamente diferentes entre estas dos regiones.
Los resultados encontrados plantean la necesidad de estudiar todo el gen CFTR para
identificar las mutaciones causantes de la FQ en el Ecuador, las cuales podran ser poco
frecuentes o an no reportadas. Se ha postulado que la frecuencia alta en la poblacin,
del alelo mutado, podra deberse a una ventaja evolutiva, mediante la cual existira una
mejor proteccin contra enfermedades diarreicas, infecciosas, bacterianas intestinales,
como el clera.
Los productos resultantes de la amplificacin por PCR del exn 10 del gen
CFTR para la deteccin de la mutacin F508, tienen un tamao de 98 pares de bases si
el alelo no tiene la mutacin y de 95 pb si el alelo tiene la delecin de 3 nucletidos
(mutacin F508). Los resultados en algunos de los grupos familiares estudiados se
presentan en la siguiente figura (Paz-y-Mio et al., 1999a).

FIGURA X.6. AMPLIFICACIN DEL EXN 10 DEL GEN CFTR MEDIANTE PCR.
CROMOSOMA 7 HUMANO. Electroforesis del exn 10 del gen CFTR. MW =
Marcador de peso molecular conocido F508. Columna 1 y 3: heterocigotos, padres
del caso 2. Columna 2: homocigoto para el alelo F508. Columna 4: madre del caso
5, portadora de un alelo mutado desconocido. Columna 5 y 9: Enfermos con alelo
F508 y otro alelo mutado desconocido. Columna 6, 7, 8: hermanos del caso 5,
sanos homocigotos. Columna 10 padre del caso 9, portador de alelo desconocido
(Modificado de Paz-y-Mio et al., 1999a; IIB, 2014).

INVESTIGACIONES MOLECULARES EN EL ECUADOR: ENFERMEDADES CONGNITAS

171

De los catorce afectos de FQ analizados, se encontr que dos (14,29%) tenan


los dos alelos F508 (F508/F508); tres (21,43%) presentaron un solo alelo F508
(F508 /x); y los restantes nueve (64,29%) no presentaron ningn alelo F508 (x/x)
(Tabla X.4).
Tabla X.4. Genotipos FQ F508 encontrados en poblacin ecuatoriana

Nmero
Porcentaje (%)

X/X
9
64,29

F508/X
3
21,43

F508/F508
2
14,29

La FQ es una de las enfermedades que en la actualidad cuenta con terapia


gentica, dirigida a los sntomas pulmonares. Se ha logrado introducir el gen normal en
adenovirus defectivos, los cuales son inoculados (autoinoculacin) en aerosoles. Los
virus infectan la mucosa pulmonar e introducen su ADN con el gen FQ integrado. Las
clulas pulmonares funcionan normalmente por varios aos y los pacientes tienen
mejoras importantes. El problema bsico de esta terapia es la respuesta inmune y el
rechazo a nuevas infecciones virales. Es importante anotar que cualquier tipo de terapia
gentica, debe partir del conocimiento preciso de los tipos de mutaciones existentes en
una poblacin, para justamente realizar los preparados teraputicos con genes
especficos. Los tratamientos clnicos van orientados a mantener un estado adecuado de
nutricin, dietas, reemplazo enzimtico, la prevencin o tratamiento agresivo de las
complicaciones pulmonares o cualquier otra; el uso de corticoides, antibiticos,
antinflamatorios, cirugas pulmonares, as como un apoyo psicolgico y familiar. El
asesoramiento gentico y reproductivo es importante para la familia. En la actualidad se
cuenta con pruebas de diagnstico prenatal gentico, para las parejas con riesgo (Paz-yMio et al., 1999a).
Para mayor informacin, el artculo titulado The F508 mutation in Ecuador,
South America se public en la revista cientfica Human Mutation, en el ao 1999 (Pazy-Mio et al., 1999a).

3.DISTROFIAMUSCULARDEDUCHENNEYBECKER
Las distrofias musculares de Duchenne (DMD) y Becker (DMB) constituyen dos
formas allicas de una enfermedad letal recesiva ligada al cromosoma X, caracterizada
por una degeneracin progresiva de los msculos con debilidad y atrofia. Afecta a
1/3000 varones nv (DMD) y a 1/18500 varones nv (DMB). La DMD fue la primera
enfermedad gentica humana en la cual se determin su base molecular en una regin
cromosmica especfica, utilizando marcadores de ADN.
La variedad Duchenne es la ms grave y tpica; su sintomatologa ocurre a los 2
7 aos de edad. La variedad ms tarda, la de Becker, inicia los sntomas en la segunda
o tercera dcada de la vida. La DMD inicia con dificultad progresiva en la marcha,
cadas, lordosis, pseudohipertrofia muscular (reemplazo por tejido fibrtico y graso); los
problemas musculares estriados son progresivos, afeccin cardiaca, deficiencia
intelectual; se afecta inclusive al sistema respiratorio, el cual es el principal causante de
la muerte de los pacientes. La DMB inicia en la edad adulta; los pacientes presentan

INVESTIGACIONES MOLECULARES EN EL ECUADOR: ENFERMEDADES CONGNITAS

172

prdida progresiva de la fuerza muscular y sobreviven hasta los 30 40 aos (Paz-yMio et al., 1999b).
3.1.GenDMD
Esta enfermedad, en todas sus variedades, se debe a mutaciones en el gen DMD,
las cuales constituyen principalmente deleciones (60% de todos los casos) que
comprometen a los exones 2-20 y ms frecuentemente a los exones 44-53 y las
duplicaciones (6% de todos los casos) constituyen la mayora de mutaciones
detectables, localizadas en dos regiones especficas del gen a una distancia de 0,5 y 1,2
Kb del promotor. El DMD es uno de los genes ms largos caracterizado y representa
cerca del 0,1% de todo el genoma humano. Est constituido por 79 exones, repartidos
en 2200 Kb de ADN (Tabla X.5) (Paz-y-Mio et al., 1999b).
Tabla X.5. Caractersticas del gen DMD
Caractersticas
Smbolo oficial
Nombre
Otros alias
Cromosoma
Localizacin
# Acceso NCBI
Gen ID
Tamao secuencia
Tamao protena
Localizacin subcelular

Informacin
DMD
Distrofina
BMD
X
Xq21,2
NC_000023,1
1756
2224919 bases
3685 aa;
426750 Da
Membrana celular

Estructura proteica

(Norwood et al., 2000)

El gen DMD se encuentra localizado en el cromosoma X, en la regin Xq21,2


del humano, como se observa en la Figura X.7.

FIGURA X.7. CROMOSOMA X HUMANO. Ubicacin del gen DMD (GeneCards,


2014).

El ARNm mide 14 Kb, por lo cual la mayor parte del gen distrofina est ocupada
por largos intrones. El gen codifica la protena distrofina, de 3685 aminocidos con un
peso molecular de 427 KDa, que normalmente est asociada al sarcolema de las clulas
musculares estriadas, esquelticas y cardacas. Se expresa en un nmero limitado de
tejidos que incluyen: msculo esqueltico, cardaco, liso y en bajos niveles en cerebro.
En la DMD la protena falta totalmente (< 3% de las protenas musculares) y en la DMB
hay formas mutantes de la protena que son disfuncionales (Paz-y-Mio et al., 1999b).
Las pruebas moleculares han mostrado que las mutaciones detectadas en este
gen son principalmente deleciones grandes, miles de bases implicadas, seguidas de
duplicaciones. Usualmente, las deleciones son detectadas por medio de hibridizacin
con sondas de ADNc o por amplificacin por PCR de las regiones calientes (hot spots).

INVESTIGACIONES MOLECULARES EN EL ECUADOR: ENFERMEDADES CONGNITAS

173

Debido al tamao grande del gen que codifica la protena distrofina (79 exones), se lo
analiza con la tcnica modificada PCR mltiplex, la cual evala simultneamente
muchos exones. La eficiencia de la deteccin es de 98%. La PCR mltiplex para DMD
y DMB, evala simultneamente 18 exones. Como se evalan relativamente pocos
exones, 18 de los 79 que son los ms implicados en el origen de la enfermedad, en
ciertos casos es necesario el anlisis de exones extras (Paz-y-Mio et al., 1999b).
3.2.Resultadosydiscusin
En el laboratorio se analizaron muestras de sangre perifrica de 10 individuos: 8
con DMD (7 casos corresponden a DMD espordicos y 1 caso corresponde a DMD
familiar), 2 posibles portadoras, la primera, madre de uno de los casos espordicos y la
otra, madre de los 2 enfermos diagnosticados clnicamente y con otro hijo que an no
presentaba sntomas. Una vez extrado el ADN, segn protocolo estndar, con PCR
mltiplex, analizamos 18 exones en solo 2 reacciones separadas de PCR, encontrando
deleciones entre los exones 45 y 51 en 3 pacientes y delecin de los exones 3 y 45 en 2
pacientes, sin detectar alteraciones en los exones estudiados en un varn recin nacido,
en dos casos con sospecha clnica y en dos portadoras (Paz-y-Mio et al., 1999b).
Las mutaciones detectadas en este gen corresponden a las deleciones tpicamente
descritas en la zona distal del gen (exones 44 a 52), Colombia presenta datos similares
(Colombia 79%, Ecuador 80%). Hay que anotar que el estudio de deleciones de los
exones del gen no proporciona un diagnstico en la totalidad de casos, ya que existen
mutaciones puntuales y algunas detectadas en intrones. As, los datos de otros
laboratorios muestran un diagnstico bajo en la deteccin de deleciones (Colombia
37%, Argentina 27% y Ecuador 71%) (Paz-y-Mio et al., 1999b).
Tabla X.6. Cebadores para la PCR mltiplex del gen DMD
Primer FW

PmF
3F
4F
6F
8F
12F
13F
17F
19F
43F
44F
45F
47F
48F
50F
51F
52F
60F

Secuencia (5-3)
GAAGATCTAGACAGTGGATACATAACAAA
TCATCCATCATCTTCGGCAGATTAA
TTGTCGGTCTCCTGCTGGTCAGTG
CCACATGTAGGTCAAAAATGTAATGAA
GTCCTTTACACACTTTACCTGTTGAG
GATAGTGGGCTTTACTTACATCCTTC
AATAGGAGTACCTGAGATGTAGCAGAAAT
GACTTTCGATGTTGAGATTACTTTCCC
TTCTACCACATCCCATTTTCTTCCA
GAACATGTCAAAGTCACTGGACTTCATGG
CTTGATCCATATGCTTTTACCTGCA
AAACATGGAACATCCTTGTGGGGAC
CGTTGTTGCATTTGTCTGTTTCAGTTAC
TTGAATACATTGGTTAAATCCCAACATG
CACCAAATGGATTAAGATGTTCATGAAT
GAAATTGGCTCTTTAGCTTGTGTTTC
AATGCAGGATTTGGAACAGAGGCGTCC
AGGAGAAATTGCGCCTCTGAAAGAGAACG

Primer RV

PmR
3R
4R
6R
8R
12R
13R
17R
19R
43R
44R
45R
47R
48R
50R
51R
52R
60R

Secuencia (5-3)
TTCTCCGAAGGTAATTGCCTCCCAGATCTG
CAGGCGGTAGAGTATGCCAAATGAAAATC
CAAAGCCCTCACTCAAACATGAAGC
GTCTCAGTAATCTTCTTACCTATGACTATGG
GGCCTCATTCTCATGTTCTAATTAG
GAAAGCACGCAACATAAGATACACCT
CTGACCTTAAGTTGTTCTTCCAAAGCAG
AAGCTTGAGATGCTCTCACCTTTTCC
GATGGCAAAAGTGTTGAGAAAAAGTC
ATATATGTGTTACCTACCCTTGTCGGTCC
TCCATCACCCTTCAGAACCTGATCT
CATTCCTATTAGATCTGTCGCCCTAC
GTCTAACCTTTATCCACTGGAGATTTG
CCTGAATAAAGTCTTCCTTACCACAC
TCTCTCTCACCCAGTCATCACTTCATAG
GGAGAGTAAAGTGATTGGTGGAAAATC
TTCGATCCGTAATGATTGTTCTAGCCTC
CTGCAGAAGCTTCCATCTGGTGTTCAGG

Peso (pb)

535
410
196
202
360
331
238
416
459
357
268
547
181
506
271
388
113
139

Aparte del diagnstico molecular de la DMD y DMB, la creatina fosfoquinasa


(CK) elevada, 50 a 100 veces (normal 160 U/L), es un dato importante de la
inflamacin y destruccin del tejido muscular. Existen tambin alteraciones en el
electromiograma. La inmunohistoqumica revela la distrofina alterada en las biopsias
musculares. Se puede identificar los portadores y realizar diagnstico prenatal. La
presencia del segundo cromosoma X en las mujeres, por medio de la aplicacin de la
PCR mltiplex, dificulta el evidenciar si son o no portadoras de la mutacin,
requirindose diferentes tcnicas (anlisis de microsatlites). No existe un tratamiento

INVESTIGACIONES MOLECULARES EN EL ECUADOR: ENFERMEDADES CONGNITAS

174

especfico, pero se ha observado que el uso de prednisona mejora el pronstico a largo


plazo. Es clave el consejo gentico. Se ha intentado el reemplazo de genes y el
transplante de mioblastos (Paz-y-Mio et al., 1999b).
En la Figura X.8 se observa la amplificacin del gen DMD y la deteccin de las
deleciones encontradas en los diferentes exones.

FIGURA X.8. DETECCIN DE DELECIONES DEL GEN DMD. Columnas 1-4 para
juego 1 de exones: Pm, 3, 43, 50, 13, 6, 47, 60 y 52. Columnas 5-8 para juego 2 de
exones: 45, 48, 19, 17, 51, 8, 12, 44 y 4. Las columnas 1-2 y 5-6 corresponden a
dos de los tres enfermos con DMD que muestran deleciones de los exones 50 y 47
(lneas 1-2) y 45, 48 y 51 (lneas 5-6), las columnas 3 y 7 corresponden al hermano
varn de un enfermo y las columnas 4 y 8 al control negativo (Modificado de Paz-yMio et al., 1999b; IIB, 2014).

Para mayor informacin, el artculo titulado Distrofia muscular de Duchenne:


Deteccin de mutaciones del gen de la distrofina a travs de la utilizacin de la PCRmltiplex se encuentra publicado en la revista cientfica MetroCiencia, en el ao 1999
(Paz-y-Mio et al., 1999b).

4.HEMOCROMATOSIS
La hemocromatosis de tipo 1 es una enfermedad autosmica recesiva
relacionada con una excesiva absorcin intestinal de hierro. Esta falla en el metabolismo
del hierro desencadena una diversidad de enfermedades como la diabetes mellitus,
cardiomiopata y falla heptica debido a la progresiva acumulacin de hierro en las
clulas parenquimales de varios rganos (Milman et al., 2005).

INVESTIGACIONES MOLECULARES EN EL ECUADOR: ENFERMEDADES CONGNITAS

175

4.1.GenHFE
En 1996 se encontr un gen candidato para la hemocromatosis, denominado
HFE, el cual se encuentra localizado en el cromosoma 6 humano (Tabla X.7) (Figura
X.9) (Feder et al., 1996).
Tabla X.7. Caractersticas del gen HFE
Caractersticas
Smbolo oficial
Nombre
Otros alias
Cromosoma
Localizacin
# Acceso NCBI
Gen ID
Tamao secuencia
Tamao protena
Localizacin subcelular

Informacin
HFE
Hemocromatosis
HLA-H
6
6p21,3
NC_000006,11
3077
11124 bases
348 aa; 40108 Da
Membrana celular

Estructura proteica

(Lebron et al., 1998)

Se ha observado que este gen presenta dos mutaciones en los pacientes con
hemocromatosis: C282Y (c845G>A/p. C282Y) y H63D (c187C>G/p. H63D) (Lyon &
Frank, 2001). La mutacin C282Y ha sido encontrada en el 60-100% de individuos
homocigotos descendientes de europeos que presentaron hemocromatosis de tipo 1.
Mientras que la mutacin H63D est presente en el 16% de la poblacin europea (Feder
et al., 1996; Lyon & Frank, 2001). Una tercera mutacin en el gen HFE ha sido
reportada tanto en pacientes como en controles. La mutacin S65C (c193A>T/p. S65C)
es responsable de una forma menos agresiva de este desorden gentico (Barton et al.,
1999; Mura et al., 1999; Holmstrm et al., 2002).

FIGURA X.9. CROMOSOMA 6 HUMANO. Ubicacin del gen HFE (GeneCards, 2014).

Sin embargo, est reportado que en algunos casos la hemocromatosis no est


solamente relacionada a las mutaciones del gen HFE. Estos interesantes
descubrimientos nacen de la observacin de que dentro de grandes familias que
demuestran alta incidencia de desrdenes por acumulacin de hierro, los miembros no
afectados pueden compartir el mismo haplotipo del gen HFE con los individuos
afectados. Esto confirma la hiptesis de que por lo menos dos genes pueden estar
envueltos en el desarrollo de hemocromatosis (Pietrangelo et al., 1999). Entre los
posibles genes asociados a las caractersticas heterogneas de la enfermedad estn: HJV,
HAMP y TfR2 (Pietrangelo et al., 2004).
Nuestro grupo de investigacin realiz un estudio de las mutaciones C282Y,
H63D y S65C del gen HFE en poblacin ecuatoriana. Se estudi un total de 112
individuos, 100 sanos y 12 clnicamente diagnosticados con hemocromatosis. La tcnica
realizada fue la PCR.

INVESTIGACIONES MOLECULARES EN EL ECUADOR: ENFERMEDADES CONGNITAS

176

4.2.Resultadosydiscusin

Las frecuencias allicas de las mutaciones encontradas en el grupo de casos y de


controles se detallan en la Tabla X.8. La frecuencia de las mutaciones C282Y y S65C
no demostr diferencias estadsticamente significativas entre pacientes con
hemocromatosis y personas sanas. Por el contrario, la frecuencia de la mutacin H63D
s demostr diferencia significativa mediante la prueba estadstica chi-cuadrado. Por
ende, se concluy que la mutacin H63D presenta una elevada influencia en la
hemocromatosis hereditaria en Ecuador.

Tabla X.8. Frecuencias allicas del gen HFE en casos y controles

Mutaciones

Alelos
N/N

C282Y
Control
200
100
Caso
24
24
H63D
Control
200
93
Caso
24
9
S65C
Control
200
93
Caso
24
11
(N) Alelo normal; (M) Alelo mutante

Individuos
N/M

M/M

Frecuencias allicas
(Casos)

Valor de p

0
0

0
0

0
0

NS

7
2

0
1

0,035
0,167

< 0,01

6
1

1
0

0,040
0,042

NS

Se ha reportado que la frecuencia allica de la mutacin C282Y es elevada en


personas de Angola (Olynyk et al., 1999; Hanson et al., 2001; Milman et al., 2005). Esta
mutacin es menos frecuente en la regin sur de Europa y est prcticamente ausente en
poblaciones de frica, Asia y Amrica del Sur (Chang et al., 1997; Cullen et al., 1998;
Monaghan et al., 1998; Snchez et al., 1998; Agostinho et al., 1999; Sohda et al., 1999;
Mariani et al., 2003). En el Ecuador no se ha reportado la presencia de esta variante. La
frecuencia de la mutacin H63D en el Ecuador es considerablemente baja con relacin a
la reportada en Estados Unidos y Europa. Por otro lado, se encontr que la frecuencia de
la mutacin S65C es mayor que la frecuencia reportada en poblacin caucsica (Mura et
al., 1999; Holmstrm et al., 2002; Mariani et al., 2003; Remacha et al., 2000). Estos
resultados podran tambin explicar la baja incidencia de hemocromatosis en Ecuador,
como se ha reportado sobre las mutaciones H63D y S65C y sus efectos clnicos dbiles
en los individuos (Lyon & Frank, 2001). Este estudio sugiere que la hemocromatosis en
Ecuador no est influenciada solamente por las mutaciones del gen HFE analizadas,
sino que tambin intervienen otras mutaciones del mismo gen y de otros genes.
Para mayor informacin, la investigacin denominada Analysis of HFE Gene
Mutations (C282Y, H63D, and S65C) in the Ecuadorian Population, se public en la
revista cientfica Annals of Hematology en el ao 2005 (Leone et al., 2005).

5.HIPOACUSIANOSINDRMICARECESIVA

La hipoacusia es considerada la deficiencia sensorial ms frecuente a nivel


mundial (Marlin et al., 2005). Cada ao, 1 de cada 1000 nios nace con discapacidad
auditiva prelingual (Yasunaga 1999; Del Castillo et al., 2002; Kenneson et al., 2002;

INVESTIGACIONES MOLECULARES EN EL ECUADOR: ENFERMEDADES CONGNITAS

177

Cordeiro-Silva et al., 2010). Se estima que alrededor del 60% de los casos se desarrolla
por factores genticos, mientras que el 40% restante se origina por causas ambientales
(Farpn & Baales, 2011). Entre los individuos afectados por causas genticas, el 70%
presenta la forma no sindrmica de la enfermedad, esto quiere decir que no se presentan
sntomas mdicos junto con la hipoacusia; sin embargo, dentro de los individuos no
sindrmicos el 80% sigue un patrn autosmico recesivo (Farpn & Baales, 2011), por
lo que la hipoacusia no sindrmica recesiva es la forma ms comn de hipoacusia
hereditaria. Debido a que la hipoacusia no sindrmica recesiva es la forma ms comn
de sordera auditiva, se realiz un anlisis polimrfico en muestras de ADN de once
familias afectadas, proveniente de doce diferentes provincias del Ecuador.
Actualmente, se han descrito alrededor de treinta genes relacionados con la
hipoacusia congnita no sindrmica recesiva (Farpn & Baales, 2011). A pesar de esta
gran variedad de genes (heterogeneidad gentica), la mayora de las mutaciones ocurre
en un solo locus denominado DFNB1, donde se han encontrado dos genes, GJB2
(DFNB1A) y GJB6 (DFNB1B). El locus DFNB1 por s solo es responsable del 50% de
las deficiencias auditivas recesivas (Wu et al., 2002; Del Castillo et al., 2005; Tamayo
et al., 2009; Zoidl & Dermietzel, 2010; Farpn & Baales, 2011). El locus DFNB1A
representa la herencia autosmica recesiva del gen GJB2 y DFNB1B representa la
herencia autosmica recesiva del gen GJB6.
5.1.GenesGJB2yGJB6
El gen GJB2 codifica la conexina 26, una protena de 226 aminocidos (Tabla
X.9) (Petit et al., 2001), mientras que el gen GJB6 codifica la conexina 30, una protena
de 261 aminocidos (Tabla X.10) (Grifa et al., 1999; RCSB-PDB, 2013).
Tabla X.9. Caractersticas del gen GJB2
Caractersticas
Smbolo oficial
Nombre
Otros alias
Cromosoma
Localizacin
# Acceso NCBI
Gen ID
Tamao secuencia
Tamao protena
Localizacin subcelular

Informacin
Estructura proteica
GJB2
Protena de unin
gap, conexina 26
DFNB1
13
13q11
NC_000013,10
2706
5513 bases
226 aa; 26215 Da
Membrana celular

(Maeda et al., 2009)

De todas las mutaciones que afectan al gen GJB2, la ms conocida y


caracterizada es la delecin 35delG; es tan importante esta delecin que est incluida en
el screening gentico en nios (Farpn & Baales, 2011). El gran nmero de estudios
genticos relacionados con el gen que codifica la conexina 26 permiti la identificacin
de mutaciones relacionadas con la etnicidad y el origen de diversas poblaciones; por
ejemplo, 167delT es la mutacin ms comn en la poblacin juda asquenaz, 35delG en
caucsicos de ascendencia europea, 235delC en la poblacin japonesa (Rabionet et al.,
2000), W24X (G71A) en la poblacin india (Mani et al., 2009), V27I (G79A) en
poblaciones hispanas y asiticas (Pandya et al., 2003; Tang et al., 2006; Samanich et al.,
2007), y S199F (C596T) en la poblacin colombiana (Tamayo et al., 2009). Por otro

INVESTIGACIONES MOLECULARES EN EL ECUADOR: ENFERMEDADES CONGNITAS

178

lado, la delecin del(GJB6-D13S1830) en el gen GJB6, es la segunda causa ms


frecuente en poblacin espaola (Farpn & Baales, 2011). La ubicacin de las
diferentes mutaciones se puede observar en la Figura X.10.
Tabla X.10. Caractersticas del gen GJB6
Caractersticas
Smbolo oficial
Nombre

Informacin
Estructura conexina 26*
GJB6
Protena de unin
gap, conexina 30
Otros alias
DFNA3
Cromosoma
13
Localizacin
13q12
# Acceso NCBI
NC_000013,10
Gen ID
10804
Tamao secuencia
10434 bases
(Maeda et al., 2009)
Tamao protena
261 aa; 30387 Da
Localizacin subcelular Membrana celular
(*) Conexina 26 asociada estructuralmente a la conexina 30.

En el Ecuador, los problemas a nivel auditivo representan el tercer tipo de


discapacidad ms comn, sin tomar en cuenta las discapacidades intelectuales. Est
presente en alrededor de 33,828 habitantes, con una tasa de prevalencia de 2,3 por cada
1000 individuos (MSME, 2013). Sin embargo, este dato no diferencia entre individuos
afectados por factores ambientales y hereditarios. Esto significa que, en nuestro pas, las
principales mutaciones causantes de la hipoacusia hereditaria no sindrmica recesiva y
sus frecuencias continan sin ser conocidas. Con los resultados obtenidos en nuestra
investigacin se espera tener una visin ms clara sobre el efecto de las mutaciones de
los genes GJB2 y GJB6, relacionadas con el desarrollo de la hipoacusia no sindrmica
recesiva en Ecuador y Latinoamrica.

FIGURA X.10. CROMOSOMA 13 HUMANO. Ubicacin de los genes GJB2 y GJB6


(GeneCards, 2014; IIB, 2014).

Con el fin de identificar las mutaciones ms comunes en el Ecuador, se realiz


secuenciacin genmica del exn 2 del gen GJB2 (DFNB1A) en 111 individuos. De
estas 111 personas en estudio, 26 fueron diagnosticados con hipoacusia y considerados
afectos (20 con hipoacusia no sindrmica neurosensorial y 6 parientes de los afectos
autocalificados como hipoacsicos). Junto a este grupo se incluy a otros dos grupos:

INVESTIGACIONES MOLECULARES EN EL ECUADOR: ENFERMEDADES CONGNITAS

179

uno denominado sanos, que consta de 57 individuos sin antecedentes familiares con
hipoacusia; y el otro grupo de 28 individuos, por ser parientes del grupo de afectos sin
hipoacusia fueron denominados familiares. Estos 3 grupos comprendieron la totalidad
de la poblacin bajo estudio. Por otro lado, para identificar a la delecin del(GJB6D13S1830) del gen GJB6 (DFNB1B) en esta misma poblacin, se realiz una PCR
mltiplex (Cordeiro-Silva et al., 2010).
En la poblacin total de estudio se encontraron 104 alelos mutados en el exn 2
del gen GJB2. De los 104 alelos, 43 fueron patognicos (29 alelos patognicos en
afectos). En el locus DFNB1A, se encontraron 16 afectos (61,1%), pertenecientes a siete
familias, con al menos un alelo patognico: 13 individuos con dos alelos (50%) y 3 con
uno solo (11,5%), varios de estos en heterocigosis compuesta con el polimorfismo no
benigno V27I. En los 10 afectos restantes (38,5%), 9 pertenecieron a tres familias donde
se hall nicamente el polimorfismo V27I, mientras que 1 individuo perteneci a la
nica familia sin mutacin en el gen GJB2. Cabe mencionar que ningn individuo de la
poblacin present la delecin del(GJB6-D13S1830), siendo sta tan frecuente en la
poblacin espaola (Farpn & Baales, 2011). Las siete mutaciones patognicas
halladas en este estudio fueron: Q7X (C19T), 35delG, V27I (G79A), R32L (G95T),
W77R (T229C), R143W (C427T), S199F (C596T) y N206S (A617G); adems de stas
tambin se identific al polimorfismo no patognico V27I (Figura X.11).

FIGURA X.11. MUTACIONES DE LA CONEXINA MEMBRANAL. Las variantes


genticas presentes en la conexina 26 se encuentran unificadas en la membrana
plasmtica, espacio intracelular y espacio extracelular (IIB, 2014).

INVESTIGACIONES MOLECULARES EN EL ECUADOR: ENFERMEDADES CONGNITAS

180

La variante gentica ms comn fue el polimorfismo V27I, del cual se


encontraron 61 alelos, equivalente al 58,9% del total, con una distribucin homognea
entre los tres grupos: afectos, sanos y familiares; ninguna otra variante fue encontrada
entre los sanos. En el aspecto poblacional, la presencia de V27I es relevante comparado
a estudios previos en los que se ha visto altas frecuencias de esta mutacin en etnias
asiticas e hispanas (Pandya et al., 2003; Tang et al., 2013; Samanich et al., 2007).
La segunda mutacin ms comn fue Q7X, presente en 19 alelos y con una
frecuencia del 18,3%. Al considerar solamente las mutaciones patognicas, sta viene a
ser la ms comn y la nica con individuos en estado homocigoto; se la encontr en
estado heterocigoto en siete individuos mientras que tres la tuvieron en estado
homocigoto, lo cual corresponde al 38,5% de los afectos. La variacin Q7X (C19T) en
una mutacin sin sentido que ocurre en el codn siete de la secuencia proteica (dominio
IC1), produciendo el intercambio de una glicina (CAG) por un codn de parada (UAG),
lo cual termina la produccin de la protena prematuramente. Hasta ahora la nica
referencia de esta mutacin fue presentada por Pandya, donde se encontr un solo
individuo con esta mutacin en heterocigosis, curiosamente este individuo es de origen
ecuatoriano (Pandya et al., 2003).
La tercera mutacin ms comn fue R32L, de esta se encontraron 7 alelos
totales, equivalente al 6,7%. Viene a ser la segunda mutacin patognica ms comn; se
la encontr en estado heterocigoto en seis individuos afectos distintos (23,1%). Las
otras variaciones: 35delG, W77R, R143W, S199F y N206S se encontraron en
frecuencias del 2,9% (tres alelos,), 4,7% (cinco alelos), 3,8% (cuatro alelos), 2,8% (tres
alelos) y 1,9% (dos alelos) de los alelos totales respectivamente.
Tabla X.11. Porcentaje de alelos encontrados en las ocho mutaciones genticas
Nucletido Aminocido
C19T
35delG
G79A
G95T
T229C
C427T
C596T
G617A

Q7X
G12V
V27I
R32H
W77R
R143W
S199F
N206S

Mutacin
Sin sentido
Cambio de lectura
Cambio de sentido
Cambio de sentido
Cambio de sentido
Cambio de sentido
Cambio de sentido
Cambio de sentido

Dominio
Intracelular 1
Intracelular 1
Transmembranal 1
Transmembranal 1
Transmembranal 2
Transmembranal 3
Transmembranal 4
Transmembranal 4

No. alelos / alelos


totales (%)
19/104 (18,3)
3/104 (2,8)
61/104 (58,9)
7/104 (6,7)
5/104 (4,8)
4/104 (3,8)
3/104 (2,8)
2/104 (1,9)

Los efectos de las mutaciones se observaron cuando se expresaba una variacin


patognica en homocigosis recesiva o en heterocigosis compuesta con otra mutacin
patognica. En algunos individuos con mutaciones en estado heterocigoto compuesto
con el polimorfismo benigno se present hipoacusia, mientras que en otros individuos
con la misma variacin patognica en heterocigosis simple no se expres la enfermedad;
para estos casos se encuentra involucrada la penetrancia incompleta.
Los 16 genotipos fueron hallados entre los tres grupos de estudio. Sin embargo,
en el grupo sanos se encontraron solamente los genotipos V27I/V27I y V27I/wt (wild
type), esto refleja su carcter benigno. En cambio, en el grupo familiares se encontraron
nicamente genotipos heterocigotos para una sola mutacin patognica o una mutacin
patognica en heterocigosis compuesta con el polimorfismo benigno V27I; estos
individuos vienen a ser portadores. En el grupo afectos se encontraron 13 individuos en

INVESTIGACIONES MOLECULARES EN EL ECUADOR: ENFERMEDADES CONGNITAS

181

heterocigosis compuesta con 2 mutaciones patognicas; la mayora de estos individuos


presentaron hipoacusia profunda. El genotipo Q7X/V27I/R32L, el ms comn, se
encontr en cuatro individuos (Tabla X.12).
Tabla X.12. Nmero de afectos, sanos y familiares con cada genotipo

Genotipo (n = 16)
Q7X/Q7X
Q7X/V27I/R32L
Q7X/S199F
35delG/W77R
W77R/R143W
Q7X/V27I
V27I/V27I
V27I/V27I/R32L
V27I/35delG
V27I/N206S
Q7X/wt
V27I/wt
35delG/wt
W77R/wt
R143W/wt
N206S/wt
Total
(WT) Wild type

Afectos (n = 26)
3
4
3
1
2
1
2
5
1
22

Sanos (n = 57)
3
19
22

Familiares (n = 28)
3
5
1
1
1
3
4
1
2
2
23

Total
3
4
3
1
2
3
9
3
1
1
3
28
1
2
2
1
67

Este anlisis gentico permiti la identificacin de 8 variaciones allicas del gen


GJB2 y, posteriormente, relacionar la clnica de 13 de los 26 individuos diagnosticados
con genotipos homocigotos recesivos o heterocigoto compuestos con 2 mutaciones
patognicas. En cuanto a los individuos que no se logr identificar una causa para su
hipoacusia, se cree que hay algn otro gen involucrado relacionado con la
heterogeneidad gentica.
Es necesario tomar en cuenta el anlisis gentico como resultado fundamental
para pacientes con hipoacusia neurosensorial no sindrmica, ya que provee de
informacin relevante para el consejo gentico. Se ha demostrado que individuos con
mutaciones ocasionadas en el gen GJB2 y GBJ6 se benefician ms de los implantes
cocleares que los pacientes con hipoacusia hereditarias sin mutaciones en estos genes
(Farpn & Baales, 2011).

Captulo XI
Investigaciones moleculares en el Ecuador:
Inmunologa

La inmunologa es el estudio de la defensa del cuerpo ante diversos agentes


infecciosos. El ser humano vive rodeado de microorganismos, muchos de ellos
causantes de enfermedades. La inmunologa es relativamente una ciencia moderna, y su
origen se lo atribuye a Edward Jenner (Murphy et al., 2008). La respuesta que
generamos contra una infeccin provocada por un agente infeccioso es conocida como
la respuesta inmune. Una respuesta inmune especfica, como la produccin de
anticuerpos contra un patgeno determinado, es conocida como la respuesta inmune
adaptativa porque se desarrolla durante el tiempo de vida de un individuo como
respuesta a la infeccin de un patgeno desconocido. En muchos casos, una respuesta
inmune adaptativa tambin resulta en el fenmeno conocido como memoria
inmunolgica, el cual confiere proteccin ante una reinfeccin para toda la vida. Esta es
una de las caractersticas que distingue a la respuesta inmune adaptativa de la respuesta
inmune innata. La inmunidad innata provee proteccin inmediata ante un amplio rango
de patgenos pero no es especfica hacia alguno de ellos (Murphy et al., 2008).
En el Ecuador se han realizado diversos estudios relacionados con la
caracterizacin gentica de la poblacin. Las investigaciones ms relevantes de nuestro
grupo son los anlisis moleculares de receptores bacterianos en poblacin infectada con
Helicobacter pylori y los anlisis poblaciones de resistencia al virus de la
inmunodeficiencia humana.

1.RECEPTORESBACTERIANOS
La bacteria Helicobacter pylori es un bacilo Gram negativo, multiflagelado y
microaerfilo que coloniza fcilmente el estmago humano (Kusters et al., 2006). Su
presencia est relacionada con enfermedades gstricas como lcera pptica, lceras
duodenales, gastritis; y es considerado como factor de riesgo para el desarrollo de
cncer gstrico. La probabilidad de infeccin es igual en cualquier estrato social, etnia,
sexo o grupo etario, aunque se observa mayor incidencia en pases con niveles socioeconmicos bajos (Chvez et al., 1998; Castro & Coehlo, 1998; Semprtegui et al.,
2007). Estudios realizados en Ecuador demuestran que su frecuencia flucta entre el
42,2% y 77% (Cabrera et al., 2002; Debets-Ossenkopp et al., 2003; Gmez et al., 2004).
Una respuesta inmune rpida y especfica del hospedero es importante para
erradicar microorganismos patgenos. Esta respuesta se inicia reconociendo antgenos
por medio de receptores presentes en las membranas de clulas hematopoyticas
especializadas. Las protenas de membrana son estructuras que ayudan a identificar
agentes patgenos y son detonadores de la respuesta inmune. Se reconocen a estos
agentes por medio de molculas llamadas patrones moleculares asociados a patgenos
(PMAP). Al producirse una interaccin entre estos PMAPs y las protenas de
membrana, se promueve una proliferacin y diferenciacin de clulas especializadas en
la defensa del hospedero. Entre los receptores ms conservados y principales iniciadores
de una respuesta inmune innata se destacan los receptores similares a toll (toll-like

INVESTIGACIONES MOLECULARES EN EL ECUADOR: INMUNOLOGA

186

receptors) (TLR) y los receptores de lectina tipo C (RLC) (Kraehenbuhl & Corbett,
2004; Achyut et al., 2007; Moura et al., 2008).
1.1.GenesTLR
Los TLR son una familia de receptores que se expresan en una gran variedad de
tipos celulares y reconocen arreglos especficos de membrana de bacterias Gram
negativas. Dentro de esta familia, TLR2 puede reconocer una amplia variedad de
PMAPs y su especificidad hacia H. pylori se genera cuando interacta con otros
receptores de la familia TLR como TLR1, TLR6; y TLR4, que tienen una alta afinidad
por los lipopolisacaridos de bacterias Gram negativas (Tabla XI.1) (Takeuchi et al.,
1999; Kawahara et al., 2001; Takeda & Akira, 2003; Gay & Gangloff, 2007).
Tabla XI.1. Caractersticas del gen TLR2
Caractersticas
Smbolo oficial
Nombre
Otros alias
Cromosoma
Localizacin
# Acceso NCBI
Gen ID
Tamao secuencia
Tamao protena
Localizacin subcelular

Informacin
TLR2
Receptores Toll
TIL4
4
4q32
NC_000004,11
7079
21803 pb
784 aa; 89838 Da
Membrana celular

Estructura proteica

(Xu et al., 2000; Tao et al., 2002)

En la siguiente figura se determina la ubicacin del gen TLR2 en el genoma


humano.

FIGURA XI.1. CROMOSOMA 4 HUMANO. Ubicacin del gen TLR2 (GeneCards,


2014).
En la siguiente tabla se detalla informacin acerca de las principales
caractersticas del gen TLR4.
Tabla XI.2. Caractersticas del gen TLR4
Caractersticas
Smbolo oficial
Nombre
Otros alias
Cromosoma
Localizacin
# Acceso NCBI
Gen ID
Tamao secuencia
Tamao protena
Localizacin subcelular

Informacin
TLR4
Receptor Toll
CD284
9
9q33
NC_000009,11
7099
13309 pb
839 aa; 95680 Da
Membrana celular

Estructura proteica

(Kim et al., 2007; Ohto et al., 2012)

INVESTIGACIONES MOLECULARES EN EL ECUADOR: INMUNOLOGA

187

En la siguiente figura se determina la ubicacin del gen TLR4 en el genoma


humano.

FIGURA XI.2. CROMOSOMA 4 HUMANO. Ubicacin del gen TLR4 (GeneCards,


2014).

1.2.GenCD209
Los RLC son una familia de receptores que reconocen a PMAPs asociados con
hidratos de carbono y se caracterizan por ser dependientes de Ca+. CD209 es una
protena perteneciente a esta familia y juega un rol importante en la internalizacin y
presentacin de antgenos, activacin de clulas T y migracin de las clulas dendrticas
(CDs) para la iniciacin de una respuesta inmune adaptativa. CD209 acta como
receptor de patgenos para virus, parsitos y bacterias, incluyendo Helicobacter pylori
(Tabla XI.3) (Zhou et al., 2006; Ryan et al., 2010).
Tabla XI.3. Caractersticas del gen CD209
Caractersticas
Smbolo oficial
Nombre
Otros alias
Cromosoma
Localizacin
# Acceso NCBI
Gen ID
Tamao secuencia
Tamao protena
Localizacin subcelular

Informacin
CD209
Cluster de
diferenciacin 209
DC-SIGN
19
19p13
NC_000019,9
30835
7586 pb
404 aa; 45775 Da
Membrana celular

Estructura proteica

(Feinberg et al., 2001; 2007)

Se han descrito variantes genticas que disminuyen la interaccin entre los


receptores y sus antgenos asociados a patgenos. Los polimorfismos en estas protenas
que reducen la capacidad de reconocimiento de molculas antgenas bacterianas
promueven una disminucin en la iniciacin de la defensa inmune del hospedero.
Adems, se aumenta la susceptibilidad hacia infecciones y enfermedades relacionadas
con la presencia de H. pylori tales como inflamaciones gstricas, lceras y cncer
gstrico (Kraehenbuhl & Corbett, 2004; Texereau et al., 2005; Achyut et al., 2007;
Moura et al., 2008).

FIGURA XI.3. CROMOSOMA 19 HUMANO. Ubicacin del gen CD209 (GeneCards,


2014).

INVESTIGACIONES MOLECULARES EN EL ECUADOR: INMUNOLOGA

188

Si la interaccin entre el receptor y su ligando (antgeno) se da en forma


adecuada, se promueve la produccin de citocinas pro-inflamatorias que inician la
respuesta celular del hospedero hacia el patgeno y se aumenta la especificidad en el
ataque. La activacin de la respuesta inmune iniciada por patgenos, y especficamente
la causada por H. pylori, es modulada principalmente por las citocinas IFN-, TNF-,
IL-1, IL-6, IL-8 e IL-18. Todas estas citocinas son conocidas como potentes inductores
de linfocitos durante inflamaciones crnicas causadas por esta bacteria (Bodger &
Crabtree, 1998; Rad et al., 2002). El IFN- aumenta la actividad de las clulas asesinas
(NK), regula la produccin de inmunoglobulinas incidiendo sobre los linfocitos B
(Carnaud et al., 1999), y ayuda en la activacin de las clulas presentadoras de
antgenos (Harris et al., 2000; Frucht et al., 2001), por lo que es una de las principales
molculas reguladoras del sistema inmune al actuar en contra de esta bacteria.
1.3.GenIFNGR1
Variaciones en el gen que codifica este interfern y su receptor (IFNGR1) han
sido asociadas con la susceptibilidad a infecciones bacterianas y con el aumento en el
riesgo a desarrollar patologas gastro-duodenales y cncer gstrico (Tabla XI.4) (Figura
XI.12) (Koch et al., 2002; Cheong et al., 2006; Salih et al., 2007; Canedo et al., 2008).
Tabla XI.4. Caractersticas del gen IFNGR1
Caractersticas
Smbolo oficial
Nombre
Otros alias
Cromosoma
Localizacin
# Acceso NCBI
Gen ID
Tamao secuencia
Tamao protena
Localizacin subcelular

Informacin
IFNGR1
Receptor interfern
gamma
CD119
6
6q23
NC_000006,11
3459
21966 pb
489 aa; 54405 Da
Membrana celular

Estructura proteica

(Thiel et al., 2000)

Nuestro grupo de investigacin analiz los polimorfismos TLR2 2029C/T,


TLR4 896A/G, CD209 -336A/G y IFNGR1 -56C/T, todos ellos relacionados con
susceptibilidad a infeccin bacteriana, hipo-sensibilidad a los lipopolisacaridos de
bacterias Gram negativas, disminucin en el reconocimiento de PMAPs bacterianos, y
aumento en el riesgo de cncer gstrico, respectivamente (Koch et al., 2002; Martin et
al., 2004; Texereau et al., 2005; Barreiro et al., 2006; Cheong et al., 2006; Achyut et al.,
2007; Salih et al., 2007; Canedo et al., 2008), y su asociacin con la infeccin a H.
pylori en un grupo de individuos ecuatorianos.

FIGURA XI.4. CROMOSOMA 6 HUMANO. Ubicacin del gen IFNGR1 (GeneCards,


2014).

INVESTIGACIONES MOLECULARES EN EL ECUADOR: INMUNOLOGA

189

El estudio fue de tipo caso-control, el cual involucr a 258 individuos


ecuatorianos de sexo masculino y femenino. Las muestras fueron obtenidas a partir de
una poblacin sintomtica con diagnstico clnico de gastritis: dolor crnico y
recurrente en la mitad del abdomen, nusea, distencin abdominal o hinchazn,
especialmente despus de la ingesta de comida. Fueron aisladas del estudio las muestras
de personas sin la sintomatologa antes mencionada. Todas las biopsias estudiadas
fueron obtenidas por medio de endoscopas. Para determinar la presencia de
Helicobacter pylori en cada paciente se realiz una PCR del gen bacteriano 16S ARNr.
Se obtuvieron 70 hombres y 75 mujeres, con una edad media de 45 aos desviacin
estndar (DE) 13,8. El grupo control estuvo conformado por 55 hombres y 58 mujeres,
con edad media de 50 aos DE 16,9. Todos los individuos pertenecieron al mismo
grupo tnico (mestizos).

Las muestras biolgicas fueron agrupadas de acuerdo a la lesin gstrica y


clasificadas segn el resultado histopatolgico. Las observaciones histopatolgicas
fueron determinadas conforme al taller internacional que evalu y revis la clasificacin
del Sistema de Sidney para el reporte de gastritis (Dixon et al., 1997). Fueron
determinados 5 estados dependiendo de la levedad o gravedad del dao observado (del
ms leve al ms grave): gastritis crnica no atrfica con presencia de lcera, gastritis
crnica atrfica, metaplasia intestinal, displasia y cncer gstrico.

1.4.Resultadosydiscusin
Se obtuvo un producto de PCR de 522 pb en 145 biopsias gstricas de las 258
analizadas; 133 muestras dieron resultados negativos en la PCR y fueron determinadas
como el grupo control en este estudio. Las frecuencias allicas y genotpicas de los
polimorfismos para TLR2, TLR4, CD209 e IFNGR1 se muestran en la Tabla XI.5.
Tabla XI.5. Frecuencias allicas y genotpicas de TLR2, TLR4, CD209 e IFNGR1
Frecuencias genotpicas
Gen

Genotipo
C/C
C/T
TLR2
2029C/T T/T

Frecuencias allicas

Hp +

Hp -

Total

Hp +

Hp -

Total

0,02
0,63
0,35

0,06
0,57
0,37

0,04
0,60
0,36

0,33

0,35

0,34

0,67

0,65

0,66

0,48

0,47

0,48

0,52

0,53

0,52

TLR4
896A/G

A/A
A/G
G/G

0,20
0,56
0,24

0,21
0,52
0,27

0,21
0,54
0,25

A/A
A/G
G/G

0,45
0,54
0,01

0,47
0,51
0,02

0,46
0,53
0,01

0,72

0,73

0,72

CD209
-336A/G

0,28

0,27

0,27

C/C
C/T
T/T

0,09
0,46
0,45

0,17
0,54
0,29

0,12
0,49
0,38

0,32

0,44

0,37

0,68

0,56

0,63

IFNGR1
-56C/T

La edad media de los individuos control fue de 50 aos, con un rango de entre
17 y 86 aos; la mediana en este grupo fue de 50,5. En el grupo infectado se obtuvo una
edad media ms baja que en los controles, 45 aos; y una mediana de 43. El rango de

INVESTIGACIONES MOLECULARES EN EL ECUADOR: INMUNOLOGA

190

edad entre afectos es de 15 hasta 88 aos. Se determin la edad media dependiendo del
tipo de gastritis presente en los individuos estudiados y se encontr que los individuos
infectados presentan menor edad media que los controles. Cabe mencionar que los
factores epigenticos son muy relevantes en la calidad de vida de las personas y en su
capacidad de protegerse ante los agentes patolgicos externos (Tabla XI.6).
Tabla XI.6. Edad media en individuos infectados y sanos segn su histopatologa
Gastritis crnica
Atrfica
No atrfica
42,3
45,2
46,5
54,5

Hp +
Hp -

Metaplasia intestinal
53,6
63,1

Se determinaron las diferencias estadsticas entre los grupos sanos y afectos para
cada una de las variantes utilizando las pruebas de 2 y OR para determinar riesgo de
infeccin (Tabla XI.7).
Tabla XI.7. Anlisis de la prueba estadstica chi-cuadrado

TLR2
2029C/T

CC
CT
TT

Hp+
n (frecuencia)
3 (0,02)
91 (0,63)
51 (0,35)

TLR4
896A/G

AA
AG
GG

29 (0,20)
81 (0,56)
35 (0,24)

24 (0,21)
59 (0,52)
30 (0,27)

2=0,350; p=0,840NS

CD209
-336A/G

AA
AG
GG

65 (0,45)
78 (0,54)
1 (0,01)

52 (0,47)
57 (0,51)
2 (0,02)

2=0,787; p=0,675NS

13 (0,09)
67 (0,46)
65 (0,45)

19 (0,17)
61 (0,54)
33 (0,29)

2=8; p=0,018*

Genotipo

CC
CT
TT
(NS) No significativo; (*) Significativo
IFNGR1
-56C/T

Hpn (frecuencia)
7 (0,06)
64 (0,57)
42 (0,37)

2, valor de p
2=3,255; p=0,195NS

La variante TLR2 2029C/T no mostr diferencias estadsticas por lo que los


alelos C y T estuvieron presentes en la misma frecuencia en los individuos afectos y
controles. A pesar que la prueba del OR muestra riesgo del polimorfismo 2029C/T para
infeccin, no existieron diferencias estadsticas entre los grupos. Con respecto al SNP
TLR4 896A/G, no se encontraron diferencias estadsticas entre los grupos ni tampoco
riesgo de infeccin. Se observ una baja frecuencia del alelo polimrfico G (1%) de la
variante CD209 -336A/G en la poblacin estudiada, por lo que de igual forma no se
obtuvieron diferencias estadsticas al correlacionar la distribucin genotpica entre
afectos y controles. Adems, no existi riesgo de infeccin con los portadores del alelo
G.
Al comparar los grupos estudiados y el polimorfismo -56 C/T se encontraron
diferencias estadsticamente significativas. Al realizar la prueba del OR se determin
riesgo de infeccin entre los individuos heterocigotos portadores del alelo T y
homocigotos (Tabla XI.8).

INVESTIGACIONES MOLECULARES EN EL ECUADOR: INMUNOLOGA

191

Tabla XI.8. Anlisis de odds ratio y polimorfismos genticos


Polimorfismo Genotipo

Hp +
Hp (n=145) (n=113)
3
7
91
64
51
42
142
106

TLR2
2029C/T

C/C
C/T
T/T
C/T+T/T

TLR4
896A/G

A/A
A/G
G/G
A/G+G/G

29
81
35
116

CD209
-336A/G

G/G
G/A
A/A
G/A+A/A

IFNGR1
-56C/T

C/C
C/T
T/T
C/T+T/T

OR

95% IC

Valor de p

3,3
2,2
3,1

0,8 13,3
0,7 11,6
0,8 12,4

0,076NS
0,135NS
0,088NS

24
59
30
89

1,1
0,9
1,1

0,6 2,2
0,5 2,0
0,6 1,9

0,408NS
0,537NS
0,463NS

1
78
65
143

2
57
52
109

2,7
2,5
2,6

0,2 30,9
0,2 28,3
0,2 29,3

0,79NS
0,86NS
0,82NS

13
67
65
132

19
61
33
94

1,6
2,9
2,1

0,7 3,5
1,3 6,5
0,9 4,4

0,32NS
0,018*
0,08NS

Para determinar la relacin de -56 C/T en presencia de H. pylori y el dao


gstrico se aplic el OR en cada uno de los grupos histopatolgicos dados por el grado
de dao gstrico diagnosticados. Existe un incremento en el riesgo en individuos con
genotipos TT ms que en los heterocigotos, aunque no son valores significativos. Solo
los individuos homocigotos presentaron un riesgo de 8,3 veces a desarrollar gastritis
crnica atrfica y la presencia de la bacteria (Tabla XI.9).
Tabla XI.9. Anlisis de odds ratio y patologas gstricas

IFNGR1
-56
C/C
C/T

T/T

Total

Gastritis crnica (%)


Control
No atrfica
n (%)
n (%)
OR
(95% IC)
13 (16)
7 (9)
Referencia
43 (54)
37 (47)
1,6
(0,6-4,5)
p = 0,258
24 (30)
34 (44)
2,6
(0,9-7,5)
p = 0,059
80
78

Control
n (%)
5 (31)
9 (56)

2 (13)

16

Atrfica
n (%)
OR
(95% IC)
6 (12)
Referencia
20 (44)
1,8
(0,4-7,7)
p = 0,31
20 (44)
8,3
(1,2-54,4)
p = 0,027
46

Control
n (%)
1 (7)
6 (43)

7 (50)

14

Metaplasia intestinal
n (%)
OR
(95% IC
0
Referencia
10 (47,6)
2,6
(1,4-5)
p = 0,412
11 (52,4)
2,5
(1,4-4,5)
p = 0,421
21

Varios receptores de membrana estn involucrados en el reconocimiento de


ligandos exgenos asociados con microorganismos patgenos. Esta interaccin ligandoreceptor es clave dentro de la iniciacin y progresin de una respuesta inmune porque se
inicia una respuesta innata inespecfica hacia el patgeno y, dependiendo de la afinidad
de estos receptores con su ligando, se progresa a una adaptacin especfica (Geijtenbeek
et al., 2002; Takeda & Akira, 2003; Mogensen, 2009).
La familia TLR reconoce arreglos conservados en patgenos, inicia produccin
de citocinas en respuesta a una infeccin y aumenta la especificidad de la respuesta
junto con receptores especficos en clulas dendrticas. TLR2 y TLR4 son receptores de
membrana que han sido descritos como identificadores de arreglos bacterianos, ambos
compitiendo para interactuar con compuestos especficos de la membrana de H. pylori

INVESTIGACIONES MOLECULARES EN EL ECUADOR: INMUNOLOGA

192

(Takeuchi et al., 1999; Gay & Gangloff, 2007; Kawahara et al., 2001). TLR2 reconoce
una amplia gama de PMAPs, principalmente lipoprotenas de las membranas
bacterianas. Esta identificacin se especifica cuando TLR2 forma dmeros con TLR1 o
con TLR6, hacindolo muy verstil para interactuar con compuestos bacterianos
caractersticos, pero poco especfico para determinadas especies de bacterias (Abreu et
al., 2005; Fukata & Abreu, 2008). 2029C/T es una variante gentica que se localiza en
el dominio intracelular TIR del receptor TLR2, el cual inicia comunicacin celular y
activa vas especficas para empezar una inflamacin. Este polimorfismo reduce la
formacin de dmeros de TLR2 con TLR1 o TLR6, disminuyendo as la activacin del
factor de transcripcin NF-B y, consecuentemente, la produccin de citocinas
proinflamatorias IL-12, IL-23 y la va mediada por IFN- (Kang & Chae, 2001;
Texereau et al., 2005; Mogensen, 2009).
Los portadores de este polimorfismo han sido asociados con susceptibilidad a
infeccin bacteriana pero en este estudio no se encontr relacin entre la variante allica
T y el aumento en la susceptibilidad a la infeccin de H. pylori, ni tampoco relacin con
riesgo de infeccin. La presencia del alelo T atena la cantidad de NF- B por lo que se
afecta la produccin de IL-12 e IFN- y se reduce la iniciacin de una respuesta inmune
innata hacia infecciones bacterianas (Kang & Chae, 2001; Bochud et al., 2003;
Texereau et al., 2005). Se esperara que este alelo disminuya el evento inflamatorio ya
que no se produciran las citocinas necesarias para esto, y que el sistema inmune no se
active en contra de H. pylori, pero los valores aqu obtenidos no son significativos para
esta hiptesis. Como se mencion anteriormente, TLR2 reconoce una amplia gama de
arreglos bacterianos conservados pero esto limita a este receptor en su especificidad, por
lo que se sugiere que otros receptores estn involucrados en una activacin de respuesta
inmune hacia esta bacteria y la variante 2029C/T de TLR2 no disminuye la produccin
de citocinas proinflamatorias en presencia de H. pylori.
La protena codificada por TLR4 tiene una mayor afinidad con los LPS de
bacterias Gram negativas y las variantes genticas en este receptor son asociadas con el
aumento de susceptibilidad a la infeccin bacteriana (Schrder & Schumann, 2005;
Achyut et al., 2007; El-Omar et al., 2008). El polimorfismo 896A/G altera el dominio
extracelular del receptor en la regin rica en leucinas. Este cambio de aminocidos
disminuye la interaccin entre el dominio extra celular de TLR4 y los LPS, reduciendo
la iniciacin de la respuesta inmune innata por falta de interaccin entre ligando y
receptor (Arbour et al., 2000; Schmitt et al., 2002; Moura et al., 2008). De la misma
forma que con el polimorfismo 2029C/T de TLR2, 896A/G no present valores
estadsticos significativos al confrontar los grupos de portadores de H. pylori y
controles.
A pesar que ambos polimorfismos estudiados estn relacionados directa
(2029C/T de TLR2) e indirectamente (896A/G de TLR4) con una reduccin en la
iniciacin de las vas pro-inflamatorias, su falta de relacin estadstica en los individuos
ecuatorianos estudiados sugiere, al igual que otros autores (Fukata & Abreu, 2008), que
estos receptores no son los nicos en iniciar una respuesta inmune hacia H. pylori, y que
su amplio rango de reconocimiento a PMAPs disminuye su especificidad al momento de
relacionarnos con una especie bacteriana. El reconocimiento de H. pylori por receptores
del sistema inmune no est en funcin de uno o varios TLRs, sino que tambin otros
receptores intervienen en reconocer, iniciar y dar una progresin correcta hacia la
infeccin (Algood & Cover, 2006; Andres et al., 2011).

INVESTIGACIONES MOLECULARES EN EL ECUADOR: INMUNOLOGA

193

Las clulas dendrticas son conocidas como las principales presentadoras de


antgenos, y constituyen un puente entre la respuesta innata del sistema inmune y una
respuesta adaptativa especfica hacia los antgenos que ingresan al hospedero (Rossi &
Young, 2005). Entre los receptores que interactan con antgenos bacterianos e inducen
esta adaptacin, CD209 es conocido por tener una alta afinidad con los
lipopolisacridos de bacterias Gram negativas, internalizar estos arreglos moleculares y
presentarlos al complejo MHC para iniciar una respuesta inmune (Zhou et al., 2006).
Variantes polimrficas en la regin promotora CD209 -336 afectan la unin de factores
de transcripcin Sp1 y posiblemente otros factores que modulan la actividad de
regulacin transcripcional de este gen (Liu et al., 2003). El alelo G en esta secuencia
influir negativamente en el nivel de expresin de la protena con respecto al alelo A,
dando como resultado un fenotipo con menor cantidad de receptores en su membrana
celular (Sakuntabhai et al., 2005). La frecuencia del alelo G en los individuos
ecuatorianos analizados no excede el 1,2% del total.
Los valores no significativos encontrados son el resultado de un nmero
reducido de individuos con este genotipo, y a pesar de que este polimorfismo no pudo
ser asociado con la infeccin de esta bacteria en una poblacin tan reducida, la baja
frecuencia del alelo G sugiere que la expresin de CD209 en todos los grupos no es
baja, y que la presencia de H. pylori no se debe a que el sistema inmune no es capaz de
reconocerlo para erradicarlo, sino que otros factores estn envueltos con su presencia en
el hospedero. La falta de relacin estadstica encontrada entre las variantes genticas de
receptores de reconocimiento a H. pylori y la poblacin bajo estudio demuestra que
estos polimorfismos no interfieren con el reconocimiento de los antgenos bacterianos,
lo que indica que se da una iniciacin adecuada de la respuesta inmune si la bacteria
interacta con el epitelio.
En esta iniciacin de la respuesta inmune en contra de H. pylori se producen
citocinas inflamatorias como IL-1, IL-2, IL-6, IL e IFN-, que ayudan a la activacin,
diferenciacin y proliferacin de macrfagos, neutrfilos y linfocitos Th1 (Suerbaum &
Michetti, 2002; Rad et al., 2004). Variantes allicas a nivel de regiones promotoras en
citocinas han sido relacionadas con susceptibilidad y severidad de varias enfermedades
infecciosas (Hurme et al., 1998; Koch et al., 2002). La variante -56 C/T de la regin
promotora de IFNGR1 afecta al sitio de iniciacin transcripcional, relacionndose al
alelo T con una mayor expresin del gen IFNGR1 en comparacin con el alelo G
(Merlin et al., 1997; Rosenzweig et al., 2004; Canedo et al., 2008). Los resultados
obtenidos para IFNGR1 -56 C/T demuestran una mayor frecuencia del genotipo TT en
individuos infectados que en individuos sanos (45% y 29%, respectivamente) dando
diferencias significativas al momento de confrontar los datos entre grupos. Helicobacter
pylori inicia una respuesta inmune mediada por linfocitos Th1 en donde IFN- se
produce para un crecimiento celular apropiado (Ernst & Gold, 2000).
Por otro lado, la infeccin inicia una respuesta mediada por neutrfilos que
induce fagocitosis, activa la capacidad microbicida y ayuda en la infiltracin de
neutrfilos en el rea afectada. La activacin de neutrfilos y macrfagos durante la
respuesta inmune resulta en la produccin de molculas altamente reactivas que daan a
la clula debido a la peroxidacin lipdica, as como tambin a la oxidacin de protenas
y ADN (Bodger & Crabtree, 1998; Rad et al., 2002). Se ha propuesto que el dao a
nivel de tejido es una consecuencia de esta accin ya que la extensin de la lesin de la
mucosa se relaciona con el grado de infiltracin de neutrfilos (Pearl-Yafe et al., 2007).

INVESTIGACIONES MOLECULARES EN EL ECUADOR: INMUNOLOGA

194

El riesgo de infeccin obtenido para los individuos homocigotos TT (OR = 2,9) puede
relacionarse con la alta expresin de esta citocina: teniendo en cuenta que un alto grado
de infiltracin neutroflica y aislamiento de macrfagos son estimulados por una mayor
cantidad de esta molcula con el fin de evitar infeccin, el dao celular causado por este
proceso puede afectar la eficacia del sistema inmune para erradicar la invasin
bacteriana, y una respuesta mediada por esta citosina, y relacionada con el genotipo TT,
puede no ser eficiente para evitar la colonizacin. El alelo T y la sobre-expresin de este
receptor no solo han sido relacionados con la infeccin de Helicobacter pylori (Thye et
al., 2003), su presencia tambin se asocia con infeccin a Plasmodium falciparum
(Jliger et al., 2003), y con proteccin a la malaria (Koch et al., 2002).
La continua interaccin de la bacteria con la mucosa gstrica promueve el
desarrollo de condiciones adversas que pueden terminar en cncer (Takeuchi et al.,
1999; Kawahara et al., 2001; Gay & Gangloff, 2007; Moura et al., 2008). La alta
frecuencia del alelo T en individuos infectados indica que el IFN- promueve una sobreexpresin de los linfocitos Th1 y neutrfilos en las reas en donde la bacteria se
encuentra, y por lo tanto se induce al dao celular (El-Omar et al., 2003; Rad et al.,
2004). Partiendo de esta hiptesis, se aplic una prueba de riesgo para determinar si los
portadores del alelo T tienen riesgo a desarrollar patologas gstricas debido al dao
celular causado por la alta expresin de IFN-. A pesar de que en el momento de
subdividir, por diagnstico histopatolgico, se obtuvieron grupos pequeos, los
individuos con el genotipo TT mostraron un riesgo de 8,3 veces para desarrollar gastritis
crnica atrfica (OR = 8,3). Se ha demostrado que este SNP se asocia con un
incremento en el riesgo a desarrollar carcinoma gstrico (Canedo et al., 2008), por lo
que la presencia del polimorfismo -56C/T sugiere que el dao inducido como
consecuencia del alelo T y la presencia de Helicobacter pylori se relaciona con etapas
previas del evento de carcinognesis en los individuos ecuatorianos estudiados.
En conclusin, los polimorfismos genticos analizados para los receptores que
reconocen PMAPs bacterianos no fueron significativos en este estudio, por lo que H.
pylori es una bacteria reconocida en forma adecuada y su presencia en el hospedero no
se asocia con estas variantes. El polimorfismo proinflamatorio IFNGR1 -56C/T se
asoci con susceptibilidad a la infeccin de H. pylori, ya que se promueve dao celular
y se reduce la eficiencia de erradicacin del sistema inmune.
Para mayor informacin, la investigacin denominada Asociacin de variantes
genticas en receptores de membrana relacionados con respuesta inmunitaria por
Helicobacter pylori en individuos ecuatorianos se public en la Revista Metro Ciencia
en el ao 2013 (Cabrera et al., 2013).

2.VIRUSDELAINMUNODEFICIENCIAHUMANA
El virus de la inmunodeficiencia humana (VIH) ataca al sistema inmunitario y
debilita los sistemas de vigilancia y defensa contra las infecciones y algunos tipos de
cncer. A medida que el virus altera la funcin y destruye a las clulas inmunitarias, la
persona infectada se torna gradualmente inmunodeficiente. La funcin inmunitaria se
suele medir mediante el recuento de clulas CD4. La inmunodeficiencia entraa una
mayor sensibilidad a diversas infecciones y enfermedades que las personas, con un
sistema inmunitario saludable, pueden combatir. La fase ms avanzada de la infeccin

INVESTIGACIONES MOLECULARES EN EL ECUADOR: INMUNOLOGA

195

por el VIH se conoce como sndrome de inmunodeficiencia adquirida (SIDA) y puede


tardar entre 2 y 15 aos en manifestarse, dependiendo del sujeto. El SIDA se define por
la aparicin de ciertos tipos de cncer, infecciones u otras manifestaciones clnicas
graves (OMS, 2011).
2.1.GenesCCR5,CCR2yCXCL12
El VIH requiere un coreceptor para ingresar a las clulas blanco en adicin a las
CD4 (Levy, 1996). La C-C quimiocina receptora de tipo 5 (CCR5) (Tabla XI.10)
(Figura X.5) y la C-X-C quimiocina receptora de tipo 4 (CXCR4) han sido identificadas
como los mejores coreceptores del macrfago-trpico y la lnea celular T-trpico para
las cadenas de VIH-1, respectivamente (Broder & Collman, 1996). El descubrimiento
de la delecin de 32 pb en el open reading frame (ORF) del gen CCR5 (CCR532) y su
relacin con resistencia a la infeccin y retraso en el comienzo del SIDA, han generado
una intensiva bsqueda de variantes allicas adicionales en el sistema de quimiocinas
receptoras (Dean et al., 1996; Samson et al., 1996). Sin embargo, no se ha demostrado
la presencia de otra variante que afecte la transmisin del VIH, y solo unas pocas
variantes han sido asociadas con un mejor pronstico en los pacientes infectados con
VIH y diagnosticados con SIDA; entre ellas estn la transicin de G a A en el ORF del
gen CCR2 (CCR2-V64I) y la transicin G a A en la regin no codificante 3 (UTR) del
gen CXCL12 (Smith et al., 1997; Mummidi et al., 1998; Berger et al., 1999;
Magierowska et al., 1999).
Tabla XI.10. Caractersticas del gen CCR5
Caractersticas
Smbolo oficial
Nombre
Otros alias
Cromosoma
Localizacin
# Acceso NCBI
Gen ID
Tamao secuencia
Tamao protena
Localizacin subcelular

Informacin
CCR5
Quimiocina
receptora 5 (C-C)
CD195
3
3p21
NC_000003,11
1234
6065 bases
352 aa; 40524 Da
Membrana celular

Estructura proteica

(Bradley et al., 2005; Schnur et al., 2011)

En la siguiente figura observamos la presencia del gen CCR5 en la regin 3p21


del cromosoma 3 humano.

FIGURA XI.5. CROMOSOMA 3 HUMANO. Ubicacin del gen CCR5 (GeneCards,


2014).
La variante CCR532 est envuelta en la prdida de 3 de los 5 dominios
transmembranales del receptor CCR5 (McNicholl et al., 1997); adems, este alelo
confiere resistencia a la transmisin de las cadenas de VIH R5 en individuos

INVESTIGACIONES MOLECULARES EN EL ECUADOR: INMUNOLOGA

196

homocigotos y ejerce un retraso de 2 a 4 aos en el comienzo del SIDA en individuos


que acarrean el alelo, el cual demuestra un efecto dominante (Smith et al., 1997;
Mummidi et al., 1998). Se ha demostrado que los individuos que presentan el
polimorfismo SDF1 801 G-A ejercen un efecto de proteccin sobre la enfermedad
(Magierowska et al., 1999; Brambilla et al., 2000) (Tabla XI.11).
Tabla XI.11. Caractersticas del gen CCR2
Caractersticas
Smbolo oficial
Nombre
Otros alias
Cromosoma
Localizacin
# Acceso NCBI
Gen ID
Tamao secuencia
Tamao protena
Localizacin subcelular

Informacin
CCR2
Quimiocina
receptora 2 (C-C)
CD192
3
3p21
NC_000003,11
729230
7195 bases
374 aa; 41915 Da
Membrana celular

Estructura proteica

(Shi et al., 2002)

En la siguiente figura observamos la presencia del gen CCR2 en la regin 3p21


del cromosoma 3 humano.

FIGURA XI.6. CROMOSOMA 3 HUMANO. Ubicacin del gen CCR2 (GeneCards,


2014).

La frecuencia de estas variantes, especialmente CCR532, ha sido estudiada en


diferentes poblaciones (Martinson et al., 1997; Magierowska et al., 1998). Existe una
limitada informacin en la frecuencia de estos alelos en poblaciones de Amrica del
Sur, es por ello que nuestro grupo de investigacin realiz un estudio de las variantes
allicas CCR532, CCR2-64I y CXCL12 (Tabla XI.12) (Figura XI.7) en individuos
ecuatorianos sanos e infectados con VIH, con el objetivo de caracterizar a la poblacin
y determinar sus frecuencias allicas.
Tabla XI.12. Caractersticas del gen CXCL12
Caractersticas
Smbolo oficial
Nombre
Otros alias
Cromosoma
Localizacin
# Acceso NCBI
Gen ID
Tamao secuencia
Tamao protena
Localizacin subcelular

Informacin
CXCL12
Quimiocina ligando
12 (C-X-C)
SDF1
10
10q11
NC_0000,10
6387
88904
93 aa; 10666 Da
Secretado

Estructura proteica

(Murphy et al., 2009)

INVESTIGACIONES MOLECULARES EN EL ECUADOR: INMUNOLOGA

197

En la siguiente figura observamos la presencia del gen CXCL12 en la posicin


10q11.

FIGURA XI.7. CROMOSOMA 10 HUMANO. Ubicacin del gen CXCL12 (GeneCards,


2014).

Para la variante CCR532 se analizaron 295 individuos afectos y para las


variantes CCR2-64I y CXCL12 se analizaron 222 individuos sanos. Adems, se
estudiaron las variantes genticas a 50 individuos mestizos infectados con VIH. El
promedio de edad de las personas infectadas fue de 35 aos. El tiempo medio de
infeccin con VIH fue de 36 meses y se lo calcul mediante el conteo de clulas CD4.
2.2.Resultadosydiscusin

Se encontr una baja frecuencia (0,005) del alelo CCR532 en nuestra


poblacin, al ser comparada con frecuencias de poblacin similar como Colombia
(0,038 y 0,027) (Rugeles et al., 2001); pero concuerda con frecuencias en poblaciones
como Venezuela (0,000), grupos indgenas de Brasil (0,000), poblacin nativa del
centro de Asia (0,005) y Sudfrica (0,001) (Martinson et al., 1997; Leboute et al., 1999).
Se encontr una frecuencia relativamente alta del alelo CCR2-64I (0,166) (Tabla
XI.13). Este alelo ha sido reportado con alta frecuencia en poblacin de frica y baja
frecuencia en poblacin de Europa (Smith et al., 1997; Mummidi et al., 1998). Adems,
estudios en otras poblaciones han demostrado que las frecuencias allicas para CCR264I varan ampliamente en diferentes poblaciones alrededor del mundo (0,000-0,570),
por lo que el alelo CCR2-64I no puede ser asociado con un grupo tnico especfico
(Smith et al., 1997).
Tabla XI.13. Frecuencias de CCR532, CCR2-64I y SDF1-3A
Polimorfismos
CCR532
CCR2-264I
SDF1-3A

Grupos
Sanos
VIH
Sanos
VIH
Sanos
VIH

+/+
0,99
1,00
0,76
0,40
0,18
0,12

Frecuencias genotpicas
+/-/0,01
0,00
0,00
0,00
0,18
0,06
0,56
0,04
0,69
0,13
0,68
0,20

Frecuencias allicas
0,005
0,166
0,48

Para la variante SDF1-3A se encontr una frecuencia de 0,480. Esta frecuencia


es inusualmente alta y es comparable a las frecuencias reportadas por varias poblaciones
en Asia (0,43), Australia (0,54) y en hispanos que viven en Estados Unidos (0,4)
(Berger et al., 1999). As como CCR2-64I, las frecuencias allicas para el polimorfismo
SDF1 801 G-A varan ampliamente y no han sido asociadas con una poblacin o grupo
tnico especfico.

INVESTIGACIONES MOLECULARES EN EL ECUADOR: INMUNOLOGA

198

A pesar que el nmero de individuos infectados analizados es reducido (50), se


encontr una tendencia en la influencia de estos alelos con la progresin de la
enfermedad, a travs de un perodo de 40 meses. Estudios previos han demostrado que
el alelo CCR2-64I ejerce su efecto protector en todos los individuos ecuatorianos
mestizos que llevan esta mutacin (Paz-y-Mio, 1998).
Al analizar los efectos del alelo SDF1-3A en los individuos en estudio con VIH,
no se confirm una relacin entre los efectos positivos o negativos de este alelo en
individuos 3A/3A. Estudios previos han demostrado que individuos homocigotos para
el alelo SDF1A demuestran una mejor prognosis para la enfermedad y una baja
progresin de SIDA. Nuestro estudio no confirma algn posible efecto generado por
este alelo, porque individuos homocigotos no demostraron diferencias significativas con
el resto del grupo.
En contraste con el conocido efecto protector del alelo CCR532 y el amplio
conocimiento acerca de sus principios biolgicos, contina siendo incierto el efecto de
los alelos CCR2-64I y SDF1-3A en la prognosis de la enfermedad. De cualquier forma,
la infeccin con VIH y la asociacin del SIDA son mecanismos complejos que
envuelven una gran cantidad de factores tanto del virus como del hospedero.

Para mayor informacin, la investigacin denominada CCR532, CCR2-64I y


SDF1-3A Polymorphisms Related to Resistance to HIV-1 Infection and Disease in the
Ecuadorian Population, se public en la revista cientfica Human Biology en el ao
2005 (Paz-y-Mio et al., 2005a).

3.SISTEMADEANTGENOSLEUCOSITARIOSHUMANOS

Las molculas del complejo mayor de histocompatibilidad, tambin llamadas


antgenos leucocitarios humanos (HLA), son el producto de un conjunto de genes que
juegan un papel fundamental en la discriminacin entre lo propio y lo extrao. Se
localiza en el locus 6q21 en humanos y gracias a la aplicacin de herramientas en
biologa molecular se ha establecido que este complejo posee alrededor de 200 genes,
4556 alelos y es considerada la familia de genes ms polimrfica en la especie humana
(Figura XI.8) (Yamamoto & Kazuo, 2000).

FIGURA XI.8. CROMOSOMA 6 HUMANO. Ubicacin del gen HLA (GeneCards,


2014).

Existen dos tipos gnicos en este complejo denominados clase I y II. Hasta la
dcada de los noventa este tipo de sistema tuvo gran auge en la antropologa forense, ya
que eran usados como marcadores en las pruebas de filiacin. Hoy en da ha aumentado
el inters en realizar la descripcin de este complejo gnico, el HLA de un individuo, ya
que tiene gran importancia en la prctica de trasplante de rganos (Maldonado, 2007).
Las frecuencias poblacionales de los genes y antgenos del HLA en humanos, constituye
la referencia necesaria para los estudios de asociacin HLA-enfermedad, por lo que es

INVESTIGACIONES MOLECULARES EN EL ECUADOR: INMUNOLOGA

199

importante la determinacin de estos marcadores genticos. Con estas frecuencias


estimadas para una poblacin particular, dicha informacin resulta til en estudios
antropolgicos que permiten inferir sobre del origen de las poblaciones (Neefjes et al.,
2011).
El amplio desarrollo en la caracterizacin de marcadores moleculares especficos
del cromosoma Y y del ADN mitocondrial ha permitido reconocer linajes de origen
geogrfico o tnico en la poblacin (Bailliet et al., 1994; Dipierri et al., 1998; AlvesSilva et al., 2000), mostrando, en los anlisis de herencia uniparental en comunidades
indgenas sudamericanas, que cerca del 90% de los amerindios actuales derivan de un
nico linaje paterno fundador que coloniz Amrica desde Asia a travs del estrecho de
Bering hace unos 22000 aos (Bianchi & Bailliet, 1997). Siendo estos resultados
similares a otros grupos de investigacin (Santos et al., 1999). Estas teoras intentan
explicar el poblamiento de Amrica, ampliamente entendida (Amrica del Norte,
Amrica Central y Amrica del Sur).
Por otro lado, en lo que respecta a la herencia exclusivamente materna se
determin la existencia de 7 a 13 linajes mitocondriales especficos de poblaciones
indgenas americanas (Bianchi & Bailliet, 1997; Santos et al., 1999). Mientras que el
estudio en diferentes poblaciones europeas, africanas y asiticas evidenci un nmero
igual o mayor de linajes paternos o maternos (Ballinger et al., 1992; Torroni et al.,
1996).
El uso de la PCR para la caracterizacin del ADN ha proporcionado una
poderosa herramienta de varios marcadores genticos como el HLA. Los genes DQ1,
LDLR, GYPA, HBGG, D7S8 y D1S80 han sido extensamente estudiados en varias
poblaciones iberoamericanas (Morales et al., 2004). En lo que a esto respecta, los datos
de HLA pueden ser ms informativos que los del cromosoma Y o del ADN
mitocondrial (Alves-Silva et al., 2000), ya que permite el anlisis de ambos linajes.
Tanto las frecuencias como las genealogas pueden ser estudiadas para comparar
poblaciones. Algunos autores han comparado las frecuencias allicas de HLA de
diversos grupos tnicos en todo el mundo. Estudios realizados sobre HLA en los
primeros pobladores de Amrica, muestran que los alelos DRB1 de amerindios y
sudamericanos son casi especficos. Los alelos DRB1 *04:11 y DRB1 *04:17 se han
encontrado solamente en las poblaciones estudiadas de Amrica del Sur. Por su parte,
las poblaciones norteamericanas comparten alelos DRB1 ms con poblaciones de Asia,
concordando con la existencia de flujo gnico entre amerindios y personas de Siberia y
de las Islas del Pacfico. En nuestro continente se han genotipificado diversos grupos
tnicos con algunos marcadores moleculares, mostrando los ancestros compartidos y el
pasado migratorio relevante del origen cultural y la diversidad biolgica de los nativos
americanos (Paz-y-Mio, 2009). Genetistas de Per, Brasil, Bolivia y Ecuador han
intercambiado datos de trabajos propios que permitieron entender el origen de sus
pueblos. Tambin se han realizado genotipificado de HLA en poblacin argentina,
chilena, peruana, colombiana, venezolana y brasilea, mostrando los diferentes
haplotipos de HLA que aparecen en estos pases (Paz-y-Mio, 2009).
En Ecuador, diversos estudios han arrojado datos muy interesantes sobre
etnicidad y mestizaje entre kichwas, negros y mestizos, permitiendo entender ms sobre
el origen de nuestra poblacin (Paz-y-Mio, 2009); trabajos sobre enfermedades
autoinmunes que afectan a nuestra poblacin se han realizado mediante la

INVESTIGACIONES MOLECULARES EN EL ECUADOR: INMUNOLOGA

200

caracterizacin del sistema HLA, identificando que el HLA DR4 est presente en el
76,7% de los individuos afectos y el 21% en los individuos control, confirmando la
asociacin entre el HLA DR4 y la artritis reumatoidea (Aguirre et al., 2011). Otro
estudio compar el complejo HLA en poblaciones afroecuatorianas y cayapas, los
cuales se encontraron infectados por Onchocerca volvulus, mostrando una fuerte
evidencia relacionada con el papel protector de DQA1 *0401 contra la oncocercosis.
Los alelos HLA DQA1 *0102 y *0103 parecen representar factores de riesgo en los
afroecuatorianos, mientras que HLA DQA1 *0301 es slo un alelo de susceptibilidad
sugerente en cayapas (De Angelis et al., 2012).
En nuestro pas existen diversas poblaciones indgenas representando el 25% del
total poblacional del Ecuador (INEC, 2013). En la provincia de Chimborazo existe el
mayor porcentaje de poblacin indgena del pas con el 17,1% de habitantes
autoidentificados como indgenas. Uno de sus pueblos tnicos es el kichwa-puruh,
grupo que tiene una poblacin aproximada de 400000 habitantes, que se encuentran
distribuidos en la Sierra central. La organizacin poltica est dispuesta en grupos
familiares unidos por comunas; sus habitantes estn agrupados en alrederor de 23
comunidades (CODENPE, 2013). Este grupo indgena es posterior al ao 1200 de la era
cristiana; sus deidades tutelares eran los volcanes Chimborazo y Tungurahua y, segn
sus creencias, la unin de ambos volcanes permiti la formacin del pueblo puruh.
Desde sus orgenes fueron agricultores que vivieron en pequeos poblados cultivando
las laderas aterrazadas de las montaas y de los valles interandinos; su alimentacin se
basa principalmente en quinua y maz. Entre su produccin agrcola constaba la coca,
algodn y aj (CODENPE, 2013). Actualmente, conservan sus vestidos como el poncho
rojo de lana con rayas y sombrero; las mujeres el anaco de pao polister o casimir
sujetado con una faja o cumbi, bayeta o rebuso sujetado al pecho con collares y con
pulseras que en las fiestas cambian por colores ms llamativos.
La caracterizacin y la distribucin de los genes HLA en la poblacin puruh
son totalmente desconocidas, por lo que esta caracterizacin gentica constituye el
primer acercamiento, en este campo, con esta comunidad ecuatoriana.
3.1.Resultadosydiscusin
La tipificacin del HLA de clase I en la poblacin puruh mostr la presencia de
8 alelos en HLA A y 17 alelos HLA B. En este grupo la frecuencia ms alta fue
registrada para HLA A *02 (39,68%), A *24 (30,95%). Para el locus B se observ la
mayor frecuencia de los alelos B *35 (44,44%), B *40 (8,73%). Para los alelos de clase
II, se demostr la presencia de 14 alelos HLA DR y 9 alelos DQ. En este grupo, la
frecuencia ms alta se registr para DR1 *04 (19,95%), 1 *08 (15,08%), 1 *14
(15,08%). Para el locus DQ se observ 1 *03 (30,95%), 1 *04 (19,84%).
Con respecto a las frecuencias genotpicas con mayor porcentaje observados en
la poblacin: A *02, *04 (34,9%); B *35, 35 (14,3%); DR 1*08, 1*11 (14,4%); y DQ
1*04, 1*06 (17,5%).
Como discusin, en este estudio se analizaron las frecuencias allicas del MHC
de clase l y II en poblacin tnica puruh de Ecuador. Se trabaj con un universo de 63
individuos autoidentificados como nativos puruh de la provincia de Chimborazo,
pertenecientes a las comunidades de: Gatazo Chico 18 (26%), Atapo 16 (23,3%) y

INVESTIGACIONES MOLECULARES EN EL ECUADOR: INMUNOLOGA

201

Columbe 35 (50,7%). La edad promedio en el grupo de estudio fue de 40 aos, con un


nmero mayor de mujeres que de hombres (48) 65% y (24) 35%, respectivamente.
Tabla XI.14. Frecuencias allicas de HLA
Alelos

Frecuencia
Nmero

Porcentaje (%)

Locus HLA-A
*01
*02
*03
*04
*24
*29
*48
*68

13
50
8
2
39
1
6
7

0,10
0,39
0,06
0,02
0,31
0,01
0,05
0,06

Locus HLA-B
*04
*07
*15
*18
*25
*35
*38
*39
*40
*41
*46
*49
*52
*53
*54
*57
*58

4
2
7
1
3
56
1
5
11
5
5
1
10
2
3
4
6

0,03
0,02
0,06
0,01
0,02
0,44
0,01
0,04
0,09
0,04
0,04
0,01
0,08
0,02
0,02
0,03
0,05

Locus HLA-DR
1*01
1*03
1*04
1*07
1*08
1*09
1*10
1*11
1*13
1*14
3*01
3*02
4*01
5*01

12
5
24
6
19
3
1
9
9
19
2
2
13
2

0,09
0,04
0,19
0,05
0,15
0,02
0,01
0,07
0,07
0,15
0,02
0,02
0,10
0,02

Al analizar los resultados obtenidos y compararlos con frecuencias allicas


reportados en poblaciones tnicas de Amrica Latina, encontramos que en Colombia,
donde se analizaron las frecuencias del complejo HLA clase l en poblacin motiln bari,
se obtuvo una alta frecuencia de los alelos A *02 (47,14%), A *24 (47,14%) y B *65
(40%), B *8 (32,86%) (Oassa et a., 2009), en el mismo pas se report para poblacin

INVESTIGACIONES MOLECULARES EN EL ECUADOR: INMUNOLOGA

202

mestiza en trasplante A *02, A *24, B *35 (Oassa et al., 2009); todos estos alelos se
reportan como frecuentes en Amrica Latina. Dentro del complejo HLA de clase II en
poblacin peruana, se encontr que los alelos ms frecuentes fueron DRB1 *11 y DRB1
*13 e igualmente en poblacin brasilea se reportaron A *02, A *24, B *35 y DRB1
*04 (Golberg, 1999). En poblaciones bolivianas, en el anlisis de frecuencias allicas de
HLA II se observ que el loci DR y DQ ms frecuentes son: DRB1 *04 (24,2%), DRB1
*08 (18,9%), el DQB1 *301 (16,8%), DQB1 *302 (57,9%), DRB4* (57,9%) y DRB3*
(35,0%). La poblacin cubana presenta los alelos de DQB1 *301 y DQB1 *02
(Martnez, 1998). Siguiendo hacia Amrica del Norte (Mxico), los alelos ms
frecuentes fueron A *02, A *24, B *35 y DRB1 *04.

Captulo XII
Investigaciones moleculares en el Ecuador:
Genotoxicologa
La genotoxicidad es un trmino colectivo que se refiere a cualquier proceso que
afecta la integridad estructural del ADN (Bohne & Cathomen, 2008). Este
multidisciplinario campo de investigacin tiene como objetivo determinar los
compuestos capaces de causar dao en el ADN, en espera de entender las consecuencias
biolgicas de los agentes genotxicos y su involucramiento en la alteracin de los
mecanismos moleculares del material gentico. Estas consecuencias pueden
eventualmente desencadenar procesos carcinognicos (Westphalen et al., 2008; PazMio et al., 2012b). En el siglo pasado, la globalizacin y la industrializacin del
hemisferio occidental dieron paso a la produccin de altos volmenes de diferentes
qumicos y preparaciones complejas que se encuentran contaminando el ambiente hasta
la actualidad (Henkler & Luch, 2011). Actividades como la extraccin del petrleo o las
aspersiones con pesticidas como el glifosato han sido dos de los problemas ambientales
ms controversiales en el Ecuador, cuyas consecuencias continan siendo estudiadas
(Paz-y-Mio et al., 2007; 2008a; Paz-y-Mio & Lpez-Corts, 2011). La agricultura en
el Ecuador es la segunda actividad productiva ms importante que contribuye en el
crecimiento econmico de la nacin. A pesar de esto, existen fallas en las regulaciones
del uso de pesticidas y seguridad ocupacional de los trabajadores, lo cual repercute en la
contaminacin ambiental y en los diferentes problemas de salud (Paz-y-Mio et al.,
2002b). Adicionalmente, varios estudios se han enfocado en investigar los efectos
causados en el ADN de individuos expuestos a radiacin ionizante en los lugares de
trabajo como los hospitales (Garaj-Vrhovac et al., 2004; Muoz et al., 2008; Stoia et al.,
2009).

1.ASPERSIONESAREASCONGLIFOSATO
El glifosato es un herbicida organofosforado, no selectivo y de amplio espectro,
efectivo para controlar especies de hierbas anuales, bienales y perennes (Duke &
Powles, 2008). Es uno de los pesticidas ms ampliamente utilizados a nivel mundial con
20000 toneladas en Europa y 51000 en Estados Unidos (Kiely et al., 2004). La actividad
del glifosato se debe principalmente a la inhibicin de la 5-enolpiruvilshikimato-3fosfato sintetasa, resultando en el retraso de la va shikimato, la cual est envuelta en la
sntesis de amonocidos aromticos en plantas y microorganismos (USDA, 2003). Este
pesticida se encuentra comnmente formulado con surfactantes que decrecen la tensin
superficial de la solucin e incrementa la penetrancia en los tejidos (OMS, 1994). El
Roundup es una solucin acuosa de sal isopropilamina de glifosato con surfactantes
como polioxietileno amina (POEA) y adyuvantes como Cosmoflux 411F (MREE, 2002;
Tsui & Chu, 2003). El glifosato puede interferir con algunas funciones enzimticas en
animales, pero los sntomas de envenenamiento dependen de la dosis y tiempo de
exposicin (Paz-y-Mio et al., 2012a).
En humanos, se ha demostrado que el Roundup es txico para la placenta,
clulas embrionarias y para la biosntesis de esteroides sexuales (Benachour & Sralini,
2009). Este pesticida mezclado con adyuvantes es citotxico mediante la alteracin de

INVESTIGACIONES MOLECULARES EN EL ECUADOR: GENOTOXICOLOGA

206

succinato deshidrogenasa y es txico para las clulas de la sangre perifrica humana


(Martnez et al., 2007). Son 4 los estudios caso-control que asocian al glifosato con el
riesgo de adquirir linfoma no-Hodgkin (McDuffie et al., 2001; Eriksson et al., 2008). En
anfibios, los renacuajos Rana pipiens demostraron decrecimiento en la longitud cabezacola he incremento en el tiempo de metamorfosis, dao en la cola y anormalidad
gonadal. La toxicidad del pesticida es un factor que ha contribuido en el decrecimiento
mundial de la poblacin de anfibios (Dinehart et al., 2009). En el desarrollo de huevos
de erizos de mar, el glifosato previene la transcripcin de la enzima involucrada en la
eclosin y genera dao en el punto de chequeo CDK1/ciclina B del ADN del primer
ciclo celular envuelto en la muerte celular por apoptosis (Marc et al., 2002; Bell et al.,
2007; Benachour & Sralini, 2009). En conejos, el tratamiento con glifosato genera
prdida del peso corporal y osmolalidad del esperma (Yousef et al., 1995). En las
mitocondrias aisladas del hgado de ratones, el Roundup deprime los complejos
mitocondriales II y III, induciendo la formacin de ductos de ADN en el hgado y
riones (Peixoto et al., 2005).
Desde el ao 2001, la frontera norte del Ecuador ha estado sujeta a aspersiones
areas con Roundup Ultra por parte del Gobierno de Colombia; es por ello que nuestro
grupo de investigacin realiz varias investigaciones para determinar el impacto del
glifosato en las reas de salud, gentica y ambiente (Paz-y-Mio et al., 2007; Paz-yMio et al., 2011a; Paz-y-Mio & Lpez-Corts, 2011).
En el ao 2006 se realiz un estudio en 45 individuos, 24 expuestos al glifosato
y 21 no expuestos, usando la tcnica ensayo cometa. Esta tcnica es usada para evaluar
el nivel de fragmentacin del ADN en individuos expuestos a compuestos qumicos
como el Roundup. A las 200 clulas observadas por cada individuo se las clasific en
seis categoras de la A a la F, siendo A las clulas normales con menor longitud de cola
y por ende menor fragmentacin del ADN, y siendo F las clulas con mayor longitud de
cola y por ende mayor fragmentacin del ADN (Figura XII.1).

FIGURA XII.1. ENSAYO COMETA. Clasificacin celular segn el grado de


fragmentacin del ADN (Modificado de Paz-y-Mio et al., 2008a; IIB, 2014).

INVESTIGACIONES MOLECULARES EN EL ECUADOR: GENOTOXICOLOGA

207

En la siguiente tabla se detallan las longitudes de las colas celulares de los


individuos expuestos al paquete pesticida y de los individuos control.
Tabla XII.1. Migracin del ADN en individuos expuestos al glifosato
Expuestos al glifosato
Individuos
Migracin del ADN (m)
(Gnero, ao)
Media
Mediana
1 (F, 53)
39,5
32,5
2 (F, 37)
44,1
32,5
3 (F, 40)
56,6
52,5
4 (M, 27)
49,2
37,5
5 (F, 44)
34,6
30,0
6 (F, 50)
30,8
27,5
7 (F,38)
33,2
30,0
8 (F, 46)
35,2
30,0
9 (F, 55)
32,8
30,0
10 (F, 50)
34,2
30,0
11 (F, 22)
32,0
27,5
12 (F, 27)
33,7
30,0
13 (F, 28)
31,0
30,0
14 (F, 59)
36,4
32,5
15 (F, 55)
32,7
30,0
16 (F, 17)
31,3
37,5
17 (F, 34)
33,4
30,0
18 (F, 45)
33,0
30,0
19 (F, 28)
31,1
27,5
20 (F, 21)
33,2
30,0
21 (F, 34)
31,8
30,0
22 (F, 23)
39,3
37,5
23 (F, 34)
35,5
37,5
24 (F, 42)
27,6
27,5
Promedios
35,5
30

No expuestos al glifosato
Individuos
Migracin del ADN (m)
(Gnero, ao)
Media
Mediana
1 (F, 17)
26,2
25,0
2 (F, 40)
25,4
25,0
3 (F, 26)
25,7
25,0
4 (M, 14)
27,3
26,5
5 (M, 32)
25,9
25,0
6 (M, 21)
25,7
25,0
7 (M, 16)
25,8
25,0
8 (F, 47)
25,7
25,0
9 (F, 15)
25,2
25,0
10 (F, 36)
25,4
25,0
11 (F, 21)
26,3
25,0
12 (F, 43)
26,8
25,0
13 (F, 53)
26,1
25,0
14 (F, 35)
27,0
25,0
15 (F, 38)
26,4
25,0
16 (F, 22)
25,1
25,0
17 (F, 71)
25,0
25,0
18 (F, 39)
25,5
25,0
19 (F, 21)
25,9
25,0
20 (F, 50)
25,3
25,0
21 (F, 43)
26,4
25,0

Promedios

25,9

25

Como resultados encontramos que los individuos expuestos a las aspersiones


areas con glifosato presentaron mayores niveles de migracin del ADN a diferencia de
los individuos control. La migracin promedio del ADN en las clulas de los individuos
expuestos fue de 35,5 m y en los individuos control fue de 25,9 m. Estos resultados
demostraron que los pesticidas, al ser genotxicos, generan fragmentacin del ADN en
mayor intensidad en personas expuestas con respecto a personas no expuestas al paquete
herbicida con glifosato.
Para mayor informacin, esta investigacin titulada Evaluation of DNA Damage
in the Ecuadorian Population Exposed to Glyphosate, se public en la revista cientfica
Genetics and Molecular Biology el ao 2007 (Paz-y-Mio et al., 2007).
En nuestra segunda investigacin, realizada el perodo 2009-2011,
determinamos una lnea base en las reas de gentica, salud y ambiente, en varias
comunidades ecuatorianas expuestas a las aspersiones areas con glifosato. Las
comunidades de la provincia de Sucumbos fueron: Chone-2, Yanamarum, Playera
Oriental, Fuerzas Unidas, Puerto Escondido, Corazn Orense, Santa Marianita, San
Francisco, Las Salinas y 5 de Agosto.

INVESTIGACIONES MOLECULARES EN EL ECUADOR: GENOTOXICOLOGA

208

Se realizaron 144 entrevistas y 521 chequeos mdicos entre hombres (47,8%) y


mujeres (52,2%). El origen de la poblacin del rea estudiada corresponde al 53,4% de
la poblacin nacida en la regin de la Amazona; el 46,6% proviene de otras regiones
del Ecuador y el 16,1% son inmigrantes de Colombia, quienes han llegado hace 10
aos. Se obtuvieron 92 muestras de sangre perifrica de individuos expuestos a las
aspersiones areas con glifosato y 90 muestras de individuos sanos utilizados como
controles.
Con respecto al anlisis gentico, se estudiaron los polimorfismos GPX1
Pro198Leu, XRCC1 Arg399 Gln y GSTP1 Ile105Val. Las caractersticas del gen GPX1
se las detalla previamente en los estudios realizados en la enfermedad de Alzheimer.
1.1.GenXRCC1
El gen XRCC1 es uno de los ms de veinte genes que participan en las vas de
reparacin por escisin de bases; se ubica en el cromosoma 19 y codifica una protena
de andamiaje de 633 aminocidos y 69526 Da, que funciona en la reparacin de
rupturas del ADN, una de las lesiones ms comunes del material gentico (Tabla XII.2)
(Figura XII.2) (Caldecott et al., 1994; Paz-y-Mio & Lpez-Corts, 2011).
Tabla XII.2. Caractersticas del gen XRCC1
Caractersticas
Smbolo oficial
Nombre
Otros alias
Cromosoma
Localizacin
# Acceso NCBI
Gen ID
Tamao secuencia
Tamao protena
Localizacin subcelular

Informacin
XRCC1
Protena reparadora
ADN
RCC
19
19q13,2
NC_000019,9
7515
32267 pb
633 aa; 69526 Da
Ncleo

Estructura proteica

(Zhang et al., 1998; Cuneo et al., 2010)

El cncer humano puede desarrollarse por dao en el ADN causado por la


exposicin a agentes carcinognicos en el ambiente. Para salvaguardar la integridad del
genoma, los humanos han desarrollado un complejo sistema de reparacin del ADN.
Entre las funciones ejercidas por el ADN, la reparacin por escisin es el principal
mecanismo de defensa contra el dao que resulta del metabolismo celular, incluyendo
especies oxgeno reactivas, metilacin, deaminacin e hidroxilacin. Por lo tanto, la
reparacin por escisin de bases es un evento universal en las clulas y es relevante en
la prevencin de la mutagnesis. XRCC1 interacta con un complejo de protenas
reparadoras del ADN, incluyendo poli(ADP-ribosa) polimerasa, ADN ligasa 3 y ADN
polimerasa-h (Caldecott et al., 1994; Dianov et al., 1999; Thompson & West, 2000).

FIGURA XII.2. CROMOSOMA 19 HUMANO. Ubicacin del gen XRCC1 (GeneCards,


2014).

INVESTIGACIONES MOLECULARES EN EL ECUADOR: GENOTOXICOLOGA

209

Debido a que el polimorfismo Arg399Gln se encuentra localizado en el dominio


BRCT-1 del gen XRCC1, dentro de la regin poli(ADP-ribosa), ha sido ampliamente
investigado tanto en su funcin como en la asociacin con riesgo al cncer. Es por ello,
que resulta de gran importancia el estudio de frecuencias del polimorfismo Arg399Gln
del gen XRCC1 en la poblacin expuesta a las aspersiones areas con glifosato.
El polimorfismo Arg399Gln consiste en la sustitucin de la base nitrogenada G
por A en el codn 399, exn 10 del gen XRCC1, siendo a nivel aminoacdico el cambio
de arginina por glutamato. La presencia de esta variante ha sido asociada con la
reduccin de la capacidad del ADN de reparar mutaciones por la presencia de aductos
de ADN (Lunn et al., 1999; Matullo et al., 2003).
1.2.GenGSTP1
El gen glutatin S-transferasa pi 1 es miembro de la superfamilia citoslica GST.
Este gen se ubica en el cromosoma 11, en la regin 11q2, y se encuentra conformado
por una secuencia de ADN de 32.267 pb (Tabla XII.3) (Figura XII.3) (Cowell et al.,
1988).
Tabla XII.3. Caractersticas del gen GSTP1
Caractersticas
Smbolo oficial
Nombre
Otros alias
Cromosoma
Localizacin
# Acceso NCBI
Gen ID
Tamao secuencia
Tamao protena
Localizacin subcelular

Informacin
GSTP1
Glutatin Stransferasa pi 1
DFN7, GSTP
11
11q2
NC_000011,9
2950
32267 pb
210 aa; 23356 Da
Citoplasma, ncleo

Estructura proteica

(Rossjohn et al., 2000)

El gen GSTP1 codifica una enzima de 210 aminocidos, de fase dos, la cual
cataliza la conjugacin del tripptido glutatin con una amplia variedad de compuestos
electroflicos, incluyendo genotxicos, carcingenos y agentes quimioteraputicos (Lo
et al., 2008). Esta enzima detoxifica radicales libres, especialmente los sustratos del
tabaco e interacta con una variedad de xenobiticos electroflicos, incluyendo sustratos
que van desde toxinas ambientales, carcingenos hasta drogas usadas en tratamientos de
cncer (Ketterer 2001; Hayes et al., 2001; Zendehdel et al., 2009). GSTP1 tambin es
responsable de la detoxificacin de metabolitos reactivos acelerando el rango de
excrecin (Rybicki et al., 2006).
La enzima glutatin S-transferasa pi 1 no solo funciona como un metabolizador
de drogas de fase dos, tambin acta como un regulador de la apoptosis (Moyer et al.,
2008), regulador de la va quinasa MAPKs como resultado de la actividad enzimtica no
ligada (Wu et al., 2006), regulador de seales celulares a travs del enlace a protenas
como c-Jun NH2- terminal quinasa, ASK1 y TRAF2, regulando la seal downstream de
los genes (Wu et al., 2006). Cuando la actividad de GSTP1 decrece, las clulas se
tornan ms susceptibles a mutaciones como resultado del estrs oxidativo (Meiers et al.,
2007).

INVESTIGACIONES MOLECULARES EN EL ECUADOR: GENOTOXICOLOGA

210

FIGURA XII.3. CROMOSOMA 11 HUMANO. Ubicacin del gen GSTP1 (GeneCards,


2014).

Se ha reportado una mutacin transicin de A a G en el nucletido 313, en el


exn 5 del gen GSTP1. Esta mutacin del ADN resulta en la traduccin del aminocido
valina en vez de isoleucina, en el codn 105 del sitio activo de la enzima. Esta mutacin
se asocia con la reduccin de la actividad enzimtica alterando su termoestabilidad. La
presencia del alelo V ha sido relacionada con el incremento del riesgo de adquirir
cncer de vejiga, testculos y prstata (Zendehdel et al., 2009).
Con respecto al anlisis citogentico, para determinar la presencia de
alteraciones cromosmicas, se obtuvo el cariotipo de 849 metafases de los individuos
expuestos y no expuestos al glifosato. Mientras que la tcnica ensayo cometa se analiz
en un total de 1100 nucleoides, para determinar los niveles de fragmentacin del ADN.
Los parmetros tomados en cuenta fueron:

a) 100 nucleoides analizados por cada individuo.

b) Correcta clasificacin de acuerdo a la longitud cabeza-cola del cometa.

c) Determinacin del nmero total de nucleoides de acuerdo al nivel de dao.

d) Promedio de longitud de los nucleoides medidos en micrmetros.

1.3.Resultadosydiscusin
Se realiz un estudio descriptivo para determinar una lnea base en la salud de la
poblacin expuesta. Dos aos despus de las aspersiones areas con glifosato, la
desnutricin, de acuerdo a la edad por el peso (malnutricin seria y moderada) en nios
de escuela, fue del 3%, con un riesgo de malnutricin leve del 23,2%. En el 2006,
despus de seis aos de aspersiones areas, la malnutricin en nios escolares creci al
10,2%, y el riesgo de malnutricin leve fue del 36,3%. El 45,8% de las familias en
Sucumbos ha usado agrotxicos, el 11,8% ha usado glifosato y el 5,37% ha
manifestado tener intoxicacin por el uso de pesticidas. El 32,3% de las familias ha
informado presentar serias enfermedades durante las aspersiones areas, la mayora el
ao 2002 (22,4%). Adems, el 22,2% de la poblacin ha presentado un familiar
fallecido, ocurriendo el 27% de las muertes entre el 2003 y 2004. El 7,7% de los
encuestados ha tenido hijos con algn tipo de malformacin, nacido en el 2001. La
frecuencia de abortos antes de las aspersiones areas fue del 8,4%, pero esta frecuencia
creci despus de las aspersiones al 12,7%.
En la Tabla XII.4 se detallan las frecuencias allicas, frecuencias genotpicas y
anlisis de riesgo (OR) correspondiente a los polimorfismos estudiados. Con respecto al
polimorfismo Ile105Val, el valor obtenido del 2 fue 9,7 y el OR fue 2,6. Sobre la
variante Arg399Gln, el valor del 2 fue 3,6 y el OR fue 0,2. Y con relacin al
polimorfismo Pro198Leu, el valor del 2 fue 0,2 y el OR fue 1,1.

INVESTIGACIONES MOLECULARES EN EL ECUADOR: GENOTOXICOLOGA

211

Tabla XII.4. Frecuencias genotpicas y allicas de GPX1, XRCC1 y GSTP1


Afectos (%)
Polimorfismo GPX1 Pro198Leu
Frecuencias genotpicas
Pro/Pro
35
Pro/Leu
48
Leu/Leu
17
Frecuencias allicas
Pro
59
Leu
41
Polimorfismo XRCC1 Arg399Gln
Frecuencias genotpicas
Arg/Arg
07
Arg/Gln
79
Gln/Gln
14
Frecuencias allicas
Arg
46
Gln
54
Polimorfismo GSTP1 Ile105Val
Frecuencia genotpicas
Ile/Ile
32
Ile/Val
40
Val/Val
28
Frecuencias allicas
Ile
52
Val
48

Sanos (%)

Valor de P

38
60
02

0,77
< 0,05

68
32

01
01
98

0,4
< 0,001

02
98

54
36
10

0,07
< 0,001

72
28

OR (95% IC)

Referencia
0,9 (0,5-1,6)
8,5 (1,8-39,9)
-

Referencia
12,2 (0,7-218)
0,03 (0,003-0,2)
-

Referencia
1,9 (1-3,8)
4,9 (2-11,8)
-

Sobre la prueba de ensayo cometa se observ que el 33% de los individuos


estudiados presentaron cometas tipo C (dao medio), el 27% present cometas tipo D
(alto dao), mientras que el 1% present cometas tipo E (dao total). Siendo 19,6 m el
promedio de migracin del ADN.
En el anlisis de alteraciones cromosmicas se realiz el cariotipaje a un total de
849 metafases. Con respecto a las aberraciones estructurales, los individuos afectos
presentaron el 1,3% y los individuos control presentaron el 0,1% de gaps. En cuanto a
las aberraciones numricas, el 12% de los individuos afectos y el 1,2% de individuos
control presentaron hipodiploida (Tabla XII.5).
Tabla XII.5. Cariotipos y porcentaje de fragilidad cromosmica
Individuos
(n=92)
Porcentaje (%)
Cariotipo

62
0

Porcentaje de alteracin cromosmica encontrada


14
1
2
1
7
1
1

1 1,2
46, XX

1,4

1,5
n = 92

1,9

2,4

2,5
100%

1
2,8

Las aspersiones areas con glifosato han causado un conflicto socioeconmico y


poltico entre Ecuador y Colombia. Esta es la razn por la que el Comit Cientfico
Ecuatoriano, desde el 2001, ha venido realizando estudios acerca de los sistemas de
aspersin y su impacto en el ambiente, salud y estilo de vida en las comunidades
afectadas (Paz-y-Mio & Lpez-Corts, 2011).

INVESTIGACIONES MOLECULARES EN EL ECUADOR: GENOTOXICOLOGA

212

El anlisis de alteraciones cromosmicas, la evaluacin del dao en el ADN y el


clculo de las frecuencias polimrficas de los genes GPX1, GSTP1 y XRCC1 fueron
realizados en mujeres de diferentes edades, quienes presentaron mayor susceptibilidad a
las txinas hepticas debido a diversos procesos fisiolgicos. La glutatin peroxidasa es
una de las enzimas antioxidantes ms importantes en humanos cuya funcin es la
detoxificacin de perxidos de hidrgeno y es parte de las enzimas antioxidantes que
previenen el dao oxidativo del ADN (Moorhead et al., 1960). El polimorfismo
Pro198Leu est asociado con el riesgo en el desarrollo de cncer de pulmn y cncer de
mama (Paz-y-Mio et al., 2002c; Shaffer et al., 2005). Se observ mayor frecuencia en
el alelo leucina en expuestos (0,41), que en sanos (0,32). El 2 determina la existencia de
diferencia significativa relacionada a la presencia de la variante entre individuos
expuestos y no expuestos. El OR estableci que la gente con presencia de este
polimorfismo present 1,1 veces ms susceptibilidad a los problemas de detoxificacin
y desarrollo de algunas enfermedades. El gen GSTP1 codific protenas que actan en
el metabolismo de xenobiticos y juegan un rol como reguladores de apoptosis
(Maldonado et al., 2006). Se pudo observar mayor frecuencia del alelo valina en
expuestos (0,48) que en no expuestos (0,28). El OR estableci que individuos con el
polimorfismo Arg399Gln presentaron 2,6 veces ms susceptibilidad al dao celular
como resultado de la exposicin al estrs oxidativo. La protena codificada por el gen
XRCC1 est envuelta en el mantenimiento de la integridad estructural del ADN,
encarando el posible dao generado por factores ambientales (Paz-y-Mio & LpezCorts, 2011). El 2 determin que no hubo diferencia significativa relacionada a la
presencia del polimorfismo Arg399Gln entre casos y controles, y el OR determin
riesgo no significativo con el desarrollo de enfermedades.
Estos resultados corroboraron los obtenidos mediante el ensayo cometa en los
dos estudios realizados. Es por ello que es aconsejable realizar estudios prospectivos a
largo plazo con el objetivo de monitorear un posible desarrollo de enfermedades en la
poblacin ecuatoriana.
Los anlisis citogenticos han demostrado anormalidades numricas y
estructurales presentes en mayor porcentaje en afectos que en sanos. A pesar de ello, las
aberraciones fueron encontradas en porcentajes dentro de los rangos normales.
Socialmente, uno de los impactos ms importantes desarrollados por las
aspersiones areas fue el miedo. Es un sentimiento presente hasta la actualidad en el
7,7% de las personas encuestadas, manifestado con pesadillas y comportamiento
anormal. Las aspersiones areas han generado procesos de migracin, inseguridad,
destruccin de fuentes econmicas y alimenticias (Paz-y-Mio & Lpez-Corts, 2011).
El estudio psicolgico consisti en analizar dibujos realizados por nios, los cuales
reflejaron angustia, peligro y tendencias paranoicas, indicando que la poblacin necesita
proteccin y seguridad por parte de las respectivas autoridades.

Para mayor informacin, la investigacin denominada Baseline Determination in


Social, Health, and Genetic Areas in Communities Affected by Glyphosate Aerial
Spraying on the Northeastern Ecuadorian Border, se public en la revista cientfica
Reviews on Environmental Health (Paz-y-Mio et al., 2011a). De igual forma, se puede
tener acceso a mayores detalles de esta investigacin en el libro Glifosato: Gentica,
Salud y Ambiente (Paz-y-Mio & Lpez-Corts, 2011).

INVESTIGACIONES MOLECULARES EN EL ECUADOR: GENOTOXICOLOGA

213

2.OTROSPESTICIDAS

Adems del impacto causado en la salud y el ambiente por las aspersiones areas
con glifosato, tambin existe un impacto negativo cuando se trabaja diariamente con
pesticidas en florcolas (Tabla XII.6).
Tabla XII.6. Otros pesticidas utilizados en florcolas
Nombre
Pyrazophos
Bitertanol
Triadimefn
Benomil
Tridemorph
Captan
Carbendazim
Clorotalonil
Dodemorph
Flusilazole
Furalaxyl
Fosetyl
Iprodione
Mancozeb
Maneb
Metataxyl
Supirimate
Oxycarboxin
Propineb
Sulfur
Trilorine
Vinclozolin
Zineb
Cyromazine
PCNB
Trimitox
Aldicarb
Fenamiphos
Profenofos
Didorvos
Detalmetrina
Acefato
Carbofuran
Clofentizine
Dienochlor
Dimetoato
Ensosulfan
Malathion
Metorril
Monocropthos
Isazofos
Permetrina
Propargite
Tetradifon
Triociclam
Amabactin

LD50 (mg/Kg)
435
45000
602
410000
650
9000
410000
410000
4500
1110
940
5800
3500
3000
6750
670
4000
2000
8500
43000
46000
10000
15000
3300
1700
0,93
15
355
56
135
915
8
15200
3160
150
80
2100
17
14
60
500
2200
10000
310
5000

Clasificacin OMS
Moderadamente peligroso
No peligroso en bajas dosis
Ligeramente peligroso
No peligroso en bajas dosis
Moderadamente peligroso
No peligroso en bajas dosis
No peligroso en bajas dosis
No peligroso en bajas dosis
No peligroso en bajas dosis
Ligeramente peligroso
Ligeramente peligroso
No peligroso en bajas dosis
No peligroso en bajas dosis
No peligroso en bajas dosis
No peligroso en bajas dosis
Moderadamente peligroso
No peligroso en bajas dosis
Ligeramente peligroso
No peligroso en bajas dosis
No peligroso en bajas dosis
No peligroso en bajas dosis
No peligroso en bajas dosis
No peligroso en bajas dosis
No peligroso en bajas dosis
Ligeramente peligroso
Ligeramente peligroso
Extremadamente peligroso
Altamente peligroso
Moderadamente peligroso
Altamente peligroso
Moderadamente peligroso
Ligeramente peligroso
Altamente peligroso
No peligroso en bajas dosis
Ligeramente peligroso
Moderadamente peligroso
Moderadamente peligroso
Ligeramente peligroso
Altamente peligroso
Altamente peligroso
Altamente peligroso
Moderadamente peligroso
Ligeramente peligroso
No peligroso en bajas dosis
Moderadamente peligroso
No peligroso en bajas dosis

INVESTIGACIONES MOLECULARES EN EL ECUADOR: GENOTOXICOLOGA

214

Nuestro grupo de investigacin realiz un anlisis cromosmico y molecular a


45 personas (22 mujeres y 23 hombres) ocupacionalmente expuestas a compuestos
qumicos, quienes se desempeaban como floricultores en Cayambe. Este estudio casocontrol tambin cont con el anlisis de 21 personas (17 mujeres y 4 hombres) no
expuestas a pesticidas ni con antecedentes de fumar o ingerir alcohol (Paz-y-Mio et al.,
2004).
Las muestras de sangre perifrica de los individuos expuestos y no expuestos a
los pesticidas se evaluaron mediante diferentes procesos. Se midieron los niveles de
fragmentacin del ADN de 200 nucleoides por individuo a travs del ensayo cometa; se
determin la presencia de alteraciones cromosmicas mediante el cariotipo de los
individuos y se analiz la presencia de polimorfismos en el gen CYP1A1.
2.1.EnzimasCYP

Las enzimas CYP son una superfamilia de hematoprotenas esenciales para el


metabolismo oxidativo, peroxidativo y reductivo en compuestos como xenobiticos
(medicamentos), qumicos ambientales y sustratos endgenos como los esteroides,
cidos grasos y prostaglandinas (Szklarz et al., 2000; Takakubo et al. 1996, Hukkanen,
2002). Su nombre se debe a que en el espectrofotmetro dan un pico de absorcin ptica
nica de 450 nm, y cuando su naturaleza de hemoprotena fue reconocida le fue dado el
nombre de pigmento de unin monxido de carbono microsomal, Citocromo P450,
CYPP450 o CYP (Nelson et al., 2009; Szklarz et al., 2000).
La nomenclatura existente para todos los genes CYP y sus productos est basada
en el uso del smbolo CYP, al cual le sigue la familia, luego la subfamilia y al final el
gen, por ejemplo: CYP 1A1; CYP, familia 1, subfamilia A, gen 1 (Nebert & Dieter,
2000; Degtyarenko & Kulikova, 2001). Se ha estimado que los seres humanos tienen
por lo menos 53 diferentes genes de este tipo agrupados en dos clases I y II. Los de la
clase II se agrupan en familias del 1 al 17 (Hukkanen, 2002; Nelson, 2009).
La estructura de esta enzima resulta de vital importancia para entender su accin
y se han realizado varios esfuerzos para caracterizarla. Estos han revelado una
estructura de prisma triangular, que en los mamferos tiene una asociacin con la
membrana del retculo endoplasmtico liso que le permite su funcionamiento
(Degtyarenko & Kulikova, 2001).
El centro activo de la catlisis de esta enzima es la hierro-porfirina IX (grupo
hemo) y el residuo de tiolato (azufre) de la cistena, que ha sido conservado como el
quinto ligando. Las enzimas CYP catalizan la insercin de un tomo de oxgeno
molecular en el sustrato (hidroxilacin), mientras que el segundo tomo de oxgeno es
reducido en agua (Degtyarenko & Kulikova, 2001). Por este comportamiento molecular
la mayora de enzimas CYP activan compuestos transformndolos en carcingenos
(Werck-Reichhart & Feyereisen, 2000).
La familia CYP1 es una de las ms estudiadas porque su accin activa a los
agentes xenobiticos y carcingenos que requieren de esta activacin para llevar a las
clulas a malignizarse. Existen tres genes miembros de la familia y son: CYP 1A1, CYP
1A2 y CYP 1B1. Estos genes comparten las principales caractersticas de regulacin y
todos son controlados transcripcionalmente por la va AHR-ARNT (receptor aril

INVESTIGACIONES MOLECULARES EN EL ECUADOR: GENOTOXICOLOGA

215

hidrocarbono-translocador nuclear del receptor arilhidrocarbn). Su actividad, es decir


el incremento en la produccin de su enzima, est inducida por pesticidas e
hidrocarburos aromticos policclicos, produciendo intermediarios que pueden provocar
dao al ADN. Esta activacin o bien su capacidad de daar el ADN est relacionada con
polimorfismos de estos genes (Hukkaken, 2000; Paz-y-Mio et al., 2005b).
El mecanismo de accin de las enzimas CYP se explica en una serie de pasos:

a)

La enzima comienza atrapando al sustrato.

b)

Un electrn es transferido al tomo Fe3+, pasando este a su estado ferroso (Fe2+). Esta
transferencia es realizada por el NADH (fosfato dinucletido nicotidamina-adenina) o por el
Citocromo b.

c)

Esta forma ferrosa se usa a una molcula de O2.

d)

Se realiza una segunda reduccin agregndose un electrn y un protn.

e)

Este intermediario pierde una molcula de agua dejando un complejo (FeO)3+ que oxida el
sustrato.

2.2.GenCYP1A1
El gen CYP1A1 est localizado en el sitio cromosmico 15q22-q24. Usualmente
su nivel de expresin constitutiva es muy baja, pero es inducido por compuestos
qumicos (pesticidas) en varios tejidos que han sido estudiados, incluyendo la placenta,
pulmn, linfocitos y glndulas mamarias (Tabla XII.7) (Figura XII.4) (Omura, 1999).
Tabla XII.7. Caractersticas del gen CYP1A1
Caractersticas
Smbolo oficial
Nombre
Otros alias
Cromosoma
Localizacin
# Acceso NCBI
Gen ID
Tamao secuencia
Tamao protena
Localizacin subcelular

Informacin
CYP1A1
Citocromo P450
CYP1, P1-450
15
15q24,1
NC_000015,9
1543
6069 pb
512 aa; 58165 Da
Retculo
endoplasmtico

Estructura proteica

(Rowland et al., 2006; Walsh et al., 2013)

Se sabe que la enzima CYP1A1 media la conversin del humo del tabaco y del
triptfano en 3-metil indol, un compuesto altamente txico (Lanza & Yost, 2001). As
tambin, media la conversin de compuestos aromticos policclicos en benzo(a)pireno
en clulas de cultivo animal (Omura, 1999). Esta situacin podra crear una condicin
en la cual el oxgeno activado puede escapar del sitio activo de esta enzima y daar
otros constituyentes celulares. Estos oxidantes pueden estar involucrados en efectos
proliferativos y mutagnicos (Park et al., 1996), y segn Hukkanen: Debido a la
importancia del CYP1A1 en la activacin de pro-carcingenos se han unificado
esfuerzos para relacionar a los polimorfismos del gen CYP1A1 con la susceptibilidad
individual a cnceres inducidos qumicamente (Hukkanen, 2002).

INVESTIGACIONES MOLECULARES EN EL ECUADOR: GENOTOXICOLOGA

216

FIGURA XII.4. CROMOSOMA 15 HUMANO. Ubicacin del gen CYP1A1 (GeneCards,


2014).

Se han descrito 7 alelos del gen CYP1A1, de los cuales, los alelos MspI (m2) y
Ile462Val (val) han sido los ms estudiados y ms relacionados al cncer. Variaciones
en la frecuencia de presentacin de estos polimorfismos han sido reportadas y se las ha
correlacionado con una actividad cataltica alteada de la enzima, es decir, tienen una
aparente relacin con el origen tumoral (Quiones et al., 1999).
El alelo normal de MspI, llamado m1, se ubica en la regin flanqueante 3 y
posee una timina en el nucletido 3235, en la zona no codificante del gen. La variante
gentica consiste en el cambio de una timina por una citosina, y se lo representa como
T3235C. Este SNP crea un sitio de reconocimiento para la enzima de restriccin MspI.
El segundo alelo Ile462Val, localizado en el exn 7 del gen, posee una adenina en la
posicin 4889 formndose una valina en el codn 462, alterando la estructura de la
protena (Aktas et al., 2002).
2.3.Resultadosydiscusin
Con respecto al anlisis molecular, las frecuencias del polimorfismo MspI para
el genotipo m1m1 fue de 0,3, para m1m2 fue de 0,16 y para m2m2 fue de 0,53. Las
frecuencias del polimorfismo Ile462Val para el genotipo Ile/Ile fue 0,04, para Ile/Val
fue 0,91 y para Val/Val fue 0,04 (Tabla XII.8) (Paz-y-Mio et al., 2004).
Tabla XII.8. Frecuencias genotpicas del gen CYP1A1
Grupos
Control
Expuesto
Total

Muestras
21
45
66

Frecuencia genotpica
m1m1
0,04
0,2
0,3

MspI
m1m2
0,14
0,11
0,16

m2m2
0,80
0,68
0,53

Ile/Ile
0
0,04
0,04

Ile462Val
Ile/Val
0,95
0,91
0,91

Val/Val
0,05
0,04
0,04

Con respecto al anlisis citogentico, se observ que las personas expuestas a los
pesticidas presentaron 5,48% de metafases con dao cromosmico (incluido gaps) a
diferencia del 0,45% encontrado en personas no expuestas. De igual forma, sin tomar en
cuenta los gaps, se observ que los expuestos presentaron 3,8% de dao cromosmico y
0,45% las personas sanas. Concluyendo que el grupo de trabajadores ocupacionalmente
expuestos a los pesticidas presentaron diferencias significativas comparado con el grupo
control (Paz-y-Mio et al., 2004).
En la prueba de ensayo cometa se observ que los floricultores expuestos a los
pesticidas presentaron mayores niveles de migracin del ADN en comparacin con los
individuos no expuestos (Tabla XII.9). Adems, se determin que existe una asociacin
significativa entre los resultados citogenticos y moleculares.

INVESTIGACIONES MOLECULARES EN EL ECUADOR: GENOTOXICOLOGA

217

Tabla XII.9. Niveles de migracin del ADN mediante ensayo cometa


Grupo
Control
Expuestos

N
21
45

Promedio de migracin (m)


25,94
31,58

Mediana de migracin (m)


25
28,8

Este estudio, junto a otros realizados a lo largo de la ltima dcada, han revelado
un incremento en la migracin del ADN en personas expuestas a agentes genotxicos
como son los pesticidas. Los pesticidas generan especies xido reactivas, los cuales
causan dao en el ADN y rupturas de cadena simple, los cuales pueden ser detectados
con pruebas como el ensayo cometa. A pesar del riesgo asociado con la exposicin a los
pesticidas, las personas se exponen a una amplia gama de compuestos txicos. Adems,
la variacin en el tipo y tiempo de exposicin es responsable de la formacin de los
diferentes niveles de genotoxicidad entre los diferentes estudios realizados (Paz-y-Mio
et al., 2004).
Para mayor informacin, la investigacin denominada Chromosome and DNA
Damage Analysis in Individuals Occupationally Exposed to Pesticides With Relation to
Genetic Polymorphism for CYP1A1 Gene in Ecuador, se public en la revista cientfica
Mutation Research el ao 2004 (Paz-y-Mio et al., 2004).

3.HIDROCARBUROS
La Amazona ecuatoriana es una de las regiones ecolgicas con mayor
biodiversidad en flora y fauna en el mundo. La actividad de extraccin del petrleo en el
Ecuador empez en el ao 1971, transformndose en la primera fuente de ingresos
econmicos para el pas (BCE, 2009). Desafortunadamente, a lo largo del proceso,
millones de galones de petrleo y residuos txicos han sido desechados directamente al
ambiente causando problemas ambientales y de salud (Kimmerling, 1993; Epstein &
Selber, 2002; Neri et al., 2006; Platt et al., 2008). Adems, ms de 30 billones de
galones de desperdicios txicos y crudo han sido eliminados a los suelos y fuentes de
agua de la Amazona (Jochnick et al., 1994).
El petrleo es una compleja mezcla de varios compuestos qumicos, el cual
contiene una variedad de agentes de diverso poder toxicolgico como el benceno,
tolueno, xileno e hidrocarburos aromticos policclicos (IARC, 1989). Altas
concentraciones de benceno pueden causar neurotoxinas que generan problemas en la
mdula espinal. De igual forma, el benceno es un agente desencadenante de la leucemia
y del desarrollo de tumores hematolgicos (Hayes et al., 2001).
La exposicin a compuestos carcingenos usados en la industria petrolera
incrementa el desarrollo del cncer en hombres, mujeres y nios. En hombres, se ha
notificado un mayor incremento en el cncer de pulmn, esfago, recto, piel y rin. En
mujeres, se ha visto un incremento de cncer cervical, ganglios linfticos y vejiga. En
nios, se ha observado una mayor incidencia en cncer hematopoytico (Blot et al.,
1977; Everall & Dowd, 1978; Kaldor et al., 1983; Olin et al., 1987; Lyons et al., 1995;
Boffetta et al., 1997; Gottlieb et al., 1982; Pan et al., 1994; Grin et al., 1998; Yang et
al., 1999; Hayes et al., 2001; McDonald, 2001).

INVESTIGACIONES MOLECULARES EN EL ECUADOR: GENOTOXICOLOGA

218

3.1.Elpetrleoysuscomponentes

El contacto directo con el petrleo o sus vapores causa irritacin, picores en la


piel y enrojecimiento de los ojos. La exposicin prolongada a concentraciones bajas de
compuestos voltiles causa nuseas, mareos, dolor de cabeza o somnolencia (Goldstein
& Bendit, 1970; Kaplan et al., 1993). En el caso de vertidos de petrleo las personas
expuestas suelen manifestar dolores de cabeza, dolor de garganta e irritacin en los ojos
(Campbell et al., 1993; Crum, 1993). En general, los crudos pesados presentan menos
problemas de toxicidad aguda que otras fracciones de petrleo porque contienen menos
compuestos orgnicos voltiles (COV). Estos sntomas de intoxicacin aguda son de
corta duracin y desaparecen rpidamente al eliminar el contacto con el petrleo
(Lillienberg et al., 1992).
3.1.1.Compuestosorgnicosvoltiles

Destacan entre la alta variedad de hidrocarburos por ser de anillo simple


(benceno, tolueno, etilbenceno y xileno, que se encuentran sobre todo en los petrleos
livianos). Se disuelven en agua con ms facilidad y son ms voltiles lo que les da un
mayor poder de captacin biolgica y dao a la salud (Greenpeace, 2003).
Inhalados pueden afectar el SNC y causar la muerte. Su ingestin causa
irritacin de garganta y estmago, dificultad respiratoria y neumona de aspiracin
(Clapp et al., 2006).
Benceno: Se evapora en el aire muy de prisa, se disuelve ligeramente en el agua
y es altamente inflamable. Es el mayor agente cancergeno humano conocido
(Melhman, 2006). Puede entrar en el cuerpo por la va respiratoria, gastrointestinal
cutnea: a) Una inhalacin breve de 10 minutos a niveles muy altos de benceno (1000020000 ppm) puede ocasionar la muerte; niveles inferiores (700-3000 ppm) pueden
causar somnolencia, mareo, ritmo cardaco rpido, dolores de cabeza, pequeos
temblores, confusin e inconsciencia. Es un veneno hematopoytico y depresor de la
mdula sea (anemia, sangrado, dficit de defensas), causando leucemias; b) Su ingesta
puede causar vmito, irritacin del estmago, mareo, somnolencia, convulsiones, ritmo
cardaco rpido, coma y la muerte; c) Por contacto causa irritacin en piel y daos a la
crnea. Atraviesa la barrera placentaria y causa bajo peso al nacer, formacin sea
retardada y dao a la mdula sea (Clapp et al., 2006), ya que en mujeres embarazadas,
el benceno se acumula en el suministro sanguneo del feto (Greenpeace, 2003).
Tolueno: El tolueno es parte natural del crudo. Se disuelve en agua y volatiliza
con facilidad. Es irritante para la piel y tracto respiratorio; puede causar toxicidad
sistmica por la ingestin o la inhalacin y es lentamente retenido a travs de la piel en
la que produce eritema y ampollas. Exposiciones crnicas de tolueno a menos de 200
ppm se asocian a la afeccin del SNC con dolor de cabeza, fatiga y nusea. Los
trabajadores repetidamente expuestos entre 200-500 ppm reportaron prdida de
coordinacin, memoria y apetito. Algunos desarrollaron desrdenes reversibles de los
nervios pticos despus de la exposicin crnica en el lugar de trabajo. Esta cronicidad
de la exposicin puede causar efectos permanentes de neuropsiquiatra, alteraciones
musculares, cardiovasculares, dao tubular renal, prdida del conocimiento, coma y
muerte sbita. En nios puede ocasionar neumonitis. Atraviesa la barrera placentaria y

INVESTIGACIONES MOLECULARES EN EL ECUADOR: GENOTOXICOLOGA

219

puede ocasionar problemas neurolgicos y crecimiento retardado, puede transmitirse


con la lactancia (Clapp et al., 2006).
Etilbenceno: Es encontrado como vapor que pasa fcilmente al aire desde el
agua y el suelo, pero puede entrar al organismo por contacto drmico, ingestin o
inhalacin. El 40-60% de etilbenceno inspirado es retenido en el pulmn. Las personas
expuestas a niveles altos de etilbenceno en el aire, por cortos perodos, se han quejado
de irritacin de ojos y garganta. A niveles ms altos han tenido problemas respiratorios,
musculares y mareo. Es txico para el SNC e irritante de membranas mucosas y ojos. El
IARC determin que es posiblemente carcinognico para humanos (Clapp et al., 2006).
Xileno: Est presente en el crudo y el alquitrn mineral. Se evapora y arde
fcilmente. La exposicin a corto plazo para niveles altos de xileno puede causar
irritacin de la piel, ojos, nariz y garganta; dificultad respiratoria y respuesta retardada
para un estmulo visual; alteraciones de memoria, molestias de estmago y problemas
renales y hepticos. Exposicin a corto y largo plazo para concentraciones altas de
xileno puede causar efectos en el sistema nervioso (dolores de cabeza, falta de
coordinacin muscular y mareo), a niveles muy altos de xileno se produce la muerte. No
hay estudios que puedan demostrarle como carcingeno. Cruza la barrera placentaria y
en animales ha demostrado ser fetotxico (Clapp et al., 2006).
3.1.2.Hidrocarburosaromticospolicclicos
Entre ellos destacan 16 compuestos incluidos en la lista de contaminantes
prioritarios de la EPA de los Estados Unidos: naftaleno, acenaftileno, acenafteno,
fluoreno, fenantreno, antraceno, fluoranteno, pireno, benzo(a)antraceno, criseno,
benzo(b)fluoranteno, benzo(k)fluoranteno, benzo(a)pireno, dibenzo(ah)antraceno,
benzo(ghi)perileno e indeno(1,2,3-cd)pireno. La mayora de estos compuestos tambin
estn clasificados como 2B por el IARC y a algunos de ellos se atribuye un potencial
genotxico (Harvey et al., 1999).
Lo ms txico de este grupo es el benzo(a)pireno, encontrado en petrleo crudo,
alquitrn mineral y creosita, as como el benzo(k)fluorantreno. El benzo(a)pireno puede
encontrarse en partculas pequeas que son inhaladas profundamente hasta los
pulmones, donde benzo(a)pireno puede ejercer efectos carcinognicos. Es absorbido
tambin a nivel de piel. Las propiedades carcinognicas de los PAH se han descrito para
estos 16 compuestos. El benzo(a)pireno es cancergeno de faringe y laringe (Clapp et
al., 2006).
3.1.3.Metalespesados
Tambin se encuentran en el crudo concentraciones variables de metales pesados
como vanadio, nquel, cobre y hierro. Otros elementos qumicos presentes son el azufre,
nitrgeno y oxgeno.
Vanadio: Es un producto de la combustin del petrleo. Acta irritando la piel,
conjuntivas y aparato respiratorio; produce decoloramiento verdoso de los dedos,
escroto y piernas, as como una coloracin verde negruzca de la lengua que indica
exposicin aguda. Se lo ha sealado, en Venezuela, como causante de los casos de
anencefalia (Granadillo et al., 1998). Es capaz de ocasionar cambios en el material

INVESTIGACIONES MOLECULARES EN EL ECUADOR: GENOTOXICOLOGA

220

gentico de plantas, animales y humanos, con malformaciones importantes en el tubo


neural. Se ha afirmado tambin que existe una correlacin definitiva entre el vanadio y
el desarrollo de enfermedades cardiovasculares y arteriesclerosis por alteracin de vasos
sanguneos, presin arterial y transporte de calcio.
Cromo: Es un cancergeno humano conocido por su efecto sobre el material
gentico. Inhalado puede causar irritacin a la nariz, estornudos, ardor nasal,
hemorragias nasales, lceras, asma y orificio del septum nasal. La exposicin a largo
plazo ha sido asociada con cncer pulmonar en trabajadores expuestos. Con su ingestin
causa trastornos estomacales y lceras, convulsiones, problemas al rin, hgado y la
muerte. Puede ser transferido de madre a hijo a travs de la lactancia (Clapp et al.,
2006).
Plomo: Es liberado en la combustin de carbn, petrleo y en las perforaciones.
La exposicin de largo plazo puede conducir a alteraciones cognitivas, debilidad en
manos y tobillos, hipertensin, daos cerebrales y renales. Estudios en trabajadores
expuestos han encontrado que puede causar cncer de pulmn, estmago y cerebral. En
los nios se ha demostrado ser un neurotxico al interrumpir la sinapsis y afectar las
zonas cruciales del aprendizaje y la memoria. En los aos setenta, Needleman descubri
una correlacin entre concentraciones dentales de plomo en nios y problemas de
distraccin, escasa organizacin, impulsividad e incapacidad para seguir instrucciones,
problemas de lectura y secundarias incompletas. El plomo atraviesa la barrera
placentaria y puede causar muerte intrauterina, precocidad y bajo peso al nacer (Clapp
et al., 2006).
Mercurio: Su ingreso al organismo es por inhalacin e ingestin y se ha
demostrado que ocasiona dao permanente a nivel cerebral y renal. El sistema nervioso
es particularmente sensible para metilmercurio y mercurio elemental. La exposicin
puede causar irritabilidad, pequeos temblores, cambios en la vista/audicin y
problemas de memoria que puede conducir a formas de Parkinson. Afecta el desarrollo
del feto a nivel neurolgico. La EPA considera que el metilmercurio es un posible
agente cancergeno (Clapp et al., 2006).
Nquel: Es eliminado con la combustin del petrleo. Los efectos de salud ms
dainos son la bronquitis crnica, la reduccin de la funcin pulmonar y el desarrollo de
los tipos de cncer de mama y pulmn. Se necesita ingerir cantidades muy grandes de
nquel para sufrir efectos dainos a la salud, aproximadamente con 250 ppm de nquel
aparecen dolores de estmago, aumento de glbulos rojos y de las protenas en orina
pero esta concentracin de nquel es 100000 veces mayor que la cantidad usualmente
encontrada en agua potable. A nivel de piel casi no se absorbe, pero produce reacciones
alrgicas de contacto. El potencial carcingeno parece deberse al sulfato de nquel y las
combinaciones de sulfuros de nquel y xidos. Pasa la barrera placentaria y puede
pasarse por la lactancia (Clapp et al., 2006).
Cadmio: Es eliminado en la combustin de fsiles. La inhalacin es la principal
va de ingreso al organismo y puede causar problemas pulmonares, renales y fragilidad
de los huesos. La exposicin de 2 horas con este compuesto causa tos e irritacin leve
de garganta; de 4 a 10 horas aparecen sntomas como tos, presin esternal, dolor de
pecho, dificultad respiratoria, sudoracin, temblor y dolor de extremidades; de 8 horas
en adelante aparece una severa dificultad para respirar, tos persistente, debilidad,

INVESTIGACIONES MOLECULARES EN EL ECUADOR: GENOTOXICOLOGA

221

malestar, anorexia, nusea, diarrea, miccin frecuente en la noche, dolor abdominal,


expectoracin de sangre y postracin. Las exposiciones a altos niveles pueden ser
fatales y los que sobreviven pueden tener secuelas por aos. Con la ingesta, el carcter
irritante tambin aparece a nivel digestivo y se puede concentrar en riones. Estudios en
animales han demostrado que su absorcin es mayor en nios y embarazadas con dietas
bajas en calcio, protena o hierro y ricas en grasas. Solo una escasa cantidad pasa la
barrera placentaria (Clapp et al., 2006).
Bario: Como barita es extrado y usado en la perforacin de pozos. Sus efectos a
la salud dependen de su solubilidad en agua. Los compuestos de bario que no se
disuelven bien (barita y carbonato de bario) permanecen mucho tiempo en el ambiente.
La barita causa pocos efectos dainos, sin embargo, el bario combinado como nitrato o
en forma de acetato, cloruro, hidrxido o sulfuro de bario, que se disuelven en agua,
puede causar efectos dainos. A altas cantidades su ingesta puede matar. En cantidades
no letales puede alterar el ritmo cardiaco o producir parlisis, nasea, retortijones
abdominales, diarrea, dificultades respiratorias, hipo o hipertensin, entumecimiento
alrededor de la cara y debilidad muscular. La inhalacin y el contacto de piel no parecen
tener los mismos efectos (Clapp et al., 2006).
Cobre: Aparece tras la incineracin de combustibles fsiles. A bajas
concentraciones puede irritar la nariz, la boca, los ojos y dar dolores de cabeza, mareo,
nusea o diarrea. A dosis altas puede causar dao heptico, renal e incluso muerte
(Clapp et al., 2006).
Zinc: Es un metal esencial y su deficiencia nutricional causa problemas de
salud, pero su exceso tambin. Pequeas cantidades elevadas pueden causar dolores de
estmago, nusea y vmito. Su ingesta prolongada puede ocasionar anemia, dao en el
pncreas y disminucin de los niveles del colesterol beneficioso. La ingesta exagerada
puede causar infertilidad, retraso del crecimiento fetal e irritacin drmica al contacto
(Clapp et al., 2006).
3.1.4.Gases
Dixido de azufre: Su frmula es SO2. Es un gas incoloro con un olor intenso
que se disuelve fcilmente en agua. En el aire, el SO2 se puede convertir en cido
sulfrico o sulfatos, mientras que en agua, el dixido de azufre puede formar cido
sulfuroso. Como gas se disuelve en la piel hmeda y en las membranas mucosas para
formar cido sulfuroso, un agente irritante que acaba con la mucosa ciliar de la
garganta, pero por s mismo el dixido de azufre es un fuerte irritante del tracto
respiratorio. A altas concentraciones puede ser mortal. Concentraciones de 100 ppm son
peligrosas para la vida. Pueden darse desde sntomas leves de irritacin local como
estornudos, rinitis, tos, pasando por la dificultad respiratoria y sofocacin hasta el
espasmo larngeo, bronco espasmo y edema pulmonar, asma, neumona y bronquitis.
Exposiciones a concentraciones muy bajas de dixido de azufre pueden agravar
enfermedades pulmonares crnicas, como el asma y enfisema. La exposicin crnica
puede causar un sentido del olfato alterado, una susceptibilidad aumentada para las
infecciones respiratorias y la disminucin acelerada en la funcin pulmonar. A
moderadas dosis se genera nusea, vmito y dolor abdominal. Es un fuerte irritante de
piel causando picor, dolor, coloracin roja y ampollas, especialmente en mucosas, con
conjuntivitis y quemaduras corneales. Est asociado a cuadros asmticos en nios y

INVESTIGACIONES MOLECULARES EN EL ECUADOR: GENOTOXICOLOGA

222

estudios en animales (cerdos) confirman que cantidades de hasta 1 ppm producen


fuertes impactos respiratorios.
cido sulfrico: Su frmula es SO4H2. Se forma en el aire desde el dixido de
azufre que se quema con los combustibles fsiles. El SO2 se transforma en SO3 que al
reaccionar con agua en el aire forma el cido sulfrico (SO4H2). Es muy corrosivo e
irritante para la piel, tracto respiratorio y gastrointestinal. Su inhalacin a altas
concentraciones puede causar dificultad respiratoria y de eliminacin de partculas
extraas. Ocasiona tambin erosin dental. En el aparato digestivo puede causar
procesos erosivos, lceras y muertes. En piel causa quemaduras, quema los ojos y puede
producir ceguera. En nieblas severas el IARC cree que es carcinognico para los
humanos.
cido sulfhdrico: Su frmula es SH2. Las emisiones de SH2 son un poderoso
abortivo a una exposicin anual superior de 4 g/m 3, el sulfuro de carbono (S2C) es una
neurotoxina muy poderosa. El umbral del olor del cido sulfhdrico est cerca de los 7
g/m 3, la toma diaria aceptable es de 1,8 ng/m3.
3.2.InvestigacionessobrehidrocarburosenelEcuador
Durante los ltimos 40 aos se han realizado varios estudios que reconocen el
impacto de esta actividad sobre la poblacin que circunda las zonas petroleras en las
diferentes provincias del oriente ecuatoriano.
En 1993 se realiz un estudio caso-control en 1465 personas expuestas y no
expuestas a la actividad petrolera, demostrando los siguientes resultados: La poblacin
infantil de las comunidades donde hay contaminacin de petrleo tuvo importantes
niveles de desnutricin (43%) en comparacin con la poblacin no expuesta al petrleo
(21,5%). Las mujeres que bebieron agua a menos de 200 m de las estaciones petroleras
presentaron 147% ms abortos que las mujeres del grupo control. Las causas ms
frecuentes de mortalidad fueron cncer, violencia y accidentes. La media de
enfermedades por persona era de tres en las comunidades expuestas y dos en las
comunidades no expuestas a la actividad petrolera. El 49% de las familias
pertenecientes a las zonas afectadas han comprometido su salud por efecto de baos en
aguas contaminadas, intoxicaciones por gas, cadas a piscinas con crudo, quema de
productos de petrleo, contacto con qumicos, explosiones de pozos, ruptura de
oleoductos y consumo de alimentos txicos. Fruto de estos accidentes se han producido
en los afectados piodermitis (50,5%), micosis (46,6%), cefaleas (17,8%), problemas
respiratorios (16,4%), reacciones alrgicas (5,5%), dermatitis y problemas renales
(2,7%) (UPPSAE, 1993).
En 1994 se realiz un anlisis en 32 muestras de agua de la zona afectada por la
actividad petrolera. Se determin que las concentraciones de hidrocarburos aromticos
policclicos estaban incrementadas varias veces por encima de los niveles permitidos
por la EPA. Las muestras de agua potable analizadas tenan concentraciones de PAH
que oscilaban entre 32,8 y 2792 ng/L. Cifras que implican un riesgo carcinognico entre
1/1000 y 1/100000 (Jochnick, 1994).
En el 2000, sobre un estudio de 500 personas se confirmaba que la presencia de
abortos y cncer era significativamente superior en comunidades expuestas a la

INVESTIGACIONES MOLECULARES EN EL ECUADOR: GENOTOXICOLOGA

223

contaminacin petrolera que aquellas que vivan a distancia de esta actividad. Los
abortos eran 150% ms frecuente y el cncer 130% ms frecuente, con un riesgo de
mortalidad de 260% ms alto que en la ciudad de Quito (San Sebastin, 2000).
En el 2003 se realiz un estudio a 1520 personas y se realizaron 342 visitas
mdicas en las comunidades afectadas por la actividad petrolera. Para ese entonces, la
industria del petrleo tena concesionadas ms de 5 millones de hectreas de la
Amazona del Ecuador. Los resultados ms destacados de esta investigacin fueron: El
100% de las personas que vivieron cerca de las estaciones de petrleo han sufrido
problemas de contaminacin, cuyas principales causas fueron en el 57% las piscinas de
petrleo, 56% de los pozos y 42% de la quema de gas en los mecheros. La actividad
petrolera afecta las bases de la subsistencia campesina e indgena; el 94% de la
poblacin encuestada ha sufrido prdidas de animales. Los animales han muerto tras
beber agua con crudo, caer a las piscinas o asfixiados por el gas. Sin embargo, un
porcentaje de la poblacin ha utilizado esta carne para su consumo. El 82,4% de la
poblacin se ha enfermado en alguna ocasin por la contaminacin: el 96% de los
enfermos reportaron problemas de la piel, 75% problemas respiratorios, 64% problemas
digestivos y 42% problemas de ojos. La principal causa de muerte ha sido el cncer en
un 32% del total de fallecidos, siendo tres veces ms que la media nacional de muertes
por cncer (12%) en el Ecuador, y 4 a 5 veces superior a Orellana (7,9%) y Sucumbos
(5,6%). Se detectaron 89 personas enfermas o fallecidas entre los vecinos por causa
directa del cncer y la contaminacin, permitindonos hablar de ms de 500 fallecidos
por causa directa de la actividad petrolera (Maldonado & Narvez, 2003).
En el 2004 un estudio fue publicado en la revista International Journal of
Occupational and Environmental Health citando las altas tasas de leucemia en nios en
zonas de explotacin petrolera en la Amazona ecuatoriana. Los investigadores
encontraron tasas de leucemia en nios de 0 a 4 aos de edad que viven en zonas de
explotacin petrolera, 3 veces ms altas que en otras partes del pas (Hurting & San
Sebastin, 2004).
En el 2005, un estudio demostr que existe un elevado riesgo en la salud de
animales y poblaciones humanas al estar expuestos a los diferentes txicos dejados por
la actividad del petrleo, siendo un problema de salud mdica los efectos no reversibles
como el cncer, riesgos de abortos espontneos y defectos en la reproduccin (San
Sebastin & Hurting, 2002). El estudio Yana Curi, encontr una tasa de abortos
espontneos 2,5 veces ms alta en comunidades ecuatorianas expuestas a la
contaminacin petrolera que en comunidades no expuestas utilizadas como control. En
este mismo estudio se analizaron otros factores como la edad en el embarazo, orden del
embarazo y estado socioeconmico, sin que se llegue a explicar la asociacin entre los
abortos espontneos y vivir en la proximidad de campos petroleros (Informe Yana Curi,
2000).
En el 2006, nuestro grupo de investigacin realiz un biomonitoreo del dao del
ADN en individuos expuestos a hidrocarburos en San Carlos, provincia de Orellana. Las
evidencias cientficas obtenidas en esta investigacin demostraron que los individuos
expuestos a hidrocarburos presentaron alto riesgo carcinognico y mutagnico. Las
personas expuestas a agentes txicos propios de las industrias petroleras sufrieron
sntomas como fatiga, dolor de cabeza, micosis cutnea, dermatitis, irritacin nasal y
ocular, gastritis, nusea y diarrea. El anlisis, desarrollado mediante la prueba ensayo

INVESTIGACIONES MOLECULARES EN EL ECUADOR: GENOTOXICOLOGA

224

cometa, permiti determinar que los individuos expuestos a los hidrocarburos


presentaron alto porcentaje de dao en el ADN comparado con individuos sanos
considerados como control. El anlisis citogentico determin que las personas
expuestas presentaron rupturas cromosmicas y gaps. Mientras que en los estudios
genticos se encontr asociacin significativa del gen hMSH2 con los individuos
expuestos a hidrocarburos y derivados del petrleo (Paz-y-Mio et al., 2008a).
Para mayor informacin, la investigacin denominada Monitoring of DNA
Damage in Individuals Exposed to Petroleum Hydrocarbons in Ecuador fue publicada
en la revista cientfica Annals of the New York Academy of Sciences el ao 2008 (Paz-yMio et al., 2008a).

4.RADIACIN
Nuestro grupo de estudio desarroll dos investigaciones relacionadas a la
radiacin ionizante mediante rayos X en trabajadores mdicos, y a la radiacin solar en
pesqueros de la Costa ecuatoriana.
4.1.RadiacinionizantemedianterayosX
La radiacin ionizante es considerada un genotxico por su capacidad de
interactuar con el ADN. Un tipo de radiacin ionizante son los rayos X, los cuales desde
su descubrimiento han sido asociados con el aparecimiento de patologas radioinducidas. Durante los primeros aos de uso de los rayos X se reportaron casos de
lesiones de piel, alteraciones hematolgicas y cncer. Desde 1950 se implementaron
normas de proteccin como disminuir la dosis lmite de radiacin y el uso de medidas
de proteccin personal para confrontar la presencia de patologas radio-inducidas
(Berrintong et al., 2001; Yoshinaga et al., 2004).
Berrintong y Yoshinaga observaron en sus investigaciones que los radilogos
que trabajaron antes del ao 1950 presentaron enfermedades como leucemia, cncer de
mama, tiroides, y posterior a este ao los casos reportados han sido mucho menores, lo
que indic que era eficaz la recomendacin de proteccin del personal y la disminucin
de la dosis (Berrintong et al., 2001; Yoshinaga et al., 2004).
A pesar de los efectos dainos sobre la salud, causada por la exposicin a altas
dosis de radiacin, debido a la cada de la bomba atmica, los efectos que causan las
bajas dosis de radiacin todava son controversiales (Clochard et al., 2000; Paz-y-Mio
et al., 2001).
El monitoreo gentico permite analizar si las poblaciones expuestas a agentes
genotxicos como los rayos X, presentan alteraciones en la morfologa de los
cromosomas y en la integridad del ADN. La utilidad del monitoreo gentico radica en
demostrar la relacin entre el dao gentico y la radiacin ionizante. Adems permite
realizar recomendaciones para prevenir enfermedades (Clochard et al., 2000; Bayo,
2001).
Existen dos tipos de efectos causados por la exposicin a la radiacin sobre la
salud: los determinsticos, que se observan en personas expuestas a altas dosis de

INVESTIGACIONES MOLECULARES EN EL ECUADOR: GENOTOXICOLOGA

225

radiacin, lo que induce a la muerte celular provocando la prdida de funcionalidad de


los tejidos; y, los estocsticos, cuando el contacto con la radiacin ionizante potencia
eventos de dao ya presentes en el individuo, provocando sinergismo entre las
alteraciones genmicas y los efectos producidos por la radiacin (Bartch et al., 1997;
Tice et al., 2000; Touil et al., 2002; Morgan et al., 2005; Muoz et al., 2008; ICRP,
2007).
La carcinognesis radio-inducida consiste en el desarrollo de los eventos de
iniciacin, promocin y progresin, los cuales se producen luego de la exposicin a la
radiacin y provocan alteraciones que predisponen la aparicin del cncer (Paz-y-Mio
et al., 2001).
La radiacin ionizante produce al genoma daos directos e indirectos. Los daos
directos consisten en la alteracin de la estructura qumica del ADN, prdida de una
base nitrogenada debido a la presencia de dmeros de timina, delecin de secuencias,
rotura de simple y doble cadena. Mientras que el dao indirecto produce la formacin
de radicales libres, principalmente de la ionizacin del agua, convirtindola en radicales
superxido e hidroxilo (Paz-y-Mio et al., 2001; Seedhouse et al., 2004; Dufloth et al.,
2005; Millikan et al., 2005; Gerci et al., 2006).
Otras macromolculas sensibles a los rayos X son los lpidos de la membrana
celular, porque se altera su estructura afectando la permeabilidad de la membrana y las
enzimas que pierden su actividad. Por otro lado, se pueden alterar las mitocondrias,
causando muerte celular inmediata al desorganizarse las crestas mitocondriales y la
cadena de fosforilacin oxidativa (Seedhouse et al., 2004; Dufloth et al., 2005; Millikan
et al., 2005).
Los estudios de biomonitoreo ayudan al esclarecimiento de los efectos
producidos por los genotxicos, al aportar informacin sobre los mecanismos
moleculares de estos procesos que causan dao de forma directa o indirecta. Entre las
pruebas que se utiliza para evaluar los efectos de los genotxicos se encuentran: el
estudio de aberraciones cromosmicas, de microncleos, el ensayo cometa, la FISH y el
anlisis de genes (Baquero et al., 2004; Prasad et al., 2004; Aka et al., 2004).
Nuestro grupo de investigacin realiz el estudio de 41 individuos que
cumplieron los criterios de inclusin en el estudio, 20 pertenecieron al grupo de
expuestos a rayos X y 21 pertenecieron al grupo de no expuestos. Del total de
individuos analizados, 16 fueron hombres y 25 mujeres, siendo 12 hombres y 8 mujeres
los expuestos, y 4 hombres y 17 mujeres los no expuestos. El promedio de edad del
grupo de expuestos fue 37 aos, mientras que la edad promedio del grupo control fue 33
aos.
Los grupos de estudio no presentaron antecedentes patolgicos personales ni
familiares de cncer, infertilidad, esterilidad, abortos, malformaciones, ni uso de
tratamientos antineoplsicos. Todos los individuos expuestos a radiacin trabajaron seis
horas diarias aproximadamente. El tiempo que los pacientes estuvieron expuestos a
radiacin va de 1 a 21 aos, siendo la media de 5,89 aos de trabajo.
La dosimetra fsica anual de los individuos expuestos fue sobre la base de los
dosmetros fsicos termoluminiscentes analizados por la Comisin Ecuatoriana de

INVESTIGACIONES MOLECULARES EN EL ECUADOR: GENOTOXICOLOGA

226

Energa Atmica (CEEA). Los valores de la dosis media de radiacin a la que estaban
expuestos los individuos fueron de 0,99 mSv de radiacin ionizante.
En el anlisis de aberraciones cromosmicas se contabilizaron 490 metafases en
el grupo de expuestos y 1274 metafases en el grupo de no expuestos. Todas las
metafases presentaron un total de 46 cromosomas. En ninguna de las metafases se
hallaron alteraciones numricas. La proporcin de aberraciones cromosmicas en los
expuestos fue del 50% y en los controles fue del 4%.
Al analizar la presencia de las aberraciones cromosmicas en 764 metafases se
encontraron alteraciones estructurales; dentro de estas se observaron gaps, roturas,
cromosomas dicntricos, anillos y doble minute (Figura XII.5). Al separar las metafases
en grupos de expuestos y controles se encontr que la metafase que present la rotura
perteneci a un individuo del grupo control. En el grupo de expuestos se encontraron 13
metafases que presentaron alteraciones tipo gaps. Otro tipo de alteracin que se
encontr fue una metafase con un cromosoma dicntrico en un sujeto expuesto a rayos
X. Adems, se encontr una metafase con una alteracin de un cromosoma en forma de
anillo. Adicionalmente, una metafase de los individuos expuestos a rayos X tambin
present un doble minute.

FIGURA XII.5. ALTERACIONES CROMOSMICAS ESTRUCTURALES. Se compara


un cromosoma normal con varios cromosomas alterados por rupturas (Modificado
de Paz-y-Mio et al., 2008a; IIB, 2014).

Al realizar el anlisis de la presencia de aberraciones cromosmicas, se encontr


que no hay una diferencia significativa al comparar entre los individuos expuestos y los
no expuestos a rayos X.
Al aplicar la prueba de ensayo cometa se analizaron 8262 nucleoides, se
encontr una media de longitud de migracin de 25,92 m en el grupo de controles y de
29,09 m en el grupo de casos. La diferencia encontrada entre ambos grupos fue
altamente significativa (Tabla XII. 10).
En los expuestos hubo un aumento en la proporcin de fragilidad en un 60%, en
comparacin con el grupo control que present el 4% de fragilidad. En el grupo de
casos, al correlacionar el promedio de la dosis de radiacin y de aberraciones
cromosmicas, no se encontr una relacin entre ambos datos. Tambin se realiz la
correlacin entre la presencia de aberraciones cromosmicas con los aos de
exposicin, pero tampoco se encontr correlacin significativa. En el grupo expuesto se
correlacion la dosis de radiacin con la longitud de las cometas, sin encontrarse
diferencias significativas. Adems, se correlacion los aos de trabajo a los que

INVESTIGACIONES MOLECULARES EN EL ECUADOR: GENOTOXICOLOGA

227

estuvieron expuestos los trabajadores con la presencia de las aberraciones


cromosmicas y la longitud de las cometas, pero tampoco se encontr diferencias. El
riesgo de presentar aberraciones cromosmicas en individuos expuestos a radiacin
ionizante es 20 veces mayor que en los individuos sanos. Mientras que la razn entre
expuestos y no expuesto a la radiacin ionizante es de 30 veces para presentar mayor
grado de fragilidad del ADN.
Tabla XII.10. Longitud de migracin del ADN mediante ensayo cometa
Individuo
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20

Expuestos a rayos X
Mediana
Media
25
25,9
25
26,5
25
26,4
25
25,8
25
24,6
22,5
24,6
42,5
43,6
35
36,5
27,5
27,4
32,5
32,7
27,5
27,4
25
27,4
27,5
28,8
30
29,3
32,5
34,8
27,5
28,8
25
29,3
25
26,7
25
27,7
25
25,8

Media
Mediana

29,08
25,83

No expuestos a rayos X
Individuo
Mediana
Media
1
25
26,3
2
25
25,4
3
25
25,7
4
26,5
27,3
5
25
25,9
6
25
25,8
7
25
25,8
8
25
25,8
9
25
25,3
10
25
25,5
11
25
26,3
12
25
26,9
13
25
26,3
14
25
26,9
15
25
26,5
16
25
25,1
17
25
25,0
18
25
25,5
19
25
25,9
20
25
25,4
21
25
26,4
Media
25,91
Mediana
25,78

En el anlisis de aberraciones cromosmicas se tom en cuenta las alteraciones


numricas y estructurales. En este estudio no se presentaron alteraciones tipo numricas.
Sin embargo, en estudios realizados por Daz-Valecillos y Madelleti, se describieron
alteraciones numricas en individuos expuestos a bajas dosis de rayos X, como prdida
o ganancia de uno o dos cromosomas e hiperdiploidas (Madelleti et al., 2002; Paz-yMio et al., 2001; Daz-Valecillos et al., 2004). En todos los estudios, incluyendo este,
las poblaciones estuvieron expuestas a dosis de radiacin similares, lo cual podra tener
una relacin con un proceso de adaptacin al dao, lo que implica que estas dosis no
alterarn la estructura cromosmica debido a la resistencia que provoca esta radiacin
sobre los mecanismos de control y reparacin del ADN.
En cuanto a las alteraciones estructurales en los individuos expuestos a los rayos
X hay un incremento en el nmero de aberraciones comparado con el grupo control. A
pesar de esto no se encontraron diferencias significativas en el nmero de aberraciones
cromosmicas. El tipo de aberraciones estructurales que se evidenciaron fueron: anillos,
roturas, gaps, cromosomas dicntricos y doble minute. Los anillos y las roturas
inestables suponen un mayor riesgo de prdida de informacin, lo que aumenta la
posibilidad de alteracin de los mecanismos de control celular: genes supresores de
tumores, activacin de proto-oncogenes, alteracin de los genes de apoptosis o de genes

INVESTIGACIONES MOLECULARES EN EL ECUADOR: GENOTOXICOLOGA

228

reparadores del ADN. Por esto, se ha demostrado que existe una correlacin entre la
presencia de aberraciones cromosmicas y la aparicin de cncer, asocindose de modo
particular con la presencia de sitios frgiles y rupturas cromosmicas (Bayo, 2001;
Goode et al., 2002; Leffon et al., 2004).
Segn Aka, las translocaciones y las roturas son frecuentes en individuos
expuestos, al contrario de las alteraciones inestables como cromosomas dicntricos,
anillos o fragmentos acntricos, ya que estas son letales para la clula en la divisin
celular (Aka et al., 2004). Las alteraciones estructurales tipo doble minute son
alteraciones inestables asociadas a un producto de una amplificacin gnica asociada
con la activacin de proto-oncogenes sensibles a la radiacin como son: N-RAS, KRAS, C-MYC (Goode et al., 2002).
Adicionalmente, se analiz la relacin entre la dosis anual de exposicin y la
presencia de aberraciones cromosmicas. No se encontr correlacin entre el aumento
de aberraciones cromosmicas y los aos de exposicin.
Mediante el anlisis del ensayo cometa, en los individuos expuestos a rayos X,
se observ un mayor grado de migracin del ADN al compararse con el grupo control,
encontrndose una diferencia altamente significativa entre las dos poblaciones. Esto se
debe a que por medio del ensayo cometa podemos observar la presencia de rupturas de
cadena simple y doble, las cuales dan origen a la formacin de la cola, que no se
observan con el anlisis de aberraciones cromosmicas. En el anlisis de aberraciones
cromosmicas, las roturas de doble cadena dan lugar a los cambios estructurales de los
cromosomas (Paz-y-Mio et al., 2002d). Es importante recalcar que las alteraciones
genmicas por mnimas que sean pueden presentarse en lugares clave que podran
alterar la estabilidad del genoma (Lalic et al., 2001; Goode et al., 2002; Leffon et al.,
2004; Hung et al., 2005; Gerci & Grillo, 2007).
Cabe aadir que en nuestro estudio no se observ una correlacin entre la dosis
de radiacin y la longitud de migracin. Es decir, a mayor dosis no aumenta el grado de
dao, debido a que la variacin de las dosis a las que estuvieron expuestos los
individuos fue mnima (Paz-y-Mio et al., 2001; Muoz et al., 2008). Tampoco se
encontr una correlacin entre la longitud de migracin del ADN y los aos de trabajo.
Esta observacin se explica por un efecto de adaptacin conocido como hormesis (Touil
et al., 2002), el cual se caracteriza por la aparicin de efectos diferentes a los esperados
luego de una exposicin crnica, por lo que este fenmeno de adaptacin se da por
accin del sistema de reparacin para proteger la informacin gentica.

Para mayor informacin, la investigacin denominada Biomonitoreo gentico de


individuos expuestos a radiacin ionizante y su relacin con el desarrollo del cncer se
public en la Revista Oncologa el ao 2008 (Muoz et al., 2008).
4.2.Radiacinsolar

La radiacin ultravioleta (UV) de la luz solar es considerada uno de los factores


ambientales ms importantes que afectan a los seres humanos y se ha implicado como la
causa principal de cncer de piel (Paz-y-Mio et al., 2001; Cadet et al., 2005). Los
tumores de piel, por ejemplo el melanoma, parecen estar ms relacionados con la

INVESTIGACIONES MOLECULARES EN EL ECUADOR: GENOTOXICOLOGA

229

exposicin acumulativa, ya que aparecen con mayor frecuencia en hombres mayores,


trabajadores al aire libre, en sitios de mxima exposicin al sol (Caarte, 2008).
En general, la radiacin ultravioleta B (UV-B) (280-320 nm) y ultravioleta A
(UV-A) (320-400 nm) son responsables de los tipos de cncer inducidos por la luz solar
(De Gruijl, 2000; Meinhardt et al., 2008). A pesar que la contribucin UV-A para el
cncer de piel melanoma est an en discusin, es la naturaleza de la exposicin a los
rayos UV la que parece determinar la ocurrencia del cncer de piel.
Las longitudes de onda ms cortas, se absorben principalmente en la epidermis,
mientras que las longitudes de onda con espectro ms amplio pueden penetrar hasta la
dermis (De Gruijl, 2000). La radiacin solar ultravioleta se subdivide en funcin de sus
caractersticas fotobiolgicas que involucra una reaccin producida por la absorcin de
luz (Mulero, 2004; Meinhardt et al., 2008). Los cromforos son molculas que absorben
luz como por ejemplo: melanina, ADN, ARN, entre otras macro molculas que son
capaces de captar distintas longitudes de onda.
En la ltima dcada, han aparecido estudios en algunos pases latinoamericanos
donde se ha informado que la mortalidad por melanoma maligno va en aumento. Segn
diferentes ponencias presentadas en el XXI Congreso Mundial de Dermatologa,
Argentina es el pas con la tasa ms alta de cncer de piel en Amrica Latina debido a la
exposicin y radiacin solar, la alteracin de la capa de ozono y el fototipo de piel de la
mayora de su poblacin (Alfaro et al, 2010). En Ecuador, al igual que en el resto de
pases, los tumores de piel ms frecuentes son los llamados no melanocticos:
basocelular y espinocelular, cuya letalidad es muy baja y son curables en un 95%
(Meinhardt et al., 2008). Sin embargo, el melanoma maligno es mucho ms mortal, y es
el que mayor incremento en la incidencia ha experimentado.
La quemadura solar o eritema, es la lesin cutnea ms frecuente generada por la
exposicin a la luz solar, para su desarrollo se estima que la UV-B es responsable del
80% y la UV-A del 20% aproximadamente. Para que aparezca este tipo de lesin
interviene la intensidad de la radiacin recibida ms la sensibilidad de la persona; la
dosis eritema mnima (MED), se define como la dosis mnima para generar eritema
cutneo de lmites notorios a las 24 horas de exposicin. La respuesta de la piel a la
exposicin no es uniforme en todos los individuos y esto ha llevado a la clasificacin de
las personas en fototipos de piel en funcin de la respuesta despus de la exposicin
solar del medio da durante 45 minutos (OMS, 2003).
Tanto las radiaciones UV-A como UV-B tienen un rol importante en la
patognesis de enfermedades fotosensibles (Norris & Hawk, 1990). Sin embargo, la
UV-B tiene mil veces mayor capacidad de producir quemadura solar y dao genotxico
(De Gruijl, 2000), y aunque la UV-A no es directamente absorbida por el ADN por su
pobre carga energtica, la generacin de fotoproductos en diversos estudios se
increment segn la intensidad recibida de radiacin UV-A a partir de 0 a 200 J/m2
(Mouret et al., 2006). Por otro lado, la radiacin UV-B es la ms involucrada en la
promocin del cncer. Diversos estudios muestran la alta mutagenicidad de esta
longitud de onda, la generacin de dmeros de timina (TT) entre la radiacin UV-A y
UV-B se encontr que era estadsticamente significativa a las 24 h (p = 0,002) y 48 h (p
= 0,05) (Mouret et al., 2006). En modelos in vitro se ha demostrado los efectos
clastognicos generados por la radiacin UV. En clulas de ovario de hmster chino se

INVESTIGACIONES MOLECULARES EN EL ECUADOR: GENOTOXICOLOGA

230

observ un incremento del 16 al 48% de aberraciones cromosmicas del tipo


cromatdico en exposicin a radiacin, con longitud de onda de 254 nm (Sgura et al.,
1996).
Los daos ocasionados en el ADN por las radiaciones UV pueden producirse por
dos vas diferentes. Pueden suceder por absorcin directa de la energa de los fotones o
mediante lesiones bioqumicas indirectas donde los cromforos endgenos transfieren la
carga a otras molculas que son las que provocan las modificaciones en el ADN (Speit
& Schtz, 2008). El dao ms comn de todos los tipos, es el dmero de pirimidina cis
syn ciclobutano, el cual representa la mayora de los fotoproductos generados por la
UV, siendo ms frecuentes los dmeros de timina-timina (TT), seguido de timinacitosina (TC) y por ltimo los de citosina-citosina (CC) (Gonzlez-Pmariega et al.,
2009).
Los efectos celulares incluyen daos en el ADN, la detencin del ciclo celular, la
depresin inmunolgica, la apoptosis, y los cambios transcripcionales (OMS, 2003;
Rodrguez-Sangrador, 2006). Estudios realizados en linfocitos de sangre perifrica
irradiados con 500 J/m2 a una longitud de onda de 365 nm, mostraron que las roturas de
simple y doble cadena inducidas por la radiacin no se distribuyen de manera aleatoria
en los cromosomas analizados (1, 3, 8, 9, 11, 14, 18, 19, 21, X e Y) y por consiguiente
no se correlacionan con el tamao de los cromosomas (Rapp et al., 2000).
En Ecuador existe un gran grupo poblacional expuesto a este tipo de radiacin
sin tomar las medidas necesarias para su proteccin. Se estima que el nmero de
enfermos con cncer de piel se ha incrementado significativamente (5000%) los ltimos
5 aos de acuerdo con un estudio de la Fundacin Ecuatoriana de Psoriasis (Caarte et
al., 2005). Y una de las principales causas, sostienen los especialistas, es la sobre
exposicin a esta radiacin.
La exposicin a algn genotxico puede producir anomalas cromosmicas que
pueden ser detectadas mediante tcnicas citogenticas (Rochette et al., 2003; Speit &
Schtz, 2008). Los linfocitos de sangre perifrica se emplean como clulas centinela
ideales para la evaluacin de aberraciones cromosmicas provocadas por agentes con
potencial genotxico (Rochette et al., 2003). El monitoreo de daos cromosmicos es
un mecanismo muy til para dar seguimiento a poblaciones expuestas a genotxicos ya
que permite la evaluacin total del genoma celular. El objetivo de este estudio fue
evaluar la frecuencia de aberraciones cromosmicas en linfocitos de sangre perifrica en
personas que se dedican a la actividad pesquera.
La investigacin fue de tipo epidemiolgico analtico, transversal de punto
comparativo de grupos expuestos y no expuestos a la radiacin solar UV. Se seleccion
a personas cuyo nico oficio sea la actividad pesquera al aire libre, de preferencia a
personas entre 35 y 45 aos, con poca ingesta de alcohol o inhalacin de tabaco, de
fototipo de piel IV. Igualmente, las mismas caractersticas para el grupo testigos cuyo
ambiente laboral lo realicen en oficinas o lugares protegidos en la sombra. Se
excluyeron del estudio a personas con antecedentes de cncer, o que tuvieron alguna
ingesta de medicamentos o alcohol en los das previos a la toma de la muestra. Una vez
recibida la aprobacin de las personas para el estudio, se les aplic una hoja de
consentimiento informado para asegurar la legitimidad y debida autorizacin para poder
trabajar con las muestras colectadas.

INVESTIGACIONES MOLECULARES EN EL ECUADOR: GENOTOXICOLOGA

231

En cuanto a la exposicin solar, el promedio de exposicin laboral en los


individuos expuestos fue de 64,84 19,8 (p = 0,07) horas; 5,3 1,4 (p = 0,92) das a la
semana por 21,7 7,0 (p = 0,0004) aos. Por su parte, el grupo testigos report 13,5
2,12 horas de trabajo, 5,2 0,71 das de trabajo por 8,7 3,1 aos de trabajo.
4.2.1.Efectogenotxicodelaexposicinsolar

Las aberraciones cromosmicas estructurales (ace) mostraron ser ms


significativas en comparacin con las aberraciones numricas (acn) en todos los
cultivos realizados: testigos (ace 5,67 7,23; acn 1 0) y expuestos (ace 8,87 14,1;
acn 8,5 4,94) en los cultivos estndar. Testigos (ace 9,33 8,5; acn 1,5 0,7) y
expuestos (ace 24 33,77; acn 10 4,24) en los cultivos con afidicolina.
4.2.2.Cultivoestndar
Las aberraciones cromosmicas estructurales informadas en el estudio, el gap
cromatdico fue la aberracin cromosmica significativamente mayor: testigos (1,3
0,86) en comparacin de los expuestos (4 1,48). Se observ otro tipo de ace
estadsticamente no demostrable. Dentro de las aberraciones cromosmicas numricas
la endorreduplicacin fue significativamente mayor: testigos (0 0) a diferencia de los
expuestos (1,14 0,82) (Tabla XII.11).
4.2.3.Cultivoconafidicolina

En el cultivo con afidicolina se report de manera significativa el gap


cromatdico (gct) testigo (1,7 0,67) en comparacin de los expuestos (7,5 3,12); el
gap cromosmico (gcs) en testigos (0 0) mientras en expuestos (2,1 1,12); la rotura
cromatdica en testigos (0,57 0,57) mientras en expuestos (7,24 1,85). De las
aberraciones cromosmicas numricas la endorreduplicacin (end) fue la aberracin
cromosmica que se report de manera significativa: testigos (0 0) y en expuestos
(1,24 0,81). Se report otro tipo de aberraciones cromosmicas estadsticamente no
demostrables (Tabla XII.11).
Tabla XII.11. Aberraciones cromosmicas registradas en los cultivos celulares
Cultivo

Aberraciones
cromosmicas

Expuestos
M DE

Control
M DE

gct
gcs
bct
bcs
end
poli

4 1,48
0,67 0,59
1,33 1,08
0,1 0,22
1,14 0,82
0,5 0,56

1,3 0,86
0
0,19 0,32
0
0
0,1 0,22

0,002
0,1
0,08
0,79
0,03
0,41

gct
gcs
bct
bcs
ACN
end
pol
(M) Mediana; (DE) Desviacin estndar

1,7 0,67
0
0,57 0,57
0
0
0,19 0,31

7,5 3,12
2,1 1,12
7,24 1,85
0,1 0,22
1,24 0,81
0,67 0,59

0,01
0,0004
0,0002
0,79
0,01
0,27

Cultivo
estndar

Grupo de
aberraciones
cromosmicas
ACE

ACN
Cultivo
afidicolina

ACE

INVESTIGACIONES MOLECULARES EN EL ECUADOR: GENOTOXICOLOGA

232

4.2.4.Causaefecto
Las personas que estuvieron en exposicin constante a la radiacin solar
mostraron un mayor nmero de aberraciones cromosmicas en comparacin a aquellas
personas que reportaron estar expuestas por pocas horas a dicha radiacin tanto en
cultivos normales como en cultivos con afidicolina. La personas expuestas tuvieron
65,85 5,64 horas de exposicin, la media de aberraciones cromosmicas registradas
fue 4,4 2,39 (p = 0,027) en el cultivo estndar; bajo el mismo tiempo de exposicin
presentaron 7,9 3,5 (p = 0,004). Se observ una relacin directa entre el tiempo de
exposicin en horas a la semana y el incremento en la frecuencia de aberraciones
cromosmicas. El coeficiente de determinacin (r2 = 0,191) permite inferir que la
variabilidad observada en el nmero total de AC se debe en 19,1% de los casos a la
variabilidad del tiempo de exposicin a la radiacin UV.
Como punto de discusin, las radiaciones ultravioleta constituyen uno de los
agentes fsicos causantes de mutaciones en los ms diversos organismos de nuestro
planeta y estas estn indisolublemente ligadas a los procesos de fotocarcinognesis
(Kozmin et al., 2003). Si la piel se somete a una exposicin crnica de radiacin solar
UV, se induce varias respuestas biolgicas, por ejemplo: el desarrollo de eritema,
edema, inmunosupresin, dao en el ADN, fotoenvejecimiento y melanognesis. Estas
alteraciones pueden estar directa o indirectamente involucradas en el desarrollo de
cncer (Goihman-Yahr, 1996; Afaq & Mukhtar, 2001).
En el presente trabajo los sujetos de estudio estuvieron en edades de 35 a 45
aos de edad, el grupo de poblacin econmicamente activa de Ecuador, en el cual la
incidencia del cncer por sobre exposicin es muy recurrente (Caarte, 2008), lo que
hace necesario evaluar el potencial genotxico de la radiacin solar UV en este grupo
poblacional.
El mayor nmero de aberraciones cromosmicas fue informado en el grupo
expuestos en comparacin con el grupo control, as como la asociacin entre el tiempo
de exposicin y el nmero de aberraciones cromosmicas, ponen de manifiesto el
potencial peligro de este genotxico ambiental para la salud de la poblacin estudiada.
El mayor nmero de gaps y roturas de tipo cromatdico registradas en el cultivo estndar
nos estara indicando la ineficiencia de los mecanismos de reparacin del ADN, como
respuesta a la radiacin UV. Los gaps cromatdico y cromosmico constituyen un tipo
de aberracin cromosmica, evaluando linfocitos humanos expuestos a radiacin
ionizante mediante ensayo cometa y estudio de aberraciones cromosmicas. Los
resultados mostraron una correlacin entre los gaps cromatdicos y cromosmicos y las
colas de los cometas (Paz-y-Mio et al., 2002d).
En la formacin de las aberraciones cromosmicas estructurales se debe tener en
cuenta la fase del ciclo celular en la cual ocurre el dao gentico (Carballo et al., 2006).
El tipo de agente clastognico puede inferir en su accin a lo largo de las diferentes
clases del ciclo celular (G1, S, G2). La radiacin UV es un agente S-dependiente, que
induce a lesiones en el ADN en cualquiera de las etapas del ciclo celular, y esto
requieren necesariamente que el material hereditario cumpla una fase de replicacin
para convertir las lesiones en aberraciones especialmente de tipo cromtida (Carballo et
al., 2006). Este concepto concuerda con la mayor recurrencia de gaps cromatdico
reportados en esta investigacin.

INVESTIGACIONES MOLECULARES EN EL ECUADOR: GENOTOXICOLOGA

233

Un estudio sobre efectos mutagnicos de la fototerapia en linfocitos humanos de


neonatos hiperbilirrubinmicos demuestra que el efecto mutagnico y turbagnico de la
luz fluorescente genera aberraciones cromosmicas estructurales como gaps y
acntricos (p = 0,0001); gaps cromosmicos (p = 0,000183), rotura cromatdica (p =
0,0039), rotura cromosmica (p = 0,0012), y pulverizaciones (p = 0,0084). Mostrando la
capacidad mutagnica de la radiacin UV (Lpez et al., 1990).
La afidicolina es un agente clastognico que inhibe la formacin de la
polimerasa alfa (Paz-y-Mio et al., 2011b), actuando a nivel de replicacin, como a
nivel de mecanismos de reparacin e inhibiendo la sntesis de ADN (Speit & Schtz,
2008). El mecanismo de accin de la afidicolina se da por su carcter de micotoxina;
esta compite por dCPT (2'-Desoxicitidina 5'-trifosfato), siendo no competitiva con
respecto a los dNTP. Tal caracterstica hace que compita por el sitio de accin del dCPT
en la enzima, inhibiendo la accin de la polimerasa. Para que se d esta disociacin
constante se requiere concentraciones de 0,4 a 0,7 mM (Moyer & Meyer, 1979). El
incremento de aberraciones cromosmicas en general en los cultivos con afidicolina, se
debe a la clara accin de la afidicolina, deteniendo la maquinaria de replicacin del
ADN.
Es muy conocida la disminucin de la capa de ozono debido a la contaminacin
principalmente de agentes qumicos como los gases clorofluorurocarbonados. Este
fenmeno ha causado un incremento de la intensidad de la radiacin recibida, en
especial la radiacin UVB que tiene mayor efecto mutagnico. Por lo tanto, estimar en
poblacin ecuatoriana de forma objetiva la sensibilidad UV, as como el tiempo de
exposicin que induce a lesiones, permitira aproximar intervalos de riesgo,
considerando que la intensidad solar y los hbitos de exposicin solar en el pas son
prolongados.

El biomonitoreo gentico se convierte en una herramienta til para evaluar


posibles efectos ocasionados por diversos agentes mutagnicos. Las pruebas
citogenticas son de gran importancia ya que nos permiten asociar con procesos de
carcinognesis en poblaciones expuestas (Paz-y-Mio et al., 2008a, 2011). En este
trabajo se demostr el efecto mutagnico de la radiacin solar en personas
sobreexpuestas. Este tipo de trabajos puede colaborar con estrategias de prevencin
contra problemas dermatolgicos mayores, inclusive el cncer, que podran afectar a
este grupo poblacional.
Para mayor informacin, la investigacin denominada Dao gentico por
exposicin solar-ultravioleta en pescadores de la Costa ecuatoriana se public en la
Revista Mdica Eugenio Espejo el ao 2013 (Araujo et al., 2013).

Captulo XIII
Citogentica

Pese a los grandes adelantos en la Gentica Humana, es interesante percatarse


que recin en 1956, Tjio y Levan determinan el nmero de cromosomas humanos en 46.
Tres aos despus (1959), y gracias a las tcnicas de bandeo cromosmico, Lejeune y
Ford describen las primeras enfermedades asociadas a una anomala cromosmica. A
comienzos del siglo XX la Citogentica surge como una combinacin de conocimientos
entre la Histologa y la Gentica, teniendo por objeto la observacin del material
gentico de un organismo que se encuentra organizado en los cromosomas a travs del
microscopio en diferentes tejidos, analizando la estructura, el nmero de los
cromosomas y las implicaciones que tienen las diferentes alteraciones en el fenotipo del
organismo estudiado.
Los cromosomas son el material hereditario organizado en eucariontes, pasando
desde una simple cadena de ADN, hasta las complejas interacciones con protenas
histonas, no histonas y diversos cambios qumicos en el medio nuclear. Los
cromosomas cumplen las funciones de conservar, transmitir y expresar informacin
hereditaria, y fueron descubiertos por Nageli en 1842, aunque el trmino cromosoma
fue acuado por Waldenyer (1888) haciendo referencia a cuerpo coloreado, debido a
que los cromosomas se tien de un color brillante con ciertas tcnicas histolgicas.
En los comienzos de la Citogentica Humana, se asuma que el nmero
cromosmico humano era de 2n = 48, y que el mecanismo de determinacin sexual era
similar al de la Drosophila melanogaster, postulados que fueron descartados ms
adelante por considerarse errneos. En 1979, Hsu divide a la Citogentica Humana en
cuatro eras: era de los aos oscuros (1952), era hipotnica (1952 1958), era
trismico (1959 1969) y era de las bandas cromosmicas que inici en los
comienzos de 1979 y alcanz su mximo apogeo en 1976 con las tcnicas de alta
resolucin propuestas por Yunis.
Un gran avance en Citogentica fue el desarrollo de tcnicas que permitieron
observar secuencias especficas de ADN contenidas en regiones puntuales de los
cromosomas. De all nacieron tres metodologas: hibridacin somtica (Harris &
Watkins, 1965); cartometra de flujo (Carrano et al., 1973); y la hibridacin in situ
(Landegert et al., 1985). A partir de esta ltima tcnica se han desarrollado nuevas
tecnologas como el cariotipo espectral (SKY) caracterizando a los cromosomas de
manera independiente mediante el uso de sondas marcadas con fluorocromos.
Hoy en da, las herramientas en Citogentica Molecular permiten detectar
alteraciones cromosmicas de un tamao menor a 3 Mb o rearreglos muy complejos,
imposibles de detectar con Citogentica convencional, esto ha permitido la deteccin e
identificacin de muchas anomalas cromosmicas imperceptibles al ojo humano. La
hibridacin genmica comparativa (CGH) permite detectar cambios numricos de
secuencias de ADN en una muestra con ndice proliferativo bajo, ya que para la
realizacin de esta tcnica no es necesaria la obtencin de metafases. Y ms
recientemente, la CGH array ha aportado innumerables ventajas en la identificacin
exacta y detallada de muchas alteraciones cromosmicas.

CITOGENTICA

238

1.NIVELESDECOMPACTACINDELADN
El ADN, en la cromatina eucarionta, est compactado a travs de diferentes
niveles estructurales. El tamao lineal del ADN es extremadamente grande, mide 1,74
m en cada clula, por lo que es indispensable que este se plegue para caber en un ncleo
celular de 2 o 3 micras. Este plegamiento constituye los niveles de compactacin del
ADN.
1.1.Nucleosoma

El primer nivel de compactacin lo constituyen los nucleosomas. El nucleosoma


se forma por dos vueltas de ADN en un ncleo proteico conformado por 8 protenas
histonas (H2A, H2B, H3 y H4), e iones, formando una fibra de 10 nm de dimetro. Las
histonas son pequeas protenas bsicas; la parte central forman el ncleo del
nucleosoma mientras que las colas N y C se extienden hacia afuera. Cada octmero
tiene aproximadamente 1,7 vueltas de ADN alrededor y cada nucleosoma est
conectado al siguiente por un ADN de unin; la longitud vara de acuerdo al tipo de
especie o por el tipo de clula. La histona H1 unida en el punto donde entra y sale el
ADN en el complejo proteico se conoce como cromatosoma. La unin del ADN y las
protenas histonas es de naturaleza electrosttica entre los grupos cargados
positivamente de las histonas y las cargas negativas de los grupos fosfatos de ADN, es
decir, al aumentar o disminuir la fuerza inica del medio se puede provocar una
disociacin o una asociacin de las histonas con respecto al ADN (Burton et al., 1978).
1.2.Fibradecromatina

Gracias a la visualizacin por microscopa electrnica de los fragmentos de


cromatina en diferentes preparaciones, se ha evidenciado que el complejo de
nucleosomas compactados forma una fibra irregular de 30 nm de dimetro visible en
interfase celular, y ha sido objeto de estudio por varios cientficos en todo el mundo. La
funcin principal que se le atribuye a la cromatina es en esencia el plegamiento del
ADN.
El proceso de compactacin de la fibra de cromatina es dependiente de la
concentracin y de la naturaleza de los iones presentes en el medio nuclear. As, se ha
observado que la concentracin de iones monovalentes necesarios para provocar
plegamiento de la cromatina es mayor a la de iones divalentes (Thomas et al., 1994).
Esto implica que cuanto mayor es la valencia del ion, mayor es su capacidad estructural,
siendo menor la concentracin necesaria para plegar la cromatina (Koch et al., 2002).
En este mismo sentido, Subirana (1992) postul que el plegamiento de la cromatina
podra ser producto de la neutralizacin de las cargas del ADN. As, al aumentar la
fuerza inica, la fibra de cromatina se plegara buscando la estructura con un mnimo de
energa. En estudios realizados por microscopa inica de barrido se ha mostrado que
los cationes Mg2+ y Ca2+ son especficamente requeridos por la clula para la
condensacin de la cromatina en cromosomas mitticos.
La incapacidad de observar la ubicacin de nucleosomas individuales en la fibra
de cromatina condensada, a lo largo del tiempo, ha generado la aparicin de varios
modelos estructurales de la fibra de cromatina, de las cuales el modelo de solenoide es
el ms aceptado por la comunidad cientfica. Este modelo, propuesto por Finch y Klug

CITOGENTICA

239

(1976), se basa en una cadena de mononucleosomas agrupados, aproximadamente 6


nucleosomas por vuelta de hlice para formar la fibra de cromatina, para lo cual se
requiere que el ADN de unin se pliegue. Otros autores, a partir de diferentes estudios
por dispersin de neutrones (Suau et al., 1979) y dicrosmo elctrico (Yabuki et al.,
1982), han contribuido a ratificar este modelo. Tambin se han propuesto otros
modelos como: el modelo de superbead (Kiryanov et al., 1976; Frank et al., 1976), el
modelo helioidal de doble origen (Woodcock et al., 1984), y recientemente el modelo de
solenoide interdigitado compacto (Bartolom et al., 1995; Daban & Bermdez, 1998).
1.3.LazosdeADN
A su vez, el solenoide forma lazos de ADN (loops) de 60 a 100 Kb dentro de un
esqueleto proteico no histnico (teora del andamiaje o scaffold) formando una fibra de
300 nm de dimetro. Segn este modelo, la fibra de cromatina se une al eje proteico por
regiones especficas del ADN ricas en A y T denominadas regiones SAR. Estas
regiones interactan con las protenas no histonas condensinas, cohesinas y la Sci
(Topoisomerasa II), que constituye el 70% del citoesqueleto proteico (Figura XIII.1).
Adems, la actividad de transcripcin y replicacin est asociada con los puntos de
interaccin entre la matriz del andamiaje y las regiones SAR.
Finalmente, la estructura en lazos se autoenrolla nuevamente compactndose en
unidades adherentes del andamiaje formando una fibra de 700 nm de dimetro que
constituye la cromtide del cromosoma, que al compactarse en la metafase se reduce a
2000 nm. Los lazos estn empacados a modo de hlices superpuestas sujetas a un eje
central o andamio. Pienta y Coff (1984) sugirieron que 18 lazos de 60 Kb podran
distribuirse radialmente alrededor del esqueleto proteico, constituyendo una nueva
unidad estructural denominada mini banda. Existen varios modelos para explicar el
mecanismo de compactacin y formacin de la cromtide del cromosoma.
Se cree que los lazos son, en efecto, unidades funcionales de la replicacin y
transcripcin del ADN. Probablemente los cromosomas mitticos son el resultado de la
condensacin o agrupamiento de los lazos o loops de la cromatina interfsica,
llegndose a producir el nivel de compactacin del cromosoma mittico de 5 a 10 veces
ms sobre la cromatina en interfase. Con el desarrollo de la tcnica ensayo cometa se
esclareci que, al tratar a la clula con detergentes no inicos, la estructura nuclear
consista de una matriz nuclear compuesta de ADN, ARN y protenas; a esta
conformacin se lo denomin nucleoide y presenta un sper enrollamiento negativo.
Esta estructura est compuesta por lazos de ADN que permanecen anclados a una red de
naturaleza proteica (Cook & Brazell, 1976).
As dispuestos, todos los genes humanos se compactan (6, 36, 1000 y hasta
10000 veces respectivamente) para caber en el ncleo celular. De los 3 billones de pb,
cada banda cromosmica contendra de 10 a 20 millones de pb. El cromosoma menor
(21) tendra unos 3 cm del total del ADN y el cromosoma mayor (1) contendra 16 cm.
En la interfase celular existen zonas cromosmicas expuestas, que corresponderan a la
fibra de 10 nm con genes activos o con capacidad de activarse, mientras que el resto de
la cromatina la constituye la fibra de 30 nm. La informacin sobre el tamao del ADN
nos permite inferir que tan solo se necesitara unas 600 Mb para cubrir toda la
informacin gentica del ser humano, lo que representa del 10 a 20% del genoma.

CITOGENTICA

240

FIGURA XIII.1. NIVELES DE ORGANIZACIN DEL MATERIAL HEREDITARIO. La


doble cadena de ADN se compacta mediante la formacin del nucleosoma, solenoide,
cilindro eje, hasta la formacin del cromosoma (Modificado de The Real Swedish
Academy of Sciences, 2009; IIB, 2014).

CITOGENTICA

241

2.CROMOSOMAS,MORFOLOGAYNOMENCLATURA
Mediante la observacin de los cromosomas mitticos al microscopio de luz, se
puede apreciar que estos adoptan, bajo ciertas condiciones, una clara conformacin
helicoidal, a pesar de que al microscopio electrnico presenten una apariencia ms
desordenada. A travs del proceso de condensacin del material hereditario, se pasa de
una fibra de ADN con una longitud de 174 cm, a los cromosomas con una longitud de 2
a 8 micras.
Los cromosomas estn formados por dos cromtides unidas en el centrmero
(constriccin primaria), regiones terminales o telmeros y en ocasiones algunos
presentan pueden presentar satlites, separados del cromosoma por una constriccin
secundaria. El centrmero divide al cromosoma en dos brazos: uno corto (p) y uno largo
(q).
El complemento cromosmico de cada clula organizado sistemticamente se
denomina cariotipo. Este trmino se utiliza para describir la constitucin cromosmica
de una especie. La identificacin morfolgica de los cromosomas est basada en los
tamaos relativos de los mismos y de sus brazos. Un idiograma es la representacin
esquemtica de la morfologa cromosmica que se usa como diagnstico gentico en
humanos, y tambin para la comparacin de los cariotipos de diferentes especies y
variedades. El idiograma est basado en las medidas de los cromosomas en varias
clulas. Los cromosomas de acuerdo a la posicin del centrmero son (Figura XIII.2):

a)

Metacntrico: Cuando sus brazos son equidistantes con respecto al centrmero y por lo
tanto sus cromtides son de la misma longitud.

b)

Acrocntrico: Cuando el centrmero se localiza en la regin subterminal formando brazos


muy pequeos, generalmente con satlites.

c) Submetacntrico: Cuando la localizacin del centrmero tiende hacia uno de los extremos,

por lo que los brazos de las cromtides son desiguales.

d)

Telocntrico: Cuando el centrmero se ubica en la regin terminal del cromosoma, no


existen brazos p, este tipo de cromosoma no est presente en el humano.

En 1960, en la convencin de Denver, se unific la nomenclatura de los


cromosomas reconocindose dos grupos: autosomas (cromosomas somticos) y
gonosomas (cromosomas sexuales). Los autosomas se numeran del 1 al 22 ordenados
por tamaos decrecientes y, dentro del mismo tamao, por la posicin del centrmero.
Los cromosomas de tamao semejante se renen en grupos que se designan por letras
(A-G). A los cromosomas sexuales X y Y se les incluye en los grupos C y G
respectivamente.
Los cromosomas 1, 3, 16, 19 y 20 son tpicamente metacntricos; el cromosoma
2 est en el lmite entre metacntrico y submetacntrico; los cromosomas B representan
el tipo submetacntrico grande. Los cromosomas de los grupos C y E (a excepcin del
16) son tpicamente submetacntricos medianos y pequeos respectivamente. Los
cromosomas D y G son acrocntricos grandes y pequeos, y usualmente presentan
satlites en los brazos cortos. El cromosoma X es submetacntrico y al Y se le considera
acrocntrico sin satlites (Figura XIII.3).

CITOGENTICA

242

FIGURA XIII.2. CLASIFICACIN DE LOS CROMOSOMAS POR LA POSICIN DEL


CENTRMERO. Los cromosomas telocntricos se pueden encontrar presentes en
algunas especies de plantas (IIB, 2014).

Desde 1970 se han desarrollado nuevas tcnicas que permiten identificar a cada
par de cromosomas por su patrn caracterstico de bandas transversales, que se ponen de
manifiesto con mtodos especiales de tincin. Las tcnicas de bandeo cromosmico
consisten en exponer a los cromosomas a diferentes sustancias y colorantes para
desnaturalizar porciones de protenas del esqueleto cromosmico (histonas y no
histonas) o evidenciar secuencias de ADN con mayor o menor cantidad de enlaces bi o
trivalentes entre las bases nitrogenadas constitutivas de ADN (guanina, citosina, adenina
o timina). Estas posibilidades permitieron un gran impacto a nivel clnico ya que
permitieron diferenciar y caracterizar genticamente un elevado nmero de sndromes.
Caspersson public la primera observacin de cromosomas por mtodos
fluorescentes mediante la adicin de mostaza de quinacrina, denominado bandeo Q;
posteriormente, Arrighi desarrolla el bandeo C como una tcnica que permite reconocer
principalmente las regiones centromricas. Por otro lado, Sumner y Evans obtenan el
mismo resultado luego de un pretratamiento de los preparados con una solucin salina a
60C. En ambos casos se obtena un patrn de bandas, luego de la tincin con colorante
de giemsa, que era enteramente equivalente al patrn de bandas Q (de quinacrina)
obtenido por Caspersson. En este bandeo no fluorescente, las bandas que se tean de
oscuro (bandas G) eran las mismas que se observaban brillantes en la tincin con
quinacrina, mientras que las bandas claras correspondan a las bandas apagadas u
opacas con quinacrina. Este patrn de bandas no fluorescentes se denomin G (giemsa);
el ms empleado hasta la actualidad en los laboratorios de Gentica (Caspersson et al.,
1999).
La descripcin cada vez ms exacta del estudio de las alteraciones
cromosmicas, su comportamiento en la divisin celular y sus implicaciones en diversas

CITOGENTICA

243

patologas, abre da a da el espectro de accin de la Gentica. Actualmente, la


Citogentica usa metodologas derivadas de la Gentica Molecular como las tcnicas
FISH para el esclarecimiento de varias cromosomopatas congnitas submicroscpicas.
Las alteraciones genticas en general, pueden tener un patrn hereditario: autosmico
dominante, autosmico recesivo, ligado al sexo, herencia mitocondrial y herencia por
impresin gnica del ADN, edicin del ARN y anticipacin gentica, dentro de los
procesos de inestabilidad cromosmica (CI) que hacen referencia a cambios en la
morfologa, en la estructura cromosmica o en el nmero de cromosomas. Hay regiones
cromosmicas que presentan alta variabilidad. Una correcta discriminacin de las
variantes inofensivas de verdaderas anomalas, especialmente durante el diagnstico
prenatal, es crucial para permitir un asesoramiento gentico (Kowalczys et al. 2007).
Por lo tanto, una caracterizacin completa de la anormalidad detectada por el uso de
todos los mtodos disponibles es necesaria para un asesoramiento gentico adecuado.

FIGURA XIII.3. CARIOTIPO HUMANO (MUJER). Fotografa que representa los 22


pares de cromosomas somticos y un par de cromosomas sexuales en el humano
(Modificado de Paz-y-Mio & Lpez-Corts, 2011; IIB, 2014).
3.ANORMALIDADESCROMOSMICASNUMRICAS
Generalmente se ha asociado anormalidades numricas a fallos en las etapas de
metafase y anafase, sin embargo, tambin este tipo de alteraciones pueden deberse a
fallas en los puntos de control (checkpoints) G1-S y G2-M generando aneuplodas. Se
denominan aneuploidas, a ganancias o prdidas de todo el juego de cromosomas (36 +
23 46 + 46) o poliploidas mucho ms grandes, sobre todo observables en cncer. En
recin nacidos se observa espordicamente este tipo de alteraciones, que no son viables
y se traducen en polimalformaciones.

CITOGENTICA

244

Existen varios tipos de protenas asociadas con la regulacin del ciclo celular en
clulas de mamferos que han sido relacionadas con problemas en la segregacin de
cromtides provocando alteraciones numricas de los cromosomas. En la actualidad se
realiza la identificacin de genes que promuevan la formacin de estas protenas, que
regulen la etapa G1-S y la unin de los microtbulos con los cinetocoros de los
cromosomas en la mitosis. Los complejos SCF (Skp1-Cullin-F-box) y APC/C
(complejo promotor de anafase) son dos clases de ligasas de ubiquitina que regulan la
transicin de G1-S y metafase-anafase, respectivamente (Carballo et al., 2006).
En investigaciones del punto de control G2-M se ha identificado el gen CHFR
(Checkpoint with forkhead and ring finger domains), el cual se encarga de regular los
estadios de la mitosis, deteniendo la condensacin cromosmica en respuesta a un estrs
mittico e interactuando con PLK (Polo-like kinase) (Erson, 2004). Investigaciones
recientes han descubierto otras protenas ligadas con este punto de control, las AU-K
(Aurora kinase) corresponden a una nueva familia de quinasas, la desregularizacin de
estas protenas induce fallos en el ensamblaje del huso, en la funcin del punto de
control G2-M y en la divisin celular provocando poliploidas (Meraldi et al., 2004).

4.MOSAICOYQUIMERA
Se denomina mosaico a dos o ms lneas celulares genticamente diferentes en
un mismo individuo. El mosaicismo puede ser causado por factores de mutacin en el
ADN, factores epigenticos o anormalidades cromosmicas. Este puede presentarse
tanto en la lnea somtica como en la lnea germinal. El mosaicismo surge durante la
embriognesis, es decir, es un evento postcigtico, y tanto el mosaicismo somtico
como el germinal pueden coexistir en el mismo individuo dependiendo de la clula
especfica afectada y el momento de desarrollo del evento de induccin del mosaicismo.
La frecuencia de mosaicismo podra depender del trastorno en particular, el tejido de
origen o de presin selectiva. Por ejemplo, ms del 83% de los pacientes con
tirosinemia hereditaria tipo I, debido a mutaciones heredadas en el gen FAH
(fumarilacetoacetato hidrolasa), parecen tener hgados mosaico que consisten en
poblaciones mutantes y revertido de hepatocitos (Kvittingen, 1994).

5.ANORMALIDADESCROMOSMICASESTRUCTURALES

Las anormalidades estructurales en los cromosomas son cambios en la estructura


de uno o varios de ellos. Estos cambios morfolgicos pueden ser espontneos o
inducidos por diversos agentes mutagnicos, y si bien este tipo de rearreglos tienen un
importante rol evolutivo, tambin pueden repercutir a corto plazo en el fenotipo del
individuo o de su descendencia. Tienen origen en errores en los mecanismos de
reparacin del ADN, como resultado de una reparacin incorrecta de roturas de doble
cadena que desencadena en rearreglos morfolgicos de los cromosomas. La expresin
de los rearreglos cromosmicos en la divisin celular puede ser de dos tipos:

5.1.Estables

Las alteraciones estructurales tienen que ver con rotura de cromosomas y el


consiguiente rearreglo en una combinacin anormal. De la misma manera que las

CITOGENTICA

245

anteriores, se puede encontrar algunos tipos de estas alteraciones, pudiendo ser estables
e inestables. Para comprender de mejor manera, la disposicin cromosmica es:

Las alteraciones estructurales estables son las siguientes:


5.1.1.Duplicacin
Una duplicacin interesante es la que ocurre en la regin terminal del
cromosomas 21, especficamente la regin q21, en esta se encuentra la informacin
gentica bsica para producir el fenotipo del sndrome de Down. En estos casos, poco
frecuentes y solo detectables por tcnicas ms finas como el FISH, el nmero
cromosmico es 46.

5.1.2.Delecin
Existen muchas deleciones que producen fenotipos polimalformativos y los
estudios sobre cncer muestran que son causa primordial para la instauracin de esta
enfermedad.

5.1.3.Insercin
Su origen puede ser una translocacin no recproca. Sobre todo en cncer,
muchas de las alteraciones cromosmicas que se encuentran son originadas en este tipo
de alteracin, y justamente la FISH ha servido para evaluar el origen del material
gentico sobrante.

5.1.4.Translocacin
Existen dos tipos, las recprocas y las robertsonianas. En la primera est
involucrado cualquier cromosoma, mientras que la segunda solo se da entre los
cromosomas acrocntricos, se las conoce tambin como fusin centromrica. En la
evolucin de las especies, las fusiones centromricas han sido importantes en la
reorganizacin del material gentico. Por ejemplo, el cromosoma 2 humano, es producto
de la fusin centromrica de dos cromosomas del chimpanc.
5.1.4.1.Recproca
Este tipo de translocacin consiste en la transferencia de segmentos entre dos
cromosomas, de tal forma que se producen daos en la conformacin pero no en el
nmero total de los cromosomas.

CITOGENTICA

246

5.1.4.2.Robertsoniana

Tipo a: Un cromosoma se pierde ya que no tiene centrmero y se genera un


cromosoma dicntrico.

Tipob: El microsoma suele perderse y se genera un cromosoma fusionado.

La translocacin t(14;21) ocupa el 50% de todas las translocaciones descritas.


Los individuos pueden ser portadores sanos de estas alteraciones, por lo tanto no
presentan cambios en su fenotipo, aunque se ha descrito que ser portador podra estar
asociado a problemas de fertilidad. Los portadores generan gametos anormales, as: los
individuos con translocaciones recprocas originan 4 tipos de gametos, uno normal, uno
portador de la translocacin y dos gametos alterados que al unirse con un gameto
normal determinar individuos doblemente afectos, esto es, trismico parcial de una
zona de los cromosomas y monosmico parcial de otra.

Gametosnormales

Gametosalterados

CITOGENTICA

247

Individuosformados

Las translocaciones robertsonianas producen 6 tipos de gametos. El siguiente


ejemplo aclara este punto: utilizando la translocacin t(14;21) tenemos 6 gametos: 14
con el 21, 14;21, 14, 21, 14;21+21, 14;21+14.
Al unirse estos gametos con otro gameto perteneciente a cromosomas normales,
durante la fecundacin, se producirn individuos sanos e individuos afectos de alguna
cromosomopata, as se originan enfermedades por translocacin como el sndrome de
Down (Tabla XIII.1):

Tabla XIII.1. Translocaciones robertsonianas y gametos


Gameto normal

Gameto alterado
14 y 21

14 y 21

14;21
14
21
14;21+14
14;21+21

Resultante
14 y 21
14 y 21
14;21
14 y 21
14 y 21
14
14 y 21
14;21+14
14 y 21
14;21+21

Normal
Portador de la
translocacin
Monosmico
Monosmico
Trismico inviable
Trismico 21

CITOGENTICA

248

5.1.5.Inversin

Existen dos tipos, las paracntricas y las pericntricas.

5.1.5.1.Paracntrica

Se refiere a que no involucra al centrmero.

5.1.5.2.Pericntrica

Se refiere a que involucra al centrmero. La ms frecuente de estas es la


inversin del cromosoma 9, que se ha informado hasta en el 3% de individuos en
algunas poblaciones. En el Ecuador es de muy baja frecuencia (< 1%).

Las inversiones tambin tienen comportamientos especiales en los individuos.


Se puede portar una inversin y tener descendencia con afecciones cromosmicas. Los
individuos que portan una inversin forman cuatro tipos de gametos: uno normal, uno
con la inversin, un fragmento acntrico y un gameto con un cromosoma dicntrico. El
cruce con un gameto normal puede producir individuos afectos, sobre todo de
deleciones.

5.1.6.Isocromosomas
Tanto los brazos cortos como largos tienen la misma informacin, resultan de la
rotura y reunin del centrmero.

5.2.Inestables

Se presentan de dos maneras:


5.2.1.Anillo

Se produce por la rotura y delecin de los telmeros de un cromosoma, luego de


lo cual los extremos libres buscan estabilidad y se fusionan. Los anillos siempre son
postcigticos, por lo tanto, siempre se los encuentra en mosaicos celulares. Los anillos
autosmicos parece que se mantienen estables en el tiempo, tanto en sus diversas formas
que pueden presentarse como en los porcentajes de las lneas celulares del mosaico.

CITOGENTICA

249

5.2.2.Dicntricos
Se producen por la delecin de los telmeros de un brazo de un cromosoma y de
los telmeros de otro cromosoma; los extremos libres se juntan formndose un
cromosoma con dos centrmeros funcionales.

Las anomalas cromosmicas estructurales se producen por prdidas de material


o deleciones, la doble delecin de los telmeros con la subsecuente formacin de
anillos, las ganancias de porciones de material determinando duplicaciones, las
inversiones de porciones cromosmicas que involucren al centrmero (pericntricas), o
que no involucren al mismo llamadas paracntricas, y las translocaciones o intercambio
de material entre dos cromosomas; y, pueden se translocaciones recprocas o no
recprocas o inserciones.
Tabla XIII.2. Incidencia de las anomalas cromosmicas en la poblacin general

Tipo
Autosmicas
Trisoma 21
Trisoma 13
Trisoma 18
+ marcador
+ marcador mosaico
Deleciones
Inversiones
Translocaciones D/D
Translocaciones D/G
Translocaciones recprocas equilibradas
Translocaciones recprocas desequilibradas
Otras

Incidencia por cada 1000 nv

Gonosmicas
Sndrome de Turner
Polismicas X
Sndrome de Klinefelter
Polisoma
Sndrome de Martin Bell o X frgil

Mujeres (m) hombres (h)


0,10 m
1,00 m
1,00 h
1,00 h
1,80 h

1,15
0,05
0,15
0,22
0,90
0,90
0,13
0,79
0,20
0,85
0,11
0,04

CITOGENTICA

250

Los mecanismos que producen anomalas cromosmicas se los detalla en la


Tabla XIII.3.
Tabla XIII.3. Mecanismos que producen anomalas cromosmicas
Factor
No disyuncin meitica
No disyuncin mittica
Anafase larga en meiosis
Anafase larga en mitosis
Doble fertilizacin
Retencin del 2do cuerpo polar
Fusin de cigotos gemelos
Rotura y reorganizacin cromosmica
Segregacin anmala de translocaciones
Crossing over en meiosis de heterocigotos

Efecto
Aneuploida (tri o monosoma)
Mosaicismos o aneuplodas
Monosoma
Mosaicismo
Triploida-tetraploida
Triploida-tetraploida
Gemelos unidos-quimeras
Anomalas estructurales
Mono o trisomas parciales
Cromosomas acntricos, dicntricos

En relacin a cifras de cromosomopatas en estudios ecuatorianos, los datos son


limitados. El estudio de Varas da una frecuencia de alteraciones cromosmicas de
0,25%, repartidas en la Tabla XIII.4.
Tabla XIII.4. Frecuencia de cromosomopatas en Quito, ao 1989
Cromosomopata
Trisoma 21
Trisoma 13
Trisoma 18
Trisoma 9 en mosaico
Sndrome Klinefelter
Total de cromosomopatas
Total nacidos vivos

Nmero
23
3
2
1
1
30
12112

%
76,7
10,0
6,7
3,2
3,2

Frecuencia
0,19
0,03
0,02
0,01
0,01
0,25

(Varas, 1989)
Las cifras de cromosomopatas en el Ecuador, obtenidas del trabajo de nuestro
laboratorio, se las ha agrupado dentro de lo que constituye el Registro Nacional
Colaborativo de Alteraciones y Variantes Cromosmicas Humanas (RNCAVCH) (Pazy-Mio et al., 1993a), y que actualmente forma parte del Repository of Human
Chromosomal Variants and Anomalies (Borgaonkar, 1987). Este registro tiene como
objetivos: Recopilar informacin sobre la relacin fenotipo-genotipo; tener una base de
datos sobre las cromosomopatas; encontrar alteraciones y variantes tpicas de nuestra
regin; localizar los laboratorios de gentica, sus lneas de trabajo y sus resultados. Para
conformar este registro se parti de los siguientes prerequisitos:

a) Confidencia de la informacin.

b) Identificacin adecuada de cada caso.

c) Informacin completa del cariotipo.

d) Facilidad para localizar a los pacientes.

La informacin que se incluye en el registro, producto de la recopilacin de los


datos registrados en los diferentes laboratorios que han colaborado voluntariamente, de

CITOGENTICA

251

la informacin obtenida a travs de la bibliografa cientfica y de comunicaciones


personales con los diferentes genetistas del pas, es precisa e incluye: tejido usado para
el estudio y confeccin del cariotipo; causa de acercamiento o inclusin de los
probandus, sea estudio poblacional, en instituciones, poblacin control, estudio de
investigacin, referencia clnica o tipo de alteracin cromosmica; y, datos del fenotipo
del probandus.
Para la base de datos del registro se ha utilizado el International System for
Human Cytogenetic Nomenclature y el sistema de clave del Repository of Human
Chromosomal Variants and Anomalies, an International Registry of Abnormal
Karyotypes. Bajo este esquema, hasta el ao 2012 se han tabulado un total de 858
autosomopatas y 329 gonosomopatas en individuos de la poblacin ecuatoriana.
Desde hace algunos aos se ha puesto atencin en un fenmeno interesante
relacionado con las variaciones interindividuales de las cromosomopatas estructurales o
de las genopatas (sndromes reconocibles), esto es, la variacin fenotpica que se
encuentra entre los afectos de la misma cromosomopata o genopata y que confieren
variabilidad a los sndromes con patrones reconocibles, por ejemplo: al sndrome de
Prader Willi se lo ha asociado con una delecin del brazo largo del cromosoma 15 (del
15q11), y se caracteriza por hipotona, manos y pies pequeos, ojos en forma de
almendra, hipogonadismo, retardo mental, obesidad y estatura baja (patrn sindrmico
reconocible); pero, pueden existir variaciones fenotpicas como defectos en la pared
ventricular, hipoplasia del lado derecho del corazn, anomalas renales y vula bfida.
Estas variaciones fenotpicas ms o menos graves, parecen deberse al tipo y
extensin de la alteracin cromosmica, es decir, a la cantidad de genes implicados en
la delecin; esto significa, que la delecin 15q11 no es siempre igual a nivel molecular,
pudiendo variar en unas decenas o centenas de bases del segmento de ADN principal o
gen clave, lo que se manifestara en fenotipos atpicos de acuerdo a los genes o
porciones de genes implicados en la delecin 15q11; a este fenmeno, en que la
informacin gentica se perdera en mayor o en menor cantidad alrededor de los genes
claves del sndrome con patrones reconocibles, se lo ha llamado sndrome de genes
contiguos. Este nuevo comportamiento de los genes solos o dentro de los cromosomas
se ha visto en otras enfermedades y sndromes con fenotipos variados, como el
sndrome de DiGeorge, el sndrome de Langer-Giedion, el sndrome de Miller-Dieker,
retinoblastoma, tumor de Willms con aniridia, el sndrome de Beckwith-Wiedemann,
entre otros, que actualmente han despertado gran inquietud en los investigadores.
En el ao 2012, el Instituto de Investigaciones Biomdicas public un artculo
cientfico en Journal of Biomedicine and Biotechnology sobre las variantes y
alteraciones cromosmicas en la poblacin ecuatoriana. Un total de 2636 individuos han
sido analizados durante los ltimos 13 aos. Los cariotipos han sido observados a travs
de la tcnica bandeo G durante el perodo 1998-2012. Los individuos llegaron de
diferentes partes del pas y fueron referidos al IIB para realizar los respectivos anlisis
citogenticos (Paz-y-Mio et al., 2012b). Los diagnsticos fueron clasificados de
acuerdo al An International System for Human Cytogenetic Nomenclature (Shaffer et
al., 2005) y organizados en nmero y porcentaje de casos con autosomopatas
cromosmicas, gonosomopatas cromosmicas, variantes cromosmicas y polimrficas.
En la siguiente tabla se detallan las autosomopatas cromosmicas registradas:

CITOGENTICA

252

Tabla XIII.5. Autosomopatas cromosmicas


Casos
Trisoma 9 (mosaico)
Trisoma 13
- Mosaico
Trisoma 18
- Mosaico
Trisoma 19
- Mosaico
Trisoma 21
- Trisoma libre
- Mosaico
- Isocromosoma
- Translocacin
- Translocacin mosaico
Trisoma 22
Trisoma parcial
- 4p+
- 7p+
- 9p+
- 14p+
- 15p+
- 19p+
- 19q+
- 21q+
- 22p+
Monosoma parcial
- 5p- 12p- 17q- 13q- 18pIsocromosoma 17
Cromosoma 4 anillo
Cromosoma 9 anillo
Cromosoma 15 anillo
inv (9) mosaico
Add (8) (p23)
Total

Nmero
2
14
1
19
1
2
1

Porcentaje (%)
0,2
1,6
0,1
2,2
0,1
0,2
0,1

674
91
5
14
1
1

78,6
10,6
0,6
1,6
0,1
0,1

2
1
1
3
3
2
1
1
2

0,2
0,1
0,1
0,3
0,3
0,2
0,1
0,1
0,2

4
1
1
3
1
1
1
1
1
1
1
858

0,5
0,1
0,1
0,3
0,1
0,1
0,1
0,1
0,1
0,1
0,1
100

6.CASOSCLNICOS
En el Instituto de Investigaciones Biomdicas se han analizado varios casos de
gran inters en el rea de la Citogentica Molecular. A continuacin se presentan dos:
6.1.Caso1:Anilloenelcromosoma4
Los cromosomas en anillo no son comunes, usualmente los pacientes con esta
alteracin gentica comprenden graves dismorfas fenotpicas, retardo mental
intermedio y la imposibilidad de reproduccin. En lo que respecta al cromosoma 4 en
anillo, se han reportado 20 casos en la literatura en todo el mundo (NCBI, 2013).

CITOGENTICA

253

En el IIB se recibi el caso de una paciente de gnero femenino producto de una


tercera gesta de padres sanos sin ninguna anormalidad patente. La madre present
fenotipo normal. La paciente naci de 40 semanas con un Apgar de 8-9. Su talla fue de
47 cm, su permetro ceflico de 32 cm y su peso de 2940 gramos. Present
dismorfognesis importante (frente aplanada, nariz picuda, microcefalia, micrognatia y
un orificio de 0,5 mm en la regin lumbosacra), estatura baja y retardo mental leve.
A la paciente se le realiz el estudio citogentico a los 10 das de nacimiento, lo
que revel la presencia de un anillo del cromosoma 4 en el 80% de las metafases
analizadas y la lnea normal de 46 cromosomas en el 20% restante (Figura XIII.4). Por
su parte, la madre mostr un cariotipo normal 46, XX.

FIGURA XIII.4. ANLISIS CITOGENTICO CONVENCIONAL (CASO 1). Se puede


observar la presencia de un anillo en el cromosoma 4, tanto en la metafase como en
el cariotipo (IIB, 2014).

Diez aos despus se vuelvi a realizar el estudio a la paciente y se realiz


arrays de mapeo gentico; se utilizaron 750 ng de ADN para la hibridacin en el array

CITOGENTICA

254

Affymetrix 750K, siguiendo las instrucciones del fabricante. Los arrays se lavaron en la
estacin de fluidos Affymetrix 450 y fueron escaneados utilizando un escner GeneChip
3000 (Tabla XIII.6).
Tabla XIII.6. Anlisis de arrays
Cromosoma

Banda

Inicio (Mb)

Fin (Mb)

Alteracin

p16,3

68345

1778803

Prdida

#
copias
1

p16,3

1784441

2126584

Ganancia

p35,2

187900881

190957460

Prdida

Genes
ZNF595,
ZNF718,
ZNF876P,
ZNF732,
ZNF141,
ABCA11P,
ZNF721, PIGG, PDE6B, ATP5I, MYL5,
MFSD7, POGF3, LOC100129917,
CPLX1, GAK, TMEM175, DGKQ,
SLC26A1, IDUA, FGFRL1, RNF212,
TMED11P,
SPON2,
LOC100130872-SPON2,
LOC100130872, CTBP1, C4orf42,
MAEA, KIAA1530, CRIPAK, FAM53A,
SLBP, TMEM129, TACC3
FGFR3, LETM1, WHSC1, SCARNA22,
WHSC2, MR943, C4orf48, NAT8L,
POLN
ZFP42,
TRIML2,
TRIML1,
LOC401164, FRG1, TUBB4Q, FRG2

La utilizacin de los arrays determin las prdidas de 4p16,3 y 4q35,2 que


llevaron a la formacin del anillo cromosmico. Se ha podido asociar genes de 4p16,3
con el fenotipo de la paciente.
6.1.1.Anlisisdelcromosoma4mediantelatcnicaFISH
Para confirmar las regiones perdidas en las partes terminales del cromosoma se
utiliz la tcnica FISH. Para este anlisis se emplearon sondas para evaluar el estado de
4p16,3 (cromosoma 4: 492870-793359) y 4q35,2 (cromosoma 4: 190183811190408149), y como control el centrmero de 4 (cromosoma 4: 48461959-49066696)
segn el protocolo de origen (Agilent) (Figura XIII.5).

Ncleos4q35,24p16,3
FIGURA XIII.5. REGIONES DEL CROMOSOMA 4 ANALIZADAS MEDIANTE FISH.
Esta tcnica permite ver la presencia de regiones telomricas y centromricas
mediante sondas fluoromarcadas (IIB, 2014).

6.2.Caso2:Trisomaparcialenelcromosoma8
Alrededor de 40 casos han sido descritos con una anormalidad de 8p que se ha
referido a duplicaciones o inversiones (Feldman et al., 1993; Minelli et al., 1993). La

CITOGENTICA

255

trisoma 8 es una anomala cromosmica poco frecuente. Se estima que presenta una
prevalencia de 1/25000 recin nacidos con una relacin hombre-mujer de 5:1.
Lleg a consulta una nia de 3 semanas con un fenotipo similar al descrito en la
trisoma parcial del cromosoma 8. Este inclua la presencia de anomalas en las
fontanelas, paladar alto, orejas de implantacin baja, hipertelorismo, micrognatia,
hipotona muscular generalizada, retraso psicomotor moderado prximo a grave,
trastornos del tono y la postura, hipoacusia neurosensorial ligera bilateral. Adems,
presentaba convulsiones tnico clnicas generalizadas que se acompaaban de cianosis
y desviacin de la mirada. Al realizarle un electro encefalograma se detect un electroonda paroxstico focal de predominio central izquierdo. Se le realiz tambin una TAC
de crneo, la cual mostr una leve ventriculomegalia y un ecocardiograma que permiti
evidenciar un soplo sistlico. Por otro lado, la paciente tambin presentaba polidactilia,
la cual no ha sido reportada en pacientes con esta alteracin cromosmica.

FIGURA XIII.6. ANLISIS CITOGENTICO CONVENCIONAL (CASO 2). Se puede


observar la presencia de una trisoma parcial en el cromosoma 8 en el cariotipo del
paciente investigado (IIB, 2014).

CITOGENTICA

256

Se decidi realizar el cariotipo a la nia y a sus progenitores. Para este anlisis


se tom una muestra de sangre perifrica y se realiz un cultivo de 72 horas con RPMI
1640 suplementado con suero fetal bovino. Los linfocitos fueron estimulados con
fitohemaglutinina. Los resultados mostraron un cariotipo 46,XX,add(8)(p23.3?) en la
nia, 46,XX,t(2;8)(p23;p23) en la madre y un cariotipo normal en el padre (Figura
XIII.7).
Para definir con mayor exactitud la alteracin encontrada en el cromosoma 8 de
la nia y los puntos de rotura de los cromosomas involucrados en la translocacin
identificada en la madre, se realizaron arrays de mapeo gentico. La utilizacin de los
arrays evidenci las alteraciones del brazo corto del cromosoma 8 responsables del
fenotipo observado en la paciente. Tambin se identificaron cambios en el nmero de
copias que podran corresponder a los puntos de rotura involucrados en la translocacin
detectada en la madre. Se ha podido asociar genes del brazo corto del cromosoma 8 con
el fenotipo de la paciente (Figura XIII.7), y genes de los cromosomas 7 y 11
responsables de la polidactilia.
CSMD1
DLGAP2
CLN8
MYOM2

CTSB
GATA4
MTMR9
MCPH1
DEFB1
XKR6

PCM1
SGCZ

Paladarhendido
Epilepsia
Epilepsiayretrasomental
Miocardiopata

PPP2R2A
BNIP3L

Paladarhendido
Paladarhendido,miocardiopatasyepilepsia

ESCO2

SndromedeRoberts

Convulsiones
Anormalidadesencorazn
Epilepsia
Problemascardiovasculares
Presenciadelconductoarteriosopersistente
Paladarhendido

Hidrocefalia
Convulsionesgeneralizadasydistrofiamuscular

FIGURA XIII.7. GENES ASOCIADOS CON FENOTIPO EN EL CROMOSOMA 8. El


paladar hendido, la epilepsia, distrofia muscular y los problemas cardiovasculares se
asocian con alteraciones en el cromosoma 8 (GeneCards, 2014; IIB, 2014).

CITOGENTICA

257

En la siguiente tabla se detallan las gonosomopatas cromosmicas registradas:


Tabla XIII.7. Gonosomopatas cromosmicas
Casos
Sndrome de Turner
- Monosoma
- Mosaico
- Isocromosoma
- Isocromosoma mosaico
- Anillo mosaico
Trisoma X
- Mosaico
Fra (X) (q27,3)
Sndrome de Klinefelter
- Mosaico
47,XYY
48,XXYY
49,XXXXY
Desorden en el desarrollo sexual
- Pseudohermafroditismo femenino
- Pseudohermafroditismo masculino
- Disgenesis gnadas mixtas
- Disgenesis gnadas puras
- Genitalia ambigua
Total

Nmero

Porcentaje (%)

132
109
6
8
1
3
3
6
17
4
7
4
1

40,1
33,1
1,8
2,4
0,3
0,9
0,9
1,8
5,2
1,2
2,1
1,2
0,3

6
17
2
1
2
329

1,8
5,2
0,6
0,3
0,6
100

En la siguiente tabla se detallan las variantes y translocaciones registradas:


Tabla XIII.8. Translocaciones y variantes
Translocacin
t(1;20)
t(2;8)
t(2;12)
t(2;18)
t(4;11)
t(5;14)

Nmero
1
1
2
2
3
5

Translocacin
t(6;7)
t(7;10)
t(13;14)
t(13;15)
t(X;8)
t(X;21)
Total

Nmero
2
1
3
2
3
1
26

Variantes
1qh+
9qh+
15ps+
16ph+
Yqh+
YphTotal

Nmero
2
6
1
1
23
4
37

Como datos concluyentes, la trisoma 21 es la autosomopata cromosmica de


mayor porcentaje: 78,6% de trisoma libre y 10,6% en mosaico en la poblacin
analizada; seguida de la trisoma 18 (2,2%) y la trisoma 13 (1,6%).
Con respecto a las gonosomopatas cromosmicas, el sndrome de Turner es el
ms frecuente: 40,1% en monosoma y 33,1% en mosaico; seguido del sndrome de
Klinefelter con el 5,2% y el pseudohermafroditismo masculino con el 5,2%.
En cuanto a variantes y polimorfismos, la variante Yqh+ se encontr presente en
23 de 37 individuos analizados (Paz-y-Mio et al., 2012b).

Captulo XIV
La gentica de la diferenciacin sexual

Este captulo trata sobre los factores genticos involucrados en los procesos de
diferenciacin sexual tanto normal como alterada.

1.DIFERENCIACINSEXUAL
La diferenciacin sexual es un proceso complicado en el que juega un papel
importante la informacin cromosmica, gentica y hormonal. El fenotipo varn o
mujer es el resultado de la armoniosa actividad de todos los factores mencionados
(Goodfellow, 1991; Brown, 2002).

1.1.Diferenciacinsexualnormal
En primer trmino, la diferenciacin sexual est comandada por la dotacin
cromosmica del cigoto. Cuando exista el cromosoma Y, la diferenciacin de la gnada
primitiva y del tubrculo genital primitivo sern hacia testculo y caracteres sexuales
masculinos respectivamente; mientras que, la ausencia de cromosoma Y diferenciar
hacia ovario y caracteres sexuales femeninos (McLaren, 1991; Paz-y-Mio et al.,
1993b). Un aspecto interesante sobre la diferenciacin sexual es el anlisis del gen de la
determinacin sexual, llamado SRY (Tabla XIV.1).
Tabla XIV.1. Caractersticas del gen SRY
Caractersticas
Smbolo oficial
Nombre
Otros alias
Cromosoma
Localizacin
# Acceso NCBI
Gen ID
Tamao secuencia
Tamao protena
Localizacin subcelular

Informacin
SRY
Regin Y que
determina el sexo
TDF
Y
Yp11,3
NC_000024,9
6736
897 bases
204 aa; 23884 Da
Ncleo; citoplasma

Estructura proteica

(Werner et al., 1995)

Este gen ha sido localizado en el brazo corto del cromosoma Y, en donde ya se


pensaba que exista el factor de determinacin testicular.

FIGURA XIV.1. CROMOSOMA Y HUMANO. Ubicacin del gen SRY (GeneCards,


2014).

LA GENTICA DE LA DIFERENCIACIN SEXUAL

262

En la Figura XIV.2 observamos la amplificacin de un fragmento de 470 pb


correspondientes al gen SRY, tanto en un control positivo como en el caso analizado. El
anlisis tambin cuenta con la amplificacin de un fragmento de 240 pb
correspondientes al gen endgeno GAPDH, el cual se utiliza como control positivo de
presencia de ADN.

FIGURA XIV.2. ANLISIS MOLECULAR DEL GEN SRY. La amplificacin del gen SRY
ayuda a entender el genotipo de un individuo para asociarlo con su fenotipo (IIB,
2014).

El descubrimiento de este gen y de una secuencia similar en el brazo largo del


cromosoma X, ha permitido actualizar los conceptos de diferenciacin sexual. Bajo esta
perspectiva, existen algunos prerequisitos para la diferenciacin gentica y
cromosmica del gnero (Brown, 2002):

a)

No se necesita todo el cromosoma Y para la identificacin sexual, basta con el SRY.

b)

El cromosoma X tiene secuencias similares al gen SRY, que podran estar activas o
inactivas en presencia o ausencia del gen SRY del cromosoma Y.

c)

Existen otros genes implicados en la diferenciacin sexual, que podran estar regulados por
el gen SRY, como con el gen CHI, MIF (factor de inhibicin mulenaria), el antgeno H-Y y
otros genes autosmicos.

d)

Los varones seran heterodmeros SRY positivos.

e)

Las mujeres seran homodmeros SRY negativos.

A nivel embrionario, la dotacin cromosmica XY o XX producir el siguiente


efecto: el sexo heterogamtico XY desarrollar los componentes de los conductos de
Wolff hacia rganos sexuales internos masculinos (vesculas seminales, conducto
deferente, epiddimo); el sexo homogamtico XX, desarrollar los derivados del
conducto de Mller hacia rganos internos femeninos (trompas uterinas, tero, vagina

LA GENTICA DE LA DIFERENCIACIN SEXUAL

263

superior), el tubrculo genital primitivo desarrollar hacia pene, escroto y uretra anterior
en caso de ser XY, mientras que desarrollar labios mayores, menores, uretra anterior,
vagina anterior y cltoris en caso de ser XX (Paz-y-Mio et al., 1993b).
Una vez formada la gnada masculina o femenina, sta empezar a producir
ciertas hormonas que coadyuvarn a la diferenciacin sexual. Los andrgenos
(testosterona y dehidrotestosterona) cooperarn en la formacin del conducto deferente,
vesculas seminales, epiddimo, cuerpo del pene y escroto, en el caso de ser varn y, en
caso de ser mujer, participarn en la conformacin del cuerpo del tero y la vulva
(McLaren, 1991).
1.2.Diferenciacinsexualalterada
La primera preocupacin sobre la diferenciacin sexual alterada surgi con el
descubrimiento de individuos hermafroditas XX, varones XX y mujeres XY. Estas
alteraciones cuestionaron algunos aspectos sobre la diferenciacin sexual normal. El
descubrimiento del antgeno H-Y, del gen SRY, de los papeles de las hormonas en el
desarrollo de los caracteres sexuales primarios y secundarios, ha permitido comprender
mejor las alteraciones de la diferenciacin sexual y clasificarlas (Paz-y-Mio et al.,
1993b).

2.CLASIFICACINDELOSESTADOSINTERSEXUALES

Los estados intersexuales pueden tener la presencia de alteraciones en los


conductos sexuales y de alteraciones del sexo gonadal.

2.1.Alteracindelosconductossexuales

Las alteraciones de los conductos sexuales pueden diferenciarse entre


pseudohermafroditismo femenino y pseudohermafroditismo masculino.

2.1.1.Pseudohermafroditismofemenino

La dotacin cromosmica es XX, los genitales internos son normales y los


externos ambiguos. En algunos casos el origen puede estar en una falla en la exposicin
a los andrgenos fetales o maternos (sndromes virilizantes) y en muchos otros es
indeterminado. Una causa comn de esta alteracin es la hiperplasia adrenal congnita,
de origen autosmico recesivo y que afecta la biosntesis del cortisol.
2.1.2.Pseudohermafroditismomasculino

La dotacin cromosmica es XY, los genitales internos son masculinos y los


externos ambiguos. El origen puede estar relacionado a alteraciones cromosmicas,
genticas, hormonales o indeterminadas.
Los pseudohermafroditismos masculinos de origen cromosmico pueden tener
diversos componentes cromosmicos: 45,X/46,XY; 47,XXY; 47,XYY; 48,XXXY;
49,XXXXY y otras variantes. Se deben a no disyunciones cromosmicas meiticas o
mitticas en caso de mosaicos.

LA GENTICA DE LA DIFERENCIACIN SEXUAL

264

Otros casos de pseudohermafroditismo masculino se originan en fallas en la


formacin embrionaria, as: sndrome de testculos rudimentarios (anorquia y agenesia
de clulas de Leyding), persistencia de los conductos mulerianos (tero y trompas) en
varones. Hoy se habla de que an el hipospadias aislado debe ser considerado como
caso de pseudohermafroditismo masculino; un tipo especial de hipospadias que se
conoce como hipospadias pesudovaginal periescrotal (HPSP) (Goodfellow, 1991).
El pseudohermafroditismo masculino puede deberse tambin a alteraciones
hormonales, genticas o patrones hereditarios en su aparecimiento, como: deficiencias
genticas para la produccin de testosterona (21 y 11 beta hidroxilasas); insensibilidad
completa a los andrgenos o sndrome de feminizacin testicular (XY) o sndrome de
Morris; insensibilidad parcial a los andrgenos o sndrome de Reifenstein; o hipoplasia
adrenal congnita con la consecuente deficiencia enzimtica (Paz-y-Mio et al., 1993b).
2.2.Alteracindelsexogonadal
Las alteraciones del sexo gonadal pueden diferenciarse entre disgenesia gonadal
de origen cromosmico o de origen gentico.
2.2.1.Disgenesiagonadaldeorigencromosmico
Todas las alteraciones que afectan a los cromosomas sexuales pueden producir
disgenesia gonadal, sndromes de Turner y Klinefelter.
2.2.2.Disgenesiagonadaldeorigengentico
Estas deben tener su dotacin cromosmica XX y ser varn, o XY y ser mujer;
las dos estn acompaadas de hipogonadismo. Las disgenesias gonadales mixtas
constituyen el hermafroditismo verdadero, cuya dotacin cromosmica puede ser XX en
el 50% de casos, XY en el 20% y solo 30% son quimeras XX/XY. Lo clave del
hermafroditismo verdadero es la presencia de los dos tipos de tejidos gonadales en un
mismo individuo; los genitales externos pueden ser variados, desde varn o
indeterminado a mujer. La Tabla XIV.2 recoge los hallazgos de nuestra experiencia en
indiferenciacin sexual (Goodfellow, 1991). Adems, existe un tipo de indiferenciacin
sexual que produce disgenesia gonadal, llamado sndrome de regresin sexual:

a)

Tipo I: El fenotipo es femenino, existe una baja del factor de inhibicin muleriano (TDF) y
presencia de la hormona testosterona en bajas proporciones.

b)

Tipo II: Son mujeres con disgenesia gonadal, hipogonadismo; no existen folculos, existe
testosterona en baja cantidad y persisten los conductos mulerianos.

c)

Tipo III: El fenotipo es intersexo masculino con disgenesia gonadal, se ha cuestionado la


presencia del antgeno H-Y y las gnadas presentan testculo fibroso o tejido ovrico
indiferenciado.

d)

Tipo IV: Se llama intersexo virilizante, se presenta la hormona testosterona y TDF, se ha


cuestionado la presencia del antgeno H-Y y no existen gnadas diferenciadas.

La conducta clnica a seguir frente a un paciente con diferenciacin sexual


alterada es: exploracin clnica de los genitales, exploracin radiolgica, evaluacin

LA GENTICA DE LA DIFERENCIACIN SEXUAL

265

hormonal, estudio del antgeno H-Y, estudio cromosmico y gentico del individuo y
familiar, exploracin quirrgica y biopsia gonadal bilateral. Una vez evaluado el caso,
debe realizarse una terapia adecuada que deber por lo menos cumplir con los siguientes
parmetros: atribucin precoz del sexo, tratamiento quirrgico que incluye los genitales
externos e internos, tratamiento hormonal y psicosocial de ser necesario.
Tabla XIV.2. Alteraciones de la diferenciacin sexual
Tipo
Alteraciones de conductos sexuales
Pseudohermafroditismo femenino
Pseudohermafroditismo masculino
Alteraciones del sexo gonadal
Disgenesia gonadal mixta
(Hermafroditismo verdadero)
Disgenesia gonadal pura
Disgenesia gonadal de origen cromosmico
Sndrome de Turner
Sndrome de Klinefelter
Total

No. de casos

Cariotipo

12
14

46,XX
46,XY

46,XX/46,XY

46,XY

110
15
150

45,X0 y variantes
47,XXY y variantes

Captulo XV
Aspectos genticos del crecimiento y
desarrollo
Existen algunos factores genticos y epidemiolgicos (ambientales,
nutricionales, socio-econmicos, culturales, emocionales) que influyen en el
crecimiento y desarrollo fsico, intelectual, emocional y conductal del individuo (Allis
et al., 2007).

1.FACTORESGENTICOS

La aptitud gentica o no del individuo son factores determinantes en el


desarrollo intrauterino y postnatal del mismo. Por tanto, es importante considerar ciertos
aspectos sobre su crecimiento y desarrollo:
1.1.Factoresgenticosenelcrecimientoydesarrollointrauterino
Es indispensable para una adecuada formacin fenotpica, crecimiento y
desarrollo adecuado, una dotacin gentica idnea que permita una formacin
anatmica-fisiolgica equilibrada, una diferenciacin celular, especializacin de
rganos y una regulacin gentica y metablica precisa. Es decir, la informacin
gentica del ADN proporcionar tres cualidades: a) fenotipo adecuado para supervivir;
b) conexiones neurofisiolgicas y metablicas reguladas; y, c) capacidad funcional y
adaptativa a las exigencias ambientales.
Los criterios vertidos significan, en resumen, que los genes proporcionan las
cualidades del fenotipo y el ambiente modifica este fenotipo dentro de rangos
especficos y soportables por el individuo y la especie. El genotipo da la capacidad de
crecer, or, pensar; mientras que el ambiente, dota de aptitudes y experiencias a los
individuos, permitiendo el desarrollo de las habilidades intelectuales y fsicas. Aqu
juega un papel importante la frmula F = G + A, en donde el fenotipo equivale al
genotipo ms el ambiente (Allis et al., 2007).
Dentro del crecimiento y desarrollo intrauterino se sabe que el factor hormonal
es importante. Luego de la diferenciacin sexual normal, las hormonas masculinas y
femeninas completan la formacin embrionaria y fetal. La insulina ha sido el
anabolizante ms importante dentro del desarrollo embrionario, mientras que las
hormonas de crecimiento: prolactina, andrgenos suprarrenales, cortisol y
glucocorticoides, han sido cuestionados como agentes implicados en el crecimiento y
desarrollo intrauterino. Datos a favor de esta argumentacin son los nacimientos de
fetos anencfalos, agenesia suprarrenal y gonadal, entre otros (Wolpert et al., 2002).
1.2.Factoresgenticosenelcrecimientoydesarrollopostnatal
Los factores ms importantes en esta fase son las capacidades fisiolgicas y
metablicas proporcionadas por el buen o mal funcionamiento de los genes
(metabolopatas) y del adecuado funcionamiento hormonal. La hormona del

ASPECTOS GENTICOS DEL CRECIMIENTO Y DESARROLLO

270

crecimiento, por algn mecanismo poco conocido, promueve el aumento del nmero de
clulas y de su tamao, tal vez incrementando la replicacin del ADN. As mismo, la
insulina, promueve la sntesis de protenas, actuando posiblemente como un inductor de
la trascripcin del ADN, es decir, produciendo ARN. El posterior y adecuado
crecimiento y desarrollo estn determinados por las oportunidades ambientales,
satisfaccin de demandas fisiolgicas, sociales, econmicas, culturales y emocionales.
An se habla de que ciertos rasgos de comportamiento, personalidad, actitudes fsicas,
aptitudes intelectuales, son producto de influencias genticas.
El estudio de algunas caractersticas fsicas y fisiolgicas en la poblacin
general, en gemelos idnticos y no idnticos, hermanos y padres, ha permitido sacar
conclusiones interesantes al respecto de los factores genticos y su relacin con el
ambiente, para el crecimiento y desarrollo. Se ha postulado, por ejemplo, que la talla de
los individuos est determinada por algn tipo de herencia ligada al sexo (genes del
cromosoma X); esto se desprende de estudios de correlacin entre hermana-hermana,
hermano-hermana, hermano-hermano, en donde se ha observado mayor correlacin
entre mujeres que entre varones. Tambin se han obtenido correlaciones decrecientes
entre hermana-hermana, padre-hija, madre-hija, madre-hijo y padre-hijo. Se han
encontrado correlaciones importantes para el aparecimiento de la denticin, los ncleos
de osificacin, el desarrollo del msculo-esqueltico y an en el comportamiento; esto
ha sugerido una dependencia con genes autosmicos y ligados al cromosoma X (Moore
& Persaud, 2008).
Para la talla se ha postulado que la herencia cumple todos los requisitos de
herencia polignica; la distribucin de la poblacin ser tpica de la campana de Gaus,
con una poblacin mayoritaria cercana a la distribucin de la media aritmtica y dos
extremos poblacionales pequeos de individuos muy altos, superiores al percentil 90, y
de individuos muy bajos, inferiores al percentil 10. Planteado as el fenmeno de la
talla, el grupo de genes (poligenes) que determina la talla actuara de la siguiente
manera:

a) Homocigotos para el polign de talla fisiolgica baja (< percentil 10).

b) Heterocigotos para el polign de talla fisiolgica media (mayora de la poblacin).

c) Homocigotos para el polign de talla fisiolgica alta (> percentil 90).

La correlacin entre individuos emparentados y no emparentados, y entre


poblaciones, corrobora la frmula para herencia polignica F = G + A, que se puede
descomponer as: la variabilidad fenotpica poblacional (Vp) es igual a la variabilidad
gentica (Vg) ms la variabilidad ambiental o no gentica (Va) y ms la variabilidad de
los dos factores juntos (genes ms ambiente) interrelacionados, lo que se llama
variabilidad correlacionada (Vc) (Allis et al., 2007).

Vp = Vg + Va + Vc

El estudio de correlaciones de caractersticas fsicas y fisiolgicas en gemelos


monocigotos, dicigotos, hermanos, padres y familiares, confirma el criterio de herencia
polignica de las caractersticas de crecimiento y desarrollo.

ASPECTOS GENTICOS DEL CRECIMIENTO Y DESARROLLO

271

Durante el crecimiento y desarrollo se ha podido observar la accin de algunos


factores qumicos y hormonales (factores de crecimiento polipeptdicos) relacionados
directamente con este proceso. Estos factores son:

a)

Factores de crecimiento asociados con embriognesis, crecimiento y desarrollo normal,


como el factor de crecimiento epidrmico, factor de crecimiento de fibroblastos,
somatomedina y el factor de crecimiento nervioso.

b)

Factores de crecimiento relacionados con poblaciones celulares del adulto, tienen


produccin continua, entre los que estn: Factores estimulantes de colonias,
eritropoyetina y factor de crecimiento epidrmico.

c)

Factores de crecimiento asociados a la respuesta proliferativa al dao celular o de


rganos como los factores de crecimiento derivados de plaquetas, derivado de monocitosmacrfagos y el derivado de clulas endoteliales.

d)

Factores de crecimiento derivados de poblaciones tumorales llamados factores


transformantes.

En la siguiente tabla se detalla la correlacin entre los caracteres fsicos y


fisiolgicos con el tipo de parentesco, ya sean gemelos idnticos, gemelos no idnticos,
hermanos o madre-hija.
Tabla XV.1. Correlaciones para el crecimiento y desarrollo de caracteres fsicos y
fisiolgicos
Parentesco

Talla
(cma)

Gemelos
idnticos
Gemelos no
idnticos
Hermanos

Peso
(Kga)

Duracin
Forma Movimientos
de vida trax/corazn
del cuerpo
(mesesa)
36,9 0,64*/0,60*
0,75*

Inicio de
la regla
(aosa)

1,7
1,8
(0,93*)
(0,40*)
4,4
4,5
78,3
0,2*/0,10*
0,54*
(0,64*)
(0,28*)
4,5
4,7
12,9
(0,64*)
(0,26*)
Madre-hija
4,4
18,4
(0,64*)
Gemelos
4,5
idnticos
(0,4*)
(a) Diferencia; (*) Coeficiente de correlacin

En relacin a las mutaciones, se sabe que cada una de ellas tiene una frecuencia

esperada, que hace referencia al nmero de clulas germinales que posee el gen anormal
en un individuo, por ejemplo:

Daltonismo

2,8 x 10-5 / Gametos

Herencia autosmica recesiva

Condrodistrofia

1 1,4 x 10-5 / Gametos

Herencia autosmica dominante

Hemofilia

2 3,2 x 10-5 / Gametos

Herencia ligada al sexo

Las mutaciones son un factor importante para la evolucin de las especies, pero
las mutaciones beneficiosas son muy escasas en la naturaleza. En su mayora, las

ASPECTOS GENTICOS DEL CRECIMIENTO Y DESARROLLO

272

mutaciones son deletreas o letales siendo las responsables de las enfermedades


genticas (Wolpert et al., 2002).
Tabla XV.2. Incidencia y riesgo de recurrencia de algunas anomalas fetales de
causa gentica
Tipo de herencia
Autosmica dominante
Hipercolesterolemia familiar
Corea de Huntington
Sordera
Ceguera
Sndrome de Marfan
Osteognesis imperfecta

Incidencia
0,6 7/1000 nv
1:500
1:5000
1:10000
1:10000
1:20000
1:25000

Riesgo
1:2 (50%)

Autosmica recesiva
Fibrosis qustica
Sordera
Ceguera
Fenilcetonuria
Mucopolisacaridosis
Glucogenosis

0,9 5/1000 nv
1:2500
1:2000
1:5000
1:10000
1:25000
1:50000

1:4 (25%)

Ligada al sexo

0,3 7/1000 nv

1:4 (25%) embarazos


1:2 (50%) en varones

Distrofia muscular (Duchenne)


Hemofilia
Otras
(nv) Nacidos vivos

1:7000
1:10000
1:5000

2.FACTORESQUEAUMENTANLASMUTACIONES
Existen algunos factores que influyen en la frecuencia de las mutaciones
espontneas, traducindose estos en el aumento de riesgo de una descendencia anormal.
Entre estos factores estn:
2.1.Edadavanzadadelosprogenitores
Una de las primeras investigaciones en este aspecto fue la de Weinberg en 1912.
l asoci a los recin nacidos de madres de edad avanzada con un aumento del nmero
de afectos de acondroplasia. Penrose, en 1955, mostr que esta observacin se deba,
con seguridad, al aumento de clulas germinales con neo-mutaciones, directamente
relacionadas con el aumento de la edad materna (Moore & Persaud, 2008).
Posteriormente a estos hallazgos, se demostr la asociacin entre la edad avanzada y
ciertas enfermedades, as: la edad materna se ha relacionado con alteraciones
cromosmicas y la paterna con enfermedades genticas.
Las enfermedades directamente relacionadas con la edad parental son:
acondroplasia, acrocefalosindactilia, sindactilia, miositis osificante, sndrome de
Marfan, retinoblastoma bilateral, hemofilia A, sndrome de Apert, enfermedad de Lesch
Nyhan, distrofia muscular de Duchenne, sndrome de Down y sndrome de Edwards
(Nussbaum et al., 2008).

ASPECTOS GENTICOS DEL CRECIMIENTO Y DESARROLLO

273

Se ha visto un mayor riesgo de enfermedades cromosmicas en relacin con la


edad materna que con la paterna. Este riesgo empieza a partir de los 34 aos de edad en
las mujeres, se duplica a los 39 aos y casi se triplica o cuadriplica a los 44 aos. Para
los hombres en cambio, el riesgo para presentar descendencia con una enfermedad
gentica empieza a partir de los 38 aos, para enfermedades como la hemofilia, la
acondroplasia, sndrome de Marfan y el retinoblastoma bilateral, entre otras.
Ciertas enfermedades genticas relacionadas con la edad tienen igual riesgo para
los dos sexos, como la distrofia muscular de Duchenne, mientras que otras
enfermedades son ms influenciadas por los varones, como la hemofilia A. Existen dos
principios relativos a la razn de mutacin y el sexo predominante en la transmisin de
la neomutacin a la descendencia (Nussbaum et al., 2008):

a) En jvenes, en los que la razn de mutacin es igual para ambos sexos, esta se incrementa

al avanzar la edad del varn.

b) En jvenes, cuando la razn de mutacin ms alta proviene de mujeres, si esta se


incrementa, debe pensarse que la responsabilidad del incremento recae sobre las clulas

germinales maculinas.

La relacin entre las alteraciones cromosmicas la edad materna es la siguiente:

Menores de 35 aos
Entre 35 y 39 aos
Entre 40 y 44 aos
De 45 y ms aos

2 / 1000 nacidos vivos


7 / 1000 nv
25 / 1000 nv
65 / 1000 nv

2.2.EdadmaternaysurelacinconelsndromedeDown

Los estudios ms amplios relacionando edad materna y cromosomopatas son


sobre sndrome de Down. Tanto los estudios extranjeros como los nacionales, coinciden
en la relacin de edad materna con la trisoma 21. Se ha observado que en la poblacin
general, el sndrome de Down tiene dos picos de predisposicin en relacin con la edad
materna: el comprendido entre los 25 y 29 aos, que est en funcin de trastornos
cromosmicos de los progenitores, y el pico progresivo de frecuencia a partir de los 35
aos, debido a problemas de no disyuncin cromosmica en las clulas germinales
maternas. Dos tercios de las no disyunciones cromosmicas son de origen materno.
Existen algunas hiptesis para explicar el origen del sndrome de Down, por no
disyuncin cromosmica, las cuatro primeras en relacin a la edad materna y las dos
ltimas en relacin a variedades de la enfermedad (Nussbaum et al., 2008).
Tabla XV.3. Frecuencia del sndrome de Down en relacin a la edad materna
Grupo de edad (aos)
15 a 19
20 a 24
25 a 29
30 a 34
35 a 39
40 a 44
45 a ms

Casos
11
21
24
30
27
24
9

Porcentaje (%)
7,5
14,4
16,4
20,5
18,5
16,4
6,2

Prevalencia
1/1167
1/1587
1/1087
1/763
1/248
1/79
1/24

ASPECTOS GENTICOS DEL CRECIMIENTO Y DESARROLLO

274

2.2.1.Teoradeladisgenesiaovular
Los ovocitos primarios permanecen un largo perodo en diascinesis; los ms
jvenes, con mayor nmero de quiasmas, seran madurados primero, mientras que los
ms viejos, con menor nmero de quiasmas y mayor riesgo de ser disgensicos, se
madurarn tardamente.
2.2.2.Teoradelasobremaduracinovular
Desde que se produce la ovulacin, hasta que el vulo sea fecundado, pueden
pasar 24 horas, los ovocitos no fecundados tempranamente, tendran mayor riesgo de ser
disgensicos.
2.2.3.Teoraextrnseca
Los ovocitos que maduran en los ltimos perodos menstruales, tendrn mayor
exposicin a factores disgensicos.
2.2.4.Teoradelaseleccinrelajada
El producto de un embarazo en edades altas, es un "producto preciado", por lo
que la naturaleza retendra con mayor facilidad un producto con una cromosomopata,
en contraste con lo que sucede en edades tempranas, en que las cromosomopatas son
eliminadas con mayor frecuencia, hecho que se conoce del estudio de restos abortivos.
2.2.5.Teoradelavariacindelasregionesorganizadorasnucleolares
La variacin polimrfica de las regiones de los cromosomas acrocntricos estara
predisponiendo a la no disyuncin y a un aumento de las trisomas.
2.2.6.Teoradeladuplicacindelaregin21q22
Algunas personas con sndrome de Down no presentan una trisoma 21
completa. Al hacer el estudio molecular de sus cromosomas (21) se ha detectado una
duplicacin de la regin 21q22, la que sera responsable de todo el fenotipo Down de
estos individuos por la presencia en triple dosis de los genes responsables de la
enfermedad. La mayora de alteraciones cromosmicas producen defectos congnitos
ms o menos graves y variables. Generalmente, encontramos retraso mental,
alteraciones craneofaciales, anomalas viscerales, alteraciones en los miembros y
dermatoglifos, talla baja y falla reproductiva (infertilidad o esterilidad).
Un aspecto importante es la coincidencia entre los riesgos genticos segn la
edad materna y la mortalidad infantil correlacionada con la edad materna. En la Tabla
XV.4, se aprecia que a partir de los 30 aos, aunque el porcentaje de fecundidad y de
nacimientos disminuye progresivamente, tanto la frecuencia de sndrome de Down
como la mortalidad infantil se encuentran siempre en rangos superiores. Llama la
atencin que los dos polos de edades maternas (baja y alta) se acoplan en lo referente a
morbi-mortalidad materno-infantil. En edades maternas tempranas los riesgos de
mortalidad infantil son mayores, mientras que en edades maternas avanzadas, tanto los
riesgos genticos como los de mortalidad infantil se acoplan. Esto pone en alerta sobre

ASPECTOS GENTICOS DEL CRECIMIENTO Y DESARROLLO

275

los graves riesgos de los embarazos en tales edades y refuerza el criterio de desalentar
concepciones en edades tempranas por riesgos de morbi-mortalidad mayor y en edades
avanzadas por riesgos cromosmicos (Moore & Persaud, 2008).
Tabla XV.4. Cifras estadsticas en riesgos genticos
Edad
(aos)

Fecundidad Nacimientos Mortalidad


(%)
infantiles
SD (%)
(%)
< 20
9,8
4,5
10,1
2124
23,4
26,2
7,4
2529
23,7
33,0
6,4
3034
19,9
21,8
7,4
3539
14,0
11,0
9,3
4044
7,4
2,2
9,6
> 45
1,8
1,1
10,2
(nv) Nacidos vivos; (SD) Sndrome de Down

Nacimientos
Ecuador (%)

SD (%)

SD (nv)

1,5
11,7
18,5
17,2
26,2
21,3
3,5

5,5
12,9
14,8
25,9
22,2
12,9
5,5

1/1667
1/1587
1/1087
1/763
1/248
1/79
1/24

En relacin al sndrome de Down, nuestros estudios revelan datos interesantes


sobre la composicin citogentica de este sndrome, detallado a continuacin:
Tabla XV.5. Hallazgos citogenticos en el sndrome de Down
Tipo
Trisoma 21 simple
Trisoma en mosaico
Trisoma por translocacin
Translocacin en mosaico
Isocromosoma no detectado en sangre
perifrica (SD gentico o mosaico?)
Total
(SD) Sndrome de Down

Nmero
315
37
6
2
4

Porcentaje (%)
86,06
10,01
1,64
0,55
1,10

366

Adems, se ha encontrado relacin entre la edad materna y el incremento de


abortos. Entre los 17 y 40 aos, un tercio de los abortos presentan aneuploidas
(alteracin del nmero de cromosomas). Existen evidencias de los efectos de la edad
materna y la produccin de fetos triploides (triple dosis cromosmica = 69
cromosomas) y fetos Turner (45,X). Las trisomas de los grupos cromosmicos D (13,
14 y 15) y G (21 y 22), como tambin la trisoma 16, son frecuentemente halladas en los
estudios de abortos relacionados con la edad materna avanzada.
2.2.7.FactoresgenticosdelsndromedeDown

El avance en gentica molecular ha aportado datos muy concretos sobre la


actividad de los genes en el fenotipo. Con respecto al sndrome de Down se tiene mucha
informacin en la actualidad sobre la relacin genotipo-fenotipo.
La expresin bioqumica del sndrome consiste en el aumento de diferentes
enzimas (ya que los genes se encuentran en triple dosis). Una de las ms conocidas e
importante es la superxido dismutasa, codificada por el gen SOD-1, que cataliza el
paso del anin superxido hacia perxido de hidrgeno. En condiciones normales esta
enzima contribuye al sistema de defensa antioxidante del organismo (Paz-y-Mio et al.,
2010a).

ASPECTOS GENTICOS DEL CRECIMIENTO Y DESARROLLO

276

Entre los genes implicados en la aparicin de trastornos asociados a este


sndrome estn: el gen COL6A1, cuya expresin incrementada se relaciona con defectos
cardiacos; el gen ETS2, cuya expresin incrementada puede ser causa de alteraciones
msculo esquelticas; la presencia incrementada del gen CAF1A, que puede interferir
en la sntesis del ADN; el exceso del gen CBS, lo cual puede causar alteraciones
metablicas y de los procesos de reparacin del ADN; el exceso de protenas
codificadas del gen DYRK, que puede asociarse con el retardo mental; la
sobreexpresin del gen CRYA1, que puede originar cataratas; la expresin aumentada
del gen GART, lo cual puede alterar los procesos de sntesis y reparacin del ADN; el
gen IFNAR, que se relaciona con la sntesis de interfern, por lo que su exceso puede
provocar alteraciones en el sistema inmunitario.
En estudios de genes (tales como el DF508, involucrado en la fibrosis qustica),
llevados a cabo en el Ecuador, se encontr evidencia de que la variacin geogrfica en
nuestra poblacin es una consecuencia del antecedente gentico diferente, si se
comparara con poblaciones a nivel mundial; fenmeno similar ocurre con otros genes,
como el BCR/ABL en leucemias, el gen reparador del dao del ADN hMSH2 y el gen
MTHFR en cncer de prstata, entre otros genes estudiados por nuestro grupo de
investigadores (Paz-y-Mio et al., 2002c; 2008a; Lpez-Corts et al., 2013).
2.3.Madresportadorasdeenfermedadesligadasalsexo
Las enfermedades genticas con herencia ligada al sexo tienen la probabilidad de
ser transmitidas por la madre portadora del gen anormal a cualquiera de los embriones
producidos en la fecundacin en cada nuevo embarazo, con un riesgo de 25%; pero, si
el sexo del feto es masculino, la probabilidad de que este sea afecto cambia
automticamente al 50%. Las hijas mujeres, en cambio, tienen la probabilidad de ser
portadoras sanas del gen anormal en el 50%; podrn transmitir a su descendencia el gen
anormal, con igual comportamiento que el antes descrito. En la actualidad se ha visto
que la manifestacin o no de un carcter ligado al sexo, podra estar relacionada con el
fenmeno de herencia por impresin genmica; en este aspecto se han estudiado, sobre
todo, el sndrome de Martin Bell o X frgil, el sndrome de Turner, algunas deficiencias
inmunitarias y factores de coagulacin.
Algunas enfermedades con herencia ligada al sexo son: ceguera para los colores,
distrofia muscular de Duchenne, dficit de glucosa-6-fosfato deshidrogenasa, hemofilia,
enfermedad de Christmas, osteodistrofia hereditaria, sndrome de Hunter (MPS II),
sndrome de Lesh Nyhan. Muchos de estos casos (enfermedad de Fabry, sndrome de
Hunter o de Lesh Nyhan) se pueden diagnosticar prenatalmente, pero en otros, tan solo
se puede diagnosticar prenatalmente el sexo fetal, lo que permite manejar los riesgos
genticos de ser portador o afecto de la enfermedad y, a la pareja, decidir sobre el futuro
de su embarazo (Nussbaum et al., 2008).
2.4.Autoinmunidad
Este es otro factor postulado como elevador del riesgo de mutaciones
espontneas. No se sabe a ciencia cierta el mecanismo que hace posible este efecto. Se
ha visto que en los procesos autoinmunitarios existe la tendencia a asociaciones
satelitales entre los cromosomas acrocntricos (grupo D y G). Esta asociacin es un
fenmeno citogentico en el que los cromosomas acrocntricos se ponen en contacto

ASPECTOS GENTICOS DEL CRECIMIENTO Y DESARROLLO

277

ntimo con sus porciones satelitales. Aunque este fenmeno se presenta con alguna
frecuencia en los exmenes cromosmicos rutinarios (nuestro laboratorio tiene una cifra
de 2% de asociaciones satelitales), en los procesos autoinmunes es ms frecuente. Se
piensa que la asociacin satelital predispone a la no disyuncin cromosmica en
metafase, dando como resultado cromosomopatas primarias.
Otro hecho observable en procesos autoinmunitarios, como por ejemplo la
artritis reumatoidea, lupus, entre otros, es el aumento de roturas cromosmicas
espontneas (nuestro laboratorio tiene la cifra de 4 a 5% de fragilidad cromosmica
espontnea), lo que tambin predispondra a aneuploidas diversas.
2.5.Polimorfismoscromosmicos
Los polimorfismos son variaciones interindividuales de la informacin gentica
que pueden presentarse a nivel gnico, cromosmico, enzimtico y proteico, que son
bien toleradas por los portadores. Algunos estudios sobre polimorfismos cromosmicos
sealan este factor como responsable de distintas patologas clnicas: retraso mental,
malformaciones congnitas con o sin alteraciones cromosmicas, padres de
malformados y problemas de fertilidad.
Los polimorfismos cromosmicos son variaciones en el patrn estructural
normal de los cromosomas que, por lo general, no dan efectos fenotpicos en los
portadores. Entre el 1,68% y 35,61% de la poblacin general, segn la regin, presenta
algn polimorfismo. Esta gran variabilidad de datos explica la dificultad en el estudio
del posible papel de estas variantes.

Tabla XV.6. Variantes cromosmicas en la poblacin de Quito (RNCAVCH)


Tipo
Yq+
14p+
9qh+
15p+
22p+
Yqinv9
t(2;18)
t(5;14)
t(4;11)
t(6;7)
t(7;10)
t(13;14)
t(13;15)
t(8;x)
t(21;x)
Fragilidad espontnea
Microcromosomas
Total

Nmero
12
3
3
2
2
2
1
1
4
2
1
1
2
1
2
1
18
2
868

Porcentaje (%)
1,38
0,34
0,34
0,23
0,23
0,23
0,11
0,11
0,46
0,23
0,11
0,11
0,23
0,11
0,23
0,11
2,07
0,23
100

Los polimorfismos afectan con especial frecuencia a las zonas heterocromticas


(zonas claras del bandeo tripsina / giemsa de los cromosomas) que corresponden a los
organizadores nucleolares (regiones comprendidas entre el centrmero y los satlites,
compuestos por ADN nucleolar) de los cromosomas acrocntricos 13, 14, 15, 21 y 22;

ASPECTOS GENTICOS DEL CRECIMIENTO Y DESARROLLO

278

las zonas polimrficas son tambin las constricciones secundarias de los cromosomas 1,
9, 16 y los brazos largos del cromosoma Y. La variabilidad observada o polimorfismo,
se debe a la diferencia del tamao de los satlites, en su nmero, en la longitud de los
tallos satelitales y en el tamao de los brazos cortos de los cromosomas acrocntricos y
de los brazos largos del cromosoma Y.
La mayora de estudios sobre los efectos de los polimorfismos tienen relacin
con problemas reproductivos. En parejas con abortos, la repeticin se ha encontrado
entre el 4,1 al 27,8% de todas las posibilidades polimrficas, excepto el Yq+
(cromosoma Y con brazos largos aumentados de tamao), con el que se ha asociado
abortos en un 83%.
En un estudio citogentico sobre 3000 individuos que consultaron por diversos
problemas, se encontr polimorfismos de los diferentes cromosomas en las siguientes
proporciones:

Retraso psicomotor

7,56%

Alteraciones en la fertilidad

5,98%

Malformaciones

3,31%

Padres de individuos con malformaciones

4%

En definitiva, queda mucho por aclarar en relacin a los polimorfismos


cromosmicos y sus implicaciones clnicas, tal vez por las pocas series estudiadas. De
todas maneras, existe ya una alerta en este sentido y muchos genetistas sugieren el
estudio cromosmico en toda pareja que decida tener descendencia.
2.6.Historiafamiliardeenfermedadesmetablicas
Existen muchos trastornos del metabolismo que son causa de subnormalidad.
Muchos de estos tienen patrones hereditarios definidos y los riesgos de recurrencia en la
descendencia de afectos o portadores del gen anormal, van desde el 25% para cada
nuevo embarazo en las enfermedades con herencia autosmica recesiva, hasta el 50% en
las dominantes. Algunas de las enfermedades ms frecuentes y que producen graves
trastornos fsicos y mentales son: enfermedad de Fabry, Gaucher, Niemann-Pick,
sndrome de Hurler, Hunter, Sanfilipo, gangliosidosis, glucogenosis, fenilcetonuria y
cistinosis.
En la actualidad, se dan pasos acelerados en el diagnstico prenatal de muchas
de estas afecciones y an se detectan heterocigotos (portadores sanos del gen anormal),
lo que posibilita a las parejas conocer los riesgos genticos a los que se enfrentan y
proyectar su descendencia con mayores elementos de anlisis.
2.7.Historiafamiliardemalformaciones
Aunque ya se trat sobre este aspecto al hablar de herencia polignica, cabe
resaltar ciertos criterios acerca de la alta predisposicin gentica que tiene la
descendencia de parejas con un historial familiar de malformaciones.

ASPECTOS GENTICOS DEL CRECIMIENTO Y DESARROLLO

279

Del total de recin nacidos con problemas malformativos congnitos y genticos,


el 2,5% presentan malformaciones mayores, con graves limitaciones de vida y
desarrollo. Por lo general, en este tipo de afecciones se encuentra un mayor nmero de
asociaciones malformativas, con mayores deficiencias fenotpicas en el afecto y
mayores riesgos de recurrencia para los familiares. Ejemplos de malformaciones
mayores son: anencefalia, espina bfida, Fallot, hidrocefalia y onfalocele.
Las malformaciones menores, representan el 3,5% en los recin nacidos; estas
son relativamente de fcil correccin y, para efectos de riesgo de recurrencia, se rigen
bajo los mismos criterios de herencia multifactorial. Prcticamente el riesgo es bajo y se
maneja el valor del 2% de recurrencia para la mayora. Ejemplos de malformaciones
menores podran ser: luxacin congnita de cadera, pie equino y sindactilia cutnea
(Nussbaum et al., 2008).
2.8.Infertilidadpreviaabortosrepetidos
Los defectos congnitos y genticos, son solo un aspecto a considerar dentro de
los riesgos de subnormalidad en la descendencia. Los problemas de infertilidad que
afectan al 10% de parejas, pueden deberse a un sinnmero de causas ambientales,
anatmicas, traumticas, genticas y cromosmicas. Revisaremos brevemente estas dos
ltimas.
2.8.1.Infertilidadyesterilidaddeorigengentico
Esta se produce por alguna de las siguientes causas:

a)

Alteraciones en el desarrollo y diferenciacin sexual (anatmicas), impedimento en la


produccin de gametos, interferencia en el desarrollo genital e interferencia en la
fecundacin.

b)

Falla en la migracin de clulas germinales (azoospermia).

c)

Defectos en la clulas gonadales: Divisin anormal de los cromosomas de los


espermatozoides, en especial problemas de asinapsis (falta de apareamiento
cromosmico en meiosis) dando un bloqueo del espermatocito I, que traduce en
esterilidad y la desinapsis (alteracin en el proceso de terminalizacin cromosmica) en
meiosis, la que ocasiona gametos desequilibrados cromosmicamente. Estos dos tipos
de alteraciones meiticas son hereditarias y familiares.

d)

Defectos de los espermatozoides que determinan inmovilidad o tetrazoopermia.

e)

Maduracin alterada de las clulas germinales. En los hombres se ha detectado que este
problema es de origen autosmico recesivo.

2.8.2.Infertilidaddeorigencromosmico
Los problemas cromosmicos producen una serie de alteraciones fenotpicas,
pero aparte de estas, tambin afectan la fertilidad de los individuos, ya que determinan
alguno de los siguientes fenmenos:

ASPECTOS GENTICOS DEL CRECIMIENTO Y DESARROLLO

280

a)

Alteraciones en el desarrollo y diferenciacin sexual (anatmicas), impedimento en la


produccin de gametos, interferencia en el desarrollo genital e interferencia en la
fecundacin.

b)

Gonosomopatas: Sndrome de Klinefelter, Turner, XYY, XXYY, XXX, XXXX, XXXXX.

c)

Translocaciones gonosoma autosoma.

d)

Translocaciones autosoma autosoma.

e)

Subfertilidad, producida por todas las alteraciones cromosmicas.

Datos obtenidos en parejas e individuos con problemas de fertilidad y que han


sido evaluados citogenticamente por nosotros, se muestran en la siguiente tabla.
Tabla XV.7. Hallazgos cromosmicos en individuos con infertilidad y esterilidad
Hallazgo
Normales
Variantes polimrficas
Fragilidad
Translocaciones
Cromosomopatas
- Sndrome de Turner
- Sndrome de Klinefelter
Microcromosoma
Otras
Total

Nmero
44
11
7
1
24
21
4
2
2
116

Porcentaje (%)
37,9
9,5
6,0
0,8
20,7
18,2
3,5
1,7
1,7

Del 8 al 45,9% de abortos espontneos presentan las anomalas cromosmicas


ya mencionadas; esto hace pensar en posibles cromosomopatas de los progenitores,
siendo las ms frecuentes:

Trisomas

42,0%

Triploidas

15,5%

Tetraploidas

4,2%

Otras (polimorfismos cromosmicos)

14,4%

El proceso a seguir en parejas con abortos repetidos, es el estudio cromosmico


en sangre perifrica de la pareja, el estudio cromosmico de meiosis gonadal, y de ser
posible, de los restos abortivos.
Tabla XV.8. Hallazgos cromosmicos en parejas con abortos repetidos
Hallazgo
Normales
Variantes polimrficas
Fragilidad
Translocaciones
Total

Nmero
36
15
7
1
59

Porcentaje (%)
61
25,5
11,8
1,7
100

ASPECTOS GENTICOS DEL CRECIMIENTO Y DESARROLLO

281

2.9.Polihidramniosyoligoamnios
En cualquiera de los dos casos debe sospecharse que el feto padece alguna
malformacin congnita mayor o menor. Por lo general, el polihidramnios se asocia a
defectos de cierre del tubo neural (anencefalia, espina bfida abierta) y obstruccin
digestiva (atresia esofgica, duodenal o yeyunal). El oligoamnios, en cambio, es
frecuente en casos de emisin anormal de orina por el feto (agenesia renal, riones
poliqusticos o multiqusticos, hidronefrosis).
En los casos descritos, los defectos malformativos tendrn un riesgo de
recurrencia emprica para cada tipo de malformacin.
2.10.Alteracionesfetales

Con respecto a las alteraciones fetales, es importante conocer sobre el


crecimiento retardado, la presentacin fetal anormal y las anomalas del ritmo cardiaco.
2.10.1.Crecimientofetalretardado
Se ha demostrado que algunas causas como la hipertensin, toxemia gravdica,
desnutricin materna, entre otras, influyen en el retardo del crecimiento fetal. Cuando
no existe evidencia sustancial de estos problemas, como causa de retraso en el
crecimiento fetal, debe sospecharse malformaciones fetales, sean de origen
multifactorial, genticas o cromosmicas. El criterio es vlido en los casos de
crecimiento fetal retardado tipo I, en el cual el feto evidencia un retardo somtico
armnico y muy hipoplsico. Algunas alteraciones encontradas en casos de crecimiento
intrauterino retardado (CIR), se presentan a continuacin:

Tabla XV.9. Malformaciones y cromosomopatas en el crecimiento intrauterino


retardado
Tipo CIR
Casos
Cromosomopatas (%)
Grupo control
2000
0,25
CIR conjunto
607
0,65
CIR tipo I
99
4,04
CIR tipo II
230
CIR tipo III
206
No clasificable
72
(CIR) Crecimiento intrauterino retardado

Malformaciones (%)
0,50
4,44
20,20
1,73
0,97
1,38

2.10.2.Presentacinfetalanormal
Cualquier alteracin persistente en la posicin fetal, sobre todo en el tercer
trimestre del embarazo, hace pensar en algn tipo de malformacin fetal: hidrocefalia,
tumores cervicales o abdominales, siameses. El seguimiento ecogrfico adecuado
solventar los casos de duda.
2.10.3.Anomalasdelritmocardiacofetal
Las bradicardias y arritmias, cuando son persistentes, hacen pensar en
malformaciones cardacas.

ASPECTOS GENTICOS DEL CRECIMIENTO Y DESARROLLO

282

2.11.Enfermedadmaternacrnica
Se ha comprobado que muchas enfermedades aumentan el riesgo malformativo
en la descendencia, as: la diabetes se asocia a una mayor incidencia de anencefalias y
displasias caudales (sndrome de regresin caudal); los distiroidismos predisponen a
anomalas cromosmicas en la descendencia. Otras enfermedades crnicas maternas
como nefritis, hipertensin, anemia y hemoglobinopatas, han sido asociadas con
mayores riesgos genticos y malformativos.
2.12.Genesmutantes
En los numerales anteriores se expusieron varias alternativas que presentan
mayor riesgo de mutacin espontnea o de subnormalidad y malformacin en la
descendencia. Existen situaciones en las que no se evidencian claros factores
desencadenantes de patologas y, aunque los resultados fenotpicos de un individuo sean
anormales, compatibles con sndromes hereditarios o cromosmicos, el genetista no
encuentra en los progenitores datos para un anlisis objetivo de los riesgos. Por ejemplo,
si una pareja tiene abortos a repeticin o ha tenido ms de un hijo con sndrome de
Down o con alguna otra malformacin, debera pensarse a priori en que los padres
tienen una alteracin cromosmica, pero al estudiarlos, estos han resultado normales. En
estas o en similares situaciones y, sin otra causa que predisponga a una enfermedad, se
ha postulado la existencia de genes calientes o genes que tienen predisposicin a
mutar espontneamente. Tambin se ha hablado de genes mutadores, es decir, genes
que aumentan la frecuencia de mutacin de otros genes. Este podra ser el caso de la
predisposicin individual o familiar a la no disyuncin cromosmica, con sus
consecuentes efectos.

3.DIAGNSTICOPRENATAL
El estudio del ambiente fetal ha despertado siempre curiosidad cientfica. Hasta
hace poco, se tena escasos conocimientos sobre el tema. Actualmente, con nuevas
tcnicas, se han llegado a comprender muchos aspectos de la relacin madre-feto, como
tambin se empiezan a detectar enfermedades en el tero y a manejar la terapia
intrauterina. Muchas de las enfermedades que se han mencionado hasta el momento, de
alguna forma producen alteraciones maternas o fetales que pueden ser detectadas o
sospechadas, poniendo en alerta sobre los riesgos malformativos o genticos del feto.
Los procedimientos implicados con mayor frecuencia se revisan a continuacin:
3.1.Procedimientosimplicadoseneldiagnsticoprenatal
Existen varios pasos que se deben dar para que el diagnstico prenatal sea
confiable y completo.
3.1.1.Hematolgicoyanlisisurinario
Muchos de los resultados obtenidos con estos simples anlisis detectan
enfermedades maternas ms o menos graves, que son causa de discapacidad o
malformacin fetal. En los casos que ameriten se evaluar anticuerpos especficos:
rubeola, toxoplasma, citomegalovirus, sfilis, VIH, glucosa, tipo sanguneo y

ASPECTOS GENTICOS DEL CRECIMIENTO Y DESARROLLO

283

proteinograma. Se podr, segn el caso, profundizar el estudio para detectar


aminocidos especficos de trastornos genticos como: Fenilcetonuria o alcaptonuria.

3.1.2.Marcadoresbioqumicosmaternos
En los ltimos aos se intenta encontrar pruebas bioqumicas maternas que
permitan detectar alteraciones fetales; en este sentido, se ha desarrollado la medida de
alfa feto protena (AFP) materna durante la gestacin, que permite rastrear dos
problemas:

a) Cifras elevadas de AFP en sangre materna comprobadas posteriormente en lquido


amnitico; se acompaan en un nmero elevado de problemas de cierre de tubo neural;

pueden ser diagnosticados hasta el 70% de casos.

b) Cifras bajas de AFP en sangre materna, se acompaan de un nmero aumentado de

cromosomopatas, especialmente la trisoma 21; si se demuestra una baja de la AFP se


debe realizar un estudio cromosmico fetal, ya que la especificidad de la prueba de AFP
materna es alta (93%) pero su sensibilidad (posibilidad de diagnstico de sndrome de
Down) es baja (20%).

3.1.3.Estudiocromosmico
En ciertos casos, se debe realizar el estudio cromosmico de la pareja o del
individuo que se sospeche que porte una alteracin cromosmica. El procedimiento a
usar puede ser el cultivo de linfocitos T de sangre perifrica o de cordn umbilical
(funiculocentesis), cultivo de tejidos o fibroblastos en monocapa. Estos son
procedimientos especializados mediante los cuales los linfocitos son cultivados por 72
horas bajo el estmulo de un agente inductor de mitosis (fitohemaglutinina); al cabo de
este tiempo, se detienen las divisiones celulares con colchicina, las clulas se someten a
un choque hipotnico de KCl al 0,54%, con lo que se consigue que los cromosomas se
separen y puedan ser visualizados. Se fija la preparacin (fijador Carnoy: Metanol/
cido actico 3:1), se extienden y se tien los cromosomas para su estudio. Los estudios
de tejidos son ms complicados y largos; se obtiene el tejido (clulas fetales de lquido
amnitico o vellosidades coriales, piel, rin, msculo, etc.), se lo degrada y se lo pone
en cultivo por 3 semanas; la cosecha es similar en la mayora de aspectos al cultivo de
linfocitos. Una vez extendidos los cromosomas en las placas portaobjetos, se pueden
realizar tcnicas especiales para identificar zonas especficas de los cromosomas; estas
tcnicas son de bandeamiento; la ms comn es el bandeamiento GTG, que utiliza
tripsina y giemsa, en la que los cromosomas adquieren coloracin obscura y clara segn
el tipo de composicin qumica que tenga el ADN (zonas claras ricas en guanina y
citosina, eucromatina, y zonas obscuras ricas en adenina y timina, heterocromatina)
(Paz-y-Mio et al., 2012b).
Las tcnicas de bandeamiento cromosmico se han desarrollado tanto que, de
patrones cromosmicos con 400 bandas en cromosomas metafsicos, se ha pasado a
obtener patrones cromosmicos de 800 a 1200 bandas en cromosomas prometafsicos y
prometafsicos tempranos, con lo que el diagnstico con la citogentica ha mejorado
notablemente. Uno de estos sndromes es Martin Bell o X frgil. Este es un sndrome
que se acompaa de retraso mental, trastornos de conducta, hiperactividad,
macroorquidismo, frente amplia y un marcador cromosmico tpico que es la rotura

ASPECTOS GENTICOS DEL CRECIMIENTO Y DESARROLLO

284

terminal del cromosoma X (fraXq27.3). Por lo general, se encuentra en la poblacin


masculina con retraso mental. Las madres de estos pacientes pueden tener retraso
mental. Por el patrn de transmisin hereditaria, es una enfermedad recesiva ligada al
sexo (Nussbaum et al., 2008). A continuacin presentamos una gua para identificar
individuos con problemas de los cromosomas autosmicos o gonosmicos:

Caractersticas generales de las alteraciones de los autosomas


a)

Retardo mental entre moderado y grave.

b)

Anomalas fsicas diversas ms o menos graves: Dismorfismos craneofaciales,


alteraciones del sistema nervioso, defectos musculoesquelticos.

c)

Alteraciones de los dermatoglifos.

d)

Infertilidad.

e)

Retardo del crecimiento.

f)

Alteraciones psicomotoras.
Caractersticas generales de las alteraciones de los gonosomas

a)

Grados variables de retardo mental o normal.

b)

Malformaciones fsicas menores o poco importantes.

c)

Problemas del aparato uro-genital.

d)

Esterilidad o infertilidad.

e)

Alteraciones en la talla (muy alto o muy bajo).

f)

Alteraciones de la conducta, el carcter o la personalidad.

Identificados los individuos que podran portar una alteracin, es indispensable


tener claras las indicaciones del estudio cromosmico, como se explica a continuacin:
Tabla XV.10. Indicaciones del estudio cromosmico

Estudio cromosmico en el individuo

Malformaciones mltiples
Retraso psicomotor
Retraso en peso y talla
Alteraciones neurolgicas
Anomalas del desarrollo sexual y de la
diferenciacin
Alteraciones de los dermatoglifos
Talla baja sin otra patologa (mujeres)
Talla muy alta (varones)

Estudio cromosmico en la pareja

Abortos a repeticin sin causa aparente


Historia de cromosomopatas anteriores, hijos o
familiares y antecedentes malformativos
Infertilidad o esterilidad de causa desconocida

ASPECTOS GENTICOS DEL CRECIMIENTO Y DESARROLLO

285

3.1.4.Amniocentesisobiopsiacorial
Esta prueba sirve para estudiar directamente los cromosomas del feto. La
amniocentesis se practica a las 16 semanas de embarazo (entre la 15 y 17), por puncin
transabdominal; se extrae lquido amnitico, se lo cultiva por unas tres semanas y se
preparan los cromosomas en la forma descrita anteriormente; se pueden estudiar los
cromosomas fetales, el sexo cromosmico o la existencia de cromosomopatas. La
amniocentesis tiene un riesgo de aborto, con tcnica bien realizada, del 3,5%, el cual es
mayor que el de cualquier mujer embarazada de 16 semanas (2%). As mismo, existe
un riesgo del 1 2% de no obtener resultados u obtener resultados errneos
(especialmente mosaicismo por contaminacin del cultivo con clulas maternas).
Tabla XV.11. Comparacin entre biopsia corial y lquido amnitico
Biopsia corial
Diagnstico temprano (9 a 11 semanas)
Tcnica directa
Resultado en 5 das
Citogentica confiable 99,9%
Menor angustia materna
Utilidad para estudios bioqumicos
Utilidad para estudios enzimticos
Factibilidad de estudios de ADN
Bajo riesgo materno y fetal
Prdida fetal 1,5%
Menor nmero de metafases
Cromosomas de peor calidad
Peor calidad de bandas
Iguales indicaciones citogentica
Igual posibilidad diagnstica

Lquido amnitico
Diagnstico tardo (15 a 18 semanas)
Cultivo a mediano plazo
Resultado en 3 semanas
Citogentica confiable 99,9%
Mayor angustia materna
Utilidad para estudios bioqumicos
Utilidad para estudios enzimticos
Factibilidad de estudios de ADN
Bajo riesgo materno y fetal
Prdida fetal 1,5%
Mayor nmero de metafases
Cromosomas de mejor calidad
Mejor calidad de bandas
Iguales indicaciones citogenticas
Igual posibilidad diagnstica

La biopsia corial se realiza entre las 9 y 11 semanas de embarazo. Por va


vaginal se extrae vellosidades coriales que son analizadas directamente, luego de aadir
colchicina, choque hipotnico, Carnoy y extensin de la muestra. La biopsia corial
aumenta el riesgo de aborto entre 1,5 y 2% del porcentaje normal de la poblacin de
embarazadas que es del 4 al 5%. En la siguiente tabla se hace una comparacin entre la
tcnica de lquido amnitico y biopsia corial.
Tabla XV.12. Indicaciones del diagnstico prenatal citogentico
Embarazo en una mujer mayor de 35 aos
Embarazo luego de abortos repetidos
Hijo anterior con una cromosomopata
Historia familiar de cromosomopatas
Herencia ligada al sexo
Progenitor con una alteracin cromosmica estructural equilibrada

3.1.5.Ultrasonografa
El desarrollo tcnico en esta rea permite, en la actualidad, detectar una serie de
anomalas y malformaciones fetales que antes era imposible. Es indispensable que el
equipo de ultrasonografa brinde nitidez y gran resolucin para poder detectar
malformaciones mayores y menores. Actualmente, se ha desarrollado la ecocardiografa

ASPECTOS GENTICOS DEL CRECIMIENTO Y DESARROLLO

286

fetal, para detectar problemas malformativos del producto. Esta alternativa debera
tomarse muy en cuenta en nuestro medio, donde los problemas de cardiopatas
congnitas son frecuentes y han registrado, en muchos casos, un componente polignico
en la herencia, tornando an ms necesaria la evaluacin familiar. En la siguiente tabla
se aprecian las posibilidades de cardiopatas segn el parentesco con los probandi.
Tabla XV.13. Frecuencia de cardiopatas congnitas segn parentesco
Grado
Primer

Parentesco
Hermanos
Hijos
Padres

Sujetos afectos (%)


2,5 a 3
3a4
1,5 a 2

Segundo

Sobrinos
Tos
Abuelos

1 a 1,5
1 a 1,5
0,5 a 1

Tercera

Primos hermanos

0,5

3.1.6.Fetoscopa
Es la visualizacin directa del feto mediante un fetoscopio. Esta tcnica brinda
actualmente una ayuda importante en los casos de sospecha de enfermedades que
necesitan examen morfolgico fetal directo, extraccin de sangre fetal por
funiculocentesis para estudios cromosmicos, enzimticos o bioqumicos en un
probable feto afecto; permite tambin realizar biopsia de piel fetal. Actualmente, se
estn utilizando los fetoscopios introducidos por va vaginal para extraccin de
vellosidades coriales. Con estas muestras se puede diagnosticar hemofilias,
hemoglobinopatas, inmunoglobulinopatas fetales, viremias o infecciones intrauterinas,
epidermolisis bullosa letal y genodermatosis.

4.ALTERNATIVASFRENTEALRIESGOGENTICO

Las enfermedades genticas y malformativas representan una dura carga social e


individual, fsica y psquica. Por esta razn, en muchos pases del mundo se ha dado a la
educacin gentica un apoyo muy importante dentro del campo de la salud pblica.
Organismos internacionales como la OMS o la OPS tienen desde hace algunos aos
contemplados, dentro de sus actividades, programas de Gentica Mdica.
Las alternativas que puede brindar la gentica estn inmersas, por tradicin, en
valores sociales y legislativos, no siempre adecuados a la realidad sanitaria de cada pas.
El genetista experto debe guiar su actividad preventiva en el plano eminentemente
cientfico, sin anteponer sus valores en el consejo o asesoramiento que el paciente ha
requerido. La obligacin del genetista ser dar el mayor nmero de datos y posibles
efectos de las enfermedades genticas y malformativas. La pareja o la embarazada ser
quien decida, sin presiones y libremente sobre el futuro de su vida reproductiva o sobre
el embarazo en curso. Lo que la Gentica Mdica pretende, no es convertirse en una
frmula fcil de evadir los problemas de salud; todo lo contrario.

ASPECTOS GENTICOS DEL CRECIMIENTO Y DESARROLLO

287

Mediante su desarrollo y el perfeccionamiento de tcnicas, unas relativamente


sencillas pero especializadas como el estudio cromosmico, otras algo ms complicadas
como el cultivo celular del lquido amnitico o la biopsia corial, hasta algunas tcnicas
sofisticadas de secuenciacin de genes anormales y la posibilidad futura de tratamiento
gnico de enfermedades intrauterinamente, hacen de la Gentica una rama seria, con
objetivos claros de servicio cientfico a la humanidad. Planteada as la funcin del
mdico genetista, las personas podrn optar por alguna de las siguientes alternativas en
la bsqueda de soluciones temporales o definitivas a la carga impuesta por un trastorno
gentico o malformativo, como posible causa de subnormalidad:

4.1.Esterilizacinocontracepcin
La contracepcin voluntaria en parejas con alto riesgo debe ser siempre tomada
en cuenta en el asesoramiento gentico o mdico. Con los rpidos avances de las
tcnicas moleculares, citogenticas, metablicas y bioqumicas para el diagnstico
prenatal, es de esperarse que en un futuro muy prximo, se resuelvan problemas hasta
hoy conflictivos para las parejas.
El problema de la esterilizacin de individuos con alto riesgo de transmisin
hereditaria es algo ms delicado. Sera ideal que, bajo una informacin real, cientfica y
adecuada, cada persona en riesgo opte por este camino. Queda la interrogante, hasta hoy
muy discutida, de qu hacer con los afectos de enfermedades genticas graves, con
riesgo de transmisin hereditaria alta o letales.
4.2.Interrupcinteraputicadelembarazo
En muchos pases la legislacin contempla el aborto teraputico como medida
adecuada en los casos confirmados de problemas genticos y malformativos que
determinan una subnormalidad. El lmite de edad gestacional para proceder a un aborto
teraputico, es a las 22 semanas de embarazo. La autorizacin est dada por dos
mdicos que han confirmado o diagnosticado el problema o, en su defecto, cuando es
pedida por las parejas o mujeres que cursan un embarazo de alto riesgo malformativo o
transmisin hereditaria.
En nuestro pas existe una prohibicin expresa sobre el aborto teraputico. Se
considera que este tema debi haber sido tratado con mayor conocimiento de causa e
imparcialidad debido a que existen casos extremos en donde las experiencias de las
madres deben ser de gran impacto en la decisin definitiva sobre el aborto teraputico.
Este es un tema preocupante a nivel nacional e internacional, tanto, que en los ltimos
Congresos de Gentica (latinoamericanos y mundiales) se ha dado un tratamiento
especial y preferencial a esta temtica, sin que los cientficos dedicados a la tica en la
investigacin lleguen a un consenso.
4.3.Asistencianeonataladecuada

En muchos casos ser necesario alertar al pediatra sobre posibles


malformaciones que pueda presentar el feto. Este solo hecho sirve para que el pediatra
siga la pista del recin nacido y se programen terapias neonatales adecuadas; caso
contrario, podra perderse la oportuna accin mdica preventiva.

ASPECTOS GENTICOS DEL CRECIMIENTO Y DESARROLLO

288

4.4.Terapiaintrauterina

Como se mencion anteriormente, la gentica est en posibilidad de corregir y


tratar algunos problemas de causa molecular. La meta es localizar una cascada gentica
anormal, analizarla, silenciarla y reemplazar sus genes defectuosos por normales. Se
estn logrando importantes avances en este campo con la Ingeniera Gentica, aunque
todava habr que esperar para su utilizacin humana.
Algunas enfermedades fetales pueden corregirse con la administracin de
frmacos a la madre que mejoran el desarrollo fetal respiratorio, la insuficiencia
cardaca fetal, las deficiencias enzimticas, minerales y avitaminosis o con correccin
de la dieta materna en caso de fabismo, galactosemia, etc. Otra alternativa es la
administracin de sustancias por va amnitica, como hormona tiroidea, nutrientes
especficos en el crecimiento intrauterino retardado (CIR) o cardiotnicos. El abordaje
teraputico del feto a travs del cordn umbilical es muy reciente y ha servido para
tratamientos farmacolgicos especficos, transfusiones sanguneas, etc. El tratamiento
quirrgico intrauterino ha posibilitado corregir problemas como la hidrocefalia,
obstruccin urinaria, hernia diafragmtica y defectos de cierre del tubo neural.

4.5.Consejooasesoramientogentico
Esta es sin duda una de las labores ms importantes y al mismo tiempo ms
difciles de la actividad de un mdico genetista. Debe ser realizada por un experto
genetista ya que el manejo de riesgos de recurrencia, la interpretacin de los estudios
genticos, el desciframiento del tipo de herencia a partir del estudio del rbol
genealgico y el manejo de otras destrezas y conocimientos indispensables para una
buena orientacin, son atributos casi exclusivos de su especializacin.
El consejo o asesoramiento gentico es tan importante como una receta acertada
de un mdico clnico o una operacin exitosa de un cirujano; es la culminacin de la
relacin mdico-paciente-genetista. Por estas razones es indispensable considerar que el
asesoramiento gentico debe estar precedido por una comprensin profunda de los
mecanismos hereditarios, de la enfermedad gentica, de su pronstico, evolucin y
tratamientos disponibles; se debe tener un diagnstico exacto del problema, conocer
perfectamente las formas de realizar un historial gentico y las genealogas; conocer las
alternativas que un individuo o una pareja podr seguir frente a su problema, dar la
informacin cientfica adecuada e imparcial; se deben adems conocer los datos
poblacionales de la frecuencia e incidencia de las patologas. Otras consideraciones
adicionales importantes son: el peso o carga que impone la enfermedad al individuo, a
la familia y a la sociedad, el riesgo de que se repita la enfermedad en la descendencia,
de acuerdo al tipo de herencia y a su gravedad. Con estos antecedentes, los objetivos
que cumple el asesoramiento gentico en el individuo son:

el dolor y el sufrimiento que causa la enfermedad (terapia psquica individual y


a) Reducir
familiar).

b) Reducir la ansiedad y los sentimientos de minusvala.

c)

Ayudar al paciente a sobrellevar la enfermedad.

d)

Plantear los posibles tratamientos y alternativas.

ASPECTOS GENTICOS DEL CRECIMIENTO Y DESARROLLO

289

Los objetivos del asesoramiento gentico en la pareja son:


a)

Ayudar a la pareja a tomar sus propias decisiones sobre su reproduccin.

b)

Dar opciones sobre la planificacin familiar.

c)

Reducir la ansiedad y los sentimientos de culpa.

d)

Educar a la pareja y a la familia sobre la enfermedad en cuestin y la forma de afrontarla.

e)

Favorecer mecanismos adaptativos que ayuden a sobrellevar problemas genticos.

f)

Estimular a las parejas para que tomen sus propias decisiones.

Las indicaciones del asesoramiento gentico se detallan en el siguiente cuadro:

Tabla XV.14. Indicaciones del asesoramiento gentico


Enfermedades
Enfermedades monognicas
Enfermedades polignicas
Malformaciones diversas
Consanguinidad
Exposicin a agentes genotxicos o mutagnicos
Cncer familiar

Herencia
Autosmicas dominantes
Autosmicas recesivas
Ligadas al sexo
Menores o mayores
Aisladas o asociadas
Qumicos, frmacos

En relacin a las cromosomopatas, el asesoramiento gentico ser especfico


segn el tipo de alteracin. En trminos generales, el riesgo de recurrencia de un
problema cromosmico simple est por debajo del 1%. El sndrome de Down constituye
un buen ejemplo de cmo se comporta una alteracin citogentica en relacin con los
riesgos de tener descendencia afecta; esta depender del tipo de alteracin citogentica
que se presente en los hijos afectos; adems, si uno de los padres es portador de una
anomala cromosmica estructural, aumenta el riesgo de una descendencia anormal.
En la siguiente tabla se aprecia que el riesgo de recurrencia vara segn el tipo de
hallazgo citogentico en el primer hijo afecto o en los padres. Las mujeres que
previamente han tenido un hijo con trisoma 21, tienen un riesgo de recurrencia
adicional del 1 al 2%. El riesgo es de 30 a 50 veces mayor que el habitual si la madre
tiene un hijo con sndrome de Down cuando es menor de 25 aos, y de 5 veces ms si
est entre las edades de 25 a 29 aos. Esto podra deberse a que uno de los progenitores
es portador de una translocacin equilibrada. En trminos generales, puede decirse que
1 de cada 60 mujeres con un hijo con esta enfermedad, engendrar posteriormente otro
hijo de similares caractersticas.
Los ltimos estudios realizados en personas con sndrome de Down en el
Ecuador se relacionan con el Primer estudio biopsicosocial clnico gentico de las
personas con discapacidad, dentro del programa gubernamental Misin Solidaria
Manuela Espejo. Ver el Captulo VII, Origen gentico de las discapacidades en el
Ecuador.

ASPECTOS GENTICOS DEL CRECIMIENTO Y DESARROLLO

290

Tabla XV.15. Riesgo de recurrencia en el sndrome de Down


Tipo
Trisoma primaria

Otras series
(%)
94,5

Series
Riesgo de recurrencia
Sin cariotipo
Con cariotipo
Ecuador (%)
94,4
5 a 50 veces ms
1a2
que la poblacin
5,6
5 a 50 veces ms
Tipo
5,5
-

Todos los dems tipos


5,5
t
3,5
t heredadas D/G
51
t 13/21, t 14/21, t
44
15/21
MPTE
PPTE
t G/G (21/22)
5,6
MPTE
PPTE
t G/G (21/21)
1,4
MPTE
PPTE
t espordica
49
100
t D/G
66
66,6
t G/G
44
33,4
(t) Translocacin; (MPTE) Madre portadora de translocacin
portador de translocacin equilibrada

1 a 2%
1 a 2%
1 a 2%
equilibrada; (PPTE)

10
5
7
3
100
100
1a2
1a2
1a2
Padre

5.TCNICASUTILIZADASPARAELDIAGNSTICOPRENATAL
Existen actualmente varias tcnicas para diagnstico prenatal que permiten
estudiar al feto en su composicin cromosmica, enzimtica, bioqumica y molecular
mediante estudios del ADN. Entre las tcnicas utilizadas actualmente para el
diagnstico prenatal y que han aparecido secuencialmente, estn:

a)

Estudio en lquido amnitico (LA), puncin transabdominal. Entre las 15 y 18 semanas de


embarazo.

b)

Estudio de vellocidades coriales o biopsia corial (BC), transvaginal. Entre las 9 y 11


semanas de gestacin.

c)

Fetoscopia y estudio de LA, transabdominal. Entre las 15 y 22 semanas de embarazo.

d)

Estudio de BC transabdominal. Entre las 15 y > 22 semanas de gestacin.

e)

Fetoscopia y estudio de BC, transvaginal. Entre las 9 y 11 semanas de embarazo.

f)

Funiculocentesis, estudio directo de sangre detal de cordn. Entre las 18 y > 22


semanas de gestacin.

g)

Celomacentesis, estudio de las clulas fetales de la cavidad celmica, tcnica


desarrollada por Davor Junkovic en Londres, que se realiza entre las 6 y 10 semanas de
embarazo, con una efectividad de hasta el 70%.

Cualquiera de las tcnicas anteriormente anotadas sirve para estudios


cromosmicos, enzimticos, bioqumicos y moleculares. La diferencia entre una y otra

ASPECTOS GENTICOS DEL CRECIMIENTO Y DESARROLLO

291

est en el grado de complejidad de cada tcnica, la edad gestacional en que se la realiza


y sus riesgos. El siguiente cuadro muestra las posibilidades de diagnstico prenatal
segn el tipo de afeccin que se busque (Tabla XV.16).
Para un diagnstico prenatal se recomienda cumplir los siguientes requisitos:
evaluacin clnico-gentica de la pareja, explicacin de las alternativas para el
diagnstico prenatal, de los riesgos de la prueba (1 a 2% de prdida fetal en los 15 das
posteriores a la extraccin de la muestra), de las posibilidades de falsos negativos y
falsos positivos (0,1 a 1%), de la probabilidad de no encontrar metafases o de no
crecimiento celular (1 a 3%) y de la real efectividad del diagnstico prenatal que,
combinando las tres tcnicas tradicionales: amniocentesis con estudio cromosmico,
bioqumico-enzimtico (AFP) y ecosonografa, puede cubrir un 30% de posibilidades
malformativas fetales. Toda tcnica de diagnstico prenatal debe realizarse bajo
vigilancia ecosonogrfica.
Tabla XV.16. Probabilidad del diagnstico prenatal segn la causa del problema
Causa
Cromosmica

Frecuencia
0,6%

Diagnstico
100%

Monognicas

1,4%

< 40%

Polignicas

3,0%

90%

Procedimiento
Lquido amnitico, biopsia corial,
funiculosentesis
Lquido amnitico, biopsia corial,
funiculocentesis (ADN, enzimas,
bioqumicos)
Ecosonograma, multifactoriales
radiolgicos, fetoscopa, inmunolgicos,
enzimticos, bioqumicos

En el pas se contaba con la tecnologa del lquido amnitico y de la biopsia


corial para estudios cromosmicos y algunos enzimticos. Con el avance del anlisis de
enfermedades genticas y cromosmicas, actualmente, existe la capacidad de analizar
ms enfermedades que hace 30 aos.
Hasta la fecha, los datos que tenemos sobre diagnstico prenatal en Quito se
concentran en la siguiente tabla:
Tabla XV.17. Diagnstico prenatal en lquido amnitico y vellosidades coriales
Indicacin
citogentica
Hijo previo SD
Alta edad materna
Hijo previo
polimalformado
Translocaciones

Casos
23
55

LA
22
55

12

12

BC
1
1

Muestra
Normal
Anormal
22
1: (47,XX,+21)
51 4: (47,XY,+21); (47,XXY); (45,X0);
(46,XX,+mic)
12
7: t(2;18); t(4;11); t(5;14); t(6;7);
t(8;X); t(13;15); t(11;14)

Abortos previos
6
6
6
Angustia materna
8
8
7
Total
111
110
2
98
(SD) Sndrome de Down; (LA) Lquido amnitico; (BC) Biopsia corial

1
13

ASPECTOS GENTICOS DEL CRECIMIENTO Y DESARROLLO

292

Una lista de indicaciones para el estudio cromosmico en la pareja e


indicaciones del diagnstico prenatal en lquido amnitico o biopsia corial se presenta
en el siguiente cuadro.

a)

Abortos a repeticin (> 1) sin causa aparente.

b)

Historia de cromosomopatas anteriores, en hijos o familiares y antecedentes


malformativos.

c)

Infertilidad o esterilidad de causa desconocida.

Indicaciones para el estudio cromosmico en la pareja

Indicaciones del diagnstico prenatal en lquido amnitico o biopsia corial


a)

Embarazo en una mujer mayor de 35 aos.

b)

Embarazo posterior a abortos a repeticiones.

c)

Historia familiar de cromosomopatas.

d)

Progenitor con una anomala cromosmica estructural equilibrada.

En este captulo se ha pretendido resolver algunas dudas sobre los riesgos


genticos y malformativos en el embarazo en particular y paralelamente, llamar la
atencin sobre aspectos que de una u otra manera contribuyan al desarrollo de la
Gentica Mdica y posibiliten mejorar o prevenir la salud en nuestra comunidad.
Algunas enfermedades que necesitan una gua mdica y gentica adecuada, con
sus posibles alternativas, se recogen en la Tabla XV.18.
De lo revisado anteriormente, se puede concluir que la Gentica de Poblaciones
sirve en la prctica para ubicar comunidades genticamente emparentadas, para estudiar
polimorfismos genticos, hallar cercanas o alejamientos gnicos, encontrar patrones
gnicos comunes asociados a enfermedades o fenmenos biolgicos peculiares de
grupos poblacionales aislados o racialmente emparentados. La Gentica de Poblaciones
sirve adems, para comprender los fenmenos de migracin, flujo de genes, intercambio
de informacin gentica, seleccin natural, al azar o artificial y la evolucin de las
especies.
En Medicina (clnica, legal y forense) la informacin de genealogas, frecuencia
de enfermedades, asociaciones de marcadores genticos, bioqumicos, enzimticos y
proteicos, permite hacer clculos bastante aproximados de riesgos de recurrencia de
enfermedades, ubicar poblaciones con mayor riesgo de enfermedades, resolver
problemas de paternidad y poder realizar un buen asesoramiento y consejo gentico.
Finalmente, el estudio de los polimorfismos en las poblaciones humanas es til para la
construccin de mapas de ligamiento y para establecer distancias entre los diferentes
genes en el genoma humano (Nussbaum et al., 2008).

ASPECTOS GENTICOS DEL CRECIMIENTO Y DESARROLLO

293

Tabla XV.18. Alternativas frente al riesgo gentico


Interrupcin teraputica del embarazo
a) Defectos del cierre del tubo neural: anencefalia, encefalocele e hidrocefalia
b) Cromosomopatas: todas las que se acompaan de minusvala severa
c) Malformaciones renales: agenesia, poliquistosis
d) Enfermedades genticas graves: bioqumicas, metablicas o hematlogicas
Tratamiento en tero
a) Anemia, eritroblastosis e hidrops
b) Hipotiroidismo y bocio
c) Hidronefrosis bilateral
d) Hidrocefalia obstructiva
e) Hernia diafragmtica
f) Insuficiencia cardaca frmaco convertible
Induccin pretermino
a) Bandas amniticas
b) Crecimiento fetal retardado tipo II
c) Gastrosquisis
d) Hidrocefalia obstructiva progresiva
e) Hidronefrosis obstructiva
f) Hidrops fetal
Cesrea electiva
a) Siameses
b) Hidrocefalia
c) Higroma qustico
d) Mielomeningocele grande o roto
e) Onfalocele
f) Teratoma sacrocoxgeo
Correccin post parto inmediato
a) Atresia digestiva
b) Hernia diafragmtica
c) leo meconial
d) Defectos de cierre de tubo neural. Higroma
e) Rin multiqustico

6.NUEVAERADELDIAGNSTICOPRENATALENELECUADOR

Una de las preocupaciones ms grandes de la mujer embarazada es si su hijo


nacer bien: ntegro, sano, con sus sentidos normales y plena capacidad mental.
Tradicionalmente, las tcnicas de evaluacin del producto del embarazo eran
limitadas: palpar y or. El desarrollo de la medicina introdujo mtodos sofisticados
como los rayos X y la ecosonografa, para evaluar intratero cientos de enfermedades.
Hacia los aos ochenta del siglo XX se desarroll el diagnstico prenatal cromosmico
y gentico, a travs del estudio del lquido amnitico extrado de la madre. La tcnica
incluye la evaluacin adicional de la protena AFP que informa si el estuche seo del
cerebro y columna vertebral estn intactos. Juntas la ecosonografa, cromosomas y AFP
dan una informacin diagnstica del feto hasta un 35% de problemas malformativos y
discapacitantes.

ASPECTOS GENTICOS DEL CRECIMIENTO Y DESARROLLO

294

La ecosonografa detecta hasta el 85% de problemas malformativos y el lquido


amnitico hasta unas 500 enfermedades cromosmicas. Pero esto no es suficiente. Aun
hay mucho por hacer ya que se conocen 9 mil enfermedades del ADN y solo mil tienen
diagnstico.
Hoy, combinando los conocimientos en Microelectrnica y Biologa Molecular
se han creado los biomicrochips (biochips), unin de ADN a lectores electrnicos de
alta sensibilidad. Los biochips podran evaluar el genoma completo de un feto, pero, por
ahora, los primeros biochips para el diagnstico prenatal se han desarrollado para las
150 enfermedades ms comunes del ADN; adelanto acogido por la comunidad cientfica
y por las madres beneficiadas con complacencia y mucha esperanza.
El diagnstico prenatal tiene objeciones que lindan con la moral. Injustamente se
lo asocia al aborto porque al diagnosticar prenatalmente un problema grave, 99% de
madres suelen solicitar una interrupcin teraputica de su embarazo, y eso est
prohibido en el Ecuador por caducas leyes. De todas maneras, ante un diagnstico de
embarazo con malformaciones o enfermedades genticas graves, las familias y las
mujeres buscan y terminan en una interrupcin teraputica, incluso al margen de la ley.
Este es justamente el tema central a ser resuelto desde el punto de vista tico y
cientfico, no moral.
Pese a los 30 aos de vigencia de las tcnicas del diagnstico prenatal, en el
Ecuador muy pocos centros las ofrecen y, por los costos altos, son casi inaccesibles. Ni
se diga los biochips que no existen en el pas ni hay planes de implementarlos. El
diagnstico prenatal (DP) es un derecho de las mujeres, de la salud reproductiva, es una
posibilidad de tener hijos sanos y debera ser parte de los programas de salud pblica y
prevencin de discapacidades.

Captulo XVI
Aspectos bioticos en la investigacin

Las regulaciones bioticas en las diversas reas de investigacin han permitido


de cierta forma controlar la metodologa experimental en los diferentes laboratorios.

1.REGULACINDELASINVESTIGACIONESANIVELMUNDIAL
Durante las ltimas cuatro dcadas se ha adquirido un conocimiento amplio
sobre el ADN, sus funciones y sus alternativas de manipulacin molecular, lo que ha
creado nuevas ramas en la Biologa y en la Medicina: la Ingeniera Gentica y la
Biotecnologa. Estas ramas han permitido la construccin artificial de molculas de
ADN que pueden transmitir informacin gentica entre clulas u organismos que no
tienen relacin alguna, es decir, que se han obviado experimentalmente las barreras que
la naturaleza ha puesto para el intercambio gentico entre organismos no emparentados
biolgicamente. Esto ha determinado que entre los investigadores surjan debates
encaminados a la autoevaluacin y autorregulacin de esta depurada tecnologa gentica
que, al decir de algunos, conlleva riesgos inconvenientes para las especies, la evolucin
y la ecologa.
El debate entre cientficos y no cientficos se ha centrado en la validez o no de
las investigaciones biotecnolgicas, sus resultados y aplicaciones. Muchos han
considerado que el asunto posee un tinte poltico importante frente al que es pertinente
pensar si la ciencia ha adquirido dimensiones suficientes como para dejarla en manos de
los propios cientficos o si se debera permitir que sea regulada, normalizada y
controlada por los no cientficos.
La tecnologa del ADN recombinante se puede resumir en las siguientes
disciplinas: manipulacin de genes procariontes, transferencia de genes intraespecie e
interespecie, mapeo y expresin artificial de ADN procarionte o eucarionte,
amplificacin y regulacin gnica, manipulacin de genes eucariontes, ingeniera
gentica humana, terapia gnica, tecnologa reproductiva y embrionaria, clonacin de
genes e individuos y manipulacin gentica de embriones, entre las principales
(Strachan & Rear, 2010).
Frente al desarrollo de la biotecnologa, la avalancha de datos y experimentos
fue tan grande en un momento determinado que los cientficos, en la reunin
denominada Asilomar Conference on DNA Recombinant Molecules (1975),
resolvieron parar las investigaciones hasta aclararse algunas cuestiones fundamentales
en la investigacin biomolecular, sobre todo en referencia a algunos experimentos que
resultaran arriesgados. Las tendencias se polarizaron en los cientficos, unos vean
como beneficiosa la manipulacin gentica y sus perspectivas, como eran la produccin
de frmacos ms eficaces y baratos, la mejor comprensin de las causas de ciertas
enfermedades genticas y del cncer, la produccin alimentaria ms abundante, la
produccin de hormonas, terapia gnica e incluso nuevos enfoques al problema de la
energa. Al otro extremo se ubicaron las tendencias pesimistas que consideraban a la
Biotecnologa como un peligro, ya que su poco conocimiento podra encaminar a la

ASPECTOS BIOTICOS EN LA INVESTIGACIN

298

humanidad a epidemias extraas producidas por agentes patgenos de nueva creacin,


amenaza de catastrficos desequilibrios ecolgicos y confeccin de nuevas armas para
militaristas y terroristas con consecuencias polticas nefastas como el dominio y control
de la humanidad. Paralelamente a la decisin de detener las investigaciones
biotecnolgicas se conformaron grupos de cientficos y no cientficos para evaluar el
producto obtenido hasta ese momento, con los siguientes tres objetivos:
a)

Analizar los potenciales riesgos biolgicos y ecolgicos de los distintos tipos de molculas
de ADN recombinante que se puedan obtener.

A continuacin, se resume ciertas normas para el trabajo biotecnolgico; que son


aceptadas
por la mayora
de investigadores
y pases
(OMS, 2005):
b) Promocionar
el desarrollo
de procedimientos
que minimicen
la difusin de estas molculas
entre los seres vivos, especialmente el hombre y los animales.

1.1.Normasdetipofsico
c) Establecer una normativa a seguir por los investigadores que trabajen en molculas de
ADN recombinante que entraen peligro potencial.

Existen cuatro normas de tipo fsico:


Estas tres tareas se concretaron como respuesta a las tendencias pesimistas entre
los investigadores y como una autocrtica severa a los experimentos hasta entonces
realizados. Se ha argumentado que los peligros biolgicos y ecolgicos de la
manipulacin biotecnolgica surgen inadvertidamente y que los daos sociales pueden
ser producto de mentes malficas. Hay que considerar que los posibles daos causados
por la investigacin en Ingeniera Gentica, no seran ni son la nica causa de peligros
para la humanidad. Los beneficios obtenidos en la manipulacin gentica son enormes,
basta anotar las vacunas obtenidas por Ingeniera Gentica o la terapia gentica, en
desarrollo (Paz-y-Mio, 2013). Sin embargo, un hecho es cierto: nunca, hasta la fecha,
se ha producido un acontecimiento funesto en la investigacin del ADN recombinante
ni en sus aplicaciones. Por esto, la comunidad cientfica consider necesario llevar a
cabo una investigacin orientada a reducir eficazmente el grado de duda actual acerca
del riesgo de determinados experimentos y crear comits de vigilancia, normalizacin y
evaluacin de la experimentacin biotecnolgica. Surgi as el concepto de contencin
biolgica, es decir, el uso de cepas microbiolgicas genticamente deficiente con mayor
control en su manipulacin.
1.1.Normasdetipofsico

En relacin a las normas de tipo fsico que existen en los diversos laboratorios a
nivel mundial, existen 4 niveles de bioseguridad que se basan en el tipo de muestras y
materiales utilizados, siendo el nivel 1 el ms leve y el nivel 4 el ms estricto. Sus
diferencias son las siguientes:

1.1.1.NivelP1
Empleo de tcnicas estriles, prohibiciones expresas (no comer, no fumar, etc.) y
esterilizacin de los desechos antes de ser eliminados.
1.1.2.NivelP2

Normas similares a las anteriores, ms el ingreso al laboratorio nicamente de


personal autorizado que conozca los riesgos a los que est expuesto.

ASPECTOS BIOTICOS EN LA INVESTIGACIN

299

1.1.3.NivelP3
Iguales indicaciones que las anteriores, pero las investigaciones se deben realizar
en laboratorios con presin negativa, y separados de otras reas de trabajo. No se
permitir la salida fuera del laboratorio de organismos viables, a menos que
permanezcan en recipientes irrompibles, sellados y descontaminados exteriormente.
1.1.4.NivelP4
Nivel de mxima seguridad, destinado al trabajo con organismos altamente
patgenos o peligrosos. Aislamiento de las zonas de trabajo; apertura de recipientes en
gabinetes o campanas de bioseguridad tipo IV. Pocos laboratorios debern ser
autorizados para este tipo de trabajo.
1.2.Normasdetipobiolgico
Existen tres sistemas EK:
1.2.1.SistemaEK1
Empleo de cepas microbiolgicas no patgenas, incapaces de colonizar al ser
humano; empleo de vectores no autorreproducibles como el fago lambda.
1.2.2.SistemaEK2
Empleo de cepas genticamente alteradas que sean incapaces de vivir en
condiciones normales fuera del laboratorio y que tengan una probabilidad de
supervivencia fuera de ste de 10-8.
1.2.3.SistemaEK3
Iguales medidas que las anteriores y adems que los recombinantes genticos
sean probados en animales.
Con el propsito de tener mayor seguridad en el trabajo biotecnolgico, se han
creado cepas bacterianas de Escherichia coli X1776 con 15 deficiencias genticas que le
proporcionan destruccin de bacterias y de su informacin gnica, si se intenta
cultivarlas fuera del laboratorio, aumento de la sensibilidad de las clulas a
determinadas condiciones fsicas y ambientales, y dificultad de transmisin de la
informacin gentica a otros microorganismos. Como se puede apreciar, las normas de
bioseguridad para el trabajo en biotecnologa de alto riesgo son rigurosas y permiten
efectuar, con bastante seguridad, estas investigaciones.
En muchos pases ya existen regulaciones legales para tratar los temas anotados;
en el nuestro, hay un vaco legal al respecto. Se ha intentado regular la accin mdica en
casos conflictivos, como aquellos en los que se deba planificar las actividades de un
hospital o evaluar un caso en particular en funcin de las demandas sociales y
prioridades mdicas e individuales.

ASPECTOS BIOTICOS EN LA INVESTIGACIN

300

En Biomedicina, existen algunos aspectos puntuales a plantear en relacin a


manipulacin gentica de embriones. Se sabe que esta orienta a:
d)

Alterar los mecanismos de reproduccin: Sea contracepcin, fertilizacin artificial y


clonacin
de individuos.
A continuacin,
se resume ciertas normas para el trabajo biotecnolgico; que son

aceptadas
por la mayora
investigadores
y Aborto
pases y(OMS,
2005):
e) Manipulacin
sobre losdecigotos
y embriones:
parto inducido.
f) Manipulacin perinatolgica: Uso de rganos y experimentacin teraputica.
1.1.Normasdetipofsico
g)

Eugenesia y eutanasia.

h)

Manejo, intercambio y uso de los recursos genticos de rganos y tejidos.

Existen cuatro normas de tipo fsico:

2.AVANCESENLATECNOLOGADELADNRECOMBINANTE
El desarrollo de la tecnologa del ADN recombinante ha desembocado al sueo
de los genetistas humanos, esto es el poder reemplazar genes anormales por normales.
Para este aspecto los tratados bioticos son rigurosos. De las cuatro categoras de la
Ingeniera Gentica Humana expuestas a continuacin, tan solo la primera ha sido
aceptada como vlida para la investigacin en terapia gnica:
a)

Terapia de clulas somticas: Su intencin es corregir defectos genticos en alteraciones


somticas.

A continuacin, se resume ciertas normas para el trabajo biotecnolgico; que son


aceptadas
por en
la mayora
de investigadores
y pases
(OMS,defectos
2005): genticos en clulas
b) Terapia
clulas germinales:
Su finalidad
ser corregir
germinales.

1.1.Normasdetipofsico
c) Incremento de una caracterstica gentica especfica: Pretender estimular la produccin
de un producto gnico, por ejemplo la hormona de crecimiento.
d)

Existen cuatro normas de tipo fsico:

Ingeniera gentica eugnica: Una vez conocido el genoma humano, pretender alterar o
mejorar caractersticas humanas complejas, sean de origen mono o polignico.

Un punto importante a ser tratado en relacin a los aspectos ticos de la


manipulacin gentica es el impacto que la biotecnologa tiene sobre los pases en vas
de desarrollo; y la dependencia tecnolgica y an poltica que este tiene por permanecer
al margen de ciertas tecnologas de vanguardia. Habr que meditar sobre la propiedad
de los descubrimientos del ADN recombinante, su comercializacin y el mantenimiento
o no de su carcter secreto. La reunin sobre el ambiente en Ro de Janeiro con su
documento sobre Biodiversidad y bioproteccin, y la llamada Agenda 21 (1992),
son pasos importantes en la proteccin de la rica biodiversidad gentica de nuestros
pueblos, de las regulaciones sobre acceso a recursos genticos, control, propiedad y
restricciones. Se habla actualmente de los riesgos de los bioprospectores y aun de un
biopirateo de las reservas genticas humanas y de otras especies. Mientras los pases "en
desarrollo" no planifiquen su desarrollo tecnolgico, la dependencia cientfica y
econmica hacia los "poseedores de la ciencia" ser mayor. El acceso a la tecnologa y a
los conocimientos cientficos, cuya potencialidad no entrae riesgo de muerte, no
produzca cambios en la identidad biolgica e individual de la especie y garantice una
vida productiva y digna, es un derecho de toda la humanidad y su utilizacin en
beneficio de todos es un imperativo.

ASPECTOS BIOTICOS EN LA INVESTIGACIN

301

El uso indebido de la informacin gentica en los momentos actuales, ha


producido fenmenos socialmente extraos y que constituyen problemas ticos
especiales, estos son: la discriminacin gentica de los individuos afectos, la
discriminacin gentica de los familiares de afectos, la discriminacin gentica de
poblaciones de riesgo detectadas mediante pesquizaje poblacional, la discriminacin de
enfermos crnicos e incurables (VIH, cncer, demencia senil, ataxia, etc.); y el
biosaqueo de muestras biolgicas (como la venta de ADN de poblacin Huaorani por
empresas extranjeras). Este fenmeno relativamente nuevo en nuestra sociedad, pone en
alerta sobre el mal uso de la informacin cientfica que, de una u otra manera ha
tergiversado el hecho gentico, ha incluido juicios de valor y ha llegado al mximo del
absurdo al tratar de justificar investigaciones, negocios y ganancias a costa del trabajo
gentico serio.
Se debe considerar tambin que la investigacin biotecnolgica y de gentica
molecular no son las nicas causas de desastres biolgicos o ecolgicos como pretenden
sostener los defensores de posiciones extremas. El propio desarrollo y tecnificacin de
las sociedades puede ocasionar mayor dao a la humanidad en comparacin con el
beneficio de las tcnicas referidas; por ejemplo, la desaparicin de especies animales y
vegetales no es y no ha sido necesariamente consecuencia de la investigacin bsica;
tmese en cuenta la presin que ejercen en su contra determinados grupos ecologistas
en la actualidad. Las aplicaciones de la investigacin biomdica sern bienvenidas
cuando no atenten contra la evolucin de las especies y estn orientadas a la utilizacin
eficaz de la tecnologa, a mejorar la calidad de vida y a asegurar el futuro de la
sociedad.
En vista de que muchos de los temas que se plantean incluyen juicios de valor, el
debate de las tendencias biotecnolgicas debe salir del campo estricto de la ciencia,
considerando que no existen "conocimientos prohibidos" y que el conocimiento
cientfico ha sido y es el motor del adelanto de la sociedad. Sera muy difcil evaluar lo
que se puede ganar o perder con un nuevo conocimiento, pero resultara an ms difcil
evaluar el precio de no tenerlo; as mismo, sera preferible normalizar los conocimientos
y los productos que la sociedad tiene antes que privarla de los beneficios de su uso.

3.ACCIONESDELAGENTICAENLASALUDPBLICA

La Gentica Mdica est orientada a identificar los principales problemas de


salud en la comunidad con la finalidad de realizar acciones encaminadas a prevenir las
enfermedades genticas, prestar los servicios asistenciales y preventivos a individuos o
familiares afectos o en riesgo de padecer o transmitir a su descendencia enfermedades
genticas. Puntualizando y siguiendo con los criterios de la OMS y la OPS, las
actividades de la gentica en la comunidad tratan de alcanzar dos objetivos:

a) Reducir la prevalencia al nacimiento de las enfermedades genticas y defectos congnitos.

b) Mejorar la calidad de vida, reduciendo al mnimo el dao al individuo y a su familia.

Para alcanzar estos objetivos se recomienda: detectar las poblaciones de riesgo


mediante el estudio adecuado de las genealogas de los casos ndice, detectar

ASPECTOS BIOTICOS EN LA INVESTIGACIN

302

poblaciones de mujeres gestantes de edad avanzada, ubicar zonas geogrficas y grupos


tnicos predispuestos o de riesgo, implantar programas de diagnstico prenatal y
asesoramiento gentico como parte de los programas generales de salud del pas y como
un programa nacional especial de control y prevencin de las enfermedades genticas.

Prevencin primaria
a)

Desalentar las gestaciones en mujeres mayores de 40 aos.

b)

Disminuir los niveles de exposicin a mutgenos y teratgenos.

c)

Llevar adelante programas para el control de defectos frecuentes en las poblaciones


y que disminuyen la capacidad productiva y de vida de los individuos, como son los
defectos de cierre del tubo neural, dislocacin congnita de cadena, entre otros.
Prevencin secundaria

a)

Servicios y centros de gentica que proporcionen el diagnstico adecuado de los


casos ndice y de las poblaciones en riesgo.

b)

Asesoramiento gentico al individuo y a la poblacin de riesgo.

c)

Diagnstico prenatal de las enfermedades genticas, en especial las ms frecuentes.


Prevencin tercearia

a)

Educacin gentica a los trabajadores de la salud y a la poblacin.

b)

Formacin de recursos humanos en gentica.

c)

Investigacin de los principales problemas de la salud gentica comunitaria en


investigacin gentica bsica.

Para esto se debe contar con un sistema de registro de alteraciones genticas y


malformaciones congnitas. Con este propsito se organiz el Registro Nacional
Colaborativo de Alteraciones y Variantes Cromosmicas Humanas; resta formar un
sistema nacional de registro de malformaciones congnitas y genticas, que integre
bases de datos de instituciones de salud pblicas y privadas (Paz-y-Mio, 1993a).
Recientemente, en nuestro pas se est fomentando e implementando un
programa nacional de diagnstico, prevencin y control de enfermedades genticas por
parte del Ministerio de Salud Pblica. A pesar de ello, las acciones que se han venido
realizando a nivel de instituciones pblicas y privadas han sido parciales, dependiendo
ms de los criterios personales de los genetistas, que de una Poltica Estatal; cabe anotar
que la Sociedad Ecuatoriana de Gentica Humana (SEGH) ha dado ya algunos pasos
para organizar la atencin de los individuos afectos de patologas genticas con el fin de
que se mantenga una estructura comn. Las actividades de gentica, en los diferentes
centros hospitalarios o universitarios; se pueden resumir a las siguientes:

ASPECTOS BIOTICOS EN LA INVESTIGACIN

a)

Diagnstico de casos ndice.

b)

Bsqueda de antecedentes familiares.

c)

Diagnstico y asesoramiento gentico.

d)

Deteccin de ciertos grupos de riesgo.

e)

Deteccin sistemtica de defectos en recin nacidos.

f)

Diagnstico prenatal.

g)

Consulta a expuestos a mutagnicos y teratgenos.

h)

Educacin continuada.

i)

Investigacin clnica y ciertas investigaciones bsicas.

j)

Formacin de personal (especialistas en biomedicina y gentica humana).

303

Captulo XVII
Biodiversidad y bioseguridad en Gentica
A inicios de los aos noventa, investigadores extranjeros determinaron, en un
grupo de indios cayapas de la provincia de Esmeraldas, una caracterstica gentica de la
inmunidad exclusiva de esa poblacin (HLA) (Rickards et al., 1994). Todos nos
preguntamos Qu ventajas trajo esta investigacin a los cayapas? Saban aquellas
personas con qu fines eran investigados? Hubo participacin de cientficos ecuatorianos
en aquellas pruebas? Conocan las autoridades del pas que se llevaba a cabo tal
investigacin?
Este hecho que parece aislado, se est convirtiendo en un fenmeno frecuente en
los pases que, como el nuestro, estn sujetos a presiones cientficas, econmicas,
ideolgicas y polticas. Tales acciones, si estn fuera del respeto a los conocimientos
cientficos tradicionales y milenarios o son conocimientos captados para un buen rdito
econmico, o, peor an, en bsqueda de especmenes biolgicos o muestras de tejidos
humanos, se las ha calificado acertadamente como biopiratera, biosaqueo y colonialismo
cientfico. Antes de buscar responsabilidades en estos casos, debemos buscar mecanismos
de defensa de nuestra identidad biolgica, gentica y en suma nacional. El propsito de
este captulo es revisar algunas de las implicaciones bioticas, de bioproteccin y
biodiversidad, que tienen algunos de los comportamientos investigativos y proyectos
internacionales, que de alguna manera podran estar atentando contra algunos grupos
humanos. Pero tambin se pretende desmitificar cuestiones genticas y tecnolgicas que
han sido manejadas mal y que podran repercutir en una posicin contraria a la actividad
cientfica seria, solidaria y en defensa de la propia humanidad.

1.BIOPROTECCINYBIODIVERSIDAD
En primer lugar es importante aclarar el significado de los trminos bioseguridad
y bioproteccin. Es preferible hablar de bioproteccin antes que de bioseguridad, debido
a que la palabra bioseguridad est entendida como una serie de conceptos, aseveraciones
y alternativas, que permitiran de alguna manera establecer un marco terico, legal y de
consenso nacional, internacional y de investigadores, para proteger o denunciar aquellos
trabajos investigativos, bioprospeccin o biosaqueo de muestras biolgicas o especmenes.
En definitiva, encontrar una frmula para asegurar los recursos genticos y los
conocimientos tradicionales o cientficos que de ellos se deriven. Esta concepcin de la
bioseguridad conduce directamente al aspecto legal de la propiedad intelectual, de las
patentes y aun el respeto a un cdigo biotico en las investigaciones.
En el convenio sobre biodiversidad que varios pases firmaron en Ro de Janeiro,
Brasil (1992), en la Conferencia de Naciones Unidas sobre el Ambiente y el Desarrollo, y
que luego fue ratificado por el Ecuador (1993), se discuti otro documento, que es la
Agenda 21, en la que se detalla las estrategias del Gobierno, necesarias para el desarrollo
sustentable de los pueblos. En su fondo y forma de alguna manera estos dos documentos
son instrumentos base para la bioproteccin. Otro de los documentos en esta lnea es la
Decisin 391, aprobada en Venezuela bajo el amparo del Acuerdo de Cartagena (1996).

BIODIVERSIDAD Y BIOSEGURIDAD EN GENTICA

308

La segunda acepcin de bioseguridad y la ms utilizada, hace relacin a las


normas, reglamentos y acuerdos que los cientficos tienen sobre la proteccin individual y
poblacional en relacin a los posibles riesgos que entraara el trabajo con las tcnicas de
Biologa Molecular, Gentica y Biotecnologa.
Entendido as el trmino bioseguridad, y por la utilizacin que ya se le ha dado ms
en relacin a seguridad laboral y de riesgos biolgicos, sera preferible hablar de
bioproteccin, este trmino est ms en conformidad con la primera definicin que se ha
intentado y no prestara a confusiones. En este documento se utilizar por lo tanto este
trmino: bioproteccin.
Se entiende como biodiversidad la innumerable variedad de especies biolgicas
existentes, cada una diferenciada de la otra por su informacin gentica, su
anatoma/morfologa, sus cualidades fisiolgicas, bioqumicas y su rol dentro del
ambiente. Pero el concepto a la luz de los nuevos conocimientos cientficos puede
extenderse a la variacin no solo a nivel de interespecies, sino tambin en intraespecies,
as por ejemplo: la variacin gentica que los seres humanos presentan y que les confiere
caractersticas biolgicas especiales como: etnicidad, susceptibilidad a enfermedades,
resistencia a enfermedades, adaptabilidad al medio, entre otros. Es decir, el concepto puede
convertirse en un asunto individual. Cada individuo por si mismo representa una unidad
diversa, corroborado por el criterio cientfico que no existen individuos iguales. En este
sentido la gentica ha aportado datos valiosos.
Otro trmino que interesa en relacin a la bioproteccin y biodiversidad es el
recurso gentico, que en Ro de Janeiro se lo defini como Todo material de origen
vegetal, animal, microbiano o de otro tipo que contenga unidades funcionales de la
herencia, se agrega que recurso gentico es todo material gentico de valor real o
potencial, incluida cualquier porcin del organismo que contenga unidades funcionales de
la herencia, esto es ADN, ARN, cromosomas, plsmidos, fagos, en suma secuencias
genticas y epigenticas. Aqu existe una limitacin en el universo de accin de material
gentico, as, todo lo que sea extracto de plantas, fluidos corporales, entre otros, que no
contengan material de la herencia, estaran excluidos de la definicin y por lo tanto
mereceran otro tratamiento.
Desde el punto de vista que nos compete, esto significara que podra ser utilizado
sin restriccin o que se debera regular su utilizacin, explotacin, bioprospeccin,
coleccin y biodisponibilidad.

2.ASPECTOSTERICOSDELABIODIVERSIDADYBIOPROTECCIN
Al inicio de este captulo se ha conceptualizado el trmino bioproteccin. A
continuacin, se tratar de algunos aspectos que se consideran importantes para aclarar la
posicin que la mayora de investigadores genetistas tiene en relacin a lo que seran las
investigaciones compartidas, la seguridad en la investigacin, la biotica y los
beneficiarios.
Muchos de los criterios que se expondrn han sido discutidos en varios congresos
latinoamericanos de Gentica, y coinciden en su esencia con los planteamientos de la

BIODIVERSIDAD Y BIOSEGURIDAD EN GENTICA

309

Conferencia del Ambiente en Ro de Janeiro, de la Agenda 21 de 1992 y de la Decisin


391 del Acuerdo de Cartagena. Entre los puntos destacados estn:

a)

Buscar la aprobacin de individuos y poblaciones para tomar sus muestras, lo que se


conoce como consentimiento informado. Algunas dudas quedan al respecto: Quin da
el consentimiento, el individuo, el grupo implicado, la sociedad, el gobernante o el Estado?
Cmo se explicar el proyectp? Los procedimientos tienen riesgos? Cmo
repercutir la investigacin en la comunidad?

b)

Se ha cuestionado si los investigadores tienen o no la facultad de extraer muestras


biolgicas de las poblaciones. En este sentido, la mayora de investigadores pensamos
que es vlido el investigar con muestras biolgicas, siempre y cuando las investigaciones
estn encaminadas a proteger al individuo, mejorar su calidad de vida, defender su
patrimonio cultural, tradicional, no atentar contra su esencia gentica o biolgica, y
cuidar su biodiversidad.

c)

Se ha hablado de custodios de los recursos genticos, con lo que se pretende que el


Estado, en caso de utilizar recursos que estn en una zona privada o comunal, consulte a
sus pobladores sobre sus planes de prospeccin o explotacin de los recursos, y en el
mejor de los casos se realice un contrato entre los colectores y los custodios, o el propio
Estado.

En algunos casos la variabilidad gentica de los seres humanos ha sido utilizada en


forma poco tica, sobre todo porque los beneficios que las personas esperan de su aporte
voluntario de muestras biolgicas, est cargado a la esperanza de una mejor vida, de
resolucin de problemas bsicos de salud, econmicos y de otra ndole. Pero curiosamente,
mientras las poblaciones esperan esos beneficios, sus bioprospectores utilizan esas mismas
limitaciones vitales para canjear, argir, comprar, biopiratear o regatear con las
poblaciones la obtencin de sus preciadas muestras, sobre todo de sangre y pelo. El caso de
la mujer Ngbe (guaym) de Panam, tal vez es el ms sonado y pone en alerta sobre las
apropiaciones de recursos genticos humanos. La personalidad de la mujer guaym,
mantenida en secreto por sus descubridores, denota lo complicado del manejo de esta
temtica. Esta mujer al parecer presenta una especial susceptibilidad genticamente
comandada a un tipo de retrovirus, similar al virus VIH del SIDA; el virus se lo conoce
como linfotropical tipo II de indgenas guaym. Este virus, en su relacin con el husped
humano, produce un tipo de leucemia (cncer sanguneo) y por ende tiene un inters
investigativo especial, ya que proporcionara nuevas pistas en el entendimiento de los
mecanismos de oncognesis y de infeccin viral. Su material gentico guardara algn tipo
de informacin valiosa desde el punto de vista de susceptibilidad a la infeccin por
retrovirus.
El caso de los cayapas y de los guaym nos abren interrogantes interesantes en la
discusin de lo que es biodiversidad y bioproteccin desde el punto de vista gentico.
Existen algunas cuestiones que se deben considerar al respecto, que podran servir de gua
en la bioproteccin y que son el espritu de los documentos de Ro de Janeiro, Agenda 21 y
Decisin 391: El reconocimiento de los derechos soberanos de los estados sobre sus
recursos naturales y genticos; los aspectos relacionados con la conservacin in situ y ex
situ de la especie o sus tejidos; el uso sustentable de los recursos biolgicos que aseguren
la supervivencia humana; el acceso a los recursos genticos y a la tecnologa relevante; el
acceso a los beneficios derivados de esas tecnologas o de sus hallazgos; la seguridad o
riesgo que implica la actividad con organismos modificados genticamente; la elaboracin

BIODIVERSIDAD Y BIOSEGURIDAD EN GENTICA

310

y adaptacin de polticas globales de conservacin de la diversidad biolgica y de la


bioprospeccin; la integracin del concepto de diversidad biolgica en las polticas
sectoriales existentes; la proteccin de los recursos que tengan carcter de diovidersos; la
legislacin, evaluacin y modernizacin de los convenios internacionales encaminados a
lograr una participacin equitativa; los acuerdos sobre propiedad intelectual, patentes,
derechos y regalas por el uso y comercializacin de los hallazgos genticos; la educacin
poblacional y comunitaria para la bioproteccin y la mantencin de la biodiversidad; el
acceso a informacin de primera mano e intercambio cientfico para el desarrollo regional;
y la proteccin y reconocimiento de los conceptos y conocimientos tradicionales de las
poblaciones.

3.FUNDAMENTOSGENTICOSDELABIODIVERSIDADHUMANA
Uno de los problemas que ms ha inquietado a la especie humana y a las
llamadas razas, es la similitud o diferencia de su componente gentico.
Frecuentemente, diversos grupos poblacionales han reivindicado sus diferencias,
enfrascando a la humanidad en rias absurdas. Los argumentos biolgicos vertidos en
relacin a las diferencias han creado confusin, ms entre los no cientficos que entre
los cientficos. El tema parece que se est aclarando.
La posibilidad de variacin de la informacin gentica humana es
extremadamente amplia, no existen individuos iguales, ni an los posibles clones
humanos seran iguales; la mezcla de 23 cromosomas de origen paterno y 23 maternos
durante la fecundacin, asegura una variabilidad de 2x1023; ms an, la variabilidad
aumenta si se considera que un solo cromosoma humano contiene veinte mil millones
de bits de informacin, es decir, 4000 volmenes de quinientas pginas, lo que
equivaldra a unos quinientos millones de palabras; esta cifra se debe multiplicar por 46
que es el nmero de cromosomas humanos, con lo que la informacin gentica del
hombre es asombrosamente enorme. Pero esta aparente y gran variacin de la
informacin hereditaria no es muy real, ms bien la informacin gentica tiende a
mantenerse estable en toda la especie humana y los cambios (mutaciones genticas) se
presentan en proporciones muy bajas (1x10-8) y, cuando aparecen se producen
enfermedades genticas (8000 conocidas hasta la fecha). Existen pequeas variaciones
entre los seres humanos que provienen de diferencias en su material de la herencia, pero
que no atentan contra la uniformidad e igualdad de la especie humana y que han
ayudado a comprender algunos fenmenos humanos interesantes, como riesgos de
enfermedad, resistencia, predisposicin, entre otros.
Cmo se puede saber si somos iguales o diferentes genticamente unos con
otros? La primera cuestin es considerar lo que significa "especie", es decir, un grupo
poblacional semejante en sus caractersticas biolgicas, fsicas, qumicas, entre otros.
(psquicas en el hombre), que no presentan dificultades reproductivas al mezclarse. De
lo que se conoce, ningn grupo poblacional humano ha mostrado dificultad o
incompatibilidad reproductiva, significando eso, que la sustancia base de su naturaleza
humana, es decir el material de la herencia (ADN), es igual para todos. El cruzamiento
adecuado y efectivo de los diferentes grupos humanos significa que sus caractersticas
biolgicas, fsicas y psquicas son tambin iguales. Entonces, desde el punto de vista de
la definicin de especie, los humanos de aqu, de Asia, de Europa y de frica somos y
pertenecemos a la misma especie: Homo sapiens sapiens, y nadie ha logrado demostrar

BIODIVERSIDAD Y BIOSEGURIDAD EN GENTICA

311

lo contrario. La segunda cuestin a considerar es el concepto de "raza", o sea, un


subgrupo de individuos que presentan, o mejor, que acumulan caractersticas "fsicas"
especiales; as, segn la coloracin de la piel habrn muchos grupos: blancos, negros,
amarillos, rojos, etc. La Antropologa moderna se encarg mal o bien de agrupar a la
especie humana en caucasoides, mongoloides, negroides. Estos trminos reflejan la
inseguridad de la clasificacin, ya no se habla de "caucsicos o blancos", ya que nadie
est seguro de su pureza. Entre unos y otros seres humanos nos confundimos en uno u
otro grupo, no existen grupos puros; as, en el frica existe una poblacin de individuos
de piel negra que por sus caractersticas biolgicas y bioqumicas se la ha clasificado
dentro de los caucasoides. El trmino raza es ms bien de carcter fsico-biolgico,
pero mal usado poltica y socialmente, por lo que ahora se tiende a usar ms bien los
trminos: etnogrupos, genogrupos y etnoculturas.
Cmo la Gentica ha aportado en la comprensin de estas semejanzas y
diferencias entre los etnogrupos? Los genetistas, investigando caractersticas
cuantificables, han descubierto que ciertos grupos poblacionales (genogrupos) presentan
en mayor o menor grado un rasgo; se podra entonces hablar de biodiversidad del
genoma humano, as, los grupos sanguneos son un buen indicador de nuestros
parecidos, por ejemplo, los guaym y los san blas, indgenas de Panam; los Sumo de
Nicaragua; los aguaruna y ticuna del Per, que alguna vez se los consider puros, son
100% del grupo sanguneo O, aunque presentan otras caractersticas que los hacen
mestizos, al igual que el resto de amerindios; mientras que la poblacin europea del
norte son O (47%), A (42,4%), B (8,3%) y AB (1,4%), y los alemanes 36,5, 42,5, 14,5 y
6,5% respectivamente. La poblacin ecuatoriana, segn nuestras investigaciones y otras
analizadas, comprueban la variedad de grupos sanguneos: en los indgenas la mayora
son O (95,37%), pero hay A (3,35%), B (1,05%) y AB (0,23%). El estudio de otros
grupos sanguneos como el factor RH, el MN, de otros factores hemticos como las
hemoglobinas, glucosa-6-fosfato deshidrogenasa, transferrina y las protenas
plasmticas de la poblacin ecuatoriana nos hacen parecidos a los mongoloides
(amerindios) y en menor grado a los caucasoides, aunque existen concentrados
negroides. En definitiva, genticamente somos similares a la poblacin mundial,
acumulamos ciertos "marcadores genticos", que nos dan especiales caractersticas
(polimorfismos genticos), manifestadas en un diferente riesgo de padecer ciertas
enfermedades como el cncer de piel, estmago, mama, prstata, la dislocacin
congnita de cadera, los pabellones auriculares pequeos (microtia), mayor riesgo a
determinadas infecciones, o que podran relacionarse con resistencia a enfermedades
virales, bacteriana, micticas, parasitarias, crnico-degenerativas, entre otros problemas
(Santiana, 1947; 1953).
Con el aparecimiento de las nuevas tcnicas de la Gentica Molecular, se ha
logrado determinar que el propio ADN presenta cierta variacin interindividual o
intertnica en la longitud de algunas de sus porciones (genes), fenmeno llamado
polimorfismo de ADN, que se presenta en ms del 1% de individuos. Muchos grupos
poblacionales presentan estos polimorfismos del ADN, lo que ha servido para reevaluar
proximidades o lejanas poblacionales. Tambin con las tcnicas de gentica molecular
se ha estudiado el ADN de unos orgnulos celulares que tienen ADN, llamados
mitocondrias, encontrndose tambin polimorfismos de su ADN, es decir, variacin del
tamao de porciones especficas. Adems, se han descubierto genes que presentan
variacin en su tamao (nmero de amplificaciones de nucletidos) y que se relacionan
con enfermedades especficas como la enfermedad de Huntington.

BIODIVERSIDAD Y BIOSEGURIDAD EN GENTICA

312

Los polimorfismos genticos que presentan las poblaciones son el substrato


terico para la bioprospeccin. El hallar genes o informacin gentica relacionada con
riesgos diferenciales para padecer enfermedades o que aclaren puntos de discusin
evolutiva, son el motor preciado de los proyectos encaminados al estudio de la similitud
o diversidad gentica de la informacin humana.

4.MITOSYVERDADESDELAMANIPULACINGENTICA
El desarrollo de la Gentica Molecular y la micromanipulacin celular en las dos
ltimas dcadas ha sido abrumador, tanto que los descubrimientos hechos por esta
ciencia han revolucionado al mundo. Hoy en da se habla con libertad de los productos
de la manipulacin de genes pero, Qu existe de verdad en relacin a esta tecnologa?
Para empezar en este complicado tema, precisemos algunos aspectos. El material
gentico de cada individuo es nico. La informacin gentica que los organismos
poseen y que han adquirido durante millones de aos de evolucin es imposible
recuperarla si la especie ha desaparecido, por lo que no se puede regenerar especies por
almacenamiento de sus tejidos o de sus genes. Desde el punto de vista biolgico no se
puede mezclar clulas cuyo contenido gentico sea diferente. De lograrlo, el nuevo
individuo est determinado a morir y no podr reproducirse. Los cruces entre especies
biolgicas prximas (burro y yegua = mula) son excepciones en la naturaleza, y as
mismo son infrtiles. Lo que si se ha logrado mezclar en experimentos, son fragmentos
ms o menos grandes de ADN formando ADN quimrico, o introducir genes enteros en
bacterias, virus y usarlos como vehculos para producir individuos transgnicos con
caractersticas nuevas, ninguno diseminado en la sociedad. De igual forma, el Instituto
Craig Venter logr crear una clula bacteriana controlada por un genoma sintetizado
qumicamente (Gibson et al., 2010). Estas tcnicas se han restringido a ciertas especies
inferiores y no a los humanos, con excepcin de las nuevas tcnicas de terapia gentica
en que se ha logrado a travs del conocimiento exacto de un gen humano, introducirlo
en enfermos y curar su dolencia.

5.PROYECTOSPARACONOCERLATOTALIDADDELGENOMAHUMANO

El desarrollo de las tcnicas de manipulacin de clulas con fines beneficiosos para


la humanidad empez antes de 1799, cuando ya se realizaban, aunque en forma
rudimentaria, embarazos por inseminacin artificial. Pero las tcnicas de
micromanipulacin celular, utilizadas cientficamente y con xito, datan de 1944, cuando
se logra la primera fertilizacin in vitro; luego en 1952 se logra clonar un sapo a partir de
clulas de renacuajo; en 1953 se conoce la estructura del ADN; luego en 1959 se logra la
primera fertilizacin artificial; en 1970 se consigue clonar embriones de ratn; en 1979 se
clona embriones de cordero, se realiza el primer anlisis de ADN y se produce insulina por
ingeniera gentica; hasta que en 1993 se clona embriones humanos y se inicia la terapia
gnica.
La manipulacin gentica y celular ha producido logros importantes: produccin de
frmacos y vacunas artificiales, caracterizacin de genes responsables de enfermedades,
produccin biotecnolgica de hormonas, transferencia de clulas fetales para la cura de
enfermedades como el Parkinson, la diabetes, lesiones de mdula espinal y anemias se ha

BIODIVERSIDAD Y BIOSEGURIDAD EN GENTICA

313

logrado tambin diagnstico preciso de enfermedades genticas, muchas aun antes de


implantar embriones fecundados artificialmente. Se ha logrado detectar genes productores
de cncer (oncogenes), se conoce la accin de genes que producen suicidio celular, estos
se los est utilizando actualmente para terapia del cncer.
Para llegar a estos conocimientos y tcnicas cientficas se debi pasar por
intrincados caminos como los cultivos celulares, el estudio de la ultraestructura del
material de la herencia (ADN), la manipulacin gentica y la ingeniera gentica. El
complicado aparataje de la investigacin subcelular, al mismo tiempo que ha provocado la
"revolucin gentica", ha iniciado una carrera, en algunos casos inescrupulosa, en la
descarnada lucha por patentar los conocimientos cientficos, en especial los genticos.
En 1988, Watson, antes galardonado con el premio Nobel, inici un inslito
programa de investigacin para catalogar la totalidad de los genes humanos: el Proyecto
Genoma Humano, aglutinando a los investigadores en la Organizacin HUGO (Human
Genome Organization). Para el inicio del programa se asign una suma similar a los bits
de informacin almacenados en el ADN, 3 billones de dlares; 200 millones de dlares
anuales hasta el ao 2003, cuando concluy el primer borrador del proyecto. Este
programa que se inici por inters cientfico puro, se ha visto empaado por intereses
polticos, econmicos e industriales. Para algunos personajes, una inversin tan grande
deba rendir frutos, llegndose a plantear que lo que hay en juego es una llave hacia los
secretos de la salud, pero tambin una mina de oro: las empresas que dominen dicho
conocimiento tendrn garantizada una increble rentabilidad futura, una vez que se aplique
dicha informacin a la Medicina Gentica.

6.ELNUEVONEGOCIODELCAPITALISMO
Desde que se realiz el primer trasplante de clulas fetales de hgado a un enfermo
con una deficiencia de la inmunidad (1968), y luego que se realiz la primera sntesis de
ADN en un laboratorio (1970), se han preparado hormonas y frmacos, se han creado
bancos de tejidos y clulas, y se han injertado genes. Los investigadores encuentran cada
vez mayor nmero de aplicaciones a la tecnologa de la Gentica Molecular, y sus
patrocinadores han puesto costos, claro est, inaccesible al comn de las personas. Estos
conocimientos manejados como negocio, son un peligro. Cada vez que se haga una
intervencin quirrgica o se efecte un diagnstico que requiera el uso de conocimientos
genticos o de micromanipulacin celular, habr que pagar derechos a los propietarios. En
el fondo se est jugando un "monopolio" con el cuerpo humano. Se trata de comprar genes
o sus partes aun cuando no se sabe exactamente para qu sirven, con la esperanza s, de
que un da darn mucho dinero. La bsqueda del gen representa el nuevo negocio del
capitalismo del siglo XXI. Los cientficos se han visto atrados para formar sus propias
empresas o trabajar para las grandes multinacionales del gen. El descubrimiento de un gen
se lo patenta, simplemente, porque la ubicacin de un gen humano cuesta unos 50 mil
dlares al ao. La gentica de patentes es agresiva; acta ms sobre las ventas que sobre el
individuo.
El interfern, la eritropoyetina, factor VIII, la insulina, vacunas, el gen FQ, entre
otros, son sustancias producidas genticamente y comercializadas. Los propietarios de los
genes han invertido cantidades gigantescas en la obtencin secreta de la medicina
gentica. Una multinacional californiana invirti 1600 millones de dlares para preparar

BIODIVERSIDAD Y BIOSEGURIDAD EN GENTICA

314

hormona de crecimiento. El mercado gentico proporciona ventas por ms de 30000


millones de dlares anuales. Los fabricantes de Intrn A (usado para tratar 16
enfermedades, incluida la leucemia) han manejado 600000 dlares para su creacin. En
1980, se confiri permiso para patentar seres vivos producidos por manipulacin gentica:
se han patentado ya microorganismos, plantas, animales y mamferos transgnicos.
Otro grupo de cientficos del gen organiz tambin un proyecto gentico paralelo al
HUGO, es el Proyecto de Diversidad del Genoma Humano (PDGH), en el que todos los
grupos tnicos estn incluidos: negros, indios y blancos. Para los retractores de este
proyecto, su objetivo es investigar la variedad de la informacin gentica que presentan los
grupos tnicos indgenas en peligro de extincin, por lo que se hara prioritario obtener su
ADN para almacenarlo, usarlo o patentarlo de ser el caso. O dicho de otra manera,
preservar la diversidad gentica humana a travs de la inmortalizacin de lneas celulares o
en bancos de genes.
El PGH y el PDGH lograron secuenciar la totalidad de los 23000 genes. Cuando
surgi la idea del Proyecto Genoma Humano no se habl de qu genes humanos se
secuenciaran. Cientficos del mundo quedaron un tanto consternados al percibir que se
secuenciaran los "genes de los rubios" y los descubrimientos seran patentados. Ante
estos sucesos, el grupo de cientficos franceses hizo su propio proyecto genoma, en el
que consideraba las variaciones de los genogrupos o etnogrupos y sus polimorfismos de
ADN y adems, divulgaba los resultados a travs de la ONU.
El nuevo negocio del capitalismo se ve justamente mermado desde inicios del
2013, ao en el que el Gobierno de Estados Unidos prohibi patentar genes y sus tcnicas
de anlisis, es por ello que ahora es posible realizar pruebas genticas como por ejemplo
los genes BRCA1 y BRCA2, en los laboratorios alrededor del mundo.

7.BIOPIRATEOYPATENTES
Lo que ha ocurrido con el descubrimiento de genes nuevos, de los polimorfismos
del ADN, de genes de predisposicin a enfermedades o de resistencia a las mismas, es
que grupos de investigadores con tecnologas sofisticadas estn saqueando muestras
biolgicas de nuestras poblaciones indgenas ricas en polimorfismos del ADN, ya que
se las considera codiciados laboratorios biolgicos, que les proporcionan datos
interesantes para sus registros, jams devueltos para provecho local. Al no tener
nuestros cientficos el apoyo ni el dinero necesarios para estos trabajos, la brecha y
dependencia cientfico-tecnolgica se agranda, por lo que se hace imperioso regular e
investigar nuestra biodiversidad para autobeneficio y hacer una bioproteccin eficaz.
El peligro de patentar conocimientos trae terribles injusticias. En Per existe un
algodn natural de colores variados, cuya exportacin significaba considerables ingresos al
pas, hasta que un laboratorio detect, aisl y manipul el gen de los colores y patent sus
semillas y "plantas genticas". Artculos periodsticos dan cuenta de atentados contra los
conocimientos tradicionales y etnoculturales a los que estamos sometidos, as el caso en
Ecuador de las plantas conocidas como sangre de drago y ayahuasca, son las ms
prximas. El golpe de las patentes a las economas poco desarrolladas har que cada vez
ms los pases en vas de desarrollo se sumerjan en la oscuridad gentica y biotecnolgica.
Al mismo tiempo, las multinacionales de los genes han puesto su mira en nuestros pases.

BIODIVERSIDAD Y BIOSEGURIDAD EN GENTICA

315

Desorganizados, a oscuras, sin leyes de proteccin de nuestra biodiversidad y sin apoyo


serio a la investigacin, somos presa fcil para el saqueo de nuestros genes o para
experimentaciones, sea en plantas con posibles substratos curativos del cncer, del VIH o
resistentes a plagas, sea en animales con caractersticas genticas especiales como
resistencia a enfermedades, sobrevida larga, bioactivos, entre otros; o en los propios seres
humanos, donadores de preciosas muestras biolgicas, nicas, raras, nuestras. Ante el
podero econmico y ante nuestro solapado silencio, nos hemos convertido en preciados
laboratorios biogenticos, conejillos de indias.

8.BIOBOICOT
Enfrentar a los apropiadores de los genes es el reto para todos, investigador y no
investigador. Debemos por un lado proteger nuestra biodiversidad, nuestra "ecogentica",
y por otro lado investigar nuestros propios y fascinantes genes. Los resultados de estas
investigaciones deben servirnos a nosotros y a toda la humanidad. La investigacin en la
biodiversidad gentica de las especies, incluido el hombre, abre una nueva discusin
biotica, demanda un autocontrol severo, exige inversin en investigacin local para el
desarrollo cientfico-tecnolgico independiente. Solo el apoyo a la investigacin nacional
nos librar del saqueo biolgico y de la sumisin a las patentes. Solo la investigacin
oportuna y seria lograr detener el bioboicot.

9.CONCIENCIABIOPROTECTORA

Un punto importante a ser tratado en relacin a los aspectos ticos de la


manipulacin gentica es el impacto que la biotecnologa tiene sobre el tercer mundo;
y la dependencia tecnolgica y an poltica que este tiene por permanecer al margen de
ciertas tecnologas de vanguardia. Habr que meditar sobre la propiedad de los
descubrimientos del ADN recombinante, su comercializacin y el mantenimiento o no
de su carcter secreto. Mientras los pases "en desarrollo" no planifiquen su desarrollo
tecnolgico, la dependencia cientfica y econmica hacia los "poseedores de la ciencia"
ser mayor. El acceso a la tecnologa y a los conocimientos cientficos, cuya
potencialidad no entrae riesgo de muerte, no produzca cambios en la identidad
biolgica e individual de la especie y garantice una vida productiva y digna, es un
derecho de toda la humanidad y su utilizacin en beneficio de todos es un imperativo.
En este punto entonces es importante plantear algunas consideraciones: el desarrollo de
la tecnologa molecular es un tema estrictamente cientfico y no debe ser confundido
con los intereses comerciales. Lastimosamente, en la prctica esto no ocurre y muchos
inventos, descubrimientos e investigaciones estn guiados por el inters econmico real
o potencial, y es en ese momento en que la esencia de la investigacin se altera y es
sustituida por intereses forneos al quehacer cientfico. La cooperacin entre cientficos
y empresas productoras de los descubrimientos es algo reclamado reiteradamente por
los gobiernos y las instituciones dedicadas a investigacin; algunos cientficos reclaman
la prctica cientfica dentro de un contexto biotico, de respeto a las soberanas de los
pueblos, sus tradiciones, cultura, diversidad y a la no utilizacin privada de
conocimientos beneficiosos para toda la humanidad.
El uso indebido de la informacin gentica en los momentos actuales ha
producido fenmenos socialmente extraos y que constituyen problemas ticos

BIODIVERSIDAD Y BIOSEGURIDAD EN GENTICA

316

especiales, estos son la discriminacin gentica de: los individuos afectos, los familiares
de afectos, las poblaciones de riesgo detectadas mediante pesquizaje poblacional, de
enfermos crnicos e incurables, la bioprospeccin con fines econmicos, las patentes de
invenciones genticas y las patentes de organismos vivos. Este fenmeno relativamente
nuevo en nuestra sociedad, pone en alerta sobre el mal uso de la informacin cientfica
que, de una u otra manera ha tergiversado el hecho gentico, ha incluido juicios de valor
peligrosos y ha llegado al mximo del absurdo al tratar de justificar investigaciones,
negocios y ganancias a costa del trabajo gentico serio.

10.NORMASDEBIOSEGURIDAD
Una de las preocupaciones constantes de las personas que trabajan en reas de
laboratorio es la proteccin personal o lo que se conoce como bioseguridad. La OMS ha
reglamentado el uso de los laboratorios, su diseo y seguridades, tanto para el personal,
como para la maquinaria y los reactivos. Adems, cada laboratorio, segn su
complejidad y tipo de trabajo, debe adoptar normas ms o menos estrictas, segn sea el
caso (OMS, 2005). El laboratorio de gentica, en muchas situaciones, funciona como
cualquier otro laboratorio pero, se convierte en un laboratorio especial debido al tipo de
muestras que se manipulan y los procedimientos que se aplican.
Las normas de bioseguridad se las puede dividir en tres tipos: 1) riesgos que
entraan los reactivos, 2) riesgos que entraan las muestras y, 3) riesgos para el
personal. Se ha llegado a este tipo de control del trabajo gentico, por los potenciales
riesgos que este entraa. De acuerdo a esto, se estipula diferentes niveles de trabajo
investigativo y cada uno, ms complejo que el anterior, demanda medidas de control de
los individuos, de los reactivos y de las muestras manipuladas, con la finalidad de
minimizar potenciales riesgos del trabajo biomdico.
10.1.Riesgosqueentraanlosreactivos
Muchos reactivos utilizados en Gentica son potencialmente txicos,
genotxicos o mutagnicos, por lo que su manipulacin debe ser idnea, evitando el
contacto directo con la piel y mucosas. El uso de pinzas, guantes, etc., es indispensable.
La misma recomendacin debe considerarse con los reactivos que produzcan gases o
que sean voltiles. Se debe tomar en cuenta que la rotulacin de los reactivos, su
taponamiento y su manipulacin tienen que ser cuidadosas. En relacin a los agentes
fsicos que pueden producir efectos adversos, debe regularse su uso en relacin a los
requerimientos, leyes o normas nacionales e internacionales, esto es especialmente
vlido para el uso de sustancias que produzcan algn tipo de radiacin (OMS, 2005).

10.2.Riesgosqueentraanlasmuestras
Las muestras que se usan en Gentica deben ser bien manipuladas. Bsicamente,
al trabajar con cultivos de clulas deben guardarse las normas de asepsia y esterilizacin
comunes. Los frascos de cultivo, pipetas y cualquier otro tipo de materiales que estarn
en contacto directo con la muestra, deben ser perfectamente lavados y esterilizados.
Actualmente, los frascos de cultivo para clulas son descartables y de plstico no txico;
en caso de uso de material de vidrio, el lavado con jabn desionizado y luego, la
correccin del pH, dan buenos resultados. Es ideal el trabajo con campanas de

BIODIVERSIDAD Y BIOSEGURIDAD EN GENTICA

317

bioseguridad tipo II (flujo laminar), en las que se asegura el trabajo estril con la
muestra y los medios de cultivo. La contaminacin es tal vez el mayor problema del
trabajo con cultivos celulares y, pese a todas las medidas de asepsia, se recomienda el
uso de medios de cultivo con antibiticos y an antimicticos (OMS, 2005).
10.3.Riesgosparaelpersonal
Una buena conducta con respecto al personal que labora dentro del laboratorio,
es llevar una ficha mdica detallada en la que se registre el tiempo de trabajo, el tipo de
trabajo, los reactivos y muestras que maneja cada persona. Debe darse a este personal
las facilidades y comodidades indispensables; el trabajo debe ser una actividad
satisfactoria, social, psquica y biolgica. Es necesario destinar un lugar para cambio y
almacenamiento de ropas y utensilios personales y sitios para reuniones, descanso y
alimentacin. Las muestras que llegan al laboratorio deben ser manipuladas con
guantes, en el caso de ser sangre u otras secreciones corporales contaminantes; como es
conocido, las muestras de sangre perifrica entraan riesgo de contagio de infecciones.
Todas las medidas de bioseguridad para el personal estn encaminadas a evitar
accidentes, exposiciones a radiaciones, infecciones, intoxicaciones, quemaduras o
envenenamientos (OMS, 2005).

REFERENCIAS EN INTERNET

318

Referenciaseninternet
Annals of Hematology (Springer)
Annals of the New York Academy of Sciences
Artculo: Alzheimer en el Ecuador
Artculo: El VIH en el Ecuador
Artculo: Gen CYP1A1 en el Ecuador
Artculo: Genotxicos en el Ecuador
Artculo: Glifosato en el Ecuador
Artculo: Hemocromatosis en el Ecuador
Artculo: Hidrocarburos en el Ecuador
Artculo: Pesticidas en florcola del Ecuador
Artculo: Variantes cromosmicas en Ecuador
Base de datos CATH
Base de datos de ARNpi
Base de datos de miARNs
Base de datos de SNPs
Base de datos Pfam
Base de datos PyMOL
Base de datos sobre genes
Cancer Research UK
Clasificacin estructural de protenas (SCOP)
Estudio Latinoamericano de malformaciones
European Bioinformatics Institute
Genetics and Molecular Biology
Human Biology
Human Mutation (Wiley)
Instituto de Investigaciones Biomdicas
Instituto Nacional de Estadsticas y Censos
J Craig Venter Institute
Ministerio de Salud Pblica
Misin Solidaria Manuela Espejo
Mutation Research (Elsevier)
National Center for Biotechnology
Online Mendelian Inheritance in Man
Organizacin del Genoma Humano
Organizacin Mundial de la Salud
Proyecto del Genoma del Neardental
Proyecto del Genoma Humano
Proyecto del Varioma Humano
Proyecto ENCODE
Proyecto Genogrgico
Proyecto Genoma 1000
Proyecto HapMap
Red Latinoamericana de Gentica Humana
Reviews on Environmental Health
Royal Swedish Academy of Sciences
The American Journal of Medical Sciences
The European Molecular Biology Laboratory
UCSC Genome Browser
Universal protein resource
Universidad de las Amricas
Wellcome Trust Sanger Institute

www.springer.com
www.nyas.org
www.ncbi.nlm.nih.gov/pubmed/20724907
www.ncbi.nlm.nih.gov/pubmed/16485782
www.ncbi.nlm.nih.gov/pubmed/15920291
www.ncbi.nlm.nih.gov/pubmed/22496977
www.ncbi.nlm.nih.gov/pubmed/21714381
www.ncbi.nlm.nih.gov/pubmed/15517265
www.ncbi.nlm.nih.gov/pubmed/18991910
www.ncbi.nlm.nih.gov/pubmed/15279831
www.ncbi.nlm.nih.gov/pubmed/23091347
www.cathdb.info
www.pirnabank.ibab.ac.in
www.mirbase.org
www.ncbi.nlm.nih.gov/projects/SNP
www.pfam.sanger.ac.uk
www.pymol.org
www.genecards.org
www.cancerresearchuk.org
www.scop.mrc-lmb.cam.ac.uk/scop
www.eclamc.org
www.embl.org
www.gmb.org.br
www.digitalcommons.wayne.edu/humbiol/
www.wiley.com
iib.udla.edu.ec
www.inec.gob.ec
www.jcvi.org
www.salud.gob.ec
www.manuelaespejo.com.ec
www.elsevier.com
www.ncbi.nlm.nih.gov
www.omim.org
www.hugo-international.org
www.who.int/es
www.eva.mpg.de/neardental/
www.genome.gov/10001772
www.humanvariomeproject.org
www.genome.gov/10005107
genographic.nationalgeographic.com
www.1000genomes.org
www.hapmap.org
www.relagh.org
www.degruyter.com/view/j/reveh
www.kva.se/en/
www.journals.lww.com/amjmedsci
www.embl.de
genome.ucsc.edu
www.uniprot.org
www.udla.edu.ec
www.sanger.ac.uk

NUESTRAS PUBLICACIONES CIENTFICAS

319

Nuestraspublicacionescientficas
Libros y artculos cientficos internacionales del IIB
Cabrera-Andrade A, Lpez-Corts A, Muoz MJ, Jaramillo-Koupermann G, Rodrguez O, Leone PE,
Paz-y-Mio C. Association of genetic variants of membrane receptors related to recognition and
induction of immune response with Helicobacter pylori infection in Ecuadorian individuals. International
Journal of Immunogenetics. 2014. [In press].
De Braekeleer E, Douet-Guilbert N, Guardiola P, Rowe D, Mustjoki S, Zamecnikova A, Al Bahar S,
Jaramillo G, Berthou C, Bown N, Porkka K, Ochoa C, De Braekeleer M. Acute lymphoblastic leukemia
associated with RCSD1-ABL1 novel fusion gene has a distinct gene expression profile from BCR-ABL1
fusion. Leukemia. 2012; doi:10.1038/leu.2012.332.
De Thoisy B, Goncalves da Silva A, Ruz Garca M, Tapia A, Ramrez O, Arana M, Quse V, Paz-y-Mio
C, Tobler M, Pedraza C, Lavergne A. Population history, phylogeography, and conservation genetics of
the last Neotropical mega-herbivore, the lowland tapir (Tapirus terrestris). BMC Evololutionary Biology.
2010;10:278.
Gaviria A, Snchez ME, Morejn G, Vela M, Aguirre V, Burgos G, Zambrano A, Leone PE, Paz-y-Mio
C. Characterization and haplotype analysis of 11 Y-STR loci in Ecuadorian population. Forensic Science
International: Genetics Supplement Series. 2013. e1-e2.
Gonzlez-Andrade F, Lpez-Pulles R, Espn VH, Paz-y-Mio C. High altitude and microtia in
Ecuadorian patients. The Journal of Neonatal-Perinatal Medicine. 2010;10916.
Jota M, Lacerda D, Sandoval J, Vieira P, Santos-Lopes S, Bisso-Machado R, Paixao-Cortes V, Revollo S,
Paz-y-Mio C, Fujita R, Salzano F, Bonatto S, Bortolini M, Santos F, Genographic Consortium. A new
subhaplogroup of native American Y-chromosomes from the Andes. American Journal of Physical
Anthropology. 2011;146:5539.
Lpez-Corts A, Jaramillo-Kouperman G, Muoz MJ, Cabrera A, Echeverra C, Rosales F, Vivar N, Pazy-Mio C. Genetic polymorphisms in MTHFR (C677T, A1298C), MTR (A2756G) and MTRR
(A66G) genes associated with pathological characteristics of prostate cancer in the Ecuadorian
population. The American Journal of the Medical Sciences. 2013; PMID: 23459165.
Paz-y-Mio C, Carrera C, Lpez-Corts A, Muoz MJ, Cumbal N, Castro B, Cabrera A, Snchez ME.
Genetic polymorphisms in apolipoprotein E (Apo E) and glutathione peroxidase 1 (GPX-1) genes in the
Ecuadorian population affected with Alzheimers disease. The American Journal of Medical Sciences.
2010;340:373377.
Paz-y-Mio C, Cumbal N, Araujo S, Snchez ME. Alterations and chromosomal variants in the
Ecuadorian population. Journal of Biomedicine and Biotechnology. 2012; doi: 10.1155/2012/432302.
Paz-y-Mio C, Cumbal N, Snchez ME. Genotoxicity studies performed in the Ecuadorian population.
Molecular Biotechnology. 2012; doi: 10.1155/2012/598984.
Paz-y-Mio C, Lpez-Corts A, Muoz MJ, Cabrera A, Castro B, Snchez ME. Incidence of the L858R
and G719S mutations of the epidermal growth factor receptor oncogene in an Ecuadorian population with
lung cancer. Cancer Genetics and Cytogenetics. 2010;196:201203.
Paz-y-Mio C, Lpez-Corts A, Muoz MJ, Castro B, Cabrera A, Snchez ME. Relationship of a
hRAD54 gene polymorphism (2290 C/T) in the altitude Ecuadorian population with chronic myelogenous
leukemia. Genetics and Molecular Biology. 2010;33:6469.
Paz-y-Mio C, Lpez-Corts A. Glifosato: Gentica, Salud y Ambiente. Imprenta Hojas y Signos.
Primera edicin. Quito, Ecuador. 2011.

NUESTRAS PUBLICACIONES CIENTFICAS

320

Paz-y-Mio C, Muoz MJ, Lpez-Corts A, Cabrera A, Palacios A, Castro B, Paz-y-Mio N, Snchez


ME. Frequency of polymorphisms pro198leu in GPX-1 gene and ile58thr in MnSOD gene in the altitude
Ecuadorian population with bladder cancer. Oncology Research. 2010;18:395400.
Paz-y-Mio C, Muoz MJ, Maldonado A, Valladares C, Cumbal N, Herrera C, Robles P, Snchez ME,
Lpez-Corts A. Baseline determination in social, health, and genetic areas in communities affected by
glyphosate aerial spraying in the Northeastern Ecuadorian border. Reviews on Environmental Health.
2011;26:4551.
Paz-y-Mio C, Ocampo L, Snchez ME. Manual de prcticas de Gentica Molecular y Citogentica
Humana. Instituto de Investigaciones Biomdicas. Universidad de las Amricas. Quito, Ecuador. 2011.
Paz-y-Mio C, Snchez ME, Araujo S, Ocampo L, Espn VH, Leone PE. Cytogenetic and molecular
characterization of hematological neoplasm in an Ecuadorian population. Open Journal of Blood
Diseases. 2013;3:108115.
Paz-y-Mio C, Tapia A, Arvalo M, Muoz MJ, Llumipanta W, Oleas G, Snchez ME. Polymorphic
variants of the mitocondrial cytochrome b gen (CYB) in the Ecuadorian population. Revista Espaola de
Antropologa Fsica. 2008;28:95101.
Paz-y-Mio C. Darwin, Evolucin y Biomedicina. Imprenta Hojas y Signos. Quito, Ecuador. 2009.
Paz-y-Mio C. Transgnicos: Una cuestin cientfica. Imprenta Hojas y Signos. Quito, Ecuador. 2013.
Quiones LA. Lavanderos MA, Cayun JP, Garca-Martin E, Agndez JA, Caceres DD, Roco AM,
Morales JE, Herrera L, Encina G, Isaza C, Redal MA, Larovere LE, NW Soria, Eslava-Schmalbach J,
Castaeda-Hernndez G, Lpez-Corts A, Magno LA, Lpez M, Chiurillo M, Rodeiro I, Castro de
Guerra D, Tern E, Estvez C, Lares-Assef F. Perception of the usefulness of drug/gene pairs and barriers
for pharmacogenomics in Latin America. Current Drug Metabolism. E-Pub ahead of print. 2014. DOI:
10.2174/1389200215666140202220753.

Libros y artculos cientficos internacionales previos al IIB


Arnold R, Carpenter D, Kirk D, Koh D, Armour M, Cebrian M, Cifuentes L, Khwaja M, Ling B,
Makaliano I, Paz-y-Mio C, Peralta G, Prasad R, Singh K, Sly P, Tohyama C, Woodward A, Zheng B,
Maiden T. Meeting report: threats to human health and environmental sustainability in the pacific basin.
Environmental Health Perspectives. 2007;115:17701775.
Bentez A, Paz-y-Mio C, Gallego J, Gimnez A. Modificacin del riesgo gentico en una gran familia
portadora de distrofia miotnica utilizando tcnicas moleculares. Progresos en Diagnstico Prenatal.
1995;7:2516.
Bentez JC, Paz-y-Mio C, Escudero A, La Puente L, Ruiz M. Diagnstico citogentico de pacientes con
anemia de Fanconi utilizando metabolitos de ciclofosfamida como agente clastognico. Sangre.
1986;31:51328.
Leone PE, Gimnez P, Collantes JC, Paz-y-Mio C. Analysis of HFE gene mutations (C282Y, H63D, and
S65C) in the Ecuadorian population. Annals of Hematology. 2005;84:1035.
Leone PE, Mendiola M, Alonso J, Paz-y-Mio C, Pestaa A. Implications of a RAD54L polymorphism
(2290C/T) in human meningiomas as a risk factor and/or a genetic marker. BMC Cancer. 2003;4:36.
Leone PE, Prez JC, Morillo S, Paz-y-Mio C. Low incidence of follicular lymphoma and t (14;18)
(q32;q21) by polymerase chain reaction analysis: observations on Ecuadorian patients. Cancer Genetics
and Cytogenetics. 2002;137:724.
Leone PE, Vega ME, Jervis P, Pestaa A, Alonso J, Paz-y-Mio C. Two new mutations and three novel
polymorphisms in the RB1 gene in Ecuadorian patients. The American Journal of Human Genetics.
2003;48:63941.

NUESTRAS PUBLICACIONES CIENTFICAS

321

Paz-y-Mio C, Dvalos MV, Snchez ME, Arvalo M, Leone PE. Should gaps be included in
chromosomal aberration analysis? Evidence based on the comet assay. Mutation Research. 2002;516:57
61.
Paz-y-Mio C, Arvalo M, Leone PE. B3/A3 rearrangement in a patient with chronic myeloid leukemia.
Leukemia & Lymphoma. 2003;44:3756.
Paz-y-Mio C, Arvalo M, Muoz MJ, Leone PE. CYP1A1 genetic polymorphisms in Ecuador, South
America. Disease Markers. 2005;21:579.
Paz-y-Mio C, Arvalo M, Snchez ME, Leone PE. Chromosome and DNA damage analysis in
individuals occupationally exposed to pesticides with relation to genetic polymorphism for CYP 1A1
gene in Ecuador. Mutation Research. 2004;8:562:7789.
Paz-y-Mio C, Bentez J, Ayuso C, Sanchez A. Ring chromosome 6: clinical and cytogenetic behaviour.
The American Journal of Medical Genetics. 1990;35:4813.
Paz-y-Mio C, Burgos R, Morillo S, Santos JC, Fiallo F, Leone PE. BCR-ABL rearrangement
frequencies in chronic myeloid leukemia and acute lymphoblastic leukemia in Ecuador, South America.
Cancer Genetics and Cytogenetics. 2002;132:65-7.
Paz-y-Mio C, Bustamante G, Dvalos V, Snchez ME, Leone PE. Cytogenetic monitoring in a
population occupationally exposed to pesticides in Ecuador. Environmental Health Perspectives.
2002;110:1077-80.
Paz-y-Mio C, Fiallo F, Morillo S, Acosta A, Gimnez P, Ocampo L, Leone PE. Analysis of the
polymorphism [gIVS12-6T->C] in the hMSH2 gene in lymphoma and leukemia. Leukemia &
Lymphoma. 2003;44:5058.
Paz-y-Mio C, Leone PE, Chavez M, Bustamante G, Crdova A, Gutirrez S, Peaherrera MS, Snchez
ME. Follow up study of chromosome aberrations in lymphocytes in hospital workers occupationally
exposed to low levels of ionizing radiation. Mutation Research. 1995;335:24551.
Paz-y-Mio C, Leone PE. Gentica y Biologa Molecular en la investigacin bsica y aplicada. Pontificia
Universidad Catlica del Ecuador. Quito, Ecuador. 1999.
Paz-y-Mio C, Leone PE. Situacin y perspectivas de desarrollo de la Gentica Humana en el Ecuador.
Pontificia Universidad Catlica del Ecuador. Quito, Ecuador. 1997.
Paz-y-Mio C, Leone PE. Three novel somatic mutations in the NF2 tumor suppressor gene [g816T>A;
g1159A->G; gIVS11-1G>T]. Human Mutations. 2000;15:487.
Paz-y-Mio C, Lpez-Corts A, Arvalo M, Snchez ME. Monitoring of DNA damage in exposed
individuals to petroleum hydrocarbons in Ecuador. Annals of the New York Academy of Sciences.
2008;1140:1218.
Paz-y-Mio C, Morillo S, Celi P, Witte T, Leone PE. 2005. CCR5delta32, CCR2-64I, and SDF1-3'A
polymorphisms related to resistance to HIV-1 infection and disease in the Ecuadorian population. Human
Biology. 2005;77:5216.
Paz-y-Mio C, Neira M, Balden MA, Boada C, Durango J, Lugo P, Peaherrera MS, Proao K, Snchez
ME, Leone PE. Estudio gentico y citogentico en individuos con retardo del crecimiento.
Endocrinologa Bolivariana. 1995;4:236.
Paz-y-Mio C, Ocampo L, Narvez R, Narvez L. Chromosome fragility in lymphocytes of women
cervical uterine lesions produced by human papillomavirus. Cancer Genetics and Cytogenetics.
1992;59:1736.

NUESTRAS PUBLICACIONES CIENTFICAS

322

Paz-y-Mio C, Peaherrera MS, Snchez ME, Crdova A, Gutirrez S, Ocampo L, Leone PE.
Comparative study of chromosome aberrations induced with aphidicolin in women affected by breast
cancer and cervix uterine cancer. Cancer Genetics and Cytogenetics. 1997;94:1204.
Paz-y-Mio C, Prez C, Burgos R, Dvalos MV, Leone PE. Delta AF508 Mutation in Ecuador, South
America. Human Mutations. 1999;14:34850.
Paz-y-Mio C, Prez JC, Dvalos V, Snchez ME, Leone PE. Telomeric association in cigarrette smokers
exposed to low levels of X-rays. Cancer Genetics and Cytogenetics. 2001;490:7780.
Paz-y-Mio C, Prez JC, Fiallo F, Leone PE. A polymorphism in the hMSH2 gene [gIVS12-6T->C]
associated with non-Hodgkin lymphomas. Cancer Genetics and Cytogenetics. 2002;132:15.
Paz-y-Mio C, Snchez ME, del Pozo M, Balden MA, Crdova A, Gutirrez S, Peaherrera MS, Neira
M, Ocampo L, Leone PE. Telomeric association in women with breast and uterine cervix cancer. Cancer
Genetics and Cytogenetics. 1997;94:2146.
Paz-y-Mio C, Tapia A, Arvalo M, Muoz MJ, Llumipanta W, Oleas G, Snchez ME. Polymorphic
variants of the mitocondrial cytochrome b gene (CYB) in the Ecuadorian population. Revista Espaola de
Antropologa Fsica. 2008;28:95101.
Paz-y-Mio C, Witte T, Robles P, Llumipanta W, Daz M, Arvalo M. Association among
polymorphisms in the steroid 5alpha-reductase type II (SRD5A2) gene, prostate cancer risk, and
pathologic characteristics of prostate tumors in an Ecuadorian population. Cancer Genetics and
Cytogenetics. 2009;189:717.
Paz-y-Mio C. Gentica Humana: Conceptos bsicos e investigaciones en el Ecuador. Quito, Ecuador.
1995.
Paz-y-Mio C. La Gentica Mdica en el Ecuador: situacin y perspectivas de desarrollo. Brazilian
Journal of Genetics. 1997;20:5562.
Paz-y-Mio C. Medical genetics services in Latin America: Ecuador. World Health Organization.
1998;146.
Paz-y-Mio C. Riesgos genticos y malformativos en el embarazo. Centro de Estudio de Poblacin y
Paternidad Responsable (CEPAR). Quito, Ecuador. 1987.
Paz-y-Mio, C. Genetic services in Ecuador. Community Genetics. 2004;7:137141.

REFERENCIAS BIBLIOGRFICAS

323

Referenciasbibliogrficas
Abreu MT, Fukata M, Arditi M. TLR signaling in the gut in health and disease. The Journal of
Immunology. 2005;174:445360.
Achyut BR, Ghoshal UC, Moorchung N, Mittal B. Association of Toll-like receptor 4 (Asp299Gly and
Thr399Ileu) gene polymorphisms with gastritis and precancerous lesions. Human Immunology.
2007;68:9017.
Afaq F, Mukhtar H. Effects of solar radiation on cutaneous detoxification pathways. Journal of
Photochemistry and Photobiology B: Biology. 2001;63:619.
Agostinho M, Arruda V, Basseres D, Bordin S, Soares M, Menezes R, Costa F, Saad S. Mutation analysis
of the HFE gene in Brazilian populations. Blood Cells Molecular Diseases. 1999;15:3247.
Aguirre M, Vzquez E, Barquera R, Vallejo C, Mestanza M, Zurita C. Estudo de HLA classes I e II em
trinta pacientes equatorianos com artrite reumatoide em comparao com alelos de indivduos sadios e
afetados com outras doenas reumticas. Tissue Antigens. 2011;79:1239.
Aka P, Mateuca R, Buchet J-P, Thierens H, Kirsch-Volders M. Are genetic polymorphisms in OGG1,
XRCC1 and XRCC3 genes predictive for the DNA strand break repair phenotype and genotoxicity in
workers exposed to low dose ionising radiations? Mutation Research. 2004;556:16981.
Akhtiamov MG, Karakbaev MK. Incidence of esophageal cancer on the plains and in the mountainous
regions of the Kazakh SSR. Voprosy Onkologii. 1983;29:4953.
Aktas D, Guney I, Alikasifoglu M, Yce K, Tuncbilek E, Ayhan A. CYP1A1 gene polymorphism and
risk of epithelial ovarian neoplasm. Gynecologic Oncology. 2002;86:1248.
Alberts B, Johnson A, Lewis J, Raff M, Roberts K, Walter P. Molecular Biology of the Cell, Fourth
Edition. Molecular Biology. 2002;1616.
Alfaro A, Castrejn L, Rodrguez M. Cncer de piel, estudio epidemiolgico a 10 aos en
derechohabientes del ISSTE en Nuevo Len. Dermatologa Revista Mexicana. 2010;54:3215.
Algood HMS, Cover TL. Helicobacter pylori persistence: an overview of interactions between H. pylori
and host immune defenses. Clinical Microbiology Reviews. 2006;19:597613.
Allis D, Jenuwein T, Reinberg D. Epigenetics. CSHL Press. 2007.
Almeida OP, Shimokomaki CM. Apolipoprotein E4 and Alzheimers disease in So Paulo-Brazil.
Arquivos de Neuro-Psiquiatria. 1997;55:17.
Alves-Silva J, da Silva Santos M, Guimares PEM, Ferreira ACS, Bandelt H-J, Pena SDJ, et al. The
Ancestry of Brazilian mtDNA Lineages. The American Journal of Human Genetics. 2000;67:44461.
Alzheimers Disease International (ADI). The global voice on dementia. [Disponible en lnea]:
www.alz.co.uk/research/statistics. Fecha de acceso: junio del 2012.
Amiel J, Lyonnet S. Hirschsprung disease, associated syndromes, and genetics: a review. Journal of
Medical Genetics. 2001;38:72939.
Andres S, Schmidt H-MA, Mitchell H, Rhen M, Maeurer M, Engstrand L. Helicobacter pylori defines
local immune response through interaction with dendritic cells. FEMS Immunology and Medical
Microbiology. 2011;61:16878.
Araujo S, Caarte C, Snchez ME, Paz-y-Mio C. Dao gentico por exposicin solar-ultravioleta en
pescadores de la costa ecuatoriana. Revista Ecuatoriana de Medicina Eugenio Espejo. 2013;2:206.

REFERENCIAS BIBLIOGRFICAS

324

Arbour NC, Lorenz E, Schutte BC, Zabner J, Kline JN, Jones M, et al. TLR4 mutations are associated
with endotoxin hyporesponsiveness in humans. Nature Genetics. 2000;25:18791.
Ayala F, Kiger J. Gentica Moderna. Omega. Barcelona, Espaa. 1984.
Bailliet G, Rothhammer F, Carnese FR, Bravi CM, Bianchi NO. Founder mitochondrial haplotypes in
Amerindian populations. The American Journal of Human Genetics. 1994;55:2733.
Baird PA, Anderson TW, Newcombe HB, Lowry RB. Genetic disorders in children and young adults: a
population study. The American Journal of Human Genetics. 1988;42:67793.
Baldwin ET, Bhat TN, Gulnik S, Hosur M V, Sowder RC, Cachau RE, et al. Crystal structures of native
and inhibited forms of human cathepsin D: implications for lysosomal targeting and drug design.
Proceedings of the National Academy of Sciences of the United States of America. 1993;90(14):6796
800.
Bales KR, Dodart JC, DeMattos RB, Holtzman DM, Paul SM. Apolipoprotein E, amyloid, and Alzheimer
disease. Molecular interventions. 2002;2:339,36375.
Ballesta F, Baldellou A. Cromosomopatas autosmicas. Barcelona, Espaa. 1971.
Ballinger SW, Schurr TG, Torroni A, Gan YY, Hodge JA, Hassan K, et al. Southeast Asian mitochondrial
DNA analysis reveals genetic continuity of ancient mongoloid migrations. Genetics. 1992;130:13952.
Banco Central del Ecuador (BCE). Cifras econmicas del Ecuador. [Disponible en lnea] URL:
www.bce.fin.ec. Fecha de acceso: abril de 2009.
Bnfai B, Jia H, Khatun J, Wood E, Risk