Studies on the structural changes of myoglobin

in tuna meat discoloration

()

A Dissertation

Mala Nurilmala

The Graduate School of Agricultural and Life Sciences

The University of Tokyo
2013

Contents
Page

Acknowledgements

List of Publications

Abstract

List of Abbreviations

10

List of Tables

12

List of Figures

13

General Introduction

16

CHAPTER 1
Molecular cloning and characterization of southern bluefin tuna
Thunnus maccoyii myoglobin

26

Section 1 cDNA cloning of southern bluefin tuna

T. maccoyii myoglobin

27

Section 2 Bioinformatic analysis

32

Section 3 Discussion

36

CHAPTER 2
Isoation and characterization of tuna myoglobin

39

Section 1 Isolation of tuna myoglobin

41

Section 2 Autooxidation profiles of tuna myoglobin

48

Section 3 Thermostability of tuna myoglobin

51

Section 3 Discussion

57

CHAPTER 3
Commercial quality evaluation of yellowfin tuna Thunnus albacares meat
and its myoglobin characteristic

65

Section 1 Myoglobin derivatives of yellowfin tuna

67

Section 2 Electrophoretic analysis and the concentration

of yellowfin tuna myoglobin

72

Section 3 Color of yellowfin tuna meat

76

Section 4 Discussion

80

CHAPTER 4
General discussion

85

References

89

ii

Acknowledgements

First of all, I would like to to express my sincere gratitude to my

supervisor, Professor Yoshihiro Ochiai accepting me as his student. Thank you
very much for your kindness to encourage, guide, and support me from initial to
final of my study.
I would like to thank Professor Shugo Watabe to take me on his laboratory
and his helpful suggestions during my study to make my experiment more better. I
am proud as a member of this lab.
I owe my deepest gratitude to Professor Hideki Ushio, who supported and
encouraged me during my study and gave more guidance for my better
experiment.
I would like to show my gratitude to Professor Shuichi Asakawa, who
gave many suggestions for my experiment.
I would like to thanks the other members of my thesis committee,
Professors Shigeki Matsunaga and Shigeharu Kinoshita.
My sincere thanks go to Dr. Misako Nakaya, Dr. Gen Kaneko, and Dr.
Hina Satone for helping me during the research.
The author was financially supported by a Japan Indonesia Presidential
Scholarship (JIPS) -World Bank.
My regards to all of the lab members who supported me during my study.
Thanks for your togetherness. I am happy with you all.
Finally, my thanks so much to my family giving me the spirit,
understanding, and encouragement throughout my research.

List of Publications

Several parts of the works described in this thesis have been published or are now
prepared for the submission as follows:

Nurilmala M, Ushio H, Kaneko G, Ochiai Y. Assessment of commercial quality

evaluation of yellowfin tuna Thunnus albacores meat based on myoglobin
properties. Food Science Technology Research (in press)

Nurilmala M, Ushio H, Watabe, S, Ochiai Y. A fast isolation method of tuna

myoglobin based on preparative gel electrophoresis. Fisheries Science (in
preparation)

Abstract

Myoglobin (Mb) is a water-soluble and oxygen-binding hemoprotein. Mb

is found mainly in the slow skeletal and heart muscles of vertebrates. Scombridae
fish such as tuna have abundant Mb both in slow and fast skeletal muscles (also
referred to as ordinary muscle, light muscle or white muscle). Mb consists of 7-8
-helical segments, designated A through H from the N terminus. It is well
established that the main function of Mb is to transport temporarily oxygen in the
muscle for facilitation of respiration, though new functions of Mb have also been
recently reported such as scavenging activity of nitrogen oxide to respond hypoxic
environments in order to maintain cellular homeostasis.
It has been considered that the primary structures of Mbs have correlations
with their stability. Previous studies revealed that structural stabilities of
scombridae fish Mbs clearly differ among the species, where skipjack tuna
Katsuwonus pelamis Mb was the most thermostable and bullet tuna Auxis rochei
Mb showed the lowest stability. Skipjack Mb exceptionally contained 146 amino
acid residues, while those of other teleost fish so far reported consist of 147 amino
acids. However, it is still unclear which factor(s) determines the stability of Mbs.
Thus, determining the primary structure would provide useful information on the
stability of Mbs. Tuna Mb can be an excellent model fish in this kind of studies.
Mb gives rise to three types of derivatives depending on the redox state of
the iron atom in the heme, namely, deoxyMb, oxyMb, and metMb.
Interconversion among Mb derivatives is affected by several factors such as
temperature, pH, metMb reducing activity, and lipid oxidation. Meat discoloration

is closely related with the proportion of the derivatives. Autooxidation rate of Mb

influences discoloration of meat, and also closely related with the stability of Mb.
Previous studies reported that fish Mbs are less stable compared to mammalian
Mbs. However, the molecular mechanism regarding their denaturation and
autooxidation still remains unclear. In the present study, attempts have been made
to characterize Mbs from the bluefin tuna and their thermal denaturation profile.
Assessment of quality evaluation of tuna meat was also carried out based on the
properties of Mb. The thesis consists of the following three chapters.
Chapter 1
The primary structure of southern bluefin tuna Thunnus maccoyii Mb has
been elucidated by molecular cloning techniques. The cDNA of this tuna
encoding Mb contained 776 nucleotides, with an open reading frame of 444
nucleotides encoding 147 amino acids. The 5 and 3 non coding regions were 74
bp and 258 bp, respectively. The primary structure has been submitted to
DDBJ/EMBL/GenBank databases with the accession number of AB592346. The
amino acid sequences as well as the nucleotide sequences were identical to those
of bluefin tuna T. thynnus and T. orientalis Mbs, suggesting that Mbs from these
tuna species share the same structural and functional properties.
A phylogenetic tree was constructed based on the deduced amino acid
sequences by neighbor-joining methods. The sequences of sea hare Mb was taken
as an outgroup to root the tree. Southern bluefin tuna Mb formed one clade with
the other tuna Mbs. In addition, scombridae Mbs formed an independent cluster.
Mb from Atlantic blue marlin, a member of scombridae, was found to be the most

distant from the other scombridae species Mbs. Moreover, the identity of amino
acid sequence was relatively high among scombridae fish (82-100%).
Based on its deduced sequence, the isoelectric point and molecular weight
of southern bluefin tuna Mb were calculated to be 8.99 and 15628, respectively.
Hydropathy plot revealed that the segment C was found to be less hydrophobic,
while the lower hydrophobicity of the segment F could be due to the presence of
Asp87 and Lys92. Homology modeling

based on the tertiary structure of

blackfin tuna Mb (PDB ID 2NRL) as a template demonstrated that southern

bluefin tuna Mb has a very similar structure to those of other fish Mbs.
Chapter 2
In order to understand the stability of tuna Mb, an attempt has been made
to elucidate the autooxidation profiles under several pH and temperature
conditions. Firstly, a fast stream-lined method was developed basically based on
ammonium sulfate fractionation and preparative native gel electrophoresis to
purify the Pacific bluefin tuna Mb. Namely, the water soluble fraction of dark
muscle was subjected to ammonium sulfate fractionation, and the fraction (4090% saturation) was subsequently applied to the preparative electrophoresis.
Under the electrophoretic condition, because of the identity of the buffer pH and
the isolectric point, only Mb stayed on the gel top, whereas the other proteins
entered the gel, resulting in the pure fraction of native Mb.
The Mb preparation gave a single band in SDS-PAGE gel. Twodimensional PAGE gave only one spot corresponding to Mb. The absorbance
spectra of Mb derivatives (deoxy, oxy, met forms) were then measured for tuna
Mb and horse Mb as a control. The extinction coefficient for the maximum (at

541 nm) of tuna oxyMb was higher than that of -maximum at 577 nm. The
maximum absorption of horse Mb as a control shifted to the higher wavelength
by 1 nm for all the derivatives, while the -maximum of oxyMb (581 nm) shifted
to the longer wavelength by 4 nm.
To investigate autooxidation profiles, oxyMbs were prepared from
purified tuna and horse Mbs which had been dialyzed in advance against 50 mM
sodium citrate (pH 5.6) or sodium phosphate buffer (pH 6.5 and 7.4) at 4oC after
reduction by addition of sodium hydrosulfite. The final concentration of Mb was
adjusted to 0.3-0.4 mg/ml with the respective buffers, and then incubated at 0oC
for up to 7 days and at 37oC for up to 3.5 h. As a result, the autooxidation of these
Mbs proceeded as a first order reaction irrespective of pH and temperatures
examined. The highest autooxidation rate was observed at pH 5.6, followed by at
pH 7.4 and 6.5 for both tuna and horse Mbs at 0oC for up to 7 days. Tuna Mb
autooxidized 2.5-3 times faster than horse Mb under all the pH conditions
examined. However, the highest autooxidation rates of both tuna and horse Mbs at
37oC were obtained at pH 5.6 followed by at pH 6.5 and 7.4, although the
autooxidation rate of tuna and horse Mbs showed similar values at pH 7.4.
The denaturation profiles of tuna Mb was compared to that of horse Mb.
Percentage Mb denaturation (PMD) was investigated under combination of pH
5.6, 6.5, 7.4 and temperature 70, 75, 80oC. In addition, to unveil the stability of
tuna Mb, PMD was measured at 55, 60, and 65oC at pH 6.5. Under all the pH
examined at 75 and 80oC, tuna Mb was almost completely denatured after 10 min
of incubation as demonstrated by a high PMD value (>90%). The denaturation
rates of tuna Mb were represented by the changes of natural logarithm of residual

concentration of Mb, resulting in a biphasic first order reaction. The denaturation

proceeded at 55 and 60oC, although PMD value increased very slowly, reaching
less than 10%. At 65oC, PMD gradually increased to 32.3% after 60 min. On the
other hand, horse Mb was very stable at 6.5 and pH 7.4 at all temperatures
examined except at 80oC at pH 6.5. However, PMD of horse Mb was gradually
increased at 75 and 80oC only at pH 5.6.
Chapter 3
An attempt was carried out to investigate the relationship among
commercial sensory evaluation grades of yellowfin tuna Thunnus albacores meat
with Mb properties including Mb derivatives ratio, color values, and Mb
extractability. The SDS-PAGE pattern of the water soluble fraction was also
examined to monitor the deterioration extent of meat quality.
The four quality grades, namely, excellent, good, acceptable, and not
acceptable as judged by the professional appraiser were compared based on the
above parameters. The ratio of Mb derivatives (deoxyMb, oxyMb, and metMb)
was determined based on the visible absorption spectra of the meat water extract.
As a result, the grade of meat was found to be significantly correlated with metMb
ratio (%) (P < 0.01). MetMb ratio of the not acceptable grade meat was
significantly higher than the other samples of the higher grade (65 %). In contrast,
the highest ratio of the oxyMb was found in the excellent meat, followed by the
good, acceptable, and not acceptable meats in this order. Thus, both metMb and
oxyMb ratios could be good parameters for the quality of tuna meat. As far as the
deoxyMb ratio is concerned, no significant correlation with the meat quality was
observed.

The extractability of Mb concentration was reduced in the lower grade

meat with the significance level of P < 0.01. Therefore, it is likely that Mb was
partially denatured, resulting in the insolubilization of Mb especially in the meat
of the lower grade. Color measurement revealed significant differences in the a*
value between the different grade meat, but essentially no difference in the L* and
b* values. Both the a* value and redness index (a*/b*) showed high correlation
coefficients with metMb ratio.
Since the high correlation of both a* value and redness index against
metMb ratio (%) was found, these parameters can be used as indicators for
grading of tuna meat. On the other hand, the meat of different grade showed very
similar patterns in the SDS-PAGE gel, although the band below Mb was not
found in the excellent grade meat, unlike the other grades, suggesting that this
band can be used as a parameter of deterioration. The Mb band could be
recognized for all the samples.
As described above, the amino acid sequence of southern bluefin tuna Mb
was reported in the present study for the first time. Phylogenetic analysis and
homology modeling of the structure revealed the typical profiles of this Mb as
scombroid fish Mbs. Then the stability of bluefin tuna Mb was examined under
various pH and temperature conditions taking PMD as a parameter. The results
obtained showed that the Mb becomes unstable at lower pH and higher
temperature, and the stability was much lower than that of horse Mb as a control.
Finally, the reliability of commercial evaluation of tuna meat quality was assessed
basically based on the properties of Mb. The results showed the quality grading

was quite reliable. Through the present assessment, excellent markers for precise
grading of tuna meat quality were found.
The present study not only succeeded in obtaining new insights to the
properties and stability profiles of tuna Mb, and but also gave useful information
for quality control of tuna meat. The study seems to have made a contribution to
the science of fish Mbs and effective utilization of tuna. Further studies are
required to reveal detailed mechanism of Mb denaturation and establish the
conditions to prevent discoloration of tuna meat.

List of Abbreviations

ANOVA

: Analysis of variance

AUAP

: Abridged universal amplification primer

BLAST

: Basic local alignment search tool

CBB

: Comassie brilliant blue

CD

: Circular dichroism

cDNA

: Complementary deoxyribonucleic acid

deoxyMb

: Deoxymyoglobin

DDBJ

: DNA data bank of Japan

DSC

: Differential scanning calorimetry

EMBL

: European molecular biology laboratory

kDa

: Kilo dalton

Mb

: Myoglobin

mRNA

: Messenger ribonucleic acid

MEGA 4

: Molecular evolutionary genetics analysis 4

metMb

: Metmyoglobin

MW

: Molecular weight

OxyMb

: Oxymyoglobin

PAGE

: Polyacrylamide gel electrophoresis

PDB

: Protein data bank

PCR

: Polymerase chain reaction

pI

: Isoelectric point

PMD

: Percentage myoglobin denaturation

10

3-RACE

: Rapid amplification of cDNA 3 -ends

5-RACE

: Rapid amplification of cDNA 5 -ends

SDS-PAGE : Sodium dodecylsulfate-polyacrylamide gel electrophoresis

Tris

: Tris(hydroxymethyl) aminomethane

11

List of Tables

1-1.

Nucleotide sequence of the primers used for cDNA cloning

1-2.

The percentage of amino acid sequence identity to southern

bluefin tuna Mb

2-1.

103

The wavelengths (nm) for the maximum absorption of Mb

derivatives of tuna and horse

2-2.

104

Denaturation rate in the fast reaction denaturation phase (Kd fast)

of tuna and horse Mbs

2-3.

2-4.

102

105

Denaturation rate in the slow reaction denaturation phase (Kd slow)

of tuna and horse Mbs

106

Denaturation rate of tuna Mb at pH 6.5

107

12

List of Figures

0-1.

The three dimensional structure of yellowfin tuna Mb (PDB 1MYT)

108

0-2.

Heme portion of Mb

109

0-3.

Interchange between the Mb derivatives

(Moller and Skibsted, 2006)

0-4.

110

Potential interacting oxidation reactions between Mb and unsaturated

fatty acids (Fautsman et al., 2010)

1-1.

Schematic diagram of the primer design for southern bluefin tuna T.

maccoyii Mb

1-2.

112

Nucleotide and deduced amino acid sequences of cDNA

encoding southern bluefin tuna T. maccoyii Mb

1-3.

114

Phylogentic tree constructed based on the amino acid sequences

of Mbs taking sea hare as an outgroup

1-5.

117

SDS - PAGE patterns of the supernatants

after ammonium sulfate fractionation

2-2.

116

Tertiary structure of southern bluefin tuna Mb compared

to that of blackfin tuna Mb (PDB 2NRL)

2-1.

115

Hydropathy plot of southern bluefin tuna Mb scanned

by a window size of 9 amino acids

1-6.

113

Alignment of amino acid sequence of southern bluefin tuna

Mb with those of other species

1-4.

111

118

SDS-PAGE patterns of the precipitates after ammonium

sulfate fractionation

119

13

2-3.

Preparative electrophoresis apparatus (Nativen AE 67-60)

120

2-4.

SDS-PAGE patterns of the each step for tuna Mb purification

121

2-5.

Two-dimensional PAGE pattern of purified tuna Mb

122

2-6.

The absorption spectra of Mb derivatives of tuna and horse

123

2-7.

The temperature effect on metMb ratio of tuna and horse Mbs

124

2-8.

The autooxidation of tuna and horse Mbs

125

2-9.

Changes in metMb ratio (%) of tuna and horse Mbs during incubation
at 0oC

126

2-10. pH dependency of the autooxidation rate at 0oC

127

2-11. The autooxidation of tuna and horse Mbs at 37oC

128

2-12. Changes in metMb ratio (%) of tuna and horse Mbs during incubation
at 37oC

129

2-13. pH dependency of the autooxidation rate at 37oC

130

2-14. Effect of pH and temperature on percentage

myoglobin denaturation (PMD) of horse and tuna Mbs

131

2-15. pH and temperature dependencies of the residual ratio of horse

and tuna Mbs

132

2-16. Effect of heat treatment on the denaturation of tuna Mb

133

3-1.

Appearance of the tuna meat slice of each grade

134

3-2.

Mb derivatives ratio in the different quality grade tuna meat

135

3-3.

SDS-PAGE patterns of the water soluble fractions from different

quality grade tuna meat (light muscle)

136

3-4.

Mb concentrations in the meat extract of different quality grade

137

3-5.

Differences in the tristimulus values of different quality grade

14

tuna meat

138

3-6.

The redness index of different quality grade tuna meat

139

3-7.

Correlation between color values and metMb ratio (%)

140

3- 8.

Correlation between redness value and Mb concentration in meat

extract

141

15

General Introduction
Background

Myoglobin (Mb), an oxygen-binding hemoprotein, is a water-soluble

globular protein. Like other proteins, Mb consists of hydrophillic (polar) and
hydrophobic (non polar) groups, whereas the hydrophillic is placed outside of the
protein which is contact with the surface of aqueous environment. The inside of
the protein is greatly hydrophobic, contributing to the stability of structure.
Fish Mb is found mainly in the slow skeletal and heart muscles of
vertebrates. However, scombridae fish such as tuna have abundant Mb both in
slow and fast skeletal muscles (also referred to as ordinary muscle, light muscle or
white muscle). It was reported that the Mb content in cultured Pacific bluefin
tuna Thunnus orientalis tended to increase with growth (Nakamura et al., 2007).
Tunas are important fish species because of their international trade
characteristics. They are a group of scombridae fish having high metabolic rates
even at slow swimming speed. They have the ability to maintain body temperature
due to the presence of counter-current heat exchangers (Graham and Dickson,
2001). Three species of bluefin tunas are known so far, namely, southern bluefin
tuna Thunnus maccoyii, Atlantic bluefin tuna Thunnus thynnus, and Pacific
bluefin tuna Thunnus orientalis. All of them are highly migratory and inhabit
temperate zones, namely in waters as cold as 10C to tropical waters (Brill, 1994).
Bluefin tunas are important species having high commercial values. Although the
amino acids sequence identities for tuna Mbs are very high (>90 %), the stability
of tuna Mbs is clearly different from each other. Thus, tuna Mbs are excellent

16

model proteins for investigating the relationship between structure and stability of
Mbs. Many attempts have been performed to characterize the structure of tuna
(Ueki et al. 2004; 2005; 2006, Ochiai et al., 2009; 2010; 2011).

Myoglobin structure
Sperm whale Mb is the first protein whose crystal structure was solved by
X-ray as reported by Kendrew et al. (1960). Its structure has a 80% of helical
chain containing eight helical segments A through H. However, the D-helix is
absent in fish Mb (Birnbaum et al. 1994). It is replaced by the random coil in its
structure as shown in Fig. 0-1.
Mb residing the cytoplasma is composed of globin polypeptide and non
protein part (the heme). The heme consists of protoporphyrin and an iron atom,
which is placed in the hydrophobic region binding imidazole group of proximal
histidine directly and distal histidine through a coordinate bond (Phillips and
Schoenboen, 1981). The organic protoporphyrin is made by tetrapyrole groups
connected by methane bridges as shown in Fig. 0-2. The iron atom holds four of
sixth coordination sites by covalent bonds of nitrogen plannar. Moreover, the fifth
coordination site binds the globin. The form will be oxyMb when the sixth of
coordination site holds oxygen, while, when water molecule places in this site, the
form is called metMb, which is physiologically inactive (Faustman and Cassens,
1990). Thus, the sixth position site has the abilty to bind a variety of ligands.
The molecular weight of Mb is around 14.000 -18.000. Mb consists of 153
amino acids residues for mammalian ones while teleost Mbs generally contain

17

147 amino acids. Thus, the molecular weights of fish Mbs are lower than that of
mammalian counterparts (Joseph et al., 2010b).
Mb has been established as a single protein expressed only in the oxidative
muscle for decades. Recently, some researchers reported that Mb has two
isoforms in the common carp and gold fish namely Mb 1 and Mb 2 (Fraser et al.,
2006). Mb 1 is not only expressed in the oxidative muscle but also in the other
tissues such as brain, liver, kidney, and gill in low concentrations, while Mb 2 is
found at a low level only in the brain (Fraser et al., 2006; Roesner et al., 2008).
Biochemical properties of Mb 2 are related to the reduction of oxidative stress in
the brain, particularly during reoxygenation after hypoxia (Helbo et al., 2011).
They revealed the ability of Mb to scavenge H2O2 in vitro which is as a potential
mechanism of carp brain in vivo protection against oxidative stress. Mb 2 shares
78% sequence identity with Mb 1 in the common carp. Tuna Mb shares 73 %
sequence identity with carp Mb 1 and 67 % with carp Mb 2 (Fraser et al., 2006).

Myglobin derivatives
Mb gives rise to three types of derivatives depending on the the redox
state of the iron atom in the heme, namely deoxy, oxy, and metMb.
Interconversion among Mb derivatives is affected by several factors such as
temperature, pH, metMb reducing activity, and lipid oxidation.
DeoxyMb, a predominant purplish-red pigment which has no ligand
bound, presents as a native pigment in anaerobic live muscle and changes to
oxyMb when exposed to oxygen (Faustman and Cassens, 1990). This condition is
due to oxygen being bound to the heme iron of Mb forming oxyMb. The iron in

18

deoxyMb and oxyMb is in the reduced or ferrous state (Fe2+).

A heme iron is

further oxidized with the prolonged incubation to form metMb where the iron
atom changes into a ferric one (Fe3+) and the sixth coordination site is replaced by
a water molecule replacing oxygen.

Myoglobin functions
It is well established that the main function of Mb is to transport
temporarily oxygen in the muscle for facilitation of respiration (Livingston et al.,
1983), though new functions of Mb have also been recently reported such as
scavenging activity of nitrogen oxide (Wittenberg and Wittenberg 2003; Ordway
and Garry 2004; Cossins and Berenbrink, 2008; Flogel et al., 2010; Helbo et al.,
2012).

Myoglobin content
Mb content changes depending on animal species, i.e., paled-color meat
such as chicken and pork generally contain low concentrations of Mb compared to
that of red-color meat such as beef. The increasing red fiber content and age
would increase the Mb level. In addition male produce more darker meat
compared than that of female (Seideman et al., 1983).
Mb concentration also varies among muscle type, for example, in leg
muscle of hogs which needs higher oxygen for movement has a high level of Mb
compared with back muscle which has much lower oxygen requirement. Thus,
intrinsic factors such as muscle activities influence the Mb content (Pegg and
Shahidi, 1997). The higher the content of Mb, the longer the animal can endure

19

maintain the activity. Since whales contain high amount of Mb, it would
significantly contribute to oxygen storage to compensate for diving capacity. In
addition, the oxidative muscles, namely, slow skeletal (dark muscle ) and heart
muscle have abundant Mb.

Meat color
Generally consumers determine the freshness of meat by the extent of
discoloration as an indicator for the quality. Meat color is very important in the
meat industry, especially when used for the consumption as raw material such as
sushi and sashimi.
Mb, the main pigment in the muscle, is responsible for red coloration. As
describe above, the state of an iron atom in the heme and its ligand at sixth
coordination site greatly contribute to the color of meat. The anaerobic deep
muscle contains abundant deoxyMb appearing purplish-red in color. The desirable
bright cherry red color for consumers is seen in fresh meat due to the contact of
ferrous-deoxyMb with oxygen. The undesirable discoloration is closely related to
the accumulation of brown color in ferric-metMb. The accumulation of metMb
lowers the meat quality (Lee et al., 2003; Chaijan, 2007; Joseph et al., 2010b).
The reaction of Mb in ferrous or ferric state with hydrogen peroxide
produced by bacteria or its muscle causes the green color as known as
choleglobin, while sulfMb is formed by the reaction of hydrogen sulfide and
oxygen on deoxyMb (Faustman and Cassens, 1990). The greening in color
appears when tuna Mb reacts with the trimethylamine oxide (TMAO), cysteine
and hydrogen peroxide (Chaijan and Panipat, 2009).

20

Other related topics

Hemoglobin
Hemoglobin (Hb), the major heme protein in the blood, is involved in
oxygen distribution from the lung to all the cells of the body, and is composed of
tetrameric heme proteins. Hb generally contains two alpha helical chains and two
beta chains. These polypeptides are basically similar to the monomer Mb
structure.

Postmortem biochemistry
At the point of death, where supply of oxygen stops in the muscle,
anaerobic glycolysis occurs and adenosine tri-phosphate (ATP) is degraded to its
related compounds such as adenosine di-phosphate (ADP), adenosine monophosphate (AMP), inosine mono-phosphate (IMP), inosine (HxR), and inosine
mono-phosphate (Hx). ATP is rapidly decomposed in fish struggling after death.
Release of inorganic phosphate lowers the muscle pH.
OxyMb can be oxidized to metMb, generating superoxide anion. The
enzyme, superoxide dismutase (SOD), would convert superoxide anion to oxygen
and hydrogen peroxide (H2O2) as shown in Fig. 0-3. By assisting metMb
reductase (MMR), which is under control of NADH-cytochrome b5
oxidoreductases, the inactive-metMb can be reduced to active-deoxyMb. Then,
this reduced form can bind oxygen to generate oxyMb in the muscle. As far as
these enzymes actively work, metMb can be cycled (Moller and Skibsted, 2006).
Thus, under post mortem condition by where the reductive enzyme system is
inactivated, the autooxidation proceeds resulting in the formation of metMb .
21

Lipid oxidation
It has been well established that Mb has a close relationship with lipid
oxidation. The stability of Mb is influenced by lipid oxidation product. On the
other hand, lipid oxidation can be accelerated by Mb as shown in Fig. 0-4. Thus,
both Mb and lipid oxidations can exacerbate each other causing off-flavor and
meat discoloration (Faustman et al., 2010). Lipid oxidation consists of three steps,
namely, initiation, propagation, and termination.
The autooxidation of oxyMb produces metMb and superoxide anion
initiating the lipid oxidation. These autooxidation will generate the deterioration
of food resulting in the discoloration and rancidity. In addition, the cysteine
residue in fish Mb is nucleophilic and to be more reactive with lipid oxidation
products (Witting et al., 2000).
The stability of Mb against lipid oxidation is in general specific to animal
species. Muscle containing higher ratio of red fiber and more lipid is susceptible
to discoloration. Lipid oxidation yields the primary and secondary oxidation
products and enhances meat discoloration. The secondary products from n-6
polyunsaturated acids such as 4-hydroxy-2-nonenal (HNE) greatly affects the
oxidation of Mb containing a few histidine residues in the structures (Yin et al.,
2011).

In addition, the autooxidation rate of porcine oxyMb was significantly

lower than Mbs from other species, namely, bovine, ovine, and cervine Mbs
(Gutzke and Trout, 2002). The oxidation of fish Mb promotes lipid oxidation
generating hydroperoxides as reported by Sohn et al. (2005).

22

Methods for investigating the protein denaturations

Denaturation involves many phenomena including unfolding of the
proteins, aggregation, cleavage, precipitation, and coagulation. There are some
methods to investigate the protein denaturation (especially for Mb) such as
differential scanning calorimetry (DSC), circular dichroism (CD) (Ochiai et al.,
2010; 2011), and percentage myoglobin denaturation (PMD) (Chen et al., 2004;
Chotichayapong et al., 2012). DSC techniques measure the physical properties
of change in protein structures by heat movements (Gill et al., 2010). However,
the unfolding transition for some proteins is not complete until the treatment
temperature (George and Makhatadze, 2001). The basic principle in the analysis
of protein using CD spectra is the measurement of the secondary structure of
protein (Sreerama et al., 2000). The disadvantages of CD were identified such as
requirement of the relatively large amounts of protein examined (~1 mg protein
per titration) and weak signals in the result of spectra (Kelly and Price, 2006).
Percentage myoglobin denaturation (PMD) is a technique for measurement of
denaturation of myglobin based on the aggregation of protein molecules (Joseph
et al., 2010). PMD is a simple method, although the factor(s) causing the
denaturation cannot be precisely identified.

23

Objective

Previous studies reported that fish Mbs are less stable compared to those
of mammalian Mbs. However, the molecular mechanism regarding their
denaturation and autooxidation processes causing discoloration still remains
unclear. Thus, in the present study, attempts have been made to characterize Mbs
from bluefin tuna species and their thermal denaturation profile. The relationship
of Mb with the quality rank of tuna was also observed.
The primary structure of tuna Mb has been elucidated to unveil its
stability. In addition, to further characterize the tuna Mb, bioinformatic analyses
were performed including phylogenetic analysis, hydropathy plot and homology
modeling based on the deduced amino acid sequence.
The fast and simple method for the isolation of tuna Mb by combining
ammonium sulfate fractionation and native gel electrophoresis was developed in
this study, since the chromatography techniques are too time-consuming to be
used routinely for large scale. Thus, this purified tuna Mb was used for further
experiments.
The changes of oxyMb to metMb are referred as the autooxidation.
Previous studies reported that fish Mb was easyly oxidized compared with
mammalian counterparts. The autooxidation rate was closely related to the low
stability of Mb (Chow, 1991). In addition, the temperature and pH affected the
autooxidation rates of cooked beef, pork and turkey meats as reported by Trout
(1989). The previous researches revealed the relationship between the stability of
tuna Mb and thermal denaturation pattern (Ueki and Ochiai, 2004; Ueki et al.,

24

2005; Ochiai et al., 2010). Moreover, acid pretreatment accelerated the oxidation
rate of tilapia Oreochromis spp. Mb (Chow et al., 2009). Concerning the postmortem color stability of meat, pH dependency of the autooxidation rate can be
another important factor.
In the next place, to assess the reliability of tuna meat quality grading
determined by sensory evaluation of professional appraisers, an attempt was
performed on yellowfin tuna meat based on the properties of Mb. The SDSPAGE pattern of water soluble fraction was also examined to monitor meat
quality in the different grades of meat.

25

Chapter 1
Molecular cloning and characterization of southern bluefin tuna
Thunnus maccoyii myoglobin

It has been considered that the primary structures of Mb have correlations

with their stability (Ueki et al., 2005; 2006). Previous study also revealed that
structural stabilities of scombridae fish Mbs clearly differ among the species,
although the sequence identities of amino acid were in the range of 9199% (Ueki
et al., 2004; 2005; 2006) where skipjack tuna Katsuwonus pelamis Mb was the
most thermostable and bullet tuna Auxis rochei Mb showed the lowest stability.
Skipjack shows the specific feature containing 146 amino acid residues while
those of other fish teleost have 147 so far reported. However, it is still unclear
which factor(s) determines the stability of Mbs.
The purpose of this chapter is to elucidate the structural profiles of
southern bluefin tuna Mb which has been unknown to date by molecular cloning
techniques. The primary structure would provide useful information on the
stability and autooxidation rate of Mbs. To further characterize this tuna Mb,
bioinformatic analyses were performed including phylogenic tree, hydropathy
plot, and homology modeling based on its deduced amino acid sequence.

26

Section 1
cDNA cloning of southern bluefin tuna T. maccoyii Mb

The primary structures of fish Mbs have been reported for bigeye tuna
Thunnus obesus (Ueki and Ochiai, 2004), and bullet tuna Auxis rochei (Ueki et
al., 2005) etc. In addition, those of Pacific T. orientalis and Atlantic bluefin tuna
T. thynnus are available with the accession numbers of AF291836 and AF291831.
However, there has been no structural information of southern bluefin tuna Mb to
date, although it is quite an important species.
In the present section, cDNA cloning of bluefin tuna T. maccoyii Mb gene
was carried out, and its amino acid sequence was deduced.

Materials and methods

Materials
The specimens of southern bluefin tuna were purchased at a local fish
market near the port of Misaki, Kanagawa Perfecture, Japan. In order to elucidate
its primary structure, the ordinary muscle of southern bluefin tuna was used. All
of the specimens were stored at -80 oC until used for experiment. All the
chemicals used in this study were of reagent grade.

27

RNA extraction and cDNA synthesis

Total RNA was extracted using Isogen (Nippon Gene, Tokyo, Japan)
according to the manufacturers protocol. Purification of mRNA containing
poly(A) tail was carried out using Oligotex-dT30 Super (Takara, Otsu, Japan).
The quantity of RNA was measured from the absorbance at 260 and 280 nm with
a UV/Vis DU 530 spectrophotometer. Then, the quality was checked by gel
electrophoresis. First-strand cDNA was synthesized using an aliquot of 5 g of
total RNA, heated at 65oC for 5 min followed by chilling on ice. The total RNA
was reversely transcribed using AP primer to get first-strand cDNA with enzyme
SuperScript III reverse transcriptase according to the manufacturers protocols.
The reaction was performed at 48oC for 90 min, then was stopped by heating
at70oC for 15 min. RNase H was added to remove the RNA template from
cDNA/RNA hybrid molecule at 37oC for 60 min.

Mb primer design
The specific primers for polymerase chain reaction (PCR) were designed
based on the conserved region of the Mb sequences of big eye tuna T. obesus,
Pacific bluefin tuna and Atlantic bluefin tuna to amplify the internal region of Mb
cDNA sequence. The data are avalaible in the database DDBJ/EMBL/Gen Bank
with the accession numbers AB104433, AF291836, and AF291831, respectively.
The schematic diagram of the Mb primer design is shown in Fig. 1-1 and detailed
primers used are shown in Table 1-1.

28

DNA amplification
The PCR amplification process was carried out at 94oC for 5 min,
followed by 30 cycles of denaturation at 94oC for 30 s, annealing at 58oC for 30 s,
and extension at 72oC for 45 s according to Ueki and Ochiai (2004) with slight
modifications. The temperature of 72 oC for 5 min was performed as a final
extension step using the PCR system 9700 (Applied Biosystem).
The 3 rapid amplification of the cDNA ends (3RACE) was performed
with gene specific primers from the result of internal sequencing and an abridged
universal amplification primer (AUAP). The PCR product was diluted 100 fold
and used as a template for nested PCR. The PCR amplification was carried out as
previously described except the annealing temperature at 60oC for 30 s.
The 5rapid amplification of the cDNA ends (RACE) was then carried out
to get a complete sequence using GeneRacer Kit (Invitrogen Corp). First strand
cDNA was synthesized from the total RNA after

dephosphorylating and

decapping mRNA according to the manufacturers protocol. 5 nested primer

and a gene specific primer M5R2 were used after amplification of DNA using
GeneRacer kit using 5 primer and a gene specific primer M5R1 under the same
PCR condition.

cDNA cloning
PCR product was purified and ligated in to the pGEM-T Easy Vector
(Promega) for 1 h. Transformation of the competent cells using E. coli (JM 109)
as a host bacterium was performed overnight in LB agar medium. Subcloning by
plasmid was carried out according to the manufacturers protocol and

29

subsequently purified by miniprep kit (Sigma-Aldrich, St. Louis, MA, USA).

DNA sequencer (ABI 3100 Genetic Analyzer) was used after labeling with
BigDye terminator.

Molecular weight (MW)

The molecular weight of southern bluefin tuna was calculated based on the
amino acid sequence (http://web.expasy.org/compute_pi/).

30

Results

Since the dark muscle gave low quality of total RNA, the mRNA was
isolated using fast skeletal muscle and then transferred to cDNA. These cDNA
fragments were further subcloned into the plasmid. The full-length sequence of
southern bluefin tuna Mb cDNA contained 776 nucleotides with an open reading
frame consisting of 444 nucleotides encoding 147 amino acids (Fig. 1-2). The 5
non coding region was 74 bp, and that of 3 non coding region was 258 bp. This
primary structure has been submitted to DDBJ/EMBL/GenBank databases with
the accession number of AB592346.

In addition, the molecular weight was

calculated to be 15628 based on its deduced amino acid sequence.

31

Section 2
Bioinformatic analysis

Bioinformatic analysis is a tool to analyze and store biological information

applying a computer. In this section, alignment of sequence and phylogenetic
analysis were performed based on computational studies. Further to investigate
the hydrophobic and hydrophylic sites, analysis of hydropathy plot also was
employed. Homology modeling was also constructed based on blackfin tuna T.
atlanticus Mb (PDB 2NRL) to get the tertiary structure of southern bluefin tuna
using Swiss Model program.

Materials and methods

Alignment of sequence and phylogenetic analysis

BLAST program was used to align the amino acid sequences (Altschul et
al., 1997). A phylogenetic tree was constructed by a neighbor-joining method
based on the amino acids sequences using multiple sequence alignment
CLUSTAL W and MEGA 4 softwares (Thompson et al., 1994; Tamura et al.,
2007). The sequence of sea hare Mb was taken as an outgroup to root the tree.
Accession numbers of amino acid sequences of Mbs are as follows: Pacific
bluefin tuna T. orientalis (AF291836), Atlantic bluefin tuna T. thynnus
(AF291831), bullet tuna Auxis rochei (AB154423), Atlantic cod Godus morhua
(EF121552), Atlantic salmon Salmo salar (NM001140642), hilsa shad Tenualosa
ilisha (AB515305), japanase jack mackerel Trachurus japonicus (AB515303),
32

milkfish Chanos chanos (AB480168), rainbow trout Oncorhynchus mykiss

(AB526463), chub mackerel Scomber japonicus (AF291835), yellowtail
amberjack Serio lalalandi (AB515304), zebrafish danio rerio (AAA50021),
icefish Pseudochaenichthys georgianus (U71055), sperm whale Physeter
macrocephalus (J03566), and sea hare Aplysiakurodai (P02211).

Hydopathy plot and homology modeling

Hydopathy plot was performed according to Kyte and Doolittle (1982).
Homology modeling was carried out by the Swiss Model program
(http://swissmodel.expasy.org).

33

Results

The complete sequence of southern bluefin tuna Mb cDNAcontains 776

nucleotides, with an open reading frame consisting of 444 nucleotides encoding
147 amino acids. Using BLAST program found that the amino acid sequence of
southern bluefin tuna Mb is identical to those of other bluefin tuna Mbs, namely
Pacific and Atlantic bluefin tunas. Both proximal and distal histidine residues
were conserved for all the species examined (Fig. 1-3).
A phylogenetic tree was constructed based on the comparison of amino
acids sequences using multiple sequence alignment CLUSTAL W through
molecular evolution and genetic analysis (MEGA) 4 software for

neighbor-

joining methods. Southern bluefin tuna Mb was found to be very close to Pacific
and Atlantic bluefin tuna Mbs. Southern bluefin tuna Mb formed one clade with
other bluefin tuna Mbs in the phylogenetic tree except that of blue marlin (Fig. 14). In addition, scombridae Mbs formed an independent clade. The sequences of
sea hare Mb was taken as outgroup to root the tree.
Based on its deduced sequence, the isoelectric point of southern bluefin
tuna Mb was calculated to be 8.99 as performed by the online tool MW.
Hydropathy plot was performed to characterize southern bluefin tuna Mb.
As presented in Fig. 1-5, the segment E was considered to be less hydrophobic,
since His60 is located in this region.
In order to estimate the tertiary structure of southern bluefin tuna Mb,
homology modeling was performed using a Swiss Model tool (Schwede et al.,
2003). This model was obtained using the structure of blackfin tuna Mb as a

34

template (PDB ID 2NRL). The primary structure of southern bluefin tuna is

mostly identical to that of blackfin tuna Mb (99.31 %) as shown in Fig. 1-6.

35

Section 3
Discussion

The complete sequence of southern bluefin tuna Mb cDNAcontained 776

nucleotides, with an open reading frame consisting of 444 nucleotides encoding
147 amino acids. Incidentally, the primary structure of fish scombridae Mb so far
reported contains 147 amino acids residue except for skipjack Mb having 146
amino acid residues.
Regarding the amino acid sequence, southern bluefin tuna Mb was
identical to Pacific and Atlantic bluefin tuna Mbs (Fig. 1-3; Table 1-2). The
arrows indicate the distal and proximal histidines involved in oxygen binding
(Fig. 1-3). So far, fish Mbs are considered to contain 7 -helical segments, A
through H except D. The sequence identity of Mbs were in the range of 21-100%
(Table 1-2). The value was relatively high among scombridae fish Mb (82-100%).
Milkfish and zebrafish (cyprinidae) Mbs showed 73 and 71% identical to the tuna,
respectively.
Buefin tuna Mbs formed one clade. In addition, bluefin tuna Mbs were
close to the other tuna Mbs, namely, bullet tuna and chub mackerels shown in the
phylogenetic tree (Fig. 1-4). These species formed an independent clade of
scombridae group.
Using an online bioinformatic tool, the molecular weight, pI,
hydrophobicity, and homology modeling were estimated. The molecular weight
and pI this tuna were 15628 and 8.99, respectively. The molecular weight of bullet
tuna Mb is 15407 measured by MALDI-TOF MS

36

(Ueki et al., 2005). The

information of pI might be useful for the development of the isolation method of

the Mbs, as examined in the next chapter.
Structural analysis of tuna Mb using hydrophathy scale was carried out to
estimate the hydrophobic and hydrophilic regions. As a result, the region C was
found to be less hydrophobic. In addition, the lower hydrophobicity of

the

segment F could also be due to the presence of Asp87 and Lys92. Accounting the
hydrophobicity is the step for understanding protein folding (Tanford 1980 in
Stanley et al., 1995) greatly affecting its three dimensional structure and its
stabilities.
Homology modeling using blackfin tuna Mb (structure PDB ID 2NRL)
as a template was performed by Swiss Model tool (Schwede et al., 2003) to obtain
the tertiary structure of southern bluefin tuna Mb. Since the high identity of their
primary structures (99.31 %), the tertiary structure of southern bluefin tuna is
likely to be very similar to that of blackfin tuna.

37

Summary

The complete sequence of T.maccoyii Mb cDNA contained 776

nucleotides, with an open reading frame consisting of 444 nucleotides encoding
147 amino acids. The 5 and 3non coding regions were 74 bp and 258 bp,
respectively.

This

primary

structure

has

been

submitted

to

DDBJ/EMBL/GenBank databases with the accession number of AB592346. The

identical nucleotide sequence among bluefin tunas (T. orientalis and T. thynnus)
was obtained in the coding region suggesting that Mbs from these bluefin tuna
species share the same structural and functional properties. Phylogenetic tree,
molecular weight, pI, hydropathy plot and homology modeling were carried out
based on its deduced amino acid sequence.

38

Chapter 2
Isolation and characterization of tuna myoglobin

Tuna fish are known as a highly migratory species. They contain a large
amount of the Mb both in fast (ordinary) and dark muscles, although the
concentration is much higher in the dark muscle. In this chapter, attempts were
made to isolate tuna Mb to further understand its biochemical properties. Many
attempts have been reported regarding the purification of Mb using
chromatography techniques (Ueki and Ochiai, 2004; Joseph et al., 2010b;
Thiansilakul et al., 2011; Yin et al., 2011). Since the chromatography techniques
are laborious and time consuming to be used routinely, a simple and rapid method
for purification is preferable. In the present chapter, preparative native gel
electrophoresis was applied aiming the fast purification of tuna Mb and the
properties were investigated.
On the other hand, it was reported that fish Mbs are generally susceptible
to oxidation and aggregation even under moderate conditions, causing meat
discoloration. In the present chapter, the stability of bluefin tuna Mb under several
pH and temperature conditions was investigated.
To further characterize the tuna Mb, the thermostability of tuna Mb was
compared to that of horse Mb. Although a high sequence identity of amino acids
found among tuna Mbs (more than 90%), their thermostabilities are clearly
different (Ueki and Ochiai, 2004). To investigate the thermostability of proteins,
the techniques such as using differential scanning calorimetry (DSC) and circular
dichroism (CD) apparatus have been adopted. Percentage myoglobin denaturation
39

(PMD) is one of the simplest methods for the evaluation of thermostability of

proteins based on the protein aggregation. In the present chapter, PMD was
carried out in order to elucidate the thermostability of purified tuna Mb.

40

Section 1
Isolation of tuna myoglobin

Since the purified Mb is essential for understanding its characteristics,

tuna Mb was isolated in this section. The combination of ammonium sulfate
fractionation and preparative native gel electrophoresis was applied to isolate the
tuna Mb.

Materials and Methods

Material
The dark muscle was excised from a live specimen of the Pacific bluefin
tuna and stored at -80 oC until used. All the chemicals used in this study were of
reagent grade (Wako, Otsu, Japan).

Ammonium sulfate fractionation

The following procedures were carried out at 0-4oC unless otherwise
stated. The dark muscle of bluefin tuna was extracted in a mortar with 2 volumes
of cold water for 20 min and centrifuged at 2800 x g (Sakuma M200-IVD, Tokyo,
Japan) for 15 min. The supernatant was filtered through a filter paper (No.5,
Advantec, Tokyo, Japan) followed by filtration through a 0.20 m filter (RC 15
Sartorius, Goettingen, Germany). The extract was subjected to 40 to 80 %
ammonium sulfate saturation and centrifuged at 1100 x g (Sakuma M200-IVD,
Tokyo, Japan) for 10 min. All of the resulting supernatants were brought to 90%

41

ammonium sulfate saturation and centrifuged under the same condition. The
precipitate was dissolved in a small amount of ice cold water, and dialyzed against
electrophoresis buffer (25 mM Tris, 192 mM glycine, pH 8.3).

Preparative electrophorhesis
Preparative native gel electrophoresis was performed by using an
apparatus Nativen AE-6760 (Atto Co., Tokyo, Japan). Two milliliters of dialyzed
solution were mixed with the same volume of native sample buffer (Bio-Rad, CA,
USA) and loaded on to the gel tube (4 cm in diameter and 8 cm in height)
consisting of 15% separating gel and 4.5% stacking acrylamide gel. The gel was
run for 2 h followed by an automatic fractionation step at 15 mA for 3 h.

SDS-PAGE patterns
SDS-polyacrylamide gel electrophoresis (SDS-PAGE) was carried out as
following procedures. An equal volume of the sample was mixed with the sample
buffer containing 50 mM Tris-HCl (pH 6.8), 0.15% ethylenediaminetetraacetic
acid (EDTA), 0.01% bromophenol blue, 4% sodium dodecyl sulfate, 12%
glycerol and 1% 2-mercaptoethanol. The protein mixtures were incubated at 95oC
for 3 min. The samples were subjected to SDS-PAGE using 15% separating gel
and 3% stacking gel based on the Laemmlis method (1970). The separating gel
contained 1.5 M Tris-HCl (pH 8.8), while the stacking gel contained 0.5 M TrisHCl (pH 6.8). The current for running the stacking and separating gels was
adjusted 10 and 20 mA, respectively. The anode and cathode buffers contained
0.1% SDS. After separation, the gel was stained with Coomassie Brilliant Blue

42

(CBB) R-250 (Wako) in methanol/acetic acid/water (5:1:4 v/v) and destained in

methanol/acetic acid/water (25:7:68 v/v). Molecular weight markers were
purchased from Bio-Rad (CA, USA); the wide range of markers (in a molecular
mass) consisted of myosin (204 kDa), -galactosidase (117 kDa), bovine serum
albumin (78 kDa), ovalbumin (52 kDa), carbonic anhydrase (37 kDa), soybean
trypsin inhibitor (29 kDa), lysozyme (19 kDa), and aprotinin (7 kDa).

2D-PAGE
For 2D-PAGE, purified Mb was dissolved in a rehydration buffer (7 M
urea,

thiourea,

3%

3-[(3-cholamidopropyl)

dimethyl-ammonio]-1-

propanesulfonate, 0.2% ampholyte (pH 3-10), 50 mM dithiothreitol). The treated

sample was applied to linear immobilized pH gradient gel (7 cm, Bio-rad) in the
range of pH 3-10. Isoelectric focusing (IEF) was carried out using a PROTEAN
IEF cell (Bio-Rad) at 250 V for 15 min, followed by 4,000 V for 2 h, and 20,000
Vh for 6 h. SDS-PAGE for the second dimension was carried out using a 12.5%
acrylamide gel after reduction and alkylation treatments. The gel was stained with
Coomassie Brilliant Blue and destained in methanol/acetic acid/water as
previously described.

Absorption spectra of purified tuna Mb

The derivatives of Mb were prepared from isolated tuna and horse Mbs
according a previous method (Tang et al., 2004) with some modifications. The
amount of sodium hydrosulfite was added followed by a dialysis process against
50 mM sodium phosphate buffer (pH 7.4) to obtain deoxyMb and oxyMb,

43

respectively. MetMb was prepared by adding the potassium ferricyanide. The

final concentration of Mb solution was adjusted to 0.3-0.4 mg/ml with same
buffer. The visible absorption spectra of Mb derivatives for the isolated tuna and
horse Mbs were measured from 380 nm to 780 nm using a Bio spectrophotometer
(Jasco V-630, Tokyo, Japan).

The effect of temperature

Temperature effect was examined in the range of 10-70oC according to
Thiansilakul et al. (2011) with slight modifications. Both tuna and horse Mbs
were dialyzed against 50 mM sodium phosphate buffer at pH 7.4 after addition of
ammonium hydrosulfite to obtain oxyMb. Dialyzed Mb was incubated

in a

waterbath for 30 min. The absorption spectra were measured from 380 to 780 nm
using a Jasco V-630 Bio spectrophotometer.

44

Results

Ammonium sulfate fractionation

Firstly, the conditions for ammonium sulfate fractionation were optimized.
SDS-PAGE patterns of the supernatants of 40, 50, 60, 70, and 80% ammonium
sulfate saturation are shown in Fig. 2-1.

All the resulting supernatants of

ammonium sulfate saturation were brought to 90% ammonium sulfate saturation

and centrifuged. The precipitates were dissolved in a small amount of cold water,
and dialysed against the electrophoresis buffer (25 mM Tris, 192 mM glycine, pH
8.3) to remove excess ammonium sulfate.

The SDS-PAGE patterns of the

precipitates are given in Fig. 2-2. The fractions of 40, 50, and 60% saturation were
found to contain a high content of Mb. Therefore, these fractions were chosen to
further purify Mb by preparative native electrophorhesis.

Preparative electrophoresis
The native gel electrophoresis was performed for the samples of 40-90%,
50-90%, and 60-90% ammonium sulfate saturation. In the present section, water
soluble fraction of dark tuna muscle was applied to the electrophoresis without
ammonium sulfate saturation.
Figure 2-3 shows apparatus of the preparative electrophoresis Nativen AE6760 (Atto Co., Tokyo, Japan). The purification of Mb from the precipitates of
40-90% and 50-90% saturation was found to give the best separation and yield.
The result showed that the highest yield of Mb was obtained from 40-90%
saturation (~ 9 mg from 2 ml of water soluble protein fraction corresponding to 2
45

g of dark muscle). Purified tuna Mb of 60-90% saturation was slightly

contaminated with another protein of about 50 kDa (data not shown). Therefore,
the 40-90% saturation fraction was used in the subsequent experiments.

SDS-PAGE patterns of purified tuna Mb

The SDS-PAGE patterns through the purification steps from the dark
muscle are shown in Fig. 2-4a. The water soluble fraction (lane A) contained a 16
kDa protein corresponding to Mb as well as a large amount of proteins with
higher molecular weights. These proteins were mostly removed by ammonium
sulfate fractionation (40% saturation) (lane B). The contaminating proteins were
further removed by the preparative electrophoresis, resulting in a single band of
Mb (lane C).
The result of tuna Mb purification without ammonium sulfate fractionation
was checked by SDS-PAGE as presented in Fig. 2-4b. The lane I contained
purified Mb with a molecular mass of about 16 kDa, showing the contaminating
protein with molecular mass about 28.6 kDa. This protein showed the same
isoelectric point value with Mb on 2D-PAGE gel (data not shown), and was
considered to be an Mb dimer. Therefore, ammonium sulfate fractionation is
necessary to get Mb of high purity.

2D-PAGE of purified tuna Mb

2D-PAGE further demonstrated the high purity of Mb (Fig. 2-5). On 2DPAGE gel purified Mb gave only one spot demonstrating the homogeneity of
purified Mb. The pI of purified Mb was found to be at around 9 calculated from
46

the mobility, quite close to the the calculated value of bluefin tuna Mb from its
amino acid sequence (8.99).

Absorption spectra of purified tuna Mb

The deoxyMb was obtained by addition of sodium hydrosulfite to the
purified Mb, and then was converted to oxyMb by dialysis. Another Mb
derivative, namely metMb, was obtained by addition of a small amount of
potassium ferricyanide to the Mb solution. The same procedure was applied to the
horse Mb as a control.
The spectra of Mb derivatives were measured in the range of 475 to 675
nm (Fig. 2-6). The peaks of deoxyMb were found at 556 and 557 nm for tuna and
horse Mbs, respectively, as shown in Table 2-1. Two peaks of oxyMb were
observed at wavelengths of 541 and 577 nm, respectively, while for tuna Mb at
542 and 581 nm for horse Mb. In addition, the maximum absorption of metMb
was found at 502 and 631 nm for tuna while at 503 and 632 nm for horse Mb.

The effect of temperature

The temperature effect on metMb formation from oxyMb at pH 7.4 is
shown in Fig. 2-7. Tuna Mb started to precipitate when the temperature reached
70oC, while no such phenomenon was recognized for horse Mb suggesting that
horse Mb is more thermostable than tuna Mb. Precipitation of Mb from Eastern
little tuna was reported at 60oC by Thiansilakul et al. (2011). At this temperature,
metMb ratio was more than 90% for both tuna and horse Mbs.

47

Section 2
Autooxidation profiles of tuna myoglobin

It still remains unclear why fish Mbs are oxidized much faster compared to
those of mammalian Mbs. In order to elucidate the effect of pH on tuna Mb
denaturation, the autoxidation profiles at pH 5.6, 6.5, and 7.4 at temperature 0 and
37oC were investigated.

Materials and methods

Materials
Bluefin tuna Mb was purified as the aforementioned method. Horse Mb
was purchased from Sigma Chemicals (St. Louis, MA, USA) and was used as a
control.

Preparation of oxyMb
OxyMbs were prepared from purified bluefin tunaMb and horse Mb
according to the method of Brown and Mebine (1969) and Tang et al. (2004) with
slight modifications. The isolated tuna and horse Mbs were dialyzed against 50
mM sodium citrate (pH 5.6) or 50 mM sodium phosphate (pH 6.5 and 7.4) to
remove the residual hydrosulfite. The final concentration of Mb solution was
adjusted to 0.3-0.4 mg/ml with the respective buffer.

48

The effect of pH on metMb formation

The tuna and horse oxyMbs were incubated at pH 5.6, 6.5, and 7.4 at 0oC
for up to 7 days and at 37oC for up to 3.5 h. The absorption spectra of metMb,
deoxyMb and oxyMb were measured at specific time intervals from 380 nm to
780 nm using a Jasco V-630 Bio spectrophotometer. The measurement was
performed in triplicate and the percentage of metMb formed was calculated
according to Tang et al. (2004).

Autooxidation rate
The autoxidation rate (k) was calculated based on the equation as reported
by Chow et al. (2003) :
k = [2 - log (100 - metMb%)]/h

49

Results
DeoxyMbs of purplish-red in color were obtained immediately after
addition of sodium hydrosulfite. Dialysis of Mb against 50 mM sodium citrate
(pH 5.6) or sodium phosphate (pH 6.5 and 7.4) buffer resulted in conversion to
oxy form and removal of excess sodium hydrosulfite.
Autooxidation of both tuna and horse Mbs proceeded as a first order
reaction irrespective of pH examined as shown in Fig. 2-8. The changes of metMb
ratio of both tuna and horse Mbs during incubation at 0oC are presented in Fig. 29. These results showed that the highest metMb formation was observed at pH
5.6, followed by pH 7.4 and 6.5, for both tuna and horse Mbs. OxyMbs changed
to metMb along with prolonged time of incubation. In addition, the highest
autooxidation rate was observed at pH 5.6, followed by those at pH 7.4 and 6.5
for both tuna and horse Mbs (Fig. 2-10). Compared to horse Mb, autooxidation
rate of tuna Mb was found to be higher at all pH examined.
The autooxidation rate of Mb at 37oC also followed a first order reaction
(Fig. 2-11). The autooxidation profiles of tuna and horse Mbs at pH 5.6, 6.5, and
7.4 are shown in Figs. 2-12. The autooxidation rate of tuna Mb was higher than
that of horse Mb (Fig. 2-20). MetMb formation rate was the highest at pH 5.6,
followed by those at pH 6.5 and 7.4 for tuna Mb. MetMb ratios of tuna Mb at pH
5.6, 6.5, and 7.4 were found to be 91.9, 72, and 43.1% after 3.5 h, respectively.
The highest autooxidation rate of both tuna and horse Mbs was obtained at
pH 5.6 followed by at pH 6.5 and 7.4. Interestingly, the autoxidation rate of tuna
and horse Mbs showed similar values at pH 7.4.

50

Section 3
Thermostability of tuna myoglobin

pH and temperature may cause unfolding

of the proteins. This

phenomenon is called denaturation where the protein will lose some functions
including biological activity and solubility. Previous studies reported that
thermostability of turkey Mb was lower than that of beef Mb during incubation at
71, 75, and 80oC. In this study, turkey Mb was incubated at pH 6.2 while beef Mb
was at pH 5.6 (Joseph et al., 2010a).

On the other hand, no difference in

thermostability was found by percentage myoglobin denaturation (PMD) between

bison and beef Mbs (Joseph et al., 2010b).
The stability of horse mackerel and chub mackerel Mbs was different,
namely, the former showed the higher in PMD value compared to chub mackerel
Mb at 60oC (Chen, 2003). On the other hand, yellowfin tuna (homeothermal warm
teleost) was the most stable at 37oC compared to mackerel species (eurythermal
warm teleost), Antartic teleost (stenothermal cold teleost), and zebrafish
(stenothermal tropical teleost) (Madden et al., 2004). Since no report is available
regarding PMD in tuna Mb, an attempt was made to investigate its denaturation
profiles taking PMD as a parameter.
It is considered that fish Mbs are quite unstable compared to mammalian
counterpart. In this section, PMD was compared in order to elucidate the
denaturation profile of tuna Mb.

51

Materials and methods

Materials
Purification of bluefin tuna Mb was carried out as previously described.
Horse Mb purchased from Sigma Chemicas (St. Louis, MA, USA) was used as a
control.

PMD
The thermostability of tuna and horse Mbs was determined by PMD
analysis according to Joseph et al. (2010b) with a little modifications. The
concentration of those Mbs was adjusted to 0.3-0.4 mg/ml. The pH was adjusted
to 5.6, 6.5, and 7.4 with 50 mM sodium citrate for pH 5.6 or 50 mM sodium
phosphate for pH 6.5 and 7.4. All the samples were incubated in the water bath at
70, 75, and 80oC for up to 1 h with specific time intervals. In addition, the
denaturation profiles at 55, 60, and 65oC at pH 6.5 were examined for tuna Mb.
The samples were cooled on ice immediately after incubation, followed by
centrifugation at 16000 x g (Sakuma M200-IVD, Tokyo, Japan) for 2 min. The
supernatants were used for the further analyses. Mb concentration was measured as
the cyanmet form using a Jasco V-630 Bio spectrophotometer at the absorbance of
540 nm. The measurement was performed in triplicate for each sample. PMD was
calculated using the following equation (Chen et al., 2004):
PMD = 100 x (Mbi Mbt)/Mbi
Where Mbi and Mbt represent the concentration of Mb before and after incubation,
respectively.

52

Denaturation rate of Mb
The denaturation rate was determined according to Chen et al. (2004) with
slight modifications. The rate constant (Kd) was calculated based on the following
equation:
Kd = (ln Mbi ln Mbt)/ t
Where Mbi and Mbt represent the concentrations of Mb before and after
incubation, respectively. Two phases of denaturation rate were determined,
namely, Kdf for fast denaturation stage and Kds for slow denaturation stage.

Measurement of Mb concentration
To one mL of the solution was added 0.5 mL of 25 mM potassium buffer
(pH 7), and after gentle mixing, 25 L of 5% NaNO3 was added, followed by
addition of 25 L of 1% KCN. After incubation the mixture at room temperature
for 1 min, the absorbance of the mixture was measured at 540 nm (Abs540). To
calculate the concentration of Mb, the molecular extinction coefficient (11300)
and the molecular weight (15628) were used based on the method of Chen and
Chow (2001) and Chow et al. (2009) with slight modifications.

53

Results

In order to elucidate the thermostability in correlation with the pH, tuna

and horse Mbs were dissolved in 50 mM sodium citrate for pH 5.6 and 50 mM
sodium phosphate buffer of pH 6.5 and 7.4. Figure 2-14 shows the changes in
PMD of tuna and horse Mbs at pH 5.6, 6.5, and 7.4, respectively, at 70, 75, and
80oC.
PMD of tuna Mb incubated at pH 5.6 increased dramatically at all
temperatures examined. The PMD values were 65.6, 93.5, and 95.3% after 10 min
at 70, 75, and 80oC, respectively. After 1 h of incubation, PMD increased to 88.5,
94.3, and 98.8 % at 70, 75, and 80oC, respectively, as shown in Fig. 2-14. For
horse Mb under the same pH, PMD value was only 13 % at 70oC after 1 h. The
PMD progressively increased at 75oC after 10 min, and then slowly increased to
48.4% after 1 h. At 80oC, PMD sharply increased to 74.9% and reached 88.6 %
after 1 h.
At pH 6.5, PMD of tuna Mb increased along with the incubation time. At
70oC, PMD reached 10.7% after 10 min and 52.1% after 1 h. However,
denaturation of tuna Mb greatly increased after 10 min for both temperatures 75
and 80oC. In these temperatures, the result roughly showed no different changes
of PMD until the end of the incubation time (Fig. 2-14). The PMD after 10 min
increased to 96.3 and 96.6% at 75 and 80oC, respectively. To further elucidate
the thermostability of tuna Mb, the incubation at 55, 60 and 65oC was carried out
as shown in Fig. 2-16. The denaturation proceeded at 55 and 60oC although PMD

54

value increased very slowly reaching less than 10%. At 65oC, PMD gradually
increased to 32.3% after 1 h of incubation.
Horse Mb showed their stability at pH 6.5 during incubation at 70 and 75oC.
At the end of incubation time, PMD was only 1.3 and 7.1%, respectively.
However, the value increased at 80oC from 26.6% to 54.2% after 10 min (Fig. 214).
The PMD of tuna Mb at pH 7.4 gradually increased after 10 min, from 31.7
% to 67.7% at 70oC. Moreover, at 75 and 80oC, tuna Mb was almost completely
denatured after 10 min of incubation. However, PMD of horse Mb hardly
increased at this pH. The PMD was 2.5% for both at 70 and 75oC, and 8% for
80oC after 1 h of incubation.
The natural logarithm of residual concentration of Mb was used to
determine the denaturation rate. The denaturation rate is categorized as two
phases, namely, fast (Kdf) and slow (Kds) denaturation stages (Chen et al., 2004).
Figure 2-15 shows the relationship between the natural logarithm of residual Mb
with pH and heating time. The results showed a biphasic first order reaction for
tuna Mb for all pH and temperatures examined except at 70oC at pH 6.5 or 7.4.
Under these conditions, denaturation of Horse Mb proceeded as a zero order. The
denaturation of horse Mb proceeded linearly at linear reaction at pH 5.6 at all
temperatures examined.
In the present section, fast denaturation proceeded from the beginning of
incubation for up to 10 min. Slow denaturation occurred during heating for 10-60
min. The higher the temperature of incubation at all pH examined, the higher the
Kdf as depicted in Table 2-2. The fast denaturation rate lowered at higher pH for

55

both tuna and horse Mbs in all the temperature examined, except at pH 6.5 at
70oC for tuna Mb. Kdf of tuna Mb at pH 6.5, and 70oC was lower than that at pH
7.4.
Since the denaturation rate proceeded linearly for horse Mb, Kds increased
as increasing temperature at all pH examined. In contrast, for tuna Mb, Kds
became low as increasing the temperature at all pH examined as shown in Table
2-3. In addition, Table 2-4 contains the Kdf and Kds values of tuna Mb at pH 6.5
at 55, 60, and 65oC. The Kdf values were similar to each other at 55 and 60oC.

56

Section 4
Disscusion

Isolation of tuna Mb
Purified Mb is essential for precise understanding of its characteristics. In
the present chapter, attempts were made for a stream-lined purification of tuna
Mb. For the quick purification of tuna Mb, combination of ammonium sulfate
fractionation and native gel electrophoresis was found to be successful.
Ammonium sulfate is effective for removing contaminating proteins.
Though preparative electrophoresis showed a relatively low resolution, proteins
except Mb are negatively charged under the electrophoretic condition and thus
moved toward the cathode. However, at the buffer pH very close to the isoelectric
point of Mb, Mb could not enter the gel. As a result, tuna Mb stayed at the surface
of the gel, as easily recognized by its characteristic red color as shown in Fig. 2-3.
By the application of the electrophoretic conditions, even fragile proteins such as
those participating in photosystems, ATP-dependent enzyme or active respiratory
supercomplexes could be separated (Seelert and Krause, 2008).
Isolation of proteins by preparative gel electrophoresis depends on their
differential migration (Margolis et al., 1995). By using the matrix such as agarose
or acrylamide gel, proteins can be separated from each other (Seelert and Krause,
2008). Purification of gliadin was found to be successful when applied to 7%
polyacrylamide gels at pH 3.1 (Rumbo et al., 1999). Previous research also
reported that myosin heavy chain isoform was isolated by preparative gel

57

electrophoresis, resulting in a sufficient high recovery for immunochemical and

biochemical studies (Sandri et al., 1999).
In this chapter, the native gel electrophoresis was also carried out to purify
tuna Mb directly without ammonium sulfate fractionation. Mb fraction prepared
without ammonium sulfate fractionation, contained the contaminating protein of
about 29 kDa. This protein showed the same isoelectric point with Mb on the 2DPAGE (data not shown), and was thus considered to be a Mb dimer. Therefore,
ammonium sulfate fractionation is essential to get rid of aggregated Mb.
The maximum absorption of tuna Mb derivatives matched with those
previously reported (Smulevich et al., 2006) except for the peak of oxyMb at 541
nm. The difference in the second peak of metMb was found between the eastern
little tuna Mb and bluefin tuna Mb (Thiansilakul et al., 2011) with the maximum
absorption at 630 nm. The extinction coefficient for the first peak of tuna oxyMb,
namely, maximum (at 541 nm) was higher than that of the second one (maximum at 577 nm). This result is in agreement with the previous report
(Viriyarattanasak et al., 2011).
Compared with tuna Mb, the maximum absorption of horse Mb shifted by
1 nm to the higher wavelength for all Mb derivatives except 4 nm for the second
peak of oxyMb at 581 nm (Table 2-1). This finding is in good agreement with the
previous report (Tang et al., 2004) regarding the maximum absorption spectra for
deoxy Mb and metMb of horse.

58

Autooxidation profiles of tuna Mb

It is well known that low pH accelerates the autooxidation of Mb (Brown
and Mebine, 1969). The lower stability of Mb corresponded to the high
autooxidation rate (Chow, 1991). The autooxidation rate of Mb at 0oC and 37oC
proceeded as a first order reaction as previous reported (Snyder and Ayres, 1961;
Brown and Dolev, 1963; Kitahara et al. 1990; Chen and Chow, 2001).
At 0oC, the autooxidation rate was found to be the highest at pH 5.6 for
both tuna and horse Mbs. The results showed that the stability of both tuna and
horse Mbs was the highest at pH 6.5, followed by at pH 7.4 and 5.6, respectively,
suggesting that the autooxidation rate is related with the low stability. The results
on the pH dependent Mb autooxidation agreed well with those of the previous
researches (Chow et al., 1985; 1987) in which Mb was purified by ammonium
sulfate fractionation followed by gel filtration. The highest value of free energy
for unfolding was found at around pH 6.5, suggesting the high stability of Mb at
this pH (Chow et al., 1989). The stability of the heme and the globin binding
decreases under acidic environment (Livingston and Brown, 1981). Exposure of
the heme to the medium seems to facilitate increasing of metMb ratio even at the
incubation temperature as low as 0oC. In addition, autooxidation rate was clearly
higher in tuna Mb than that of horse Mb at all pH values examined. Under neutral
and basic pH conditions, the structural stability of Mb was maintained by the
lower autooxidation rate at pH 6.5 and 7.4 for both Mbs.
Compared with horse Mb, the autooxidation rate of tuna Mb was higher at
all pH except at pH 7.4 at 37oC. The metMb increased rapidly and the highest
autooxidation rate was obtained at pH 5.6 for both tuna and horse Mbs, followed

59

by those at pH 6.5 and 7.4. In the present study, the autooxidation rate of Pacific
bluefin tuna Mb was calculated to be 0.071/h at pH 7.4, while Madden et al.
(2004) reported that of yellowfin tuna Mb was 0.088/h at pH 7.5. The stability of
the linkage between the heme and the globin decreases under acidic environment
so that the unstable regions will expose the heme to the medium, resulting in
increasing of metMb ratio. In addition, autooxidation rate was slightly higher for
tuna Mb than that of horse Mb at pH 5.6 and at pH 6.5. At pH 7.4, both tuna and
horse Mbs showed similar values of autooxidation rate. On the other hand,
yellowfin tuna (homeothermal warm teleost) Mb was reported to be the most
stable one among the four species examined, followed by those of zebrafish
(stenothermal tropical teleost), mackerel (eurythermal teleost), and Notothenia
coriiceps (stenothermal cold teleost) (Madden et al., 2004). However, the
autooxidation of tuna Mb proceeded even during quick freezing (Chow et al.,
1985). The metMb ratio was also found to increase during dialysis under
refrigeration in this study (data not shown). The most rapid autooxidation was
observed at pH 5.6, followed by pH 6.5 and 7.4 for tuna and horse Mbs. The
autooxidation caused the changes of color from vivid red to brown. OxyMb has
changed to metMb form with the prolonged time of incubation. The higher
incubation temperature accelerated the autooxidation rate.

Thermal denaturation of Mb
Protein denaturation occurs because of the disruption of bonding
interaction in either the secondary or tertiary structures without the change in the
primary structure. Many factors cause protein denaturation such as a high

60

temperature and pH.

DSC is a technique to observe the thermostability of

proteins based on the heat absorptions of its structure decomposition, while CD is

specifically used to measure the decomposition of secondary structure. PMD is a
method to investigate the protein denaturation based on the aggregation of protein
molecules. PMD technique thus help us to estimate apparent denaturation profiles
with heat treatments by simple procedures, although this method can not
specifically identify factor(s) causing the denaturation. In order to elucidate the
thermostability of tuna Mb, PMD of tuna Mb was measured compared to horse
Mb at pH 5.6, 6.5, and 7.4. These pH represent post mortem condition of horse
and tuna meat. These Mbs were denatured at 70, 75, and 80oC.
In the present chapter, both pH and temperature showed the effect on the
denaturation behavior of both tuna and horse Mbs. Mb was rapidly denatured at
all the temperature examined. Incubation at pH 5.6 for 10 min resulted in high
PMD value. Tuna Mb almost completely denatured at the end of incubation. On
the other hand, the stability of horse Mb was maintained at 70oC, while a slight
denaturation was found at 75oC. At 80oC, a progressive denaturation was obtained
as demonstrated by a high PMD during the initial incubation. This result suggests
that tuna Mb is more susceptible to thermal denaturation compared to that of
horse Mb.
PMD of tuna Mb at pH 6.5 showed a progressive increase along with the
incubation time at 70oC, reaching 52.1% at the end of incubation. However, at pH
6.5 at 70oC, tuna Mb was less stable than that of at pH 7.4. Similar results were
revealed by the previous researches (Chow et al., 1985; 1987). The presence of

61

sodium chloride increased the PMD and sodium tripolyphosphate lowered the
PMD (Trout, 1989).
Horse Mb showed its stability at pH 6.5 at 70 and 75oC even when the
temperature and incubation time were increased. In other words, horse Mb did
not suffer from thermal denaturation under present condition. Similar result was
observed at pH 7.4 at all the temperatures examined. The denaturation also
occurred at pH 5.6 suggesting that pH affected the thermostability of horse Mb.
The denaturation rates of tuna Mb at all pH and temperatures examined,
except at 70oC at pH 6.5 and 7.4, represented by the changes of natural logarithm
of residual concentration of Mb, showed a biphasic first order reaction. The
similar result was reported (Chen et al., 2004), where spotted shark Mb showed
the highest thermal stability followed by chub mackerel Mb and tilapia Mb. In
addition, a biphasic first order reaction was reported for swamp eel Mb
(Chotichayapong et al., 2012 ).
Previous studies revealed that the melting temperature, Tm

was the

highest in horse Mb compared to that of tuna Mbs as estimated by the result of

differential scanning calorimetry (DSC) (Ueki and Ochiai, 2004), indicating that
horse Mb is stable against high temperature than that of tuna Mb. The stability of
tuna Mb as measured by circular dichroism (CD) spectrometry showed the major
structural changes occured at around 58 and 72oC (Ochiai et al., 2010).
At all pH and temperatures examined, horse Mb showed its stability against
heat-induced denaturation compared to that of tuna Mb. It may be because of the
differencies in their primary structures. Tuna Mb is shorter than horse Mb by 6-7
amino acids. In addition, mammalian Mbs contain eight -helical segments,

62

namely A through H, while fish Mbs consist of seven -helical segments. The Dhelix is absent in fish Mbs and replaced by a random coil (Birnbaum et al., 1994).
With these characteristics, horse Mb may be protected from thermal denaturation.

63

Summary

The method consisting of ammonium sulfate fractionation and preparative

gel electrophoresis could obtain tuna Mb of high purity. This method can be
applied to isolate Mbs from other species only by adjusting the buffer pH closer to
the isoelectric point of respective Mbs. The highest autooxidation rate of tuna Mb
was obtained at pH 5.6, followed by at pH 7.4 and 6.5 at 0oC for up to 7 days.
However, at 37oC for up to 3.5 h, the highest autooxidation was obtained at pH
5.6, followed by at pH 6.5 and 7.4. The autooxidation rate of tuna Mb was clearly
higher than that of horse Mb at all pH examined. In addition, PMD of tuna Mb
was higher than that of horse Mb at all pH and temperatures examined. These
results revealed that tuna Mb was much more unstable than horse Mb especially
under acidic pH.

64

Chapter 3
Commercial quality evaluation of yellowfin tuna Thunnus
albacares meat and its myoglobin characteristic

Seven species of tunas are consumed around the world. Yellowfin tuna
Thunnus albacores, whose meat is characterized by light red color and less fat, is
one of the most commercially important and favored tuna. This scombridae
species inhabit the tropical and subtropical waters around the world. Therefore,
this species is generally exported to Japan from tropical countries, such as
Indonesia, Taiwan, and so on. Yellowfin tuna is the largest exported tuna in
Indonesia, where Japan and USA are the main market countries (MMAF, 2012).
A quality check is frequently performed before processing and transportation.
Sensory analyses performed by experienced appraisers are generally carried out to
determine the freshness as a composite of qualitative traits. Sensory analysis, the
method using human senses for color, appearance, taste, and odor, is an important
tools in food industry. Color is one of the most important factors affecting
consumers preference. The meat color of tuna is closely related with Mb content
and the red/ox state of the heme iron.
Many factors, such as catching method, slaughter technique, handling, and
storage condition influence tuna meat quality. The initial processing step of fish
affects postmortem biochemical changes and various quality parameters. Post
mortem glycolysis in anaerobic condition occurs at the point of death where there
is no supply of oxygen to the muscle tissue. In this condition, pyruvate will be
converted to the lactic acid. The ultimate pH will contribute to the fish quality.

65

Many attempts have been made to investigate the quality of fish and meat
(Chow et al., 1985, 2009; Trout, 1989; Chen and Chow, 2001; Duran et al., 2008;
Faustman, 2010; Imamura et al., 2012). However, the reliability of quality ranking
determined by sensory evaluation has not yet been well documented to date. Thus,
the objective in this chapter was to investigate the relationship among sensory
evaluation grade, Mb concentration, Mb derivatives ratio based on the red/ox state
and color value of yellowfin tuna meat. The SDS-PAGE pattern of this water
soluble fraction was also examined to monitor the degradation of meat quality.

66

Section 1
Myoglobin derivatives of yellowfin tuna

As described in the general introduction that three forms of Mb exist in the

meat based on its chemical state, namely deoxyMb, oxyMb, and metMb. The
iron state in the heme pocket contributes to the color of meat. In this section, the
measurement of Mb derivatives was performed to investigate the relationship
between commercial quality evaluation on yellowfin tuna grades determined by
the professional appraiser and its Mb derivatives properties.

Materials and methods

Materials
40 specimens of yellowfin tuna fast muscle were obtained from Nutrindo
Freshfood International Co. in Sulawesi, Indonesia. All the chemicals used in this
study were of reagent grade purchased through Wako Co., Otsu, Japan.

Sample preparation
Fresh yellowfin tuna specimens caught with a long line fishery in the
Celebes Sea and landed on the Port of Bitung, Sulawesi, Indonesia, in August of
2009 were obtained. Samples were ranked into four categories by sensory
evaluation (mostly according to appearance, odor, and finger touch) of the
professional qualified appraiser belonging to a tuna meat processing company

67

(Nutrindo Fihery Co.); namely, excellent, good, acceptable, and not acceptable,
the basic grading for Japanese and US markets (Fig. 3-1). Ten different
individuals were obtained for each group. The meat (fast skeletal or white muscle)
was sampled from the dorsal part of fish, wrapped in polyethylene film and
immediately transported on ice to our laboratory (by way of a jet plane within one
day). Samples were stored at -80oC until used for experiment.

Determination of myoglobin derivatives

The following procedures were carried out at 0-4oC unless otherwise
stated. The meat slices samples were homogenized with 7 volumes of ice cold
water under moderate speed using polytron homogenizer (model PT 10-35,
Kinematica AG, Littau, Switzerland). The supernatants obtained by centrifugation
at 3000 x g for 15 min were filtered through a filter paper (No.2, Advantec Co.,
Tokyo, Japan), and subsequently filtered through a cartridge filter (poresize, 0.20
m RC 15 Sartorius, Goettingen, Germany). Visible spectra were measured in the
range of 380 to 780 nm using a spectrophotometer (V-630 Bio, Jasco, Tokyo,
Japan). The ratio of Mb derivatives (deoxyMb, oxyMb and metMb) was
calculated based on the absorbance between 380 and 780 nm (Tang et al., 2004).
The measurement was performed in triplicate for all sample in each grade.

Statistical analysis
JMP 7.0.2 (SAS Institute, Cary, NC, USA) was used for all the statistical
analysis. Experimental results were provided as mean values with standard
deviations. The data were analyzed using one way analysis of variance

68

(ANOVA). Differences among the different grades of tuna meat were analyzed
by Tukey-Kramer test (Steel and Torrie, 1988) and statistical significance was
determined at P < 0.01 and P< 0.05 levels.

69

Results

Sample preparation
As shown in Fig. 3-1, high quality meat is featured by its vivid red color.
With the deterioration proceeding, the redness was weakened and the whitish
color was gradually expressed. The lower grade meat gave fishy odor (data not
shown).

Myoglobin derivatives ratio

In this study, the relation between quality and Mb derivatives of yellowfin
tuna meat was investigated. The deterioration of meats is partly induced by
metMb formation resulting in browning of the meat. The ratio of Mb derivatives,
namely,

deoxyMb,

oxyMb,

and

metMb

was

determined

based

on

spectrophotometric absorption of the meat extract. The grade of meat was

significantly correlated with metMb ratio (%) (Fig. 3-2a), i.e., the value was the
lowest in the excellent grade meat, and gradually increased as the grade of meat
decreased. The metMb ratio for excellent grade was 18.2% followed by 38.3, 45,
and 65% for good, acceptable, and not acceptable grades, respectively. From
these results, it is very clear that the discoloration was the most pronounced in the
D sample. However, the values for the good and acceptable grades were similar to
each other with no significant difference between them.
The oxyMb ratio was inversely related with metMb ratio (Fig. 3-2b). Both
metMb and oxyMb ratios could be good parameters indicative of the quality of
tuna meat. As far as the deoxyMb ratio is concerned, no significant correlation
70

with the meat quality was recognized except for excellent and not acceptable
meat (Fig. 3-2c).

71

Section 2
Electrophoretic analysis and the concentration of yellowfin tuna
myoglobin

It is well known that some factors affect the protein degradation and
decomposition with lowering the fish quality. Stagg et al. (2012) observed protein
degradation triggered by acidification and high temperature in the muscle of
skipjack Katsuwonus pelamis.
On the other hand, the Mb content varies depend on the muscle position,
age, species, and body weight. Mb content also increased with the growth in
dorsal ordinary muscle (DOM) of cultured Pacific bluefin tuna (Nakamura et al.,
2007).
In this section, the electrophoresis of water soluble extract was performed
to understand the protein degradation by SDS-PAGE patterns in the grades of
yellowfin tuna. In addition, Mb content of yellowfin tuna fast muscle with
different grades was also determined.

Electrophoresis analysis
SDS-polyacrylamide gel electrophoresis (SDS-PAGE) was carried out on
the water soluble fraction basically according to Laemmli (1970). The
polyacrylamide slab gel was performed by using a 15 % polyacrylamide gel as
described in Chapter 2. After the run, the gel was stained with Coomassie Brilliant
Blue (CBB) R-250.

72

Measurement of myoglobin content

The water soluble fraction prepared as describe above was used for the
measurement of Mb derivatives ratio. Measurement of Mb concentration was
carried out as described in Chapter 2.

Statistical analysis
Statistical analysis was carried out for Mb concentration of yellowfin tuna
Mb as described in Section 1.

73

Results

SDS-PAGE patterns
Figure 3-3 shows the SDS-PAGE patterns of the water soluble fraction of
yellowfin tuna meat of different quality grades. The molecular weight of
yellowfin tuna Mb is ~ 15600. Thus Mb band was recognized for all the grades.
This band is highlighted in the figure as Mb with an arrow. Irrespective of the
quality grade, the protein fraction showed similar electrophoretic patterns, except
for the densities of the bands X and Y indicated in the figure. The band X, which
is considered to be a decomposed protein, was present except in the excellent
grade meat.
In addition, the density of the band Y of about 40000 was clearly low in
the not acceptable grade meat. In this grade, there were also other bands of
lower staining intensities compared to those of higher grade meat. This seems to
be the result of protein denaturation in the low quality meat. It was concluded that
the meat of excellent and not acceptable quality grade are clearly
distinguishable from each other.

The concentration of myoglobin

In the present study, the grade of yellowfin tuna significantly affected
concentration of Mb as shown in Fig. 3-4. The excellent sample was significantly
higher than other grades (P<0.05). The Mb concentration was 219.8, 145.7, 133.2,
and 90.6 mg/100 g for excellent, good, acceptable, and not acceptable grades,
respectively. The lowest value was found in the not acceptable grade, while no
74

significant difference was obtained between good and acceptable grades. The Mb
concentration gradually decreased as the meat grade lowered. The absolute
contents of oxyMb calculated based on the data of Figs. 2 and 7 were 157 26.5,
63.7 11.5, 50.6 8.0 and 22.6 5.5 mg/100g for the excellent, good, acceptable
and not acceptable meats, respectively. The values seem to well demonstrate the
quality of each grade quantitatively.

75

Section 3
Color of yellowfin tuna meat

Since Mb abundantly found in both fast and slow skeletal muscle of tuna
fish, color is one of the important attributes affecting its appereance especially
when it serves for raw fish such as sashimi and sushi. The instrument for color
evaluation provides rapid technique with high accuracy that enables the analyst
to obtain a series of parameters in a few seconds, and the best one to estimate the
lycopene concentration in tomato was the L*, a* and b* values of tomato juice
measured with Hunter colorimeters (Fernandez-Ruiz et al., 2010). The L*, a* and
b* values were also used for fishery product to determine its freshness (Ochiai et
al., 1988; Chen and Chow, 2000; Imamura et al., 2012).
Therefore, the relationship between the quality ranking and the color
parameters was carried out for yellowfin tuna. The objective of this section was to
assess the reliability of the sensory evaluation for tuna meat of different quality
grades with special reference to the color reference.
In this section also determined is the correlation between redness value
and metMb ratio as well as redness index and metMb ratio. Finally to get more
understanding, the correlation between redness value and Mb concentration is also
determined.

76

Materials and methods

Materials
The dorsal of yellowfin tuna meat was used as described in Section 1.

Sample preparation
40 samples of yellowfin fast muscle tuna is used as aforementioned. Just
before the experiment, the meat (in polyvinyl chloride bag) was thawed in tap
water and immediately subjected to the following analyses.

Meat color
The color of the sample meat slices was measured with a colorimeter
(NF333, Nippon Denshoku Co., Tokyo, Japan). The tristimulus (L*, a*, and b*)
values (Hunt, 1977) were measured in triplicate for all sample in each grade. The
redness index (a*/b*) was also adopted to evaluate the meat color according to
Chen et al. (1997). The correlation between metMb ratio with a* and metMb ratio
with a*/b* were examined as described by Ochiai et al. (1988). In this section
also is determined the correlation between redness value and Mb concentration to
further understand the color tones and concentration of Mb.

Statistical analysis
Statistical analysis was carried out as described in Section 1. The
coefficient correlation was determined by Excel software.

77

Results

Meat color
The L*, a* and b* values of tuna meat of the different quality grade are
shown in Fig. 3-5. The L* did not differ significantly between the different meat
quality grades (Fig. 3-5a). The values were around 30 with no significant
differences, and therefore, did not reflect the meat quality. On the other hand, the
a* values tended to be smaller in the lower grades of meat (Fig. 3-5b). The values
were significantly different (P<0.05) among any combinations of the quality
grades. The result is quite reasonable, since the value is roughly proportional to
the optical impression of meat redness (Fig. 3-1).
Next, the redness index (a*/b*) was calculated using the data in Fig. 3-5.
The values were found to be significantly different among the different meat
quality grades (Fig. 3-6). Even between the B and C meat grades, significant
difference (P<0.05) was observed.
The correlations of the a* value and redness index against metMb ratio
(%) value are shown in Fig. 3-7. The correlation coefficients were -0.999 and 0.997 for a* and and redness index against metMb ratio, respectively. These
results are quite similar to the previous reports on fish Mb (Chow et al., 1988;
Ochiai et al., 1988; Chen and Chow, 2001). From Fig. 3-7a and b, the formula
were induced as follows :
MetMb (%) = -6.1 x (a* value) + 76.6
MetMb (%) = -54.3 x (Redness index value) + 83.2

78

To further examine the Mb charactersistic, the correlation between redness

value and Mb concentration was calculated. As a result the strong correlation was
obtained. This correlation coefficient was -0.990 (Fig. 3-8). From this figure the
formula was induced as follows :
Concentration/extractability (mg/100g) = -16.6 x (a value) + 242.6

79

Section 4
Discussion

The samples were stored at -80oC until used for experiment. The samples
frozen at ultra low temperature (-70oC) preserve biological sample for long term
(Tedeschi and De Paoli, 2011). In addition, the low temperature (-80C) kept good
quality without lipid oxidation in whole and fillet fish of horse mackerel during 12
mo (Aubourg et al., 2004).
OxyMb loses an electron in ferrous state to ferric iron, namely the
autooxidation, causes color browning which is quite an undesirable event for
consumers. Therefore, maintenance of the bright red meat color representing
freshness, occurs mainly through managing the red/ox state of an iron atom by
reducing Mb autooxidation rate. In this section, metMb ratio of the excellent
grade tuna meat was approximately 18 %, suggesting this meat grade was very
fresh. The value is comparable to that of bigeye tuna Thunnus obesus meat frozen
by air-blast freezing at -70oC for 48 h and stored at -55oC was reported to be 2025% (Imamura et al., 2012). These results thus suggested that the composition of
Mb derivatives should reflect the freshness of yellowfin tuna.
DeoxyMb, a predominant purplish-red pigment having no bound oxygen,
presents as a native pigment in anaerobic live muscle (Faustman and Cassens,
1990). This might cause the unstable in its structure and found in the low
concentration as shown in Fig. 3-2c. Oxygen binds to the sixth coordination site
of ferrous heme in deoxyMb form appearing in bright red color on the surface of
the meat.

80

The significant differences in Mb derivatives ratio could have been due to

differences in the freshness of fish. Namely, in the case of a long-line fishing, the
time required for harvesting fish on board the ships greatly differs, because there
are so many hooks on the line. Some fish are harvested alive, while others are
dead in the warm sea water for a long time. For this reason, it is impossible to
harvest fish of similar freshness using this fishing method. The ranking of fish
quality before shipping is thus very important. The catching methods contributed
to the fish quality (Borderias and Sanchez-Alonso, 2011).
As described above, tuna meat quality deteriorates under sub-optimal
storage conditions. In the case of yellowfin tuna, low quality meat is considered to
have resulted from prolonged incubation of the body in the warm sea water after
death. Body temperature of tuna fish is considered to be maintained at higher
temperature than that of ambient sea water (Carey and Teal, 1966). Muscle pH is
also considered to go down in postmortem tuna meat (Roy et al., 2012). Tuna Mb
is quite unstable at high temperature range and under low pH (Chow et al., 1989).
Preincubation of purified tuna Mb at 40oC and pH 6 resulted in its structural decay
(Ochiai, 2011), suggesting that Mb in yellowfin tuna meat was denatured.
The X band was not found in the A samples suggesting that this band can
be used as a parameter of deterioration. In addition, only the D sample contained a
thin band of Y suggesting this band can also be used as an indicator for
progressively deteriorating meat. It is known that low pH and high temperature
induce the protein oxidation decreasing its solubility. Protein solubility of breast
meat in broilers decreased after heat exposure increasing the oxidation of
sarcoplasmic and myofibrillar proteins from pectoralis majors of broiler chickens

81

to different extents (Wang et al., 2009). Protein degradation was observed on

skipjack tuna at pH 5 (Stagg et al., 2012). Thus in the study, the X band is
considered as the result of protein decomposition.
The density of the Y band was found clearly low in the not acceptable
grade meat. This finding suggested that the protein of water soluble fraction
denatured in the low quality meat. In the case of bluefin tuna Thunnus orientalis,
the protein band around 40 - 50 kDa, which is considered to be creatine kinase,
decreased in the low quality meat (Ochiai, 2011). Creatine kinase has already
been characterized as an indicator of physical stress and muscle damage in
livestock animal production (Daroit and Brandelli, 2008).
The extractability of Mb concentration was reduced in lower grade meat.
The lower is the grade of meat, the lower is the Mb concentration of the extract.
The concentration should be very similar in a given species (Brown, 2006).
Therefore, it is likely that Mb was partially denatured and such denatured Mb was
insolubilized in a larger extent in the meat of the lower grade.
It was concluded that the a* value is an excellent parameter to distinguish
the quality of meat. In the case of b* value, there was almost no significant
difference between the meat of different quality grade (Fig. 3-5c). Previous
studies on bluefin tuna meat disclosed that Mb oxidation resulted in increase of L*
and decrease a* values (Chow et al., 1990, Chen and Chow, 2001). This
discrepancy might have been caused by the lower Mb content in yellowfin tuna
meat. As the ratio of oxyMb, the redness decreased with lowering the grades of
ordinary muscle, indicating oxyMb ratio roughly matched with the redness values.

82

The decreases in a* value coincided with the metMb formation on the surface of
yellowfin tuna meat.
Since the strong correlation of the a* value as well as redness index
against metMb ratio (%), this parameters can be used as an indicator the freshness
of tuna meat. Moreover the high value of correlation coefficient between the Mb
concentration and redness value suggested that the redness value impacted to its
concentration.

83

Summary
The quality of yellowfin tuna as evaluated using sensory tests by the
professional appraiser was found to be quite reliable based on the results of Mb
derivatives ratio, Mb concentration, electrophoretic patterns of water soluble
protein fraction, and color measurement. It follows that even untrained person can
judge the meat quality grade by using these methods. Meanwhile, it is very
important to establish how the high quality of meat can be maintained. First of all,
the method of harvesting fish should be improved, while handling, storage and
transportation conditions are require reconsideration.

84

Chapter 4
General discussion

Seven species of tuna, namely, skipjack tuna Katsuwonus pelamis,

albacore T. alalunga, yellowfin tuna T. albacares, southern bluefin tuna T.
maccoyii, bigeye tuna T. obesus, Pacific bluefin tuna T. orientalis, and Atlantic
bluefin tuna T. thynnus were known as international economic fish for industry
(sustainablefish.org, 2012).
Mb responsible for giving rise to meat coloration, is found abundantly
both in slow and fast muscles of tuna. Fish Mb is less stable compared to that of
mammalian causing the rapid discoloration in the meat. To unveil the molecular
mechanism of discoloration in tuna meat, several attempts were made in this
study.
First of all, the full length nucleotide sequence of cDNA encoding
southern bluefin tuna Mb was elucidated. The complete sequence of T. maccoyii
Mb cDNA contained 776 nucleotides, with an open reading frame consisting of
444 nucleotides encoding 147 amino acids. The primary structure has been
submitted to DDBJ/EMBL/GenBank databases with the accession number of
AB592346.
The sequence identity of Mbs with T. maccyii Mb were in a wide range of
21-100% (Table 1-2). The value was relatively high among scombridae fish Mbs
(82-100%). The nucleotide sequence of the coding region of this Mb was identical
to those of the other bluefin tuna species, thus giving the same amino acid

85

sequence. It is thus suggested that Mbs from these bluefin tuna species share the
same structural and functional properties.
In order to understand the stability of tuna Mb, an attempt has been made
to elucidate the autooxidation under several pH and temperature conditions. The
dark muscle of Pacific bluefin tuna was used to prepare for further experiment.
Previous study on three species of tilapia and one hybrid, namely, Oreochromis
niloticus, O. aureus, O. mossambicus, and the hybrid tilapia whose Mbs have the
same amino acid sequences, showed similar autooxidation rate among them
(Chow et al., 2009).
Purified Mb is essential for understanding the biochemical, molecular, and
biological properties precisely. Because the chromatography techniques are too
time consuming to be used routinely for large scale purification, the fast and
simple method of isolation was developed by combining ammonium sulfate
fractionation and native gel electrophoresis. The results obtained clearly showed
that this method can provide tuna Mb of high purity. This method can be applied
to isolate Mbs from other species only by adjusting the buffer pH closer to the
isoelectric point of respective Mbs.
The derivatives of purified tuna and horse Mbs (0.3-0.4 mg/ml) were
prepared by the addition of sodium hydrosulfite for deoxyMb, and followed by
dialysis for oxyMb. MetMb was obtained after addition of the potassium
ferricyanide in 50 mM sodium phosphate buffer (pH 7.4). The absorption spectra
were measured in the range of 475 to 675 nm (Fig. 2-6). As shown in Table 2-1,
the result of maximum absorption of Mb derivatives from tuna is consistently
reported previously (Smulevich et al., 2006) except for the first peak of oxyMb.

86

In addition, the extinction coefficient of maximum absorption namely,

maximum (at 541 nm) of tuna oxyMb was higher than that of -maximum (577
nm) while -maximum was higher than that of maximum in case of horse Mb.
This result is in agreement with the previous report (Viriyarattanasak et al., 2011).
In order to observe the autooxidation profiles, the effect of pH and
temperature were examined in the purified tuna Mb at pH 5.6, 6.5, and 7.4 at 0
and 37oC. Horse Mb was used as a control. At 0oC, the highest autooxidation rate
was observed at pH 5.6, followed by those at pH 7.4 and 6.5 for both tuna and
horse Mbs as shown in Fig. 2-10. In other words, the results showed that both tuna
and horse Mbs were stable at pH 6.5 followed by at pH 7.4 and 5.6, respectively.
It is suggested that the autoxidation rate is related with the low stability. Under the
incubation condition, the results obtained agreed well with those of the previous
researches (Chow et al., 1985; 1987). Compared to horse Mb, autooxidation rates
of tuna Mb were found to be higher at all pH examined.
The pH dependency at 37oC showed a different profile compared with that
at 0oC. At 37oC the highest autooxidation rate of both tuna and horse Mbs was
obtained at pH 5.6 followed by at pH 6.5 and 7.4. In this connection, the
autooxidation rate increased with decreasing pH in a range of 5.5-7.0 (Chen and
Chow, 2001). Interestingly, the autooxidation rate of tuna and horse Mbs showed
similar values at pH 7.4 as shown in Fig. 2-13.
pH and temperature affected to the denaturation behavior of both tuna
and horse Mbs as shown by the changes in PMD value (Fig. 2-14).
Thermostability determined by PMD was observed at pH 5.6, 6.5, 7.4 at 70, 75,
80oC for both purified tuna and horse Mbs. At pH 6.5, the denaturation proceeded

87

at 55 and 60oC, although PMD values increased very slowly reaching less than
10%. From this results, horse Mb was thought to be very stable at all pH and
temperatures examined. Future differential scanning calorimetry (DSC) and
circular dichroism (CD) analyses will supply the supplemental information for
understanding the denaturation mechanisms of Mbs. Furthermore, point mutation
studies using recombinant tuna Mb would provide more information regarding its
stability. In addition, the effect of lipid oxidation might give useful information
for characteristics of Mb.
In order to understand the molecular mechanisms involved in the
postmortem quality deterioration of red colored meat, it would be of great help to
characterize the properties of Mb. Thus, the relationship of Mb derivatives with
the quality of meat was examined in yellowfin tuna meat. The quality ranking of
yellowfin tuna meat as determined by sensory tests by a professional appraiser
was found to be quite reliable based on the results of Mb derivatives ratio, color
measurement, Mb extractability, and SDS-PAGE patterns of water soluble protein
fraction. It follows that even untrained person can judge the meat quality grade by
using these methods. Meanwhile, it is very important to establish how the high
quality of meat can be maintained. First of all, the method of harvesting fish
should be improved, while handling, storage and transportation conditions are also
required to be reconsidered. Further analyses on the relationships between tuna
Mb structures and their stabilities will provide us the way to control tuna meat
quality.

88

References

Aubourg SP, Pineiro C, Gonzalez MZ (2004)

Quality loss related to

rancidity development during horse mackerel (Trachurus trachurus)

frozen storage. J of the American Oil Chemists' Society, 81:671-678
Alderton AL, Faustman C, Liebler DC, Hill DW (2003) Induction of redox
instability of bovine myoglobin by adduction with 4-hydroxy-2nonenal. Am Chem Soc, 42:4398-4405
Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W,
Lipman DJ (1997) Gapped BLAST and PSI-BLAST: a new generation
of protein database search programs. Nucleic Acids Res, 25:3389-3402
Birnbaum GI, Evans SV, Przybylska M, Rose DR (1994) 1.70 resolution
structure of myoglobin from yellowfin tuna. An example of a
myoglobin lacking the D helix. Acta Cryst D, 50:283-289
Brill R (1994) A review of temperature and oxygen tolerance studies of
tunas pertinent to fisheries oceanography, movements models and
stock assessments. Fish Oceanogr, 3 (3):204-216
Borderias AJ, Sanchez-Alonso I (2011) First processing steps and the
quality of wild and farmed fish. J Food Sci, 76:R1-R5
Brown WD, Dolev A (1963) Autoxidation of beef and tuna oxymyoglobin. J
Food Sci, 28:207-210
Brown WD, Mebine LB (1969) Autoxidation of oxymyoglobins. J Biol
Chem, 244:6696-6701

89

Brown, WD (2006) The concentration of myoglobin and hemoglobin in tuna

flesh. J Food Sci, 27:26-28
Carey, FG, Teal JM (1966). Heat conservation in tuna fish muscle. Proc Nat
Acad. Sci. USA, 56:1464-1469
Chaijan M (2007) Lipid and myoglobin oxidations in muscle foods.
Songklanakarin J Sci Technol, 30(1):47-53
Chajian M, Benjakul S, Visessanguan W, Lee S,

Faustman C (2008).

Interaction of fish myoglobin and myofibrillar proteins. J Food Sci,

73: 292-298
Chaijan M, Panipat W (2009) Post harvest discoloration of dark-fleshed fish
muscle: a review. Walailak J Sci Tech, 6(2):149-166
Chen HH, Chiu EM, Huang JR (1997). Color and gel forming properties of
horse mackerel (Trachurus japonicus) as related to washing
conditions. J Food Sci, 62:985-991
Chen WL, Chow CJ (2001) Studies on the physicochemical properties of
milkfish myoglobin. J Food Biochem, 25:157-174
Chen HH. 2003. Effect of cold storage on the stability of chub and horse
mackerel myoglobins. Food Sci, 68:1416-1419
Chen L, Lin S, Chen HH (2004) Thermal stability and denaturation rate of
myoglobin from various species of fish. Fish Sci, 70:293-298
Chotichayapong C, Wiengsamut K, Chanthai S, Sattayasai N, Tamiya T,
Kanzawa N, Tsuchiya T (2012) Isolation of heat-tolerant myoglobin
from Asian swamp eel Monopterus albus. Fish Physiol Biochem, doi:
10.1007/s10695-012-9644-y

90

Chow CJ, Ochiai Y, Hashimoto K (1985) Effect of freezing and thawing on

the autoxidation of bluefin tuna myoglobin. Bull Japan Soc Sci Fish,
51(12):2073-2078
Chow CJ, Ochiai Y, Watabe S, Hashimoto K (1987) Autoxidation of bluefin
tuna myoglobin associated with freezing and thawing. J Food Sci,
52:589-591
Chow CJ, Ochiai Y, Watabe S, Hashimoto K (1988) Effect of freezing and
thawing on the discoloration of tuna meat. Bull Japan Soc Sci Fish, 54:
639-648
Chow CJ, Ochiai Y, Watabe S, Hashimoto K (1989) Reduced stability and
accelerated

autoxidation of tuna myoglobin in association with

freezing and thawing. J Agric Food Chem, 37:1391-1395

Chow CJ, Chu YJ, Wang LC (1990) Comparison of heme pigment
extraction from tuna and round herring. The Proceedings of The
Second Asian Fisheries Forum, pp. 877-880. Asian Fisheries Society,
Manila, Philippines
Chow CJ (1991) Relationship between the stability and autooxidation rate of
myoglobin. J Agric Food Chem, 39:22-26
Chow CJ, Ochiai Y, Watabe S (2004) Effect of frozen temperature on
autoxidation and aggregation of bluefin tuna myoglobin in solution. J
Food Biochem, 28:123-134
Chow CJ, Yang JI, Lee PF, Ochiai Y (2009) Effect of acid and alkaline
pretreatment on the discoloration rates of dark muscle and myoglobin

91

extract of skinned tilapia fillet during iced storage. Fish Sci, 75:14811488
Chow CJ, Wu JC, Lee PF, Ochiai Y (2009) Structural and autooxidation
profiles of myoglobin from three species and one hybrid of tilapia
(Cichlidae, Perciformes). Comp Biol Physiol, 154:274-281
Cossins AR, Berenbrink M (2008)

Myoglobin's new clothes.

Nature,

454:416417
Daroit DJ, Brandelli A (2008) Implications of skeletal muscle creatine
kinase to meat quality. J Animal Feed Sci, 17:285-294
Duran A, Erdemli U, Karakaya, M, Yilmaz MT (2008) Effects of slaughter
methods on physical, biochemical and microbiological quality of
rainbow trout Oncorhynchus mykiss and mirror carp Cyprinus carpio
filleted in pre-, in- or post-rigor periods. Fish Sci, 74:1146-1156
Faustman C, Cassens RG (1990) The biochemical basis for discoloration in
fresh meat : a review. J Muscle Foods, 1:217-243
Faustman C, Liebler DC, nMcClure TD, Sun Q (1999) ,-Unsaturated
Aldehydes accelerate oxymyoglobin oxidation. J Agric Food Chem,
47:3140-3144
Faustman C, Sun Q, Mancini R, Suman SP (2010) Myoglobin and lipid
oxidation interactions: mechanistic bases and control. Meat Sci, 86:8694
Fernandez-Ruiz V, Torrecilla JS, Camara M, Mata MCS, Shoemaker C
(2010) Radial basis network analysis of color parameters to estimate
lycopene content on tomato fruits. Talanta, 83:9-13

92

Figueiredo KCS, Ferraz HC, Borges CP, Alves TLM (2009) Structural
stability of myoglobin in organic media. Protein J, 28:224-232
Flogel U, Fago A, Rassaf T (2010) Keeping the heart in balance: the
functional interactions of myoglobin with nitrogen oxides. J Exp Biol,
213:2726-2733
Fraser J, de Mello LV, Ward D, Rees HH, Williams DR, Fang YC, Brass A,
Gracey AY, Cossins AR (2006) Hypoxia-inducible myoglobin
expression in nonmuscle tissues. Proc Natl Acad Sci USA, 103:29772981
George I, Makhatadze (2001) Measuring protein thermostability by
differential scanning calorimetry. Current Protocols in Protein
Science.Unit 7.9. doi: 0.1002/0471140864.ps0709s12
Gill P, Moghadam TT, Ranjbar B (2010) Differential scanning calorimetry
techniques: applications in biology and nanoscience. J Biomol Tech,
21(4):167-193
Graham JB, Dickson

KA (2001)

Anatomical and physiological

specializations for endothermy. In Tuna: Physiology, Ecology and

Evolution, Fish physiology, vol. 19 (ed. B. A. Block and E. D.
Stevens), pp. 121-165. San Diego: Academic Press
Gutzke D, Trout GR (2002) Temperature and pH dependence of the
autoxidation rate of bovine, ovine, porcine, and corvine oxymyoglobin
isolated from three different muscles-longissimus dorsi, gluteus
medius, and biceps femoris. J Agric Food Chem, 50:2673-2678

93

Helbo S, Dewilde S, William DR, Berghmans H, Berenbrink M, Cossin AR,

Fago A (2012) Functional differentiation of myoglobin isoform in the
hypoxia-tolerant carp indicates tissue-specific protective roles. Am J.
Physiol Regul Integr Comp Physiol, 302:R693-701
Hunt RWG (1977) The specification of colour appearance. 1. Concept and
terms. Color Res Appl, 2:55-68
Imamura S, Suzuki M, Okazaki E, Murata Y, Kimura M, Kimiya T,
Hiraoka Y (2012) Prevention of thaw-rigor during frozen storage of
bigeye tuna Thunnus obesus and meat quality evaluation. Fish Sci, 78:
177-185
Joseph P, Suman SP, Li S, Beach CM, Claus JR
spectrometric

characterization

and

(2010a) Mass

thermostability

of

turkey

myoglobin. J Food Sci and Technol, 43:273-278

Joseph P, Suman SP, Li S, Beach CM, Steinke L, Fontaine, M (2010b)
Characterization of bison (Bison bison) myoglobin. J Meat Science,
84:71-78
Joseph P, Suman SP, Li S, Fontaine M, Steinke L (2012) Amino acid
sequence

of

myoglobin

from

white-tailed

deer

(Odocoileus

virginianus). Meat Sci, 92:160-163

Kelly SM, Price NC (2006) Circular dichroism to study protein interactions.
Current

Protocols

in

Protein

Science.

Unit

20.10.

doi:

10.1002/0471140864.ps2010s46
Kendrew JC, Dickerson RE, Stranberg BE, Hart RG, Davies DR. Phillips
DC, Shore VC (1960) Structure of myoglobin. Nature, 185:422-427

94

Kitahara Y, Matsuoka A, Kobayashi N, Shikama K (1990) Autoxidation of

myoglobin from bigeye tuna fish (Thunnus obesus). Biochem Biophys
Acta, 1038:23-28
Kimiya T, Hiraoka Y (2012) Prevention of thaw-rigor during frozen storage
of bigeye tuna Thunnus obesus and meat quality evaluation. Fish Sci,
78:177-185
Kyte J, Doolittle R (1982) A simple method for displaying the hydropathic
character of a protein. J Mol Biol, 157:105-132
Laemmli UK (1970) Cleavage of structural proteins during assembly of the
head of bacteriophage T4. Nature, 227:680-685
Lee S, Joo ST, Alderton AL, Hill DW, Faustman C (2003) Oxymyoglobin
and lipid oxidation in yellowfin tuna (Thunnus albacores) loins. J
Food Sci, 68:1664-1668
Livingston DJ, Brown WD (1981) The chemistry of myoglobin and its
reactions. J Food Technol, 35:244-252
Livingston DJ, Lamar GN, Brown WD (1983) Myoglobin diffusion in
bovine heart muscle. Science, 220:71-73
Madden PW, Babcock MJ, Vayda ME, Cashon RE (2004) Structural and
kinetic characterization of myoglobins from eurythermal and
stenothermal fish species. Comp Biochem Physiol, 137B:341-350
MMAF (Ministry of Marine Affairs and Fisheries) (2010) Indonesian
Fishery Statistics
Moller JKS, Skibsted LH (2006) Myoglobins the link between discoloration and
lipid oxidation in muscle and meat. Quim Nova, 29:1270-1278

95

Nakamura Y, Ando M, Seoka M, Kawasaki K, Tsukamasa Y (2007)

Changes of proximate compositions and myoglobin content in the
dorsal ordinary muscles of the cultured Pacific bluefin tuna Thunnus
orientalis with growth. Fish Sci, 74:1155-1159
Nicholas JW, Weber LJ (1989) Comparative oxygen affinity of fish and
mammalian myoglobins. J Comp Physiol, B159:205-209
Ochiai Y, Chow C, Watabe S, Hashimoto K (1988) Evaluation of tuna meat
discoloration by Hunter color difference scale. Bull Japan Soc Sci
Fish, 54:649-653
Ochiai Y, Ueki N, Watabe S (2009) Effects of point mutations on the
structural stability of tuna myoglobins. Comp Biochem Physiol, 153
B:223-228
Ochiai Y, Watanabe Y, Ozawa H, Ikegami S, Uchida N, Watabe S (2010).
Thermal denaturation profiles of tuna myoglobin. Biosci Biotechnol
Biochem, 74 (8):1673-1679
Ochiai Y (2010) Changes in quality and denaturation of sarcoplasmic
protein components in the burnt meat of bluefin tuna Thunnus thynnus
orientalis. Nippon Suisan Gakkaishi, 76:695-704
Ochiai Y (2011) Temperature dependent structural perturbation of tuna
myoglobin. WASET, 74:731-735
Ordway GA, Garry DJ (2004) Myoglobin: an essential hemoprotein in
striated muscle. J Exp Biol, 207:3441-3446
Pegg RB, Shahidi F (1997) Unraveling the chemical identity of meat
pigments. Crit Rev Food Sci Nutr, 37(6):561-589

96

Phillips SEV, Schoenboen BP (1981) Neutron diffraction reveals oxygenhistidine hydrogen bond in oxymyoglobin. Nature, 92:81-82
Purdue.eduWeb:http://chemed.chem.purdue.edu/genchem/topicreview/bp/1b
iochem/blood3.html#top/ Accessed Oct 15, 2012
Roesner A, Mitz SA, Hankeln T, Burmester T (2008) Globins and hypoxia
adaptation in the goldfish, Carassius auratus. FEBS J, 275: 36333643
Roy BC, Ando M,

Itoh T, Tsukamasa Y (2012) Structural and

ultrastructural changes of full-cycle cultured Pacific bluefin tuna

(Thunnus orientalis) muscle slices during chilled storage. J Sci Food
Agric, 92:1755-1764
Rumbo M, Chirdo FG, Giorgieri SE, Fossati CA, Anon MC (1999)
Preparative fractionation of gliadins by electrophoresis at pH 3.1 (APAGE). J Agric Food Chem, 47:3243-3247
Sandri M, Rizzi C, Rossini K, Catani C, Cantini M, Spina M (1999)
Purificatioan of myosin heavy chain isoforms by electroendosmotic
preparative gel electrophoresis: characterization of embryonic slow
myosin heavy chain. J Basic Appl Myol, 9(2):71-78
Schwede T, Kopp J, Guex N, Peitsch MC (2003) SWISS-MODEL: an
automated protein homology-modeling server.

Nucleic Acids Res,

31:3381-3385
Seelert H, Krause F (2008) Preparative isolation of protein complexes and
other

bioparticles

by

elution

Electrophoresis, 29:2617-2636

97

from

polyacrylamide

gels.

Seideman SC, Cross HR, Smith GC, Durland PR (1984) Factors associated
with fresh meat color: a review. J Food Quality 6, 211-237
Smulevich G, Droghetti E, Foocardi C, Massimo C, Ciaccio C, Nocentini M
(2006) A rapid spectroscopic method to detect the fraudulent treatment
of tuna fish with carbon monoxide. Food Chem, 101:1071-1077
Snyder HE, Ayres JC (1961) The autoxidation of crystallized beef
myoglobin. J Food Sci, 26:469-474
Sreerama N, Yu S, Venyaminov, Woody RW (2000) Estimation of protein
secondary structure from circular dichroism spectra: inclusion of
denatured proteins with native proteins in the analysis. Anal Biochem
287, 243-251
Sohn JH, Taki Y, Ushio H, Kohata T, Shioya I, Oshima T (2005). Lipid
oxidation in ordinary and dark muscles of fish: Influences on rancid
off-odor development and color darkening of yellowtail flesh during
ice storage. J Food Sci, 70:490-496
Stagg NJ, Amato PA, Giesbrecht F,

Lanier TC

(2012) Autolytic

degradation of skipjack tuna during heating as affected by initial

quality and processing conditions. J Food Sci, 77:C149-C155
Stanley R, Krystek JR, William J, Metzler, Jiri N. 1995. Hydrophobicity
Profiles for Protein Sequence Analysis. Current Protocol in Protein
Science, 2.21-2.213
Steel RGD, Torrie JH (1980) Principles and procedures of statistics. New
York:McGraw-Hill

98

Suman SP, Faustman C, Stamer SL, Liebler DC (2006) Redox instability

induced by 4-hydroxy-2-nonenal in porcine and bovine myoglobins at
pH 5.6 and 4 C. J Agric Food Chem, 54:3402-3408
Suman SP, Faustman C, ,Stamer SL, Liebler DC (2007) Proteomics of
lipid

oxidation-induced

oxidation

in

porcine

and

bovine

oxymyoglobins, Proteomics, 313:628-640

Suman SP, Joseph P, Li S, Steinke L, Fontaine M (2009) Primary structure
of goat myoglobin. Meat Sci, 82:456-460
Sustainablefish WEB: http://www.sustainablefish.org/fisheries-improvement
/tuna/indonesia-yellowfin-tuna Accessed 27 Oct 2012
Tamura K, Dudley J, Nei M, Kumar S (2007) MEGA 4: molecular
evolutionary genetics analysis (MEGA) software version 4.0. Mol Biol
Evol, 24:1596-1599
Tang J, Faustman C, Hoagland TA (2004) Krzywicki revisited: equations
for spectrophotometric determination of myoglobin redox forms in
aqueous meat extract. J Food Sci, 69 C:717-720
Tedeschi R, De Paoli P (2011) Collection and Preservation of Frozen
Microorganisms. In Methods in Biobanking,

ed. by J. Dillner.

Humana Press, pp. 313-326

Thiansilakul Y, Benjakul S, Richards MP (2011) Isolation, characterisation
and stability of myoglobin from eastern little tuna (Euthynnus affinis)
dark muscle. Food Chem., 124:254-261
Thompson JD, Higgins DG, Gibson TJ (1994) CLUSTAL W: improving the
sensitivity of progressive multiple sequence alignment through

99

sequence weighting, position-specific gap penalties and weight matrix

choice. Nucleic Acid Res, 22:4673-4680
Trout GR (1989) Variation in moglobin denaturation and color of cooked
beef, pork and turkey meat as influenced by pH, sodium
chloride,sodium tripolyphosphate, and cooking temperature. J Food
Sci, 54:536-540
Ueki N, Ochiai Y (2004) Primary structure and thermostability of bigeye
tuna myoglobin in relation to those from other scombridae fish. Fish
Sci, 70:875-884
Ueki N, Chow CJ, Ochiai Y (2005) Characterization of bullet tuna
myoglobin with reference to thermostability structure relationship. J
Agric Food Chem, 53:4968-4975
Ueki N, Ochiai Y (2006) Effect of amino acid replacement on the structural
stability of fish myoglobin. J Biochem, 140:649-656
Viriyarattanasak C, Sato NH, Watanabe M, Kajiwara K, Suzuki T (2011)
Equations

for

spectrophotometric

determination

of

relative

concentrations of myoglobin derivatives in aqueous tuna meat extract.

Food Chem, 127:656-661
Wang RR, Pan XJ, Peng ZQ (2009) Effects of heat exposure on muscle
oxidation and protein functionalities of pectoralis majors in broilers.
Poultry Sci, 88:1078-1084
Wittenberg JB, Wittenberg BA (2003) Myoglobin function reassessed. J
Exp Biol, 206: 2011-2020

100

Witting PK, Douglass Dj, Grant Mauk A. 2000. Reaction of human

myoglobin and H2O2. J Biol Chem, 275:20391-20398
Yin S, Faustman C, Tatiyaborworntham N, Ramanathan R, Maheswarappa
NB, Mancini RA, Joseph P, Suman SP, Sun Q (2011) Species-specific
myoglobin oxidation. J Agric Food Chem, 59:12198-12203

101

Table 1-1. nucleotide sequence of the primers used for cDNA cloning
Primers
cDNA synthesis
Target cloning
3-RACE
5-RACE

Insert check

AP
F1
R1
M3R1
M3R2
AUAP
M5R1
M5R2
GeneRacerTM 5 primer
GeneRacerTM 5 nested primer
T7
SP6

102

Nucleotide sequence
5-GGCCACGCGTCGACTAGTAC(T)16-3
5-ACCCGTTTATTCAAAGAGCAC-3
5-ACGTTCCTCAGGGCTGTC-3
5-GTGCCACTGTGCTGAAGAAAC-3
5-CAAGCTGATTTCTGAGGTCC-3
5-GGCCACGCGTCGACTAGTAC-3
5-CCTTTGGCCTTCAGCAGCTCTCC-3
5-GCACAGTGGCACCATGAGCAGAAAC-3
5-CGA CTG GAG CAC GAG GAC ACT GA-3
5-GGACACTGACATGGACTGAAGGAGTA-3
5'-TAATACGACTCACTATAGGG-3'
5'-ATTTAGGTGACACTATAGAA-3'

Table 1-2. The percentage of amino acid sequence identity to southern bluefin
tuna Mb
Species
Pacific bluefin tuna
Atlantic bluefin tuna
Blackfin tuna
Yellowfin tuna
Pacific bonito
Bullet tuna
Atlantic blue marlin
Chub mackerel
Japanase jack mackerel
Spotted green pufferfish
Yellowtail amberjack
Gold fish
Red seabream
Milkfish
Rainbow trout
Zebrafish
Sea hare

Amino acid identity (%)

100
100
99
99
89
86
84
82
80
80
78
76
75
73
73
71
21

103

Table 2-1. The wavelengths (nm) for the maximum absorption of Mb derivatives
of tuna and horse
Tuna
DeoxyMb
OxyMb
MetMb

1
556
541
502

Horse
2

1
557
542
503

577
631

104

2
581
632

Table 2-2. Denaturation rate in the fast reaction denaturation phase (Kd fast) of
tuna and horse Mbs
(x 10-3)
pH
5.6

6.5

7.4

70
75
80

107
286
424

11.3
273
305

38.2
227
236

70
75
80

7.3
33.4
146

1.4
4.1
30.9

0.7
0.8
0.9

Temp. (oC)
Tuna

Horse

105

Table 2-3. Denaturation rate in the slow reaction denaturation phase (Kd slow) of
tuna and horse Mbs
(x 10-3)
pH
5.6

6.5

7.4

70
75
80

1.6
6.4
10

0.2
0.4
9.4

0.3
0.5
1.5

70
75
80

22
6.7
2.5

13
2.5
1.3

15
4.9
2.8

Temp. (oC)
Tuna

Horse

106

Table 2-4. Denaturation rate of tuna Mb at pH 6.5

Temp. (oC)
55
60
65

Kd fast (10-3)
0.7
0.7
7

Kd slow (10-3)
0.3
0.4
6.4

107

Fig. 0-1. The three dimensional structure of yellowfin tuna Mb (PDB 1MYT). The
letters indicate each helical segment. D helix is replaced by a random coil.

108

Fig. 0-2. Heme portion of Mb.

(http://chemed.chem.purdue.edu/genchem/topicreview/bp/1biochem/blood3.html#
top)

109

Fig. 0-3. Interchange between the Mb derivatives (Moller and Skibsted, 2006).

110

Fig. 0-4. Potential interacting oxidation reactions between Mb and unsaturated

fatty acids (Fautsman et al., 2010).

111

Fig. 1-1. Schematic diagram of the primer design for southern bluefin tuna T.
maccoyii Mb. The boxed area consists of white and colored ones, corresponding
tothe non coding region and the coding region, respectively. The arrows indicate
the positions of primers used for the sequrnce, refer to Table 1-1.

112

AAGAAGAATTTTGCTGTAATCAGACGGGATATATTACTACTTTGCAGATCTAGATTTCTCCATC
TCCTCAGGTC
ATG GCT GAC TTT GAT GCA GTT CTG AAG TGT TGG GGT CCA GTG GAG
Met Ala Asp Phe Asp Ala Val Leu Lys Cys Trp Gly Pro Val Glu

45
15

GCG GAC TAC ACC ACC ATT GGA GGC CTG GTT CTG ACC CGT TTA TTC
Ala Asp Tyr Thr Thr Ile Gly Gly Leu Val Leu Thr Arg Leu Phe

90
30

AAA GAG CAC CCT GAG ACC CAG AAG CTG TTC CCC AAA TTC GCT GGC
Lys Glu His Pro Glu Thr Gln Lys Leu Phe Pro Lys Phe Ala Gly

135
45

ATC GCC CAG GCT GAC ATA GCC GGT AAC GCA GCT GTT TCT GCT CAT
Ile Ala Gln Ala Asp Ile Ala Gly Asn Ala Ala Val Ser Ala His

180
60

GGT GCC ACT GTG CTG AAG AAA CTT GGA GAG CTG CTG AAG GCC AAA
Gly Ala Thr Val Leu Lys Lys Leu Gly Glu Leu Leu Lys Ala Lys

225
75

GGC AGT CAC GCT GCC ATC CTA AAA CCA CTG GCA AAC AGC CAT GCC
Gly Ser His Ala Ala Ile Leu Lys Pro Leu Ala Asn Ser His Ala

270
90

ACT AAG CAC AAG ATT CCC ATT AAT AAC TTC AAG CTG ATT TCT GAG
Thr Lys His Lys Ile Pro Ile Asn Asn Phe Lys Leu Ile Ser Glu

315
105

GTC CTT GTG AAG GTC ATG CAT GAG AAG GCA GGA CTC GAT GCC GGT
Val Leu Val Lys Val Met His Glu Lys Ala Gly Leu Asp Ala Gly

360
120

GGG CAG ACA GCC CTG AGG AAC GTG ATG GGT ATC ATC ATC GCC GAC
Gly Gln Thr Ala Leu Arg Asn Val Met Gly Ile Ile Ile Ala Asp

405
135

CTT GAG GCC AAC TAC AAA GAG CTG GGC TTC TCT GGC TGA
Leu Glu Ala Asn Tyr Lys Glu Leu Gly Phe Ser Gly *

444
148

GGTCACACATGTCATACCGCCGGGTCGGACAGCAAACAGGAATGTTTTCCACCAGCTAAGTGCAC
ATTTTACAAGTTAGTTTGTATAGGGTTTTTTTTCTGTTATTGTGTCCACTCCTGTAACTGCTCAA
TAATAAACATAATTCATGTTTCAGTGTAAATGAAAGAATTCTTGGCTAACAAGATGTAAACTTCA
AcAACCTGTACCCTGTTGTCACCTTATTACCATAAAAAAACTTGTTGCTTAAAAAAAAAAAAA

Fig. 1-2. Nucleotide and deduced amino acid sequences of cDNA encoding
southern bluefin tuna T. maccoyii Mb. Bold faced letters and asterisk indicate the
initiation and stop codons, respectively.

The data have been submitted to

DDBJ/EMBL/GenBank databases with the accession number of AB592346.

113

Fig. 1-3. Alignment of amino acid sequence of southern bluefin tuna Mb with
those of other species. Dots indicate identical amino acids. The boxes contain
helical segments A through H except D which is missing in fish Mbs. Conserved
distal and proximal histidine residues are indicated by arrows.

114

Fig. 1-4. Phylogenetic tree constructed based on the amino acid sequences of Mbs
taking sea hare as an outgroup. The numbers on the branches are the bootstrap
confidence levels calculated from 1000 replicate analyses.

115

Fig. 1-5. Hydropathy plot of southern bluefin tuna Mb scanned by a window size
of 9 amino acids.

116

Blackfin tuna Mb

Southern bluefin tuna Mb

Fig. 1-6. Tertiary structure of southern bluefin tuna T. maccoyii Mb compared to

that of blackfin tuna Mb (PDB 2NRL). The -helices are shown by ribbons. The
letters indicate the helical segments. Segment D is missing in fish Mbs.

117

Fig. 2-1. SDS - PAGE patterns of the supernatants after ammonium sulfate
fractionations. Gel concentration was 15%. M: molecular weight marker; A: water
soluble fraction of dark musle; B: supernatant of 40% ammonium sulfate
saturation; C: supernatant of 50% ammonium sulfate saturation; D: supernatant of
60% ammonium sulfate saturation; E: supernatant of 70% ammonium sulfate
saturation; F: supernatant of 80% ammonium sulfate saturation. The arrow
indicates Mb.

118

Fig. 2-2. SDS-PAGE patterns of the precipitates after ammonium sulfate

fractionations. Gel concentration was 15%. M: molecular weight marker; A:
precipitate of 40-90% ammonium sulfate saturation; B: precipitate of 50-90%
ammonium sulfate saturation; C: precipitate of 60-90% ammonium sulfate
saturation; D: precipitate of 70-90% ammonium sulfate saturation; E: precipitate
of 80-90% ammonium sulfate saturation. The arrow indicates Mb.

119

Fig. 2-3. Preparative electrophorhesis apparatus (Nativen AE 67-60).

120

Mb

Contaminating Mb

Mb

Fig. 2-4. SDS-PAGE patterns for the purification steps of Mb from tuna dark
muscle. Gel concentration was 15%. (a) Using ammonium sulfate fractionation.
A: water soluble fraction of dark muscle; B: precipitate of 40-90% ammonium
sulfate saturation; C: purified tuna Mb.

(b) Without ammonium sulfate

fractionation. M: molecular weight markers; S: water extract; F: supernatant after

paper filtration; R: supernatant after membrane filter filtration; I: purified tuna
Mb.

121

Fig. 2-5. Two-dimensional PAGE pattern of the purified tuna Mb. The arrow
shows Mb. Gel concentration for the second dimension (SDS-PAGE) was 12.5%.

122

Fig. 2-6. The absorption spectra of Mb derivatives of tuna and horse.

123

Fig. 2-7. The temperature effect on metMb ratio of tuna and horse Mbs. Filled
and white circles represent tuna and horse Mbs, respectively. The results are
provided as the mean values and standard deviations. (n=3).

124

Fig. 2-8. The autooxidation of tuna and horse Mbs at 0oC. (a) Filled squares,
circles, and triangles represent the data for tuna Mb at pH 6.5, 7.4, and 5.6,
respectively. (b) Open squares, circles, and triangles represent the data for horse
Mb at pH 6.5, 7.4, and 5.6, respectively.

125

Fig. 2-9. Changes in metMb ratio (%) of tuna and horse Mbs during incubation at
0oC. (a) In 50 mM sodium citrate buffer (pH 5.6). (b) In 50 mM phosphate buffer
(pH 6.5). (c) In 50 mM sodium phosphate buffer (pH 7.4). Filled and open circles
represent tuna and horse Mbs, respectively. The results are provided as the mean
values with standard deviations (n=3).

126

Fig. 2-10. pH dependency of the autooxidation rate at 0oC. Filled boxes and
circles represent tuna and horse Mbs, respectively.

127

Fig. 2-11. The autooxidation of tuna and horse Mbs at 37oC. (a) Filled squares,
circles, and triangles represent the data for tuna Mb at pH 7.4, 6.5, and 5.6,
respectively. (b) Open squares, circles, and triangles represent the data for horse
Mb at pH 7.4, 6.5, and 5.6, respectively.

128

Fig. 2-12. Changes in metMb ratio (%) of tuna and horse Mbs during incubation
at 37oC. (a) In 50 mM sodium citrate buffer (pH 5.6). (b) In 50 mM phosphate
buffer (pH 6.5). (c) In 50 mM sodium phosphate buffer (pH 7.4). Filled and open
circles represent tuna and horse Mbs, respectively. The results are provided as the
mean values with standard deviations (n=3).
129

Fig. 2-13. pH dependency of the autooxidation rate at 37oC. Filled squares and
circles represent tuna and horse Mbs, respectively.

130

Fig. 2-14. Effect of pH and temperature on percentage myoglobin denaturation

(PMD) of horse and tuna Mbs. Open and filled triangles, squares, diamonds
represent tuna and horse Mbs at 70, 75, an 80oC, respectively. Data are shown as
averages with standard deviations (n=3).

131

Fig. 2-15. pH and temperature dependencies of the residual ratio of horse and
tuna Mbs. Open and filled triangles, squares, diamonds represent tuna and horse
Mbs at 70, 75, and 80oC, respectively.

132

Fig. 2-16. Effect of heat treatment on the denaturation of tuna Mb. (a) Percentage
myoglobin denaturation (PMD) at pH 6.5 and (b) The changes of residual Mb at
pH 6.5. Filled circles, crosses, and triangles represent the incubation temperature
(55, 60, and 65oC), respectively. Data are shown as averages with standard
deviations (n=3).

133

Fig. 3-1. Appearance of the tuna meat slice of each grade.

A, excellent; B, good; C, acceptable; D, not acceptable. Note that the redness is
more enhanced in the higher quality meat.

134

Fig. 3-2. Mb derivatives ratio in the different quality grade tuna meat. A,
excellent; B, good; C, acceptable; D, not acceptable.
(a) MetMb ratio. (b) oxyMb ratio (c) deoxyMb ratio. The asterisks represent
significant differences (**P<0.01 and *P<0.05). Data are shown as average with
standard deviations (n=10 for each grade of meat).

135

Fig. 3-3. SDS-PAGE patterns of the water soluble fractions from different quality
grade tuna meat (light muscle).
M: molecular weight marker. A, excellent; B, good; C, acceptable; D, not
acceptable. Mb concentration: 2.1 g. 15 % gel.

136

Fig. 3-4. Mb concentrations in the meat extract of different quality grade.

A, excellent; B, good; C, acceptable; D, not acceptable. The asterisks represent
significant differences (**P<0.01 and *P<0.05). Data are shown as average with
standard deviations (n=10 for each grade of meat).

137

Fig. 3-5. Differences in the tristimulus values of different quality grade tuna meat.
A, excellent; B, good; C, acceptable; D, not acceptable.
(a) L* value. (b) a* value. (c) b* value. The asterisks represent significant
differences (**P<0.01 and *P<0.05). Data are shown as average with standard
deviations (n=10 for each grade of meat).

138

Fig. 3-6. The redness index of different quality grade tuna meat.
A, excellent; B, good; C, acceptable; D, not acceptable. The asterisks represent
significant differences (**P<0.01 and *P<0.05). Data are shown as average with
standard deviations (n=10 for each grade of meat).

139

Fig. 3-7. Correlation between color values and metMb ratio (%).
(a) Between a* value and metMb ratio (%) and (b) between the redness index and
metMb ratio (%).

140

Fig. 3- 8. Correlation between redness value and Mb concentration in meat

extract.

141