THE JOURNAL OF BIOLOGICAL CHEMISTRY

2004 by The American Society for Biochemistry and Molecular Biology, Inc.

Vol. 279, No. 39, Issue of September 24, pp. 4080240806, 2004
Printed in U.S.A.

The Basis for Resistance to -Lactam Antibiotics by Penicillinbinding Protein 2a of Methicillin-resistant Staphylococcus aureus*
Received for publication, March 31, 2004, and in revised form, June 1, 2004
Published, JBC Papers in Press, June 28, 2004, DOI 10.1074/jbc.M403589200

Cosimo Fuda, Maxim Suvorov, Sergei B. Vakulenko, and Shahriar Mobashery

From the Department of Chemistry and Biochemistry, University of Notre Dame, Notre Dame, Indiana 46556

Emergence of bacterial strains designated as methicillinresistant Staphylococcus aureus (MRSA)1 from the 1960s to the
present has created clinical difficulties for nosocomial infections worldwide (1). The genetic determinant for this resistance
is mecA, which is not native to S. aureus but has been acquired
by it many times over the past 40 years from unknown sources
(2). The gene product of mecA is a penicillin-binding protein
(PBP) designated PBP2a. S. aureus normally produces four
PBPs (3), enzymes that are anchored on the cytoplasmic membrane, the functions of which are the assembly and regulation
of the latter stages of the cell wall biosynthesis (4, 5). Whereas
these four PBPs are susceptible to modification by -lactam
antibiotics, an event that leads to bacterial death, PBP2a is
* This work was supported by National Institutes of Health Grant
GM61629. The costs of publication of this article were defrayed in part
by the payment of page charges. This article must therefore be hereby
marked advertisement in accordance with 18 U.S.C. Section 1734
solely to indicate this fact.
To whom correspondence should be addressed. Tel.: 574-631-2933;
Fax: 574-631-6652; E-mail: mobashery@nd.edu.
1
The abbreviations used are: MRSA, methicillin-resistant Staphylococcus aureus; PBP, penicillin-binding protein.

refractory to the action of all available -lactam antibiotics.

PBP2a is capable of taking over the functions of the four typical
PBPs of S. aureus in the face of the challenge by -lactam
antibiotics.
The pharmaceutical industry responded by initiating research programs in the discovery of novel -lactams that will
inhibit PBP2a. A few cephalosporins have been identified, of
which a handful has now advanced into clinical trials for MRSA
treatment (6 8). Also, the clinical urgency has been met in the
past few years by the introduction of Synercid (a combination of
quinupristin and dalfopristin) (9), daptomycin (10), and linezolid (an oxazolidinone) (11) for treatment of MRSA. However,
resistance to all of these agents exists, and the recent emergence of variants of MRSA resistant to linezolid (12) and glycopeptide antibiotics (1316) has created a situation in which
certain strains of S. aureus are either treatable only with a
single class of antibiotics or are simply not treatable, which is
a disconcerting situation clinically.
As -lactams (penicillins, cephalosporins, carbapenems, etc.)
arguably remain the most important antibiotics clinically (55%
of all antibiotics used globally belong to this class), it is imperative to understand the molecular mechanisms for resistance to
these antibiotics. This mechanistic knowledge, along with
structural information (17), should prove indispensable in devising strategies to circumvent the clinical problem presented
by MRSA. In this vein, we report herein our cloning, expression, and purification of PBP2a of S. aureus. Kinetics were
carried out with a series of -lactam antibiotics to explore their
interactions with PBP2a. Furthermore, we report on our results in understanding the incremental steps in the catalytic
process of PBP2a. The enzyme undergoes a substantial conformational change in the course of its interactions with -lactam
antibiotics, which should have implications for the catalytic
events of PBP2a in cross-linking of the bacterial cell wall.
EXPERIMENTAL PROCEDURES

Cloning of PBP2aChromosomal DNA of S. aureus ATCC706986

was isolated using a DNeasy tissue kit (Qiagen). The mecA gene was
amplified without the sequence encoding its 23-amino acid-long Nterminal anchoring region using two oligonucleotide primers, SAPBP2a-1D (TAATCCATGGCTTCAAAAGATAAAGAAAT) and SAPBP2a-R
(TAATAAGCTTCTGTTTTGTTATTCATCTATAT). These primers contain recognition sequences for the restriction endonucleases NcoI and
HindIII (italicized) that were utilized for cloning of the PCR product
into the corresponding sites of expression vector pET24d(). Recombinant plasmid was initially used to transform competent cells of Escherichia coli JM83. Both DNA strands of the mecA gene from several
transformants were sequenced, and recombinant plasmid was used to
transform competent cells of E. coli BL21(DE3).
Site-directed MutagenesisTo produce mutants of PBP2a, the mecA
gene was recloned from the pET24d() vector into the smaller vector
pUC19 using sites for the restriction endonucleases XbaI and HindIII.
The QuikChange site-directed mutagenesis kit (Stratagene, La Jolla,
CA) was utilized to produce three mutant derivatives of PBP2a. To

40802

This paper is available on line at http://www.jbc.org

Downloaded from http://www.jbc.org/ by guest on February 9, 2015

Penicillin-binding protein 2a (PBP2a) of Staphylococcus aureus is refractory to inhibition by available -lactam antibiotics, resulting in resistance to these antibiotics. The strains of S. aureus that have acquired the
mecA gene for PBP2a are designated as methicillin-resistant S. aureus (MRSA). The mecA gene was cloned and
expressed in Escherichia coli, and PBP2a was purified
to homogeneity. The kinetic parameters for interactions
of several -lactam antibiotics (penicillins, cephalosporins, and a carbapenem) and PBP2a were evaluated. The
enzyme manifests resistance to covalent modification by
-lactam antibiotics at the active site serine residue in
two ways. First, the microscopic rate constant for
acylation (k2) is attenuated by 3 to 4 orders of magnitude
over the corresponding determinations for penicillinsensitive penicillin-binding proteins. Second, the enzyme shows elevated dissociation constants (Kd) for the
non-covalent pre-acylation complexes with the antibiotics, the formation of which ultimately would lead to
enzyme acylation. The two factors working in concert
effectively prevent enzyme acylation by the antibiotics
in vivo, giving rise to drug resistance. Given the opportunity to form the acyl enzyme species in in vitro experiments, circular dichroism measurements revealed that
the enzyme undergoes substantial conformational
changes in the course of the process that would lead to
enzyme acylation. The observed conformational
changes are likely to be a hallmark for how this enzyme
carries out its catalytic function in cross-linking the
bacterial cell wall.

The Basis for Resistance to -Lactams by PBP2a of MRSA

the active site serine, and the acyl enzyme species slowly undergoes
deacylation according to Equation 1.
Ks
k2
k3
E-I O
EP
EI|
-0 EI O

(Eq. 1)

E represents PBP2a, EI is the non-covalent pre-acylation complex,

E-I is the covalent acyl enzyme species, and P denotes the product of
hydrolysis of the -lactam antibiotic. The first-order rate constants for
protein acylation were determined for different -lactam compounds
using a Cary 50 UV spectrophotometer (Varian Inc.) at room temperature. The parameters for the reaction between PBP2a and nitrocefin
were determined directly by monitoring the formation of the acyl enzyme species at 500 nM (500 15,900 cm1 M1). The experiments
were carried out in 25 mM Hepes, 1 M NaCl (pH 7.0) buffer. The
observed first-order rate constants (kobs) were measured at a protein
concentration of 2.5 M with different concentrations of nitrocefin (20
120 M) and monitored for 45 min each, at which time the protein was
invariably acylated.
Nitrocefin (120 M) was used as the reporter molecule to determine
the apparent first-order rate constants for acylation by other nonchromogenic (or poorly chromogenic) -lactams at varying concentrations in competition experiments (18).
The deacylation rate constants for wild-type PBP2a were determined
using BOCILLIN FL as a reporter molecule (19). A typical reaction
mixture (60 l) contained 15 M of PBP2a and a -lactam antibiotic
concentration at least 2-fold higher than its Kd value. The mixture was
incubated at room temperature for 45 min in 25 mM Hepes, 1 M NaCl
(pH 7.0) buffer. The excess -lactam was removed by passing the
mixture through a Micro Bio-Spin6 column (Bio-Rad). An aliquot (3
l) of the mixture was diluted 5-fold with the same buffer and incubated
at room temperature for different time intervals. The amount of the free
protein, liberated from the acyl protein species, was assayed by the
addition of BOCILLIN FL to afford a final concentration of 40 M and
incubated for an additional 45 min at room temperature. SDS sample
buffer (15 l) was added to the reaction mixture, which was then boiled
for 3 min. The samples (30 l in total) were loaded onto a 10% SDSpolyacrylamide gel, which was developed and then scanned using a
Storm840 Fluorimager.
Circular DichroismThe CD spectra of the wild-type PBP2a (6 M in
25 mM Hepes, 1 M NaCl, pH 7.0) were recorded on a Jasco J-600
instrument (Easton, MD, 5-mm path length) in the absence and presence of 30 M oxacillin or 30 M ceftazidime. The -lactams had negligible CD readings compared with the protein. Regardless, the contribution of the -lactam substrate was subtracted in each case. The
proteins were incubated with the -lactam antibiotics at 25 C.
RESULTS AND DISCUSSION

PBP2a has been cloned and studied by others (20 25). We

have cloned this protein for our studies as well. The mecA gene
was PCR-amplified from the chromosomal DNA of S. aureus
ATCC706986 without the 69 base pairs in the 5-region encoding the 23-amino acid-long N-terminal membrane anchor. The
gene was cloned between the NcoI and HindIII sites of the
expression vector pET24d(), and PBP2a was produced intracellularly after induction with isopropyl--D-thiogalactopyranoside. The gene was recloned into the XbaI and HindIII sites
of the smaller plasmid pUC19 to produce mutant variants of
the mecA gene efficiently. Subsequent to mutagenesis, the corresponding genes were recloned back between the NcoI and
HindIII sites of the pET24d() vector, and the enzymes were
produced intracellularly by isopropyl--D-thiogalactopyranoside induction. PBP2a was purified to apparent homogeneity in
three chromatographic steps. We typically obtained 40 mg of
pure protein from a liter of culture.
We have evaluated the kinetics of interactions of three
cephalosporins (nitrocefin, cefepime and ceftazidime), two penicillins (ampicillin and oxacillin), and one carbapenem (imipenem) with PBP2a (Table I). PBP2a, as with virtually all
other known PBPs, undergoes acylation with its peptidoglycan
substrate at an active site serine (Ser-403) for its transpeptidase activity (cell wall cross-linking). The acyl enzyme species
then undergoes the transpeptidation reaction with another

Downloaded from http://www.jbc.org/ by guest on February 9, 2015

obtain the K406A mutant two mutagenic primers, MecS/A-d (CCAGGTTCAACTCAAGCAATATTAACAGCAATG) and MecS/A-r (CATTGCTGTTAATATTGCTTGAGTTGAACCTGG), that include the codon GCA
(in bold) for alanine instead of that for lysine (AAA) were used. Two
other mutagenic primers, SaurY519PD (GCTGATTCAGGTTTCGGACAAAGTGAAAT) and SaurY519PD (ATTTCACTTTGTCCGAAACCTGAATCAGC), that contain the TTC codon for phenylalanine (in bold)
were used to introduce the Y519F mutant derivative of PBP2a. The
double mutant enzyme, K406A/Y519F, was produced by introducing a
second substitution into the K406A mutant derivative. After mutagenesis the nucleotide sequence for each of the genes producing mutant
enzymes was verified, and these genes were recloned between the NcoI
and HindIII sites of the pET24d() expression vector.
Expression of Wild-type PBP2a and Its Mutant Variants K406A,
K406A/Y519F, and Y519F in E. coliThe wild-type PBP2a and
K406A, K406A/Y519F, and Y519F mutant variants were each expressed using the same method. E. coli BL21 (DE3) was transformed
with the plasmid pET24d(), which contained the wild-type and mutant mecA gene in its multiple cloning site. A 3-ml overnight seed
culture was used to inoculate 500 ml of the LB medium supplemented
with kanamycin (30 g/ml). Cells were grown at 37 C with shaking
(120 rpm) until the A600 reached 0.8 (about 6 h) followed by the
addition of 0.4 mM isopropyl--D-thiogalactopyranoside to induce expression. The bacterial culture was then incubated at 25 C for another
20 h. Cells were harvested by centrifugation at 5500 g for 10 min at
4 C, and the pellet was suspended in 10 mM Tris/HCl buffer, pH 8
(buffer A).
Purification of Wild-type and Mutant PBP2aThe wild-type PBP2a
and its mutants K406A, K406A/Y519F, and Y519F were each purified
using the same three-step purification protocol with an LP chromatography system (Pharmacia) at 4 C. Cells were disrupted by 30 cycles of
sonication (20 s of burst and 20 s of rest for each cycle) using a Branson
sonifer. The resulting supernatant was then centrifuged at 14,000 g
for 25 min using a Beckman-Coulter centrifuge. Pelletting, suspension
in buffer A, and sonication were each repeated three times to ensure a
high yield. The resultant cell-free extract was loaded at 2 ml/min onto
a Q-Sepharose column (2.5 30 cm; 80 ml of High Q support resin,
Bio-Rad) equilibrated with buffer A. The proteins were eluted with a
linear gradient of 0 0.3 M NaCl in buffer A at 4 ml/min (total volume of
800 ml). PBP2a eluted at 0.10 0.15 M NaCl as determined by
SDS-PAGE.
The fractions containing PBP2a were combined, concentrated, and
brought to 1.5 M (NH4)2SO4 in buffer A. The combined solution was then
loaded at 2 ml/min onto a phenyl-agarose column (2.5 30 cm; 60 ml of
phenyl-agarose resin, Sigma) equilibrated with 1.5 M (NH4)2SO4 in
buffer A. The protein was eluted with a linear gradient of 1.5 0.5 M
(NH4)2SO4 in buffer A at 4 ml/min (total volume of 600 ml). The
fractions containing PBP2a eluted at 1.2 0.8 M (NH4)2SO4 and were
identified by SDS-PAGE.
The protein fractions were combined and concentrated, and the
buffer was exchanged to 0.2 M NaCl in buffer B (50 mM sodium
phosphate, pH 7.0) and loaded at 1.0 ml/min onto a Sepharose column
(2.5 50 cm; 160 ml of High S support resin, Bio-Rad) equilibrated
with buffer B. The protein was eluted with a linear gradient of 0.21.0
M NaCl in buffer B at 1.5 ml/min to a final volume of 1500 ml. PBP2a
was eluted from the column at 0.6 0.8 M NaCl. The fractions were
combined, dialyzed against 25 mM Hepes in 1 M NaCl, pH 7.0. The
protein concentration was determined with the BCA protein assay kit
(Pierce). The yield from a 500-ml cell culture of either the wild-type
PBP2a, the K406A mutant, or the Y519F mutant was 20 mg. The
double mutant K406A/Y519F yielded 10 mg from a 500-ml cell
culture. Each was concentrated to 12 mg/ml. The wild-type and
mutant proteins used in our experiments were all homogenous (data
not shown).
13
C NMR ExperimentsThe wild-type PBP2a protein (5 mg) was
dialyzed against several changes of degassed 25 mM sodium acetate
buffer (pH 4.5) and then against degassed 50 mM sodium phosphate,
0.15 mM NaCl, 0.1 mM EDTA, pH 7.0. Subsequently, the protein was
dialyzed against buffer containing 50 mM sodium phosphate, 0.15 mM
NaCl, 10% D2O, and 20 mM NaH13CO3 (the source of CO2). The protein
was concentrated to 0.15 mM. The 13C NMR spectrum of the wild-type
PBP2a protein indicated no modification of the protein by 13C-labeled
carbon dioxide. The procedure did not affect the quality of the protein
because the pseudo first-order rate constants for acylation of the protein
by nitrocefin with and without this treatment remained the same.
Determination of the Kinetic Parameters for Interactions of -Lactam
Antibiotics with the PBP2a ProteinPBP2a experiences acylation at

40803

The Basis for Resistance to -Lactams by PBP2a of MRSA

40804

TABLE II
Kinetic parameters for the interactions of K406A, Y519F,
and K406A/Y519F mutant PBP2a variants with
three -lactam antibiotics

TABLE I
Kinetics parameters for interactions of -lactam antibiotics
with the wild-type PBP2
-Lactams

k2
s

Nitrocefin
Cefepime
Ceftazidime
Ampicillin
Oxacillin
Imipenem

10

k3
3

3.7 0.3
1.5 0.1
1.0 0.1
3.4 0.1
1.6 0.1
1.7 0.1

10

Kd
6

7.2 0.1
5.9 0.5
3.2 0.2
3.2 0.1
2.5 0.1
3.3 0.3

192 24
1618 145
671 116
668 124
180 25
603 93

k2/Kd
M

s1

19.0 3.0
0.9 0.1
1.5 0.3
5.0 1.0
9.0 1.0
2.8 0.4

Enzyme

k2
s

K406A
Y519F
K406A/Y519F

Nitrocefin
Ceftazidime
Oxacillin
Nitrocefin
Ceftazidime
Oxacillin
Nitrocefin
Ceftazidime
Oxacillin

10

Kd
5

4.5 0.1
0.8 0.1
1.2 0.5
280 40
150 10
260 20
5.2 1.1
1.9 0.2
1.2 0.3

200 70
510 100
800 80
230 50
1400 220
590 15
200 60
930 200
1100 60

k2/Kd
M

s1 102

22.0 9.0
1.6 0.3
1.5 0.5
1200 300
250 20
440 25
27 10
2.0 0.5
1.1 0.2

basal level that was attained for the BlaR protein and not far
from the undetectable levels seen for the same mutation in the
OXA-10 enzyme. Hence, in the cases of the BlaR and the
OXA-10 proteins the acylation rate constants were higher, so
the drops in their magnitudes were also larger on mutation.
However, the basal level that we have observed for the lysine to
alanine mutant variants in all three proteins were essentially
the same.
Tyr-519 is another potentially basic residue within the active
site. It could potentially provide the activation if it were unprotonated in the side chain and if the side chain were to
undergo rotation from the position seen in the x-ray structure.
Mutant enzyme variants Y519F and K406A/Y519F gave kinetic properties similar to the wild-type and to the K406A
mutant, respectively. Therefore, this tyrosine residue does not
play a role in catalysis, and Lys-406 is the basic residue that
promotes the active site serine for enzyme acylation (Table II).
It is noteworthy that at least one penicillin-binding protein is
now shown to be carboxylated in the side chain of its active site
lysine (product of carbon dioxide addition to the lysine side
chain amine) (16). In light of the reversibility of lysine carboxylation in proteins, there are known examples of lysine-carboxylated proteins that were identified by x-ray crystallography in
their non-carboxylated forms. Hence, there was a possibility
that PBP2a might be carboxylated at Lys-406. We carried out
the diagnostic 13C NMR experiment for detection of protein
lysine carboxylation with PBP2a, as reported for other proteins
previously (15, 16). The experiment showed that PBP2a is not
carboxylated at any lysine, and thus the crystal structure depicts the correct structure for Lys-406.
As shown in Fig. 1A, the x-ray structure of PBP2a reveals that
the active site of the enzyme is not an open cleft. Indeed, the
access to the active site is not obvious from the x-ray structure.
Lim and Strynadka (17) have shown that the acyl enzyme species
with -lactam antibiotics largely maintains the active site in the
same conformation with small movements within the immediate
vicinity of the ligand away from that seen in the native enzyme
(Fig. 1, B and C). A conformational change to open the active site
would appear to be necessary both for the turnover events with
the peptidoglycan substrate and for interactions with inhibitors
such as -lactam antibiotics.
The relatively slow nature of the kinetics of the interactions
of -lactam antibiotics with PBP2a indicated to us that these
interactions might be studied by circular dichroism spectroscopy to explore the possibility of such protein conformational
changes. We carried out these studies with oxacillin (a penicillin) and ceftazidime (a cephalosporin). Incubation of PBP2a
with either oxacillin or ceftazidime resulted in dramatic conformational changes in the protein (Fig. 2), most readily observed at the minima at 208 and 222 nm, which are because of
-helices. As revealed in Fig. 2, A and C, the helix content
decreased on exposure to the antibiotic, and a set of conforma-

Downloaded from http://www.jbc.org/ by guest on February 9, 2015

strand of the peptidoglycan. -Lactam antibiotics subvert this

process by undergoing the enzyme acylation process, but the
resulting complex is often stable such that the enzyme is inactivated, and the organism is deprived of its vital function.
The processes for interactions of -lactam antibiotics with
PBP2a were sufficiently slow that the need for stopped-flow
rapid kinetics was obviated. It is noteworthy that manifestation of resistance is because of both a slow rate of enzyme
acylation (k2 effect) as well as an absence of high affinity of the
enzyme for -lactams in general (Kd effect). The t12 for enzyme
acylation was in the range of 3 to 12 min with these antibiotics.
This contrasts dramatically to t12 values of low milliseconds for
typical penicillin-sensitive PBPs (26, 27). The elevated dissociation constants for the pre-acylation complexes ranged between 180 and 1618 M, resulting in second-order rate constants (k2/Kd) of 119 M1 s1. The rate constants for
deacylation (k3) of the acyl enzyme species were exceedingly
poor, giving t12 values in the range of 26 to 77 h. Considering
that S. aureus doubles its population size in 20 30 min under
favorable growth conditions, the formation of the acyl enzyme
species is irreversible for practical purposes. In essence, the
non-covalent encounters between the antibiotics and PBP2a
are not favorable (high Kd), and the rate constants for enzyme
acylation are exceedingly poor (slow k2). Hence, formation of
the acyl enzyme species would not take place in vivo for these
two reasons. The fact that the acyl enzyme species with -lactam antibiotics is extremely stable is irrelevant to the resistance problem, as the species would simply not form in vivo.
Considering that PBP2a fulfills the critical physiological needs
of the bacterium in the presence of -lactam antibiotics, the set
of events that led to the evolution of this important resistance
enzyme to antibiotics is quite remarkable (28).
We hasten to add that the kinetic parameters that we report
herein are somewhat different from those reported by Lu et al.
(29), who used a mass spectrometric approach for analysis of
kinetics. Whereas our Kd values are sufficiently high to preclude enzyme acylation when considering the in vivo situation,
the corresponding numbers by Lu et al. (29) were substantially
higher than ours (high millimolar range).
The issue of activation of the active site serine is of interest.
As will be discussed below, Ser-403 is well sheltered within the
active site and its side chain hydroxyl is in contact with the side
chain of Lys-406 (8). This arrangement of Ser-X-X-Lys for PBPs
and related -lactamases is understood to be important for the
mechanisms of these enzymes (30). We have shown that when
the corresponding lysine is mutated to alanine in the OXA-10
-lactamase, the enzyme cannot undergo acylation by its substrate (31). A similar mutation in the penicillin-binding protein
BlaR from S. aureus was shown to attenuate the rate of protein
acylation by 6730-fold (32). The K406A mutant variant of
PBP2a underwent extremely sluggish acylation. The effect was
mostly on k2, which was attenuated by 80- to 130-fold for the
mutant variant (Table II). Whereas the magnitude of the effect
is relatively small, this level of attenuation reduces the already
sluggish rate of acylation to the range of 105 s1, which is the

Inhibitor

The Basis for Resistance to -Lactams by PBP2a of MRSA

40805

Downloaded from http://www.jbc.org/ by guest on February 9, 2015

FIG. 1. Active site of PBP2a from the x-ray structure. A, a stereo

view to the active site environment from the x-ray structure of PBP2a
is rendered as a solvent-accessible surface (Connolly surface, green),
whereas important residues in the active site are shown in a capped
sticks representation. A dotted Connolly surface (purple) is used to
demonstrate the surface of the regions that cover the active site opening. B, a stereo view of the secondary structures (orange tube representation) and various important residues for the native enzyme structure
is depicted. C, the penicillin G/PBP2a acyl enzyme complex is shown.
(Penicillin G is shown in yellow, and capped sticks are color-coded
according to atom types; oxygen, nitrogen, and carbon are shown in red,
blue, and white, respectively.) The perspectives are the same for all
three panels.

tional changes was noted within the first four t12 values for
acylation (for virtually complete protein acylation). These conformational changes continued for the duration of the monitoring for 3 days. In essence, the monitoring of the two wavelengths in the course of the experiments (Fig. 2, B and D)
indicated that substantial conformational flexibility exists in
the protein. The details of conformational changes were not
identical in the two cases, reflecting the differences in the
structures of the penicillin and cephalosporin used for these
experiments. A fuller understanding of these differences
should await structural-biological studies in the future.
Whereas 30% of the enzymic activity was lost at the end of 3
days of the CD experiment, the conformational state of the
enzyme returned largely to the native state in both CD experiments. The relatively subtle conformational change seen for
x-ray structures of the acyl enzyme species compared with the
native structure (8) would not account for our observations in
the CD experiments. Hence, the x-ray structure shows a complex that has settled, conformationally speaking, close to the
native state, such as the species that we observed near the
middle of the CD determinations (700 min for oxacillin and
1400 min for ceftazidime). Based on the k3 values (Table I), by
the end of the CD experiment, the acyl enzyme species are
expected largely to have undergone hydrolysis to return to the
native state.
We underscore that these conformational changes are expected to be operative during the typical turnover events by
this enzyme as well in light of the closed nature of the active
site. A volume in excess of 1000 3 is needed for the sequestration of the two peptidoglycan residues within the active site

FIG. 2. Circular dichroic spectra of PBP2a in the presence of

-lactam antibiotics. A, the far-UV CD spectrum of the wild-type
PBP2a () during oxacillin turnover at 1 h (E), 24 h (f), 48 h (), and
72 h (). B, change in the molar ellipticity of the wild-type PBP2a at 208
() and 222 nm (E) as a function of time during turnover of oxacillin. C,
the far-UV CD spectrum of the wild-type PBP2a () during ceftazidime
turnover at 1 h (E), 24 h (f), 48 h (), and 72 h (). D, change in the
molar ellipticity of the wild-type PBP2a at 208 nm () and 222 nm (E)
as a function of time during turnover of ceftazidime.

for the transpeptidase activity (33). The requisite conformational change would be expected to create this space for the
catalytic events. Furthermore, these conformational changes
must take place substantially more rapidly for the case of the
peptidoglycan substrate. Although we cannot predict at the
present what may precipitate these conformational changes, it
is inherently intuitive that the polymeric peptidoglycan sub-

40806

The Basis for Resistance to -Lactams by PBP2a of MRSA

REFERENCES
1. Pinho, M. G., de Lencastre, H., and Tomasz, A. (2001) Proc. Natl. Acad. Sci.
U. S. A. 98, 10886 10891
2. Enright, M. C., Robinson, D. A., Randle, G., Feil, E. J., Grundmann, H., and
Spratt, B. G. (2002) Proc. Natl. Acad. Sci. U. S. A. 99, 76877692
3. Georgopapadakou, N. H., Dix, B. A., and Mauriz, Y. R. (1996) Antimicrob.
Agents Chemother. 29, 333336
4. Bush, K., and Mobashery, S. (1998) Adv. Exp. Med. Biol. 456, 7198
5. Goffin, C., and Ghuysen, J. M. (2002) Microbiol. Mol. Biol. Rev. 66, 702738
6. Entenza, J. M., Hohl, P., Heinze-Krauss, I., Glausner, M. P., and Moreillon,
P.,(2002) Antimicrob. Agents Chemother. 46, 171177
7. Malouin, F., Blais, J., Chamberland, S., Hoang, M., Park, C., Chan, C.,
Mathias, K, Hakem, S., Dupree, K., Liu, E., Nguyen, T., and Dudley, M. N.
(2003) Antimicrob. Agents Chemother. 47, 658 664
8. Ishikawa, T., Matsunaga, N., Tawada, H., Kuroda, N., Nakayama, Y.,
Ishibashi, Y., Tomimoto, M., Ikeda, Y., Tagawa, Y., Iizawa, Y., Okonogi, K.,
Hashiguchi, S., and Miyake, A. (2003) Bioorg. Med. Chem. 11, 24272437

9. Drew, R. H., Perfect, J. R., Srinath, L., Kurkimilis, E., Dowzicky, M., and
Talbot, G. H. (2000) J. Antimicrob. Chemother. 46, 775784
10. Richter, S. S., Kealey, D. E., Murray, C. T., Heilmann, K. P., Coffman, S. L.,
and Doern, G. V. (2003) J. Antimicrob. Chemother. 52, 123127
11. Dailey, C. F., Dileto-Fang, C. L., Buchanan, L. V., Oramas-Shirey, M. P., Batts,
D. H., Ford, C. W., and Gibson, J. K. (2001) Antimicrob. Agents Chemother.
45, 2304 2308
12. Tsiodras, S., Gold, H. S., Sakoulas, G., Eliopoulos, G. M., Wennersten, C.,
Venkataraman, L., Moellering, R. C., and Ferraro, M. J. (2001) Lancet 358,
207208
13. Bartley, J. (2002) Infect. Control Hosp. Epidemiol. 23, 480
14. Walsh, T. R., Bolmstrom, A., Qwarnstrom, A., Ho, P., Wootton, M., Howe,
R. A., MacGowan, A. P., and Diekema, D. (2001) J. Clin. Microbiol. 39,
2439 2444
15. Centers for Disease Control and Prevention (2002) Morb. Mortal. Wkly. Rep.
51, 931
16. Centers for Disease Control and Prevention (2004) Morb. Mortal. Wkly. Rep.
53, 322323
17. Lim, D., and Strynadka, N. C. (2002) Nat. Struct. Biol. 9, 870 876
18. Graves-Woodward, K., and Pratt, R. F. (1998) Biochem. J. 332, 755761
19. Zhao, G., Meier, T. I., Kahn, S. D., Gee, K. R., and Blaszczak, L. C. (1999)
Antimicrob. Agents Chemother. 43, 1124 1128
20. Roychoudhury, S., Dotzlaf, J. E., Ghag, S., and Yeh, W. (1994) J. Biol. Chem.
269, 1206712073
21. Sun, Y., Bauer, M. D., and Lu, W. (1998) J. Mass Spectrom. 33, 1009 1016
22. Pinho, M.G., Ludovice, A. M., Wu, S., and De Lencastre, H. (1997) Microb.
Drug Resist. 3, 409 413
23. Hackbarth, C. J., Miick, C., and Chambers, H. F. (1994) Antimicrob. Agents
Chemother. 38, 2568 2571
24. Katayama, Y., Zhang, H. Z., Hong, D., and Chambers, H. F. (2003) J. Bacteriol.
185, 54655472
25. Katayama, Y., Zhang, H. Z., and Chambers, H. F. (2004) Antimicrob. Agents
Chemother. 48, 453 459
26. Lu, W. P., Kincaid, E., Sun, Y., and Bauer, M. D. (2001) J. Biol. Chem. 276,
31494 31501
27. Jamin, M., Hakenbeck, R., and Frere, J. M. (1993) FEBS Lett. 331, 101104
28. Crisostomo, M. I., Westh, H., Tomasz, A., Chung, M., Oliveira, D. C., and de
Lencastre, H., (2001) Proc. Natl. Acad. Sci. U. S. A. 98, 98659870
29. Lu, W. P., Sun, Y., Bauer, M. D., Paule, S., Koenigs, P. M., and Kraft, W. G.
(1999) Biochemistry 38, 6537 6546
30. Wu, C. Y., Alborn, W. E., Flokowitsch, J. E., Hoskins, J., Unal, S., Blaszczak,
L. C., Preston, D. A., and Skatrud, P. L. (1994) J. Bacteriol. 176, 443 449
31. Golemi, D., Maveyraud, L., Vakulenko, S., Samama, J. P., and Mobashery, S.
(2001) Proc. Natl. Acad. Sci. U. S. A. 98, 14280 14285
32. Golemi-Kotra, D., Cha, J. Y., Meroueh, S. O., Vakulenko, S. B., and
Mobashery, S. (2003) J. Biol. Chem. 278, 18419 18425
33. Lee, W., McDonough, M. A., Kotra, L., Li, Z. H., Silvaggi, N. R., Takeda, Y.,
Kelly, J. A., and Mobashery, S. (2001) Proc. Natl. Acad. Sci. U. S. A. 98,
14271431

Downloaded from http://www.jbc.org/ by guest on February 9, 2015

strate would bind at a site outside of the immediate active site

to initiate the processes.
A pertinent question on activity should be whether truncation by removal of the membrane anchor would affect activity.
The conclusion from studies by others is that there is no consequential difference on activity with the loss of the membrane
anchor (29). This is also entirely in accordance with the x-ray
structure for PBP2a, which indicates that the point of insertion
into the membrane by the membrane-spanning portion is quite
distal to the catalytic domain (17).
In this study we have described the kinetics of interactions of
six -lactam antibiotics with the PBP2a of S. aureus. We also
documented dramatic conformational changes for the protein
in the presence of these antibiotics within the time scale for
these turnover events. The function of PBP2a would appear to
be more complex than previously appreciated. In light of the
clinical importance of this protein to resistance to -lactam
antibiotics, a more complete understanding of these processes
at the structural level is required. It is with such fuller understanding of these events that we may be able to conceive of
strategies for inhibition of this deleterious bacterial enzyme in
the near future.

Enzyme Catalysis and Regulation:

The Basis for Resistance to -Lactam
Antibiotics by Penicillin-binding Protein 2a
of Methicillin-resistant Staphylococcus
aureus
Cosimo Fuda, Maxim Suvorov, Sergei B.
Vakulenko and Shahriar Mobashery
J. Biol. Chem. 2004, 279:40802-40806.
doi: 10.1074/jbc.M403589200 originally published online June 28, 2004

Find articles, minireviews, Reflections and Classics on similar topics on the JBC Affinity Sites.
Alerts:
When this article is cited
When a correction for this article is posted
Click here to choose from all of JBC's e-mail alerts
This article cites 33 references, 20 of which can be accessed free at
http://www.jbc.org/content/279/39/40802.full.html#ref-list-1

Downloaded from http://www.jbc.org/ by guest on February 9, 2015

Access the most updated version of this article at doi: 10.1074/jbc.M403589200