Time: 3 hours

Biology XII (Revision Test 01)

Marks: 70

NOTE: Please give brief, precise answers for the questions. Unnecessary statements may invoke
negative marking. Wherever necessary, the diagrams drawn should be neat and properly labeled.
1. Name the transcriptionally active region of chromatin in a nucleus.
[1]
2. Mention the contribution of genetic maps in human genome project.
[1]
3. How does the flow of genetic information in retroviruses (HIV) deviate from the central
dogma proposed by Francis Crick?
[1]
4. Give the initiation codon for protein synthesis. Name the amino acid it codes for.
[1]
5. Name the enzyme involved in the continuous replication of DNA strand. Mention the
polarity of the template strand.
[1]
6. Write the full form of VNTR. How is VNTR different from Probe?
[2]
7. a) Draw a neat labelled diagram of a nucleosome.
b) Mention what enables histones to acquire a positive charge.
[2]
8. A template strand is given below. Write down the corresponding coding strand and the
mRNA strand that can be formed along with their polarity.
3ATGCATGCATGCATGCATGCATGC5
[2]
9. Name the scientist who suggested that the genetic code should be made of a combination of
three nucleotides. Explain the basis on which he arrived at this conclusion.
[2]
10. Mention the role of ribosomes in peptide-bond formation. How does ATP facilitate it? [2]
11. Following a severe accident, many charred and disfigured bodies are recovered from the site
making the identification of the dead very difficult. Name and explain the technique that
would help the authorities to establish the identity of the dead to be able to hand over the
dead to their respective relatives.
[3]
12. Why is tRNA called an adapter? Draw and label a secondary structure of tRNA. How does
the actual structure of tRNA look like?
[3]
13. Monocistronic structural genes in eukaryotes have interrupted coding sequences. Explain.
How are they different in prokaryotes?
[3]
14. List the salient features of double helix structure of DNA.
[3]
15. a) A DNA segment has a total of 1000 nucleotides, out of which 240 of them are adenine
containing nucleotides. How many pyrimidine bases this DNA segment possesses?
b) Draw a diagrammatic sketch of a portion of DNA segment to support your answer. [3]
16. It is established that RNA is the first genetic material. Explain giving three reasons.
OR
Why is DNA a better genetic material when compared to RNA?
[3]
17. a) Name the enzyme that catalyses the transcription of hnRNA.

b) Why does the hnRNA need to undergo changes? List the changes hnRNA undergoes and
where in the cell such changes take place.
[3]
18. Unambiguous, universal and degenerate are some of the terms used for the genetic code.
Explain the salient features of each one of them.
[3]
19. State the aim and describe Meselson & Stahls experiment.
[3]
20. With the help of a schematic diagram, explain the location and the role of the following in a
transcription unit: Promoter, Structural gene, Terminator.
[3]
21. Name the enzyme responsible for the transcription of tRNA & the amino acid the initiator
tRNA gets linked with. Explain the role of initiator tRNA in initiation of protein synthesis.[3]
22. Explain the significance of satellite DNA in DNA fingerprinting technique.
[3]
23. You have learned that the genetic information of an organism lies in its sequence of bases in
DNA. If two individuals differ, then their DNA sequences would also be different, at least in
certain parts. These assumptions led to the quest of finding out the complete DNA sequence
of human genome. The human genome project was launched in 1990 and completed in 2003.
a) Name the new area in biology, which HGP is closely related with.
b) Enumerate the goals of HGP.
c) What will be the value to humans, of spending a lot of money on these programmes? [4]
24. Describe the process of transcription in a bacterium.
OR
Explain the process of DNA replication with the help of a schematic diagram. In which phase
of the cell cycle does replication occur in eukaryotes? What would happen if cell-division is
not followed after DNA replication?
[5]
25. How did Hershey and Chase establish that DNA is transferred from virus to bacteria?
OR
Explain Griffiths series of experiments where he witnessed transformation in bacteria he
worked with. Name the scientists responsible for determining the biochemical nature of
transforming principle in Griffiths experiments. What did they prove?
[5]
26. Which methodology is used while sequencing total the DNA from a cell? Explain in detail.
OR
Sketch a schematic diagram of lac operon in switched on position. How is the operon
switched off? Explain.
[5]

---------- ALL THE BEST ----------