Bio 140 Exam 4

Fall 2015
_
Name ______________
__
Use the answer pages for answers. Indicate your test version,
Section ______________
Sections
• Drawing
• Multiple Choice (3 points each) Mark 2 as FREE on sheet
• Fill in require you to use the word bank, recording the appropriate letter in the space. 2 points each,
mark 2 as FREE
• Identify/name do not have a word list. Mark 1 free
Multiple Choice
1

In the figure shown, A is the _______ region, B is the
_______ region, and this gene includes _______
introns and _______ exons.
A.
promoter; terminator; 2; 3
B.
promoter; terminator; 3; 2
C.
terminator; promoter; 2; 3
D.
terminator; promoter; 3; 2
E.
promoter; stop codon; 2; 3

2

Vinblastine is a standard chemotherapeutic drug used to treat cancer. Because it interferes with the assembly
of microtubules, its effectiveness must be related to _____.
A) disruption of mitotic spindle formation
B) inhibition of regulatory protein phosphorylation
C) suppression of cyclin production
D) myosin denaturation and inhibition of cleavage furrow formation
E) inhibition of DNA synthesis
3) Sister chromatids will separate from each other during which phase(s)?
A) mitosis and cytokinesis
B) mitosis
C) mitosis and meiosis II
D) nuclear membrane deconstruction
4
Independent assortment of chromosomes is a result of _____.
A) the random way each pair of homologous chromosomes lines up at the metaphase plate during meiosis I
B) the random combinations of eggs and sperm during fertilization
C) the random distribution of the sister chromatids to the two daughter cells during anaphase II
D) the relatively small degree of homology shared by the X and Y chromosomes
E) the diverse combination of alleles that may be found within any given chromosome
5

At a certain location in a gene, the template strand of DNA has the sequence GAAG. A mutation results in an
insertion making the sequence GAAAG. This type of mutation is likely to cause a __________ mutation
a. silent.
b. missense.
c. nonsense.
d. frame-shift.
e. translocation.

6
Which of the following statements about the structural organization of chromatin is true?
A. The DNA from a single human cell measures about 2 meters when extended.
B. Nucleosomes consist of DNA and several histone molecules.
c. During mitosis and meiosis, chromatin becomes highly coiled and condensed.
D All the statements are true
E. A and B are true

Radioactive thymine would pair with nonradioactive guanine. d. All four bases of the DNA would be radioactive. Balding. When scientists looked at the DNA of these individuals. One of the daughter cells. B) RNA may be used instead of DNA as inheritance material. what is a possible fate of the cell? A) The cell can be transformed to a cancerous cell. DNA in both daughter cells would be radioactive. C) The cell will become embryonic.7 In E. e. what is the function of DNA polymerase III? A) to unwind the DNA helix during replication B) to seal together the broken ends of DNA strands C) to add nucleotides to the end of a growing DNA strand D) to degrade damaged DNA molecules E) to rejoin the two DNA strands (one new and one old) after replication 8 Which of the following sequences would result from replication of this DNA template strand? 3′-AAGTCAGT-5′ A) 3′-AAGTCAGT-5′ B) 5′-AAGTCAGT-3′ C) 5’TGACTGAA3’ D) 3’’TGACTGAA5’ E) 5′-TTCAGTCA-3′ 9 Hutchinson-Gilford progeria is a syndrome that results in the accelerated aging of infants and children. What would happen if a cell replicates once in the presence of this radioactive base? a. and fragile bone structure typically begin during infancy. and the children typically do not live through their teenage years. coli bacteria to which radioactive thymine has been added. circulatory trouble. When the rate of repair lags behind the rate of mutation. Neither of the two daughter cells would be radioactive. they found the DNA had shorter ________ than those of healthy individuals. but not the other. b. A) telomeres B) ribosomes C) introns D) primers 10 In a healthy cell. . A) TTG-CTA-CAG-TAG B) AAC-GAC-GUC-AUA C) AUG-CTG-CAG-TAT D) AAA-AAT-ATA-ACA E) AAA-GAA-TAA-CAA 12 Suppose you are provided with an actively dividing culture of E. would have radioactive DNA c. coli. the rate of DNA repair is equal to the rate of DNA mutation. 11 A possible sequence of nucleotides in the template strand of DNA that would code for the polypeptide sequence phe-leu-ile-val would be _____. D) DNA synthesis will continue by a new mechanism.

which is made up of only four different bases. The figure here shows the results of the electrophoresis run. Which of the following choices correctly describes the relationship between the fragment size of DNA in the bands (A-E)? A. All of the above 14 Suppose a piece of DNA is digested with two different restriction enzymes in three reactions. e. Having extra digits is a dominant trait. but not of tRNA or rRNA in eukaryotic organisms. C) RNA splicing can be catalyzed by tRNA. b. 17 Death cap mushrooms produce a substance called alpha-amanitin. DNA molecules form codons of three bases that code for amino acids. A+B=D 15 A man has extra digits (six fingers on each hand and six toes on each foot).13 How can DNA. Exons are cut out before mRNA leaves the nucleus. His wife and their daughter have a normal number of digits. The couple's second child has extra digits. but not RNA polymerase II or III B) RNA polymerase III. but not RNA polymerase I and II C) the action of one or more basic transcription factors D) the action of RNA polymerase II. B=D+E D. C=A+D E. B=D+A C. A) the action of RNA polymerase I. Reactions 1 and 2 contain only a single enzyme. DNA molecules are extremely long. c. D) A primary transcript is often much shorter than the final RNA molecule that leaves the nucleus. This is possible because alpha-amanitin efficiently interferes with _____. Alpha-amanitin efficiently blocks synthesis of mRNA. The reactions are loaded into wells of an electrophoresis gel. Wells #1 and #2 receive the reactions with single enzymes while well #3 gets the reaction with both enzymes. d. encode the information necessary to specify the workings of an entire organism? a. but not RNA polymerase I or III . The genetic code is redundant but not ambiguous. the third reaction receives both enzymes. What is the probability that their next (third) child will have extra digits? A) 1/2 B) 1/16 C) 1/8 D) 3/4 E) 9/16 16 Which one of the following statements about RNA processing is true? A) Ribozymes may function in RNA splicing B). C=A+B B. DNA can be replicated with low error rates.

4. Ten 11 Genes that are on the same chromosome. M G I R G H S I 5'atggggatacgcggccattcgatc3' 2 The template strand for this DNA coding strand: 5'atggggatacgcggccattcgatc3' 5'gatcg aatggccgcgtatccccat'3 3 The experiments of Meselson and Stahl established that the replication of DNA is _________. Translate this using the codon table.semiconservative_______________. the allele for tall plants is dominant over the allele for short plants. frameshift.MATCHING/FILLIN (2 points each) (Mark two as FREE. or ___________ nonsense 7 _____________ are removed by a spliceosome complex. Find it in the list. like the type you receive while sunbathing. Out of 20 offspring resulting from the test cross. or "linked". __________ 15 In the DNA gel shown which suspect is guilty? (# not in word list) 16. do not assort independently. True or false 12 Ultraviolet light. about _______ should be tall. and contains the first amino acid codon followed several more codons. 17 Name a gene and its protein that was modeled during the chromosome project (not in list) . and one of their offspring is test crossed. 1 The following DNA sequence is found at the start of a protein coding gene. can cause a type of mutation called ______________. A true-breeding tall plant is crossed with a short plant. but can be separated by recombination. ____thymine dimers___ 13 DNA synthesis in eukaryotic cells initiates at many points simultaneously (true or false) true 14 This molecule carries the amino acid during translation.5 In lab you used _______________ to cut _________________ DNA. silent. 6 Point mutations are referred to as missense. 8 An example of codominance is _____________ ABo bloodtype 9 ________________is NOT synthesized from a DNA template. 10 In garden peas.) Select a word or figure from the “bank”.

one free (names not in word bank) __________________ _________________________ 2 points each _______________________ ___________________________ __________________________ _________________________ .Identify the molecule or structure.

Identify the molecule or structure. one free (names not in word bank) __________________ _________________________ 2 points each _______________________ ___________________________ __________________________ _________________________ .

Sign up to vote on this title
UsefulNot useful

Master Your Semester with Scribd & The New York Times

Special offer: Get 4 months of Scribd and The New York Times for just $1.87 per week!

Master Your Semester with a Special Offer from Scribd & The New York Times