Tema 8.

Evolución de secuencias de DNA
1. Tasa de mutación espontánea
2. Estimación de las tasas de sustitución de nucleótidos.

Evolucion Molecular
http://bioinfo2.ugr.es/EvolMol/

Universidad de Granada

José L. Oliver
http://www.ugr.es/~oliver/

4 transiciones (α)
8 transversiones (β)

Proporción esperada Transiciones/Transversiones = 1/2

DESDE

ATCTAGATCTAGTGCATAGCATGCA
|*|||*||*|||||*|||*|||*||

HASTA

ACCTAAATTTAGTGAATATCATCCA

Desde/Hasta

A

T

C

G

A

--

A→T

A→C

A→G

T

T→A

--

T→C

T→G

C

C→A

C→T

--

C→G

G

G→A

G→T

G→C

--

Evolucion Molecular
http://bioinfo2.ugr.es/EvolMol/

Universidad de Granada

José L. Oliver
http://www.ugr.es/~oliver/

ugr.es/~oliver/ .ugr.es/EvolMol/ A G G G A (en 1) G T T T G (en 1) A G A Se excluye A G T Se excluye A G C Se excluye Universidad de Granada José L.Evolucion Molecular http://bioinfo2. Oliver http://www.

es/EvolMol/ Universidad de Granada José L.es/~oliver/ .3%. Oliver http://www.ugr. frente al 33% (4/12) esperado • C y G son los nucleótidos más mutables (la mutacion C  G es la más frecuente. salvo en las islas CpG) • La mayoría de las mutaciones son hacia A o T Mutación de base en el genoma: aumento de A+T Pero los genes son ricos en G+C !! Evolucion Molecular http://bioinfo2.• Las transiciones suponen el 59.ugr.

es/EvolMol/ Universidad de Granada José L.es/~oliver/ .7 !! Genes funcionales: Gen 1 Consenso Gen 2 Gen 3 … Evolucion Molecular http://bioinfo2. Oliver http://www.Transition/Transversion ratio = 15.ugr.ugr.

es/EvolMol/ nd número de posiciones con nucleótidos diferentes A T C G probabilidad = 1/3 Universidad de Granada No vale Poisson José L. Oliver http://www.es/~oliver/ .ATCTAGATCTAGTGCATAGCATGCA |*|||*||*|||||*|||*|||*|| ACCTAAATTTAGTGAATATCATCCA p = nd / n Evolucion Molecular http://bioinfo2.ugr.ugr.

K sigue subestimando la divergencia Evolucion Molecular http://bioinfo2.ugr. Oliver http://www.ugr.Método de Jukes y Cantor ∑=1 ∑=1 ∑=1 ∑=1 K = -3/4 ln(1 . K es una buena estima de la divergencia.es/EvolMol/ Universidad de Granada José L. Pero para distancias mayores.4/3 p) siendo p = nd / n Si la distancia entre ambas secuencias es baja.es/~oliver/ .

Método de Kimura con 2 parámetros (K2P) ∑=1 ∑=1 ∑=1 ∑=1 R+P+Q=1 K = .es/~oliver/ .ugr.½ ln [(1 – 2P – Q) √ 1 – 2Q] Evolucion Molecular http://bioinfo2.es/EvolMol/ Universidad de Granada José L. Oliver http://www.ugr.

Oliver http://www.Evolucion Molecular http://bioinfo2.es/~oliver/ .ugr.es/EvolMol/ Universidad de Granada José L.ugr.

Método de Tamura El contenido en G+C (θ) de las secuencias puede ser ≠ 0.5 Método de Tamura y Nei Toma en cuenta tanto el sesgo en G+C como en la proporción de transiciones / transversiones Evolucion Molecular http://bioinfo2.es/EvolMol/ Universidad de Granada José L.ugr.ugr.es/~oliver/ . Oliver http://www.

Oliver http://www.es/~oliver/ .ugr.es/EvolMol/ Universidad de Granada José L.Modelo general de sustitución de nucleótidos (12 parámetros) PERO no da estimas mejores que los de 6 parámetros Evolucion Molecular http://bioinfo2.ugr.

ugr.52 III III 0.42 0.ugr.64 0..42 0. etc. se podría pensar que los métodos con más parámetros serán mejores. Oliver http://www.Comparación de los diferentes métodos • En principio.) • Otro problema es que la fórmula de los métodos con más parámetros a menudo es inaplicable (logaritmos con argumento negativo.es/EvolMol/ K2P GIN (6 parámetros) Divergencia II Universidad de Granada José L.88 0..92 Inaplicable Evolucion Molecular http://bioinfo2.64 0.) Ejemplo: estimas de K entre la α-globina de conejo y ratón Posición del codón JC I 0.68 I II 0. ya que son más realistas • Pero en la práctica no es así debido a que hay que estimar más parámetros  menos estadística  más errores de muestreo (las secuencias son finitas.es/~oliver/ .

8  87.Divergencia II I III II: Valores bajos  Corrección poco importante (8.3) III:  “ altos Evolucion Molecular http://bioinfo2.es/EvolMol/ “ muy “ Universidad de Granada (36.5  9.ugr. Oliver http://www.9) José L.es/~oliver/ .ugr.

es/~oliver/ .ugr. Oliver http://www.ugr.Secuencia ‘ancestral’ Simulación mutaciones .es/EvolMol/ K Universidad de Granada K K José L..n veces Alineamientos K Evolucion Molecular http://bioinfo2..

ugr.es/EvolMol/ Universidad de Granada José L.es/~oliver/ .Simulación Evolucion Molecular http://bioinfo2. Oliver http://www.ugr.

ugr. Oliver http://www.ugr.es/~oliver/ .Las distancias más sofisticadas (con más parámetros) son imprescindibles para estimar correctamente la longitud de las ramas en una filogenia. pero importan menos para estimar la topologia (orden de ramificación) correcta Evolucion Molecular http://bioinfo2.es/EvolMol/ Universidad de Granada José L.

ugr.Tasa de sustitución K Tasa de sustitución de nucleótidos: r = K / 2T Evolucion Molecular http://bioinfo2. Oliver http://www.es/EvolMol/ Universidad de Granada José L.ugr.es/~oliver/ .

Oliver http://www.ugr.β-globina • SS > NS • Mayor dispersión en SS The amount of nucleotide divergence at synonymous and nonsynonymous sites of the β-globin gene as a function of time since divergence.es/~oliver/ .ugr.es/EvolMol/ Universidad de Granada José L. Evolucion Molecular http://bioinfo2.

es/EvolMol/ Universidad de Granada José L.ugr.Histona H4 Gen: • 55 sustituciones • SS > NS Proteína: • 2 sustituciones Evolucion Molecular http://bioinfo2. Oliver http://www.es/~oliver/ .ugr.

Humanos vs.ugr.ugr. roedores (ratón o rata) Evolucion Molecular http://bioinfo2. Oliver http://www.es/~oliver/ .es/EvolMol/ Universidad de Granada José L.

ugr.ugr.Humanos vs.es/~oliver/ . Oliver http://www. roedores (ratón o rata) Evolucion Molecular http://bioinfo2.es/EvolMol/ Universidad de Granada José L.

ugr.es/EvolMol/ Universidad de Granada José L.es/~oliver/ .Variación en distintas regiones de los genes Evolucion Molecular http://bioinfo2.ugr. Oliver http://www.

Oliver http://www.ugr.Divergencia en exones vs.es/~oliver/ . intrones Evolucion Molecular http://bioinfo2.ugr.es/EvolMol/ Universidad de Granada José L.

es/~oliver/ .ugr. Oliver http://www.Variación de NS en el gen de la insulina NS Evolucion Molecular http://bioinfo2.ugr.es/EvolMol/ Universidad de Granada José L.

es/~oliver/ .es/EvolMol/ Universidad de Granada José L.Tasa evolutiva en el genoma mitocondrial de mamíferos • Tasa de sustitución de nucleótidos muy alta: SS diez veces mayor que en el núcleo • Causas: • Alta concentración de radicales superóxido O2• Replicación poco fiel • Saturación rápida: linealidad hasta sólo 10 MA  Reloj rápido Filogenias entre especies próximas: primates.ugr. Evolucion Molecular http://bioinfo2. Oliver http://www. etc.ugr.

ugr.es/~oliver/ .ugr. Oliver http://www.Tasa evolutiva en orgánulos de plantas Evolucion Molecular http://bioinfo2.es/EvolMol/ Universidad de Granada José L.

ugr.es/EvolMol/ Universidad de Granada José L. Oliver http://www.es/~oliver/ .Tasa evolutiva en virus Evolucion Molecular http://bioinfo2.ugr.

es/~oliver/ .es/EvolMol/ Universidad de Granada José L.ugr.Tasa evolutiva en el virus de la gripe Evolucion Molecular http://bioinfo2. Oliver http://www.ugr.

Sign up to vote on this title
UsefulNot useful