Tema 8.

Evolución de secuencias de DNA
1. Tasa de mutación espontánea
2. Estimación de las tasas de sustitución de nucleótidos.

Evolucion Molecular
http://bioinfo2.ugr.es/EvolMol/

Universidad de Granada

José L. Oliver
http://www.ugr.es/~oliver/

4 transiciones (α)
8 transversiones (β)

Proporción esperada Transiciones/Transversiones = 1/2

DESDE

ATCTAGATCTAGTGCATAGCATGCA
|*|||*||*|||||*|||*|||*||

HASTA

ACCTAAATTTAGTGAATATCATCCA

Desde/Hasta

A

T

C

G

A

--

A→T

A→C

A→G

T

T→A

--

T→C

T→G

C

C→A

C→T

--

C→G

G

G→A

G→T

G→C

--

Evolucion Molecular
http://bioinfo2.ugr.es/EvolMol/

Universidad de Granada

José L. Oliver
http://www.ugr.es/~oliver/

ugr.Evolucion Molecular http://bioinfo2.es/~oliver/ .ugr.es/EvolMol/ A G G G A (en 1) G T T T G (en 1) A G A Se excluye A G T Se excluye A G C Se excluye Universidad de Granada José L. Oliver http://www.

• Las transiciones suponen el 59.es/~oliver/ .ugr.3%.ugr. Oliver http://www. salvo en las islas CpG) • La mayoría de las mutaciones son hacia A o T Mutación de base en el genoma: aumento de A+T Pero los genes son ricos en G+C !! Evolucion Molecular http://bioinfo2.es/EvolMol/ Universidad de Granada José L. frente al 33% (4/12) esperado • C y G son los nucleótidos más mutables (la mutacion C  G es la más frecuente.

es/EvolMol/ Universidad de Granada José L.Transition/Transversion ratio = 15.7 !! Genes funcionales: Gen 1 Consenso Gen 2 Gen 3 … Evolucion Molecular http://bioinfo2.es/~oliver/ . Oliver http://www.ugr.ugr.

ugr.es/~oliver/ .ATCTAGATCTAGTGCATAGCATGCA |*|||*||*|||||*|||*|||*|| ACCTAAATTTAGTGAATATCATCCA p = nd / n Evolucion Molecular http://bioinfo2.ugr.es/EvolMol/ nd número de posiciones con nucleótidos diferentes A T C G probabilidad = 1/3 Universidad de Granada No vale Poisson José L. Oliver http://www.

es/~oliver/ . Oliver http://www.ugr.ugr.Método de Jukes y Cantor ∑=1 ∑=1 ∑=1 ∑=1 K = -3/4 ln(1 . K es una buena estima de la divergencia. Pero para distancias mayores. K sigue subestimando la divergencia Evolucion Molecular http://bioinfo2.es/EvolMol/ Universidad de Granada José L.4/3 p) siendo p = nd / n Si la distancia entre ambas secuencias es baja.

es/EvolMol/ Universidad de Granada José L. Oliver http://www.ugr.½ ln [(1 – 2P – Q) √ 1 – 2Q] Evolucion Molecular http://bioinfo2.ugr.es/~oliver/ .Método de Kimura con 2 parámetros (K2P) ∑=1 ∑=1 ∑=1 ∑=1 R+P+Q=1 K = .

Evolucion Molecular http://bioinfo2.es/~oliver/ .ugr.ugr.es/EvolMol/ Universidad de Granada José L. Oliver http://www.

Oliver http://www.ugr.Método de Tamura El contenido en G+C (θ) de las secuencias puede ser ≠ 0.5 Método de Tamura y Nei Toma en cuenta tanto el sesgo en G+C como en la proporción de transiciones / transversiones Evolucion Molecular http://bioinfo2.ugr.es/EvolMol/ Universidad de Granada José L.es/~oliver/ .

ugr.es/~oliver/ .ugr.Modelo general de sustitución de nucleótidos (12 parámetros) PERO no da estimas mejores que los de 6 parámetros Evolucion Molecular http://bioinfo2. Oliver http://www.es/EvolMol/ Universidad de Granada José L.

68 I II 0.64 0. se podría pensar que los métodos con más parámetros serán mejores..64 0.52 III III 0. ya que son más realistas • Pero en la práctica no es así debido a que hay que estimar más parámetros  menos estadística  más errores de muestreo (las secuencias son finitas.42 0. Oliver http://www.42 0.es/~oliver/ .88 0.) Ejemplo: estimas de K entre la α-globina de conejo y ratón Posición del codón JC I 0.) • Otro problema es que la fórmula de los métodos con más parámetros a menudo es inaplicable (logaritmos con argumento negativo..92 Inaplicable Evolucion Molecular http://bioinfo2. etc.Comparación de los diferentes métodos • En principio.ugr.ugr.es/EvolMol/ K2P GIN (6 parámetros) Divergencia II Universidad de Granada José L.

8  87.Divergencia II I III II: Valores bajos  Corrección poco importante (8.es/~oliver/ .9) José L.ugr. Oliver http://www.3) III:  “ altos Evolucion Molecular http://bioinfo2.es/EvolMol/ “ muy “ Universidad de Granada (36.5  9.ugr.

ugr.es/~oliver/ .Secuencia ‘ancestral’ Simulación mutaciones ..es/EvolMol/ K Universidad de Granada K K José L.ugr.. Oliver http://www.n veces Alineamientos K Evolucion Molecular http://bioinfo2.

Simulación Evolucion Molecular http://bioinfo2. Oliver http://www.ugr.ugr.es/EvolMol/ Universidad de Granada José L.es/~oliver/ .

ugr. pero importan menos para estimar la topologia (orden de ramificación) correcta Evolucion Molecular http://bioinfo2. Oliver http://www.Las distancias más sofisticadas (con más parámetros) son imprescindibles para estimar correctamente la longitud de las ramas en una filogenia.ugr.es/EvolMol/ Universidad de Granada José L.es/~oliver/ .

Oliver http://www.es/~oliver/ .es/EvolMol/ Universidad de Granada José L.Tasa de sustitución K Tasa de sustitución de nucleótidos: r = K / 2T Evolucion Molecular http://bioinfo2.ugr.ugr.

ugr.es/~oliver/ .ugr.es/EvolMol/ Universidad de Granada José L. Evolucion Molecular http://bioinfo2. Oliver http://www.β-globina • SS > NS • Mayor dispersión en SS The amount of nucleotide divergence at synonymous and nonsynonymous sites of the β-globin gene as a function of time since divergence.

es/EvolMol/ Universidad de Granada José L.ugr. Oliver http://www.es/~oliver/ .ugr.Histona H4 Gen: • 55 sustituciones • SS > NS Proteína: • 2 sustituciones Evolucion Molecular http://bioinfo2.

es/EvolMol/ Universidad de Granada José L.ugr.es/~oliver/ . roedores (ratón o rata) Evolucion Molecular http://bioinfo2. Oliver http://www.Humanos vs.ugr.

es/~oliver/ .ugr.Humanos vs.es/EvolMol/ Universidad de Granada José L. Oliver http://www.ugr. roedores (ratón o rata) Evolucion Molecular http://bioinfo2.

Variación en distintas regiones de los genes Evolucion Molecular http://bioinfo2. Oliver http://www.es/~oliver/ .ugr.es/EvolMol/ Universidad de Granada José L.ugr.

Oliver http://www. intrones Evolucion Molecular http://bioinfo2.ugr.ugr.Divergencia en exones vs.es/~oliver/ .es/EvolMol/ Universidad de Granada José L.

es/EvolMol/ Universidad de Granada José L.ugr.ugr.Variación de NS en el gen de la insulina NS Evolucion Molecular http://bioinfo2.es/~oliver/ . Oliver http://www.

es/EvolMol/ Universidad de Granada José L.ugr. Oliver http://www. Evolucion Molecular http://bioinfo2. etc.Tasa evolutiva en el genoma mitocondrial de mamíferos • Tasa de sustitución de nucleótidos muy alta: SS diez veces mayor que en el núcleo • Causas: • Alta concentración de radicales superóxido O2• Replicación poco fiel • Saturación rápida: linealidad hasta sólo 10 MA  Reloj rápido Filogenias entre especies próximas: primates.ugr.es/~oliver/ .

Oliver http://www.Tasa evolutiva en orgánulos de plantas Evolucion Molecular http://bioinfo2.es/EvolMol/ Universidad de Granada José L.ugr.es/~oliver/ .ugr.

es/EvolMol/ Universidad de Granada José L. Oliver http://www.Tasa evolutiva en virus Evolucion Molecular http://bioinfo2.ugr.ugr.es/~oliver/ .

Oliver http://www.es/~oliver/ .Tasa evolutiva en el virus de la gripe Evolucion Molecular http://bioinfo2.ugr.es/EvolMol/ Universidad de Granada José L.ugr.

Master your semester with Scribd & The New York Times

Special offer for students: Only $4.99/month.

Master your semester with Scribd & The New York Times

Cancel anytime.