Biochemistry and Molecular Biology

Tear Production After Bilateral Main Lacrimal Gland

Resection in Rabbits
Dhruva Bhattacharya,1 Yuan Ning,1,2 Fangkun Zhao,2 William Stevenson,1 Rongji Chen,1
Jinsong Zhang,2 and Mingwu Wang1
1

Department of Ophthalmology and Vision Science, University of Arizona College of Medicine, Tucson, Arizona, United States
Department of Ophthalmology, the Fourth Affiliated Hospital of China Medical University, Eye Hospital of China Medical
University, Key Lens Research Laboratory of Liaoning Province, Shenyang, China

Correspondence: Mingwu Wang,

Cornea and External Disease Service,
Department of Ophthalmology and
Vision Science, University of Arizona
College of Medicine, 655 N. Alvernon Way, Suite 108, Tucson, AZ
85711-1824, USA;
mwang@eyes.arizona.edu.
DB and YN contributed equally to the
work presented here and should
therefore be regarded as equivalent
authors.
Submitted: June 23, 2015
Accepted: October 29, 2015
Citation: Bhattacharya D, Ning Y, Zhao
F, et al. Tear production after bilateral
main lacrimal gland resection in rabbits. Invest Ophthalmol Vis Sci.
2015;56:77747783. DOI:10.1167/
iovs.15-17550

PURPOSE. This study reports tear compensation observed in rabbits with bilateral resection of
main lacrimal gland (LG) and explored the potential mechanisms.
METHODS. Dry eye conditions were created by resection of nictitating membrane (NM),
Harderian gland (HG), and main LG in eight (16 eyes) male New Zealand White rabbits. In
addition to Schirmer test, Periodic acid-Schiff (PAS) staining, and ocular surface staining with
fluorescein and rose Bengal, conjunctival impression cytology was employed before and up to
4 months after excision (AE). Using reverse transcription-quantitative polymerase chain
reaction (RT-qPCR), expression of inflammatory biomarkers (IL-1b, TNF-a, and matrix
metalloproteinase-9) were monitored. Further, involvement of ionic and water transporters
were investigated in conjunctival epithelium.
RESULTS. Significant dry eye phenotypes in rabbits were observed 1 month AE, which
corroborated with elevated biomarker mRNA expression. However, Schirmer test score and
goblet cell numbers never decreased AE in conjunctival epithelium. Moreover, ocular surface
staining, and biomarker expression declined to baseline in over 4 months AE. No upregulation
was observed of the following conjunctival ionic transporters: cystic fibrosis transmembrane
conductance regulator, sodium potassium chloride cotransporters, sodium potassium ATPase,
and epithelial sodium channels. Instead, aquaporin (AQP) 4 and AQP5 were upregulated.
Immunolocalization and immune blotting of AQP4 was demonstrated in rabbit conjunctival
epithelium.
CONCLUSIONS. In the absence of NM, HG, and main LG in rabbits, tear secretion was not
decreased and significant improvement of dry eye phenotypes observed with time AE.
Conjunctival AQPs are possibly involved in a compensatory tear fluid production.
Keywords: dry eyes, conjunctiva, aquaporins

ry eye syndrome (DES) is characterized by an immunoinflammatory response, affecting the ocular surface.1 Dry
eye syndrome involves defects in aqueous, lipid, and/or mucin
layers of the tear film (TF), resulting in damage to the ocular
surface.1,2 Dry eye syndrome is currently classified into two
categories, aqueous tear-deficient and evaporative dry eyes, all
leading to increase in tear osmolarity and ocular surface
inflammation.3 Ocular surface plays a significant role in the
modulation of tear volume and TF composition.4 The conjunctiva, and to a much lesser degree, the cornea, are involved in
basal tear production.4 Although the main lacrimal gland (LG) is
considered the major source of tears,5 the conjunctiva modifies
the TF by absorbing/secreting electrolytes and water and by
secreting proteins such as mucin.6
Diquafosol, an activator of the P2Y2 receptor, is now used as
a topical ophthalmic solution outside the United States for
DES.7 Diquafosol stimulates mucin secretion from conjunctival
goblet cells,8,9 activates the fluid pump mechanism of the
accessory LGs on the conjunctiva,1012 thereby promoting TF
stability and rehydration.7 Human clinical studies have demonstrated its efficacy in improving aqueous tear secretion1214 and
mucin secretion,1517 establishing a new dry eye treatment

strategy: tapping into the reserve of the conjunctiva for tear and
mucin augmentation.
It is believed that in the ocular epithelia, fluid transport
involves secondary active Cl transport which creates the
osmotic gradient to drive transepithelial water transport.18
Besides P2Y2 receptor, ionic transporters such as cystic fibrosis
transmembrane conductance regulator (CFTR), sodium potassium chloride cotransporter (NKCC), sodium potassium ATPase
(NKA), and epithelial sodium channels (ENaC) across conjunctival epithelium regulate the ionic gradient across ocular
surface as well.19 Additionally, the presence of aquaporin
(AQP)-type water channels in ocular surface tissues suggests
their role in water/fluid transport and TF homeostasis.20 Across
a variety of epithelial tissues, AQPs and CFTR have been
identified as the principal molecular pathways for water and
Cl transport, respectively.18 Aquaporin 3 and AQP5 have been
identified in conjunctival epithelium.2022
Previous in vitro studies have shown that rabbit conjunctival
epithelium has the capacity to provide adequate tear volume.23,24 In the present study, mixed-mechanism dry eye
conditions were created in rabbits by bilateral excision of the
nictitating membrane (NM), Harderian gland (HG), and main

Copyright 2015 The Association for Research in Vision and Ophthalmology, Inc.
iovs.arvojournals.org j ISSN: 1552-5783

7774

Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/Journals/IOVS/934740/ on 12/11/2015

Tear Production After Bilateral Main LG Resection

LG. The ocular surface status of these rabbits was evaluated
before and after the excision for 4 months. We herein report
findings of spontaneous improvement of dry eye phenotypes
and ocular surface inflammation in these rabbits, as well as our
initial attempt to delineate the underlying mechanism, by
analyzing different ionic and water transporter proteins
encoded by conjunctival epithelium.

METHODS
Experimental Animals and Ethics Statement
Male New Zealand white rabbits (n 8, 16 eyes; Harlan
Sprague Dawley, Indianapolis, IN, USA), weighing 2.0 to 2.5 kg
were used for the study. The rabbits were reared under
standard laboratory conditions (22 6 28C, 40% 6 5% relative
humidity, and a 12-hour lightdark cycle) with free access to
food and water throughout the experiment. The study was
conducted in compliance with the Tenets of the Declaration of
Helsinki and ARVO Statement for the use of Animals in
Ophthalmic and Visual Research. The protocol was approved
by the University of Arizona (Tucson, AZ, USA) Institutional
Animal Care and Use Committee (protocol# 14-511). All
surgeries were performed by skilled surgeons (YN and MW).

Operative Procedure
The bilateral resection of the NM, HG, and main LG was
performed following a modified surgical procedure of Chen et
al.25 Identical procedure was performed on both eyes. Briefly,
the skin of both periocular regions was shaved. Induction was
initiated with an intramuscular injection of Ketamine (25 mg/
kg; Henry Schein, New York, NY, USA) Xylazine (5 mg/kg;
Akorn, Inc., Decatur, IL, USA) and each rabbit intubated with
an uncuffed endotracheal tube. The general anesthesia was
maintained by 1% to 4% Isoflurane gas with 1.5 L/min oxygen
flow during the entire surgery. The cardiopulmonary status of
the animals and the depth of anesthesia were monitored every
5 minutes. The surgical field was disinfected with 5% betadine
and draped. In our procedure, the NM was first snipped off at
its base. The HG was extracted from the space between the
medial rectus muscle and the anterior wall of the orbit,
through the excision wound of the NM, and removed in its
entirety. Hemostasis was achieved by gentle pressure tamponade. Then the upper and lower eyelids were sutured together
to prevent dryness of the eye for the remainder of the
procedure. A curve-shaped linear incision was subsequently
made along the inferior and lateral orbital rims, to remove the
infraorbital, temporal, and intraorbital lobes of the main LG.
The orbit septum and skin wound were then closed separately
with interrupted 5-0 vicryl sutures. Buprenorphine sustainedrelease (0.3 mg/kg; Hospira, Lake Forest, IL, USA) was given
subcutaneously for perioperative pain management. Tobradex
ophthalmic ointment (Alcon, Puurs, Belgium) was administered topically at the surgical wounds three times a day for 7
days, and Enrofloxacin (10 mg/kg; Bayer, Pittsburgh, PA, USA)
was given subcutaneously once daily for 3 days as prophylactic
anti-infection.

Evaluations
All rabbits were assessed before excision (BE) and monthly up
to 4 months after excision (AE). To minimize slit-lamp finding
artifacts, the evaluations were carried out in 2 days in the
following sequence on each eye. The first day begins with
corneal fluorescein staining, followed immediately by rose
Bengal staining and conjunctival impression cytology. On the

IOVS j December 2015 j Vol. 56 j No. 13 j 7775

second day, Schirmer test I (SIt; without anesthesia) was
performed.

Corneal Fluorescein Staining Test

All 16 eyes of rabbits were examined under the slit-lamp
microscope (GR-54; Gilras LLC, Miami, FL, USA) with a cobalt
blue filter after instilling 1 drop 1% fluorescein solution. The
corneal fluorescein staining was assessed by a trained
ophthalmologist (YN), using the standard National Eye
Institute grading system.26,27 Briefly, the cornea was divided
into five areas (central, superior, nasal, inferior, and temporal);
punctate fluorescein staining in each area is graded on a scale
of 0 to 3, and the total score (015) is the sum of scores from
all five areas.

Rose Bengal Staining Test

After instilling 1 drop 0.1% rose Bengal solution (HUB
Pharmaceuticals, LLC, Rancho Cucamonga, CA, USA) all rabbit
eyes were examined under the yellow light of the same slitlamp microscope by the same ophthalmologist (YN). Areas of
rose Bengal staining represent dead or dying cells. Within the
palpebral fissure, the exposed ocular surface was divided into
three sections: nasal and temporal bulbar conjunctiva, and the
central cornea. The intensity of staining in each section was
scored up to three points, with a maximum possible score of
nine points.

Schirmer I Test
Briefly, after the rabbits were comfortably stabilized with a
restraining device, standard Schirmer test filter paper strips
(Alcon Laboratories, Inc., Fort Worth, TX, USA) were folded at
the 5-mm notch and inserted into the lower lateral one-third of
conjunctival fornix and eyelids closed by gentle force for 5
minutes. The length of the moistened paper was then
recorded. The test was performed three times and the average
score used for analysis.

Conjunctival Impression Cytology

Conjunctival impression cytology (CIC) was performed on
each rabbit eye after instilling 0.5% proparacaine hydrochloride
eye drop (Bausch & Lomb, Rochester, NY, USA) and wiping
away the excessive tear fluid. One 8-mm diameter nitrocellulose (Sartorius AG, G
ottingen, Germany) filter paper disc with a
pore size of 0.45 lm was gently placed on the surface of the
superior temporal bulbar conjunctiva 2 mm from the corneal
limbus. After applying light pressure for 5 seconds, the paper
was peeled off and immediately placed in either, Trizol solution
(Invitrogen, Carlsbad, CA, USA) for RNA isolation or 10%
formalin solution for Periodic acid-Schiff (PAS) staining or 100
lL radio immunoprecipitation assay (RIPA) buffer (Teknova,
Hollister, CA, USA) for protein isolation.
PAS Staining of CIC Specimens. The PAS staining was
performed following a modified procedure of Tseng et al.28
Briefly, CIC filter paper discs were placed in 70% ethyl alcohol
for 2 minutes and tap water (twice). Periodic acid (SigmaAldrich Corp., St. Louis, MO, USA) staining was carried out for
10 minutes and the discs were rinsed twice with tap water.
After staining with Schiff reagent (Sigma-Aldrich Corp.) for 2
minutes and rinsing twice with tap water, the discs were
stained with Gills Hematoxylin (Sigma-Aldrich Corp.) for 10
minutes. After rinsing twice with tap water, the discs were
mounted on glass slides for observation and photographing
under the microscope (EVOS FL Auto; Life Technologies,
Carlsbad, CA, USA).

Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/Journals/IOVS/934740/ on 12/11/2015

IOVS j December 2015 j Vol. 56 j No. 13 j 7776

Tear Production After Bilateral Main LG Resection

TABLE. Primer Sets Studied for Quantitating Gene Expressions by RT-qPCR
Gene

Forward Primer

Reverse Primer

NCBI Accession Number

b-actin
IL-1b
TNF-a
MMP-9
CFTR
ENaCaj
NKCC1
NKAa1
AQP4
AQP5

GGACATCAAGGAGAAGCTGTG
GGTGTTGTCTGGCACGTATG
AGTCCCCAAACAACCTCCAT
GTCTTCCCCTTCGTCTTCCT
CATTGAAAGCAGGTGGGATT
CGGACTGGCTTCTACCAGAGG
AAGAGGAGGAGGCGCATATT
GCTGACACGACAGAGAACCA
TGTGATTCCAAACGGACTGA
CTGGCATCCTCTACGGACTG

GGCAGCTCGTAGCTCTTCTC
CCTTGCACAAAACTCATGGA
TGGGCTAGAGGCTTGTCACT
CAGAAGCCCCACTTCTTGTC
GCTATGGCTCCAACCACAAT
CGGCAGGTGAAGATGAAGTT
TCTGCAAATCCCACCACATA
TCCTGGTTGGCCTGAAATAC
AGGTCCAAAAGATCGAGCAG
AGCTGGAAGGTGAGGATCAA

NM_001101683
M26295.1
M12845.1
NM_001082203
NM_001082716
AF229025
AF170447
AF235024
AF000312
AF495879

RNA Isolation and cDNA Synthesis

Total RNA was isolated from the CIC specimens in TRIzol
solution according to manufacturers instructions (Invitrogen).
RNA concentration was measured using NanoDrop ND-1000
Spectrophotometer (NanoDrop Technologies, Wilmington, DE,
USA). The purity of the RNA was assessed by absorbance ratio
at 260/280 nm. A ratio greater than 1.9 was considered good
quality RNA preparation and used for further experiments. The
first strand cDNA synthesis was performed with QuantiTect
Reverse Transcription Kit (Qiagen, Valencia, CA, USA) using
approximately 500 ng total RNA according to manufacturers
instructions. Reverse transcription was initiated using RTprimer mix (oligo-dT and random primers) supplied with the
kit.

Primer Design and Evaluation

Primers with an annealing temperature of 608C were designed
using OligoPerfect Designer (Life Technologies) for amplifying
coding sequence fragments of 100 to 135 bp in length. The
primer sequences used in this study are listed in the Table.

Reverse Transcription-Quantitative Polymerase

Chain Reaction (RT-qPCR)
The reverse transcription (RT) reactions were set using
QuantiTect SYBR Green PCR kit (Qiagen). The 25 lL total
volume of reaction mixture contained 12.5 lL 23 SYBR Green
PCR Master Mix (Qiagen), 0.4 lM forward and reverse primers,
and 1 lL cDNA. The qPCR was performed on StepOnePlus
Real-Time PCR System (Applied Biosystems, Foster City, CA,
USA) with the following amplification cycling conditions: 15
minutes, 958C initial denaturation; 40 cycles of 15 seconds,
958C denaturation, 30 seconds, 608C primer annealing, and 30
seconds, 728C extension. The fluorescence was recorded
during the elongation step in each cycle. A melting curve
analysis was performed at the end of each PCR by gradually
increasing the temperature from 608C to 958C while recording
the fluorescence. A single peak at the melting temperature of
the PCR-product confirmed primer specificity. To be able to
compare between different runs, we used a fixed fluorescence
threshold for derivation of the cycle threshold (CT) value for all
runs. We performed three technical replicates for each
biological specimen to evaluate the relative quantification.

Relative Quantification of mRNA Levels

Relative quantification of the expression of different genes
(Table) from each rabbit CIC specimen was performed at each
time point BE and AE. The fold change in expression of tested
genes was relative to the internal housekeeping gene, b-actin

(endogenous control gene). The mean fold change in

expression of genes was calculated using 2DDCT method,
where DDCT (CTGene  CTActin)after excision  (CTGene 
CTActin)before excision. Differences between CT for each target
mRNA and b-actin in each specimen was used to calculate
level of target mRNA relative to that of b-actin mRNA in the
same specimen.

Immunohistochemistry
To verify the expression of AQP4 in the rabbit conjunctiva,
immunohistochemistry was performed. Fresh conjunctiva
tissues from unoperated and operated rabbits were immediately embedded in cryomolds with tissue freezing medium
(Triangle Biomedical Sciences, Durham, NC, USA), frozen in
Isopentane (Sigma-Aldrich Corp.) cooled on dry ice, and then
stored at 808C. Conjunctiva tissues were sectioned (4 lm),
fixed in cold acetone for 10 minutes, air dried, and stored at
808C until further use. Slides were stained using Ventana
Medical Systems automated platform (Roche, Tucson, AZ, USA)
using standard DAB staining kit (Ventana Medical Systems, Inc.,
Roche) as per manufacturers instructions. The primary
antibody was mouse monoclonal antibody (which cross reacts
with rabbit) to AQP4 (Abcam, Cambridge, MA, USA) diluted at
1:30 with Ventana PSS diluent (Ventana Medical Systems, Inc.,
Roche). After incubation at 378C for 30 minutes, the slides
were incubated with anti-mouse IgG biotin labeled antibody
(Vector Laboratories, Burlingame, CA, USA) at 1:200 dilution
and incubated at 378C for 30 minutes. Finally, the slides were
counter stained with Hematoxylin II (Ventana Medical Systems,
Inc., Roche) and bluing reagent (Ventana Medical Systems, Inc.,
Roche). The staining was observed and photographed using a
light microscope (Nikon Eclipse Ti; Nikon, Melville, NY, USA).

Immunoblotting
Total cell lysate proteins were isolated from CIC in RIPA buffer
with 13 HALT protease and phosphatase inhibitor single use
inhibitor cocktail (Thermoscientific, Rockford, IL, USA) by
incubating on ice for 30 minutes. Protein concentration was
determined by Pierce BCA Protein Assay Kit (Thermo Fisher
Scientific, New York, NY, USA). Samples were mixed with
Laemmli sample buffer (Bio-Rad Laboratories, Inc., Hercules,
CA, USA) containing b-mercaptoethanol and heated at 958C for
10 minutes. Proteins (15 lg) were resolved on 10% Mini
PROTEAN TGX precast gels (Bio-Rad Laboratories, Inc.) in
electrophoresis cell (Bio-Rad Laboratories, Inc.) using 13 Tris/
Glycine/SDS buffer (Bio-Rad Laboratories, Inc.). Resolved
proteins were transferred to immuno-Blot PVDF membrane
using 13 Glycine/SDS buffer (Bio-Rad Laboratories, Inc.) and
20% methanol (Sigma-Aldrich Corp.). The membrane was

Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/Journals/IOVS/934740/ on 12/11/2015

IOVS j December 2015 j Vol. 56 j No. 13 j 7777

Tear Production After Bilateral Main LG Resection

nonfat dried milk. The membrane was finally washed thrice

with 13 TBS-T buffer, incubated with super signal west pico
chemiluminescent substrate (Thermoscientific) for 1 minutes,
exposed to Amersham Hyper film TM ECL (GE Health Care
Ltd., Pittsburgh, PA, USA), and developed using SRX-101A
medical film processor (Konica Minolta Medical and Graphic,
Inc., Shanghai, China). Apparent molecular weights were
determined using precision plus protein all blue standards
(Bio-Rad Laboratories, Inc.).

Data Analysis and Statistics

Data in figures are presented as mean standard error method,
the bars representing standard errors. Statistical significance
between two groups (BE and AE) was evaluated using unpaired
2-tailed t-test. A probability of P equal to 0.05 was considered
significant (where applicable, *P < 0.05, **P < 0.01, ***P <
0.001).

RESULTS
Ocular Surface Changes
FIGURE 1. Clinical examination of the rabbit eyes before (BE) and after
(AE). Comparing with BE, increased staining of fluorescein on the
cornea (top panels) and that of rose Bengal on both the cornea and
conjunctiva (bottom panels) was observed 1 month AE.

Significantly higher scores for both fluorescein and rose Bengal

staining demonstrated the presence of dry eye phenotypes in
as early as 1 month AE (Fig. 1). Interestingly, both fluorescein
and rose Bengal staining on the cornea and conjunctiva
progressively reduced with time AE (Fig. 2).

blocked at room temperature for 1 hour with 5% nonfat dried

milk prepared in 13 TBS-T (50 mM Tris-HCl [pH: 7.5], 150 mM
NaCl, 0.05% Tween20) buffer. The membrane was then
thoroughly washed with 13 TBS-T buffer and incubated at
48C for overnight with the primary antibody mouse monoclonal antibody to AQP4 (Abcam) at 1:200 dilution prepared in 3%
bovine serum albumin (Sigma-Aldrich Corp.). Next, the
membrane was thoroughly washed with 13 TBS-T buffer and
incubated at room temperature for 1 hour with secondary
antibody goat anti-mouse IgG-HRP (Santa Cruz Biotechnology,
Inc., Fort Worth, TX, USA) at 1:10,000 dilution prepared in 5%

Tear Secretion as Measured by Schirmer I Test

Interestingly, there was no significant reduction in tear
production over the 4-month period AE (Fig. 3). The SIt score
was 20.49 BE and slightly reduced to 18.18 at 1 month AE, but
such a reduction was not significant (P 0.18). Schirmer I test
scores were 22.89 at 2 months (P 0.083), 25.70 at 3 months
(P 0.0004), and 20.96 at 4 months AE (P 0.799; Fig. 3). Our
data shows that the tear secretion increased significantly at 3
months, and then returned to baseline level at 4 months AE. It
appears that the level of tear secretion at each time point was

FIGURE 2. Fluorescein and rose Bengal staining scores of rabbit ocular surface before (BE) and after (AE) excision. Fluorescein and rose Bengal
staining scores are compared BE with each time points AE.

Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/Journals/IOVS/934740/ on 12/11/2015

IOVS j December 2015 j Vol. 56 j No. 13 j 7778

Tear Production After Bilateral Main LG Resection

FIGURE 3. Monitoring of tear secretion on rabbit eyes before (BE) and

after (AE) excision. Schirmer I test scores were compared to reflect tear
secretion change BE and AE. No significant reduction of tear secretion
over a 4-month period AE was noted. There was significant increase of
tear secretion at 3 month AE.

negatively but synchronously associated with the levels of

corneal and conjunctival staining as shown in Figure 2.

Assessment of Goblet Cells by Impression

Cytology
Periodic acid-Schiff staining demonstrated abundance of goblet
cells within the conjunctival epithelium of rabbit eyes (Fig. 4).
However, due to inconsistency of sampling between discs and
even in different areas of one disc, reliable quantitative analysis
was not feasible to assess the changes in conjunctival goblet
cell number BE and AE. No obvious morphologic change of the
goblet cells was noted BE and AE.

mRNA Level of Dry Eye Biomarkers

To estimate the changes of ocular surface inflammation, the
mRNA level of DES-associated inflammatory cytokines27,2933
was assessed from the CIC specimens. The cytokine markers,
IL-1b, TNF-a, and ocular surface injury marker matrix metalloproteinase (MMP)-9 showed significant elevation at 1 month
AE, but over the following 3 months, their expression
progressively declined to the baseline level (Fig. 5). Interleukin-1b was upregulated 96-fold at 1 month AE (P 0.0027) and
then declined to 24-fold at 2 months (P 0.0002), 13-fold at 3
months (P 0.008), and finally to 4-fold at 4 month AE (P
0.0533). Similarly, TNF-a was 9-fold upregulated at 1 month AE
(P 0.0064), then declined to 3- (P 0.122), 2- (P 0.265),
and 1.5-fold (P 0.31) at 2, 3, and 4 months AE, respectively.
Matrix metalloproteinase-9 followed a similar trend from 13fold upregulation at 1 month AE (P 0.0289) to a progressive
reduction to the baseline level over 4 months AE (P 0.162).

Screening of Genes Modulating Ocular Fluid in the

Conjunctival Epithelium
To understand the compensatory mechanisms involved in
maintaining the tear volume, we investigated the expression of
genes potentially involved in regulating the ocular surface
water and Cl, Na, K transport. We quantified the mRNA
expression of AQP4, AQP5, CFTR, NKA, NKCC1, and ENaCa.
Interestingly, none of the ionic transporters showed any

FIGURE 4. Periodic acidSchiff staining of the goblet cells in the

conjunctival epithelium of rabbit eyes. Representative photo of the PAS
stained goblet cells (arrowheads) among the squamous epithelial cells
(arrows) of rabbit eyes from conjunctival impression cytology.

upregulation during the observation period of 4 months AE.

Of all the genes screened, only AQP5 showed significant
upregulation. AQP4 showed a trend of upregulation at 2 (P
0.0837) and 3 months (P 0.142), and then declined to
baseline level at 4 months AE (Fig. 6). AQP5 was significantly
upregulated, earlier than AQP4, at 1 (P 0.0311), 2 (P
0.0004), 3 (P 0.0475) months, and stayed nearly 2-fold
upregulated at 4 months AE (Fig. 6).

Expression of AQP4 in Rabbit Conjunctival

Epithelium
It has not been previously reported that AQP4 is expressed in
the conjunctival epithelium. Because the upregulation of AQP4
mRNA was detected, we set out to verify the posttranslational
expression of this water channel molecule. Immunostaining
against AQP4 demonstrated the abundant presence of the
AQP4 in all layers of rabbit conjunctival epithelium except for
the subepithelial stroma (Fig. 7). Both the squamous epithelial
and the goblet cells of rabbit conjunctiva showed positive
staining. There were no distinct differences in the AQP4
expression in the conjunctival tissue in rabbits without surgical
excision (Fig. 7A) and AE (Fig. 7B).
Immunoblotting against AQP4 for the total protein isolated
from the conjunctival epithelium showed the presence of the
dimeric form of AQP434,35 of size approximately 65 kDa (Fig. 8)
in rabbits without surgical excision (lane 1) and AE (lane 2).

DISCUSSION
In the present study, it is tantalizing to see that the tear
secretion never decreased over time in the rabbits after the
NM, HG, and main LG were surgically ablated. At 1 month AE,
the rabbits indeed demonstrated significant dry eye phenotypes clinically (increased fluorescein and rose Bengal staining), which were corroborated by the elevated ocular surface
inflammatory biomarker expression in the conjunctival epithelium. However, with no external intervention, the clinical
signs of dry eye improved and ocular surface inflammation
decreased to the baseline level (BE) in over 4 months. This
seems to suggest that in acute dry eyes, as created in our
experiment, ocular surface injury, and inflammation can be

Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/Journals/IOVS/934740/ on 12/11/2015

Tear Production After Bilateral Main LG Resection

IOVS j December 2015 j Vol. 56 j No. 13 j 7779

FIGURE 5. The expression of inflammatory biomarker genes in rabbit conjunctival epithelium before (BE) and after (AE) excision. Significant
upregulation of IL-1b, TNF-a, and MMP-9 was seen at 1 month AE, but the upregulation declined with time to the baseline level BE. The fold change
in expression of an inflammatory biomarker gene is relative to internal housekeeping gene, b-actin (endogenous control gene).

mostly reverted as long as the tear volume is maintained. This

should be distinguished from human DES caused by an
underlying autoimmune disorder such as Sj
ogrens syndrome,
a chronic dry eye condition, in which both the main LG and
the conjunctiva are affected by inflammatory infiltration.3638
This can explain why no compensatory conjunctival tear
secretion has been observed in Sj
ogrens syndrome patients,
even at the early stage of this disease. Hence, it makes sense
that treatment strategy for DES caused by an underlying
autoimmune disorder needs to be targeting disease-relevant
inflammatory mediators.36,39,40 It is not surprising to see some
residual dry eye phenotypes due to the mixed-mechanism dry
eye conditions created in our study. The HG secretes lipid to
the ocular surface which retards tear evaporation. The NM, as a
third eyelid, helps to spread the tears over the ocular surface
and to contain evaporation.
Our observations that tear secretion were not affected in
the absence of the main LG suggest the presence of a
compensatory mechanism in the remaining ocular surface
tissues. In previous studies,25,41 approximately 30% to 45%
reduction in tear secretion was seen upon unilateral resection
of the NM, HG, and main LG, as compared with the unoperated
side. The retention of 55% to 70% tear secretion capacity seen
in these previous studies also suggests alternative sources of
ocular surface tears. In our study, three of the eight rabbits
were later randomly chosen and euthanized for autopsies.
Careful inspection of the ocular orbits of all six eyes did not
reveal any LG or HG tissues to suggest either an incomplete

excision or regeneration. Hence, the alternative sources of

tears would have to come from the remaining ocular surface
tissues: the conjunctiva and the accessory LGs.
There are several possible explanations to our finding of
robust tear secretion in the absence of the HG and main LG.
First, we specifically chose male rabbits to study in order to
minimize possible influence from sex hormones on the
conjunctival function. Sex hormone alteration, especially
androgen deficiency, adversely affects ocular surface homeostasis.3 Whereas previously, Chen et al.25 used Japanese albino
rabbits of both sexes in their studies, and Li et al.41 used female
New Zealand white rabbits only. Female rabbits, under the
influence of hormones, possibly have a less robust capacity to
compensate for the surgically induced dry eye condition.
Second, bilateral surgery could also contribute to the
discrepancy seen in our study. We believe bilateral surgery is
important because DES is an immune mediated ocular surface
disorder involving both eyes.32,42 In addition, the regulation of
lacrimal secretion involves the central nervous control: afferent
trigeminal sensory fibers from the ocular surface (cornea and
conjunctiva), superior salivary nucleus in the pons and efferent
fibers through the pterygopalatine ganglion.1 The neural
pathway control, such as blink reflex to noxious ocular surface
stimuli, involves bilateral somatosensory cortex.43 As a result,
the response to the unilateral, surgically induced dry eye
would ultimately lead to a compensatory over secretion on the
unoperated side. In our study, comparisons were made not
between eyes of the same animal, but against the same eyes BE

Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/Journals/IOVS/934740/ on 12/11/2015

Tear Production After Bilateral Main LG Resection

IOVS j December 2015 j Vol. 56 j No. 13 j 7780

FIGURE 6. Upregulation of aquaporin 4 and 5 in rabbit conjunctival epithelium AE. AQP4 gene showed a trend of upregulation (P > 0.05 at all time
points) AE as compared with BE, whereas AQP5 gene showed significant upregulation at 1, 2, and 3 months AE. The fold change in expression of a
gene is relative to internal housekeeping gene, b-actin (endogenous control gene).

and AE at different time points. Third, there have been reports

supporting that the main LG is not indispensable under certain
conditions. Unilateral removal of the main LG did not result in
keartoconjunctivitis sicca (KCS) in squirrel monkeys, although
tear secretion decreased significantly.44 In patients who
underwent palpebral dacryoadenectomy for the treatment of
epiphora, up to 86% did not develop dry eyes and up to 50%
continued to have epiphora.45,46 In this procedure only the
palpebral lobe of the main LG is surgically removed through a
conjunctival incision. However, because the tear ducts from
the orbital lobe of the LG traverse the palpebral lobe, removal
of the palpebral lobe essentially blocks orbital lobe secretion to
the superior lateral conjunctival fornix. Fourth, even in some
rabbit dry eye models created with similar surgeries as ours,
significant reduction in tear secretion was not seen in all
studies. Gilbard et al.47 cauterized bilateral lacrimal excretory
ducts in their model, in addition to excising the NM and HG.
Although tear osmolarity increased and goblet cell density
decreased significantly, tear secretion was unchanged. This was
thought by others to be due possibly to incomplete cauteriza-

tion of the excretory ducts,25 but it is very unlikely that

incomplete cauterization took place in all animals. In a study
by Odaka et al.,48 not all rabbits had evidence of dry eyes
(inadequate tear volume, decreased goblet cell density, and
KCS) 4 weeks after resection of the NM, HG, and main LG.
Moreover, laboratory studies also supported that rabbit
conjunctival epithelium has the capacity to be the primary
source of TF. It was measured in one study that in rabbits, the
basal conjunctival fluid secretory rate is 0.79 lL/min, whereas
the basal tear production rate is 0.72 lL/min.23 Another study
demonstrated that the conjunctival fluid secretion was 175%
greater than tear turnover.24 Taken together, it is plausible to
speculate that, at least in rabbits, alternative tear secretion can
be augmented in compensation for the deficiency of the main
LG.6,46,49,21 The conjunctiva and the accessory LGs underneath
it are most likely responsible for such compensatory tear
production.
It is known that the genetic construction of mouse or rat
ocular surface is closer to that of humans. We instead chose
rabbits for our study mainly for the following reasons. The

FIGURE 7. Immunolocalization of AQP4 on rabbit conjunctival epithelium. Immunostaining against AQP4 demonstrated the abundant presence of
AQP4 in the membrane of squamous epithelial and goblet cells of the conjunctiva in rabbits without excision (A) and AE (B) of the main lacrimal
gland, Harderian glands, and nictitating membrane. The subepithelial conjunctival stroma stained negative. Inset (B): It appears that the localization
of AQP4 is on all aspects of the cell membrane in the basal layer of the epithelium (arrowheads). In the apical layer, AQP4 staining appears more
predominantly on the basolateral aspect of the cells (arrows).

Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/Journals/IOVS/934740/ on 12/11/2015

Tear Production After Bilateral Main LG Resection

FIGURE 8. Detection of AQP4 on rabbit conjunctival epithelium.

Immunoblotting against AQP4 demonstrated the presence of dimeric
form of AQP4 (~65 kDa) in the total cell protein isolated from the
rabbit conjunctival epithelium procured from conjunctival impression
cytology. Lane 1: rabbit conjunctiva without excision; lane 2: rabbit
conjunctiva AE.

surface area of mouse conjunctiva occupies a much smaller

fraction of the entire ocular surface. Therefore, the functional
contribution of mouse or rat conjunctiva to the TF may not be
comparable to that of humans. On the other hand, the surface
area occupied by rabbit conjunctiva is closer to that of humans.
In addition, mouse eyes are small and their lacrimal apparatus
not amendable to surgical maneuver. In particular, the intraorbital LG and the HG are all located in the retrobulbar
compartment. It is near impossible to extract these glands
without severely damaging the conjunctiva and even the optic
nerve. Moreover, the histoarchitectural features of the rabbit
LG more closely resemble those of the human LG, in
comparison to mice and rats.50 The functional implication of
such resemblance is not yet clear, but could suggest that the
main LG contributes similarly to the ocular surface tear fluid in
both rabbits and humans. Likewise, the remaining tear
contributors at the ocular surface, including the conjunctiva,
could function similarly as well.
Ocular surface, lined by stratified corneal and conjunctival
epithelia, lies in contact with TF. Net ionic fluxes are
determined by mass action and by transmembrane Na
concentration gradient. Net fluxes of Na, K, and Cl into
cells and that of H and HCO3 out of cells establish an
osmotic gradient, which dictates the direction of the water
flow across the plasma membranes.19 Corneal and conjunctival
epithelia secrete Cl and absorb Na.6 In conjunctival
epithelium, Cl secretion (basolateral to apical movement)
accounts for approximately 60% and Na reabsorption (apical
to basolateral) accounts for approximately 40% of net ionic
transport.6,21 Hara et al.51 suggested that this ionic transport
may determine the amount of tears collected in the conjunctiva sac, which potentially affect the stability of TF. The ENaC
in mouse,52 rabbit, and human conjunctiva51 mediates active
Na reabsorption to maintain the electrolyte/water homeostasis.53 Similarly, CFTR (involved in secretion/transepithelial
conductance of Cl) has a potential role in the major pathways
for Cl transport at the ocular surface.4 Other transporters such
as NKCC and NKA have also been implicated in maintaining
the ionic balance of the ocular fluid.
To delineate the compensatory tear secretion mechanisms
seen in our study, we assayed the mRNA expression of different
ionic transporters (CFTR, NKA, NKCCI, and ENaC) in the
conjunctival epithelium.51 To our surprise, none of the
conjunctival ionic transporters studied showed any evidence
of upregulation by 4 months AE. Because the tissue procured
by CIC contains only the conjunctival epithelium, this could
mean that the conjunctival epithelium is not actively involved
in the compensatory tear secretion at the ocular surface.
However, previous studies have indicated that basal CFTR
activity may be very low under normal conditions, so that
ocular surface hydration does not depend on CFTR function.4
Reduced CFTR function produces only minor effects on ocular
functions.18 It was therefore proposed that upregulation of

IOVS j December 2015 j Vol. 56 j No. 13 j 7781

alternative secretory pathways either in tear producing glands,
or within the cornea or conjunctiva, may compensate for an
impaired CFTR Cl channel function.4 Thus, lack of evidence
for upregulation of the ionic transporters assayed in our study
cannot exclude the conjunctiva as a candidate tissue for
compensatory tear secretion.
AQP-type water channels are a family of small transmembrane proteins that facilitate osmotically driven water transport
across cell plasma membranes, providing the major molecular
pathway for water movement.20 Ocular surface AQPs facilitates
osmotically driven water transport across cell plasma membranes in maintaining the tear volume and osmolarity.18,54 Of
all the AQPs encoded in ocular surface, AQP4, and AQP5
functions primarily as water selective transporters and AQP5,
in particularly, is associated with tear formation by the LG.55
Interestingly, it has been concluded that water transport
facilitated by conjunctiva encoded AQP 3 does not play any
role in transconjunctival fluid movement.20
In our study, AQP4 and AQP5 indeed showed an upregulation from 1 to 3 months, and returned to near baseline by 4
months AE. This could be an important mechanism to explain
the maintained tear secretion capacity at the ocular surface
after the resection of the main LG. Because major transporters
for Cl (CFTR) and Na (ENaC) showed no evidence of mRNA
upregulation, over expression of AQPs in the conjunctiva
epithelium suggests that the increase of water flow to the
ocular surface is achieved mainly through the increase of
highly permeable pathways (predominantly AQP5), not
through the increase of net movement of electrolytes across
the cell membrane.
It has been previously shown that AQP 5 provides the
principal route for osmotically driven water flux across the
intact corneal epithelium.20 Histologically, the corneal epithelium has all the transporters, and it can be mobilized to
transport fluid when its intercellular junctions are immature
and permeable, 56 although at a very low rate. 57 Our
preliminary in vivo data in rabbit conjunctiva suggests a
transcellular water flux mechanism rather than a paracellular
one.
The role of accessory LGs (such as the gland of Wolfring)
was not investigated in this study due to technical challenges.
The function of accessory LGs could be important for ocular
surface biology58 and may contribute significantly to the tear
fluid components.59 In fact, it has been shown that these
glands function similarly to the main LG in contributing to the
electrolytes and volume of the tear fluid.44,58 Gland of Wolfring
expresses most of the same channels and transporters related
to K secretion that have been identified in the LG thus
indicating a possible contribution to the elevated K concentration in tears.60 Bergmanson et al.61 demonstrated that the
rabbit conjunctiva contains glands similar to the gland of
Wolfring. Therefore, it is very important to be able to study the
accessory lacrimal glands in the future. We plan to procure
accessory lacrimal gland cells using laser microdissection and
further study the mRNA profiles of the different ionic and
water transporters in these cells.
To summarize, a mixed-mechanism dry eye condition was
surgically created in rabbits by resection of NM, HG, and main
LG. Significant dry eye phenotypes in association with elevated
ocular surface inflammation were observed at 1 month AE
although tear secretion was not decreased. Interestingly, with
no intervention, dry eye phenotypes and ocular surface
inflammation gradually improved over a period of 4 months
AE. This indicates compensatory tear secretion from the
remaining ocular surface tissues and adequate tear fluid alone
can alleviate ocular surface damage in an acute dry eye
situation. AQP 4 and AQP 5, among other conjunctival water
transporters, appear to be involved in restoring the ocular

Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/Journals/IOVS/934740/ on 12/11/2015

Tear Production After Bilateral Main LG Resection

surface fluids. Our study demonstrates the pivotal role played
by the conjunctiva in the maintenance of ocular surface
homeostasis. In addition, the conjunctiva could be a target
tissue, as in the case of Diquafosol, for therapeutic interventions of DES.

Acknowledgments
The authors thank the Animal Care Facility at the University of
Arizona for the care of our animals throughout this study.
Supported by Research to Prevent Blindness Foundation (New
York, NY, USA) and Department of Ophthalmology and Vision
Science at University of Arizona (Tucson, AZ, USA).
Disclosure: Disclosure: D. Bhattacharya, None; Y. Ning, None; F.
Zhao, None; W. Stevenson, None; R. Chen, None; J. Zhang,
None; M. Wang, None

References
1. The definition and classification of dry eye disease: report of
the Definition and Classification Subcommittee of the International Dry Eye WorkShop. Ocul Surf. 2007;5:7592.
2. Sambursky R, David WF III, Latkany R, et al. Sensitivity and
specificity of a point-of-care matrix metalloproteinase 9
immunoassay for diagnosing inflammation related to dry eye.
JAMA Ophthalmol. 2013;131:2428.
3. The epidemiology of dry eye disease: report of the Epidemiology Subcommittee of the International Dry Eye WorkShop.
Ocul Surf. 2007;5:93107.
4. Levin MH, Verkman AS. CFTR-regulated chloride transport at
the ocular surface in living mice measured by potential
differences. Invest Ophthalmol Vis Sci. 2005;46:14281434.
5. Thorig L, van Agtmaal EJ, Glasius E, Tan KL, van Haeringen NJ.
Comparison of tears and lacrimal gland fluid in the rabbit and
guinea pig. Curr Eye Res. 1985;4:913920.
6. Dartt DA. Regulation of mucin and fluid secretion by
conjunctival epithelial cells. Prog Retin Eye Res. 2002;21:
555576.
7. Gong L, Sun X, Ma Z, et al. A randomised, parallel-group
comparison study of diquafosol ophthalmic solution in
patients with dry eye in China and Singapore. Br J
Ophthalmol. 2015;99:903908.
8. Jumblatt JE, Jumblatt MM. Regulation of ocular mucin
secretion by P2Y2 nucleotide receptors in rabbit and human
conjunctiva. Exp Eye Res. 1998;67:341346.
9. Kemp PA, Sugar RA, Jackson AD. Nucleotide-mediated mucin
secretion from differentiated human bronchial epithelial cells.
Am J Respir Cell Mol Biol. 2004;31:446455.
10. Murakami T, Fujihara T, Horibe Y, Nakamura M. Diquafosol
elicits increases in net Cl- transport through P2Y2 receptor
stimulation in rabbit conjunctiva. Ophthalmic Res. 2004;36:
8993.
11. Nichols KK, Yerxa B, Kellerman DJ. Diquafosol tetrasodium: a
novel dry eye therapy. Expert Opin Investig Drugs. 2004;13:
4754.
12. Tauber J, Davitt WF, Bokosky JE, et al. Double-masked,
placebo-controlled safety and efficacy trial of diquafosol
tetrasodium (INS365) ophthalmic solution for the treatment
of dry eye. Cornea. 2004;23:784792.
13. Yokoi N, Kato H, Kinoshita S. Facilitation of tear fluid secretion
by 3% diquafosol ophthalmic solution in normal human eyes.
Am J Ophthalmol. 2014;157:8592.
14. Koh S, Maeda N, Ikeda C, et al. Effect of diquafosol ophthalmic
solution on the optical quality of the eyes in patients with
aqueous-deficient dry eye. Acta Ophthalmol. 2014;92:671
675.

IOVS j December 2015 j Vol. 56 j No. 13 j 7782

15. Shigeyasu C, Hirano S, Akune Y, Yamada M. Diquafosol
tetrasodium increases the concentration of mucin-like substances in tears of healthy human subjects. Curr Eye Res.
2015;40:878883.
16. Terakado K, Yogo T, Kohara Y, et al. Conjunctival expression of
the P2Y2 receptor and the effects of 3% diquafosol ophthalmic
solution in dogs. Vet J. 2014;202:4852.
17. Mori Y, Nejima R, Masuda A, et al. Effect of diquafosol
tetrasodium eye drop for persistent dry eye after laser in situ
keratomileusis. Cornea. 2014;33:659662.
18. Levin MH, Verkman AS. Aquaporins and CFTR in ocular
epithelial fluid transport. J Membr Biol. 2006;210:105115.
19. Ding C, Parsa L, Nandoskar P, et al. Duct system of the rabbit
lacrimal gland: structural characteristics and role in lacrimal
secretion. Invest Ophthalmol Vis Sci. 2010;51:29602967.
20. Levin MH, Verkman AS. Aquaporin-dependent water permeation at the mouse ocular surface: in vivo microfluorimetric
measurements in cornea and conjunctiva. Invest Ophthalmol
Vis Sci. 2004;45:44234432.
21. Candia OA. Electrolyte and fluid transport across corneal,
conjunctival and lens epithelia. Exp Eye Res. 2004;78:527
535.
22. Oen H, Cheng P, Turner HC, Alvarez LJ, Candia OA.
Identification and localization of aquaporin 5 in the mammalian conjunctival epithelium. Exp Eye Res. 2006;83:995998.
23. Li Y, Kuang K, Yerxa B, et al. Rabbit conjunctival epithelium
transports fluid, and P2Y2(2) receptor agonists stimulate Cl(-)
and fluid secretion. Am J Physiol Cell Physiol. 2001;281:595
602.
24. Shiue MH, Kulkarni AA, Gukasyan HJ, et al. Pharmacological
modulation of fluid secretion in the pigmented rabbit
conjunctiva. Life Sci. 2000;66:105111.
25. Chen ZY, Liang QF, Yu GY. Establishment of a rabbit model for
keratoconjunctivitis sicca. Cornea. 201130:10241029.
26. Lemp MA. Report of the National Eye Institute/Industry
workshop on Clinical Trials in Dry Eyes. CLAO J. 1995;21:
221232.
27. Marko CK, Menon BB, Chen G, et al. SPDEF null mice lack
conjunctival goblet cells and provide a model of dry eye. Am J
Pathol. 2013;183:3548.
28. Tseng SC. Staging of conjunctival squamous metaplasia by
impression cytology. Ophthalmology. 1985;92:728733.
29. Chen YT, Nikulina K, Lazarev S, et al. Interleukin-1 as a
phenotypic immunomodulator in keratinizing squamous
metaplasia of the ocular surface in Sj
ogrens syndrome. Am J
Pathol. 2010;177:13331343.
30. De Paiva CS, Chotikavanich S, Pangelinan SB, et al. IL-17
disrupts corneal barrier following desiccating stress. Mucosal
Immunol. 2009;2:243253.
31. Yeh S, Song XJ, Farley W, et al. Apoptosis of ocular surface cells
in experimentally induced dry eye. Invest Ophthalmol Vis Sci.
2003;44:124129.
32. Stevenson W, Chauhan SK, Dana R. Dry eye disease: an
immune-mediated ocular surface disorder. Arch Ophthalmol.
2012;130:90100.
33. Marko CK, Tisdale AS, Spurr-Michaud S, Evans C, Gipson IK.
The ocular surface phenotype of Muc5ac and Muc5b null
mice. Invest Ophthalmol Vis Sci. 2014;55:291300.
34. Promeneur D, Lunde LK, Amiry-Moghaddam M, Agre P.
Protective role of brain water channel AQP4 in murine
cerebral malaria. Proc Natl Acad Sci U S A. 2013;110:1035
1040.
35. Trinh-Trang-Tan MM, Cartron JP, Bankir L. Molecular basis for
the dialysis disequilibrium syndrome: altered aquaporin and
urea transporter expression in the brain. Nephrol Dial
Transplant. 2005;20:19841988.

Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/Journals/IOVS/934740/ on 12/11/2015

Tear Production After Bilateral Main LG Resection

36. Pflugfelder SC. What causes dryness in Sj
ogrens syndrome
patients and how can it be targeted? Expert Rev Clin
Immunol. 2014;10:425427.
37. Fox RI, Stern M, Michelson P. Update in Sj
ogren syndrome.
Curr Opin Rheumatol. 2000;12:391398.
38. Fox RI. Sj
ogrens syndrome. Lancet. 2005;366:321331.
39. Akpek EK, Lindsley KB, Adyanthaya RS, et al. Treatment of
Sj
ogrens syndrome-associated dry eye an evidence-based
review. Ophthalmology. 2011;118:12421252.
40. Tishler M, Yaron I, Geyer O, et al. Elevated tear interleukin-6
levels in patients with Sj
ogren syndrome. Ophthalmology.
1998;105:23272329.
41. Li N, Deng X, Gao Y, et al. Establishment of the mild, moderate
and severe dry eye models using three methods in rabbits.
BMC Ophthalmol. 2013;13:14712415.
42. Zhu Z, Stevenson D, Schechter JE, et al. Lacrimal histopathology and ocular surface disease in a rabbit model of
autoimmune dacryoadenitis. Cornea. 2003;22:2532.
43. Becerra L, Morris S, Bazes S, et al. Trigeminal neuropathic pain
alters responses in CNS circuits to mechanical (brush) and
thermal (cold and heat) stimuli. J Neurosci. 2006;26:10646
10657.
44. Maitchouk DY, Beuerman RW, Ohta T, Stern M, Varnell RJ. Tear
production after unilateral removal of the main lacrimal gland
in squirrel monkeys. Arch Ophthalmol. 2000;118:246252.
45. Hornblass A, Guberina C, Herschorn BJ. Palpebral dacryoadenectomy for epiphora. Ophthal Plast Reconstr Surg. 1988;4:
227230.
46. Scherz W, Dohlman CH. Is the lacrimal gland dispensable?
Keratoconjunctivitis sicca after lacrimal gland removal. Arch
Ophthalmol. 1975;93:281283.
47. Gilbard JP, Rossi SR, Gray KL. A new rabbit model for
keratoconjunctivitis sicca. Invest Ophthalmol Vis Sci. 1987;
28:225228.

IOVS j December 2015 j Vol. 56 j No. 13 j 7783

48. Odaka A, Toshida H. Ohta T, et al. Efficacy of retinol palmitate
eye drops for dry eye in rabbits with lacrimal gland resection.
Clin Ophthalmol. 2012;6:15851593.
49. Candia OA, Alvarez LJ. Fluid transport phenomena in ocular
epithelia. Prog Rein Eye Res. 2008;27:197212.
50. Schechter JE, Warren DW, Mircheff AK. A lacrimal gland is a
lacrimal gland, but rodents and rabbits are not human. Ocul
Surf. 2010;8:111134.
51. Hara S, Hazama A, Miyake M, et al. The effect of topical
amiloride eye drops on tear quantity in rabbits. Mol Vis. 2010;
16:22792285.
52. Matsuo T. Expression of amiloride-sensitive sodium channel in
rat eye. Acta Medica Okayama. 1998;52:279283.
53. Garty H, Palmer LG. Epithelial sodium channels: function,
structure, and regulation. Physiol Rev. 1997;77:359396.
54. Agre P, Kozono D. Aquaporin water channels: molecular
mechanisms for human diseases. FEBS Lett. 2003;555:7278.
55. Verkman AS. Role of aquaporin water channels in eye
function. Exp Eye Res. 2003;76:137143.
56. Yang H, Reinach PS, Koniarek JP, et al. Fluid transport by
cultured corneal epithelial cell layers. Br J Ophthalmol. 2000;
84:199204.
57. Klyce SD. Enhancing fluid secretion by the corneal epithelium.
Invest Ophthalmol Vis Sci. 1977;16:968973.
58. Gilbard JP, Rossi SR, Heyda KG, Dartt DA. Stimulation of tear
secretion by topical agents that increase cyclic nucleotide
levels. Invest Ophthalmol Vis Sci. 1990;31:13811388.
59. Jordan DR, Anderson RB, Mamalis N. Accessory lacrimal
glands. Ophthalmic Surg. 1990;21:146147.
60. Ubels JL, Gipson IK, Spurr-Michaud SJ, et al. Gene expression
in human accessory lacrimal glands of Wolfring. Invest
Ophthalmol Vis Sci. 2012;53:67386747.
61. Bergmanson JP, Doughty MJ, Blocker Y. The acinar and ductal
organisation of the tarsal accessory lacrimal gland of Wolfring
in rabbit eyelid. Exp Eye Res. 1999;68:411421.

Downloaded From: http://iovs.arvojournals.org/pdfaccess.ashx?url=/data/Journals/IOVS/934740/ on 12/11/2015