Journal of Pharmacological Sciences

J Pharmacol Sci 106, 136 143 (2008)1

2008 The Japanese Pharmacological Society

Full Paper

Protective Effect of Baicalin Against Carbon TetrachlorideInduced

Acute Hepatic Injury in Mice
Sang-Won Park1, Chan-Ho Lee1, Yeong Shik Kim2, Sam Sik Kang2, Su Jin Jeon3, Kun Ho Son3,
and Sun-Mee Lee1,*
1

College of Pharmacy, Sungkyunkwan University, 300 Cheoncheon-dong, Jangan-gu, Suwon-si, Gyeonggi-do 440-746, Korea
College of Pharmacy, Seoul National University, Seoul 110-460, Korea
3
Department of Food Science and Nutrition, Andong National University, Gyeongbuk 760-749, Korea
2

Received August 23, 2007; Accepted November 21, 2007

Abstract. This study examined the effects of baicalin, a bioactive flavonoid isolated from
Scutellariae Radix, on carbon tetrachloride (CCl4)-induced liver injury. Mice were treated
intraperitoneally with 0.5 ml / kg CCl4 and different groups of animals received 25, 50, 100, and
200 mg / kg baicalin. At 24 h after the CCl4 treatment, the level of serum aminotransferases and
lipid peroxidation was significantly elevated, whereas the hepatic glutathione content was
decreased. These changes were attenuated by baicalin. The histological studies showed that
baicalin inhibited the portal inflammation, centrizonal necrosis, and Kupffer cell hyperplasia,
which are the three most common characteristics of CCl4-induced liver damage. The serum level
and mRNA expression of tumor necrosis factor- were markedly increased by the CCl4 treatment
but suppressed by baicalin. The mRNA and protein expression levels of inducible nitric oxide
synthase and heme oxygenase-1 increased significantly at 24 h after the CCl4 treatment. Baicalin
attenuated the increase in the protein and gene expression of inducible nitric oxide synthase but
augmented the increase in those of heme oxygenase-1. These findings suggest that baicalin
protects hepatocytes from the oxidative damage caused by CCl4, and this protection is likely due
to the induction of HO-1 expression and the inhibition of the proinflammatory mediators.
Keywords: baicalin, carbon tetrachloride (CCl4), heme oxygenase-1, oxidative stress,
proinflammatory mediator
inflammatory agent and smooth muscle relaxant, and
used as a component of some hepatoprotective herb
mixtures in China, Japan, and Korea (2). Baicalin is the
major active constituent of the isolated root of
Scutellaria baicalensis GEORGI that scavenges reactive
oxygen species (ROS) and has an anti-inflammatory
activity (3). A recent report suggested that baicalin
suppresses the hemin-nitrite-H2O2induced liver injury
caused by inhibitory oxidation and nitration in HepG2
cells (4) and inhibits the activation of redox-sensitive
nuclear factor-B (NF-B) in kidney tissue from old rats
(5). However, there is limited information on the in vivo
hepatoprotective effects of baicalin.
Carbon tetrachloride (CCl4) is commonly used as a
chemical inducer of experimental liver injury (6). It has
been suggested that the hepatic necrosis caused by CCl4
involves bioactivation by a microsomal cytochrome
P450dependent monooxygenase system, resulting in

Introduction
Liver diseases are a major problem throughout the
world. Many environmental toxins cause liver injury to
humans, and despite new advances in hepatology, the
treatment for liver diseases does not resolve the
problems caused by these toxins. Furthermore, despite
the increasing need for agents to protect the liver from
damage, modern medicine lacks a reliable liver protective drug. Therefore, there has been considerable interest
in the role of complementary and alternative medicines
for the treatment of liver diseases (1).
The radix of Scutellaria baicalensis GEORGI is an
eastern traditional medicine that is used as an anti*Corresponding author. sunmee@skku.edu
Published online in J-STAGE: January 11, 2008
doi: 10.1254/jphs.FP0071392

136

Baicalin in CCl4-Induced Hepatic Injury

the formation of trichloromethyl free radicals and ROS,

which initiate lipid peroxidation and protein oxidation
leading to hepatocellular membrane damage (7). This
process is followed by the release of inflammatory
mediators from the activated hepatic macrophages,
which are believed to potentiate the CCl4-induced
hepatic injury.
This study evaluated the role of the inhibition of
oxidative stress and inflammation as a possible molecular mechanism for the protective effect of baicalin in a
CCl4-induced liver injury.
Materials and Methods
Chemicals
Unless stated otherwise, all chemicals were obtained
from Sigma Chemical Co. (St. Louis, MO, USA).
Preparation of baicalin from Scutellariae Radix
The dried roots of Scutellaria baicalensis GEORGI
(Labiatae) were purchased in Sun-Chon and were
authenticated by Dr. J.H. Lee, an Oriental medicine
specialist. A voucher specimen was deposited at the
Department of Food and Nutrition, Andong University,
Korea. The dried roots of Scutellaria baicalensis Georgi
(20 kg) were percolated with 70% ethanol (EtOH) three
times and concentrated in vacuo, and a residue (6 kg)
was suspended in H2O and partitioned successively with
CH2Cl2, EtOAc, and butanol (BuOH), to give CH2Cl2
(300 g), EtOAc (120 g), and BuOH (2.2 kg) soluble
fractions, respectively. A portion of the BuOH fraction
(50 g) was subjected to silica gel column chromatography eluted with a stepwise gradient of CH2Cl2:MeOH
to yield ten fractions (C1 C10) based on their
polarities. Also fraction C7 was rechromatographed on a
silica gel column eluted with CHCl3:MeOH:H2O =
7:3:1 52:28:8 to give five subfractions (C7.1 C7.5).
The C7.5 fraction was re-crystallized in methanol to
obtain pure baicalin, which was subjected to analytical
HPLC (3.9 300 mm, bondapak C-18 column) with
elution by MeOH : 5% acetic acid [7:3 (v / v), 0.5 ml
/ min]; the obtained baicalin, with a purity >95%, had a
retention time of 5.9 min. The structure of baicalin was
verified by comparison of the NMR data with those
reported in the literature (Fig. 1) (8).
Animals and experimental treatments
Male ICR mice (25 30 g) were given access to water
and food throughout the experiments ad libitum. The
animals were fasted for 16 h before the CCl4 treatment.
The use and care of animals were carried out according
to the Sungkyunkwan University Animal Care
Committee guidelines. The mice were randomly divided

137

Fig. 1. The structure of baicalin (7-D-glucuronic acid,5,6-dihydroxyflavone).

into 7 groups with 8 animals each. Group 1 was used as

the normal control and was given the respective
vehicles. Groups 2 7 were administered CCl4 (0.5 ml
/ kg in olive oil) intraperitoneally. The mice in groups
3 7 were treated intraperitoneally with baicalin (25, 50,
100, and 200 mg / kg) and silymarin (positive control for
hepatoprotective properties, 200 mg / kg) twice 30 min
before and 2 h after the CCl4 injection, respectively.
These baicalin doses were selected because they had
been previously evaluated in a lung injury model of rats
induced by paraquat poisoning (9). Twenty four hours
after injecting the CCl4, blood was taken from the
abdominal aorta and the liver was isolated and stored at
75C for later analysis.
Determination of serum aminotransferase activities
The serum alanine aminotransferase (ALT) and
aspartate aminotransferase (AST) activities were determined by standard spectrophotometric procedures using
a ChemiLab ALT and AST assay kit (IVDLab Co., Ltd.,
Korea), respectively.
Measurements of hepatic lipid peroxidation and
glutathione content
The steady-state level of malondialdehyde (MDA),
which is the end product of lipid peroxidation, was
measured in the liver homogenates by measuring the
level of thiobarbituric acid-reactive substances spectrophotometrically at 535 nm, as described by Buege and
Aust (10). The hepatic glutathione content was determined in the liver homogenates after precipitation with
1% picric acid using yeast-glutathione reductase, 5,5'dithio-bis(2-nitrobenzoic acid), and NADPH, at 412 nm
(11). The hepatic glutathione values are expressed as
mmol / mg protein.
Histological analysis of tissues
The liver slices were made from a part of the left lobe
and fixed immediately in a 10% buffered formalin phosphate solution, embedded in paraffin, and sectioned at
5 m. The serial sections were stained with hematoxylin

138

S-W Park et al
Table 1.

PCR primers used in this study and the amplified product length

Gene (accession number)

Primer sequences (5'-3')

TNF- (M11731)

Sense: AGCCCACGTCGTAGCAAACCACCAA
Antisense: AACACCCATTCCCTTCACAGAGCAAT

446

iNOS (NM_010927)

Sense: AAGCTGCATGTGACATCGACCCGT
Antisense: GCATCTGGTAGCCAGCGTACCGG

598

COX-2 (NM_011198)

Sense: ACTCACTCAGTTTGTTGAGTCATTC
Antisense: TTTGATTAGTACTGTAGGGTTAATG

582

HO-1 (NM_010442)

Sense: AACAAGCAGAACCCAGTCT
Antisense: TGTCATCTCCAGAGTGTTC

374

-Actin (X03672)

Sense: TGGAATCCTGTGGCATCCATGAAA
Antisense: TAAAACGCAGCTCAGTAACAGTCCG

348

and eosin (H&E) to evaluate the portal inflammation,

hepatocellular necrosis, and Kupffer cell hyperplasia.
The sections were examined in a blind manner under an
Olympus CKX 41 microscope (Olympus Optical Co.,
Ltd., Tokyo) (12).
Measurement of serum TNF-
The tumor necrosis factor- (TNF-) concentrations
were quantified using a commercial TNF- ELISA assay
kit (eBiosciences Co., San Diego, CA, USA).
Western blot immunoassay
Freshly isolated liver tissue was homogenized in a
lysis buffer. A 20-g sample of protein from the liver
homogenates was loaded per lane on 7.5% or 10.0%
polyacrylamide gels. Electrophoresis was then performed. The proteins were then transferred to nitrocellulose membranes. Western blot analysis was performed using the polyclonal antibodies against mouse
inducible nitric oxide synthase (iNOS; Transduction
Laboratories, San Jose, CA, USA), cyclooxygenase-2
(COX-2; Cayman, Ann Arbor, MI, USA), heme
oxygenase-1 (HO-1; Stressgen Bioreagents Corp., Ann
Arbor, MI, USA), and the monoclonal antibody against
mouse -actin. The binding of all the antibodies was
detected using an ECL detection system (iNtRON
Biotechnology Co., Ltd., Korea), according to the
manufacturers instructions. The intensity of the
immunoreactive bands was determined using a densitometric analysis program (Image Gauge V3.12; Fuji
Photo Film Co., Ltd., Tokyo).
Total RNA extraction and reverse transcriptionpolymerase chain reaction
The total RNA was isolated using the method
described by Chomczynski and Sacchi (13). Reverse
transcription of the total RNA was carried out to

Product length (bp)

synthesize the first strand cDNA using oligo(dT)12-18

primer and SuperScriptTM II RNase H Reverse
Transcriptase (Invitrogen Tech-LineTM, Carlsbad, CA,
USA). The PCR reaction was performed with a diluted
cDNA sample and amplified in each 2-l reaction
volume. The final reaction concentrations are as follows:
primers, 10 M; dNTP mix, 250 mM; 10 PCR buffer;
Ex Taq DNA polymerase, and 0.5 U / reaction. The genespecific primers are listed in Table 1. All the PCR
reactions had an initial denaturation step at 94C for
5 min and a final extension at 72C for 7 min using a
GeneAmp 2700 thermocycler (Applied Biosystems,
Foster City, CA, USA). The PCR amplification cycling
conditions were as follows: 28 cycles of 94C (30 s),
65C (30 s), and 72C (30 s) for TNF-; 35 cycles of
94C (30 s), 60C (30 s), and 72C (30 s) for iNOS; and
35, 30, and 25 cycles of 94C (30 s), 56C (30 s), and
72C (30 s) for COX-2, HO-1, and -actin, respectively.
After RT-PCR, 10-l samples of the amplified products
were resolved by electrophoresis on a 1.5% agarose gel
and stained with ethidium bromide. The intensity of each
PCR product was evaluated semiquantitatively using a
digital camera (DC120; Eastman Kodak, New Haven,
CT, USA) and a densitometric scanning analysis program (1D Main; Advanced American Biotechnology,
Fullerton, CA, USA).
Statistics
All the results are reported as the means S.E.M. The
overall significance of the data was examined by oneway analysis of variance (ANOVA). The differences
between the groups were considered significant at
P<0.05 with the appropriate Bonferronic correction
made for multiple comparisons.

Baicalin in CCl4-Induced Hepatic Injury

Table 2.
Groups

139

Effect of baicalin on the serum aminotransferases, lipid peroxidation, and hepatic glutathione content in the CCl4-induced mice
Dose
(mg /kg)

Control

ALT
(U/ l)

AST
(U /l)

Malondialdehyde
(nmol / g liver)

Hepatic glutathione content

(nmol /mg protein)

62.5 16.0

151.3 33.9

32.9 0.3

6.97 0.55

CCl4
Vehicle
Baicalin

25
50
100
200

Silymarin

200

12528.1 990.8**

13589.2 1225.0**

44.1 0.6**

3.27 0.29**

11978.6 496.2**

13853.3 1076.1**

38.4 0.8**++

4.47 0.66*

9173.0 629.4**

++

5.65 0.59+

8790.0 580.3**

++

++

5.81 0.54+

8370.6 627.7**

++

7828.6 630.6**

++

11544.8 939.9**
8779.0 317.3**++

39.6 0.7**
37.9 0.7**

10929.3 1177.3**

40.3 1.6**

4.56 0.43*

9013.9 832.7**++

36.4 1.0*++

3.35 1.06**

The values are the means S.E.M. of 8 mice per group. *,**Significantly different (P<0.05, P<0.01) from the control group.
different (P<0.05, P<0.01) from the vehicle-treated CCl4 group.

+,++

Significantly

Results

with baicalin at the dose of 100 mg/kg.

Serum aminotransferase activities, lipid peroxidation,

and hepatic glutathione content
The serum ALT and AST activities in the control
group were 62.5 16.0 and 151.3 33.9 U /l, respectively. The serum ALT and AST activities increased
markedly 24 h after the CCl4 injection. These increases
were inhibited by the 50 and 100 mg/kg baicalin
treatment. The serum ALT and AST activities were also
lower in the silymarin-treated CCl4 group than in the
vehicle-treated CCl4 group. Similar to the aminotransferase activities, the MDA level increased significantly in the CCl4-injected mice, which was attenuated
by all doses of baicalin and silymarin at 200 mg/kg. The
hepatic glutathione content in the CCl4-injected mice
decreased to 47% of the control value but this decrease
was attenuated by the baicalin treatment at a dose of 50
and 100 mg/kg (Table 2).

iNOS, COX-2, and HO-1 protein expression

Similar to the serum TNF- level, the level of iNOS
and COX-2 protein expression was significantly higher
in the CCl4-treated mice than in the controls. The
increase in the level of iNOS protein expression was
significantly suppressed by the 100 mg/kg baicalin
treatment, but baicalin had little effect on the level of
COX-2 protein expression. The level of HO-1 protein
expression in the CCl4 group was significantly higher
than that in the control group. This increase was augmented by the baicalin (100 mg/kg) treatment (Fig. 4).

Histological analysis
The histological features of the liver in the control
group showed a normal liver lobular architecture and
cell structure. However, 24 h after the CCl4 injection, the
histopathological lesions of the liver showed extensive
hepatocellular damage, as evidenced by the presence of
portal inflammation, centrizonal necrosis, and Kupffer
cell hyperplasia. These histopathological changes were
ameliorated by both the baicalin (100 mg/kg) and
silymarin (200 mg/kg) treatments (Fig. 2).
Serum TNF- level
As shown in Fig. 3, the level of serum TNF- was
133.6 8.5 pg/ml in the control group. On the other
hand, in the vehicle treated-CCl4 group, the serum TNF level increased to 2.3 times that of the control group.
This increase was significantly attenuated by treatment

TNF-, iNOS, COX-2, and HO-1 mRNA expression

The TNF-, iNOS, COX-2, and HO-1 mRNA
expression was quite low in the control group. However,
the level of TNF-, iNOS, COX-2, and HO-1 mRNA
expression increased markedly 24 h after the CCl4
injection. The increase in the level of TNF- and iNOS
mRNA expression was suppressed by the baicalin
treatment at a dose of 100 mg/ kg, whereas the level of
COX-2 mRNA expression was not affected by baicalin.
The level of HO-1 mRNA expression was further
elevated by the baicalin treatment (Fig. 5).
Discussion
CCl4-induced hepatic injury is an experimental model
widely used in hepatoprotective drug screening. This
study shows for the first time that baicalin can prevent
the acute hepatic damage induced by CCl4. CCl4-induced
hepatotoxicity is believed to involve two phases. The
initial phase involves the metabolism of CCl4 by
cytochrome P450, which leads to the formation of free
radicals and lipid peroxidation (14). The second step
involves the activation of Kupffer cells, probably by free

140

S-W Park et al

Fig. 2. Effect of baicalin on the histological changes in the liver of the CCl4-treated mice (original magnification 100).
A: Control group: normal lobular architecture and cell structure; B: vehicle-treated CCl4 group: extensive hepatocellular damage
with the presence of portal inflammation, centrizonal necrosis, and Kupffer cell hyperplasia; C: CCl4 and baicalin (100 mg /kg)treated group: mild portal inflammation and minimal hepatocellular necrosis and Kupffer cell hyperplasia. D: CCl4 and silymarin
(200 mg / kg)-treated group: mild portal inflammation and minimal hepatocellular necrosis and Kupffer cell hyperplasia.

Fig. 3. Effect of baicalin (100 mg /kg) on the serum TNF- level

in the liver of the CCl4-treated mice. The values are reported as
the means S.E.M. of 8 mice per group. **Significantly different
(P<0.01) from the control group. ++Significantly different (P<0.01)
from the CCl4 group.

radicals. The activation of Kupffer cells is accompanied

by the production of proinflammatory mediators (15).
As a result of the hepatic injury, the altered permeability
of the membrane causes the enzymes from the cells to be

Fig. 4. Effect of baicalin (100 mg / kg) on the iNOS, COX-2, and

HO-1 protein expression in the liver of the CCl4-treated mice.
The values are reported as the means S.E.M. of 8 mice per group.
**Significantly different (P<0.01) from the control group. ++Significantly different (P<0.01) from the CCl4 group.

Baicalin in CCl4-Induced Hepatic Injury

Fig. 5. Effect of baicalin (100 mg / kg) on the TNF-, iNOS, COX-2,

and HO-1 mRNA expression in the liver of the CCl4-treated mice.
The values are reported as the means S.E.M. of 8 mice per group.
**Significantly different (P<0.01) from the control group. ++Significantly different (P<0.01) from the CCl4 group.

released into circulation (16), which damages the hepatic

cells, as shown by the abnormally high level of serum
hepatospecific enzymes. In this study, the serum ALT
and AST levels increased markedly 24 h after the CCl4
injection, but these increases were attenuated by treatment with baicalin at 50 and 100 mg/ kg. These results
indicate that baicalin preserves the structural integrity of
the hepatocellular membrane and protects the mice
against CCl4-induced hepatotoxicity. This phenomenon
was also supported by histological examinations. CCl4
caused a variety of histological changes to the liver,
including centrizonal necrosis, portal inflammation, and
Kupffer cell hyperplasia. These changes were significantly attenuated by baicalin. Furthermore, the hepatoprotective effect of baicalin seemed to be the same as
that of silymarin, which has been used as a potent
hepatoprotective agent. The present results suggest that
baicalin may have potential clinical application for
treating liver diseases.
It is generally accepted that the hepatotoxicity of CCl4
is the result of reductive dehalogenation. The trichloromethyl free radical is capable of binding to lipids, which
initiates lipid peroxidation and liver damage (17). GSH
constitutes the first line of defense against free radicals
and is a critical determinant of the tissue susceptibility to
oxidative damage. Previous studies on the mechanism of

141

CCl4-induced hepatotoxicity reported that GSH plays a

key role in detoxifying the reactive toxic metabolites of
CCl4 and that liver necrosis begins when the GSH stores
are depleted (18). In this study, baicalin exhibited
protective effects by impairing the CCl4-mediated oxidative stress through the decreased production of free
radical derivatives, as evidenced by the decreased MDA
level. Furthermore, baicalin attenuated the hepatic
glutathione depletion 24 h after the CCl4 injection. The
increase in the hepatic glutathione level in the baicalintreated mice could be due either to its effect on the de
novo synthesis of glutathione, its regeneration, or both.
As a consequence, the hepatic glutathione level could
be maintained at levels sufficient to counteract the
increased formation of free radicals, as in the case of
CCl4 toxicity. These results suggest that the antioxidant
properties may be one mechanism through which
baicalin protects against the liver damage mediated by
CCl4. Baicalin at 100 mg/kg was selected as the optimal
effective dose for evaluating the molecular mechanisms
of baicalin against CCl4-induced hepatotoxicity.
Kupffer cells release a number of inflammatory
mediators with cytotoxic potential. The two mediators
of particular interest are TNF- and nitric oxide (NO).
TNF- is a pleiotropic proinflammatory cytokine that is
produced rapidly by macrophages in response to tissue
injury. TNF- stimulates the release of cytokine from
macrophages and induces a phagocyte oxidative
metabolism and NO production (19). NO is a highly
reactive oxidant that is produced by parenchymal and
nonparenchymal liver cells from L-arginine through the
action of NOS. NO participates in a variety of physiological processes, including vasodilation, neurotransmission, and nonspecific host defense. When released by
macrophages against infectious agents, NO can also
react with the superoxide anion to form a potent and
versatile oxidant, peroxynitrite, which stimulates the
production of TNF- in Kupffer cells through the
activation of the oxidant-sensitive transcription factor
NF-B (20). The notion that NO is involved in acute
liver injury is based on several observations that toxininduced hepatic damage is associated with increased NO
production by the liver (21). However, it remains to be
determined whether the augmented production of NO
has a protective or deleterious role in the liver. In this
study, the serum level of TNF- and iNOS protein
expression increased after CCl4 administration with a
concomitant increase in their gene expression, and this
increase was prevented by baicalin. These results
suggest that baicalin largely regulates the CCl4-induced
production of TNF- and iNOS at the transcriptional
level.
Previous studies reported that the induction of COX

142

S-W Park et al

in the inflammatory response is the secondary effect of

CCl4-induced hepatotoxicity (22). COX-2 is the
mitogen-inducible isoform of COX, and it is induced in
macrophages by several proinflammatory stimuli, such
as cytokines and growth factors, leading to COX-2
expression and the subsequent release of prostaglandins
(23). In this study, the levels of COX-2 protein and
gene expression increased significantly after the CCl4
treatment. However, the baicalin treatment did not affect
this increase. Kim et al. (24) also reported that baicalin
inhibited iNOS gene expression and NO production but
does not affect the production of prostaglandin E2 and
the expression of the COX-2 gene in lipopolysaccharidetreated Raw 264.7 macrophages.
HO-1 is not only a key enzyme in the heme catabolism but is also a heat shock protein (HSP 32) in rats.
HO-1 is induced by its substrate heme, as well as by
various oxidative stresses, and is believed to play an
important protective role against oxidative injury (25).
Wen et al. (26) reported that the administration of CCl4
resulted in a time-dependent increase in hepatic HO-1
activity, which reached a maximum at 24 h. This
increase was accompanied by the rapid and significant
induction of HO-1 protein expression, which occurred in
the same time-dependent manner following CCl4
administration. In this study, the levels of HO-1 protein
and gene expression also increased markedly 24 h after
the CCl4 injection. Interestingly, the baicalin treatment
augmented the increase in the levels of HO-1 protein and
gene expression. When animals were pretreated zincprotophophyrin IX for inhibition of HO-1 expression,
the histology of baicalin-treated CCl4-exposed liver
tissue did not markedly differ from that of the CCl4exposed ones (data not shown). This finding suggests
that the protective mechanism of baicalin against CCl4induced hepatic injury might be closely associated with
overexpression of HO-1. HO-1 oxidatively cleaves
heme yielding CO, iron, and biliverdin IX, which is
then reduced to bilirubin IX by biliverdin reductase
(27). Recently, it was reported that CO has anti-inflammatory and antiapoptotic properties (28). CO, a newly
identified signaling molecule, has long been believed to
participate in many biological events and play a key role
in mediating the cytoprotection against oxidant-induced
injury (29). The cellular functions of overproduced CO
in the liver cells are unclear but the CO generated
through the HO-1 pathway during CCl4-induced tissue
injury might be important in the antioxidant defense as
well as in the anti-inflammatory response (30). More
studies will be needed to examine this effect in detail.
In conclusion, baicalin protects the liver from CCl4induced oxidative stress, which might be due to the
induction of HO-1 and the inhibition of the inflam-

matory response. Because baicalin can be consumed

over long periods of time without any known side
effects, its possible role as a promising therapeutic in
human oxidative stress and inflammatory liver disease
deserves consideration. The potential for using baicalin
in experimental and practical applications should be
examined further.
Acknowledgment
This work was supported by a grant from the Korea
Food and Drug Administration (Studies on the Identification of Efficacy of Biologically Active Components
from Oriental Herbal Medicines).
References
1 Galati EM, Mondello MR, Lauriano ER, Taviano MF, Galluzzo
M, Miceli N. Opuntia ficus indica (L.) Mill. fruit juice protects
liver from carbon tetrachloride-induced injury. Phytother Res.
2005;19:796800.
2 Taira Z, Yabe K, Hamaguchi Y, Hirayama K, Kishimoto M,
Ishida S, et al. Effects of Sho-saiko-to extract and its components, Baicalin, baicalein, glycyrrhizin and glycyrrhetic acid,
on pharmacokinetic behavior of salicylamide in carbon tetrachloride intoxicated rats. Food Chem Toxicol. 2004;42:803807.
3 Li BQ, Fu T, Gong WH, Dunlop N, Kung H, Yan Y, et al. The
flavonoid baicalin exhibits anti-inflammatory activity by binding
to chemokines. Immunopharmacology. 2000;49:295306.
4 Zhao Y, Li H, Gao Z, Gong Y, Xu H. Effects of flavonoids
extracted from Scutellaria baicalensis Georgi on hemin-nitriteH2O2 induced liver injury. Eur J Pharmacol. 2006;536:192199.
5 Kim DH, Kim HK, Park S, Kim JY, Zou Y, Cho KH, et al.
Short-term feeding of baicalin inhibits age-associated NFkappaB activation. Mech Ageing Dev. 2006;127:719725.
6 Kamalakkannan N, Rukkumani R, Varma PS, Viswanathan P,
Rajasekharan KN, Menon VP. Comparative effects of curcumin
and an analogue of curcumin in carbon tetrachloride-induced
hepatotoxicity in rats. Basic Clin Pharmacol Toxicol. 2005;
97:1521.
7 McCay PB, Lai EK, Poyer JL, DuBose CM, Janzen EG.
Oxygen- and carbon-centered free radical formation during
carbon tetrachloride metabolism. Observation of lipid radicals
in vivo and in vitro. J Biol Chem. 1984;259:21352143.
8 Kubo M, Matsuka H, Kimura Y, Okuda H, Arichi S. Scutellariae
Radix. X. Inhibitory effects of various flavonoids on histamine
release from rat peritoneal Mast cells in vitro. Chem Pharm Bull.
1984;32:50515058.
9 Liu JH, Ma YT, Shi HW, Feng ZS, Zheng SL, Lv CH, et al.
Effect of baicalin on expression of heme oxygenase-1 in lung
injury of rats associated with paraquat poisoning. Zhonghua Lao
Dong Wei Sheng Zhi Ye Bing Za Zhi. 2006;24:337340.
10 Buege JA, Aust SD. Microsomal lipid peroxidation. Methods
Enzymol. 1978;52:302310.
11 Brehe JE, Burch HB. Enzymatic assay for glutathione. Anal
Biochem. 1976;74:189197.
12 Sato Y, Yoneda M, Nakamura K, Makino I, Terano A. Protective effect of central thyrotropin-releasing hormone on carbon

Baicalin in CCl4-Induced Hepatic Injury

13

14

15

16

17

18

19

20

21

22

tetrachloride-induced acute hepatocellular necrosis in rats. J

Hepatol. 2003;39:4754.
Chomczynski P, Sacchi N. Single-step method of RNA isolation
by acid guanidinium thiocyanate-phenol-chloroform extraction.
Anal Biochem. 1987;162:156159.
Koch RR, Glende EA Jr, Recknagel RO. Hepatotoxicity of
bromotrichloromethanebond dissociation energy and lipoperoxidation. Biochem Pharmacol. 1974;23:29072915.
Edwards MJ, Keller BJ, Kauffman FC, Thurman RG. The
involvement of Kupffer cells in carbon tetrachloride toxicity.
Toxicol Appl Pharmacol. 1993;119:275279.
Drotman RB, Lawhorn GT. Serum enzymes as indicators of
chemically induced liver damage. Drug Chem Toxicol. 1978;
1:163171.
Ahmed S, Rahman A, Alam A, Saleem M, Athar M, Sultana S.
Evaluation of the efficacy of Lawsonia alba in the alleviation of
carbon tetrachloride-induced oxidative stress. J Ethnopharmacol.
2000;69:157164.
Williams AT, Burk RF. Carbon tetrachloride hepatotoxicity: an
example of free radical-mediated injury. Semin Liver Dis.
1990;10:279284.
Bautista AP, Schuler A, Spolarics Z, Spitzer JJ. Tumor necrosis
factor-alpha stimulates superoxide anion generation by perfused
rat liver and Kupffer cells. Am J Physiol. 1991;261:G891G895.
Matata BM, Galinanes M. Peroxynitrite is an essential component of cytokines production mechanism in human monocytes
through modulation of nuclear factor-kappa B DNA binding
activity. J Biol Chem. 2002;277:23302335.
Li J, Billiar TR. Nitric Oxide. IV. Determinants of nitric oxide
protection and toxicity in liver. Am J Physiol. 1999;276:G1069
G1073.
Basu S. Oxidative injury induced cyclooxygenase activation in
experimental hepatotoxicity. Biochem Biophys Res Commun.

143

1999;254:764767.
23 Planaguma A, Claria J, Miquel R, Lopez-Parra M, Titos E,
Masferrer JL, et al. The selective cyclooxygenase-2 inhibitor
SC-236 reduces liver fibrosis by mechanisms involving nonparenchymal cell apoptosis and PPARgamma activation.
FASEB J. 2005;19:11201122.
24 Kim KW, Ha KT, Park CS, Jin UH, Chang HW, Lee IS, et al.
Polygonum cuspidatum, compared with baicalin and berberine,
inhibits inducible nitric oxide synthase and cyclooxygenase-2
gene expressions in RAW 264.7 macrophages. Vascul
Pharmacol. 2007;47:99107.
25 Otterbein LE, Choi AM. Heme oxygenase: colors of defense
against cellular stress. Am J Physiol. 2000;279:L1029L1037.
26 Wen T, Guan L, Zhang YL, Zhao JY. Dynamic changes of heme
oxygenase-1 and carbon monoxide production in acute liver
injury induced by carbon tetrachloride in rats. Toxicology.
2006;228:5157.
27 Maines MD. Heme oxygenase: function, multiplicity, regulatory
mechanisms, and clinical applications. FASEB J. 1988;2:2557
2568.
28 Brouard S, Otterbein LE, Anrather J, Tobiasch E, Bach FH,
Choi AM, et al. Carbon monoxide generated by heme oxygenase
1 suppresses endothelial cell apoptosis. J Exp Med. 2000;
192:10151026.
29 Sass G, Soares MC, Yamashita K, Seyfried S, Zimmermann
WH, Eschenhagen T, et al. Heme oxygenase-1 and its reaction
product, carbon monoxide, prevent inflammation-related
apoptotic liver damage in mice. Hepatology. 2003;38:909918.
30 Otterbein LE, Bach FH, Alam J, Soares M, Tao Lu H, Wysk M,
et al. Carbon monoxide has anti-inflammatory effects involving
the mitogen-activated protein kinase pathway. Nat Med.
2000;6:422428.