See

discussions, stats, and author profiles for this publication at: https://www.researchgate.net/publication/51249650

Identification of bidirectional gene conversion

between SMN1 and SMN2 by simultaneous
analysis of SMN dosage and hybrid genes in a
Chinese population
Article in Journal of the neurological sciences June 2011
Impact Factor: 2.47 DOI: 10.1016/j.jns.2011.06.002 Source: PubMed

CITATIONS

READS

32

8 authors, including:
Tai-Heng Chen

Ching-Cherng Tzeng

Kaohsiung Medical University

Chi-Mei Medical Center

39 PUBLICATIONS 151 CITATIONS

41 PUBLICATIONS 512 CITATIONS

SEE PROFILE

SEE PROFILE

Chun-Chi Wang

Yuh-Jyh Jong

Kaohsiung Medical University

National Chiao Tung University

24 PUBLICATIONS 197 CITATIONS

132 PUBLICATIONS 1,430 CITATIONS

SEE PROFILE

All in-text references underlined in blue are linked to publications on ResearchGate,

letting you access and read them immediately.

SEE PROFILE

Available from: Tai-Heng Chen

Retrieved on: 13 April 2016

This article appeared in a journal published by Elsevier. The attached

copy is furnished to the author for internal non-commercial research
and education use, including for instruction at the authors institution
and sharing with colleagues.
Other uses, including reproduction and distribution, or selling or
licensing copies, or posting to personal, institutional or third party
websites are prohibited.
In most cases authors are permitted to post their version of the
article (e.g. in Word or Tex form) to their personal website or
institutional repository. Authors requiring further information
regarding Elseviers archiving and manuscript policies are
encouraged to visit:
http://www.elsevier.com/copyright

Author's personal copy

Journal of the Neurological Sciences 308 (2011) 8387

Contents lists available at ScienceDirect

Journal of the Neurological Sciences

j o u r n a l h o m e p a g e : w w w. e l s ev i e r. c o m / l o c a t e / j n s

Identication of bidirectional gene conversion between SMN1 and SMN2 by

simultaneous analysis of SMN dosage and hybrid genes in a Chinese population
Tai-Heng Chen a, b, 1, Ching-Cherng Tzeng c, 1, Chun-Chi Wang d, Shou-Mei Wu d, Jan-Gowth Chang e, f,
San-Nan Yang a, g, Chih-Hsing Hung h, Yuh-Jyh Jong a, e, g,
a

Department of Pediatrics, Kaohsiung Medical University Hospital, Kaohsiung Medical University, Kaohsiung, Taiwan
Division of Pediatric Emergency, Department of Emergency, Kaohsiung Medical University Hospital, Kaohsiung Medical University, Kaohsiung, Taiwan
Department of Pathology, Chi Mei Medical Center, Tainan, Taiwan
d
School of Pharmacy, College of Pharmacy, Kaohsiung Medical University, Kaohsiung, Taiwan
e
Department of Laboratory Medicine, Kaohsiung Medical University Hospital, Kaohsiung, Taiwan
f
Institute of Clinical Medicine, College of Medicine, Kaohsiung Medical University, Kaohsiung, Taiwan
g
Graduate Institute of Medicine, College of Medicine, Kaohsiung Medical University, Kaohsiung, Taiwan
h
Department of Pediatrics, Kaohsiung Municipal Ta-Tung Hospital, Kaohsiung, Taiwan
b
c

a r t i c l e

i n f o

Article history:
Received 20 April 2011
Accepted 1 June 2011
Available online 25 June 2011
Keywords:
Gene conversion
Spinal muscular atrophy
Capillary electrophoresis
Gene dosage
Hybrid SMN genes

a b s t r a c t
Spinal muscular atrophy (SMA) is a neurodegenerative disease characterized by programmed motoneuron
death. The survival motor neuron 1 (SMN1) gene is an SMA-determining gene and SMN2 represents an SMAmodifying gene. Here, we applied capillary electrophoresis to quantify the SMN gene dosage in 163 normal
individuals, 94 SMA patients and 138 of their parents. We further quantied exons 7 and 8 in SMN1 and SMN2.
We found that the SMA patients carried the highest SMN2 copies, which was inversely correlated with disease
severity among its three subtypes. Increased SMN1 was signicantly associated with decreased SMN2 in the
normal group. We also observed that parents of type I SMA patients had signicantly fewer SMN2 copies than
those of types II and III patients. The hybrid SMN genes were detected in two normal individuals and one
patient and her mother. These results imply that increased SMN2 copies in SMA patient group might be
derived from SMN1-to-SMN2 conversion, whereas the trend that normal individuals with higher SMN1 copies
simultaneously carry fewer SMN2 copies suggested a reverse conversion, SMN2-to-SMN1. Together with the
identication of hybrid SMN genes, our data provided additional evidence to support that SMN1 and SMN2
gene loci are interchangeable between population groups.
2011 Elsevier B.V. All rights reserved.

1. Introduction
With the incidence of 1 in 10,000 live births, autosomal-recessive
spinal muscular atrophy (SMA) accounts for the leading genetic cause
of infant mortality [1]. According to the age of onset and the highest
level of motor function achieved, SMA is classied into: severe type I
(onset before 6 months old with no ability to sit unaided),
intermediate type II (onset before 18 months old with the ability to
sit but not walking independently), and mild type III (onset after
18 months old with the ability to walk) [2]. SMA is caused by
deciency of the survival motor neuron (SMN) protein, which is
encoded by two highly homologous genes on chromosome 5q13,
telomeric SMN (SMN1) and centromeric SMN (SMN2) [3]. SMN1 is the

All authors of this article indicated no potential conicts of interest.

Corresponding author at: Graduate Institute of Medicine, College of Medicine,
Kaohsiung Medical University, No. 100, Shih-Chuan 1st Road, Kaohsiung 80708,
Taiwan. Tel.: +886 7 311 7820; fax: +886 7 321 2062.
E-mail address: yjjong@kmu.edu.tw (Y.-J. Jong).
1
Both authors contribute equally to this study.
0022-510X/$ see front matter 2011 Elsevier B.V. All rights reserved.
doi:10.1016/j.jns.2011.06.002

SMA-determining gene deleted homozygously in more than 95% of

patients. SMN2 differs from SMN1 by ve nucleotides, in which one
critical C-to-T transition of exon 7 resulting in alternative splicing
during transcription. Consequently, in contrast to SMN1, SMN2 genes
produce primarily truncated, unstable SMN protein [4].
Loss of the SMN1 gene can occur either by gene deletion or by gene
conversion [5]. Although SMN2 gene might be dispensable in normal
individuals [3], it is vital for SMA patients because at least one SMN2
gene is retained in all SMA patients [6]. Furthermore, it has been
suggested that the SMN2 gene can attenuate disease severity in SMA
patients [7], and this hypothesis has been veried by the SMA-like
mouse model [8]. However, this genotypephenotype correlation is
not absolute, and thus it implies that the SMN2 gene might not be
functionally equivalent in all subjects and that other modifying factors
may exist [9,10]. On the other hand, the efciency of SMN1-to-SMN2
gene conversion has also been proposed to determine the clinical
severity [11,12].
Because the determination of the SMN gene dosage is crucial in
genetic counseling and prognostic evaluation, several different quantitative methods have been applied. Recently, we have developed a

Author's personal copy

84

T.-H. Chen et al. / Journal of the Neurological Sciences 308 (2011) 8387

capillary electrophoresis (CE) assay to analyze SMN gene dosages

[13,14]. In this study, we quantied SMN1 and SMN2 gene dosage in
three Chinese population groups to investigate the role of SMN gene
conversion in the equilibrium of these two highly homologous genes.
Furthermore, we simultaneously resolved the SMN1/SMN2 genes in
exons 7 and 8 to explain the molecular basis of the conversion events.
Our study could provide additional evidence that may lead to better
understanding of these two genes in homeostasis among different
populations and patients with three SMA subtypes.
2. Materials and methods
2.1. Subjects
This study was approved by the institutional review board at
Kaohsiung Medical University Hospital (KMUH-IRB-980125). We
enrolled 94 SMA patients whose genotypes report homozygous
deletion without intragenic mutation of the SMN1 gene. Of these, 10
patients were type I, 44 were type II, and 40 were type III. We also
enrolled 138 SMA carriers, who were the parents of the aforementioned homozygous SMN1 deletion SMA patients. Besides, we enrolled
163 normal individuals with no family history of SMA, who were
designated as the control group.
2.2. Assay for quantication of SMN1 and SMN2 copy number
Genomic DNA extracted from the peripheral blood was further
processed by GFX Genomic Blood DNA Purication kit according to
the manufacturer's instructions. We used a universal multiplex PCR
and CE to calculate the copy number of the SMN1 and SMN2 genes.
Briey, exon 7 of SMN1/SMN2 was amplied via a multiplex PCR
method for determining the relative gene dosage of SMN1 and SMN2
within the genome [14]. Amplication of the KRIT1 and CYBB genes
was used as endogenous controls for comparison. Quantication of
the copy number of SMN1 and SMN2 genes was accomplished by CE
(Beckman P/ACE MDQ system; Fullerton, CA, USA), and the quantitative accuracy of this method was also validated by another method,
multiplex ligation-dependent probe amplication (MLPA), as previously described [13,14]. All test samples were analyzed in triplicate.
2.3. Detection of SMN conversion events by simultaneous quantication
of exons 7 and 8 in SMN1 and SMN2
We further designed two additional pairs of primers to simultaneous
amplify the SMN1/SMN2 genes in exons 7 and 8 for detection of gene
conversion events between these two genes. The primer sequences for
the forward primer, containing a universal section, and the reverse
primer are as follows: ATAAGTGACGTACTAGCAACGTCGAACTCCTGAGCTCAGGT and AAAAGTAAGATTCACTTTCA, respectively, for exon
7; and ATAAGTGACGTACTAGCAACGGAACATTAAAAAGTTCAGATGTTA
and TTTAAGACACTCTAACACTT, respectively, for exon 8. The universal
section (ATAAGTGACGTACTAGCAACG) is a non-human sequence and is
utilized for the labeling of the amplicon with a uorescent tag by a
universal FAM primer. The method principle was conducted as
described in a recent study [15]. Similarly, exon 7 and exon 8 belonging
to SMN1 and SMN2, respectively, were simultaneously amplied and
then analyzed by the same CE system with the use of -globin and KRIT1
genes for internal controls to detect the relative gene dosage. All the
detected hybrid SMN genes with regard to conversion events were
further conrmed by sequencing analysis. All samples were also assayed
in triplicate.
2.4. Identication of SMN2 c.859GNC variant in SMA patients
In this study, we attempted to investigate a previously reported
positive disease modier, SMN2 c.859GNC substitution, in a certain

portion of our patient group. By direct sequencing using primers and

methodology reported previously [9], we analyzed c.859GNC variant
in exon 7 of SMN2 for all our type II or type III SMA patients with only
two SMN2 copies.
2.5. Statistical analysis of SMN gene distribution
The copy numbers of the SMN1 and SMN2 genes in normal
individuals, carriers and different subtypes of SMA patients were
compared by analysis of variance (ANOVA) and the Tukey test for
post-hoc comparison. Student's t-test was applied when two
independent groups were compared. The frequency, reported as a
distribution, of SMN1 compared to SMN2 copy in the control group
was also analyzed by the chi-square (x 2) test. A p-value of less than
0.05 was considered statistically signicant.
3. Results
3.1. Gene dosage of SMN1 and SMN2 in the different population groups
The copy numbers of SMN genes in three groups are shown in
Table 1. The average copy number of SMN1 gene of normal individuals
was signicantly higher than the carriers and SMA patients (p b 0.01).
In contrast, the average copy number of SMN2 gene was signicantly
higher in SMA patients than those of the carriers and normal controls
(both p b 0.01). Each of the average copy numbers of SMN2 in patients
with SMA type II and type III was signicantly higher than of the
average copy number in type I patients (both p b 0.01). If the patients
with SMA type II and type III were combined into one group, named
type IIIII, we still found a higher number of SMN2 copies in this
combined group (3.13 0.71; mean SD) than in type I patients
(p b 0.01; t-test).
The distribution of the SMN2 copy number in 3 subgroups of SMA
patients is shown in Table 2. No signicant correlation was observed
between the distribution of SMN2 copies and gender in SMA patients.
Two SMN2 copies were found in 7 of 10 type I patients (70%),
compared to only 9 of 44 type II patients (20.5%) and 6 of 40 type III
patients (15%). However, we did not identify any SMN2 c.859GNC
substitutions in aforementioned 15 types II and III SMA patients with
two SMN2 copies (as shown in supplementary data). Three or more
SMN2 copies were found in 69 of 84 (82.1%) types II and III SMA
patients, whereas 3 of 10 (30%) type I patients possessed three SMN2
copies.
The distribution of SMN genotypes in normal individuals is shown
in Table 3. Four of 163 controls (2.5%) carried one SMN1 copy and
were therefore identied as SMA carriers. The majority of normal
individuals (139/163; 85.3%) carried two SMN1 copies, and their
SMN2 gene copy number varied between zero and three. Homozygous
absence of the SMN2 gene was observed in 10 of 163 (6.1%) normal
individuals. We found that increased SMN1 copies was signicantly
associated with reduced SMN2 copies; that is, all the normal
individuals with 3 copies of SMN1 typically had zero or one SMN2
Table 1
SMN1/SMN2 gene copies in different groups of population.
Subject

Numbers

M/F

Average SMN1 copy

number (mean SD)

Average SMN2 copy

number (mean SD)

Controls
Carriers
SMA patients:
Type I
Type II
Type III

163
138
94
10
44
40

54/109
63/75
56/38
4/6
28/16
24/16

2.12 0.46a
1.01 0.12
0
0
0
0

1.48 0.63
2.33 0.77
3.04 0.73b
2.33 0.50c
3.05 0.68
3.23 0.73

M: male; F: female.
a
Signicantly higher in controls than in carriers and SMA patients (p b 0.01).
b
Signicantly higher in SMA patients than in controls and carriers (p b 0.01).
c
Signicantly lower in type I than in types II and III SMA subgroups (p b 0.01).

Author's personal copy

T.-H. Chen et al. / Journal of the Neurological Sciences 308 (2011) 8387
Table 2
Distribution of SMN2 copies in 94 SMA patients.
SMA and
gender

Table 4
SMN1/SMN2 copies in 138 parents of a child with different subtypes of SMA.

Distribution for SMN2

copy number
2

Total

mean SD

Female
Type I SMA
Type II SMA
Type III SMA

4.
2
3

2
10
9

0
4
4

0
0
0

6
16
16

2.33 0.52
3.13 0.62
3.06 0.68

Male
Type I SMA
Type II SMA
Type III SMA
Total

3
7
3
22

1
14
11
47

0
7
9
24

0
0
1
1

4
28
24
94

2.25 0.50
3.00 0.72
3.33 0.76
3.04 0.73

Including one patient with hybrid SMN gene.

3.2. Identication of SMN hybrid genes in different groups

The quantication of the copy numbers of SMN1 and SMN2 in
exons 7 and 8 was performed in all 395 enrolled subjects. We found a
hybrid SMN gene in one patient with type I whose SMN1 gene was
homozygously lacking exon 7 but not exon 8 (exon 7 of SMN1:SMN2
vs. exon 8 of SMN1:SMN2 = 0:2 vs. 1:1; Fig. 1A). The mother of this
type I patient also carried a similar discordant number of exons 7 and
8 belonging to SMN1 and SMN2 genes (exon 7 of SMN1:SMN2 vs. exon
8 of SMN1:SMN2 = 1:2 vs. 2:1). These results suggested that an
identical hybrid SMN gene, composed of SMN2 exon 7 and SMN1 exon
8, existed in this lineage. Furthermore, two normal individuals were
also found to have an SMN gene hybrid. One had an SMN1 to SMN2
ratio of 2:1 in exon 7 and a ratio of 1:2 in exon 8. The other had had
homozygous absence of SMN2 exon 7 but not of exon 8 (Fig. 1B). Three
subjects mentioned above, one patient with type I SMA and two
normal individuals, have also been included in a previous report [15].

Table 3
Distributions of SMN genotype in 163 controls.
SMN1:SMN2
copy number

Number of subjects

Percentage (%)

4:0
4:1
3:0
3:1
2:0a
2:1a
2:2
2:3
1:1
1:2
1:3
Total

3
1
6
10
1
54
83
1
1
2
1
163

1.8
0.6
3.7
6.1
0.6
33.1
50.9
0.6
0.6
1.2
0.6
100

Including one control with hybrid SMN gene.

Phenotype
of SMA
cases

Average SMN1 copy

number in parents
(mean SD)

SMN2 copies
distributions n
(%)

SMN2 copy
number
(mean SD)

M/F

Type I

1.00 0.00

1.85 0.67a

10/10

Type II

1.01 0.12

2.33 0.68

33/37

Type III

1.02 0.14

1
2
3
1
2
3
4
1
2
3
4

2.52 0.85

20/28

copy:
copy:
copy:
copy:
copy:
copy:
copy:
copy:
copy:
copy:
copy:

6 (30)
10 (50)
4 (20)
6 (8)
37 (53)b
25 (36)
2 (3)
6 (13)
16 (33)c
21 (44)
5 (10)

M: male; F: female.
a
Signicantly lower in type I SMA carriers than types II and III SMA carriers (p b 0.01).
b
Including one parent with SMN1/SMN2 copy number 2:2.
c
Including one parent with SMN1/SMN2 copy number 2:2.

copy (20/20; 100%), whereas only 55 of 139 (39.6%) normal

individuals with two SMN1 copies had zero or one SMN2 copy
(p b 0.0001; x 2 test).
The distribution of the SMN genes in the SMA carriers is shown in
Table 4. The number of SMN2 copies varied among the SMA carriers: 7
(5.1%) had four copies, 50 (36.2%) had three copies, 63 (45.7%) had
two copies and 18 (13%) had one copy. None of the carriers had zero
SMN2 copies. We also found that type I SMA carriers had fewer SMN2
copies compared to type II and type III carriers (p b 0.01). There was no
overall signicant difference in the distribution of SMN2 copies
between genders (data not shown).

85

4. Discussion
To date, the majority of studies regarding the SMN gene
conversion, mainly SMN1-to-SMN2, are based on the ndings of
varying SMN2 copy number among SMA patients with different
phenotypes [12,16,17]. In the present study, we have demonstrated
the presence of SMN gene-conversion events among different
population groups by the following observations: (1) there are
signicant differences in the numbers of SMN2 copies presented not
only in different SMA subtypes but also in SMA carriers and normal
controls; and (2) hybrid SMN genes exist in SMA patients, carriers and
normal individuals. Our results, which show successively increasing
SMN2 copies with the lowest number in normals, higher numbers in
carriers and a peak in SMA patients, support the possibility that SMN2
genes are generated when either one or both SMN1 genes are absent.
Hence, our population-based results indicate that SMN1-to-SMN2
conversion events might be essential and occur frequently than
previously expected.
A previous study has observed that in 512% of SMA patients,
retained SMN2 genes with unequal ratio of exons 7 and 8 could be
generated by partial conversion from SMN1[18]. Accordingly, the
existence of hybrid (chimeric) SMN genes in SMA patients, as seen in
one of our SMA patients (Fig. 1C), can represent alternative evidence
for SMN1-to-SMN2 conversion [11,12]. On the other hand, our data of
SMN1/SMN2 gene dosage in normal individuals supports a previous
population-based study which postulated the existence of SMN2-toSMN1 conversion [19]. Moreover, the presence of SMN hybrid genes
was also identied in our two unaffected individuals (Fig. 1D), which
could further represent SMN2-to-SMN1 conversion events [20,21].
Thus we not only provide population-based evidence via quantication of SMN gene dosage but also propose a molecular basis for gene
conversion, the hybrid SMN gene, by differentiating the copy ratios of
SMN1 to SMN2 in exons 7 and 8 to support the hypothesis of SMN2-toSMN1 conversion. Interestingly, a recent large-scale population study
reports signicantly higher SMN1 copies per allele in certain ethnic
groups [22]. They suggest that such a phenomenon might be
attributed to one of two factors: (1) an ancestral form of duplication
of SMN1 or (2) events of SMN2-to-SMN1 conversion in normal
population. We found the latter explanation more convincing based
on our observation in normal individuals. Of note, a recent in vitro
study highlights the signicance of our SMN2-to-SMN1 conversion
nding by showing that it can even be driven by using single-stranded
oligonucleotides [23]. Given that SMN1 genes can produce more stable
and biologically active SMN protein, creating an SMN1-like gene
converted from SMN2 in SMA patients might be an appealing target
for gene therapy [24]. Thus, our nding not only provides evidence of

86

Fig. 1. (A) Electropherograms and sequence analysis in one patient with SMA type I revealed homozygous absence of SMN1 exon 7 but not of exon 8 (exon 7 of SMN1:SMN2 vs. exon 8 of SMN1:SMN2 = 0:2 vs. 1:1). (B) Electropherograms and
sequence analysis were performed in one normal individual whose SMN2 gene homozygously lacked exon 7 but not exon 8 (exon 7 of SMN1:SMN2 vs. exon 8 of SMN1:SMN2 = 2:0 vs. 1:1). (C) Schematic diagram demonstrating the SMN1-toSMN2 conversion event in the above SMA patient. (D) Schematic diagram illustrating the formation of hybrid gene due to SMN2-to-SMN1 gene conversion in the above normal individual. Peaks of electropherogram: 1, -globin; 2, KRIT1; 3,
SMN2-exon 7; 4, SMN1-exon 7; 5, SMN2-exon 8; 6, SMN1-exon 8. RFU: relative uorescent units.

Author's personal copy

T.-H. Chen et al. / Journal of the Neurological Sciences 308 (2011) 8387

Author's personal copy

T.-H. Chen et al. / Journal of the Neurological Sciences 308 (2011) 8387

natural conversion events of SMN2-to-SMN1 but also could be the

basis of a potential therapy for SMA in the future.
Our ndings in SMA carriers may clarify the questions about the
timing of the conversion events. By providing a direct parental
relationship, our ndings further enhance a previous study, which
suggested that the severity of the disease in SMA offspring might have
already been determined in the parental generation [12]. Although de
novo deletion/conversion of the SMN1 gene due to unequal crossingover at the SMN1 locus during meiosis has been hypothesized [25],
our observations indicate that the severity of the effect of SMA alleles
could be inherited from the majority of SMA carriers. We hypothesize
that the SMN1 conversion/deletion events mostly occur before
meiosis. However, considering that several studies also found a lack
of association between SMN2 copies and intrafamilial phenotypic
variability [17], we still emphasize caution when interpreting SMA
carrier screening results to predict the disease phenotype in offspring.
In our SMA patient group, the inverse correlation between number
of SMN2 copies and disease severity could further address the variable
degree of SMN1-to-SMN2 conversion in SMA pathogenesis [12,16].
The large scale of genuine deletions of SMN1 genes in comparison to
the lesser degree of conversion events to SMN2 genes causes the
majority of type I patients to carry only one or two SMN2 copies, as
seen in 70% of our type I patients; whereas 82.1% of our types II and III
SMA patients carry at least three SMN2 copies, which corresponds to
higher-efciency SMN1-to-SMN2 conversion. However, a hybrid SMN
gene was also detected in one of our type I SMA patients, which
suggested that partial conversion might not completely mitigate
disease severity. Nevertheless, we still observed phenotypic discordance in a proportion of our SMA patients with identical SMN2 copies.
Gender-biased SMA severity, possibly through a gender-specic
modier PLS3, has been reported [10]; however, we did not nd a
signicant correlation between gender and clinical severity. Another
recently recognized SMA modier, SMN2 c.859GNC variant, was not
found in our milder-severity patients with relatively few SMN2 copies.
Through our observation, we suggest that the presence of phenotype
genotype discrepancy is possibly related to other SMA-modifying
factors with ability in modulating efciency of SMN gene conversion.
While this study supports the hypothesis of gene conversions
between SMN1 and SMN2 in either direction, some questions still
need to be answered. Firstly, additional linkage analysis of regions
anking the SMN1 or SMN2 locus should be performed to identify
whether increased SMN1 genes in normal individuals might arise
from de novo duplications. Second, because our study detects the
critical two-base differences between exon 7 and exon 8 of SMN1/
SMN2 to identify the presence of hybrid genes, we suggest further
study to investigate the sequence change of the additional three bases
in introns 6 and 7 to assess the extent of conversion and its correlation
to clinical severity.
In conclusion, our study provides both population-based and
experimental evidence of an interchangeable gene locus between
SMN1 and SMN2. We identify the presence of SMN1-to-SMN2
conversion events in SMA patients and carriers, and vice versa, in
the normal population. Given that SMN2 copy number can ameliorate
disease severity to some degree, and because SMN2-to-SMN1
conversion certainly occurs, a trial of gene therapy directing the
conversion from SMN2 to SMN1 in SMA patients would provide
information important for developing an alternative strategy for SMA
therapy in the future.
Acknowledgments
We are grateful to all SMA patients and families for their kind
support. This study received grants from the National Science Council
of Taiwan (NSC-95-2314-B-037-090and 96-2314-B-037-034-MY3), a
grant from the Kaohsiung Medical University Hospital (KMUH988G11), and partial nancial support from Sun's KMU-SMA fund. We

87

also express our cordial gratitude to Dr. Brunhilde Wirth for kindly
providing the SMN1 and SMN2 genomic DNA standards.
Appendix A. Supplementary data
Supplementary data to this article can be found online at doi:10.
1016/j.jns.2011.06.002.
References
[1] Ogino S, Leonard DG, Rennert H, Ewens WJ, Wilson RB. Genetic risk assessment in
carrier testing for spinal muscular atrophy. Am J Med Genet 2002;110:3017.
[2] Munsat TL, Davies KE. Report of international SMA consortium meeting.
Neuromuscul Disord 1992;2:4238.
[3] Lefebvre S, Brglen L, Reboullet S, Clermont O, Burlet P, Viollet L, et al.
Identication and characterization of a spinal muscular atrophy-determining
gene. Cell 1995;80:15565.
[4] Lorson CL, Hahnen E, Androphy EJ, Wirth B. A single nucleotide in the SMN gene
regulates splicing and is responsible for spinal muscular atrophy. Proc Natl Acad
Sci U S A 1999;96:630711.
[5] Burghes AH. When is a deletion not a deletion? When it is converted. Am J Hum
Genet 1997;61:915.
[6] Ogino S, Wilson RB, Gold B. New insights on the evolution of the SMN1 and SMN2
region: simulation and meta-analysis for allele and haplotype frequency
calculations. Eur J Hum Genet 2004;12:101523.
[7] Campbell L, Potter A, Ignatius J, Dubowitz V, Davies K. Genomic variation and gene
conversion in spinal muscular atrophy: implications for disease process and
clinical phenotype. Am J Hum Genet 1997;61:4050.
[8] Hsieh-Li HM, Chang JG, Jong YJ, Wu MH, Wang NM, Tsai CH, et al. A mouse model
for spinal muscular atrophy. Nat Genet 2000;24:6670.
[9] Prior TW, Krainer AR, Hua Y, Swoboda KJ, Snyder PC, Bridgeman SJ, et al. A positive
modier of spinal muscular atrophy in the SMN2 gene. Am J Hum Genet 2009;85:
40813.
[10] Oprea GE, Krober S, McWhorter ML, Rossoll W, Muller S, Krawczak M, et al. Plastin
3 is a protective modier of autosomal recessive spinal muscular atrophy. Science
2008;320:5247.
[11] DiDonato CJ, Ingraham SE, Mendell JR, Prior TW, Lenard S, Moxley III RT, et al.
Deletion and conversion in spinal muscular atrophy patients: is there a
relationship to severity? Ann Neurol 1997;41:2307.
[12] Velasco E, Valero C, Valero A, Moreno F, Hernndez-Chico C. Molecular analysis of
the SMN and NAIP genes in Spanish spinal muscular atrophy (SMA) families and
correlation between number of copies of cBCD541and SMA phenotype. Hum Mol
Genet 1996;5:25763.
[13] Wang CC, Chang JG, Ferrance J, Chen HY, You CY, Chang YF, et al. Quantication of
SMN1 and SMN2 genes by capillary electrophoresis for diagnosis of spinal
muscular atrophy. Electrophoresis 2008;29:290411.
[14] Wang CC, Chang JG, Jong YJ, Wu SM. Universal multiplex PCR and CE for
quantication of SMN1/SMN2 genes in spinal muscular atrophy. Electrophoresis
2009;30:110210.
[15] Wang CC, Jong YJ, Chang JG, Chen YL, Wu SM. Universal uorescent multiplex PCR
and capillary electrophoresis for evaluation of gene conversion between SMN1
and SMN2 in spinal muscular atrophy. Anal Bioanal Chem 2010;397:237583.
[16] Feldktter M, Schwarzer V, Wirth R, Wienker TF, Wirth B. Quantitative analyses of
SMN1 and SMN2 based on real-time lightcycler PCR: fast and highly reliable
carrier testing and prediction of severity of spinal muscular atrophy. Am J Hum
Genet 2002;70:35868.
[17] Cusc I, Barcel MJ, Rojas-Garca R, Illa I, Gmez J, Cervera C, et al. SMN2 copy
number predicts acute or chronic spinal muscular atrophy but does not account
for intrafamilial variability in siblings. J Neurol 2006;253:215.
[18] Wirth B. An update of the mutation spectrum of the survival motor neuron gene
(SMN1) in autosomal recessive spinal muscular atrophy (SMA). Hum Mutat
2000;15:22837.
[19] Ogino S, Gao S, Leonard DG, Paessler M, Wilson RB. Inverse correlation between
SMN1 and SMN2 copy numbers: evidence for gene conversion from SMN2 to
SMN1. Eur J Hum Genet 2003;11:2757.
[20] Hahnen E, Schnling J, Rudnik-Schneborn S, Zerres K, Wirth B. Hybrid survival
motor neuron genes in patients with autosomal recessive spinal muscular
atrophy: new insights into molecular mechanisms responsible for the disease.
Am J Hum Genet 1996;59:105765.
[21] Huang CH, Chang YY, Chen CH, Kuo YS, Hwu WL, Gerdes T, et al. Copy number
analysis of survival motor neuron genes by multiplex ligation-dependent probe
amplication. Genet Med 2007;9:2418.
[22] Hendrickson BC, Donohoe C, Akmaev VR, Sugarman EA, Labrousse P, Boguslavskiy
L, et al. Differences in SMN1 allele frequencies among ethnic groups within North
America. J Med Genet 2009;46:6414.
[23] DiMatteo D, Callahan S, Kmiec EB. Genetic conversion of an SMN2 gene to SMN1: a
novel approach to the treatment of spinal muscular atrophy. Exp Cell Res
2008;314:87886.
[24] Bertoni C, Rustagi A, Rando TA. Enhanced gene repair mediated by methyl-CpGmodied single-stranded oligonucleotides. Nucleic Acids Res 2009;37:746882.
[25] Cusin V, Clermont O, Grard B, Chantereau D, Elion J. Prevalence of SMN1 deletion
and duplication in carrier and normal populations: Implication for genetic
counselling. J Med Genet 2003;40:e39.