Vous êtes sur la page 1sur 36

Master Sciences

Mention « Microbiologie-Biologie Végétale et Biotechnologies »

Année 2010/2011

Unité d’enseignement « Initiation à la recherche en Microbiologie »



Fascicule de principes techniques

1

Avant-propos

A titre d’exemples, certains protocoles sont explicités dans ce fascicule. Ceux-ci peuvent

présenter de nombreuses variantes.

METHODES D'OBSERVATION DES MICROORGANISMES

Bactériologie

Il est possible d'observer les microorganismes

- soit lorsqu'ils sont regroupés en colonies sur boîte visible à l’œil, il s'agit alors d'une observation macroscopique - soit à l'état de cellule, il s'agit alors d'une observation microscopique.

1 - Observation macroscopique des colonies

C'est l'étude de l'aspect des colonies. Une colonie est l'amas, visible à l’œil nu, constitué par des milliards de descendants d'une seule cellule bactérienne et dont la taille, la forme, la couleur, la consistance sont caractéristiques de chaque espèce. L'étude de l'aspect des colonies nécessite l'observation à l’œil nu, en lumière naturelle et artificielle, par éclairage direct et par transparence des colonies.

Conditions d'examen L'examen macroscopique des cultures est le premier examen effectué à partir de l'isolement après incubation . L'aspect des colonies dépend du milieu utilisé, de la durée et de la température de l'incubation . Il ne pourra être décrit convenablement qu'à partir de colonies bien isolées : les colonies sont d'autant plus petites qu'elles sont rapprochées.

Les colonies sont observées par transparence, réflexion ou transillumination oblique.

qu'elles sont rapprochées. Les colonies sont observées par transparence, réflexion ou transillumination oblique. 2

2

Aspect

La description des colonies doit mentionner

1 : La taille ou le diamètre de la colonie

Elle peut être mesurée à l'aide d'une règle graduée pour les grandes colonies.

2 : La forme

- allure des contours lisses, dentelés, déchiquetés réguliers, irréguliers

- relief

surface bombée, demi-bombée, plate centre parfois surélevé, parfois ombiliqué (en creux)

3 : L'aspect de la surface

Il peut être lisse ou rugueux,

4 : L'opacité

Les colonies sont décrites comme

- opaques (ne laissent pas passer la lumière)

- translucides (laissent passer la lumière mais on ne voit pas les formes au travers, comme le verre dépoli)

-

transparentes (laissent passer la lumière et voir les formes au travers, comme le verre)

5

: La consistance

Au moment du prélèvement il est possible d'apprécier si les colonies sont grasses, crémeuses (on obtient facilement des suspensions homogènes), sèches ou encore muqueuses (on obtient difficilement des suspensions homogènes).

6 : La couleur (pigmentation)

Les colonies habituelles sont crème. Une couleur différente est due à des pigments : jaune, rouge, orange, violette

Principaux types

En

distinguées

rassemblant

les

critères

précédemment

décrits,

trois

sortes

de

colonies

peuvent

être

- colonies S (de l'anglais Smooth - Lisse) : colonies à surface lisse et bords réguliers, bombées, de consistance crémeuse et donnant des suspensions homogènes

- colonies R (de l'anglais Rough - Rugueux) : colonies à surface rugueuse et bords dentelés, plates, de consistance sèche et donnant des suspensions hétérogènes

3

- colonies M (= Muqueuse) : colonies à surface lisse et bords réguliers, bombées, filantes sous l'anse, et donnant des suspensions hétérogènes.

7 : Odeur - une odeur caractéristique peut être présente

2 - Observation microscopique

L'observation microscopique permet de faire une étude morphologique des cellules d'une espèce microbienne. Elle comprend l'examen à l'état frais (examen entre lame et lamelle des bactéries vivantes) l'examen après coloration (le plus souvent sur frottis séchés et fixés).

2.1 - Examen à l'état frais

Il permet d'observer sur les cellules vivantes:

- la forme des cellules

- leur mode de groupement

- leur mobilité

- la quantité approximative des bactéries par champ microscopique

* Forme des cellules

Ce caractère est très important en bactériologie, il peut à lui seul conduire à la

détermination de genre mais on doit l'utiliser avec une extrême prudence. C'est ainsi qu'on différencie des germes ayant :

- une forme sphérique : les cocci (ordres de Micrococcales)

- une forme allongée en bâtonnet : les bacilles (ordre des Bacteriales)

- une forme intermédiaire : les cocobacilles

- une forme incurvée en virgule (vibrio) ou en ondulation (ordre des Spirillales)

- une forme spiralée (ordre des Spirochaetales)

- une forme ramifiée (ordre des Actinobactériales).

Attention l'examen est effectué à travers une certaine épaisseur de liquide, des bactéries identiques pourront apparaître sous des angles divers et sembler différentes.

A côté de la forme elle-même des bactéries, l'étude des groupements retrouvés dans les cultures et qui sont liés au mode de division des germes vient compléter les données morphologiques et fournir de précieuses informations pour l'identification . Ainsi dans l'ordre des Micrococcales, les différents groupements observés sont caractéristiques d'un genre donné:

- groupement par deux en diplocoques:

genre Pneumococcus pour les cocci Gram +

genre Neisseria pour les cocci Gram -

- groupement en chainettes:

4

genres Streptococcus, Leuconostoc, Enterococcus - groupement en tétrades : genre Gaffkya - groupement en amas plans (grappe de raisin): genre Staphylococcus - groupement en amas non plans:

amas cubiques: genre Sarcina amas irréguliers : genre Micrococcus - groupements en palissades ou en lettres (XVL): genres Corynebacterium et Cellulomonas.

* Mobilité

La mobilité est le caractère le plus important mis en évidence à l'état frais. On doit observer :

- la présence ou l'absence de mobilité - les caractères de cette mobilité : frétillement des bactéries à ciliature polaire ou tournoiement des bactéries péritriches.

Remarque: Une bactérie mobile doit se déplacer dans le champ microscopique avec un mouvement qui lui est propre, les autres bactéries restant immobiles ou se déplaçant dans d'autres directions. Attention cette mobilité ne doit pas être confondue avec les mouvements browniens qui sont des mouvements désordonnés de particules (sans déplacement véritable) dus à l'agitation thermique des molécules de liquide ni avec les mouvements transmis par les courants (toutes les bactéries sont entrainées dans la même sens).

* Eléments particuliers de la bactérie

La capsule La présence d'une capsule est révélée à l'état frais de la souche cultivée sur milieu enrichi, par la coloration négative à l'encre de Chine. Sa mise en évidence est un indice important .

Ex : des diplocoques Gram + entourés d'une capsule importante évoquent Streptococcus pneumoniae.

Les spores Leur présence permet à elle seule de ranger les bactéries aérobies dans la famille des Bacillaceae. De plus la spore et sa position permettent la classification des bactéries en groupes à l'intérieur d'une famille.

2.2 - Examen après coloration

Si la plupart des bactéries et des microbes peuvent être observés en suspension aqueuse, cette observation est grandement facilitée par l'application de colorants.

Les colorations, réalisées sur des frottis séchés et fixés, sont classées en

coloration simple (1 seul colorant)

5

coloration différentielle type Gram L’action de plusieurs colorants permet des effets de contraste: un premier colorant (cristal violet), un mordant qui complexe le colorant (lugol, acide phénique, acide chromique, chaleur), un différenciateur qui est une substance décolorante (alcool à 90°, mélange alcool/acétone, acides forts) et enfin un deuxième colorant .

colorations spéciales des structures bactériennes (cils ou pili, capsules, spores

La coloration de Gram

)

C'est la coloration différentielle systématiquement réalisée lors d'un examen microscopique de bactéries. Elle permet non seulement d'observer la forme des cellules mais aussi de diviser les bactéries en deux grands groupes taxonomiquement différents:

- bactéries Gram-positives : Gram +

- bactéries Gram-négatives : Gram -

Les bactéries qui retiennent le colorant basique utilisé (cristal-violet) après lavage à l'alcool sont dites Gram-positives, celles qui ne le retiennent pas sont dites Gram-négatives. Les bactéries Gram-négatives peuvent prendre la couleur d'un second colorant. Leur paroi ne présente pas de barrière de perméabilité à l'élution du complexe colorant-mordant par l'alcool.

La paroi des bactéries Gram + est imperméable au complexe colorant-mordant, elles ne sont pas décolorées.

Procédure :

- Préparer la lame et l'échantillon à examiner comme pour un état frais.

- Etaler la suspension bactérienne en un film mince et régulier sur la lame avec une anse de platine par un mouvement régulier et circulaire (étalement de 2 à 3 cm de diamètre).

- Laisser évaporer à sec soit à l'air libre, soit en tenant la lame bien au dessus de la flamme, le frottis doit devenir terne mais ne doit ni brunir, ni brûler.

- L'étape de fixation qui suit consiste à tuer les bactéries, à rendre les membranes plus

perméables, à fixer les structures sans les altérer et à faire adhérer le frottis à la lame. En tenant la lame avec une pince écraser trois fois la flamme avec la lame, le frottis est prêt à subir une coloration. (Il existe une technique plus délicate qui consiste à verser quelques gouttes d'alcool à 90°C sur la lame, laisser quelques secondes, égoutter et enflammer).

Coloration de Gram :

- recouvrir le frottis fixé de cristal-violet, laisser agir une minute

- laver l'excès de cristal violet avec quelques gouttes de Lugol; attendre 1mn

- laver à l'eau et égoutter sur un mouchoir en papier.

6

- traiter la préparation avec de l'alcool à 95° (ou avec un mélange alcool/acétone) goutte à goutte jusqu'à ce que l'alcool ajouté n'entraîne plus de cristal-violet

- recolorer avec la safranine pendant une minute (si le décolorant utilisé est un mélange

alcool/acétone, ne colorer que 20 secondes avec la safranine)

- laver, égoutter, sécher doucement la lame entre deux feuilles de papier Joseph.

- Observer à l'immersion avec l'objectif ayant le plus fort grossissement sans contraste de phase (0 ou HF). Pour cela, déposer une goutte de liquide à immersion sur la lame, directement au contact du frottis. Ne pas utiliser de lamelle.

Champignons filamenteux

Les champignons constituent un groupe d’organisme d'une extrême variété, des espèces microscopiques aux organismes de plusieurs kilos. Ils ont colonisé tous les milieux, terrestres ou aquatiques, et jouent un rôle primordial dans l'écologie de la planète en recyclant la matière organique morte. Les champignons présentaient déjà de grandes diversités à l'ère carbonifère. Ils sont parmi les plus anciennes formes « végétales » différenciées apparues sur le globe terrestre. Classés, initialement, parmi les végétaux à cause de la structure de leurs cellules, ils ne réalisent pourtant pas de photosynthèse. Ce groupe, dont les quelque 100 000 espèces se sont adaptées à des modes de vie très variés, est maintenant considéré comme un règne à part entière. Certains s'associent par symbiose à des algues pour survivre dans des conditions climatiques extrêmes, d'autres parasitent la peau de l'homme, quant aux saprophytes, ils provoquent la pourriture du bois. Ce sont des Eucaryotes. Ils sont hétérotrophes : ils ne peuvent pas, comme les plantes vertes, synthétiser la matière organique à partir du gaz carbonique atmosphérique et doivent donc puiser dans le milieu ambiant l'eau, les substances nutritives et les éléments minéraux nécessaires à la synthèse de leur propre matière. Ils les absorbent à travers la paroi de leur appareil végétatif. Sans véritables tissus, à l'inverse des plantes supérieures ou des animaux, leur appareil végétatif :

le thalle ne comporte ni racine, ni tige, ni feuille. Le thalle peut être constitué d'une cellule unique, comme dans le cas de la levure de bière, ou plus souvent, d'une structure filamenteuse, ou mycélium. Le mycélium est non cloisonné chez les champignons inférieurs, et les filaments mycéliens, ou hyphes, peuvent être comparés à des cellules géantes. Chez les champignons supérieurs le mycélium est cloisonné, en effet les hyphes sont divisées en plusieurs segments contenant chacun un ou plusieurs noyaux. D’un point de vue structural les hyphes sont des sortes de tuyaux contenant le cytoplasme, les noyaux et autres organites cellulaires. Elles sont chez les champignons supérieurs cloisonnées. Dans les parties jeunes du mycélium les cloisons sont percées de pores qui permettent le passage du contenu cellulaire d'un compartiment à l'autre. Dans les parties les plus âgées, les cloisons sont fermées, isolant les parties en voie de dégénérescence des parties actives. Des septums assurent le cloisonnement des différents compartiment cellulaire (Fig1, Fig 2 et Fig3). La colonisation du susbstrat est réalisée par extension et ramification des hyphes. L'accroissement de celles-ci s'effectue par le sommet, ou apex, où s'effectue l'essentiel des réactions de synthèse et dégradation du métabolisme dit "primaire", indispensable à la construction de la cellule du champignon. Les régions apicales des hyphes sont caractérisées par

7

la présence de nombreuses vésicules cytoplasmiques contenant les enzymes et les précurseurs de synthèses de nouveaux polymères. Les produits du métabolisme "secondaire" non indispensable au fonctionnement de la cellule, sont plutôt stockés en région subapicale. Les métabolites secondaires les plus connus sont les pigments, les antibiotiques, les mycotoxines

Le mycélium croît et s'étend pour former un réseau à trois dimensions capable de s'organiser en structures complexes, tels que les chapeaux des champignons supérieurs. Le chapeau et le pied, partie visible du champignon, ne constituent que sa fructification (organe a reproducteur qui contient les spores produites au cours de la reproduction sexuée).

Fig2 : Région apicale d’une hyphe

reproduction sexuée). Fig2 : Région apicale d’une hyphe Fig 4 : Une colonie : Fig 3

Fig 4 : Une colonie :

: Région apicale d’une hyphe Fig 4 : Une colonie : Fig 3 : architecture d’une

Fig 3 : architecture d’une cellule fongique (ascomycètes, deutéromycètes)

d’une cellule fongique (ascomycètes, deutéromycètes) Le développement de l’hyphe se fait à partir d’une

Le développement de l’hyphe se fait à partir d’une spore (sexuée ou asexuée) par émission d’un ou plusieurs tubes germinatifs et par croissance de la seule cellule terminale. La formation d’une colonie se fait de façon radiale à partir du point d'inoculation.

8

La complexité des cycles de reproduction sexuée ou asexuée est l'un des éléments qui ont entraîné la création d'un règne à part pour les champignons. La classification des espèces est d'ailleurs fondée sur ces particularités.

La reproduction asexuée se réalise différemment selon l'espèce: par bourgeonnement chez la levure, par individualisation d'un des segments d'une hyphe ou par formation de spores asexuées.

Fig 5 : Sporulation asexuée :

A. niger

spores asexuées. Fig 5 : Sporulation asexuée : A. niger et A. fumigatus La reproduction sexuée

et

A. fumigatus

Fig 5 : Sporulation asexuée : A. niger et A. fumigatus La reproduction sexuée nécessite la

La reproduction sexuée nécessite la fusion de deux cellules spécialisées, ou gamètes.

Les levures

Les levures sont des champignons microscopiques unicellulaires (ou très faiblement pluricellulaires) qui se multiplient par bourgeonnement ou sporulation. Elles ont la capacité de fermenter des matières organiques, minérales ou végétales pour produire des substances variées. Les levures sont constituées par les espèces du genre Saccharomyces, agents de la fermentation alcoolique de la bière, du vin, du cidre, et des éléments actifs du levain de boulanger. C'est l'activité chimique des levures qui provoque le dégagement de bulles de gaz carbonique et fait lever la pâte à pain. Ces levures sont des cellules rondes ou ovales, qui, placées dans un milieu sucré ou glucidique, avec ou sans oxygène, se multiplient activement. Ces micro-organismes ont un diamètre compris entre 6 à 8 10 -6 m . Saccharomyces pompe : ce groupe se caractérise par son mode de division végétatif qui est transversal alors que les autres levures bourgeonnent. Elle a une forme rectangulaire.

Saccharomyces cerevisiae. Au microscope, elle apparaît de formes arrondies ou ovoïdes. Bourgeon en formation

Saccharomyces cerevisiae . Au microscope, elle apparaît de formes arrondies ou ovoïdes. Bourgeon en formation 9

9

CROISSANCES BACTERIENNES

RAPPELS SUR L'ENERGETIQUE DE LA CROISSANCE La croissance peut être définie comme un accroissement ordonné de tous les composants

d'un organisme. Chez les organismes unicellulaires, elle aboutit à une augmentation du nombre

d'individus. Cette augmentation du nombre de cellules se traduit par une augmentation de la

turbidité du milieu de culture. On peut admettre que lorsque la densité optique du milieu ne dépasse pas la valeur 0,6 (avec les spectros de TP) il y a proportionnalité entre le nombre

d'individus présents dans la culture et la densité optique.

Le développement d'une culture sera donc facilement représenté en traçant le graphique

des densités optiques en fonction du temps : D.O. = f (t) En réalité, pour des raisons de précision, on tracera plutôt le graphique du log de la D.O.

en fonction du temps sur papier semi-logarithmique. Au temps t o on a x o bactéries dans le milieu (inoculum)

au temps t on a x bactéries dans le milieu

Pendant l'intervalle de temps dt, l'accroissement du nombre de cellules de la culture sera

proportionnel à x

Donc :dx/dt = µ.x

d'où : Ln x = µ . t + constante

(1)

(2)

où:

dx/x = µ.dt

Ln = log népérien

Au temps t = o, on a x o bactéries, donc : Ln x o = constante

(3)

De (2) et (3), on tire: Ln x = µ . t + Ln x o

Ln x-Lx o

= µ . t

On passe en exponentielle :

soit :

Ln x/x o = µ . t

x/x o = e µt

x = x o . e µt

(4)

Si l'on considère que la masse unitaire des bactéries présentes dans la culture est

constante, la relation (4) peut s'écrire :

m = m o . e µt

(5)

m o = masse de l'inoculum

Soit t le temps nécessaire à un doublement de la population (temps de génération). C'est le temps pour lequel on a : m = 2.m o

Si l'on reporte cela dans (5), on a : 2 m o = m o e µt

Donc

: Ln 2 = µt . Ln e

10

( or

2 = e µt

Ln e = 1 )

soit :0,69 = µt

d'où l'on

tire:

µ

= 0,69/t;

µ = taux népérien de croissance

Pour une culture en phase exponentielle de croissance, le logarithme du nombre d'organismes s'accroît linéairement en fonction du temps.

En conséquence, on peut admettre que le log de la masse bactérienne et donc le log de la DO 600 nm s'accroissent eux aussi linéairement en fonction du temps.

La croissance d'une culture est affectée par des facteurs tels que :

- l'état physiologique des cellules utilisées pour inoculer le milieu,

- la composition du milieu

- les conditions d'incubation.

Ces différentes influences se répercutant sur la forme de la courbe de croissance, il sera assez facile de mettre leurs effets en évidence par comparaison des courbes établies dans diverses

conditions de culture.

Ces différents facteurs vont aussi se répercuter sur une grandeur très importante : le

rendement de la croissance K :

K = masse de bactéries produites (en g poids sec)

quantité d'aliment consommé (en g)

Par la suite, on appellera rendement moléculaire de croissance : La valeur de Y s'exprimera donc

en grammes. mole -1 .

Y = masse de bactéries produite ( en grammes P.S)

quantité d'aliment consommé (en moles)

Remarques : en milieu non renouvelé, Y est constant tout au long de la croissance si celle ci est

bien limitée par la source d'énergie.

- Y ne peut être déterminé qu'en milieu minimum, c'est-à-dire ne contenant qu'un seul

substrat énergétique. Donc la masse de bactéries synthétisée en fin de croissance dépend de la quantité initiale de substrat limitant.

De manière pratique

Pour établir une courbe de croissance, il convient d’ensemencer un milieu de culture

avec un inoculum provenant d’une préculture réalisée dans les mêmes conditions que celles

établies pour l’étude (atmosphère, nature du milieu, riche ou minimum, température, agitation,

facteur limitant la croissance). La cinétique de croissance est suivie par lecture de l’absorbance de fractions aliquotes prélevées par exemple toutes les 20 minutes.

La valeur lue est rapportée directement sur une feuille de papier à échelle semi-

logarithmique (DO échelle log en ordonné ; temps, échelle millimétrée en abscisse). La phase

11

exponentielle se traduit par une droite (tracée à la règle), les phases d’accélération et de ralentissement sont lissées en courbe. De manière routinière, on calcule d’abord le temps de génération (On se place sur la droite et l’on choisi une DO X correspondant au temps t1, puis un deuxième point correspondant à DO = 2X. Cette dernière correspondant au doublement de biomasse est obtenue à t2 sur l’échelle des abscisses. Le temps de génération ( tg en heure ou min )correspond à t2-t1 : tg =

t2_t1

Pour calculer le taux de croissance µ (en h -1 ), on applique la relation µ = 0,69/t

Exemple d'une courbe de croissance

le taux de croissance µ (en h - 1 ), on applique la relation µ =

12

TRANSFORMATION DE MICROORGANISMES

Définition : Modification héréditaire des propriétés d'une bactérie par un ADN extérieur. Ce phénomène existe naturellement chez certaines bactéries comme Acinetobacter. La transformation "naturelle" ou physiologique est le premier modèle connu de transfert de matériel génétique (ADN), qui est fixé et absorbé par des bactéries réceptrices, dites en état de compétence. Ce modèle a permis en 1944 de démontrer que l'ADN était le support chimique de l'hérédité.

Principe :

D'une part, il doit y avoir de l'ADN libéré d'une bactérie (exogénote). D'autre part celui-ci doit

phase de compétence

être

fixé

sur

une

bactérie

réceptrice

en

de compétence être fixé sur une bactérie réceptrice en Cette absorption d'ADN est suivie d'une

Cette absorption d'ADN est suivie d'une recombinaison génétique avec acquisition de nouveaux caractères génétiques stables, donc transmissibles à la descendance.

génétiques stables, donc transmissibles à la descendance. Ce transfert naturel d'ADN bactérien est limité à

Ce transfert naturel d'ADN bactérien est limité à quelques espèces. Il est partiel : une partie de l'exogénote (1-2% du génome) pénètre et se recombine (si homologie suffisante).

La transformation est une technique de base du génie génétique. Elle est utilisée quotidiennement dans les laboratoires lors de clonage.

Des cellules non transformables naturellement comme E. coli mais rendues compétentes par traitement chimique (classiquement par des traitements au CaCl 2 ) peuvent être transformées avec de l’ADN plasmidique.

13

1- Cellules compétentes Protocole de préparation de cellules compétentes :

- pour 50 mL de culture

1 - Ensemencer le milieu liquide Luria Broth (LB) au 1/100 avec culture de la nuit. Incuber à

37°C avec agitation.

2 - Quand DO 550 = 0,45 bloquer la croissance dans la glace pendant 15 minutes. Transférer dans

des récipients de centrifugation refroidis.

3 - Centrifuger 15 minutes à 2500 rotations par minute (rpm) à 4°C.

4 - Jeter le surnageant en égouttant au maximum et reprendre le culot dans un petit volume de CaCl 2 100mM glacé avec agitation douce. Compléter à 20 ml avec la même solution.

5 - Conserver 15 minutes dans la glace (ou plus).

6 - Centrifuger 15 minutes à 2500 rpm à 4°C.

7 - Jeter le surnageant et reprendre le culot dans un petit volume de CaCl 2 100mM -15% glycérol glacé avec agitation douce. Compléter à 1,25 ml.

8 - Laisser dans la glace 15 minutes au moins.

9 - Aliquoter, refroidir dans l'azote liquide. Conserver à -70°C.

2-Transformation bactérienne

Préparer des tubes de bactéries compétentes contenant 100µl d'une suspension de cellules d'Escherichia coli. Ils doivent être maintenus dans de la glace. Les manipulations devront se faire stérilement près d'un bec Bunsen allumé. Protocole :

1 - t = 0. Ajouter l'ADN dans les tubes ; agiter le tube. Les bactéries restent dans la glace.

2 - t = 25 minutes. Agiter légèrement et transférer les tubes dans un bain-marie à 37°C pendant 3 minutes.

3 - t = 28 minutes. Agiter legèrement et laisser les tubes 10 minutes dans la glace.

4 - t = 38 minutes. Ajouter stérilement 0,5 ml de milieu liquide Luria Broth (LB) préchauffé à

37°C ; agiter légèrement. Transférer à 37°C durant 60 minutes.

5 - t = 98 minutes. Agiter légèrement et étaler les bactéries (éventuellement après dilution selon le

protocole qui aura été discuté). Sur chaque boîte, étaler 100µl de la suspension de bactéries. Remarque : pendant les temps morts les boîtes des différents milieux seront marquées et les tubes de dilution préparés, selon le protocole que vous aurez entrepris. Commentaires :

1 ère étape : l'ADN en solution dans le tube va venir s'adsorber à la surface des bactéries. Il n'entre pas dans les bactéries car à 0°C les phospholipides sont figés (donc les menbranes sont figées). 2 ème étape : on passe de 0°C à 37°C. La fluidité membranaire se trouve alors presque instantanément restaurée. Ceci permet à l'ADN de franchir l’ enveloppe bactérienne. 3 ème étape : retour à température ambiante. 4 ème et 5 ème étapes : le milieu liquide LB préchauffé à 37°C va restaurer le métabolisme et la croissance des bactéries (1 à 2 cycles de division). Durant 60 minutes le plasmide va pouvoir se répliquer ; les gènes vont s’exprimer, notamment le gène codant pour l’enzyme conférant aux bactéries transformées la résistance a un antibiotique. Puis on triera les bactéries sensibles et les bactéries resistantes en les plaçant sur un milieu renfermant un antibiotique (principe de sélection positive par expression directe). On récupérera ainsi les bactéries transformées.

14

3- L’electrotransformation

L'électrotransformation a pour but la perméabilisation de la membrane cytoplasmique sous l'influence d'un champ électrique. Les fonctions précises qui induisent cette perméabilisation sont encore mal connues, mais il semble que la membrane soit destabilisée localement et transitoirement, laissant apparaître des structures transitoires de perméation (STP) qui autorisent l'entrée ou la sortie de molécules. Dans le cas d'une transformation, le but recherché est l'entrée de matériel plasmidique dans les cellules avec bien sûr, la notion de rendement maximum. On cherche à obtenir le maximum de transformants par g d'ADN. Pour ce faire, 3 paramètres doivent être contrôlés:

- le champ électrique appliqué, dont la tension et la durée doivent être suffisament élevées

pour induire l'apparition de STP, sans tuer les cellules (pour E. coli, 5 à 6 kV/cm, 4 ms).

- la résistance du milieu, qui doit être très grande de façon que l'énergie du choc électrique

ne soit pas dissipée en chaleur.

- la concentration de cellules, qui doit être suffisante pour que le courant passe par contact

entre les cellules (habituellement de l'ordre de 10 11 cellules/ml).

15

Minipréparation de plasmides et analyse de restriction

Les plasmides :

Les plasmides sont des éléments génétiques que l'on trouve dans une grande variété de bactéries. Ce sont des molécules d'ADN bicaténaire et circulaire dont la taille varie, selon les types, de 2000 à 200 000 paires de bases. Ils contiennent souvent des gènes dont les produits sont utiles à la bactérie (par exemple un gène conférant la résistance à un antibiotique). L'utilisation des plasmides a permis la construction d'outils appelés vecteurs, qui sont des ADN plasmidiques (ou phagiques) modifiés et qui ont permis le développement des techniques de biologie moléculaire. Dans ces vecteurs on peut insérer dans des endroits précis un fragment d'ADN étranger (clonage). Cette construction (plasmide recombinant) est ensuite introduite dans des bactéries (transformation) où elle pourra être produite en un grand nombre de copies.

Des méthodes rapides ont été mises au point permettant d'isoler l'ADN plasmidique en

quantité et en qualité suffisantes pour effectuer un certain nombre d'analyses. Bien que ces méthodes puissent différer sur certains points, les étapes principales restent les mêmes :

- croissance des bactéries contenant le plasmide à extraire

- récupération des cellules bactériennes par centrifugation

- lyse des cellules avec un tampon approprié (il s’agit souvent d’un mélange de SDS et de NaOH : on parle alors de lyse alcaline)

- précipitation de l’ADN plasmidique en présence d’éthanol ou d’isopropanol (il peut aussi s’agir d’une fixation spécifique de l’ADN sur une résine)

- resuspension de l’ADN dans de l’eau ou dans du tampon

Une fois purifiés, ces ADN plasmidiques peuvent être analysés par électrophorèse sur gel d'agarose. On peut ainsi contrôler la qualité d'une préparation de plasmides.

Les enzymes de restriction :

Les enzymes de restriction appartiennent à la classe des endonucléases, c’est-à-dire des enzymes capables de cliver les liaisons phosphodiester entre deux nucléotides à l’intérieur d’un acide nucléique. Les endonucléases se différencient des exonucléases qui dégradent la molécule d’ADN à partir de l’une de ses extrémités (3’ ou 5’). Les enzymes de restriction sont capables de reconnaître spécifiquement une courte séquence, de 4 à 10 pb, et de cliver l'ADN au site reconnu. Ils permettent de fragmenter l'ADN en segments de taille réduite. Certains enzymes coupent le site en son milieu et produisent deux fragments dont les extrémités sont franches. Cependant, la plupart réalisent une coupure dissymétrique : on parle dans ce cas d'extrémités cohésives (chaque fragment possède une chaîne qui dépasse l'autre de quelques bases). Plusieurs centaines de ces enzymes ont été caractérisés :

ils reconnaissent une grande variété de sites de coupure. Les séquences de nucléotides reconnues par les enzymes de restriction sont habituellement des séquences dites palindromiques. Les séquences palindromiques sont des séquences où la succession des nucléotides lue dans le sens 5’ vers 3’ (gauche-droite) pour le premier brin est identique à la séquence lue dans le sens droite-gauche pour le second brin (sens 5’ vers 3’). Ces séquences palindromiques sont le plus souvent constituées de 4, 5 ou 6 paires de bases.

16

Les enzymes de restriction présentent une nomenclature bien précise. Leur nom comporte plusieurs lettres (3 ou 4). La première lettre de dénomination de l’enzyme est écrite en majuscule, elle correspond au genre de la bactérie d’où a été extraite l’enzyme. La seconde lettre et la troisième lettre (en minuscules) correspondent à l’espèce de la bactérie d’où l’enzyme est extraite. On peut avoir une quatrième lettre écrite en majuscule correspondant à la souche bactérienne. Enfin pour terminer, un chiffre romain indique l’ordre de caractérisation de ces enzymes. Exemples:

EcoRI, extraite de Escherichia coli RYB, site reconnu: G / AATTC SmaI, extraite de Serratia marcescens, site reconnu: CCC / GGG PstI, extraite de Providencia stuartii, site reconnu: CTGCA / G

Les utilisations des enzymes de restriction sont très nombreuses en biologie moléculaire. Elles peuvent être utilisées pour établir une carte de restriction de toute molécule d'ADN que l'on souhaite caractériser. Cela consiste à déterminer l'ordre des sites de restriction le long de cette molécule, qui vont produire, après "digestion enzymatique" de cette molécule, des fragments de tailles différentes dont la taille pourra être définie par électrophorèse. Les enzymes de restriction peuvent également être utilisées pour préparer un fragment d’ADN d’un gène donné (insert) à être inséré dans un vecteur comme un plasmide.

Un grand nombre d’enzymes sont commercialisées. Une unité d’activité enzymatique est définie comme la quantité d’enzyme nécessaire pour couper 1 µg d’ADN en 1 heure dans le tampon et à la température appropriés pour l’enzyme utilisée.

pour couper 1 µg d’ADN en 1 heure dans le tampon et à la température appropriés

17

PCR = Polymerase Chain Reaction ( réaction de polymérisation en chaîne )

1)

Introduction

La PCR est une méthode permettant la multiplication d’une courte séquence d’ADN (jusqu’à 2 ou 3 Kb en routine et parfois plus) appelée séquence cible, à partir d’une infime quantité d’ADN génomique ou plasmidique. Elle est même possible à partir de l’ADN génomique issu d’une cellule unique voire a patir de cellules lysées. Elle est réalisée dans un tube à essai (Tube eppendorf) en quelques heures. Publiée en 1985 par R. Saiki, elle a révolutionné le diagnostic moléculaire des maladies génétiques comme bien d’autres domaines.

des maladies génétiques comme bien d’autres domaines. Le taux de multiplication (ou taux d’amplification) est

Le taux de multiplication (ou taux d’amplification) est tel que la réaction revient à rendre négligeable le reste du génome qui n’a pas été amplifié car le produit de PCR contient presque exclusivement des millions d’exemplaires de la séquence cible. Il est donc facilement analysable par exemple sur un gel d’électrophorèse en fluorescence UV sans avoir à rechercher spécifiquement la séquence cible par hybridation moléculaire comme c’était le cas auparavant (technique de Southern-blot). La PCR est utilisée dans la très vaste majorité des diagnostics moléculaires.

18

2)

Principe

La séquence cible est multipliée par synthèses successives à l’aide :

- des amorces (Primers), fragments courts d’ADN, spécifiques (ou non) de la séquence à

amplifier, il s’agit généralement d’oligonucléotides de 18 à 25 bases, dont les séquences ne

doivent pas être complémentaires et qui ne doivent pas former de structures secondaires.

- d’un enzyme particulière, une ADN polymérase active à haute température, température à laquelle l’ADN est dénaturé, comme par exemple la Taq polymérase

Chaque synthèse ou cycle de PCR est constituée de 3 étapes constituées de trois plateaux de température différents : dénaturation (autour de 95°C), hybridation des amorces (entre 50 et 60°C) et polymérisation ou élongation (autour de 72°C). On considère souvent un temps d’élongation de 1 minute par Kb à amplifier. Chaque cycle dure quelques minutes. La séquence cible étant doublée à chaque cycle, le taux d’amplification (théorique) est de 2(exposant)n, si bien qu’après une trentaine de cycles de PCR, le nombre de copies de la séquence cible est plusieurs dizaines de millions de fois supérieur à n’importe qu’elle autre séquence du génome. Cette sur- représentation la rend facilement analysable et manipulable.

la rend facilement analysable et manipulable. 3) La réaction Le milieu réactionnel doit contenir :

3) La réaction

Le milieu réactionnel doit contenir :

 l’ADN contenant la séquence à amplifier ; il peut s’agir de l’ADN génomique ou d’ADN plasmidique contenant une séquence d’intérêt  les deux amorces olignonucléotidiques monobrins complémentaires chacune d’une des extrêmités du fragment à amplifier.  des désoxynucléotides libres dATP, dCTP, dGTP, dTTP qui sont incorporables pour former le brin d’ADN néosynthétisé.

19

 du MgCl 2 et une solution donnant au milieu réactionnel un pH et une concentration saline optimale pour le fonctionnement de l’enzyme  l’enzyme permettant la synthèse d’un néobrin à partir des amorces ; il s’agit d’une ADN polymérase thermostable, par exemple la Taq DNA polymérase issue du micro-organisme thermophile : Thermus aquaticus.

Le tube contenant le milieu réactionnel est placé dans un appareil appelé « thermocycleur », sorte de plaque chauffante programmable en temps et en température et disposant de délais de montée et de descente en température extrêmement courts. Il délivre à chaque instant au milieu réactionnel une température donnée permettant la réalisation de l’une des trois étapes du cycle de PCR : dénaturation, hybridation ou synthèse.

du cycle de PCR : dénaturation, hybridation ou synthèse. Simulation d’une réaction PCR : Nombre de

Simulation d’une réaction PCR :

Nombre de brin d’ADN :

1

Nombre de cycles :

25

Nombre de copies :

33 554 432 33 554 382

 

Nombre de copies cibles :

Copies cibles

=

99.99985%

Nombre de copies

20

4) Les limites de la technique

a) La PCR suppose la synthèse chimique de deux oligonucléotides utilisés pour l’amorçage

de la réaction. Il faut donc que la séquence nucléotidique du fragment à analyser soit connue au

niveau de ces régions d’amorçage. Il est néanmoins possible de contourner le problème en clonant le fragment dont la séquence est totalement inconnue dans un vecteur (plasmide,

bactériophage

)

afin d’utiliser la séquence (connue) du vecteur pour amorcer la réaction de

PCR

b) La taille du fragment à amplifier ne peut pas dépasser quelques kilobases. Au-delà, il se

produit des phénomènes qui empêchent la réaction de se faire normalement : interruptions

prématurées dues à la formation de structures secondaires, réappariement des fragments néosynthétisés entre eux etc………

c) Le taux d’amplification est théoriquement de 2(exposant)n mais en pratique le rendement de la réaction n’est jamais de 100%.

d) Au-delà d'un certain nombre de cycles, le taux d'amplification baisse progressivement pour

tendre vers 1 (Voir ci après). Ceci est dû à une diminution de la concentration des désoxynucléotides et des oligonucléotides et à l'augmentation de la concentration du produit de

PCR.

des désoxynucléotides et des oligonucléotides et à l'augmentation de la concentration du produit de PCR. 21

21

5) Design des amorces

Les amorces doivent être spécifiques, stables et compatibles

Séquence cible

5'

3'

5'

stables et compatibles Séquence cible 5' 3' 5' Séquence identique à la séquence 5-3' Amorce droite

Séquence identique à la séquence 5-3'

Amorce droite (antisens) 3'

Amorce gauche (sens)

Amorce droite (antisens) 3' Amorce gauche (sens) 5' complément inverse de la séquence 5'-3'
Amorce droite (antisens) 3' Amorce gauche (sens) 5' complément inverse de la séquence 5'-3'

5'

complément inverse de la séquence 5'-3'

5' 3'
5'
3'

3'

Les amorces ont en général une longueur de 21 nt (ou 21 mers) et sont toujours écrites du 5’ vers le 3’.

Généralement les nucléotides G et C plus stables, sont privilégiés à l’extrémité 5’ alors que les nucléotides T et A moins stables sont privilégiés à l’extrémité 3’.

5’

3’

s sont privilégiés à l’extrémité 3’. 5’ 3’ 5’ 3’ Extrémité 3’ stable Extrémité 5’ stable
5’ 3’
5’
3’
privilégiés à l’extrémité 3’. 5’ 3’ 5’ 3’ Extrémité 3’ stable Extrémité 5’ stable En effet

Extrémité 3’ stable

Extrémité 5’ stable

En effet le sens de la polymérisation étant 5’ 3’, l’initiation de la polymérisation par la Taq sera rendue plus efficace par la facilité d’accession à cette extrémité moins rigide de l’amorce hybridée sur la cible.

moins rigide de l’amorce hybridée sur la cible. Ex : Choix d’amorces obtenues avec le programme

Ex : Choix d’amorces obtenues avec le programme en ligne

http://frodo.wi.mit.edu/primer3/

GTCATGGTGATGTGGTTTGTTTGCTGCTCAGCCATGCGGAAAACGGCCTCCAATGTGCTG

>>>>>>>>>>>>>>>>>>>>

AATACGTCATGCGCATCCCCGTCAAGCTCGCTCGCGTAATGGACACCCTGTACGAAAGTG

CCTTGGGCTTTTGCAATGTCGACAGCCTCCATAATCAATCCCATATAATCCGGCTCATTC

ATTGGATAAAGGGCAAATTGGCACGGCG <<<<<<<<<<<<<<<<<<<< En noir : séquence cible

LEFT PRIMER

TGGTGATGTGGTTTGTTTGC

GC% : 45%;

Tm : 60,41

RIGHT PRIMER

CCAATTTGCCCTTTATCCAA

GC% : 40%

Tm : 59,77

Il est également possible de rajouter sur ces amorces des sites de restriction enzymatiques ou bien des étiquettes (séries de nucleotides codant des acides aminés spécifiques ex :

CACCACCACCACCACCAC pour 6 Hist). Le rajout de ces nucléotides inexistants sur la séquence cible va créer un mésappariement dont il faudra tenir compte pour choisir la température d’hybridation.

22

Purification d'une protéine

Pour étudier la structure et les fonctions biologiques d'une protéine in vitro, plusieurs étapes essentielles doivent être mises en œuvre afin d'obtenir une protéine suffisamment pure et concentrée pour être utilisée dans différents tests enzymatiques ou chimiques. Les principales étapes sont schématisées ci-dessous :

Les principales étapes sont schématisées ci-dessous : 23 1 . Surproduction 2 . Préparation d'un extrait

23

1 . Surproduction

2 . Préparation d'un extrait protéique

3 . Purification

- Surproduction : Le gène d'intérêt est cloné dans un vecteur d'expression, qui porte également un gène de résistance à un antibiotique (par exemple, le gène bla dont l'expression entraîne une résistance à l'ampicilline). Après des bactéries par le plasmide recombinant, ces dernières sont cultivées en présence de l'antibiotique ad hoc afin de sélectionner uniquement les bactéries portant le vecteur. Arrivées en phase exponentielle (DO 600 comprise entre 0,4 et 0,7), il est alors possible d'ajouter un inducteur dans le milieu de culture (arabinose pour pBAD, ou IPTG pour le promoteur Lac par exemple) qui est ensuite importé dans le cytoplasme bactérien. En se fixant sur le promoteur localisé en amont du gène cloné, l'inducteur augmente le niveau de transcription du gène, ce qui a pour effet direct de surproduire la protéine d'intérêt.

Préparation d'un extrait protéique : Cette étape va consister à préparer un extrait "brut" à partir de la culture cellulaire précédente. Pour cela, il va falloir rompre les cellules soit par choc mécanique (presse de French, ultrasons), soit par traitement enzymatique (lysozyme). Après centrifugation, on retrouve toutes les molécules solubles dans le surnageant, alors que les débris cellulaires, les membranes biologiques et les molécules insolubles sont concentrés dans le culot.

Purification : A ce stade, le but est de séparer la protéine d'intérêt de toutes les autres protéines présentes dans l'extrait. Plusieurs critères permettent la séparation des protéines : leur taille (gel filtration), leur charge (chromatographie échangeuse d'ions), leur affinité (chromatographie d'affinité, immuno-adspoption). Généralement, plusieurs étapes faisant intervenir différents critères de séparation sont nécessaires pour permettre une purification efficace. Depuis une dizaine d'années, les techniques de biologie moléculaire ont permis la construction de protéines recombinantes possédant une étiquette (ou tag) greffée sur leur extrémité N- ou C- terminale. La plus répandue est l'étiquette histidine, qui est constituée d'un hexapeptide de 6 histidines qui ont la propriété de se fixer sur le nickel. On peut également citer le "flag peptide", qui est un octapeptide reconnu spécifiquement par un anticorps. Le principal intérêt de cette approche est d'obtenir un protocole de purification en une étape, l'inconvénient étant que la protéine purifiée porte un peptide additionnel sur l'une des deux extrémités.

Evaluation de la pureté de la protéine : Une fois la protéine purifiée, il est possible d'évaluer son degré de pureté en la faisant migrer sur SDS-PAGE (Sodium Dodecyl Sulfate PolyAcrylamide Gel Electrophoresis). Si la purification est correcte, on ne doit obtenir qu'une seule bande migrant à la taille de la protéine si elle est monomérique, ou à la taille de sa sous-unité si elle est oligomérique. Cette étude peut être complétée par la technique de western-blot, qui permet de confirmer les résultats obtenus par SDS-PAGE en faisant agir un anticorps reconnaissant spécifiquement la protéine purifiée. Cette expérience permet également de visualiser les produits de dégradation éventuels de la protéine d'intérêt, et d'expliquer ainsi la présence potentielle de bandes de plus faible poids moléculaire que la protéine.

24

SDS-PAGE (sodium dodecyl sulfate – polyacrylamide gel electrophoresis)

Principe: séparation de protéines en fonction de leurs masses moléculaires Quand elles sont dénaturées par la chaleur (à 95°C) en présence d’un excès de SDS et d’un agent réducteur (-mercaptoéthanol DTT -dithiothreitol-), la plupart des protéines fixent de la même façon le SDS (détergent anionique) qui les transforment en polyanions et leur confèrent donc une charge nette négative. Les protéines ayant la même densité de charge se déplaceront à la même vitesse dans un champ électrique. Dans le système SDS-PAGE, la séparation des protéines s’effectue donc uniquement selon un critère de taille.

s’effectue donc uniquement selon un critère de taille . Les gels de polyacrylamide résultent de la

Les gels de polyacrylamide résultent de la polymérisation d’un monomère, l’acrylamide, en présence un agent bifonctionnel (NN’méthylène bis acrylamide) réticulant les chaînes entre elles. La polymérisation du gel est initiée par l’ajout d’APS (persulfate d’ammonium) et est catalysée par l’ajout de TEMED (NNN’N’-tétraméthyl-éthylène diamine). La polymérisation se traduit par la formation d’un réseau de mailles, dont la taille varie en fonction de la concentration en acrylamide. La migration des protéines sera plus ou moins retardée en fonction de leur taille et de celle des mailles (9% séparation de grosses protéines, 15% de petites protéines). Il existe une relation linéaire entre la distance de migration électrophorétique et le log de la masse moléculaire des protéines dénaturées par le SDS.

La séparation des protéines s’effectue dans un système discontinu constitué de deux parties. Un gel de concentration (stacking-gel) qui contient des puits dans lesquels sont chargés les échantillons. Ce gel est coulé au-dessus d’un gel de séparation (running-gel) où les protéines seront séparées en fonction de la taille. L’acrylamide est neurotoxique. Manipuler avec des gants tant qu’il n’est pas polymérisé.

stacking-gel

puits

running-gel 25
running-gel
25

Des conditions natives de PAGE peuvent être réalisées pour conserver la structure des protéines, leur activité enzymatique ou l’interaction avec une autre protéine partenaire. Dans ce cas, il ne faut pas utiliser de SDS (dans aucun des tampons), d’agents réducteurs, ni bouillir les échantillons. Il s’agit alors d’une séparation selon la taille et la charge globale des protéines.

selo n la taille et la charge globale des protéines. Système SDS-PAGE (Miniprotean III, BioRad) PhastSystem

Système SDS-PAGE (Miniprotean III, BioRad)

des protéines. Système SDS-PAGE (Miniprotean III, BioRad) PhastSystem (Pharmacia) Extrêmement rapide Gels

PhastSystem (Pharmacia) Extrêmement rapide Gels pré-coulés

Les protéines peuvent être colorées au bleu de Coomassie ou à l’argent (très sensible).

rapide Gels pré-coulés Les protéines peuvent être colorées au bleu de Coomassie ou à l’argent (très
rapide Gels pré-coulés Les protéines peuvent être colorées au bleu de Coomassie ou à l’argent (très

26

Western-blot (Immuno-blot)

Principe: Sous l’effet d’un courant électrique, les protéines contenues dans le gel d’acrylamide vont être transférées ("blottées") sur une membrane (nitrocellulose, PVDF). Les protéines sont liées irréversiblement à celles-ci et peuvent donc être visualisées par réaction anticorps-antigène après traitement de la membrane par un anticorps spécifique de la protéine étudiée.

La détection s’effectue le plus souvent de manière indirecte grâce à

un

premier

anticorps et couplé à

- un radioisotope (auto-radiogramme)

- fluorophore

- une enzyme (phosphatase alcaline ou peroxydase)

- à la streptavidine (révélation par la biotine)

anticorps

secondaire

(anti

IgG)

dirigé

contre

le

Ac II aire

Ac I aire

Deux méthodes de détection sont couramment utilisées :

- réaction chromogénique qui produit un précipité sur la membrane au niveau de la protéine cible - chémiluminescence : émission de lumière au niveau de la protéine cible, détectée après exposition sur film photographique (très sensible) ex péroxydase /H 2 O 2 O 2 - (superoxyde)oxydation du luminol lumière

sensible) ex péroxydase /H 2 O 2  O 2 - (superoxyde)  oxydation du luminol

27

Electrophorèse ADN

Principe: séparation des acides nucléiques (AN) en fonction de leurs masses moléculaires

Des gels d'agarose de % différents (0,3 à 2%) sont utilisés pour séparer des fragments d'ADN de 0,2 à 20kb, ou de polyacrylamide pour des fragments de taille inférieure à 1kb (5 à 20%). Ces molécules chargées négativement migrent vers l'anode à une vitesse inversement proportionnelle à leur masse moléculaire. L'ADN est visualisé grâce au Bet (Bromure d’éthydium) qui s'intercale entre les bases des acides nucléiques et qui émet une fluorescence orange (à 590nm) après excitation aux UV (à 300nm). La taille et la quantité des fragments sont estimées par comparaison avec le marqueur de taille (seuil de détection dizaines de ng). Le Bet est potentiellement cancérigène : manipuler avec des gants, et utiliser les poubelles adéquates. L'observation du gel sous UV réclame une protection des yeux.

adéquates. L'observation du gel sous UV réclame une protection des yeux. Marqueur de taille 28 Mupid

Marqueur de taille

adéquates. L'observation du gel sous UV réclame une protection des yeux. Marqueur de taille 28 Mupid

28

Mupid system

DOSAGE de PROTEINES

PRINCIPE et GENERALITES

Plusieurs méthodes de dosage des protéines utilisent des propriétés des acides aminés, composant les protéines. Ce sont généralement des méthodes spectrophotométriques basées sur certaines caractéristiques spectrales ou réactionnelles des acides aminés. Le choix d’une méthode dépend des besoins et des caractéristiques recherchés: fiabilité, sensibilité, rapidité, possibilité de récupérer l'échantillon après dosage, présence de substances interférentes dans l'échantillon, etc

MÉTHODOLOGIES 1/ Absorption à 280 nm

Le tryptophane absorbe fortement à 280 nm de même que, dans une moindre mesure, la tyrosine. La phénylalanine et la cystine ont également de faibles absorptions dans cette région de l'U.V. rapproché. Il est donc possible de doser les protéines en mesurant l'A 280 . Évidemment l'absorption à cette longueur d'onde dépend principalement du nombre de tryptophanes dans le mélange protéique. Une solution contenant 1 mg de protéines/mL présente une A 280 de l'ordre de 0.5 à 2.0.

Pour une protéine pure, il est possible de calculer le coefficient d’extinction molaire. Il s'agit de calculer l'A 280 due à chacun des quatre acides aminés mentionnés précédemment et d'en faire le total. Il suffit alors de mesurer l’A 280 d’une solution protéique pure, dans un tampon contenant un agent chaotropique (chlorure de Guanidium qui permet de dénaturer complètement la protéine), pour déterminer sa concentration.

On s'est aperçu qu'il y a très peu de masquage de l'A 280. On peut donc appliquer en première approximation le coefficient d’extinction molaire calculé pour une protéine non dénaturée. Pour un mélange de protéines, la mesure de A 280 donne une approximation assez fiable, surtout pour comparer des mélanges de composition semblable.

Les avantages de cette méthode sont sa relativement bonne sensibilité (50-100 g), sa simplicité et sa rapidité d'exécution. Elle permet en outre de récupérer la solution protéique si besoin est, car elle ne nécessite pas que les protéines de la solution soient détruites par une réaction quelconque. Elle est particulièrement utile pour suivre le contenu en protéine de l'effluent d'une chromatographie.

Elle a cependant un désavantage majeur, la présence de contaminants ayant une absorption à 280 nm. Parmi ces contaminants potentiels, on trouve les acides nucléiques. Ils absorbent fortement dans l'U.V., avec un maximum autour de 254 nm, et contaminent souvent les préparations de protéines. Une méthode permet de déterminer la concentration protéique d'un mélange contenant une proportion donnée d'acides nucléiques. Cette méthode requiert la mesure

29

de l'absorption à deux longueurs d'onde: à 280 nm, pour les protéines, et à 260 nm, pour les acides nucléiques. Ces valeurs peuvent alors s'intégrer dans l'équation:

[protéines] (mg/mL) = 1.55 A 280 - 0.76 A 260

Parmi les autres contaminants potentiels, les produits tampons et les détergents peuvent souvent être problématiques. Une façon simple d'éliminer ce facteur est d'inclure ces produits dans le blanc, lorsque c’est possible.

2/Méthode du biuret

La réaction du biuret a permis de mettre au point une méthode quantitative de dosage des protéines. Cette réaction du biuret est la formation d'un complexe pourpre entre le biuret (NH 2 - CO-NH-CO-NH 2 ) et deux liens peptidiques consécutifs en présence de cuivre en milieu alcalin. Le complexe de coordination résultant absorbe fortement dans le bleu.

Cette méthode est peu sensible (1-20 mg), mais elle est relativement rapide. Sa principale qualité est d'avoir une absorption égale pour toutes les protéines. Certains composés interfèrent avec ce dosage, comme les peptides, le saccharose, le tampon Tris, le glycérol, etc

3/Méthode de Lowry

Cette méthode combine une réaction au biuret et une réaction au réactif de Folin- Ciocalteu. Ce dernier, à base de phosphomolybdate et de phosphotungstate, réagit avec les tyrosines et les tryptophanes, pour donner une coloration bleue qui s'ajoute à celle du biuret. Cette méthode a été tellement utilisée que l'article original de Lowry est un des articles scientifiques les plus cités au monde! Encore aujourd'hui on publie de nouvelles variantes de cette méthode.

La grande sensibilité de la méthode de Lowry est sa principale qualité. Elle peut atteindre 5-10 µg. La zone de linéarité de la réaction est cependant étroite et il faut utiliser la portion linéaire de la courbe qui correspond à l'absorption de l'inconnu.

Le protocole en est le suivant :

A 1 ml d'échantillon à doser, convenablement dilué dans l'eau distillée, on ajoute 5 ml de réactif C. Après dix minutes, on ajoute rapidement 0,5 ml de réactif de Folin-Ciocalteu, dilué de moitié dans l'eau (ajouter le réactif au centre du tube, ne pas le faire couler sur les parois). Ce réactif est préparé pendant les 10 minutes d'attente, et en quantité juste suffisante pour le dosage en cours (exemple: un témoin + 5 dosages, soit 6 tubes). Il vous faudra donc 3 ml de réactif dilué de moitié, c.a.d. 1,5 ml de réactif de Folin-Ciocalteu. Pour tenir compte d'un éventuel volume mort de la pipette, diluez 2 ml de réactif pur ---> 4 ml final). Mélanger. Après trente minutes à l'obscurité, l'absorption à 750 nm est lue et la concentration en protéines estimée par rapport à une courbe étalon établie avec l'albumine de sérum de boeuf (entre 0 et 0,1 g/l).

N.B.:

Réactif C = 50 parties de réactif A pour 1 partie de réactif B

30

Réactif A = Na 2 CO 3 20 g/l dans NaOH 0,1N Réactif B = CuSO 4 5 g/l; tartrate de sodium et de potassium 10 g/l. La courbe d'étalonnage sera réalisée à partir d'une solution mère à 100 mg/l

Cette méthode est très sensible à de très nombreuses substances interférentes: certains peptides et acides aminés. le saccharose, le tampon Tris, le glycérol, les dérivés mercaptan,

De nombreuses variantes ont été développées pour

contrer ces défauts. Entre autres, citons une méthode permettant d'éliminer les substances interférentes par microprécipitation des protéines à l'acide trichloroacétique après complexation

l'EDTA, de nombreux détergents, etc

avec du desoxycholate.

4/Méthode du bleu de Coomassie

Cette méthode est basée sur l'adsorption du colorant bleu de Coomassie G250. En milieu acide, ce colorant s'adsorbe sur les protéines et cette complexation provoque un transfert de son pic d'adsorption qui passe du rouge au bleu.

C'est une méthode très sensible (2-5 µg de protéines) et très rapide. Elle est aussi assez résistante à la plupart des interférents qui nuisent à la plupart des autres méthodes. Seuls les détergents, comme le Triton et le dodécylsulfate de Na (SDS), et des bases fortes interfèrent avec cette méthode.

Son principal défaut est sa réactivité très différente face à diverses protéines. Il faut par exemple noter que la protéine souvent utilisée pour la confection de courbes d'étalonnage, l'albumine sérique bovine (ou BSA), réagit beaucoup plus fortement que la moyenne et n'est donc pas appropriée. Un autre inconvénient de la méthode est la tendance du réactif à s'adsorber sur le verre des cuvettes de spectrophotomètre et qu'il faut donc les nettoyer consciencieusement après usage.

5/Acide bicinchonique

L'acide bicinchonique (BCA) réagit avec les complexes de Cu 2+ et de protéines de façon très similaire à la réaction du biuret. En formant de tels complexes, il prend une couleur pourpre typique. C'est une méthode sensible et rapide qui résiste aux détergents comme le Triton ou le SDS.

6/Méthode de Kejdahl

Cette méthode consiste à mesurer la quantité d'azote organique d'un échantillon. Il faut évidemment savoir, pour l'échantillon analysé, quelle est la relation entre la quantité d'azote et celle de protéines. Elle requiert un équipement coûteux et complexe. On ne l'applique qu'à des échantillons difficiles à homogénéiser comme du matériel végétal.

31

LE DOSAGE ENZYMATIQUE



Le substrat de l’enzyme doit être fourni en concentration saturante (supérieure à 10 fois le



Km). L’activité enzymatique est évaluée au cours du temps soit en évaluant la consommation



de substrat, soit en évaluant l’apparition d’un produit de la réaction. Cette évolution de la composition du mélange réactionnel peut être évaluée :



 soit directement en mesurant l’absorbance de l’élément suivi en utilisant son coefficient d’extinction molaire.  Soit en évaluant la concentration de cet élément dans le mélange par un dosage spécifique. Il est alors nécessaire de réaliser une gamme d’étalonnage. L’activité enzymatique peut être exprimée par ml de solution enzymatique o ou rapportée à la quantité de protéine enzymatique et on parle d’activité spécifique

Quelques exemples concrets :

1/ Evaluation de l’apparition d’un produit de réaction et utilisation du coefficient d’extinction molaire : exemple du dosage de la phosphatase alcaline dans un extrait cellulaire

Principe : La mesure de l'activité de la phosphatase alcaline exploite la réaction suivante :

de la phosphatase alcaline exploite la réaction suivante : NO2 - - O - PO3H2 +

NO2 -

- O - PO3H2 + H2O

----->

paranitophénylphosphate ou pNPP

O - PO3H2 + H2O -----> paranitophénylphosphate ou pNPP NO2 - - OH + H3PO4 paranitrophénol

NO2 -

- OH + H3PO4

paranitrophénol

La phosphatase alcaline hydrolyse le paranitrophénylphosphate en acide phosphorique et paranitrophénol qui absorbe à 410 nm.

Mode opératoire Mettre dans un tube à essai :

- 2 ml d’extrait cellulaire

- 1 ml de solution de pNPP à 2,5 10 -3 M

Incuber 1 heure à 37°C. Arrêter la réaction en ajoutant 0,6 ml de tampon PO4Na 1 M pH 8,5. Lire la D.O à 410 nm en utilisant comme témoin le contenu d'un tube dans lequel le pNPP a été remplacé par 1 ml d'eau distillée.

Calcul

Connaissant le coefficient d'absorption moléculaire du p-nitrophénol (soit = 1,75 X 10 3 UDO.M -1 ), déterminer la quantité de produit libéré à l’aide de la relation suivante DO/t x1,8/1 = lC (l, la longueur du trajet optique est généralement de 1 cm ; 1,8/1 permet de tenir compte du facteur de dilution de l’extrait dans le mélange enzymatique ; t est exprimé en

32

minutes, C est l’activité enzymatique exprimée en nombre de moles de pNP libéré par litre et par minute)

1 unité phosphatase est la quantité d'enzyme qui libére 1 µmole de paranitrophénol par minute à 37°C. Pour avoir l’activité enzymatique exprimée en unités phosphatase, il faut multiplier C par 10 6 (pour passer des moles en moles) et le diviser par 1000 (pour passer des l en ml)

2 /Evaluation de l’apparition d’un produit de réaction :

a/

Exemple du dosage

de

la

-galactosidase avec établissement d’une courbe

d’étalonnage pour l’évaluation de l’ONP produit.

On peut utilisé l'ortho-nitrophényl -D-galactopyrannoside ou ONPG qui est hydrolysé par la -galactosidase suivant la réaction:

ONPG + H 2 O

-galactosidase

---------->

galactose + ONP

L'ortho-nitrophényl (ONP) libéré présente en milieu alcalin une forte coloration jaune, dont l'intensité est proportionnelle à sa concentration, ce qui permet de le doser à 405 nm.

Le protocole expérimental du dosage dans un extrait cellulaire peut suivre les étapes suivantes :

- Au temps 0, mettre dans un tube 1 ml de la solution d'ONPG dans du tampon phosphate

pH7 et 2 ml d’extrait dilué dans du tampon phosphate pH7.

- Incuber à 28°C pendant 15 mn exactement, dans un bain-marie (ou noter exactement le

temps). On peut également préparer un volume réactionnel plus important au départ et faire des prélèvements de 3 ml à différents temps.

- Ajouter 2 ml de Na 2 CO 3 1 M pour arrêter la réaction et permettre le développement de la coloration jaune (en milieu alcalin) aux 3 ml de mélange réactionnel. - Bien agiter.

- Mesurer la densité optique à 405 nm en utilisant comme témoin un mélange de 2 ml

d’extrait dilué + 1 ml d'eau distillée + 2 ml de Na 2 CO 3.

- En se reportant à la courbe étalon (U DO= f( nmole ONP/ml d’extrait dilué)) on pourra

déterminer le nombre d'unités -galactosidase de l’extrait cellulaire en tenant compte de sa dilution successive dans la prise d’essai de 2 ml.

Etablissement de la courbe étalon Pour établir la courbe représentant les variations de la densité optique à 405 nm en fonction de la concentration en ONP, préparer une série de dilutions de 1/10ème en 1/10ème , dans du tampon phosphate 0,1 M pH 7, à partir d’une solution mère d'ONP 2.10 -3 M. Réaliser une courbe étalon : DO (4O5nm) / nmole d’ONP /ml d’extrait dilué * Une unité -galactosidase est souvent définie comme étant la quantité d'enzyme libérant 1.10 -9 mole (1 nmole) d'ONP par minute à 28°C.

33

L’unité officielle d’activité enzymatique est le katal. Le katal (kat) est la quantité d'enzyme qui catalyse la transformation de 1 mole de substrat par seconde. Le katal n'est jamais utilisé, car beaucoup trop grand. On utilise plutôt le µkat (10 -6 katal), nkat (10 -9 katal) ou le pkat (10 -12 katal).

La plupart des biochimistes préfèrent l' "unité internationale" (IU, International Unit), qui est la quantité d'enzyme qui catalyse la transformation de 1 µmole de substrat par minute. 60 IU valent donc1 µkat.

b/ Le dosage de l’activité -galactosidase exprimée en Unités Miller

Principe :

Le substrat utilisé est également l’ONPG (ortho-nitrophényl -galactopyranoside) qui est hydrolysé en milieu aqueux en galactose et ONP (ortho-nitophénol). Le dosage est réalisé sur 0,1 ml d'échantillon de culture selon le protocole mis au point par Miller en 1972. Les unités Miller obtenues sont des unités arbitraires proportionnelles à une augmentation de la quantité d'ONP par minute et par cellule. Elles présentent l'avantage d'être de l'ordre de plusieurs centaines lorsque la ß-galactosidase est présente dans la cellule et d'au maximum 10 lorsque l'enzyme est absente.

Mode opératoire - Dans un tube contenant 0,9 ml de tampon Z (tampon Z (Na 2 HPO 4 ,7H 2 O: 0,06M; NaH 2 PO 4 ,H 2 0: 0,04M; KCl: 0,01M; MgSO4,7H 2 O: 0,001M; ß-mercaptoéthanol: 0,05M; pH

7). Ce tampon "phosphate" permet le maintien de l'état réduit des groupements SH des protéines indispensable à l'activité de la ß-galactosidase grâce au ß-mercaptoéthanol) est ajouté 0,1 ml de culture préalablement refroidie. Faire un ou deux tubes témoins avec 0,9 ml de tampon Z et 0,1 ml de milieu de culture stérile.

- Mélanger

- Ajouter 1 goutte de toluène (à la pipette Pasteur, sous la hotte). Celui-ci permet l'interruption partielle de la membrane cytoplasmique et permet ainsi aux petites molécules comme l'ONPG de diffuser dans le cytoplasme qui contient la ß-galactosidase.

- Mélanger au vortex pendant 10 secondes

- Ouvrir les tubes et les mettre dans une étuve à 37°C pendant environ 40 minutes. Cette étape permet l'évaporation du toluène.

- Ajouter 0,2 ml de solution d'ONPG (à 4 mg/ml dans du tampon phosphate) et déclencher un

chronomètre, puis placer immédiatement les tubes dans un bain marie à 28°C.

- Surveiller la coloration jaune dans les tubes. Dès qu'elle apparaît, il faut sortir le tube du bain marie, arrêter la réaction avec 0,5 ml de Na 2 CO 3 1M, et noter le temps de réaction. Après 2

heures de réaction, arrêter les réactions dans tous les tubes qui n'ont pas "jauni"

- Centrifuger les tubes pendant 5 minutes

- Transférer 1 ml de surnageant dans une microcuve.

- Lire les DO à 550nm et à 420nm pour chaque échantillon en faisant le zéro d'absorbance sur le tube témoin.

Calcul des unités Miller L'activité ß-galactosidase mesurée selon Miller est proportionnelle à l'absorbance à 420nm résultant de l'absorbance de l'ONP et est inversement proportionnelle au temps de réaction, au

34

volume d'échantillon utilisé pour faire la réaction et à la concentration cellulaire de l'échantillon (donnée par l'absorbance des cellules à 600nm). L'absorbance mesurée à 420nm est en fait la somme de l'absorbance de l'ONP et de l'absorbance des débris cellulaires qu'il peut subsister dans les cuves. Pour éliminer cette dernière absorbance il convient de retrancher à la mesure lue à 420nm la mesure de l'absorbance à 550nm (due aux débris cellulaires seuls) multipliée par le facteur 1,75 quand il s'agit de cultures d' E. coli.

L'activité en unités Miller est donc donnée par la formule 10 3 x (DO 420 - (1,75 x DO 550 )) / t x V x DO 600 t : temps de réaction en mn v : volume de culture utilisé pour faire la réaction en ml

avec

Calcul des activités spécifiques Il est possible de convertir les unités Miller ainsi obtenues en activité spécifique de la ß- galactosidase exprimée en unité ß-galactosidase par mg de protéine. L'unité ß-galactosidase est souvent définie comme la quantité d'enzyme qui produit une nmole d'ONP par minute à 28°C et à pH 7. Dans les conditions utilisées ci-dessus, une nmole d'ONP/ml a une absorbance à 420nm de 0,0045. De plus, bien que les dosages de protéines dans les extraits cellulaires soient précis et relativement rapides, il est possible d'estimer la quantité de protéines à partir de la DO à 600nm en supposant que 10 9 cellules contiennent 150µg de protéines et que 2 unités DO 600

correspondent à 10 9 cellules par ml.

Conseils pour l’établissement d’une COURBE ETALON

I) Dilutions - Pour l'établissement des courbes étalon, une solution-mère (SM) dont la concentration correspond au maximum de la courbe étalon est utilisée. A partir de cette SM, il faut

confectionner des dilutions de 1/10 e en 1/10 e de façon à obtenir 10 points expérimentaux (1/10 e ,

8/10 e , 9/10 e , SM) régulièrement espacés sur votre courbe. Attention, il ne s’agit pas de

2/10 e ,

, dilutions en cascade.

- Préparez des volumes suffisants des dilutions pour éviter les erreurs dues au pipetage de faibles

volumes. Par exemple, pour une dilution 8/10 e :

8

ml de SM + 2 ml d'eau distillée, ou

4

ml de SM + 1 ml d'ED.

II) Pipetage

- Il est préférable d'utiliser des pipettes de précision (volumes repérés par un code de couleur).

- Toujours pipeter un volume entre deux graduations de la pipette, et non entre une graduation et l'extrémité de celle-ci (pipette à écoulement total). Vous gagnerez ainsi en précision.

- Pour le maximum de précision, utiliser une pipette dont le volume maximum est le plus proche possible de votre volume à pipeter.

35

III)

Echantillon

- Toujours bien agiter vos dilutions (au vortex de préférence) avant de prélever le volume

d'échantillon (1 ml en général) nécessaire au dosage. Ne confondez pas dilution et échantillon.

Le volume de la dilution importe peu (exemple: 10 ml ou 5 ml pour les deux dilutions au 8/10 e décrites précédemment). Le volume de l'échantillon est défini par les conditions expérimentales du dosage. Appliquer sur les différents échantillons ainsi confectionnés les différentes étapes du dosage.

IV)

- Il est absolument obligatoire de faire un témoin pour chaque série de mesure. Ce témoin

contiendra tous les réactifs (seul l'échantillon sera remplacé par un volume égal d'eau distillée), et

sera incubé de la même façon que les autres tubes: temps de réaction, température, lumière ou obscurité. A ce propos il est primordial de respecter scrupuleusement les conditions de réaction si vous voulez obtenir des résultats précis et reproductibles.

Témoin

V) Mesures -Vérifier que les parois des cuves de mesure ne soient pas recouvertes de buée

- Faire toutes vos mesures avec la même cuve (neuve). Commencer par régler le zéro du

spectrophotomètre sur le témoin, puis vider la cuve, l'égoutter sur un kleenex et la remplir avec la

plus grande dilution (1/10 e ), faire la mesure puis vider la cuve et passer à la dilution suivante; ainsi de suite jusqu'à la solution mère. Vous vous affranchirez ainsi des petites erreurs de mesure dues aux imperfections des cuves de plastique.

- Enfin, avant de faire vos mesures, vérifiez toujours que le spectrophotomètre que vous allez utiliser est réglé sur la bonne longueur d'onde.

36