Vous êtes sur la page 1sur 37

1 Simulado 2007 - Estilo UFC

1 Simulado 2010 Estilo ENEM


Prova de Conhecimentos Gerais

CINCIAS DA NATUREZA E
SUAS TECNOLOGIAS
Questes de 1 a 45

Questo 01
Observe o seguinte anncio:

A propaganda acima citada est relacionada divulgao de um cosmtico de grande aceitao no mercado e com benefcios
comprovados. As zonas quadriculadas preservam a marca do produto. A partir da anlise acima, indique a afirmao verdadeira.
a) O pH da pele ligeiramente bsico, logo existe uma falha na divulgao quando se afirma que a composio natural da superfcie da
pele neutra.
b) O pH da pele neutro, logo a divulgao est correta ao divulgar que a composio natural da superfcie da pele neutra.
c) O pH da pele ligeiramente cido, logo existe uma falha na divulgao quando se afirma que a composio natural da superfcie da
pele neutra.
d) O pH da pele ligeiramente cido, mas no existe falha na divulgao quando se afirma que a composio natural da superfcie da
pele neutra.
e) O pH da pele ligeiramente cido, mas no existe falha na divulgao pois esta no afirma que a composio natural da superfcie da
pele neutra.

Questo 02
A todo momento, os seres vivos pluricelulares perdem muitas
clulas do prprio corpo, como, por exemplo, quando ocorrem
ferimentos, quando os alimentos passam pelo trato digestrio e
ate mesmo quando h o envelhecimento celular, mas, graas a
um processo de diviso celular, a mitose, as clulas somticas
so repostas diariamente. No entanto, para uma clula se dividir
em duas novas clulas iguais, ela deve passar por um processo
anterior de multiplicao do seu contedo. Essa etapa e
conhecida como interfase.
Existe um segundo tipo de diviso celular, a meiose, que ocorre
somente nas clulas gamticas. Esse processo permite que o
nmero cromossmico das espcies seja mantido aps o evento
da fecundao e que os indivduos sejam geneticamente
diferentes entre si. Portanto, as clulas podem se dividir por
mitose e/ou meiose.

Com relao, ao exposto acima, assinale a alternativa correta.


a) Os processos de mitose e meiose ocorrem em todos os
seres vivos.
b) O numero cromossmico permanece igual aps ambos os
processos, contudo as clulas que realizam o segundo tipo
de diviso celular sofrem a permuta gnica, o que gera
variabilidade gentica.
c) A transcrio de RNA ocorre principalmente na interfase.
Durante os processos de divises, a transcrio diminui,
chegando ate a inativao.
d) Na fase de metfase, os fusos mitticos se ligam aos
telmeros dos cromossomos.
e) Tanto na anfase da mitose quanto nas anfases I e II da
meiose, as cromatides irms so separadas para os plos
opostos.

Simtrico Pr-Universitrio 1 Simulado Estilo ENEM 2010 www.simetrico.com.br

1 Simulado 2010 Estilo ENEM


Questo 05

Questo 03
Os grficos representam o crescimento de dois animais (A e B).

O hidrognio o elemento qumico mais abundante no universo.


No planeta Terra, ele o terceiro em ocorrncia (aps oxignio e
silcio). No entanto, como substncia simples, ele representa
apenas 0,81% em volume da atmosfera.
Com base nas informaes acima, assinale a alternativa correta.
a) O elemento qumico hidrognio pode formar apenas
compostos covalentes.
b) 11 X 12 Y e 13 Z , no so nucldeos do elemento qumico
hidrognio.
c) O nucldeo 12 Y o deutrio, que com o oxignio forma a
gua dura.
d) 0,81% em volume significa que, em 1 L de ar atmosfrico
existem 8,1 mL de gs hidrognio.
e) O tomo de hidrognio isoeletrnico com o gs nobre
Hlio, e com o ction bivalente do Ltio.

Questo 06

Baseado nos mesmos correto afirmar que:


a) O animal A, quando adulto, ter um tamanho maior que B.
b) O animal B, quando adulto, ter um tamanho maior que A.
c) O animal A tem crescimento limitado.
d) O animal B, em momento algum, apresenta o mesmo
tamanho de A.
e) Os animais A e B, num dado momento, podem apresentar o
mesmo tamanho.

O professor "Django um empreendedor. Alm de exercer o


magistrio, tambm horticultor. Querendo expandir suas fontes
de renda, resolveu investir no cultivo de escargots. Adquiriu um
exemplar da espcie Achatina fubica e colocou-o em sua horta.
Aps algum tempo observou a destruio de sua horta pela ao
de um elevado nmero de escargots. Ficou pasmo, pois era
impossvel a invaso da horta pelos referidos animais. Com base
no texto e seus conhecimentos, correto afirmar que:
a) a espcie utilizada para iniciar o cultivo de escargots realiza
reproduo assexuada.
b) o animal cultivado no pertence classe gastropoda.
c) o nmero de animais aumentou como resultado de
fecundao cruzada.
d) a espcie usada para iniciar a criao no monica.
e) a espcie citada do gnero Achatina e do filo mollusca.

Questo 04
O famoso professor Raul Brito viaja para Sobral toda semana
para lecionar Matemtica. Usualmente, ele desenvolve uma
velocidade mdia de 100 km/h durante todo o percurso. Na
viagem da semana passada, ao ser surpreendido por uma
chuva, decide reduzir a velocidade para 60 km/h, permanecendo
assim at a chuva parar, 20 min depois, quando retorna sua
velocidade inicial. Essa reduo temporria de velocidade fez
com que o tempo da viagem do Raul aumente, com relao
estimativa inicial, em:
a) 4 min
b) 6 min
c) 8 min
d) 10 min
e) 12 min

Questo 07
A propagao de ondas na gua estudada em grandes
tanques, com detectores e softwares apropriados. Em uma das
extremidades de um tanque, de 200 m de comprimento, um
dispositivo D produz ondas na gua, sendo que o perfil da
superfcie da gua, ao longo de toda a extenso do tanque,
registrado por detectores em instantes subseqentes. Um
conjunto de ondas, produzidas com freqncia constante, tem
seu deslocamento y, em funo do tempo, representado ao lado,
tal como registrado por detectores fixos na posio x = 15 m.
Para esse mesmo conjunto de ondas, os resultados das
medidas de sua propagao ao longo do tanque so
apresentados na pgina de respostas. Esses resultados
correspondem aos deslocamentos y do nvel da gua em
relao ao nvel de equilbrio (y = 0 m), medidos no instante
t = 25 s para diversos valores de x. A partir desses resultados:

Simtrico Pr-Universitrio 1 Simulado Estilo ENEM 2010 www.simetrico.com.br

1 Simulado 2007 - Estilo UFC


1 Simulado 2010 Estilo ENEM
Prova de Conhecimentos Gerais

responsveis pelo procedimento, usaram a ECP para induzir


funes dentro das redes cerebrais residuais e ainda funcionais.
Segundo os pesquisadores, se os resultados forem replicados
em outros casos, podero mudar os padres de cuidado desses
pacientes crnicos, que passaro a contar com a possibilidade
de tratamentos e acompanhamentos clnicos reabilitativos.
A figura mostra, em um certo instante, a situao de um paciente
no qual eletrodos so aplicados em pontos A, B e C, separados
pelas distncias indicadas. De B para c o potencial eltrico
cresce de 1 mV e de A para C, de 2 mV.

Estime a freqncia f, em Hz, com que as ondas foram


produzidas e assinale a opo corresponde mesma.
a) 0,1 Hz
b) 0,2 Hz
c) 0,3 Hz
d) 0,4 Hz
e) 0,5 Hz

Questo 08
Implante de eletrodos no crebro traz
paciente de volta vida
Agncia FAPESP - 03/08/2007
Um paciente, norte-americano de 38 anos, que, aps ter sido
vtima de agresso, estava no que se chama de estado de
conscincia mnima. Sua nica forma de comunicao,
inconsistente, resumia-se a eventuais movimentos com os dedos
ou com os olhos. Aps seis anos nesse estado, o paciente
deixou de precisar se alimentar por meio de tubos e recuperou a
capacidade de se expressar verbalmente.

Supondo, para fins de estimativa, que o campo eltrico E ao


longo do segmento AB seja uniforme e tenha a direo de AB,
ento E:
a) Aponta de A para B e tem mdulo 7,5.10-3 V/m
b) Aponta de B para A e tem mdulo 2,5.10-3 V/m
c) Aponta de B para A e tem mdulo 7,5.10-6 V/m
d) Aponta de A para B e tem mdulo 2,5.10-3 V/m
e) Aponta de B para A e tem mdulo 7,5.10-3 V/m

Questo 09

Implante de eletrodos
A causa de tamanha e extremamente rara recuperao de uma
leso cerebral traumtica se deve ao sucesso indito - e que
est sendo considerado revolucionrio - de um procedimento
conhecido como estimulao cerebral profunda (ECP). A cirurgia
envolve o implante de eletrodos para promover impulsos
eltricos em determinadas regies cerebrais. Os mdicos

Na cidade de Fortaleza, praas e avenidas so iluminadas com


lmpadas de vapor de sdio (luz amarela) e vapor de mercrio
(luz branca). Como sabemos a descarga eltrica atravs desses
gases, promove a emisso de luz, como conseqncia dos
saltos dos eltrons.
Com relao a este fenmeno, marque a alternativa verdadeira.
a) A luz branca e a luz amarela possuem a mesma intensidade,
sendo constitudas por ftons com diferentes energia.
b) Ao saltar de uma rbita para outra mais externa, o eltron
emite energia radiante.
c) Ondas eletromagnticas so liberadas no instante em que o
eltron passa do estado fundamental para o estado excitado.
d) No estado excitado o eltron acumula a energia absorvida
durante a descarga eltrica.
e) A luz amarela e a luz branca so emitidas por ondas
eletromagnticas de diferentes freqncias e mesmo
comprimento de onda.

Simtrico Pr-Universitrio 1 Simulado Estilo ENEM 2010 www.simetrico.com.br

1 Simulado 2010 Estilo ENEM

Questo 10
O jogo-da-velha um jogo popular, originado na Inglaterra. O
nome velha surgiu do fato de esse jogo ser praticado, poca
em que foi criado, por senhoras idosas que tinham dificuldades
de viso e no conseguiam mais bordar. Esse jogo consiste na
disputa de dois adversrios que, em um tabuleiro 3 X 3, devem
conseguir alinhar verticalmente, horizontalmente ou na diagonal,
3 peas de formato idntico. Cada jogador, aps escolher o
formato da pea com a qual ir jogar, coloca uma pea por vez,
em qualquer casa do tabuleiro, e passa a vez para o adversrio.
Vence o primeiro que alinhar 3 peas.
Substituindo os tradicionais smbolos do famoso jogo-da-velha
por artrpodes, sendo: = Animais Dceros e X = Animais
ceros. Analise o tabuleiro abaixo:

FSH e estrognios dominam os primeiros 15 dias do ciclo


menstrual com a finalidade de tornar a mulher frtil, isto , de
preparar para a fecundao uma das 350 mil clulas germinativas
com as quais nasceu."
O trecho faz referncia a um grupo de clulas que a mulher
apresenta ao nascer. Essas clulas so
a) ovognias em incio de meiose, presentes no interior dos
folculos ovarianos e apresentam 23 cromossomos.
b) ovcitos em incio de meiose, presentes no interior dos
folculos ovarianos e apresentam 46 cromossomos.
c) ovcitos em fase final de meiose, presentes no interior de
folculos ovarianos e apresentam 23 cromossomos.
d) vulos originados por meiose, presentes na tuba uterina e
apresentam 23 cromossomos.
e) ovognias em incio de meiose, presentes na tuba uterina e
apresentam 46 cromossomos.

Questo 12

Obs.: Os nmeros 1, 2, 3, 4 e 5 sero usados para a resoluo


da questo.
Neste momento a vez do jogador que utiliza os crculos. Esse
jogador ganhar o jogo se:
a) Se substituir o nmero 1 por carrapato.
b) Se substituir o nmero 2 por piolho.
c) Se substituir o nmero 5 por pulga.
d) Se substituir o nmero 3 por borboleta.
e) Se substituir o nmero 4 por aranha.

Questo 11
O trecho a seguir foi extrado do artigo "Desencontros sexuais", de
Drauzio Varella, publicado na "Folha de S. Paulo", em 25 de
agosto de 2005.
"Nas mulheres, em obedincia a uma ordem que parte de
uma rea cerebral chamada hipotlamo, a hipfise libera o
hormnio FSH (hormnio folculo estimulante), que agir sobre os
folculos ovarianos, estimulando-os a produzir estrognios,
encarregados de amadurecer um vulo a cada ms.

Com a atual crise no fornecimento de energia eltrica, uma boa


maneira de economizar energia substituir as lmpadas
incandescentes, que tm um rendimento muito baixo, por
lmpadas fluorescentes. Estas lmpadas contm gs neon puro
ou misturado com argnio a baixa presso e uma pequena
quantidade de mercrio lquido. Quando submetido a uma
tenso eltrica, o gs ioniza-se, baixando sua resistncia eltrica
e estabelecendo uma corrente eltrica no seu interior. O
mercrio, ento, vaporiza-se e as sucessivas colises entre seus
tomos e o neon fazem com que eles emitam radiao visvel e
ultravioleta. Esta ltima absorvida pelo p fluorescente da
camada interior do tubo, que o reemite na faixa da radiao
visvel. Esse o motivo do alto rendimento e baixo consumo de
energia dessas lmpadas.
Considere um feixe de radiao ultravioleta propagando-se no ar
com uma velocidade de 3,0 x 108 m/s e freqncia de
1,0 x 1015 Hz. Qual o comprimento de onda, no ar, desta
radiao?
a) 3 x 107 m
b) 8 x 107 m
c) 10 x 107 m
d) 15 x 107 m
e) 20 x 107 m

Simtrico Pr-Universitrio 1 Simulado Estilo ENEM 2010 www.simetrico.com.br

1 Simulado 2007 - Estilo UFC


1 Simulado 2010 Estilo ENEM
Prova de Conhecimentos Gerais

Questo 13
Ao abastecer o veculo em um posto, o consumidor adquire a gasolina C, uma mistura de gasolina A (pura) com lcool anidro. A
proporo em volume de lcool anidro nessa mistura determinada por resolues federais, podendo variar entre 20% e 25%. O teor de
lcool na gasolina deve ser analisado, a fim de aferir a qualidade desse combustvel, como ilustrado a seguir:

A partir dos dados da ilustrao, correto afirmar que, em volume, o teor de lcool presente nessa gasolina de:
a) 32%
b) 68%
c) 66%
d) 20%
e) 24%

Questo 14
Galileu Galilei foi um fsico, matemtico, astrnomo e filsofo
italiano que teve um papel preponderante na chamada revoluo
cientfica. Ele desenvolveu os primeiros estudos sistemticos do
movimento uniformemente acelerado e do movimento do
pndulo. Descobriu a lei dos corpos e enunciou o princpio da
inrcia e o conceito de referencial inercial, idias precursoras da
mecnica newtoniana.

Galileu melhorou significativamente o telescpio refrator e com


ele descobriu as manchas solares, as montanhas da Lua, as
fases de Vnus, quatro dos satlites de Jpiter, os anis de
Saturno, as estrelas da Via Lctea. Estas descobertas
contriburam decisivamente na defesa do heliocentrismo.
Contudo a principal contribuio de Galileu foi para o mtodo
cientfico, pois a cincia assentava numa metodologia
aristotlica.
Chegou a ser destinado carreira religiosa, mas o seu pai
queria que fosse mdico e por isso inscreveu-o na Universidade
de Pisa. No entanto desistiu de estudar medicina e decidiu
estudar matemtica. Foi nessa poca que inventou a balana
hidrosttica, cujo mecanismo descreveu no breve tratado "La
bilancetta", publicado em 1644. Durante o curso de medicina
descobriu o isocronismo do pndulo, determinando que o seu
perodo no depende da massa, mas apenas do comprimento
do fio. Foi o primeiro a pensar que este fenmeno permitiria
fazer relgios muito mais precisos, e j no final da sua vida viria

Simtrico Pr-Universitrio 1 Simulado Estilo ENEM 2010 www.simetrico.com.br

1 Simulado 2010 Estilo ENEM

a trabalhar no mecanismo de escapo que mais tarde originaria o


relgio de pndulo.
Em Pisa realizou as suas famosas experincias de queda de
corpos em planos inclinados. Nestas demonstra que a
velocidade de queda no depende do peso.
Um dos princpios que Galileu estabeleceu foi que, quando um
corpo parte do repouso em MRUV, as distncias percorridas por
ele em intervalos de tempo arbitrariamente iguais, so
diretamente proporcionais aos nmeros mpares 1, 3, 5, 7, 9,
11.... etc.
Essa propriedade pode ser facilmente compreendida quando se
analisa as reas sob o grfico V x T para esse movimento.

do complexo, um dos instrumentos da "soluo final", o


meticuloso plano de extermnio dos judeus arquitetado pelos
nazistas.

velocidade

Prisioneiros em Auschwitz

0 1T

2T

3T

4T

5T

tempo

Considere que uma rampa possua uma extenso de 64 m.


Quando uma bola de sinuca abandonada do repouso do ponto
mais alto dessa rampa, determine as sucessivas distncias x1,
x2, x3 e x4 que sero percorridas por essa bola em intervalos de
tempos iguais:
a) 4, 12, 20, 28
b) 3, 9, 18, 34
c) 4, 10, 20, 30
d) 6, 12, 18, 28
e) 5, 12, 20, 27

Questo 15
Viagem na memria: o inferno de Auschwitz
Em meados de 1944, em plena Segunda Guerra Mundial (19391945), o jovem combatente da Resistncia francesa Charles
Gottlieb, ento com 18 anos, foi detido e colocado em um trem
rumo a um destino desconhecido. Ao desembarcar em seu
paradeiro final, se viu diante de um portal que dava acesso a
uma enorme rea cercada de arame farpado, vigiada por
guardas armados e povoada de farrapos humanos, a maioria
vestida com uniformes listrados. A primeira frase que ouviu
ressoa at hoje em sua memria: "Aqui voc entra por esse
porto e sai por aquela chamin", disse seu interlocutor,
apontando para a fumaa que saa ao longe do topo de uma
torre de tijolos. Quem lhe deu as boas-vindas foi um dos
prisioneiros do campo de Auschwitz-Birkenau, na Polnia. A
fumaa a que se referia provinha de um dos fornos crematrios

Cmaras de gs em Auschwitz
O macabro campo hoje uma extensa rea deserta de ruidoso
silncio. Uma grama verde substitui o lodaal de outrora. Das
cmeras de gs, onde os detentos eram asfixiados pelo vapores
do Zyklon B* em uma morte lenta de at 20 minutos, pensando
que se dirigiam para uma ducha, restam runas.
Duas a trs vezes por semana, no meio da madrugada, diz ele,
os alemes fazerem uma inspeo nos dormitrios para
"controle de pulgas". "Era tudo inveno para exterminar mais
pessoas. Eles escolhiam alguns que diziam estar infectados,
colocavam na parte traseira do caminho, fechada, com o cano
da descarga inserido no interior. Os prisioneiros morriam no
caminho e os corpos era desovados diretamente nos fornos para
incinerao".
Fernando Eichenberg, jornalista
www.terramagazine.terra.com.br
* Zyklon B era a marca registrada de um pesticida a base de
cido ciandrico que foi utilizado pelos Nazistas como veneno no
assassinato em massa por sufocamento em sesses de banho
coletivo nas cmaras de gs.
O Zyklon B foi inicialmente usado nos campos de concentrao
para desinfestar piolhos e evitar o tifo. Em setembro de 1941, as
primeiras experincias foram realizadas no campo de
concentrao de Auschwitz para testar o assassinato de
humanos com o veneno.

Simtrico Pr-Universitrio 1 Simulado Estilo ENEM 2010 www.simetrico.com.br

1 Simulado 2007 - Estilo UFC


1 Simulado 2010 Estilo ENEM
Prova de Conhecimentos Gerais
Com relao ao exposto acima, marque a opo correta.
a) Nas cmaras de gs, envenenava-se os prisioneiros por
ao do cido ciandrico (HNC) utilizado na forma de
vapores.
b) O Zyklon B fundamenta-se na asfixia por interao do CO
com os ons ferrosos que gera asfixia por diminuir a ao
das hemoglobinas.
c) Da descarga dos caminhes era eliminado gs ciandrico,
que mata por asfixia.
d) A fumaa dos caminhes capaz de envenenar uma pessoa
em ambiente fechado pela ao do CO que diminui o
transporte de oxignio para os tecidos.
e) No pode-se matar pessoas somente com a ao das
fumaas de caminho, por isso utilizava-se HCN (cido
ciandrico).

cruzamento entre mudas altas e baixas das duas espcies (P1),


obtendo F1 que ao serem fentipos resultantes dos cruzamentos
foram representados nos grficos a seguir:

Questo 16
Notcia de um certo jornal de circulao nacional em meados de
abril de 2010: Polcia Federal prende homem suspeito de ser
um dos maiores traficantes de ECSTASY da Europa para o
Brasil.
Apesar de ser uma boa notcia, o problema est longe de ser
resolvido. O consumo de drogas entre os jovens cresce a cada
dia, no mundo inteiro. No Brasil no diferente o ECSTASY por
exemplo muito consumido nas baladas noturnas e a sua
combinao com bebidas alcolicas pode causar conseqncias
desastrosas ao usurio!!! O ECSTASY apresenta a estrutura
representada a seguir:
O
O

NH

CH3

CH3

Com relao molcula do ECSTASY assinale a alternativa


correta.
a) Apresenta frmula emprica C11H13O2N
b) Na sua estrutura, existem 4 pares de eltrons no ligantes.
c) No pode ser classificado bioquimicamente como
aluciongeno.
d) Trata-se de uma molcula que apresenta amina secundria,
ter cclico e grupos alquila.
e) uma molcula aromtica com estrutura homocclica.

Supondo que as plantas altas, tanto da espcie X quanto da


espcie Y, sejam mais produtivas, pode-se afirmar corretamente
que se obtm na espcie:
a) X e na espcie Y, 100% de mudas altas ao cruzar mudas
altas em F2;
b) X, 50% de mudas altas ao cruzar as mudas altas em F1;
c) Y, 100% de mudas altas ao cruzar as mudas mdias em F2;
d) Y, 100% de mudas altas ao cruzar mudas altas em P1 com
mudas altas em F2;
e) Y, 100% de mudas altas ao cruzar mudas altas em P1 com
mudas mdias em F2.

Questo 18
A FORA G Nas transmisses de corridas de Frmula 1 pela
TV, frequentemente mostrado no canto da tela o medidor
virtual de fora g indicando a intensidade da fora g que o piloto
est sentindo em tempo real.

Questo 17
Com o enorme crescimento populacional, ha tambm uma
necessidade crescente de alimentos, o que estimula a obteno
de culturas vegetais com mxima produtividade. Muitas vezes
esse melhoramento lana mo do conhecimento da herana
gentica de um determinado carcter como, por exemplo, a
altura. Supondo-se que duas espcies vegetais - X e Y poderiam apresentar mudas com alturas diferentes, realizou-se

Mas afinal o que a Fora G ? a fora fictcia que voc sente


para trs, quando acelera o carro bruscamente para frente; Ou
que voc sente para frente quando seu carro bruscamente
freado; Ou que voc sente lhe puxando para fora da curva,
quando voc faz uma curva fechada. Voc sentir essa fora G

Simtrico Pr-Universitrio 1 Simulado Estilo ENEM 2010 www.simetrico.com.br

1 Simulado 2010 Estilo ENEM

sempre que estiver acelerado, portanto, s estar livre dela caso


esteja parado ou em movimento retilneo sem acelerao.
Por que ela chamada de fora G ? Ora, para fazer uma aluso
fora da gravidade (peso) que tambm age em voc. Por
exemplo, se seu carro d uma freada muito brusca com uma
acelerao retardatria a = 20 m/s2, essa acelerao equivale a
duas vezes a acelerao da gravidade (terrestre). Nessa freada
brusca, dizemos que seu corpo ficar sujeito a fora g de
intensidade 2G empurrando seu corpo para frente. rigor,
isso significa que, durante essa freada, voc se sentir
empurrado para frente por uma fora duas vezes maior do que o
seu prprio peso, ou seja, uma fora 2P.

Freada brusca (a bolinha sai


do centro e vai para frente)

Curva para a esquerda (a


bolinha sai do centro e vai
para a direita)

Acelerada forte para frente


(a bolinha sai do centro e vai
para trs)

Curva para a direita (a


bolinha sai do centro e vai
para a esquerda)

Da mesma forma, digamos que voc faa uma curva fechada de


raio R com velocidade V no seu carro de Frmula 1 , com uma
acelerao centrpeta actp = V2/R = 30 m/s2. Essa acelerao
equivale a trs vezes a acelerao da gravidade g = 10 m/s2.
Nesse caso, voc sentir seu corpo sendo empurrado
radialmente para fora da curva com uma fora g de intensidade
3G. Em outras palavras, voc sentir uma fora fictcia trs
vezes maior do que o seu peso lhe empurrando para a fora da
curva, ou seja, uma fora 3P. Nas curvas, essa fora tambm
chamada de fora centrfuga.
A fora G, na verdade, uma fora fictcia. Quem est fora do
carro, em p fora no gramado assistindo ao piloto fazer curva,
no enxerga nem sente essa fora. Ela s percebida, de fato,
por quem est sob o efeito da acelerao.
Em 29 de abril de 2001, funcionrios da CART (Champion Auto
Racing Teams) cancelaram uma corrida no Texas Motor
Speedway porque os pilotos tiveram vertigens aps apenas
10 voltas. A combinao de altas velocidades e curvas fechadas
do Texas Motor Speedway gera foras de quase 5G nas curvas.
A 5G, um piloto experimenta uma fora igual a cinco vezes o seu
peso.

Os pilotos sofrem um enorme castigo em uma pista como essa.


Esse nvel de acelerao maior do que a maioria das pessoas
j experimentou. Mesmo um nibus espacial desenvolve
somente 3G na decolagem. O mais surpreendente o tempo
que esses pilotos toleram esse tipo de fora.
O autdromo do Texas Motor Speedway tem 2,4 km de
comprimento: a reta frontal tem 686 m de comprimento e a reta
oposta tem 405 m de extenso.

A uma velocidade de 370 km/h, os pilotos demoram cerca de 6,5


segundos para percorrer a reta frontal e ento enfrentam quase
5G de fora nos 6,5 segundos seguintes, enquanto eles
contornam a curva. Em seguida, demoram somente cerca de 4
segundos para percorrer a reta oposta antes da prxima curva e
outros 6,5 segundos de quase 5G novamente. Se a corrida
planejada de 966 km tivesse prosseguido at o final, os pilotos
teriam sofrido uma variao de 5G (nas curvas) at quase
zero G (nas retas) cerca de 800 vezes durante toda a prova
(urra !).
A musculatura do pescoo dos pilotos sofre bastante em provas
de corrida por causa dessa fora G, requerendo grande preparo
fsico e musculatura treinada para esse tipo de atividade. Que
todo bom piloto tem que ser bom de brao fcil entender. Mas,
por este raciocnio, conclumos que todo bom piloto deve
ser bom tambm de pescoo !
Imagine que voc venha de carro na avenida Dom Luiz atrasado
para sua aula no Simtrico e entre na rotatria da Praa
Portugal. Quanto maior a sua velocidade na curva, maior ser a
fora g que voc sentir na curva. Entretanto, a sua velocidade
na curva no pode ser grande demais devido ao risco de
derrapamento caso o atrito no cho seja insuficiente. Sendo o
coeficiente de atrito esttico entre os pneus do carro e o cho
igual a E = 1,5 e cintico C = 1,2, o Prof. Renato Brito pede
que voc determine a mxima fora g que voc poder sentir ao
fazer a curva na Praa Portugal:
a) 0,8.G
b) 1,0.G
c) 1,2.G
d) 1,5.G
e) 2,0.G

Simtrico Pr-Universitrio 1 Simulado Estilo ENEM 2010 www.simetrico.com.br

1 Simulado 2007 - Estilo UFC


1 Simulado 2010 Estilo ENEM
Prova de Conhecimentos Gerais
Questo 19
As fotoclulas (ver esquema abaixo), utilizadas em circuitos
eltricos, so dispositivos que geram e permitem a passagem de
corrente eltrica apenas quando recebem iluminao.
Funcionam, portanto, como interruptores de corrente eltrica
acionados pela luz, sendo usadas em mquinas fotogrficas,
alarmes antifurto, torneiras automticas e portas de
supermercados.
No plo negativo da fotoclula, existe uma camada metlica que
facilmente libera eltrons pela ao da luz.
LUZ

vcuo

Com relao ao dispositivo citado, podemos afirmar


corretamente que:
a) O metal alcalino mais indicado para a construo da camada
metlica, o ltio.
b) Para cada metal, a emisso de fotoeltrons independe da
freqncia do fton da luz incidente.
c) Considerando os metais Na, K, Cu, Ag, a prata o metal que
possui a menor freqncia de corte.
d) Quando a freqncia da luz incidente maior que a
freqncia de corte, verifica-se a emisso de fotoeltrons,
independente da intensidade da luz.
e) Duplicando-se a freqncia da luz incidente, duplica-se a
energia cintica dos fotoeltrons emitidos.

Questo 20
EST NA INTERNET:
Porque a Coca-Cola Zero, que contm Ciclamato, foi
proibida nos Estados Unidos?
A Coca Cola LIGHT possui: Acesulfame K (16mg/%) e
Aspartame (24mg/%), num total de 40mg/100ml de bebida, de
edulcorantes. J a Coca Cola ZERO tem em sua formulao
Ciclamato de Sdio (27mg%), Acesulfame K (15mg%) e
Aspartame (12 mg%), tornando-a mais doce que a outra - um
total 54mg/100ml de bebida).
Tendo em conta que o edulcorante Ciclamato de Sdio
est terminantemente proibido pelo F.D.A (Federal Drugs
Administration) - Organismo mximo de controle de alimentos
e drogas dos EEUU da Amrica por comprovados efeitos na
gnese de tumores cancergenos, e mais, que o Ciclamato
muito mais barato que o Aspartame a razo de 10 dlares por
quilo do Ciclamato contra 152 dlares/Kg do Aspartame, vem a
pergunta: Que Coca-Cola voc passar a tomar?
http://www.stmt.com.br/cocacola_zero_proibida.html

INFORMAO DO MINISTRIO DA SADE:


Esclarecimentos sobre o uso do edulcorante ciclamato em
alimentos
Em resposta a vrias demandas recebidas pela Anvisa a
respeito da segurana de uso do aditivo edulcorante ciclamato
em alimentos, em especial em bebidas no alcolicas com
informao nutricional complementar (por exemplo, refrigerantes
zero, sem acar), informamos o que segue.
As dvidas quanto segurana de uso de ciclamato
iniciaram aps a observao de que alguns indivduos e certos
animais eram capazes de metabolizar ciclamato a cicloexilamina
e de que a sua ingesto crnica aumentava a incidncia de
tumores de bexiga em ratos. Por esse motivo, o ciclamato foi
proibido nos EUA em setembro de 1970. Contudo, a FDA
recebeu petio do setor produtivo para revisar essa proibio, a
qual est atualmente em anlise.
A pedido da FDA, as informaes disponveis sobre
ciclamato foram reavaliadas em 1985 pela National Academy of
Sciences e pelo National Research Council Committee, os quais
concluram que luz de evidncias experimentais e
epidemiolgicas, o ciclamato no era carcinognico. Uma
pesquisa feita pelo Instituto Nacional de Cncer dos EUA
avaliou, durante 17 anos, a ingesto por macacos de
quantidades dirias (cinco vezes por semana) de ciclamato
equivalentes quelas constantes em 30 latas de refrigerante
diettico Esse estudo revelou que nenhum dos animais contraiu
cncer de bexiga.
Em 1999 o ciclamato foi classificado pela Agncia
Internacional de Pesquisa sobre Cncer (Iarc) como pertencente
ao Grupo 3, isto , no carcinognico para humanos. Segundo a
Iarc, h evidncia inadequada em animais de laboratrio e em
humanos para a carcinogenicidade de ciclamatos.
As normas brasileiras que determinam os limites
mximos de aditivos alimentares so elaboradas com base em
referncias internacionais, como o Codex Alimentarius (Norma
Geral de Aditivos Alimentares GSFA), a Unio Europia e, de
forma complementar, a U. S. Food and Drug Administration
(FDA). Alm disso, por acordo firmado no Mercosul, somente
aditivos que constam da Lista Geral Harmonizada Resoluo
GMC n. 11/2006 podem ser autorizados pelos Estados Partes,
incluindo Brasil. O uso de ciclamato est previsto na GSFA,
considerada a principal referncia, e em Diretiva da UE, bem
como na Lista Geral Harmonizada de Aditivos do Mercosul.
http://www.anvisa.gov.br/alimentos/informes/40_020609.htm
Com base na leitura acima julgue os itens a seguir e marque o
correto.
a) Pode se perceber que a informao do primeiro site
totalmente confivel tendo vrias referncias cientficas.
b) O site oficial do Ministrio da Sade ratifica as informaes
do www.stmt.com.br/cocacola_zero_proibida.html
c) O site inicial afirma que existe 54mg/100mL de ciclamato de
sdio na Coca-cola Zero.
d) No se pode confiar no site do Ministrio da Sade pois ele
autoriza o uso de ciclamato, sendo o Brasil e pases subdesenvolvidos os nicos a utilizar este edulcorante.
e) Segundo o site www.stmt.com.br, existe 54% de peso em
volume de edulcorantes na Coca-cola Zero.

Simtrico Pr-Universitrio 1 Simulado Estilo ENEM 2010 www.simetrico.com.br

10

1 Simulado 2010 Estilo ENEM

Questo 21

Questo 22
Chuveiro eltrico

JOGO DURO CONTRA O DOPING

Desenvolvido no Brasil, na dcada de 1940, o chuveiro eltrico


procurou substituir nesse pas a fonte principal de calor uma
vez que redes de gs eram praticamente inexistentes nas
grandes cidades ao contrrio da energia eltrica. Com a rpida
urbanizao assistida no Brasil desde ento, esta soluo foi
sendo a principal adotada, embora convivesse com outras
formas de aquecimento da gua. De concepo bastante
simples, o chuveiro eltrico era constitudo de um elemento de
aquecimento, chamado de "resistncia" no Brasil (no confundir
com resistor), feito de um fio espiralado composto de metais com
alto ponto de fuso, como o nquel, o cromo ou uma liga dos
dois metais, que ao aquecer, esquenta imediatamente a gua,
um sistema dotado de uma alavanca que abre/fecha a gua e
liga/desliga a eletricidade, alm do espalhador de gua, sempre
parecido com os tradicionais chuveiros.

Fifa adota as normas rgidas da agncia antidoping para


punir quem usar estimulantes na Copa
A atitude mais condenvel do esporte, o doping, receber
marcao dura e sob presso na Copa do Mundo (...) A Fifa (...)
considera doping qualquer iniciativa para melhorar a performance
do jogador fora dos parmetros de treinamento e preparao do
esporte. As tentativas de alterar ou destruir amostras de urina (...)
para exame so tambm consideradas atos de doping. Os testes
no futebol so feitos por amostragem. Depois das partidas, dois
jogadores de cada equipe so definidos por sorteio para colher a
urina.
No maior escndalo de doping da histria das Copas,
Diego Maradona, flagrado aps a vitria da Argentina sobre a
Nigria por 2 a 1, no Mundial de 1994, usava esse componente. O
laudo da Fifa mostrou que o craque ingeriu, no dia do jogo, uma
quantidade dez vezes maior de efedrina do que a mdia possvel
de ser encontrada se ele usasse a substncia para desentupir o
nariz.
(Revista Isto , edio N. 1909)
O(s) processo(s) envolvidos no exame citado no texto, permitindo
detectar a efedrina e outras substncias proibidas no organismo,
se denomina(m):
a) filtrao glomerular, apenas.
b) reabsoro tubular.
c) filtrao glomerular e secreo tubular.
d) secreo tubular, apenas.
e) reabsoro e secreo tubulares.

Questo 23
Um estudante que morava em no Cear e estudava no curso
Simtrico, na turma do Sade 10, Passou em Medicina na
Universidade Federal de Porto Alegre, e teve que se mudar, e
consigo levou seu chuveiro eltrico. Seu cuidado deveria ser
com a tenso eltrica da nova cidade, pois no Cear a tenso
eltrica de 220 V, e ele estava indo para uma regio onde a
tenso de 110 V. Modificaes devero ser feitas na
resistncia do chuveiro para que a potncia eltrica dele no
sofra modificaes.
Com relao nova resistncia do chuveiro e a corrente eltrica
que passar atravs dessa resistncia, correto afirmar que:
a) tanto a resistncia original quanto a corrente eltrica
quadruplicaro.
b) a resistncia original ser reduzida metade e a corrente
eltrica duplicar.
c) tanto a resistncia original como a corrente eltrica
duplicaro.
d) a corrente eltrica permanecer a mesma, no sendo, pois
necessrio modificar a resistncia original.
e) a resistncia original ser reduzida quarta parte e a
corrente eltrica duplicar.

O consumo de cachaa, bebida destilada mais consumida no


Brasil, deve ser moderado devido ao seu alto teor de etanol
(38% a 48% em volume). Na cachaa, so encontradas algumas
substncias prejudiciais sade, como metanol e aldedo
actico. O cobre (presente no material de alguns alambiques)
tambm um contaminante, cujo teor mximo permitido 5
mg/L. A tabela seguinte contm os pontos de ebulio, em
condies ambiente (1 atm e 25C), de alguns componentes da
cachaa.
Composto
Metanol
Etanol
Propan-1-al
Etanal (aldedo
actico)
cido etanico
(cido actico)
Metanal

Ponto de ebulio
(C)
65,0
78,5
97,4

Massa Molar
(g/mol)
32
46
60

21,0

44

118,2

60

21,0

30

Simtrico Pr-Universitrio 1 Simulado Estilo ENEM 2010 www.simetrico.com.br

1 Simulado 2007 - Estilo UFC


1 Simulado 2010 Estilo ENEM
Prova de Conhecimentos Gerais
Com base nas informaes acima, assinale a alternativa correta.
a) O etanol tem ponto de ebulio superior ao do aldedo
actico, devido existncia de interaes intermoleculares
do tipo dipolo instantneo (tambm chamada ponte de
hidrognio) no lcool.
b) O ponto de ebulio do metanol superior ao do metanal,
porque no metanal existem ligaes de hidrognio
intermoleculares.
c) O cido actico mais voltil que o etanol.
d) A frmula molecular do propan-1-al C3H8O2
e) O cido actico apresenta ponto de ebulio superior ao do
propan-1-al, devido existncia de ligaes de hidrognio
bastante fortes entre as molculas do cido, dando origem a
um dmero.

Questo 24
Os meios de comunicao tm noticiado, freqentemente, que o
Brasil esta se tornando um pas de obesos. Os rgos
envolvidos com a sade pblica tem mostrado preocupao
constante com a dieta do povo brasileiro, pois o tradicional prato
de "feijo, arroz, bife e salada" esta sendo substitudo por
comidas industrializadas e com alto teor calrico. Estima-se que
o consumo de feijo e de arroz caiu em torno de 30% nos
ltimos anos.
Com base no texto acima e nos conhecimentos sobre a terra,
considere as afirmativas a seguir.
I. O prato tradicionalmente consumido pelo brasileiro
apresenta elementos essenciais ao metabolismo, como
protenas, carboidratos, gorduras, vitaminas e sais minerais.
II. A ingesto de protenas e importante, pois elas sero
degradadas em aminocidos, usados como fonte na sntese
das protenas codificadas pelo organismo.
III. Os carboidratos e lipdios da dieta so fonte importante de
energia para os organismos, pois essas molculas
preservam, na forma de energia qumica, boa parte da
energia gasta para a sua sntese.
IV. Os cidos nuclicos ingeridos so incorporados ao DNA do
organismo, razo pela qual questiona-se o consumo de
alimentos transgnicos.
Esto corretas apenas as afirmativas:
a) I e III.
b) I e IV.
c) II e IV
d) I, II e III
e) II, III e IV.

duas superfcies sem que estas, entretanto, deslizem uma sobre


a outra.
Quando se tenta empurrar uma caixa em repouso em relao ao
solo, nota-se que se pode gradualmente ir aumentado a fora
sobre a caixa sem que esta entretanto se mova. A fora que se
ope fora aplicada sobre a caixa, e que a esta se soma para
dar uma resultante nula de foras, o que necessrio para
manter a caixa em repouso, justamente a fora de atrito
esttico que atua na caixa. A fora de atrito esttico em
mdulo igual ao da componente paralela superfcie da fora
aplicada pelo homem, at que o bloco se mova. Entretanto, h
uma fora limite que o homem pode aplicar na caixa sem que o
caixote se mova: a componente desta fora paralela superfcie
iguala-se de atrito esttico mxima, em mdulo. Ao entrar em
movimento, a fora que o homem exerce diminui bem se
comparada necessria para colocar o caixote em movimento.
Neste caso, a componente paralela da fora que ele passa a
exercer para manter o caixote se movendo iguala-se em mdulo
fora de atrito dinmico, e mostra-se relativamente
independente da velocidade do caixote (para baixas
velocidades), sendo esta consideravelmente menor do que a
fora mxima aplicada.
Matematicamente a fora de atrito dinmico relaciona-se com a
fora normal mediante a seguinte equao:
Fatcin = C.N
E a fora de atrito esttico mxima relaciona-se com a fora
normal da seguinte forma:
Fatmax = e.N
Considere que, numa situao inicial, uma caixa permanece em
repouso sobre uma rampa inclinada 45 devido ao de uma
fora de atrito de intensidade Fat = 42N. So dados E = 1,2,
C = 0,8, , 2 = 1,4 e g = 10 m/s2.

45o
Caso a inclinao da rampa seja reduzida para 30, a fora de
atrito esttico agindo sobre a caixa:

Questo 25
A Fora de Atrito Chama-se de fora de atrito esttico a fora
que se ope ao incio do movimento entre as superfcies, ou ao
atrito de rolamento de uma superfcie sobre outra. Por exemplo,
pode-se citar o atrito entre o pneu de um carro quando este no
est escorregando sobre a superfcie (o que no implica que o
pneu no possa estar rolando). Chama-se fora de atrito esttico
mximo mxima fora de atrito esttico que pode existir entre

11

30o
a)
b)
c)
d)
e)

Permanecer constante;
Diminuir 12 N;
Diminuir 15 N
Diminuir 25 N
Diminuir 30 N

Simtrico Pr-Universitrio 1 Simulado Estilo ENEM 2010 www.simetrico.com.br

1 Simulado 2010 Estilo ENEM

12

Questo 26

Questo 28

A refrigerao e o congelamento de alimentos so responsveis


por uma parte significativa do consumo de energia eltrica numa
residncia tpica. Para diminuir as perdas trmicas de uma
geladeira, podem ser tomados alguns cuidados operacionais:
I. Distribuir os alimentos nas prateleiras deixando espaos
vazios entre eles, para que ocorra a circulao do ar frio
para baixo e do quente para cima.
II. Manter as paredes do congelador com camada bem espessa
de gelo, para que o aumento da massa de gelo aumente a
troca de calor no congelador.
III. Limpar o radiador (grade na parte de trs) periodicamente,
para que a gordura e a poeira que nele se depositam no
reduzam a transferncia de calor para o ambiente.

No texto a seguir, reproduzido do livro "Descobertas Acidentais


em Cincias" de Royston M. Roberts (Editora Papirus,
Campinas, SP, 1993), algumas frases referentes a etapas
importantes na construo do conhecimento cientifico foram
colocadas em maisculo e identificadas por um numeral romano.

Para uma geladeira tradicional correto indicar, apenas,


a) a operao I.
b) a operao II.
c) as operaes I e II.
d) as operaes I e III.
e) as operaes II e III.

Questo 27
Os sabes e detergentes compreendem uma variedade de
produtos que usamos no dia-a-dia com a finalidade de remover a
sujeira. Sobre esses produtos esto representadas a seguir, as
estruturas dos mesmos.
SABO

DETERGENTE BIODEGRADVEL

A partir das informaes fornecidas, assinale a alternativa


verdadeira.
a) O que caracteriza um sabo ou um detergente o fato de
serem estruturalmente constitudos de pequenos grupos
hidrocarbnicos, que no tm afinidade com a gua
(hidrofbicos), e um ou mais grupos polares que tm
afinidade com a gua (hidroflicos).
b) Sabes so cidos carboxlicos de cadeia longa, resultantes
principalmente da saponificao de gorduras e leos.
c) Para um detergente ser biodegradvel importante que a
cadeia hidrocarbnica seja linear como as que ocorrem nas
gorduras naturais e que so totalmente biodegradveis.
d) A principal diferena entre sabes e detergentes, no uso
caseiro, que em geral os sabes so slidos e os
detergentes so lquidos.
e) Tanto os sabes como os detergentes, apresentam grande
parte polar (lipofdica) e pequena parte apolar (hidroflica).

"Em 1889, em Estrasburgo, ento Alemanha, enquanto


estudavam a funo do pncreas na digesto, Joseph von
Merling e Oscar Minkowski removeram o pncreas de um co.
No dia seguinte, um assistente de laboratrio chamou-lhes a
ateno sobre o grande numero de moscas voando ao redor da
urina daquele co. (I) CURIOSOS SOBRE POR QUE AS
MOSCAS FORAM ATRADAS A URINA, ANALISARAM-NA E
OBSERVARAM QUE ESTA APRESENTAVA EXCESSO DE
ACAR. (II) ACAR NA URINA E UM SINAL COMUM DE
DIABETES.
Von Mering e Minkowski perceberam que estavam vendo pela
primeira vez a evidencia da produo experimental de diabetes
em um animal. (III) O FATO DE TAL ANIMAL NAO TER
PNCREAS SUGERIU A RELAO ENTRE ESSE RGO E O
DIABETES.
(...) Muitas tentativas de isolar a secreo foram feitas, mas sem
sucesso ate 1921. Dois pesquisadores, Frederick G. Banting, um
jovem mdico canadense, e Charles H. Best, um estudante de
medicina, trabalhavam no assunto no laboratrio do professor
John J. R. Mac-Leod, na Universidade de Toronto. Eles
extraram a secreo do pncreas de ces. (IV) QUANDO
INJETARAM OS EXTRATOS [SECREO DO PNCREAS]
NOS CES TORNADOS DIABTICOS PELA REMOO DE
SEU PNCREAS, O NVEL DE ACAR NO SANGUE
DESSES CES VOLTAVA AO NORMAL, E A URINA NO
APRESENTAVA MAIS ACAR."
A alternativa que identifica corretamente cada uma das frases
em destaque com cada uma das etapas de construo do
conhecimento cientfico :
a) I - Hiptese; II - Teste da hiptese; III - Fato; IV Observao.
b) I - Fato; II - Teoria; III - Observao; IV - Teste da hiptese.
c) I - Observao; II - Hiptese; III - Fato; IV - Teste da
hiptese.
d) I - Observao; II - Fato; III - Teoria; IV - Hiptese.
e) I - Observao; II - Fato; III - Hiptese; IV - Teste da
hiptese.

Questo 29
Segundo dados da OMS (Organizao Mundial da Sade), 2/3
dos pacientes com cncer utilizaro a radioterapia em alguma fase
do tratamento da sua doena, quer de maneira exclusiva ou
associada a outras modalidades de terapia oncolgica.
A radioterapia uma especialidade mdica recente, pois o
emprego de radiao ionizante como recurso teraputico tem
apenas um sculo trata-se de uma terapia voltada quase que
exclusivamente aos pacientes com cncer, eventualmente pode
ser indicada em algumas patologias benignas. O agente
teraputico empregado so as radiaes ionizantes (comumente
os raios gama, X e eltrons).

Simtrico Pr-Universitrio 1 Simulado Estilo ENEM 2010 www.simetrico.com.br

1 Simulado 2007 - Estilo UFC


1 Simulado 2010 Estilo ENEM
Prova de Conhecimentos Gerais

13

Um homem em tratamento com radioterapia, para combater um


tumor no sistema nervoso, apresentava paralisia em um dos lados
do corpo (hemiplegia). Essa paralisia ocorreu porque o tumor
provavelmente havia afetado:
a) os nervos do sistema simptico.
b) um dos hemisfrios cerebrais.
c) os nervos do sistema parassimptico.
d) a poro ventral da medula espinhal.
e) a base do tronco enceflico.

Questo 30
A gua do mar salgada devido ao grande nmero de sais
minerais dissolvidos, constitudos, em sua maior parte, por:
sdio, potssio, magnsio, clcio e cloro. Considerando os
elementos Mg, Na e Cl e algumas de suas propriedades
peridicas, identifique a afirmativa correta:
Dados:
Na (Z = 11)
Mg (Z = 12)
Cl (Z = 17)
Ca (Z = 20)
Br (Z = 35)
a) O nmero quntico magntico do eltron de valncia de
sdio + 1.
b) O cloro um metal com sete eltrons de valncia.
c) O magnsio um metal alcalino.
d) possvel, em algumas situaes biolgicas, substituir o
clcio pelo magnsio, uma vez que ambos apresentam
propriedades qumicas semelhantes.
e) O cloro, assim como o bromo, apresenta-se na temperatura
ambiente no estado lquido.

O motorista abasteceu o carro s 7 horas da manh, quando a


temperatura ambiente era de 15C, e o deixou estacionado por 5
horas, no prprio posto. O carro permaneceu completamente
fechado, com o motor desligado e com as duas lmpadas
internas acesas. Ao final do perodo de estacionamento, a
temperatura ambiente era de 40C. Considere as temperaturas
no interior do carro e no tanque de gasolina sempre iguais
temperatura ambiente.
Ao estacionar o carro, a gasolina ocupava uma certa frao f do
volume total do tanque de combustvel, feito de ao. Qual o valor
mximo de f para o qual a gasolina no transborde quando a
temperatura atinge os 40C?
a) 93,0 %
b) 80,5 %
c) 97,8 %
d) 34,1%
e) 12,9%

Questo 32

Questo 31
A questo abaixo se relaciona a situaes vivenciadas por um
motorista que, dirigindo seu prprio carro, faz sozinho uma
viagem de frias. Sempre que necessrio utilize, em seus
clculos, os seguintes dados:

Simtrico Pr-Universitrio 1 Simulado Estilo ENEM 2010 www.simetrico.com.br

14

1 Simulado 2010 Estilo ENEM

O que diz a lei que restringe o consumo de bebidas


alcolicas por motoristas?
A lei considera crime conduzir veculos com praticamente
qualquer teor alcolico no organismo. Quem for pego sofrer
punies que variam da multa at a cadeia. O homicdio
praticado por um motorista alcoolizado ser considerado doloso
(com inteno de matar). A lei prev tambm a proibio da
venda de bebidas alcolicas nas das rodovias federais em zonas
rurais.
Como foram estabelecidos os limites?
Na verdade, o limite de 0,2 g/L se refere margem de erro do
prprio bafmetro, explica o relator da lei, deputado Hugo Leal
(PSC-RJ). "Para que no haja conflito, estabeleceu-se uma
pequena margem de erro na questo da aferio do aparelho".
Esse limite, porm, poder ser revisto pelo governo, a partir de
estudos que analisam a dosagem de lcool em itens como antispticos e at doces com licor.
Quanto permitido beber antes de dirigir?
A partir de agora, praticamente nada limite de 0,2 grama de
lcool por litro de sangue. Antes, somente motoristas cuja
dosagem de lcool no sangue superava 0,6 grama de lcool por
litro de sangue (duas latas de cerveja) eram punidos.
Aps beber, quanto tempo preciso esperar antes de dirigir?
De maneira geral, um copo de cerveja ou um clice de vinho
demora cerca de seis horas para ser eliminado pelo organismo
j uma dose de usque leva mais tempo. Por isso,
independentemente do volume ou tipo de bebida ingerida,
mais prudente que o motorista s reassuma o volante 24 horas
depois de beber. Assim mesmo, passado esse intervalo, se
persistirem sintomas do lcool, o melhor a fazer no dirigir. A
alternativa tomar um txi, transporte coletivo ou ento entregar
a direo a quem no bebeu.
www.veja.com

No tocante ao exposto acima, marque a alternativa correta:


a) De acordo com a leitura, atualmente o motorista pode
consumir duas latas de cerveja e dirigir sem ser punido.
b) O limite mximo permitido de 200ppm de lcool no sangue
(considerando densidade do sangue igual a da gua)
c) aconselhado que aps ingerir bebida alcolica, o indivduo
s dirija seis horas depois.
d) O limite autorizado baseado em dados que comprovam
que com esse ndice de lcool o condutor dirige com total
segurana, segundo a reportagem.
e) O lcool utilizado em bebidas , normalmente o propanol, j
que o etanol utilizado como combustvel para veculos.

Questo 33 (NULA)
Em um programa de rdio foram feitos os seguintes comentrios:
No como carne bovina, pois, geralmente, o gado tratado
com certos hormnios esterides que podem causar-me
problemas.
No bebo leite de vaca, pois, o hormnio do crescimento
(somatotrfico) presente em sua composio pode alterar o
crescimento dos meus ossos.
Em relao aos hormnios mencionados nesses comentrios,
assegura-se que, no organismo humano:
a) ambos so absorvidos sem alterao, mimetizando seus
efeitos;
b) tanto os esterides como o hormnio somatotrfico so
totalmente digeridos e inativados;
c) apenas os esterides so digeridos e totalmente inativados;
d) apenas os esterides so absorvidos pelo trato intestinal sem
sofrer grandes alteraes em sua estrutura;
e) apenas o somatotrfico no digerido nem absorvido pelo
trato gastrintestinal.
OBS.:
No simulado original a questo 6 foi repetida tambm como 33.
Logo, para efeito de gabarito ela esta nula. A questo acima
seria a correta.

Questo 34
A unio de vrios aminocidos forma os peptdeos. Estes, aps passarem por diferentes processamentos no Reticulo endoplasmtico
rugoso e complexo de Golgi, formam as protenas.
As protenas exercem inmeras funes no nosso organismo, como por exemplo as funes enzimticas. Para descobrir se determinado
organismo produz determinada protena, faz-se a construo de uma fita de RNA mensageiro a partir dela. Isso e possvel graas a relao
existente entre os cdons do RNA mensageiro (cada trs nucleotdeos) e os aminocidos presentes nas protenas. Cada trs nucleotdeos
correspondem a um aminocido, portanto, a partir de uma sequencia de aminocidos (peptdeo), possvel obter uma sequencia de
nucleotdeos (RNA mensageiros). O inverso tambm pode ocorrer. A correspondncia entre os cdons do RNA mensageiro e os
aminocidos por ele determinados constitui o cdigo gentico, que esta representado na tabela a seguir:
Simtrico Pr-Universitrio 1 Simulado Estilo ENEM 2010 www.simetrico.com.br

1 Simulado 2007 - Estilo UFC


1 Simulado 2010 Estilo ENEM
Prova de Conhecimentos Gerais

15

Phe (fenilalanina), Leu (leucina), Ile (isoleucina), Met (metionina), Val (valina), Ser (serina), Pro (prolina), Thr (treonina), Ala (alanina), Tyr
(tirosina), His (histidina), Gln (glutanina), Asn (asparagina), Lys (lisina), Asp (cido asprtico), Glu (cido glutmico), Cys (cistena), Trp
(triptofano), Arg (arginina), Gly (glicina), pare (cdon de parada).
Com base no texto e em seus conhecimentos, correta a seguinte afirmao:
a) O peptdeo Gly-Gly-Gly-His-Arg-Leu-Ile-Gln pode ter sido originado a partir do seguinte RNA mensageiro:
GGCGGUGCGCACCGCCUUAUUCAA.
b) A partir da seqncia do RNA mensageiro UUUCAUAGUGCUGGGAGCCAC, e formado o seguinte peptdeo: Phe-His-Ser-Ala-Gly-ArgHis.
c) A partir da seqncia do RNA mensageiro GUGGUUGUCGCUCGUCGGCGG, e formado o seguinte peptdeo: Val-Val-Val-Val-Arg-ArgArg.
d) A partir da sequencia do RNA mensageiro UUAGGGGAGACUCGGCAGGAG, e formado o seguinte peptdeo Leu-Gly-Glu-Thr-Arg-GlnGlu.
e) O peptdeo Lys-Phe-Lys-Tyr-Tyr-Thr-Ile pode ter sido originado a partir do seguinte RNA mensageiro: AAAUUUAACUAUUACACAAUA.

Questo 35
Em um dia em que se registrava uma temperatura ambiente de
27C, um balo de festa foi cheio com ar, cuja densidade era de
1,3kg/m3. Foi medida uma diferena de massa entre o balo
vazio e cheio de 7,8g. Considerando o ar como um gs ideal,
qual seria o seu volume se, depois de cheio, ele fosse guardado
numa cmara fria a -23C, sem variar a presso e o nmero de
partculas em seu interior?
a) 3L
b) 4L
c) 5L
d) 6L
e) 6,5L

a) Por serem gases sintticos, conclui-se que os freons foram


obtidos por processos fsicos.
b) Nos freons os tomos de cloro so istopos dos tomos de
flor.
c) Os elementos flor e cloro pertencem a um mesmo perodo
da tabela peridica.
d) O tomo de flor menos eletronegativo do que os tomos
de carbono e cloro.
e) No estado fundamental, os tomos de carbono e flor tm o
mesmo nmero de nveis eletrnicos.

Questo 37
Osis marinhos em perigo

Questo 36
Os freons so gases sintticos, isto , inexistentes na natureza
antes de o homem invent-los. So substncias compostas
constitudas de carbono cloro e flor (clorofluorcarbonetosCFCs), de amplo emprego industrial. Os freons so
quimicamente inertes, pois no so inflamveis, no oxidam
materiais, no so explosivos nematxidos. Do exposto correto
afirmar:

Bilogos planejam o repovoamento dos recifes de corais,


um dos mais ricos ambientes do mundo, ameaados pela pesca
excessiva.
Na etapa inicial desse projeto, os pesquisadores
trabalharo com as principais espcies responsveis pela
formao dos recifes, como os corais-crebro do gnero
Mussimilia, encontrados apenas no Brasil, o coral-estrelagrande

Simtrico Pr-Universitrio 1 Simulado Estilo ENEM 2010 www.simetrico.com.br

1 Simulado 2010 Estilo ENEM

16

(Montastrea carvenosa) e o coral-crebro-pequeno (Favia


grvida), um globo de cerca de 10 centmetros cuja aparncia
lembra um crebro humano. Tanto os corais-crebro quanto o
estrela-grande so de fecundao externa. J o crebropequeno uma espcie com fecundao interna.
Aps a fecundao, os ovos desenvolvem-se em larvas
microscpicas - as plnulas - que nadam algum tempo antes de
se fixarem nas rochas do fundo do mar e originarem novas
colnias.
Pesquisa FAPESP. Jan. 2004 (adapt.)
Com base no texto, foram feitas as seguintes afirmaes:
I. Os corais estrela-grande e crebro-pequeno pertencem a
uma mesma classe.
II. A fecundao realizada pelo coral-crebro-pequeno promove
maior capacidade adaptativa que a realizada pelo coralcrebro.
III. A capacidade dispersiva dos corais resultante do
desenvolvimento dos zigotos.
IV. Os gneros Monastrea, Favia e Aussilia so encontrados
apenas no Brasil.
V. Os corais citados realizam reproduo assexuada.
Esto corretas as afirmativas:
a) I e II, apenas.
b) I, II e III, apenas.
c) I, III e V, apenas.
d) II, III e IV, apenas.
e) II, III e V, apenas.

Questo 38
Os eltrons, em um circuito no qual h uma corrente eltrica
contnua, movem-se com velocidade muito pequena (apenas
0,1 mm/s, aproximadamente). Entretanto, quando ligamos o
interruptor do circuito, o campo eltrico que surge no condutor
estabelecido quase instantaneamente em todo fio, pois a
velocidade de propagao desse campo praticamente igual
da luz. Ento, em um tempo muito curto, todos os eltrons livres
j esto em movimento, embora os eltrons que comearam a
mover-se nas proximidades do interruptor s alcancem o
filamento depois de um tempo muito longo. Portanto, os eltrons
que provocam o aquecimento do filamento a 2500C so
aqueles presentes no seu prprio tungstnio.

LUZ, A. M.R.; LVARES, B.A., Curso de Fsica, 5. ed. Eletricidade.


So Paulo: Scipione, p. 155.

A propsito do assunto tratado no texto, assinale a alternativa


correta:
a) O efeito joule consiste na transformao de energia trmica
em energia luminosa em um resistor percorrido por uma
corrente eltrica.
b) As lmpadas incandescentes foram criadas por James Watt.
c) Os filamentos dessas lmpadas so geralmente feitos de
tungstnio, que um metal cujo ponto de fuso baixo.
d) Para um eltron percorrer um fio de 60 cm de comprimento
com velocidade constante de 0,1 mm/s seria necessrio um
tempo de 100 minutos.
e) Em Fahrenheit, a temperatura do filamento pode chegar a
950 F.

Questo 39
O Brasil atualmente defronta-se com a perspectiva de um significativo aumento na demanda por etanol combustvel. Esta previso
sustenta-se em certas realidades de mercado, como:
I. aumento do consumo interno de lcool hidratado devido ao sucesso dos automveis flexi-fuel no mercado de veculos automotivos
leves.
II. expanso das exportaes brasileiras de etanol em funo do crescente interesse mundial pela mistura deste gasolina, como forma
de diminuir as emisses de gases de efeito estufa (GEE).
Um caminho para solucionar o problema seria ampliar a produtividade de litros de lcool por hectare de cana plantada, aproveitado
integralmente a biomassa da planta para produzir etanol. Essa rota recebe o nome de etanol lignocelulsico ou de 2 gerao. Para
obtermos etanol lignocelulsico so necessrios, basicamente, dois processos: a hidrlise dos polissacardeos em acares simples e a
fermentao destes em etanol.
Disponvel em: HTTP://www.bioetanol.ogr.br/interna/index.php?pq=MzM Acesso em: 16 ago. 2009.

Com base nas informaes acima, assinale a afirmao correta.


a) Hidrlise significa reao qumica de quebra pelo hidrognio.
b) A hidrlise da celulose pode ser representada por:

c) O aumento da produtividade de lcool por hectare pode ser conseguido pela fermentao da molcula de acar liberada pela
hidrlise da lignocelulose presente no bagao da cana.
d) A fermentao da glicose para gerao de etanol pode ser representada pela equao corretamente balanceada:
C4H12O2 2C2H5OH.
e) A molcula de etanol produzida pelo processo tradicional diferente da molcula de etanol produzida pela fermentao do acar
proveniente da lignocelulose.
Simtrico Pr-Universitrio 1 Simulado Estilo ENEM 2010 www.simetrico.com.br

1 Simulado 2007 - Estilo UFC


1 Simulado 2010 Estilo ENEM
Prova de Conhecimentos Gerais

17

Questo 42

Questo 40
O Sistema Vascular Sanguneo
O sistema vascular sanguneo compe-se de vasos com
diferentes calibres, que so as artrias, as veias e os capilares.
Esse sistema transporta o sangue do corao para os tecidos e
destes de volta para o corao e deve trabalhar de forma a
minimizar a energia despendida pelo corao no bombeamento
do sangue. Em particular, essa energia reduzida quando a
resistncia do sangue baixa. Tal situao foi experimentalmente
comprovada e resultou em uma das Leis de Poiseuille, que d a
resistncia R do sangue como sendo

Atualmente, muitos condomnios fazem a iluminao de


determinadas reas, como escadas e entradas de elevadores,
com sensores e temporizadores, para que as luzes permaneam
acesas apenas por pequenos intervalos de tempo, enquanto
esto sendo utilizadas. A figura a seguir representa,
esquematicamente, duas possibilidades, A e B, de montagem de
circuitos eltricos com essa finalidade. Na figura, S representa
um sensor. As lmpadas so idnticas e possuem valores
nominais de 127V 60W. A rede eltrica que alimenta cada
circuito fornece tenso eltrica U = 127 V.

R = C(L/r2)
em que L o comprimento do vaso sanguneo, r o raio, e C
uma constante positiva determinada pela viscosidade do
sangue. A relao entre presso, resistncia e fluxo mdio nos
vasos sanguneos anloga, de modo geral, relao entre,
respectivamente, a diferena de potencial, a resistncia e a
corrente eltrica num circuito eltrico, expressa pela Lei de Ohm.
Se o raio do vaso sanguneo dobrado ao longo de toda a sua
extenso, ento a resistncia do fluxo sanguneo reduz-se a um
percentual do valor inicial igual a:
a) 5,25%
b) 6,25%
c) 12,15%
d) 25%
e) 50%

Questo 41
Desta vida voc no leva nada. Mas voc pode deixar. Doe
crneas. Doe novos horizontes para quem no pode ver
Campanha do Ministrio da Sade, 2008
No contexto de uma campanha e de acordo com seus
conhecimentos, considere as seguintes afirmaes:
I. No sendo rgo vital, a crnea a ser transplantada
removida de um doador vivo.
II. O transplante de crnea indicado para pacientes que sofrem
de catarata.
III. A rejeio da crnea improvvel por ela no ser
vascularizada.
IV. A crnea comparvel lente mvel de uma cmera uma vez
que responsvel pelo ajuste focal das imagens pelo olho.
Assinale o item que contm a(s) afirmao(es) correta(s):
a) I, II, III e IV
b) II e IV, apenas.
c) I e II, apenas.
d) II e III, apenas.
e) III, apenas.

A melhor associao :
a) em srie, pois as lmpadas possuem o maior brilho possvel.
b) em srie, pois as lmpadas devero operar na sua potncia
nominal.
c) em paralelo, pois as lmpadas devero operar em suas
potncias nominais apresentando um menor brilho.
d) em paralelo, pois as lmpadas devero operar em suas
potncias nominais apresentando um maior brilho.
e) Em srie e em paralelo simultaneamente.

Questo 43
Dengue uma doena causada por vrus do gnero Flavivrus e
transmitida pelo mosquito Aedes Aegypti. Em geral, o acometido
de dengue apresenta necessidade de tomar antitrmicos,
cefalia, fraqueza, dores nas articulaes, anorexia, manchas
vermelhas na pele e pequenos sangramentos. No dengue
hemorrgico observa-se um aumento da permeabilidade dos
capilares sanguneos, o que pode levar morte. Com base no
texto incorreto afirmar:
a) o agente etiolgico do dengue acelular.
b) a pessoa acometida de dengue apresenta dor de cabea,
falta de apetite e febre.
c) o AAS no indicado no tratamento, pois trata-se de um
vasodilatador.
d) o vetor do dengue pertence ao gnero Aedes.
e) o transmissor da referida virose dcero e octpode.

Questo 44
Princpio de Arquimedes Quando um corpo est totalmente
ou parcialmente imerso em um fluido em equilbrio, ficar sob a
ao de uma fora que depender da poro do corpo que est
imersa. Isto pode ser verificado se tentarmos submergir uma
cortia ou bola cheia de ar em recipiente com gua. Quanto mais
profundo estiver o corpo maior ser a fora que teremos de fazer
para mant-lo naquela profundidade.
A fora que faz a cortia flutuar, parecendo que o corpo possui
um peso menor do que o peso real denominado de empuxo do
fluido sobre o corpo. O princpio de Arquimedes quantifica o

Simtrico Pr-Universitrio 1 Simulado Estilo ENEM 2010 www.simetrico.com.br

18

1 Simulado 2010 Estilo ENEM

valor desta fora: Um corpo total ou parcialmente imerso em um


fluido sofre um empuxo que igual ao peso do volume do fluido
deslocado pelo corpo.
Contam os livros que o sbio grego Arquimedes o descobriu
enquanto tomava banho, quando procurava responder a Hiero,
rei de Siracusa, se sua coroa era realmente de ouro puro.
Conta Vitrvio, que o rei mandou fazer uma coroa de ouro. Para
isso, contratou um arteso, que consoante uma boa quantia de
dinheiro e a entrega do ouro necessrio, aceitou o trabalho.
Na data prevista o arteso entregou a coroa executada na
perfeio, porm, o rei estava desconfiado que o arteso
pudesse ter trocado o ouro por prata, pediu a Arquimedes que
investigasse o que se passava uma vez que este era muito
inteligente.
Um dia, enquanto tomava uma caipirinha numa banheira, em
Iguatu com seu amigo Rabin Juc, Arquimedes observou que,
medida que seu corpo mergulhava na banheira, a gua
transbordava. Concluiu, ento, como poderia resolver o
problema da coroa e de to contente que estava saiu da
banheira e foi para a rua gritando: "Eureka, Eureka!", que em
lngua grega quer dizer descobri, achei, encontrei.

mesma, tanto se o cone posto a boiar de cabea para cima ou


de cabea para baixo nesse lquido.

Isso nos permite concluir que:


a) O empuxo que age no cone igual metade do peso do
cone;
b) O empuxo que age no cone igual ao dobro do peso do
cone;
c) A densidade do cone a metade da densidade do lquido;
d) A densidade do lquido a metade da densidade do cone;
e) A densidade do lquido igual densidade do cone

Questo 45
A composio dos produtos para a reidratao oral deve ter as
seguintes especificaes, de acordo com a norma internacional
OMS/UNICEF:
Composio por litro de gua
Sdio 90 mEq
Potssio 20-25 mEq
Cloreto 80 mEq
Citrato (*) 30-25 mEq
Glicose 111 mMol
(*) O citrato pode ser substitudo por bicarbonato, lactato ou
acetato.
Assim, pegou um vasilhame com gua e mergulhou um pedao
de ouro, do mesmo peso da coroa, registrando o quanto a gua
tinha subido. Fez o mesmo com um pedao de prata. Efetuou o
mesmo registro e comparou-o com o anterior concluindo que o
ouro no fez a gua subir tanto como a prata. O nvel da gua
subiu mais com a prata do que com o ouro.
Por fim, inseriu a coroa na gua. Esta elevou o nvel da gua
mais do que o ouro e menos do que a prata. Arquimedes
constatou, ento, que a coroa havia sido feito com uma mistura
de ouro e prata. Pde-se assim desvendar o mistrio da coroa e
desmascarar o arteso.
Para compreender, lembre-se que tanto a coroa, quanto o
pedao de ouro e quanto o pedao de prata utilizados por
Arquimedes tinham todos o mesmo peso. Entretanto, como a
densidade do ouro maior do que a da prata, o pedao de ouro
ocupa um volume menor que o pedao de prata de mesmo
peso. Se o pedao de ouro possui menor volume, ento o
mesmo deslocou um volume menor de gua do que o pedao de
prata. A coroa, sendo feita de uma mistura de ouro e prata,
possua uma densidade mdia entre o ouro e a prata.
Considere que um cone macio seja posto para boiar em um
lquido. A marca circular deixada pelo lquido na superfcie do
corpo denominada a linha dgua. Curiosamente no caso
desse lquido e desse corpo, a linha dgua exatamente a

Outros eletrlitos e outros componentes no aportam benefcios


adicionais nesta fase de reposio e devem ser evitados, a no
que surjam comprovaes cientficas que justifiquem sua
incluso.
No se pode adicionar corantes e/ou sabores aos produtos para
reidratao oral.
Os produtos para reidratao podem ser apresentados como
solues prontas para uso, solues concentradas para serem
diludas ou como p ou grnulos para diluio em gua, de
acordo com instrues de preparo que devem constar da
embalagem de forma clara como est descrito no item III desta
Norma, que trata de bula e rotulagem.
II. A composio dos produtos para a preveno da desidratao
e para a manuteno da hidratao deve ter as seguintes
especificaes:
- A concentrao de Sdio poder variar entre 40 e 60 mEq/L. A
concentrao de potssio dever ser 20 mEq/L. A concentrao
milimolar de bicarbonato (ou base equivalente) dever compor
1/5 a 1/3 dos nions, sendo o restante cloreto. A concentrao
de glicose dever estar entre 110 e 140 mMol/L.
PAULO ROBERTO MIELE http://e-legis.anvisa.gov.br

Simtrico Pr-Universitrio 1 Simulado Estilo ENEM 2010 www.simetrico.com.br

1 Simulado 2007 - Estilo UFC


1 Simulado 2010 Estilo ENEM
Prova de Conhecimentos Gerais
Analise as informaes acima e indique o item verdadeiro.
a) A glicose pode ter uma concentrao de 1,2 x 10-2 mol/L
para est dentro das especificaes.
b) As solues de reidratao s se tornam eletrolticas, se
houver diluio de solues concentradas.
c) O sdio contido na soluo provem unicamente do cloreto de
sdio.
d) O nion em maior concentrao o sdio.
e) A concentrao milimolar mxima de bicarbonato dever
compor 1/3 dos nions.

Simtrico Pr-Universitrio 1 Simulado Estilo ENEM 2010 www.simetrico.com.br

19

1 Simulado 2010 Estilo ENEM

20

CINCIAS HUMANAS E
SUAS TECNOLOGIAS
Questes de 46 a 90

Questo 46

De acordo com o imaginrio da charge o contato do colonizador


com o nativo brasileiro se mostrou:
a) evidentemente pacfico e inofensivo aos seus costumes e
hbitos de liberdade.
b) contraditrio, na medida em que apresenta o nativo
ameaador e rebelde diante do colonizador recm chegado.
c) promissor ao desenvolvimento nativo e superao do atraso
diante da civilizao europia.
d) revelador de uma ameaa que assustava o ndio, apesar da
promessa de paz do colonizador.

e) pacfico e pautado pela promessa de vida melhor aos nativos


isolados na terra virgem brasileira.

Questo 47
A Revoluo Industrial ocorrida no final do sculo XVIII
transformou as relaes do homem com o trabalho. As
mquinas mudaram as formas de trabalhar, e as fbricas
concentraram-se em regies prximas s matrias-primas e
grandes
portos,
originando
vastas
concentraes
humanas.Muitos dos operrios vinham da rea rural e cumpriam
jornadas de trabalho de 12 a 14 horas, na maioria das vezes em
condies adversas. A legislao trabalhista surgiu muito
lentamente ao longo do sculo XIX e a diminuio da jornada de
trabalho para oito horas dirias concretizou-se no incio do
sculo XX.
Pode-se afirmar corretamente que as conquistas no incio deste
sculo, decorrentes da legislao trabalhista, esto relacionadas
com:
a) A expanso do capitalismo e a consolidao dos regimes
monrquicos constitucionais.
b) A expressiva diminuio da oferta de mo-de-obra, devido
demanda por trabalhadores especializados.
c) A capacidade de mobilizao dos trabalhadores em defesa
dos seus interesses.
d) O crescimento do Estado ao mesmo tempo que diminua a
representao operria nos parlamentos.
e) A vitria dos partidos comunistas nas eleies das principais
capitais europias.

Questo 48
Tomando como base a interpretao abaixo do Grfico e seus conhecimentos sobre a Globalizao, analise as afirmativas a seguir:
I. a globalizao um processo ideal para
garantir o acesso a bens e servios para toda a
populao.
II. a globalizao um fenmeno econmico e,
ao mesmo tempo, cultural.
III. a globalizao favorece a manuteno da
diversidade de costumes.
IV. filmes, programas de TV e msica so
mercadorias como quaisquer outras.
V. As ameaas globais ao meio ambiente, vindas
de diferentes setores, entre os quais o militar e
o nuclear.
Destas afirmativas esto corretas:
a) I, II e IV, apenas.
b) II, IV e V, apenas.
c) II, III e IV, apenas.
d) I, III e IV, apenas.
e) III, IV e V, apenas.

Simtrico Pr-Universitrio 1 Simulado Estilo ENEM 2010 www.simetrico.com.br

1 Simulado 2007 - Estilo UFC


1 Simulado 2010 Estilo ENEM
Prova de Conhecimentos Gerais
Questo 49
Leia os enunciados sobre domnios paisagsticos brasileiros e
assinale a alternativa que corresponda corretamente a cada um
deles, respectivamente.
1. A regio tem seu mecanismo regulador no ciclo anual que
alterna longas estiagens e grandes cheias, capazes de cobrir
mais de dois teros de sua rea. A reduo de matas ciliares
e conseqente assoreamento de rios, alm do turismo
descontrolado ameaam este domnio e suas espcies,
como a arara-azul e a ona-pintada.
2. Cortado por trs das maiores bacias hidrogrficas do
continente, possui grande variedade de formaes vegetais,
desde campos abertos at formaes florestais. Sobre
terrenos predominantemente sedimentares, a monocultura, a
minerao e a pecuria extensiva reduziram drasticamente a
cobertura original, intensificando os processos erosivos.
Espcies como o lobo guar esto ameaadas de extino.
3. Trata-se do domnio brasileiro menos protegido e estudado,
cuja degradao j ocasionou a extino de algumas
espcies, como a ararinha azul. um domnio que
apresenta grave situao social, o que leva explorao
predatria dos delicados recursos ambientais por meio de
agricultura e pecuria inadequadas e extrativismo primrio.
a)
b)
c)
d)
e)

Cerrado, Amaznia e Caatinga


Pantanal, Cerrado e Caatinga
Caatinga, Cerrados e Pampas gachos
Amaznia, Cerrados e Caatinga
Pantanal, Amaznia e Cerrados

Questo 50
O monstrengo que est no fim do mar
Na noite do breu ergueu-se a voar
A roda da nau voou trs vezes
Voou trs vezes a chiar
E disse: quem que ousou entrar
Nas minhas cavernas que no desvendo
Meus tetos negros no fim do mundo...
(PESSOA, Fernando. Mensagens. tica,
So Paulo, 1986, p.21)
De acordo com o poema, marque a opo correta no que
concerne mentalidade criada pelos navegadores e cronistas
em relao aos mares e terras desconhecidos.
a) Enfrentar o mar significava ir ao encontro de perigos
desconhecidos e desafiar crenas: navegar em guas
habitadas por monstros e explorar terras onde viviam seres
sobrenaturais.
b) Os viajantes portugueses e espanhis lanaram-se ao mar
para concretizar o sonho dourado do seu tempo: a
expanso comercial. E no havia, por parte dos
navegadores, a crena em monstros fantsticos.
c) Na poca das grandes navegaes, os europeus buscavam
tambm o paraso terrestre, repleto de riquezas e sem
sofrimentos.
d) a crena em monstros martimos fez navegadores e
investidores desistir do projeto de conquistas martimas.
e) a igreja foi a maior responsvel pela campanha contra as
navegaes martimas, pois sua luta reforava dogmas
teocntricos.

21

Questo 51

Na diviso de terras retratada acima, a parte que cabe aos


nativos brasileiros pode ser entendida metaforicamente:
a) como prioritria tanto pra Espanha quanto pra Portugal.
b) como pequena se comparada com a parte portuguesa e
espanhola.
c) como grande, pois fruto do reconhecimento europeu de seu
autoctonismo.
d) como preferencial ao avano do sistema colonizatrio lusoespanhol.
e) como uma linha imaginria que representa a conquista de
suas terras.

Questo 52
Somos servos da lei para podermos ser livres.
Ccero
O que apraz ao prncipe tem fora de lei.
Ulpiano
As frases acima so de dois cidados da Roma Clssica que
viveram praticamente no mesmo sculo, quando ocorreu a
transio da Repblica (Ccero) para o Imprio (Ulpiano).
Tendo como base as sentenas acima, considere as afirmaes:
I. A diferena nos significados da lei apenas aparente, uma
vez que os romanos no levavam em considerao as
normas jurdicas.
II. Tanto na Repblica como no Imprio, a lei era o resultado de
discusses entre os representantes escolhidos pelo povo
romano.
III. A lei republicana definia que os direitos de um cidado
acabavam quando comeavam os direitos de outro cidado.
IV. Existia, na poca imperial, um poder acima da legislao
romana.

Simtrico Pr-Universitrio 1 Simulado Estilo ENEM 2010 www.simetrico.com.br

22

1 Simulado 2010 Estilo ENEM

Esto corretas, apenas as afirmaes:


a) I e II.
b) I e III.
c) II e III.
d) II e IV.
e) III e IV.

Marque a alternativa que apresenta de modo correto o mapa


representativo da organizao do espao brasileiro, no perodo
descrito no texto.

Questo 53
Em 1999, o Programa das Naes Unidas para o
Desenvolvimento elaborou o Relatrio do Desenvolvimento
Humano, do qual foi extrado o trecho abaixo. Nos ltimos anos
da dcada de 90, o quinto da populao mundial que vive nos
pases de renda mais elevada tinha:
86% do PIB mundial, enquanto o quinto de menor renda,
apenas 1%;
82% das exportaes mundiais, enquanto o quinto de menor
renda, apenas 1%;
74% das linhas telefnicas mundiais, enquanto o quinto de
menor renda, apenas 1,5%;
93,3% das conexes com a Internet, enquanto o quinto de
menor renda, apenas 0,2%.
A distncia da renda do quinto da populao mundial que vive
nos pases mais pobres que era de 30 para 1, em 1960
passou para 60 para 1, em 1990, e chegou a 74 para 1, em
1997.
De acordo com esse trecho do relatrio, o cenrio do
desenvolvimento humano mundial, nas ltimas dcadas, foi
caracterizado pela:
a) diminuio da disparidade entre as naes.
b) diminuio da marginalizao de pases pobres.
c) incluso progressiva de pases no sistema produtivo.
d) crescente concentrao de renda, recursos e riqueza.
e) distribuio eqitativa dos resultados das inovaes
tecnolgicas.

Questo 54
Leia, com ateno, a descrio do espao geogrfico:
E por aqueles campos que ele agora via da janela do
trem em movimento na certa passara um dia o cap. Rodrigo
Cambar, montado em seu frete, de espada cinta, violo a
tiracolo, chapu de aba quebrada sobre a fronte altiva. De certo
modo ele simbolizava a tradio de hombridade do Rio Grande,
uma tradio achava Rodrigo que as geraes novas deviam
manter, embora dentro dum outro ambiente. Tinham-se acabado
as guerras com os castelhanos. As fronteiras estavam
definitivamente traadas. Trilhos de estrada de ferro cortavam os
campos, e ao longo dessas paralelas de ao, atravs de
centenas de quilmetros, estavam plantados postes telegrficos.
Em algumas cidades havia j telefones e at luz eltrica. Os
inventos e descobrimentos da cincia, as maquinas que a
inteligncia e o engenho humano inventavam e construam para
melhorar e facilitar a vida, aos poucos iam entrando no Rio
Grande e um dia chegariam a Santa F.
Fonte: VERSSIMO, E. O tempo e o vento, Porto Alegre,
Globo, 1963.
Simtrico Pr-Universitrio 1 Simulado Estilo ENEM 2010 www.simetrico.com.br

1 Simulado 2007 - Estilo UFC


1 Simulado 2010 Estilo ENEM
Prova de Conhecimentos Gerais

23

Questo 55
A FOME NO MUNDO
No se deve confundir fome com subnutrio. A fome
ameaa no s a vida das pessoas, mas tambm a sua
dignidade. Uma carncia grave e prolongada de alimentao
provoca o debilitamento do organismo, a apatia, a perda do
sentido social, a indiferena e, por vezes, a hostilidade em
relao aos mais frgeis: em particular as crianas e os idosos.
Assim, grupos inteiros so condenados a morrer na desgraa.
No decurso da histria, esta tragdia repete-se infelizmente, mas
a conscincia contempornea compreende melhor que outrora
que a fome constitui um escndalo.
At ao sculo XIX, as misrias que dizimavam
populaes inteiras tinham, com muita frequncia, uma origem
natural. Hoje elas so mais circunscritas mas, na maioria das
vezes, derivam da ao humana. Basta citarmos algumas
regies ou pases para nos convencermos disto: Etipia,
Camboja, Uganda , Ruanda, Haiti...etc . Nesta poca em que o
homem, mais que outrora, tem a possibilidade de fazer fae s
misrias, tais situaes constituem uma verdadeira desonra para
a humanidade.
Fonte :
http://www.vatican.va/roman_curia/pontifical_councils/corunu.
acesso 2010.
Produto da necessidade moderna de relacionar natureza e
sociedade, a geografia por muito tempo ficou incomodada pelo
desconforto da discusso sobre seu objeto de estudo, o qual
sempre foi motivo de amplo debate. Com relao as mais
recentes propostas de abordagem da cincia geogrfica,
relacionada a temtica da fome, marque a opo correta.

Simtrico Pr-Universitrio 1 Simulado Estilo ENEM 2010 www.simetrico.com.br

24

1 Simulado 2010 Estilo ENEM


situado diante da linha de contato entre as placas tectnicas de
Nazca, no Pacfico, e da Amrica do Sul.
Disponvel em:
http://diariodonordeste.globo.com/materia.asp?codigo=74855
6 Acesso em: 10/03/2010

a) geografia crtica, suas escolas e subdivises no cabe,


nem nunca coube, o tratamento de problemas dessa
natureza (a fome.), uma vez a mesma tem como finalidade
principal a simples descrio da paisagem.
b) Relacionar o problema
da fome ao crescimento
populacional, como costuma fazer estudos de Geografia da
Populao pautados em teses malthusianas e
neomalthusianistas, no elucida a problemtica. Importante
torna-se outros elementos significativos como: estrutura
agrria, distribuio de renda e diviso internacional do
trabalho.
c) A chamada revoluo cientfica-tcnica tem um papel
irrelevante na explorao dos recursos utilizados pelo
homem, visto que a mesma caracteriza apenas as modernas
espacialidades urbanas.
d) A Geografia Crtica comunga com a idia de que a fome
resulta, unicamente, da relao que o homem mantm com
o meio. A discusso remete-se, conforme ocorre na
Geografia Tradicional, questo relativa ao uso irracional
dos recursos naturais pelo homem, no devendo considerarse os aspectos polticos, econmicos e sociais.
e) Em geografia agrria a anlise do problema (a fome) deve
desconsiderar a estrutura fundiria, pois a concentrao de
grandes extenses de terras, nas mos de uma minoria, no
contribui para agravar a fome do Terceiro Mundo.

Com base no exposto acima, possvel inferir corretamente que:


a) o novo mapa do Chile foi resultante de interaes humanas
com o meio fsico.
b) as alteraes geofsicas do espao geogrfico so
constantes e perceptveis no tempo-espao humano atual,
por esse motivo no foi uma supressa tal deslocamento da
cidade de Concepcin.
c) o tremo no Chile (27/02/2010) e no Haiti (12/02/2010)
sinalizam para as possveis catstrofes futuras decorrentes
do aquecimento global, resultantes da agresso das
atividades humanas no espao geogrfico.
d) apesar das interaes da sociedade com o meio fsico
provocarem mudanas mais drsticas na paisagem, as
ocorrncias ssmicas podem modificar o espao geogrfico.
e) Por estar no centro de placas tectnicas a populao chilena
convive com os terremotos, apesar da supressa da
intensidade do tremor do dia 27 de fevereiro de 2010

Questo 57
Um dos problemas ambientais mais graves que afligem grandes
cidades brasileiras o das enchentes. Sobre seus
conhecimentos sobre o tema e as consideraes abaixo ,
responda a questo.
Rio de Janeiro enfrenta uma grande quantidade de
chuvas, principalmente na capital que basta chover um
pouco mais forte que uma grande parte da cidade inundada.
A falta de investimentos um dos maiores problemas para
as enchentes. A falta de Infra-estrutura gera todo a
polemica .
Quando se chove a gua simplesmente no tem para
onde ir e por isso as inundaes so causadas.
Outro problema so as sujeiras que as pessoas
jogam nas ruas sem nenhuma vergonha nos bueiros que
ficam bloqueados e no conseguem escoar a gua. Esses
so os dois principais problemas que eu vejo na cidade. Se
a populao contribusse no teramos tantos

Questo 56
MAPA MODIFICADO
Terremoto redesenha Chile
O terremoto que sacudiu o Chile em fevereiro
redesenhou os mapas da regio, causando um deslocamento de
at quatro metros nas zonas prximas ao epicentro, afirmaram,
ontem, cientistas chilenos. Mas dados preliminares indicam que
a cidade de Concepcin, segunda maior do pas, e tambm
bastante afetada, se deslocou trs metros para sudeste.
Santiago, a capital, "andou" meio metro. A energia liberada pelo
sismo foi to grande que, segundo a Nasa, deslocou em cerca
de 7,6 centmetros o eixo de rotao da Terra. O Chile est

Fonte : http://noticias.bol.uol.com.br/brasil/2010/04/06/chuvaforte-provoca-tres-mortes-no-rio-de-janeiro.jhtm

Simtrico Pr-Universitrio 1 Simulado Estilo ENEM 2010 www.simetrico.com.br

1 Simulado 2007 - Estilo UFC


1 Simulado 2010 Estilo ENEM
Prova de Conhecimentos Gerais
I. Uma das causas das enchentes relaciona-se com a
ocupao desordenada dessas cidades pois, nesse
processo, at as reas de vrzea dos rios que atravessam
seus stios foram inteiramente ocupadas por avenidas
marginais e edificaes. Uma forma de tentar minimizar esse
problema seria destruir por deciso unilateral do Poder
Executivo municipal as construes existentes nessas
vrzeas.
II. Como a ocupao urbana dessas cidades foi realizada sem
planejamento, elas esto quase totalmente tomadas por
avenidas e edificaes, o que impede a absoro da gua
das chuvas pelo solo. Uma forma de tentar minimizar esse
problema seria construir, em reas estratgicas, grandes
reservatrios de gua, denominados popularmente
piscines.
III. Uma das causas das enchentes nas grandes cidades est
relacionada com o intenso processo de assoreamento dos
rios que atravessam seus stios, pois eles assim se tornam
muito rasos e por isso transbordam rapidamente quando
ocorre uma grande chuva. Uma forma de minimizar esse
problema seria rebaixar mecanicamente as calhas desses
cursos fluviais
IV. A culpa das enchentes inteiramente das populaes
urbanas, que tm o hbito de jogar lixo nas ruas de forma
indiscriminada, contribuindo para que as galerias pluviais e
os bueiros, construdos para escoarem a gua das chuvas,
no consigam realizar essa tarefa, por estarem entupidos.
Uma forma de minimizar esse problema seria, por deciso
do poder municipal, multar e prender quem jogasse lixo nas
ruas.
Sobre as consideraes apresentadas, pode-se dizer de modo
correto, que apontam causas reais e solues legalmente
viveis as de nmero:
a) I e II, apenas.
b) I e III, apenas.
c) II e III, apenas.
d) II e IV, apenas.
e) III e IV, apenas.

Questo 58

25

Sobre o contexto social e a literatura do perodo retratado no


quadro acima, correto afirmar que:
a) esto intimamente ligados contra reforma, pois a arte
barroca procura comover o leitor, envolvendo-o
emocionalmente na retomada dos valores cristos.
b) valorizavam as formas clssicas, procurando imitar os
modelos greco-romanos, tais como: busca da perfeio
formal, racionalismo e convencionalismo.
c) nesse momento, ocorrem as primeiras lutas sociais contra o
capitalismo progressivamente dominador. Nas artes,
destaca-se o retrato realista das dinmicas sociais e a
anlise psicolgica dos personagens.
d) marcado pelas vitrias polticas da burguesia, da o
nacionalismo e a idealizao dos elementos locais.
e) a literatura do perodo consiste em relatrios, documentos e
cartas que se empenhavam em levantar a fauna, a flora e os
habitantes da nova terra, da o fato de ser uma literatura
meramente descritiva.

Questo 59
O primeiro testemunho sobre a antropofagia na Amrica foi
registrado por lvarez Chanca (...) em 1493. (...) Registrada a
abominao antropofgica, os monarcas espanhis autorizam
em 1503 a escravido de todos os carabas pelos colonos. No
litoral brasileiro, os tupinambs, do grupo tupi, tinham o hbito
do canibalismo ritual (...). Prova de barbrie e, para alguns, da
natureza no-humana do amerndio, a antropofagia condenava
as tribos que a praticavam a sofrer pelas armas portuguesas a
guerra justa e do ca tiveiro perptuo em 1557, por terem
devorado no ano anterior vrios nufragos portugueses, entre os
quais se encontrava o primeiro bispo do Brasil.
Lus Felipe de Alencastro, Folha de S. Paulo, 12 out. 1991.
A partir do fragmento correto concluir que
a) as tribos tupiniquins, aliadas aos franceses, acreditavam na
justia e na importncia da guerra justa como capaz de
permitir a supremacia contra tribos inimigas.
b) conforme determinava a legislao de Portugal e da
Espanha at o incio do sculo XIX, apenas os nativos da
Amrica que praticavam o canibalismo foram escravizados.
c) a escravizao dos amerndios foi legal e efetiva apenas at
a entrada dos primeiros homens escravos africanos na
Amrica, a partir da segunda metade do sculo XVII.
d) o estranhamento do colonizador europeu com a prtica da
antropofagia por parte dos nativos da Amrica serviu de
pretexto para a escravizao desses nativos.
e) portugueses e espanhis, assim como a Igreja Catlica,
associavam a desumanidade dos ndios ao fato desses
nativos insistirem na prtica da guerra justa.
TEXTO REFERNCIA PARA AS QUESTES 60 e 61
O texto abaixo, de John Locke (1632-1704), revela algumas
caractersticas de uma determinada corrente de pensamento.
Se o homem no estado de natureza to livre, conforme
dissemos, se senhor absoluto da sua prpria pessoa e
posses, igual ao maior e a ningum sujeito, por que abrir
ele mo dessa liberdade, por que abandonar o seu imprio
e sujeitar-se- ao domnio e controle de qualquer outro

Simtrico Pr-Universitrio 1 Simulado Estilo ENEM 2010 www.simetrico.com.br

26

1 Simulado 2010 Estilo ENEM

poder? Ao que bvio responder que, embora no estado de


natureza tenha tal direito, a utilizao do mesmo muito
incerta e est constantemente exposto invaso de
terceiros porque, sendo todos senhores tanto quanto ele,
todo homem igual a ele e, na maior parte, pouco
observadores da eqidade e da justia, o proveito da
propriedade que possui nesse estado muito inseguro e
muito arriscado. Estas circunstncias obrigam-no a
abandonar uma condio que, embora livre, est cheia de
temores e perigos constantes; e no sem razo que
procura de boa vontade juntar-se em sociedade com outros
que esto j unidos, ou pretendem unir-se, para a mtua
conservao da vida, da liberdade e dos bens a que chamo
de propriedade.
(Os Pensadores. So Paulo: Nova Cultural, 1991)

Questo 60
Do ponto de vista poltico, podemos considerar o texto como
uma tentativa de justificar:
a) a existncia do governo como um poder oriundo da
natureza.
b) a origem do governo como uma propriedade do rei.
c) o absolutismo monrquico como uma imposio da natureza
humana.
d) a origem do governo como uma proteo vida, aos bens e
aos direitos.
e) o poder dos governantes, colocando a liberdade individual
acima da propriedade.

(COPRNICO, N. De Revolutionibus orbium


caelestium.)
Aqueles que se entregam prtica sem cincia so como o
navegador que embarca em um navio sem leme nem bssola.
Sempre a prtica deve fundamentar-se em boa teoria. Antes de
fazer de um caso uma regra geral, experimente-o duas ou trs
vezes e verifique se as experincias produzem os mesmos
efeitos. Nenhuma investigao humana pode se considerar
verdadeira cincia se no passa por demonstraes
matemticas.
(VINCI, Leonardo da. Carnets.)
O aspecto a ser ressaltado em ambos os textos para
exemplificar o racionalismo moderno :
a) a f como guia das descobertas.
b) o senso crtico para se chegar a Deus.
c) a limitao da cincia pelos princpios bblicos.
d) a importncia da experincia e da observao.
e) o princpio da autoridade e da tradio.

Questo 63

Questo 61
Analisando o texto, podemos concluir corretamente que se trata
de um pensamento:
a) do liberalismo.
b) do socialismo utpico.
c) do absolutismo monrquico.
d) do socialismo cientfico.
e) do anarquismo.

Questo 62
(...) Depois de longas investigaes, convenci-me por fim de
que o Sol uma estrela fixa rodeada de planetas que giram em
volta dela e de que ela o centro e a chama. Que, alm dos
planetas principais, h outros de segunda ordem que circulam
primeiro como satlites em redor dos planetas principais e com
estes em redor do Sol. (...) No duvido de que os matemticos
sejam da minha opinio, se quiserem dar-se ao trabalho de
tomar conhecimento, no superficialmente mas duma maneira
aprofundada, das demonstraes que darei nesta obra. Se
alguns homens ligeiros e ignorantes quiserem cometer contra
mim o abuso de invocar alguns passos da Escritura (sagrada), a
que toram o sentido, desprezarei os seus ataques: as verdades
matemticas no devem ser julgadas seno por matemticos.

Sobre o sistema escravista retratado na charge e o que ela


sugere , podemos afirmar de modo verdadeiro que:
a) a igreja assumiu papel contraditrio ao condenar abusos de
castigos corporais sem questionar a prpria escravido.
b) o discurso do poder institucional se colocou frontalmente
contra qualquer ato de tortura contra o escravo.
c) a afirmao do padre na charge refora a postura
incondicional de defesa da igreja catlica do negro livre.
d) a igreja catlica procurou o absoluto silncio em relao aos
castigos corporais aplicados contra os negros.
e) o feitor orientado pelo padre procurava ser condescendente
no momento de chibatear o negro.

Simtrico Pr-Universitrio 1 Simulado Estilo ENEM 2010 www.simetrico.com.br

1 Simulado 2007 - Estilo UFC


1 Simulado 2010 Estilo ENEM
Prova de Conhecimentos Gerais

27

Questo 65

Questo 64
Analise os mapas abaixo e as afirmativas relacionadas aos
mesmos.

Analise a charge e o texto a seguir.

Disponvel em: <www.inesc.org.br.> Acesso em: 19 Jun. 2005.


TEXTO

O que a Usina Hidreltrica de Belo Monte?

I. Atualmente, observam-se significativos graus de degradao


de ecossistemas marinhos e costeiros, sendo o mangue um
dos mais afetados, especialmente, em decorrncia de sua
posio prxima s principais fontes de poluio.
II. Dentre as mais graves ameaas s regies coralferas do
planeta, esto os efluentes lanados por acidentes com
embarcaes, o aquecimento global, a explorao predatria
e a poluio em zonas costeiras.
III. Os mangues constituem-se em ecossistemas resistentes e
adaptveis a mudanas fsicas, o que se comprova por sua
distribuio independente de zonas trmicas.
IV. As regies coralferas, embora permanentemente
ameaadas de degradao, esto entre os ecossistemas
mais resistentes do planeta, tal como ocorre com os
mangues.
Est correto apenas o que se afirma em:
a) I.
b) II.
c) I e II.
d) II e III.
e) I, III e IV.

Com projeto para ser instalada na regio conhecida


como Volta Grande do Rio Xingu, no Par, a Usina de Belo
Monte deve ser a terceira maior do mundo em capacidade
instalada, atrs apenas das usinas de Trs Gargantas, na China,
e da binacional Itaipu, na fronteira do Brasil com o Paraguai.
Para a construo da hidreltrica de Belo Monte, no Rio
Xing, inundaro uma rea no Par onde se localizam 30 terras
indgenas e afetar um tero do municpio de Altamira. As
principais tribos indgenas a serem afetadas so: aldeia
Paquiamba, dos ndios juruna, a tribo Arara,
As lideranas indgenas da Volta Grande do rio Xingu, no
Par, prometem realizar uma ocupao da regio em que ser
construda a usina hidreltrica de Belo Monte. No h previso
de quantas pessoas estaro envolvidas. Cerca de 150 ndios da
etnia Xikrin Kayap devem chegar rea a partir de quarta-feira
(21). O cacique Luis Xipaya, presidente do Conselho Indgena
de Altamira (PA), afirma que a ocupao das margens prximas
rea da barragem principal uma forma de protestar contra o
projeto da usina. Ele diz que as comunidades locais no foram
ouvidas nos debates sobre a construo.
Com base na charge, no texto e nos conhecimentos sobre o
tema, considere as afirmativas a seguir.
I. A charge e o texto mostram a preocupao do Governo
brasileiro em desenvolver uma Poltica Indigenista que vise
garantir os direitos territoriais dos povos indgenas.
II. O texto e a charge remetem importncia da poltica
indigenista brasileira nos ltimos cinco anos e aos ganhos
sociais decorrentes da garantia dos direitos a essa
populao.
III. A partir da charge e do texto, possvel verificar que os
povos indgenas esto alijados do apoio oficial necessrio
luta pela manuteno de suas terras e de seus recursos
naturais.
IV. A charge e o texto indicam que, em diversas instncias,
ecoam aes e discursos contrrios s reais necessidades
dos povos indgenas.

Simtrico Pr-Universitrio 1 Simulado Estilo ENEM 2010 www.simetrico.com.br

1 Simulado 2010 Estilo ENEM

28
Esto corretas as afirmativas:
a) I e II, apenas.
b) II e III, apenas.
c) III e IV, apenas.
d) I, II e IV, apenas.
e) I, III e IV, apenas.

c) moralizante, na medida em que aponta a precariedade da


formao crist do Brasil como causa da predominncia de
elementos primitivos e pagos.
d) preconceituosa, pois critica tanto ndios quanto negros,
representando de modo positivo apenas o elemento
europeu, vindo com as caravelas.
e) negativa, pois retrata a formao do Brasil como incoerente
e defeituosa, resultando em anarquia e falta de seriedade.

Questo 66
No Brasil colonial, seguindo o costume portugus, desde o
despertar o cristo se via rodeado de lembranas do reino dos
cus. Na parede contgua cama, havia sempre algum smbolo
visvel da f crist: um quadrinho ou caixilho com gravura do
anjo da guarda ou do santo; uma pequena concha com gua
benta; o rosrio dependurado na cabeceira da cama.

Questo 68

(MOTT, Luiz. Cotidiano e Vivncia Religiosa: entre a capela e o


calundu. In. Laura de Mello e Souza (org.). Histria da Vida Privada no
Brasil.)

Sobre a influncia da religio na vida do Brasil colonial que o


texto aborda, podemos afirmar corretamente que:
a) no possui qualquer vnculo com a tradio metropolitana
portuguesa.
b) faz parte de um culto exclusivo nas famlias de posses, visto
que o povo preferia a religio africana.
c) durante a ocupao holandesa, os rituais catlicos foram
completamente abolidos, pois a religio dos novos donos do
Brasil era protestante.
d) os smbolos e signos religiosos, presentes em cada canto da
casa, refletia a combinao de beleza, f e dominao na
sociedade dividida em senhores e escravos.
e) o cristianismo aplicado a realidade colonial brasileira, foi
subvertido e corrompido pelos vcios culturais africanos e
indgenas.

Questo 67
Brasil
O Z Pereira chegou de caravela
E preguntou pro guarani da mata virgem
Sois cristo?
No. Sou bravo, sou forte, sou filho da Morte
Teter tet Quiz Quiz Quec!
L longe a ona resmungava Uu! ua! uu!
O negro zonzo sado da fornalha
Tomou a palavra e respondeu
Sim pela graa de Deus
Canhem Bab Canhem Bab Cum Cum!
E fizeram o Carnaval
(Oswald de Andrade)

O artesanato traz as marcas de cada cultura e, desse modo,


atesta a ligao do homem com o meio social em que vive. Os
artefatos so produzidos manualmente e costumam revelar uma
integrao entre o homem e o meio ambiente, identificvel no
tipo de matria-prima utilizada.
Pela matria-prima (o barro) utilizada e pelos tipos humanos
representados, em qual regio do Brasil o artefato acima foi
produzido?
a) Sul.
b) Norte.
c) Nordeste.
d) Centro-Oeste.
e) Sudeste

Questo 69
Observe os grficos para responder questo que se segue:

Este texto apresenta uma verso humorstica da formao do


Brasil, mostrando-a como uma juno de elementos diferentes.
Considerando-se esse aspecto, correto afirmar que a viso
apresentada pelo texto :
a) ambgua, pois tanto aponta o carter desconjuntado da
formao nacional, quanto parece sugerir que esse
processo, apesar de tudo, acaba bem.
b) inovadora, pois mostra que as trs raas formadoras
portugueses, negros e ndios pouco contriburam para a
formao da identidade brasileira.
Simtrico Pr-Universitrio 1 Simulado Estilo ENEM 2010 www.simetrico.com.br

1 Simulado 2007 - Estilo UFC


1 Simulado 2010 Estilo ENEM
Prova de Conhecimentos Gerais

29

quais um homem (...) bata o ar com asas como um pssaro. (...)


Mquinas que permitam ir ao fundo dos mares e dos rios
(apud. BRAUDEL, Fernand. Civilizao
material,economia e capitalismo: sculos XVXVIII,So Paulo: Martins Fontes, 1996, vol. 3.).
Considerando a dinmica do processo histrico, pode-se afirmar
de modo verdadeiro que as idias de Roger Bacon
a) inseriam-se plenamente no esprito da Idade Mdia ao
privilegiarem a crena em Deus como o principal meio para
antecipar as descobertas da humanidade.
b) estavam em atraso com relao ao seu tempo ao
desconsiderarem os instrumentos intelectuais oferecidos
pela Igreja para o avano cientfico da humanidade.
c) opunham-se ao desencadeamento da Primeira Revoluo
Industrial, ao rejeitarem a aplicao da matemtica e do
mtodo experimental nas invenes industriais.
d) eram fundamentalmente voltadas para o passado, pois no
apenas seguiam Aristteles, como tambm baseavam-se na
tradio e na teologia.
e) inseriam-se num movimento que convergiria mais tarde para
o Renascimento, ao contemplarem a possibilidade de o ser
humano controlar a natureza por meio das invenes.

Questo 71
Considerando os trs grficos, assinale a alternativa que faz
consideraes corretas sobre as relaes existentes entre os
fenmenos neles mostrados.
a) O fenmeno mostrado no grfico 1 no apresenta nenhum
tipo de relao de causa ou de efeito com o fenmeno
mostrado no grfico 3.
b) O fenmeno mostrado no grfico 3 no apresenta nenhum
tipo de relao de causa ou de efeito com o fenmeno
mostrado no grfico 2.
c) Os fenmenos mostrados, embora estejam ocorrendo no
planeta, no apresentam entre si nenhum tipo de relao de
causa ou de efeito.
d) O fenmeno mostrado no grfico 2 apresenta uma estreita
relao de causa ou de efeito com os fenmenos mostrados
nos grficos 1 e 3.
e) O fenmeno mostrado no grfico 3 no apresenta qualquer
tipo de relao de causa ou de efeito com o fenmeno
mostrado no grfico 1.

Questo 70
O franciscano Roger Bacon foi condenado, entre 1277 e 1279,
por dirigir ataques aos telogos, por uma suposta crena na
alquimia, na astrologia e no mtodo experimental, e tambm por
introduzir, no ensino, as idias de Aristteles. Em 1260, Roger
Bacon escreveu:
Pode ser que se fabriquem mquinas graas s quais os
maiores navios, dirigidos por um nico homem, se desloquem
mais depressa do que se fossem cheios de remadores; que se
construam carros que avancem a uma velocidade incrvel sem a
ajuda de animais; que se fabriquem mquinas voadoras nas

Leia os texto I e II.


I. Para o filsofo ingls Thomas Hobbes (1588-1679), o estado
de natureza um estado de guerra universal e perptua.
Contraposto ao estado de natureza, entendido como estado
de guerra, o estado de paz a sociedade civilizada. Dentre
outras tendncias que dialogam com as idias de Hobbes,
destaca-se a definida pelo texto abaixo.
II. Nem todas as guerras so injustas e correlativamente, nem
toda paz justa, razo pela qual a guerra nem sempre um
desvalor, e a paz nem sempre um valor.
BOBBIO, N. MATTEUCCI, N PASQUINO, G.
Dicionrio de Poltica, 5 ed. Braslia: Universidade de
Braslia; So Paulo: Imprensa Oficial do Estado, 2000.
Comparando as idias de Hobbes (texto I) com a tendncia
citada no texto II, pode-se afirmar corretamente que:
a) em ambos, a guerra entendida como inevitvel e injusta.
b) para Hobbes, a paz inerente civilizao e, segundo o
texto II, ela no um valor absoluto.
c) de acordo com Hobbes, a guerra um valor absoluto e,
segundo o texto II, a paz sempre melhor que a guerra.
d) em ambos, a guerra ou a paz so boas quando o fim justo.
e) para Hobbes, a paz liga-se natureza e, de acordo com o
texto II, civilizao.

Questo 72
Tropas da Aliana do Tratado do Atlntico Norte (OTAN)
invadiram o Iraque em 1991 e atacaram a Srvia em 1999. Para
responder aos crticos dessas aes, a OTAN usaria,
possivelmente, argumentos baseados:
a) na teoria da guerra perptua de Hobbes.
b) tanto na teoria de Hobbes como na tendncia expressa no
texto II.

Simtrico Pr-Universitrio 1 Simulado Estilo ENEM 2010 www.simetrico.com.br

30

1 Simulado 2010 Estilo ENEM

c) no fato de que as regies atacadas no possuam


sociedades civilizadas.
d) na teoria de que a guerra pode ser justa quando o fim
justo.
e) na necessidade de pr fim guerra entre os dois pases
citados.

Questo 73
A Geologia trabalha com longas escalas de tempo, analisando
os fatores endgenos e exgenos que transformam a litosfera ao
longo de milhes de anos, contribuindo para a criao de novos
espaos geogrficos. O texto a seguir trata de um agente
transformador que at pouco tempo atrs quase no era levado
em conta. Leia-o com ateno:
A ao humana sobre a superfcie terrestre dez vezes mais
poderosa do que todos os rios e geleiras. Estima- -se que o
homem tenha transportado, ao longo de sua histria, cerca de
16 mil km3 de solo e rochas. Parece que nada na natureza to
rpido e to perigoso para o meio ambiente quanto a atividade
humana. Atualmente a humanidade movimenta cerca de
140km3 de solos e rochas por ano, o que equivale a desgastar
325 metros da superfcie continental a cada milho de anos.
Compare-se esse dado com o que se sabe sobre as foras
naturais de eroso nos ltimos 540 milhes de anos: estas
desgastaram a superfcie terrestre em cerca de 30 metros a
cada milho de anos.
Esse processo se acelerou desde a Revoluo Agrcola, graas
ampliao das reas de cultivo, mas foi a Revoluo Industrial,

com ampliao das cidades, minerao, industrializao e


transporte, que mais mudou a superfcie terrestre.
A eroso per capita mundial, em nossos dias, de cerca de 6
toneladas ao ano, variando segundo o grau de desenvolvimento
do pas. Nos Estados Unidos a mdia de 30 toneladas per
capita.
(Traduzido e adaptado de Bruce H. Wilkinson, Humans
as geologic agents: a deep-time perspective. Geology. Vol. 33,
abril 2005.)
Com base no texto e nos seus conhecimentos sobre as
transformaes do espao natural e geogrfico, aponte a
afirmao correta:
a) A ao humana se situa em uma escala de tempo
relativamente curta, contada em milhares de anos, mas sua
dinmica tem sobrepujado as foras da natureza, que agem
em escalas mais longas.
b) A ao humana teve incio na era Terciria e, graas ao
acelerado crescimento humano na fase inicial das migraes
intercontinentais, causou grandes transformaes
superfcie terrestre.
c) O desgaste da superfcie continental no relevante, j que
os continentes esto sofrendo um contnuo processo de
soerguimento.
d) O volume de solos destrudo pela ao humana realmente
elevado, mas o volume de rochas movimentado pela ao
das geleiras e rios bem superior.
e) Nos pases pobres a eroso per capita muito menor que
nos pases ricos devido ao pequeno uso que suas
populaes fazem da natureza e sua maior preocupao
com o meio ambiente.

Questo 74
Diversidade biolgica, ou biodiversidade, refere-se variedade da vida no planeta Terra, incluindo: a variedade gentica dentro das
populaes e espcies; a variedade de espcies da flora, da fauna e de microrganismos; a variedade de funes ecolgicas
desempenhadas pelos organismos nos ecossistemas; e a variedade de comunidades, habitats e ecossistemas formados pelos
organismos. (DIAS, B. F. S. Biodiversidade: perspectivas e oportunidades tecnolgicas.)
No mapa a seguir esto assinalados os pases em cujos territrios se encontram 70% das espcies vegetais e animais existentes sobre a
Terra. A maioria dos pases que apresenta megadiversidade est localizada nas regies onde ocorrem florestas pluviais tropicais.

Simtrico Pr-Universitrio 1 Simulado Estilo ENEM 2010 www.simetrico.com.br

1 Simulado 2007 - Estilo UFC


1 Simulado 2010 Estilo ENEM
Prova de Conhecimentos Gerais

31

No que diz respeito a biodiversidade, julgue os itens a seguir.


I. A biodiversidade produto de processos evolutivos mediados por mecanismos de seleo natural.
II. Nas florestas tropicais, a grande diversidade de condies abiticas, tais como temperatura, umidade, luminosidade, relevo, etc.,
favorece a diversificao de inmeras espcies que podem ocupar diferentes nichos ecolgicos.
III. Madagascar, Indonsia e Filipinas apresentam, alm de grande biodiversidade, um elevado nmero de espcies que ocorrem apenas
nesses locais; sendo ilhas, constituem ambientes propcios para a evoluo de espcies exclusivas, pois esto isoladas
geograficamente dos continentes.
IV. medida que certos ambientes tais como o solo, as copas das grandes rvores de florestas tropicais e o fundo do mar venham a
ser mais estudados, muitas novas espcies podero ser descobertas.
V. A biodiversidade constitui hoje um enorme potencial para que a biotecnologia desenvolva, com propsito alimentcio e industrial, novas
espcies, mais resistentes s pragas, doenas e adversidades ambientais.
Esto corretos os itens:
a) I, II, III e V, somente.
b) II, III, IV e V, somente.
c) I, III e IV, somente.
d) II, IV e V, somente.
e) I, II, III, IV e V.

Questo 75
O texto abaixo reproduz parte de um dilogo entre dois
personagens de um romance.
Quer dizer que a Idade Mdia durou dez horas?
Perguntou Sofia.
Se cada hora valer cem anos, ento sua conta est
certa. Podemos imaginar que Jesus nasceu meia-noite, que
Paulo saiu em peregrinao missionria pouco antes da meianoite e meia e morreu quinze minutos depois, em Roma. At as
trs da manh a f crist foi mais ou menos proibida. (...) At as
dez horas as escolas dos mosteiros detiveram o monoplio da
educao.
Entre dez e onze horas so fundadas as primeiras
universidades.
Adaptado de GAARDER, Jostein. O Mundo de Sofia,
Romance da Histria da Filosofia. So Paulo: Cia das Letras,
1997.
O ano de 476 d.C., poca da queda do Imprio Romano do
Ocidente, tem sido usado como marco para o incio da Idade
Mdia. De acordo com a escala de tempo apresentada no texto,
que considera como ponto de partida o incio da Era Crist,
pode-se afirmar corretamente que:
a) as Grandes Navegaes tiveram incio por volta das quinze
horas.
b) a Idade Moderna teve incio um pouco antes das dez horas.
c) o Cristianismo comeou a ser propagado na Europa no incio
da Idade Mdia.
d) as peregrinaes do apstolo Paulo ocorreram aps os
primeiros 150 anos da Era Crist.
e) os mosteiros perderam o monoplio da educao no final da
Idade Mdia.

Questo 76

A charge acima sugere que Tiradentes ao longo da histria:


a) foi desprezado como lder idealista defensor da liberdade e
da democracia.
b) ficou marcado como traidor da metrpole portuguesa e da
colnia brasileira.
c) tornou-se exemplo de criminalidade e subverso da ordem
pblica.
d) conquistou status de libertrio e defensor da democracia no
Brasil.
e) ficou preso e esquecido no passado dos livros de histria.

Simtrico Pr-Universitrio 1 Simulado Estilo ENEM 2010 www.simetrico.com.br

32

1 Simulado 2010 Estilo ENEM

Questo 77

Questo 79
Observe o mapa e as figuras a seguir.

A figura acima representa no universo dos engenhos coloniais


do Brasil:
a) a especializao da produo aucareira que prioriza
experincia e tecnologia trazidas pelos africanos.
b) a participao dos escravos na moagem da cana,
consolidando a frase de Antonil: os escravos so as mos e
os ps do senhor.
c) o predomnio do trabalhador livre e assalariado na moagem
da cana e feitura do acar.
d) uma das fases iniciais da empresa aucareira, logo aps a
colheita, onde predominava o trabalhador livre e especialista.
e) a moagem da cana feita por escravos destacados
exclusivamente pra essa funo, j que no escravismo
brasileiro escravo da lavoura no exerce qualquer outra
funo na fazenda.

Questo 78
O texto foi extrado da pea Trilo e Crssida de William
Shakespeare, escrita, provavelmente, em 1601.
Os prprios cus, os planetas, e este centro
reconhecem graus, prioridade, classe,
constncia, marcha, distncia, estao, forma,
funo e regularidade, sempre iguais;
eis porque o glorioso astro Sol
est em nobre eminncia entronizado
e centralizado no meio dos outros,
e o seu olhar benfazejo corrige
os maus aspectos dos planetas malfazejos,
e, qual rei que comanda, ordena
sem entraves aos bons e aos maus.
(personagem Ulysses, Ato I, cena III).
SHAKESPEARE, W. Trilo e Crssida. Porto: Lello &
Irmo, 1948.
A descrio feita pelo dramaturgo renascentista ingls se
aproxima da teoria
a) geocntrica do grego Claudius Ptolomeu.
b) da reflexo da luz do rabe Alhazen.
c) heliocntrica do polons Nicolau Coprnico.
d) da rotao terrestre do italiano Galileu Galilei.
e) da gravitao universal do ingls Isaac Newton.

Correlacionando-se os elementos que atuam na formao dos


solos, assinale a alternativa que CORRETAMENTE associa o
perfil de solo sua respectiva localizao no mapa.
a) X 1; Y 2; Z 3
b) X 2; Y 1; Z 3
c) X 3; Y 1; Z 2
d) X 2; Y 3; Z 1
e) X 1; Y 3; Z 2.

Simtrico Pr-Universitrio 1 Simulado Estilo ENEM 2010 www.simetrico.com.br

1 Simulado 2007 - Estilo UFC


1 Simulado 2010 Estilo ENEM
Prova de Conhecimentos Gerais

33

Questo 80
Analise as representaes cartogrficas.

(M. E. Simielli, Geoatlas, 2007)


Estas representaes so anamorfoses geogrficas. Uma anamorfose geogrfica representa a superfcie dos pases em reas
proporcionais a uma determinada quantidade.
As anamorfoses acima representam, respectivamente:
a) Nmero de turistas recebidos e Produto Nacional Bruto.
b) Produto Nacional Bruto e Populao.
c) Populao e Nmero de turistas recebidos.
d) Populao ativa na agricultura e Produto Nacional Bruto.
e) Populao e Populao ativa na agricultura

Questo 81
... todos os brasileiros, e, sobretudo os brancos, no percebem
suficientemente que tempo de se fechar a porta aos debates
polticos (...). Se continua a falar dos direitos dos homens, da
igualdade, terminar-se- por pronunciar a palavra fatal:
liberdade, palavra terrvel e que tem muito mais fora num Pas
de escravos que em qualquer outra parte.
(MOTA, Carlos Guilherme (org.). 1822: dimenses. So
Paulo: Perspectiva, 1972. p. 482.)
O texto acima, escrito provavelmente por volta de 1823/1824,
parte de uma carta sobre a independncia do Brasil, enviada por

um observador europeu a D. Joo VI. Leia com ateno o texto


e, a seguir, assinale a alternativa que expressa a configurao
social do processo brasileiro de independncia.
a) A democracia racial, decorrente de uma intensa
miscigenao durante o perodo colonial, contribuiu para
conciliar, logo nos primeiros anos do Imprio, os interesses
dos distintos grupos sociais.
b) A soluo monrquica, atravs da qual a jovem nao
optava por afastar-se de seus vizinhos americanos e adotar
modelos polticos europeus, foi historicamente necessria
como instrumento de conciliao das raas no Brasil.

Simtrico Pr-Universitrio 1 Simulado Estilo ENEM 2010 www.simetrico.com.br

34

1 Simulado 2010 Estilo ENEM

c) O haitianismo, temor da elite branca brasileira de que se


repetisse no Brasil uma revoluo negra, tal qual ocorrera no
Haiti, limitou as bases sociais da independncia e justificou
manifestaes como essa da carta transcrita.
d) Em razo de temores como aquele expresso na carta citada,
a independncia fez-se acompanhar de um processo
crescente de enfraquecimento da escravido. Os mesmos
grupos que lideraram o processo de independncia
liderariam, anos depois, a abolio da escravatura.
e) O temor expresso na carta infundado, pois alm de contar
com um nmero pequeno de escravos poca da
independncia, as relaes entre os escravos e seus
senhores, no Brasil, sempre foram cordiais, decorrendo
justamente disso a noo de democracia racial.

sculo XX, e era mais utilizada por alguns setores da


populao.
II. A tatuagem, de origem polinsia, difundiu-se no ocidente
com a caracterstica que permanece at hoje: utilizao
entre os jovens com funo estritamente esttica.
III. O texto mostra como a tatuagem uma prtica que se
transforma no tempo e que alcana inmeros sentidos nos
diversos setores das sociedades e para as diferentes
culturas.
Est correto o que se afirma apenas em
a) I
b) II
c) III
d) I e II
e) I e III

Questo 82
Nas favelas, o trfico supera as instituies; nessas
comunidades, a influncia do poder pblico torna as relaes de
poder, primitivas, at blicas. Leia o que afirma uma moradora
de favela no Rio de Janeiro:

Questo 84

a vantagem de viver aqui, no pagar aluguel e morar na zona


sul. A desvantagem pagar o IPTU mais caro do Rio, muito caro
mesmo: a violncia.
(O Globo, abril de 2001)
A relao sociedade/poder descrita acima, caracteriza-se pela:
a) ausncia do poder pblico, fruto de uma mera deficincia da
administrao estatal.
b) presena do poder pblico nesta comunidade quando
solicitada.
c) deficincia do poder pblico nestas comunidades tidas como
pouco relevantes socialmente.
d) adeso da prpria comunidade ao comando alternativo que
afasta o poder pblico.
e) estrutura de poder democrtico organizada pelas
associaes de moradores da comunidade.

Questo 83
"A palavra tatuagem relativamente recente. Toda a gente sabe
que foi o navegador Cook que a introduziu no Ocidente, e esse
escrevia tattou, termo da Polinsia de tatou ou tu tahou,
'desenho'.
(...) Desde os mais remotos tempos, vemo-la a transformarse:
distintivo honorfico entre uns homens, ferrete de ignomnia entre
outros, meio de assustar o adversrio para os bretes, marca de
uma classe de selvagens das ilhas marquesas (...) sinal de
amor, de desprezo, de dio (...). H trs casos de tatuagem no
Rio, completamente diversos na sua significao moral: os
negros,os turcos com o fundo religioso e o bando de meretrizes,
dos rufies e dos humildes, que se marcam por crime ou por
ociosidade".
RIO, Joo do. Os Tatuadores. Revista Kosmos. 1904, apud: A
alma encantadora das ruas, SP: Cia das Letras, 1999.
Com base no texto so feitas as seguintes afirmaes:
I. Joo do Rio revela como a tatuagem j estava presente na
cidade do Rio de Janeiro, pelo menos desde o incio do

A charge sugere que a independncia, em 1822, pode ser


descrita da seguinte forma:
a) O pas passou da dependncia econmica em relao a
Portugal subordinao em relao aos EUA e sofreu
profundas mudanas na estrutura social.
b) O pas manteve a dependncia econmica em relao a
Portugal, adquirindo liberdade poltica e social.
c) O pas passou da dependncia econmica em relao a
Portugal subordinao em relao Inglaterra, no
alterando sua estrutura social colonial.
d) O pas passou da dependncia econmica em relao a
Portugal subordinao em relao Frana, alterando sua
estrutura social colonial.
e) O pas manteve a dependncia econmica em relao a
Portugal e no modificou sua estrutura social colonial.

Questo 85
Um jornalista publicou um texto do qual esto transcritos trechos
do primeiro e do ltimo pargrafos:
" 'Mamezinha, minhas mozinhas vo crescer de novo?'
Jamais esquecerei a cena que vi, na TV francesa, de uma
menina da Costa do Marfim falando com a enfermeira que
trocava os curativos de seus dois cotos de braos. (...)"

Simtrico Pr-Universitrio 1 Simulado Estilo ENEM 2010 www.simetrico.com.br

1 Simulado 2007 - Estilo UFC


1 Simulado 2010 Estilo ENEM
Prova de Conhecimentos Gerais
"Como manter a paz num planeta onde boa parte da
humanidade no tem acesso s necessidade bsicas mais
elementares? (...) Como reduzir o abismo entre o campons
afego, a criana faminta do Sudo, o Severino da cesta
bsica e o corretor de Wall Street? Como explicar ao menino
de Bagd que morre por falta de remdios, bloqueados pelo
Ocidente, que o mal se abateu sobre Manhattan? Como
dizer aos chechenos que o que aconteceu nos Estados
Unidos um absurdo? Vejam Grozny, a capital da
Chechnia, arrasada pelos russos. Algum se incomodou
com os sofrimentos e as milhares de vtimas civis, inocentes,
desse massacre? Ou como explicar menina da Costa do
Marfim o sentido da palavra ' civilizao' quando ela
descobrir que suas mos no crescero jamais?".
UTZERI, Fritz. Jornal do Brasil, 17/09/2001.
Apresentam-se, abaixo, algumas afirmaes tambm retiradas
do mesmo texto. Aquela que explicita uma resposta do autor
para as perguntas feitas no trecho citado :
a) "tristeza e indignao so grandes porque os atentados
ocorreram em Nova Iorque".
b) "ao longo da histria, o homem civilizado globalizou todas as
suas mazelas".
c) "a Europa nos explorou vergonhosamente".
d) "o neoliberalismo institui o deus mercado que tudo resolve".
e) "os negcios das indstrias de armas continuam de vento
em popa".

35

Questo 87
"...diz Oliveira Lima que um oficial portugus jurou a um oficial
brasileiro que o Brasil continuaria escravo de Portugal e que o
prncipe embarcaria, mesmo que para isto, tivesse sua espada
de servir-lhe de prancha".
Fonte: LUSTOSA, Isabel. "Perfis Brasileiros: D. Pedro I". So
Paulo: Companhia das Letras, 2006. P. 132/133.
O episdio acima narrado refere-se ao famoso "Dia do Fico". Em
relao aos desdobramentos dele decorrentes, considere as
seguintes afirmativas:
I. A oficialidade portuguesa no se conformou com a deciso
de D. Pedro I de permanecer no Brasil. As tropas armadas
portuguesas saram dos quartis, armados de cassetetes,
insultando transeuntes e praticando desacatos.
II. Medidas para conter os desagravos das tropas portuguesas
no foram tomadas e contraditoriamente, D. Pedro I exigiu
que as mesmas permanecessem no Brasil e posteriormente
premiou as tropas, tornando-as sua guarda pessoal.
III. Instalou-se um clima de guerra com toda tropa de linha e
miliciana do pas. A estes se juntaram cidados de todas as
classes: roceiros, agregados, negros forros, escravos
dispostos a enfrentar a diviso portuguesa.
So corretas:
a) I, II e III.
b) apenas I e III.
c) apenas I e II.
d) apenas II e III.
e) apenas I.

Questo 86
Por que labutar no campo, na cidade? A mquina o far
por ns.
As relaes campo-cidade tm passado por grandes
transformaes no Brasil. Com relao a esse processo,
correto afirmar que:
a) A crescente modernizao das atividades agropecurias tem
liberado grandes contingentes de trabalhadores rurais que,
ao se dirigirem para as cidades, criam ncleos caipiras nas
reas urbanas.
b) foi, principalmente, a partir da segunda metade do sculo XX
que a economia rural tornou-se fornecedora de matriasprimas para as indstrias urbanas e consumidora de
mercadorias e servios urbanos.
c) medida que o processo de mecanizao da agricultura
concentrado nas reas de cultivos de exportao, tornam-se
mais evidentes o tradicionalismo do campo e o dinamismo
da cidade.
d) as diferenas socioculturais entre o mundo rural e o urbano
tm se acentuado medida que avana a revoluo tcnicocientfica e informacional nas cidades, principalmente do
Sudeste.
e) as estreitas ligaes entre o mundo rural e o urbano,
caractersticas da primeira metade do sculo XX, perderam
fora quando a modernizao da agricultura reduziu a
subordinao tcnica do campo em relao cidade.

Questo 88
Os efeitos abominveis das armas nucleares j foram sentidos
pelos japoneses h mais de 50 anos (1945). Vrios pases tm,
isoladamente, capacidade nuclear para comprometer a vida na
Terra. Montar o seu sistema de defesa um direito de todas as
naes, mas um ato irresponsvel ou um descuido pode
desestruturar, pelo medo ou uso, a vida civilizada em vastas
regies. A no-proliferao de armas nucleares importante.
No 1 domingo de junho de 98, ndia e Paquisto rejeitaram a
condenao da ONU, decorrente da exploso de bombas
atmicas pelos dois pases, a ttulo de teste nuclear e
comemoradas com festa, especialmente no Paquisto. O
governo paquistans (pas que possui maioria da populao
muulmana) considerou que a condenao no levou em conta
o motivo da disputa: o territrio de CAXEMIRA, pelo qual j
travaram 3 guerras desde sua independncia (em 1947, do
Imprio Britnico, que tinha o Subcontinente Indiano como
colnia). Dois teros da regio, de maioria muulmana,
pertencem ndia e 1/3 ao Paquisto.
Sobre o tempo e os argumentos podemos dizer de modo
verdadeiro que:
a) a bomba atmica no existia no mundo antes de o Paquisto
existir como pas.
b) a fora no tem sido usada para tentar resolver os
problemas entre Paquisto e ndia.
c) Caxemira tornou-se um pas independente em 1947.

Simtrico Pr-Universitrio 1 Simulado Estilo ENEM 2010 www.simetrico.com.br

36

1 Simulado 2010 Estilo ENEM

d) os governos da ndia e Paquisto encontram-se numa


perigosa escalada de soluo de problemas pela fora.
e) diferentemente do sculo anterior, no incio do sculo XX, o
Imprio Britnico no tinha mais expresso mundial.

Questo 89
Michel Eyquem de Montaigne (1533-1592) compara, nos
trechos, as guerras das sociedades Tupinamb com as
chamadas "guerras de religio" dos franceses que, na segunda
metade do sculo XVI, opunham catlicos e protestantes.
" (...) no vejo nada de brbaro ou selvagem no que dizem
daqueles povos; e, na verdade, cada qual considera brbaro o
que no se pratica em sua terra. (...) No me parece excessivo
julgar brbaros tais atos de crueldade [o canibalismo] , mas que
o fato de condenar tais defeitos no nos leve cegueira acerca
dos nossos. Estimo que mais brbaro comer um homem vivo
do que o comer depois de morto; e pior esquartejar um homem
entre suplcios e tormentos e o queimar aos poucos, ou entreglo a ces e porcos, a pretexto de devoo e f, como no
somente o lemos mas vimos ocorrer entre vizinhos nossos
conterrneos; e isso em verdade bem mais grave do que assar
e comer um homem previamente executado. (...) Podemos
portanto qualificar esses povos como brbaros em dando
apenas ouvidos inteligncia, mas nunca se compararmos a
ns mesmos, que os excedemos em toda sorte de
barbaridades."
MONTAIGNE, Michel Eyquem de, Ensaios, So Paulo:
Nova Cultural, 1984.

Causas de expulso:
- Liberao de mo-de-obra pela mecanizao
Causas de atrao:
- Oferta de empregos urbanos
Conseqncias:
- Urbanizao integrada; aumento de populao
secundria e terciria
Pases subdesenvolvidos
Causas de expulso:
- Presso demogrfica no campo
Causas de atrao:
- Fascnio urbano
Conseqncias:
(?)
Com base no texto anterior, assinale a alternativa que descreve
corretamente as "conseqncias" para os pases
subdesenvolvidos:
a) Urbanizao anmala, cinturo marginal, subemprego no
setor tercirio.
b) Urbanizao integrada provocando um cinturo marginal
mesmo com o crescimento dos empregos na indstria e nos
servios.
c) Urbanizao anmala, depois integrada, devido s polticas
econmicas adotadas revertendo a situao de fascnio
urbano.
d) Crescimento lento da populao urbana devido ao processo
de industrializao recente.
e) Absoro do excedente populacional do campo pelo
moderno e crescente setor tercirio.

De acordo com o texto, pode-se afirmar corretamente que, para


Montaigne,
a) a idia de relativismo cultural baseia-se na hiptese da
origem nica do gnero humano e da sua religio.
b) a diferena de costumes no constitui um critrio vlido para
julgar as diferentes sociedades.
c) os indgenas so mais brbaros do que os europeus, pois
no conhecem a virtude crist da piedade.
d) a barbrie um comportamento social que pressupe a
ausncia de uma cultura civilizada e racional.
e) a ingenuidade dos indgenas equivale racionalidade dos
europeus, o que explica que os seus costumes so
similares.

Questo 90
Nos pases subdesenvolvidos a migrao campo-cidade
apresenta determinadas causas e conseqncias como mostra o
quadro a seguir.

Pases desenvolvidos
Simtrico Pr-Universitrio 1 Simulado Estilo ENEM 2010 www.simetrico.com.br

GABARITO PROVA 1
CINCIAS DA NATUREZA E SUAS TECNOLOGIAS
01
E
16
D
31
C

02
C
17
D
32
B

03
E
18
D
33
NULA

04
C
19
D
34
D

05
D
20
E
35
C

06
E
21
E
36
E

07
B
22
C
37
C

08
B
23
E
38
D

09
D
24
D
39
C

10
D
25
B
40
B

11
B
26
D
41
E

12
A
27
C
42
D

13
A
28
B
43
E

14
A
29
B
44
C

15
D
30
D
45
E

57
C
72
D
87
B

58
D
73
A
88
D

59
D
74
E
89
B

60
D
75
A
90
A

CINCIAS HUMANAS E SUAS TECNOLOGIAS


46
D
61
A
76
D

47
C
62
D
77
B

48
B
63
A
78
C

49
B
64
B
79
A

50
C
65
C
80
B

51
E
66
D
81
C

52
E
67
A
82
C

53
D
68
C
83
E

54
D
69
D
84
C

55
B
70
E
85
B

56
D
71
B
86
B

SIMTRICO PR-UNIVERSITRIO DPTO DE VESTIBULARES