Vous êtes sur la page 1sur 20

16CBSVMLR1

16BIOMLR1

STL CBSV et spcialit biotechnologies

Lusage de la calculatrice est autoris.

Ds que les sujets vous sont remis, assurez-vous quils sont complets.

Les sujets de CBSV et de biotechnologies seront traits sur des copies


spares.

Dure totale de lpreuve: 4 heures

LUNDI 20 JUIN 2016


_____

CBSV : sous preuve coefficient 4


Biotechnologies : sous preuve coefficient 4

SESSION 2016

Srie : STL
Spcialit biotechnologies

BACCALAURAT TECHNOLOGIQUE

BACCALAURAT TECHNOLOGIQUE
Srie : Sciences et Technologies de Laboratoire
Spcialits : - Biotechnologies

- Sciences physiques et chimiques


en laboratoire
SESSION 2016

Sous-preuve crite de
Chimie biochimie sciences du vivant
LUNDI 20 JUIN 2016
Coefficient de cette sous-preuve : 4
Ce sujet est prvu pour tre trait en deux heures.

Les sujets de CBSV et de spcialit seront traits


sur des copies spares.
Lusage de la calculatrice est autoris.
Ce sujet comporte 9 pages.

Partie 1 : pages 2 4
Partie 2 : pages 5 9
Les 2 parties sont indpendantes.

16CBSVMLR1

Page : 1/9

Partie I : les digesteurs de boues (8 points)


Lexcdent des boues issues des stations dpuration peut tre limin dans des digesteurs
de boues.
Lobjectif de cette tude est de comprendre comment certaines voies mtaboliques
dorganismes vivants sont exploites par ltre humain pour valoriser les boues
excdentaires des stations dpuration.
Le document A montre un des microorganismes prsents dans un digesteur de boues.
1.1.

Dterminer le moyen dobservation qui a permis dobtenir la photographie du


document A, en argumentant la rponse.

Fonctionnement des digesteurs de boues


1.2.

partir du document B, construire le schma reprsentant la chane trophique dun


digesteur de boues correspondant aux trois tapes du fonctionnement. Pour chaque
tape prciser les groupes de microorganismes responsables et les molcules
produites.

tude dune voie de mthanogense


La plupart des mthanognes sont des organismes hydrognotrophes qui produisent du
mthane par rduction du dioxyde de carbone en prsence de dihydrogne comme agent
rducteur. La voie mtabolique simplifie de cette mthanogense est prsente dans le
document C.
1.3.

Aprs avoir recopi sur la copie les molcules A, B et C du document C, entourer


les groupes caractristiques et identifier les fonctions chimiques correspondantes
pour chacune des molcules.

1.4.

Chacune de ces quatre tapes est une rduction. Argumenter cette affirmation dans
le cas de ltape 2.

1.5.

tablir lquation de la raction doxydorduction de ltape 1 entre le dioxyde de


carbone et le dihydrogne.

On donne les couples :


CO2 / HCO2H
H+ / H2
1.6.

Donner la condition ncessaire sur lenthalpie libre apparente de raction rG pour


que cette raction soit favorise dans les conditions biologiques (pH = 7 et 37C).

16CBSVMLR1

Page : 2/9

Document A : exemple de microorganisme mthanogne : Methanopyrus kandleri

Moyen dobservation

il humain

Microscope
photonique

Microscope
lectronique
transmission

Pouvoir de rsolution

0,2 mm

0,2 m

2 nm

Document B : fonctionnement des digesteurs de boues


Un digesteur de boues dsigne une enceinte hermtique dans laquelle des
microorganismes anarobies vont salimenter des matires organiques contenues dans
les boues.
On peut schmatiquement distinguer trois tapes dans le fonctionnement dun digesteur
de boues. Chaque tape est ralise par un groupe diffrent de microorganismes en
l'absence de dioxygne. Agissant en interaction et de faon complmentaire d'un point
de vue mtabolique, ces diffrents microorganismes forment une vritable chane
trophique en anarobiose.
Dans un premier temps, les matires organiques complexes contenues dans les boues
subissent des fermentations assures par des microorganismes fermentaires. Ces
fermentations librent notamment une grande varit d'acides organiques et d'alcools.
Dans un second temps, le groupe des microorganismes actognes permet la
transformation des divers composs issus de la phase prcdente en prcurseurs
directs du mthane : lacide actique CH3COOH, le dioxyde de carbone CO2 et le
dihydrogne H2.
Les microorganismes mthanognes assurent la troisime et dernire tape de la
digestion des boues qui aboutit la production de mthane CH4 gaz combustible utilis
par ltre humain comme source dnergie. Il existe deux voies possibles de
mthanogense :
lune partir du dihydrogne H2 et du dioxyde de carbone CO2
l'autre partir de lacide actique CH3COOH.

16CBSVMLR1

Page : 3/9

Document C : voie mtabolique simplifie de la mthanogense par rduction du CO2

16CBSVMLR1

Page : 4/9

Partie 2 : tude dun traitement enzymatique du glaucome (12 points)


Le glaucome est une pathologie qui touche lil. Il se manifeste par une dgnrescence
progressive du nerf optique pouvant aller jusqu la ccit. Lun des signes de la maladie
est une augmentation de la pression de lhumeur aqueuse de lil (appele aussi pression
intraoculaire), ce qui entrane la destruction du nerf optique par compression.

On cherche comprendre une voie de traitement dune forme de glaucome.

Le document D prsente lhumeur aqueuse et son renouvellement.


Le document E est une coupe transversale de la partie antrieure de lil.
2.1.

mettre deux hypothses permettant dexpliquer laugmentation de la pression


intraoculaire, responsable de lapparition dun glaucome.

Origine gntique dune forme de glaucome


La myociline est une protine prsente au niveau du trabculum. Des mutations dans le
gne codant la myociline sont associes une pression intraoculaire leve et au
dveloppement dune certaine forme de glaucome. La myociline code par lallle mut
perturbe le fonctionnement du trabculum (document F).
2.2.

laide des connaissances et du tableau du code gntique fourni en annexe,


donner les deux chanes polypeptidiques correspondant respectivement aux
squences de lallle de rfrence et de lallle mut du gne.

2.3.

Formuler une hypothse sur une des consquences possibles de la mutation sur la
structure de la chane polypeptidique de myociline.

2.4.

Proposer une explication au fait que la myociline mute intervient dans


laugmentation de la pression intraoculaire.

2.5.

Conclure sur la rgion de lil implique dans laugmentation de la pression


intraoculaire pour cette forme de glaucome.

16CBSVMLR1

Page : 5/9

Une voie de traitement du glaucome


Pour limiter lvolution de cette pathologie, un traitement est possible en utilisant une
molcule qui inhibe laction de lanhydrase carbonique, lenzyme responsable de la
synthse de lacide carbonique. Celle-ci catalyse la raction suivante :
CO2 + H2O

H2CO3

Lacide carbonique (H2CO3), produit au cours de cette raction, se dissocie en milieu


aqueux pour donner lion hydrognocarbonate (HCO3).
2.6.

crire lquation de la raction acide-base entre lacide carbonique et leau.

Lactivit de lanhydrase carbonique aboutit lapparition dions hydrognocarbonate dans


lhumeur aqueuse.
La scrtion de lhumeur aqueuse met en jeu des phnomnes osmotiques : des changes
de matire entre le plasma et lhumeur aqueuse se font au travers dune barrire semipermable.
2.7.

Interprter les observations exprimentales donnes dans le document G relatif


une modlisation simple des phnomnes osmotiques.

2.8.

Mettre en lien la production dions hydrognocarbonate dans lhumeur aqueuse et le


volume de celle-ci.

Le dorzolamide est un inhibiteur de lanhydrase carbonique utilis pour limiter la pression


intraoculaire. Le document H prsente le mode daction de cet inhibiteur sur lenzyme.
2.9.

Indiquer leffet de linhibiteur sur lactivit catalytique de lanhydrase carbonique.

2.10. Expliquer en quoi laction du dorzolamide provoque une baisse de la pression


intraoculaire.

16CBSVMLR1

Page : 6/9

Document D : lhumeur aqueuse et son renouvellement


Lhumeur aqueuse est un milieu aqueux transparent situ dans la partie antrieure de lil.
Elle est indispensable pour assurer une bonne vision. Le renouvellement de lhumeur
aqueuse est assur par deux processus : une scrtion partir du plasma sanguin par les
corps ciliaires, et une limination par le trabculum.
La pression intraoculaire dpend du volume de lhumeur aqueuse situe entre le cristallin
et la corne.

Document E : coupe transversale de la partie antrieure de lil

2015

1092

Document F : portion des squences des brins transcrits de lallle de rfrence et de


lallle mut du gne codant la myociline

Allle de rfrence

CCCATAGTGCCTGTTAAAGGGATG

Allle mut

CCCATAGTGCCTATTAAAGGGATG

16CBSVMLR1

Page : 7/9

Document G : exprience mettant en vidence le principe de losmose

Ci : concentration en solut S
C2 < C3 < C1

Le volume total de solution dans le tube en U est constant.

Document H : mode daction du dorzolamide sur lanhydrase carbonique

Daprs : Campbell, Biology : Concepts and Connections (7e dition)

16CBSVMLR1

Page : 8/9

Annexe : tableau du code gntique

16CBSVMLR1

Page : 9/9

BACCALAURAT TECHNOLOGIQUE
Srie : Sciences et Technologies de Laboratoire
Spcialit :

Biotechnologies

SESSION 2016
LUNDI 20 JUIN 2016

Sous-preuve crite de Biotechnologies


Coefficient de la sous-preuve : 4
Ce sujet est prvu pour tre trait en deux heures.

Les sujets de CBSV et de biotechnologies seront traits


sur des copies spares.

Lusage de la calculatrice est autoris.

Ce sujet comporte 10 pages.

16BIOMLR1

Page : 1/10

PRODUCTION DINSULINE PAR GENIE GENETIQUE


Le diabte de type 1 est d la destruction de cellules du pancras endocrine qui produisent une
hormone polypeptidique hypoglycmiante : linsuline. Les personnes atteintes de diabte, et
prsentant un dfaut de production dinsuline, doivent recourir des injections de cette hormone
pour rguler leur glycmie.
Historiquement, linsuline utilise en thrapeutique a dabord t extraite de pancras de porc et de
buf. La demande de plus en plus importante dinsuline au niveau mondial et le risque sanitaire
associ lutilisation de produits animaux ont conduit mettre en place des techniques de
production dinsuline par gnie gntique.
Linsuline humaine est maintenant produite partir de souches bactriennes dEscherichia coli
transformes par un plasmide recombinant contenant le gne codant le prcurseur de linsuline
(proinsuline).
On se propose dtudier les diffrentes tapes de la production de linsuline humaine par gnie
gntique afin de valider les choix raliss au cours de la mise en place du procd :
- obtention dune souche dEscherichia coli recombinante ;
- optimisation de la culture de la souche slectionne ;
- purification de linsuline humaine produite ;
- dosage de linsuline humaine purifie.

1. OBTENTION DUNE BACTERIE RECOMBINANTE


1.1.

Construction du plasmide recombinant

Afin dobtenir un plasmide recombinant, le gne codant le prcurseur de linsuline (proinsuline) est
insr dans le plasmide pBR322 au niveau du site de restriction de lenzyme BamH1.
Le document 1 prsente la carte de restriction simplifie du plasmide natif pBR322. La construction
du plasmide et la slection des clones recombinants sont prsentes dans le document 2.
Q1. A laide du document 1, indiquer les lments justifiant lutilisation du plasmide pBR322 en
gnie gntique.
Q2. Raliser un schma annot du plasmide recombinant.
Q3. A laide des documents 1 et 2, argumenter lintrt de lutilisation de lenzyme BamH I plutt
que lutilisation des enzymes EcoR I et Hind III, pour la construction du plasmide recombinant.

1.2.

Transformation bactrienne et slection de clones de bactries recombinantes

Le document 2 prsente les diffrents rsultats possibles obtenus aprs transformation de la


souche dEscherichia coli. Quatre types de clones bactriens A, B, C et D peuvent tre obtenus.
Q4. Argumenter le caractre sensible ou rsistant de chaque type de clones A, B, C et D vis--vis
de lampicilline et de la ttracycline.

Le document 3 prsente les rsultats de la slection des clones de bactries recombinantes aprs
culture sur des milieux gloss additionns dantibiotiques.
Q5. partir des documents 2 et 3, identifier par leur numro les colonies correspondant au clone
de type A.
Q6. En dduire le numro des colonies de bactries transformes par le plasmide recombinant.
16BIOMLR1

Page : 2/10

2. OPTIMISATION DE LA CULTURE DE LA SOUCHE SELECTIONNE


Dans le but doptimiser la culture dun clone recombinant, un suivi de croissance dans deux milieux
M1 et M2 est ralis 37 C en arobiose.
Le document 4 prsente les courbes de croissance de ce clone dans ces deux milieux dont la
composition est donne.
Q7. Dterminer la dure de la phase de latence dans ces deux milieux.

La vitesse spcifique de croissance en phase exponentielle


par lquation aux grandeurs suivante :

expo

(=

) peut tre dtermine

ln X 2 ln X 1
t2 t1

Q8. Dterminer la vitesse spcifique de croissance en phase exponentielle exprime en min-1, dans
les milieux M1 et M2.
Q9. laide de la composition des milieux M1 et M2, expliquer les diffrences de rsultats
concernant la dure de la phase de latence et la vitesse spcifique de croissance.
Q10. En dduire le milieu permettant une croissance optimale du clone dE. coli . Argumenter la
rponse.

3. PURIFICATION DE LINSULINE PRODUITE PAR LA BACTERIE RECOMBINANTE


Linsuline humaine est synthtise sous forme de proinsuline par le clone slectionn. Une tape de
lyse bactrienne libre la proinsuline, laquelle subit un traitement enzymatique qui conduit la
production dinsuline mature.

Proinsuline
86 acides
amins

Traitement
enzymatique

Insuline mature + Peptide C + 4 Acides amins libres


51 acides
amins

31 acides
amins

Le mlange obtenu est ensuite dpos sur une colonne de chromatographie en vue de la
purification de linsuline mature.
Le document 5 prsente le schma de principe de cette chromatographie et les caractristiques
des diffrents types de gels Sephadex G utiliss pour la sparation des molcules.
Q11. Exploiter le document 5 pour dgager le principe de sparation des molcules par cette
mthode chromatographique.
Q12. Sachant quun acide amin a une masse molculaire denviron 100 daltons (Da), calculer la
masse molculaire approximative de linsuline mature et du peptide C.

Q13. Choisir le gel Sephadex le plus adapt la purification de linsuline mature. Argumenter la
rponse.

16BIOMLR1

Page : 3/10

4. DOSAGE DE LINSULINE HUMAINE PURIFIEE


Linsuline humaine ainsi purifie est dose par une technique immuno-enzymatique dont le principe
est prsent dans le document 6.
Q14. laide des symboles fournis dans la lgende, schmatiser ldifice molculaire obtenu en fin
de la raction immuno-enzymatique dans une cupule contenant linsuline.
Q15. Expliquer pourquoi labsorbance mesure 450 nm est proportionnelle la concentration en
insuline prsente dans lchantillon.
SYNTHESE
Q16. Raliser un organigramme des quatre tapes principales de production de linsuline humaine
en y intgrant les choix retenus pour loptimisation du procd.

16BIOMLR1

Page : 4/10

DOCUMENT 1 Carte de restriction simplifie du plasmide pBR322


Pour tre utilisable en gnie gntique, un plasmide doit contenir une origine de rplication lui
permettant une rplication autonome dans la cellule, au moins un gne de slection destin
discriminer les clones recombinants et des sites de restriction permettant son remodelage.

Gne amp R : gne de rsistance lampicilline

Gne tet

ori : origine de rplication

BamH I, EcoR I, Hind III : sites de restriction spcifiques de chaque enzyme de restriction

: gne de rsistance la ttracycline

Remarque : Un gne nest traduit en protine que lorsquil est sous sa forme continue, non
interrompue.

16BIOMLR1

Page : 5/10

DOCUMENT 2 Obtention dun clone recombinant


Construction du plasmide, transformation et slection des clones recombinants

Caractristiques des 4 types de clone transforms


Type A

Type B

Type C

Type D

Rsistance
lampicilline

oui

oui

non

non

Rsistance la
ttracycline

oui

non

non

non

16BIOMLR1

Page : 6/10

DOCUMENT 3 - Reprsentation schmatique de la slection des clones

Rplique par
empreinte

4
6

6
10

7
11

12

10

12

Bote n1

Bote n2

Milieu additionn
dampicilline

Milieu additionn
dampicilline
et de ttracycline

Lgende
: colonie bactrienne dE.coli

16BIOMLR1

Page : 7/10

DOCUMENT 4 - Culture dun clone recombinant dans deux milieux


Composition des milieux M1 et M2

Milieu M1 (bouillon nutritif)

Milieu M2 (bouillon cur-cervelle)

Peptones
Extrait de viande
Chlorure de sodium
Eau

Ajust pH 7,2

Peptones
Extrait cur-cervelle
Chlorure de sodium
Glucose
Phosphate disodique
Eau
Ajust pH 7,4

Courbes de croissance dans les milieux M1 et M2

MILIEU M2

MILIEU M1

Temps (minutes)
Lgende : X = biomasse

16BIOMLR1

Page : 8/10

DOCUMENT 5 - Chromatographie par gel-filtration


Schma de principe
Dans ce type de chromatographie, la phase stationnaire est compose de billes de gel poreuses ; la
phase mobile est une solution tampon dont le flux entrane les molcules sparer.

Caractristiques de tamisage molculaire de trois gels


Type de gel

0 1 500

1 000 5 000

5 000 800 000

Sephadex G15
Sephadex G25
Sephadex G200

16BIOMLR1

Intervalle de masses molculaires des


composs ralentis par le gel (Da)

Page : 9/10

DOCUMENT 6 - Principe du dosage immuno-enzymatique de linsuline


Ce dosage est bas sur la reconnaissance simultane de linsuline humaine par deux anticorps.
Dans une microplaque, sont ajouts successivement :

le premier anticorps anti-insuline ;

le milieu contenant linsuline doser ;

le second anticorps anti-insuline, qui est coupl la peroxydase ;

le substrat incolore TMB.

Chacune des tapes est suivie de lavages.


La peroxydase catalyse la raction de transformation du TMB en un produit color qui absorbe
450 nm. Lintensit de la couleur est proportionnelle la concentration en insuline prsente dans
lchantillon.
Les diffrents acteurs intervenant dans ce dosage sont schmatiss dans la lgende ci-dessous :
Symbole

Signification
Cupule de microplaque

Insuline humaine

Anticorps anti-insuline humaine fix au fond des cupules

Anticorps anti-insuline humaine coupl la peroxydase

Substrat
Produit
color

16BIOMLR1

Raction catalyse par la peroxydase

Page : 10/10