UNIVERSIDADE ESTADUAL DE CAMPINAS

FACULDADE DE ODONTOLOGIA DE PIRACICABA

Cindy Goes Dodo

O efeito de partculas de titnio na osseointegrao

The effect of titanium particles on the osseointegration

Piracicaba
2016

CINDY GOES DODO

O efeito de partculas de titnio na osseointegrao.

The effect of titanium particles on the osseointegration.

Tese apresentada Faculdade de
Odontologia de Piracicaba da Universidade
Estadual de Campinas como parte dos
requisitos exigidos para a obteno do ttulo de
Doutora em Clnica Odontolgica, rea de
concentrao em Prtese Dental
Thesis presented to the Piracicaba
Dental School of the University of Campinas
in partial fulfillment of the requirements for the
degree of Doctor in Dental Clinic, in Dental
Prosthesis area

Orientador: Altair Antoninha Del Bel Cury

ESTE
EXEMPLAR
CORRESPONDE VERSO FINAL
DA TESE DEFENDIDA PELA ALUNA
CINDY GOES DODO, E ORIENTADA
PELA
PROFA.
DRA.
ALTAIR
ANTONINHA DEL BEL CURY

Piracicaba
2016

DEDICATRIA

Dedico esta tese minha famlia, por todo amor, apoio e incentivo
para a concluso deste trabalho.

Agradecimento Especial
minha orientadora, Profa. Dra. Altair Antoninha Del Bel Cury pela
confiana, dedicao e pacincia durante minha formao. Sou extremamente grata
por acreditar na minha capacidade, por me estimular e por tentar incansavelmente
extrair todo meu potencial. Certamente levarei seu exemplo profissional e humano
para toda a minha vida.

Agradecimentos
A Deus, a quem sou grata por esta jornada, onde tenho a oportunidade de
evoluir e aprender.
A Universidade Estadual de Campinas por meio do seu magnfico Reitor,
Prof. Dr. Jos Tadeu.
A Faculdade de Odontologia de Piracicaba da Universidade Estadual de
Campinas, na pessoa de seu Diretor, Prof. Dr. Guilherme Elias Pessanha
Henriques.
A Coordenadora dos Cursos de Ps-Graduao da Faculdade de
Odontologia de Piracicaba, Profa. Dra. Cnthia Pereira Machado Tabchoury.
A Coordenadora do Programa de Ps-Graduao em Clnica Odontolgica
da Faculdade de Odontologia de Piracicaba da Universidade Estadual de Campinas,
Prof. Dra. Karina Gonzales Silvrio Ruiz.
A Fundao de Amparo Pesquisa do Estado de So Paulo, FAPESP, pelas
bolsas de estudo de Mestrado (2011/16318-8), Doutorado Direto (2013/19791-8) e
Estgio Pesquisa no Exterior (BEPE, 2014/10085-6) na Universidade de Rochester,
NY, Estados Unidos da Amrica.
A Universidade de Rochester, por meio do magnfico Reitor Dr. Joel Seligman
e ao Diretor da Faculdade de Medicina e Odontologia Dr. Mark B. Taubman pela
oportunidade do estgio.
Ao Prof. Dr. Luiz Meirelles e sua famlia pela amizade, convivncia e
confiana. Agradeo ao Professor pelas inmeras oportunidades de aprendizado
durante meu estgio no Eastman Institute for Oral Health sob sua orientao. Seu
desempenho como professor e pesquisador inspirador.
Aos professores Profa. Dra. Jacqueline Abranches e Prof. Dr. Jos Lemos
por me receberem em seu laboratrio para o desenvolvimento de parte deste trabalho.

Aos docentes da rea de Prtese Dentria da Faculdade de Odontologia de
Piracicaba, Prof. Dr. Guilherme Elias Pessanha Henriques, Prof. Dr. Marcelo
Ferraz Mesquita, Prof. Dr. Mauro Antnio de Arruda Nbilo, Prof. Dr. Rafael
Leonardo Xediek Consani e Prof. Valentim Adelino Ricardo Baro por
contriburem com minha formao pessoal e profissional ao longo da ps-graduao.
Aos Professores da rea de Prtese Parcial Removvel, Profa. Dra. Clia
Rizatti Barbosa, Prof. Dra. Renata Cunha Matheus Rodrigues Garcia, e Prof. Dr.
Wander Jos da Silva pelo conhecimento compartilhado, boa convivncia, carinho e
ateno.
A todos os docentes do Programa de Ps-Graduao em Clnica Odontolgica
da Faculdade de Odontologia de Piracicaba, Universidade Estadual de Campinas, que
de alguma forma contriburam para meu aprendizado e crescimento profissional.
A Sra. Eliete Lima secretria da rea de Prtese pelo carinho, ateno e
disponibilidade.
A Sra. Gislaine Piton, tcnica do Laboratrio de Prtese Parcial Removvel,
por cuidar com tanto carinho e dedicao do nosso laboratrio e alunos.
A rea de Periodontia pela oportunidade de utilizar o laboratrio de Biologia
Molecular para o desenvolvimento deste trabalho, em especial Profa. Dra. Karina
Gonzalez.
Aos Professores Prof. Dr. Marcelo Mesquita, Prof. Dr. Valentim Baro,
Profa. Dra. Fernanda Faot, pela solicitude e bons conselhos.
Aos tcnicos Sr. Adriano Martins, Sra. Eliene Navares, Sra. Mariana
Lazarin, pela disponibilidade e aprendizado.
A todos amigos e colegas de ps-graduao pela convivncia agradvel,
aprendi e me diverti muito com todos vocs. Em especial agradeo aos amigos Plinio
Mendes Senna, Antonio Pedro Ricomini, Bruno Salles Sotto-Maior, Marcele
Pimentel Jardim, Indira Cavalcanti, Germana de Villa Camargos, Priscilla
Cardoso Lazari, Isabella Marques, Claudia Brilhante, Paula Bavia, Lis Meirelles,
Ana Paula Martins, Marco Aurlio de Carvalho, Giselle Ribeiro, Camila Heitor,
Larissa Vila Nova, Guilherme Henrique Oliveira, Thais Veja Gonalves, Bruna

Alfenas, Dimorvan Bordin e Edmara Tatiely Pedroso Bergamo que colaboraram
em muitos sentidos para o desenvolvimento deste trabalho, seja compartilhando
conhecimento, corrigindo um documento, me aconselhando ou simplesmente me
ouvindo.
As minhas queridas amigas Thatiana de Vicente Leite, Caroline Hanada
Odo, Pamela Saporski, Polliane Sciliano, Izabella Patta Pereira, Mabelle
Monteiro, Sthefanie Furlan, Ana Carolina Horita, Larissa Resende, Carolina
Ventura Beatriz Porto, e Nbia Pini, por me apoiarem e me darem foras para
sempre seguir em frente.
A toda a minha Famlia por me apoiar incondicionalmente em todas as minhas
decises, por ser minha base e minha estrutura. Este trabalho no teria se
concretizado sem a ajuda de cada um de vocs.

Resumo
Tratamentos de superfcie em implantes dentais de titnio tm sido desenvolvidos
para aumentar a rugosidade de superfcie e consequentemente melhorar a
osseointegrao. Apesar do sucesso clnico dos implantes dentais, em muitos casos
pode ocorrer perda ssea marginal e o mecanismo relacionado a este processo no
est claro na literatura. Alguns estudos descrevem que, durante a insero do
implante no osso, os picos criados para produzir superfcies rugosas, podem se
quebrar em micro e/ou nanopartculas de titnio, que so liberadas no tecido periimplantar e podem levar a perda ssea. O sistema imune reage na presena dessas
partculas, sendo os macrfagos a primeira linhagem celular a entrar em contato com
essas partculas. Um processo inflamatrio exacerbado pode ser gerado, levando a
produo de citocinas pro-inflamatrias ligadas ao processo osteoltico. Portanto, para
avaliar a resposta inflamatria de macrfagos, um estudo in vitro (Estudo 1) foi
desenvolvido cultivando clulas THP-1 na presena de micro e nanopartculas de
titnio em associao com Lipopolissacrido de Porphyromonas gingivalis (LPS PG),
patgeno comum da microbiota oral, durante 12 h, 24, 48h. Foram avaliadas as
citocinas pr-inflamatrias TNF-, IL1-, IL-6 que esto relacionadas com o processo
osteoltico, quanto a expresso gnica pelo mtodo Cq e Elisa. Os dados foram
analisados usando anlise de varincia com dois fatores e teste de Tukey (p <0,05).
De acordo com os resultados a presena de micro e nanopartculas titnio a expresso
gnica e a produo de citocinas pr-inflamatrias aumentou em comparao ao
controle, e a associao de partculas de titnio e LPS PG no aumentou a expresso
gnica e a produo de citocinas comparado com os grupos tratados somente com
partculas de titnio. Tambm para avaliar a reao ssea na presena de partculas
de titnio um estudo in vivo (estudo 2) foi realizado com 14 coelhos New Zealand.
Implantes com superfcie lisa foram inseridos na tbia com 3 mg de micropartculas de
titnio e no fmur com 1 mg de micropartculas dos animais, em ambas as pernas. Os
dados foram analisados por regresso de modelo misto (p <0,05). Aps 7 e 28 dias
uma diminuio no contato osso/implante no grupo com partculas em relao ao
controle foi observado pelas anlises histolgica e histomorfomtrica. Alm disso, 6
animais receberam 12 implantes na tbia para avaliar a expresso gnica de fatores
pr-osteognicos e foi observado que aps 7 dias houve diminuio desses fatores
para os grupos com partculas comparado ao controle. Pode-se concluir que partculas
de titnio afetam os estgios iniciais da osseointegrao.
Palavras-Chave: Implante dentrio, Citocinas, Reabsoro ssea, Ostelise.

Abstract
Dental implant surface treatments are being developed in order to increase roughness
and consequently improve chemotaxis to optimize osseointegration. Despite the
clinical success of dental implants, it is known that in many cases, marginal bone loss
occurs in the peri-implant area and the mechanism related to this process is not clear
in the literature. Some studies described that during implant insertion the peaks created
to produce rougher surfaces, are prone to break and micro and nanoparticles of
titanium are released in the peri-implant tissue culminating in an osteolytic process.
The immune system reacts against the shed particles and the macrophages are the
first cell linage interacting with titanium particles stimulating an inflammatory process
that can overproduce cytokines, leading to bone resorption. In order to evaluate
inflammatory response by macrophages, an in vitro study (Study 1) was developed
culturing THP-1 cell linage in the presence of micro and nanoparticles of titanium in
association with Lipopolysaccharide from Porphyromonas gengivalis (LPS PG) for
12h, 24 and 48h and pro-inflammatory cytokines related to the osteolytic process TNF, IL1-, IL-6 were evaluated. Gene expression was analyzed using Cq method and
Elisa comparing to the standard curve, the data were analyzed using ANOVA two-way
and Tukeys test (p<0.05). As results it was observed that in the presence of micro and
nanoparticles of titanium gene expression and protein production were increased
compared to control, and the association of titanium particles and LPS PG did not
increase gene expression and protein production compared to groups treated with
titanium particles. Also to assess bone reaction in the presence of titanium
microparticles an animal study (Study 2) was performed with 14 New Zealand White
Rabbits, implants with turned surface were placed in tibia with 3mg of microparticles of
titanium and femur using 1mg of microparticles of titanium in both legs of the animals.
Data were analyzed using regression mixed model (p<0.05). After 7 and 28 days bone
contact decreases in test group compared to control by histological and
histomorphometric analysis. Moreover, 6 animals received 12 implants in tibia to
evaluate the main osteogenic genes and after 7 days a decrease in the expression
was observed. Conclusively the presence of titanium particles affects early stages of
osseointegration.
Keywords: Dental Implants, Cytokines, Osteolysis, Bone resorption

SUMRIO

1 INTRODUO ....................................................................................................... 16
2 ARTIGOS ............................................................................................................... 21
2.1 PRO-INFLAMMATORY ANALYSIS OF HUMAN MACROPHAGE IN CONTACT WITH TITANIUM
MICRO/NANOPARTICLES AND PORPHYROMONAS GINGIVALIS

.................................................. 21

2.2 ARTIGO: TITANIUM PARTICLES AFFECT EARLY STAGES OF OSSEOINTEGRATION ............... 41

3 DISCUSSO .......................................................................................................... 57
4 CONCLUSO ........................................................................................................ 61
REFERNCIAS ......................................................................................................... 62

16

1 INTRODUO
O titnio e suas ligas tem sido utilizados como implantes, na rea
ortopdica e odontolgica, devido ao benefcio de suas propriedades qumicas e
mecnicas (Albrektsson and Sennerby, 1990a). Uma camada estvel de xidos se
forma quando o titnio exposto ao oxignio e essa camada hidroflica confere
biocompatibilidade a superfcie (Neoh et al., 2012). A osseointegrao o contato
direto entre osso vital e a superfcie de um implante de titnio submetido carga
funcional. Esse conceito de unio direta entre osso vital e a superfcie do implante, em
nvel de microscopia ptica, confere o sucesso do uso de implantes de titnio para o
suporte de prteses dentais e ortopdicas (Albrektsson, 1983; Albrektsson and
Sennerby, 1990b).
Mesmo aps a consolidao do uso clnico dos implantes, as pesquisas se
concentraram na melhoria dos j expressivos ndices de sucesso (Albrektsson et al.,
1986a; Wennerberg and Albrektsson, 2009). Portanto, modificaes na superfcie dos
implantes tiveram como objetivo aumentar a previsibilidade clnica para melhorar o
prognstico do tratamento e, diminuir o tempo de cicatrizao para a instalao de
prteses (Borsari et al., 2005; Terheyden et al., 2012). Para os implantes
odontolgicos, as modificaes tambm objetivaram diminuir o fenmeno de
reabsoro ssea cervical ao redor dos implantes osseointegrados conhecido como
saucerizao ssea, onde uma perda inicial de 1,5mm no primeiro ano e de at 2mm
em 5 anos considerado dentro da normalidade, (Albrektsson et al., 1986b;
Albrektsson et al., 2012).
Geralmente as modificaes so caracterizadas pelo aumento da
rugosidade de superfcie, para melhorar a resposta celular, e consequentemente o
processo de osseointegrao (Borsari et al., 2005; Wennerberg and Albrektsson,
2009). Existem vrios mtodos de modificao de superfcie de implantes, mas
comumente so divididos em dois grandes grupos, os mtodos de adio,

17


normalmente obtidos atravs de spray de plasma com partculas de titnio ou
hidroxiapatita, e os mtodos de subtrao, normalmente obtidas por laser ou ataque
cido, a combinao dos dois mtodos tambm utilizada. A superfcie rugosa
representa uma modificao micro ou nano morfolgica estrutural que aumenta a rea
de contato entre o osso vital e o implante, o que aumenta a estabilidade primria dos
implantes e a resistncia ao torque de remoo, favorecendo a deposio ssea
quando comparada superfcie lisa (Carr et al., 1997; Sutter et al., 1988).
Entretanto, ao longo do tempo percebeu-se que durante o uso de implantes
ortopdicos, a texturizao criada para aumentar a rugosidade de superfcie pode ser
desgastada em micropartculas e nanopartculas de titnio (Zhang et al., 2011) que
so liberados na rea periimplantar levando a uma reao inflamatria exacerbada
(Goodman et al., 2014; Wei et al., 2009). Essa reao pode ser ainda intensificada
caso haja presena de endotoxinas bacterianas provenientes do implante ou em stio
cirrgico contaminados (Bi et al., 2001; Meyer et al., 2006; Ragab et al., 1999).
O processo inflamatrio relacionado presena de partculas de titnio
liberadas durante o uso das prteses ortopdicas, exacerba a produo das citocinas
pr-inflamatrias, Interleucina 6 (IL-6), Fator de Necrose Tumoral Alpha (TNF-),
Interleucina 1 Beta (IL1-) que esto ligadas ao incio do processo osteoltico (Shin et
al., 2012). Estas citocinas so produzidas por macrfagos aps a fagocitose, que so
as primeiras clulas a interagir com as partculas liberadas, e essa produo
exacerbada de citocinas culmina em perda ssea ao redor do implante, e consequente
falha da prtese ortopdica (Obando-Pereda et al., 2014; Shin et al., 2012).
Na odontologia, os implantes dentrios podem liberar micropartculas e
nanopartculas de titnio no tecido periimplantar durante a insero no stio sseo
(Senna et al., 2015). Essas partculas so provenientes da quebra dos picos, criados
para o aumento da rugosidade de superfcie, durante a insero do implante. Outra
caracterstica da liberao de partculas dos implantes dentrios que difere dos
implantes ortopdicos, o acmulo na regio cervical prximo as trs primeiras roscas
do implante devido ao autorrosqueamento dos implantes (Mints et al., 2014; Senna et

18


al., 2015).

Anlises histolgicas da regio periimplantar tambm mostraram a

presena das partculas aps 6 meses da colocao do implante (Flatebo et al., 2011;
Olmedo et al., 2008).
Apesar da evidncia de partculas de titnio no tecido periimplantar de
implantes dentrios, o mecanismo e a influncia dessas partculas de titnio na regio
periimplantar oral ainda no foram avaliados. Devido as diferenas biolgicas e
mecnicas dos implantes ortopdicos para os implantes dentais, muito ainda deve ser
investigado para saber qual o efeito da presena de partculas de titnio na regio
periimplantar oral.
A regio periimplantar oral possui uma microbiota natural, portanto a
presena de endotoxinas ir ocorrer mesmo que no haja presena de contaminao
do implante ou do stio cirrgico e como descrito no quarto pargrafo essa associao,
pode exacerbar a reao inflamatria (Bi et al., 2001; Meyer et al., 2006; Ragab et al.,
1999). Sabe-se que a microbiota periimplantar semelhante a microbiota periodontal
pr-existente (Rutar et al., 2001), uma bactria altamente patognica e pouco virulenta
que determinante para doenas periodontais a Porphyromonas gingivalis, pode ser
encontrada em regies periimplantares (Lee et al., 1999; Leonhardt et al., 2003;
Mombelli et al., 1995; Rutar et al., 2001). Portanto essencial a avaliao da
associao de micropartculas e nanopartculas de titnio a endotoxinas bacterianas
da cavidade oral, que podem levar a falha do tratamento (Lang et al., 2011).
O processo de saucerizao ssea tambm uma caracterstica especfica
dos implantes orais que multifatorial e as causas e o mecanismos de reabsoro
continuam em discusso. A literatura descreve como causas traumas cirrgicos,
sobrecarga oclusal, periimplantite, micro espaos entre implante e osso, adaptao
do epitlio juncional aps a perda do espao biolgico e o mdulo de crista do
implante(Albrektsson et al., 2012; Cochran et al., 2009) , a presena das partculas de
titnio poderia contribuir para a perda ssea neste processo sendo um fator somatria
as causas j descritas.

19


No intuito de investigar a existncia e o mecanismo e de um processo
osteoltico na presena das partculas de titnio na regio cervical do implante dental,
pode-se tambm analisar os fatores relacionados ao processo osteognico. Se
observarmos um gene como RUNX-2 (runt-related transcription factor 2) um precursor
osteoblstico em que sua expresso est diretamente ligada a expresso dos genes
relacionados a formao da matriz ssea como Ocitocina (OCN), Osteopontina
(OPN), Colgeno tipo 1 (ColA1), Sialoprotena ssea (BSP), Fosfatase alcalina (ALP),
deduziremos que existe uma expresso gnica que poder levar a formao ssea
(Kirkham et al., 2007). A Osteopontina alm de ser um gene da matriz ssea, sua
expresso pode estar relacionada com a atividade osteoclstica. Outros genes como
Osterix (OSX) ligado a ossificao, Protena morfogentica 2 (BMP-2) que um fator
de crescimento sseo e o paratormnio (PTH) que est associado a liberao de on
clcio do osso, so importantes marcadores da atividade ssea (Granchi et al., 2010;
Gyurko et al., 2005).
Sendo assim, a avaliao da associao de micropartculas e
nanopartculas de titnio, liberados a partir de implantes dentrios, com endotoxinas
presentes na rea periimplantar da cavidade oral como LPS de Porphyromonas
gingivalis (Lang et al., 2011) sobre a produo de citocinas pr-inflamatrias
relacionadas com a o processo de ostelise, se faz necessria. Assim como,
importante avaliar a influncia de partculas de titnio no processo de reabsoro
ssea na regio cervical de implantes dentrios, uma vez que a presena de partculas
de titnio pode contribuir para o processo de saucerizao ssea culminando na falha
do selamento da regio periimplantar.
Portanto um estudo in vitro (Artigo 1) foi proposto para avaliar o
comportamento dos macrfagos humanos na presena de micropartculas e
nanopartculas de titnio associada com LPS de Porphyromonas Gingivalis, sobre a
expresso gnica e produo de citocinas pr-inflamatrias relacionadas a ostelise
e um estudo in vivo (Estudo 2) foi proposto para avaliar a reao do osso peri-

20


implantar e a expresso de genes relacionados a osteognese nos estgios iniciais
da osseointegrao, na presena de micropartculas de titnio.

21

2 ARTIGOS

2.1 Pro-inflammatory analysis of human macrophage in contact with

titanium micro/nanoparticles and Porphyromonas gingivalis

Cindy Goes Dodo

Luiz Meirelles
Alejandro Ayres-Reyes
Karina Gonzalez Silvrio Ruiz
Jacqueline Abranches
Altair Antoninha Del Bel Cury*

* Corresponding author:
Altair Antoninha Del Bel Cury
Department of Prosthodontics and Periodontology, Piracicaba Dental
School, University of Campinas.
Avenida Limeira, 901. Piracicaba, So Paulo, Brazil. 13414-903.
Phone: +55 19 21065294; Fax +55 19 2106-5211;
E-mail: altcury@fop.unicamp.br

22



Abstract
Titanium dental implant insertion can release titanium particles in the
periimplant region that can overstimulate inflammation leading to osteolysis, the
association with bacterium and can exacerbate inflammatory reaction. A high invasive
bacterium as Porphytomonas gingivalis, is present in the periimplant area and the
association of this bacterium and titanium particles remains unkown. This study
evaluated the behavior of human macrophages in contact with micro and nanoparticles
of titanium associated with Lipopolysaccharide (LPS) PG. THP-1 cell were
differentiated to macrophages and were treated for 12h, 24h, and 48h following 6
groups: Control(C), LPS PG (L); Microparticles (M); Nanoparticles (N); LPS PG and
microparticles (LM); LPS PG and nanoparticles (LN). The pro-inflammatory cytokines
TNF-, IL1-, IL-6 were analyzed regarding cell viability, morphology, mRNA
expression (RT-PCR) and protein production (Elisa). For statistics Anova two-way
followed by Tukeys test was used (p<0.05). After treatment cells presented similar
viability and morphology demostranting that the presence of treatments were not
causing cell death. Gene expression was higher for TNF- and IL1- after 12h and IL6 after 24h, results. Cytokine production regarding time was an ascending curve for
TNF- with the peak at 48h and IL1- and IL-6 had a straight line between time besides
IL-6 at 48h for N group. Conclusively, these results suggest that macrophages are
more affected by nanoparticles and LPS PG did not increase the pro-inflammatory
reaction.
Keywords: Osteolysis, Dental implant, Cytokines, Bone resorption, Titanium

23



Introduction
Titanium implants are the most used for dental rehabilitation and the surfaces
properties have been modified to enhance cellular response, usually by increasing the
surface roughness [1, 2]. The modifications in the surfaces are an attempt to increase
the primary stability and improve the process of osseointegration [1, 3]. Previous
studies from our group demonstrated that during insertion into bone the peaks created
to increase roughness are prone to break, culminating in the release of titanium
microparticles and nanoparticles, especially in the cortical region near the neck of the
implant [4, 5]. Also, histological analyses showed that titanium particles can be trapped
in peri-implant tissue even after 6 months of implant placement [6, 7].
Whereas the presence of titanium particles shed from rough titanium surfaces
during dental implant insertion in the cortical region was proved, the consequences
related to the presence of this shed particles in the dental peri-implant tissue were
poorly investigated. Despite, orthopedic studies, showed that the presence of titanium
particles from wear of limb prosthesis could overexpress pro-inflammatory cytokines
as IL-6, TNF-, IL1-, that are related to the osteolysis process, culminating in bone
loss around the implant and prosthesis failure [8, 9]. Furthermore, the orthopedic
studies showed that the presence of bacterium endotoxins in the implant could
intensify the inflammatory reaction, increasing bone loss [10-12].
In the peri-implant region there is a natural microbiota usually similar to the oral
cavity before implant installation [13]. Porphyromonas gingivalis is a key pathogen for
periodontal diseases [14] and is a bacterium reported to be presented in the dental
peri-implant region after dental implant installation [13, 15-17]. Thus, it is important to
assess the influence of microparticles and nanoparticles of titanium released from
dental implants surfaces during insertion, associated with endotoxins from bacteria
present in the peri-implant area. Hence, an in vitro study was proposed to evaluate the
pro-inflammatory reaction of macrophages, the first cell linage interacting with a foreign
body, in the presence of microparticles and nanoparticles of titanium associated with

24


Lipopolysaccharide from Porphyromonas gingivalis [18], regarding gene expression
and protein production of pro-inflammatory cytokines related to osteolysis process.
2- Materials and Methods
2.1 Titanium particles
Microparticles of titanium powder CAS 7740-32-6

(<20 micron, 93%, Alfa

Aesar, Ward Hill, MA, USA) and Nanoparticles Titanium (IV) oxide CAS 13463-67-7
(21 nm, Sigma Aldrich, St Louis, MO, USA) were used in this study. The particles were
weighted and separated in 15 mL tubes (Fischer Scientific, Waltham, Massachusetts,
USA) containing 25 mg each. A cleaning procedure was necessary to certificate that
the particles were not contaminated with amounts of endotoxin (10-20 units/ml) as
reported previously [10, 12, 19]. The particles were cleaned using nitric acid 25% for 2
h followed by 3 washes in Phosphate-buffered saline (PBS) (Invitrogen, Waltham,
Massachusetts, USA) for 5 minutes each time and placed in 95% ethanol with 0.1N of
NAOH for 24h, followed by 3 washes in PBS [10, 20]. After the cleaning procedure the
presence of endotoxins was measured using Limulus Amebocyte Lysate Chromogenic
Endotoxin Quantification Kit (Thermo Fisher Scientific, Grand Island, NY, USA)
following the manufacture protocol. The detection measured was <0.01endotoxin
units/mL, confirming the effectiveness of the cleaning procedure [19]. The particles
were kept in PBS 25 mg/mL at 4C [21, 22] and the solution was agitated for 20 min
prior each usage [23].
2.2 Cell Culture
The human monocyte THP-1 cells (5x105 cells/well) were placed in a 6 well
plate with RPMI-1640 medium, supplemented with 10% fetal bovine serum and 1%
antibiotics penicillin-streptomycin (Invitrogen, Carlsbad, CA, USA) in a incubator under
5% atmosphere CO2/95% air at 37 C. The cells were differentiated to macrophages
using 125ng/well for 48h of phorbol 12 myristate 13- acetate (PMA) (Sigma Aldrich,
St. Louis, MO, USA) [24]. The wells were washed 3 times with PBS and treated

25


following

experimental

groups:

no

treatment,

Control(C);

g/mL

Lipopolysaccharide from Porphyromonas gingivalis (L) [8, 25]; 50 ng/mL of Titanium

microparticles

(M)

50ng/mL

Titanium

nanoparticles

(N);

g/mL

of

Lipopolysaccharide from Porphyromonas gingivalis plus 50 ng/mL microparticles (LM);

1 g/mL of Lipopolysaccharide from Porphyromonas gingivalis plus 50 ng/mL of
titanium nanoparticles (LN). The treatments were diluted in RPMI-1640 medium and 5
mL was placed in each well of a 6 well/plate [20, 26].
2.3 Cell viability in the presence of titanium particles
The cell viability analyses were performed to evaluate whether the
treatments proposed were leading to cell death. After treatments for 12h, 24h and 48h
the viability was verified in a spectrophotometer (Multiskan Spectrum Microplate
Spectrophotometer, Thermo Fisher Scientific Inc., MA, USA) at 490 nm using CellTiter
96 Aqueous One Solution Cell Proliferation Assay with tetrazolium compound [3-(4,5dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium,
inner salt; MTS (Promega, WI, USA) following the manufacturer instructions [3]. Also
the cells were treated following the experimental groups on polysine-coated glass
cover slips (ThemoScientific Waltham, Massachusetts, USA) and prepared for
spectrometry electron microscopy (SEM) analysis with 5% Karnovisk overnight, and
dehydrated in successive concentrations of ethanol (50%, 70%, 95% and twice at
100%) with 15 minutes incubation time between each step. The samples were then
critical point-dried using a critical point dryer (Critical Point Dryer, Seevac Inc, Florida,
USA). Each specimen was mounted on a SEM stub and sputter-coated with a
conductive layer of AuPd. The samples were imaged using a JEOL JSM 5600 PV SEM
(Akishima, Tokyo, Japan).
2.4 Gene expression analysis
After the incubation period following the experimental groups, the cells were
harvested after 12 h, 24 h, and 48 h. Also a baseline group (0 h) was prepared for gene

26


expression data analysis. Total RNA was extracted using TRIzol Reagent (Invitrogen,
Carlsbad, CA, USA) according to the recommended protocol and the quantity and the
quality of RNA obtained were analyzed using Nanodrop (ND-1000 Spectrophotometer
Wilmington, DE, USA) and an agarose 0.8% gel electrophoresis (40 min, 80 mA). Total
RNA extracted was cleaned using DNA-free DNA Removal Kit (Ambion, Life
Technologies, Carlsbad, California, USA) and purified using RNeasy Mini Kit (Qiagen,
Valencia, CA, USA). The purified RNA (0.5g of RNA per reaction) was converted to
cDNA in a reverse transcriptase reaction using a PrimeScrip RT reagent kit (Qiagen,
Valencia, CA, USA). RT-PCR (100ng of cDNA per reaction) was carried out using the
PerfeCta SYBR Green FastMix Kit (Quanta Biosciences, Gaithersburg, Maryland,
USA) and StepOnePlus real-time PCR system (Life Technologies) following 40 cycles
of 95oC for 10s, and 60oC for 30s and 95oC for 10s. The comparative quantification
algorithm (Ct) method was used and the expression level of the internal control
gene, Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used to normalize
the data. Experiments were performed in triplicate. The gene specific primers used in
this study are described in Table 1 [20].
Table 1. Gene sequence for Real time-PCR
Gene
GAPDH
IL-1
TNF-
IL-6

Seq 5to 3
F: CGAGATCCCTCCAAAATCAA
F:GGACAAGCTGAGGAAGATGC
F: AGCCCATGTTGTAGCAAACC
F: CACAGACAGCCACTCACCTC

R:TTCACACCCATGACGAACAT
R:TCGTTATCCCATGTGTCGAA
R:TGAGGTACAGGCCCTCTGAT
R:TTTTCTGCCAGTGCCTCTTT

2.5 Quantification of cytokine production

The cell-free supernatant was collected from three independent experiments
and the extracellular levels of cytokines TNF- , IL -1 and IL- 6 was measured using
the Single-Analyte ELISArray Kits (Qiagen, Valencia, CA, USA), following the
manufacture protocol. The absorbance was on a spectrophotometer (Multiskan

27


Spectrum Microplate Spectrophotometer, Thermo Fisher Scientific Inc., MA, USA), and
concentrations ere calculated according to the standard curve of each cytokine.
2.6 Statistical Analyses
The results were analyzed by analysis of variance followed by Tukeys test
within the level of significance at 5%. The data analysis software used in this study
was SAS 7.0 (SAS, Cary, North Carolina, USA)
3. Results
3.1 Cells viability and expression of inflammatory cytokines
We observed that the treatments proposed did not affect cell viability. The
results showed similar results among groups after cell viability analysis p<0.05 (Fig1)
and similar morphology after SEM analysis (Fig. 2).

Figure 1. Cell viability absorbance percentage compared to control after 12h, 24h and 48h (p>0.05). THP-1 cells
were treated with 1 g/mL of LPS from P. gengivalis (LPS), Titanium microparticles 50 ng/mL (M), Titanium Nanoparticles 50
ng/mL (N), LPS P. gingivalis 1 g/mL with 50 ng/mL of titanium microparticles (LM) and LPS P. gengivalis 1 g/mL with 50 ng/mL
of titanium nanoparticles (LN).

28

Figure 2. SEM of THP-1 cells that were after treated 12h, 24h and 48h with 1 g/mL of LPS from P. gengivalis
(LPS), Titanium microparticles 50 ng/mL (M), Titanium Nanoparticles 50 ng/mL (N), LPS P. gingivalis 1 g/mL with 50 ng/mL of
titanium microparticles (LM) and LPS P. gengivalis 1 g/mL with 50 ng/mL of titanium nanoparticles (LN).

Our findings, related to gene expression, revealed that the peak of expression
for TNF- and IL-1 occurred after 12 h hours and for IL-6 was after 24 h (Fig. 3).
When analyzing each gene by time, TNF- at 12 h had the highest fold increased for
N and LN groups (8,39 fold and 6,60 fold), at 24 h N, M, LM and LN groups had similar
expression, and at 48 h the highest fold increased was once more for N and LN (3,32
fold 2,86). Regarding IL1-, the highest fold increased was at 12 h for N group 11,65
fold, at 24 h for N and LN (5,09 fold and 5,99 fold) and at 48 h for N group 3,14 fold.
IL-6 presented at 12 h the highest fold increased for N group 39,56 fold, 24 h for N and
LN groups (78,09 fold and 64,78 fold) and at 48 h for N and LN groups (7,44 fold and
7,31 fold).
Generally, after the treatments, THP-1 cells had the higher expression of proinflammatory cytokines in the presence of titanium nanoparticles. Another general
expression behavior was the lower fold increased in presence of LPS PG, an example
was the LN group that the genes IL-6 at 12h and IL1- at 12h and 48h IL-B the fold
increased was lower than the N group in the same time points. Regarding the groups
treated with titanium microparticles and interestingly late expression of TNF- was
observed when cells were exposed to microparticles in comparison to nanoparticles.

29


The group LM that was associated with LPS PG had the same behavior as the group
treated with titanium microparticles, besides the gene TNF- at 12h, the group LM
presented a significant gene expression.

30

31


Figure 3. Gene expression analyses of pro-inflammatory cytokines related to osteolysis.Fold increased of TNF,IL1- and IL-6 was compared to the housekeeping gene (GAPDH) and control of each group (Ct). THP-1 cells were treated
with 1 g/mL of LPS from P. gengivalis (LPS), Titanium microparticles 50 ng/mL (M), Titanium Nanoparticles 50 ng/mL (N), LPS
P. gingivalis 1 g/mL with 50 ng/mL of titanium microparticles (LM) and LPS P. gengivalis 1 g/mL with 50 ng/mL of titanium
nanoparticles (LN). * Significant differences from all groups from the same cytokine (p<0.05) and **Significant differences from all
groups from the same cytokine (p<0.05). Data expressed as the mean SD of experiments made in quadruplicate.

3.2 Cytokine Production

The cytokine production generally was an ascending curve for TNF- and the
peak occurred after 48 h. For IL-1 and IL-6 the production was almost a straight line,
with the exception for the production of IL-6 for N group that had higher production at
48h.
The average high expression of cytokine was to IL1- followed by TNF- and
IL1-6 (Fig 4). The results showed that TNF- production was more pronounced at 48h
for N group (2019.1 pg/ml) followed by the groups statically equivalent M at 24h (605
pg/ml), 48h (983 pg/ml) and group LN 48 h (958 pg/ml). The results showed that IL1-
presented the highest protein production but the production of all groups was
statistically equivalent. For IL-6 the highest protein production was also for the group
treated with nanoparticles at 48h (1301,82pg/ml). Overall, the groups treated with
titanium micro and nanoparticles presented the highest protein production. The groups
treated with titanium particles in association with LPS PG presented similar or less proinflammatory production than the groups treated just with titanium particles.

32

Figure 4. Pro-inflammatory cytokines expression of THP-1 cells treated after 12h, 24 h and 48 h with 1 g/mL of
LPS from P. gengivalis (LPS), Titanium microparticles 50 ng/mL (M), Titanium Nanoparticles 50 ng/m (N), LPS P. gingivalis 1
g/mL with 50 ng/mL of titanium microparticles (LM) and LPS P. gengivalis 1 g/mL with 50 ng/mL of titanium nanoparticles (LN).
* Significant differences from all groups from the same cytokine (p<0.05) and **Significant differences from all groups from the
same cytokine (p<0.01). Data expressed as the mean SD of experiments made in triplicate.

33


Discussion
The presence of titanium particles in the dental peri-implant region can
be an obstacle to bone regeneration that can lead to marginal bone loss. The
orthopedic literature showed the influence of titanium wear particles in the osteolytic
process that cause implant failure and can be exacerbated in the presence of bacteria.
In this study we aimed to analyze the behavior of human macrophages in the presence
of titanium particles shed during insertion of dental implants into bone associated with
a common pathogen in the periimplant region, P. gingivalis [13, 17].
The cells viability results demonstrated that the treatments were not causing cell
death and the SEM results showed similar morphology among groups. Although it was
demonstrated similar cell viability between groups and cell morphology titanium
particles and LPS from P. gingivalis could affect pro-inflammatory cytokines genes
expression and protein production [3, 27]. Gene expression results showed that TNF and IL1- had the highest fold increased after 12h and IL-6 after 24h, following
previous results that showed the inflammation process related to the presence of
titanium particles in orthopedics [8, 28]. The groups with nanoparticles of titanium
presented the highest fold increased for all genes showing a possible relation with the
particle size [3]. Titanium microparticles affect gene expression although was less than
titanium nanoparticles, this study used the same concentration of particles as
nanoparticles were smaller, to achieve the same weight more particles were needed
the result could be related to a dose-dependency not only about particle size [23, 29].
Protein production was higher for IL1- in all time points and groups analyzed,
this cytokine have a higher production compared to TNF- and IL-6 [8]. However, the
analysis of the protein production behavior is more significant than the values of
production [9, 30]. IL-1 is the cytokine expressed to start the osteolytic process and
plays an important role to TNF- expression that modulates RANK-L production,
leading to bone resorption. Therefore we could observed that the production of TNF-
was an ascending curve regarding time and probably if this study analyzed in a later
time point the curve would still ascending [31]. After the production of IL1- and TNF-

34


, IL-6 is produced and this cytokine is related to the recruitment and activation of
osteoclasts, which resorb bone [9, 32]. For IL-6 the production pattern was a straight
line besides the group treated with titanium nanoparticles that showed higher
production of cytokines after 48h, suggesting that nanoparticles could lead to more
bone resorption [32, 33].
We could observe that mRNA and cytokine expression did not present a parallel
behavior. For example, TNF- was expressed at 12h for N, LM, and LN groups and
the protein production did not occur at 12h or even after 24h. Another finding was IL-6
that had the highest fold increased and IL1- produced more proteins. Others studies
in the orthopedic literature described similar results as ours [8, 12, 19, 34], but the
reason regarding this findings are unknown. A possibly explanation is that this
discrepancy in mRNA expression and protein production can be related to a posttranscriptional processing or autocrine mechanisms to prevent an over-inflammatory
reaction that can be harmful for the system[8].
Moreover others studies showed that titanium particles contribute to
inflammatory response without the presence of a pathogen, but the presence of a
endotoxins can exacerbate inflammatory reaction [12]. In this study the association of
titanium particles with a pathogen from the oral cavity, LPS from P. gingivalis was
analyzed and did not increase gene expression or protein production of proinflammatory cytokines when associated with titanium micro and nanoparticles. LPS
from P. gingivalis is reported not to be as others Gram-negative bacterium, when
inducing

pro-inflammatory

cytokines

in

several

types

of

cells

including

monocyte/macrophage cell type [24, 35, 36]. This is characteristic of P. gingivalis that
helps the bacteria to invasion, without alarming the host immune system [37]. Another
explanation regarding the lower expression and production of the pro- inflammatory
cytokines in the presence of LPS PG could be related to the concentration used in this
study. Previous studies using the same commercially LPS had similar results with
concentrations around 1 l/ml [38-40], and only higher concentrations around 10 l/ml

35


[41] showed more effect in cytokine production but for human periodontal ligament
stem cells, this commercial LPS PG seems to have less potency than a LPS PG
extracted after culturing PG. This could be related to the cell linage of Porphyromonas
gingivalis [42] or to the procedure used to extract LPS [43], a comparative evaluation
is needed to prove the differences between LPS.
In our results we could observe that the presence of titanium particles can affect
THP-1 cells regarding gene expression and protein production of pro-inflammatory
cytokines related to the osteolytic process and groups treated with titanium
nanoparticles had more effect increasing gene expression and protein production.
Moreover, investigations must be done regarding the effect of titanium particles in the
process of marginal bone break down in dental implants in the early stages of
osseointegration. Titanium micro and nanoparticles could have a potential contribution
in the bone resorption process leading marginal bone loss.
Conclusion
The presence of titanium particles stimulates the expression and production of
pro-inflammatory cytokines TNF- , IL -1 and IL- 6 that are related to the osteolysis
process. Nanoparticles of titanium affect more the pro-inflammatory reaction. The
association with LPS from P. gingivalis did not increased gene expression of proinflammatory genes and produced less pro-inflammatory cytokine compared to the
groups treated with microparticles and nanoparticles of titanium.
Acknowledgments
The authors declare no potential conflicts of interest with respect to the
authorship and/or publication of this study.
We gratefully acknowledge Dr. Jose Lemos for the support during the
development of this study. We also thank Dr. Irlan Almeida, Dr. Jessica K. Kajfasz, Dr.
Plinio Senna and James H. Miller for the critical advices. We acknowledge the So
Paulo Research Foundation for granting scholarships FAPESP# 2013/19791-8 and

36


FAPESP#2014/10085-6 for the author Dr. Cindy Dodo during the development of this
study.
Refences
[1] Borsari V, Giavaresi G, Fini M, Torricelli P, Salito A, Chiesa R, et al. Physical
characterization of different-roughness titanium surfaces, with and without
hydroxyapatite coating, and their effect on human osteoblast-like cells. Journal of
biomedical materials research Part B, Applied biomaterials. 2005;75:359-68.
[2] Wennerberg A, Albrektsson T. Effects of titanium surface topography on
bone integration: a systematic review. Clinical oral implants research. 2009;20 Suppl
4:172-84.
[3] Zhang Y, Yu W, Jiang X, Lv K, Sun S, Zhang F. Analysis of the cytotoxicity of
differentially sized titanium dioxide nanoparticles in murine MC3T3-E1 preosteoblasts.
Journal of materials science Materials in medicine. 2011;22:1933-45.
[4] Senna P, Antoninha Del Bel Cury A, Kates S, Meirelles L. Surface Damage on
Dental Implants with Release of Loose Particles after Insertion into Bone. Clinical implant
dentistry and related research. 2015;17:681-92.
[5] Mints D, Elias C, Funkenbusch P, Meirelles L. Integrity of implant surface
modifications after insertion. The International journal of oral & maxillofacial implants.
2014;29:97-104.
[6] Flatebo RS, Hol PJ, Leknes KN, Kosler J, Lie SA, Gjerdet NR. Mapping of
titanium particles in peri-implant oral mucosa by laser ablation inductively coupled
plasma mass spectrometry and high-resolution optical darkfield microscopy. Journal of
oral pathology & medicine : official publication of the International Association of Oral
Pathologists and the American Academy of Oral Pathology. 2011;40:412-20.
[7] Olmedo DG, Tasat DR, Evelson P, Guglielmotti MB, Cabrini RL. Biological
response of tissues with macrophagic activity to titanium dioxide. Journal of biomedical
materials research Part A. 2008;84:1087-93.

37


[8] Obando-Pereda GA, Fischer L, Stach-Machado DR. Titanium and zirconia
particle-induced pro-inflammatory gene expression in cultured macrophages and
osteolysis, inflammatory hyperalgesia and edema in vivo. Life sciences. 2014;97:96-106.
[9] Souza PP, Lerner UH. The role of cytokines in inflammatory bone loss.
Immunol Invest. 2013;42:555-622.
[10] Ragab AA, Van De Motter R, Lavish SA, Goldberg VM, Ninomiya JT, Carlin
CR, et al. Measurement and removal of adherent endotoxin from titanium particles and
implant surfaces. Journal of orthopaedic research : official publication of the Orthopaedic
Research Society. 1999;17:803-9.
[11] Meyer U, Buhner M, Buchter A, Kruse-Losler B, Stamm T, Wiesmann HP.
Fast element mapping of titanium wear around implants of different surface structures.
Clinical oral implants research. 2006;17:206-11.
[12] Bi Y, Van De Motter RR, Ragab AA, Goldberg VM, Anderson JM, Greenfield
EM. Titanium particles stimulate bone resorption by inducing differentiation of murine
osteoclasts. The Journal of bone and joint surgery American volume. 2001;83-A:501-8.
[13] Rutar A, Lang NP, Buser D, Burgin W, Mombelli A. Retrospective
assessment of clinical and microbiological factors affecting periimplant tissue conditions.
Clinical oral implants research. 2001;12:189-95.
[14] O'Brien-Simpson NM, Burgess K, Brammar GC, Darby IB, Reynolds EC.
Development and evaluation of a saliva-based chair-side diagnostic for the detection of
Porphyromonas gingivalis. Journal of oral microbiology. 2015;7:29129.
[15] Leonhardt A, Bergstrom C, Lekholm U. Microbiologic diagnostics at
titanium implants. Clinical implant dentistry and related research. 2003;5:226-32.
[16] Lee KH, Maiden MF, Tanner AC, Weber HP. Microbiota of successful
osseointegrated dental implants. Journal of periodontology. 1999;70:131-8.
[17] Mombelli A, Marxer M, Gaberthuel T, Grunder U, Lang NP. The microbiota
of osseointegrated implants in patients with a history of periodontal disease. Journal of
clinical periodontology. 1995;22:124-30.

38


[18] Lang NP, Berglundh T, Working Group 4 of Seventh European Workshop
on P. Periimplant diseases: where are we now?--Consensus of the Seventh European
Workshop on Periodontology. Journal of clinical periodontology. 2011;38 Suppl 11:17881.
[19] Schwab LP, Xing Z, Hasty KA, Smith RA. Titanium particles and surfacebound LPS activate different pathways in IC-21 macrophages. Journal of biomedical
materials research Part B, Applied biomaterials. 2006;79:66-73.
[20] Jin S, Park JY, Hong JM, Kim TH, Shin HI, Park EK, et al. Inhibitory effect of
(-)-epigallocatechin gallate on titanium particle-induced TNF-alpha release and in vivo
osteolysis. Experimental & molecular medicine. 2011;43:411-8.
[21] Han SG, Newsome B, Hennig B. Titanium dioxide nanoparticles increase
inflammatory responses in vascular endothelial cells. Toxicology. 2013;306:1-8.
[22] Montiel-Davalos A, Ventura-Gallegos JL, Alfaro-Moreno E, Soria-Castro E,
Garcia-Latorre E, Cabanas-Moreno JG, et al. TiO(2) nanoparticles induce dysfunction and
activation of human endothelial cells. Chemical research in toxicology. 2012;25:920-30.
[23] Zhang Y, Yu S, Xiao J, Hou C, Li Z, Zhang Z, et al. Wear particles promote
endotoxin tolerance in macrophages by inducing interleukin-1 receptor-associated
kinase-M expression. Journal of biomedical materials research Part A. 2013;101:733-9.
[24] Diya Z, Lili C, Shenglai L, Zhiyuan G, Jie Y. Lipopolysaccharide (LPS) of
Porphyromonas gingivalis induces IL-1beta, TNF-alpha and IL-6 production by THP-1
cells in a way different from that of Escherichia coli LPS. Innate immunity. 2008;14:99107.
[25] Chen LL, Yan J. Porphyromonas gingivalis lipopolysaccharide activated
bone resorption of osteoclasts by inducing IL-1, TNF, and PGE. Acta Pharmacol Sin.
2001;22:614-8.
[26] Shin DK, Kim MH, Lee SH, Kim TH, Kim SY. Inhibitory effects of luteolin on
titanium particle-induced osteolysis in a mouse model. Acta biomaterialia. 2012;8:352431.

39


[27] Irshad M, Scheres N, Crielaard W, Loos BG, Wismeijer D, Laine ML.
Influence of titanium on in vitro fibroblast-Porphyromonas gingivalis interaction in periimplantitis. Journal of clinical periodontology. 2013;40:841-9.
[28] Cachinho SC, Pu F, Hunt JA. Cytokine secretion from human peripheral
blood mononuclear cells cultured in vitro with metal particles. Journal of biomedical
materials research Part A. 2013;101:1201-9.
[29] Goodman SB, Konttinen YT, Takagi M. Joint replacement surgery and the
innate immune system. Journal of long-term effects of medical implants. 2014;24:253-7.
[30] Amarasekara DS, Yu J, Rho J. Bone Loss Triggered by the Cytokine
Network in Inflammatory Autoimmune Diseases. J Immunol Res. 2015;2015:832127.
[31] Wei S, Kitaura H, Zhou P, Ross FP, Teitelbaum SL. IL-1 mediates TNFinduced osteoclastogenesis. The Journal of clinical investigation. 2005;115:282-90.
[32] Darowish M, Rahman R, Li P, Bukata SV, Gelinas J, Huang W, et al.
Reduction of particle-induced osteolysis by interleukin-6 involves anti-inflammatory
effect and inhibition of early osteoclast precursor differentiation. Bone. 2009;45:661-8.
[33] Schwarz EM, Benz EB, Lu AP, Goater JJ, Mollano AV, Rosier RN, et al.
Quantitative small-animal surrogate to evaluate drug efficacy in preventing wear debrisinduced osteolysis. Journal of orthopaedic research : official publication of the
Orthopaedic Research Society. 2000;18:849-55.
[34] Trindade MC, Lind M, Sun D, Schurman DJ, Goodman SB, Smith RL. In vitro
reaction to orthopaedic biomaterials by macrophages and lymphocytes isolated from
patients undergoing revision surgery. Biomaterials. 2001;22:253-9.
[35] Lu J, Yang Z, Jiang J, Wang Z, Zhu P. Regulative effect of P38MAPK on
release of TNFalpha and NO from alveolar macrophages under endotoxin stimulation.
Chinese journal of traumatology = Zhonghua chuang shang za zhi / Chinese Medical
Association. 2001;4:75-7.
[36] Ogawa T, Uchida H. Differential induction of IL-1 beta and IL-6 production
by the nontoxic lipid A from Porphyromonas gingivalis in comparison with synthetic

40


Escherichia coli lipid A in human peripheral blood mononuclear cells. FEMS immunology
and medical microbiology. 1996;14:1-13.
[37] Holt SC, Kesavalu L, Walker S, Genco CA. Virulence factors of
Porphyromonas gingivalis. Periodontology 2000. 1999;20:168-238.
[38] Andrukhov O, Ertlschweiger S, Moritz A, Bantleon HP, Rausch-Fan X.
Different effects of P. gingivalis LPS and E. coli LPS on the expression of interleukin-6 in
human gingival fibroblasts. Acta Odontol Scand. 2014;72:337-45.
[39] Barksby HE, Nile CJ, Jaedicke KM, Taylor JJ, Preshaw PM. Differential
expression of immunoregulatory genes in monocytes in response to Porphyromonas
gingivalis and Escherichia coli lipopolysaccharide. Clin Exp Immunol. 2009;156:479-87.
[40] Nebel D, Arvidsson J, Lillqvist J, Holm A, Nilsson BO. Differential effects of
LPS from Escherichia coli and Porphyromonas gingivalis on IL-6 production in human
periodontal ligament cells. Acta Odontol Scand. 2013;71:892-8.
[41] Kato H, Taguchi Y, Tominaga K, Umeda M, Tanaka A. Porphyromonas
gingivalis LPS inhibits osteoblastic differentiation and promotes pro-inflammatory
cytokine production in human periodontal ligament stem cells. Arch Oral Biol.
2014;59:167-75.
[42] Diaz L, Hoare A, Soto C, Bugueno I, Silva N, Dutzan N, et al. Changes in
lipopolysaccharide profile of Porphyromonas gingivalis clinical isolates correlate with
changes in colony morphology and polymyxin B resistance. Anaerobe. 2015;33:25-32.
[43] Hirschfeld M, Ma Y, Weis JH, Vogel SN, Weis JJ. Cutting edge: repurification
of lipopolysaccharide eliminates signaling through both human and murine toll-like
receptor 2. J Immunol. 2000;165:618-22.

41

2.2 Artigo: Titanium Particles Affect Early Stages of Osseointegration

Cindy Goes Dodo

Altair Antoninha Del Bel Cury
Stephen L. Kates
Gustavo Mendona
Luiz Meirelles*

*Corresponding author:
Luiz Meirelles
Director Professional Products and Standards
American Dental Association
211 East Chicago Ave.
Chicago, IL 60611-2678
Jounal of Dental Research

42


Abstract
Titanium particles shed from the implant surface during implant placement are strongly
associated with osteolysis. This study investigated the early bone response at the
implant-bone interface in the presence of titanium microparticles. New Zealand White
rabbits (UCAR #2014-031) (n=20) received 68 titanium Grade IV implants, with turned
surface (3.75x7 mm), placed bilaterally in the tibia and femur. Test group was treated
with 3 mg (tibia) and 1 mg (femur) of titanium microparticles with mean diameter of
3m (93% 20m) free of endotoxin. Control group was treated with saline. After 1
and 3 days the cells attached to the implant were analyzed regarding gene expression
(6 animals, 12 implants placed in tibia) of osteogenic markers. After 1 and 4 weeks the
animals were euthanized for histological and histomorphometrical analysis (14
animals, 56 implants placed in tibia and femur). Multiple regression mixed model was
used for statistical analysis. After 1 week, test group demonstrated areas of bone
resorption associated with titanium particles (2-30 m) and absence of new bone
formation (NBF) while control group did not present any signs of bone resorption or
new bone formation. After 4 weeks, the remodeling process was observed for both
groups, but test group presented titanium particles trapped in the new bone formation.
Histomorphometrical analysis demonstrated bone-implant contact (BIC) values
reduced in test compared to control sites (p0.0001). The impaired healing persisted
at 4 weeks. Osteogenic expression demonstrated an upregulation of OCN (1.4-fold)
and OPN (1.0-fold) at 3 days and after 7 days, a downregultaion of COL1A1 (18.4fold), BSP (4.8-fold), OCN (38.9-fold), PTH (1.6-fold) was detected for test compared
to control implants. Conclusively, early stages of osseointegration were affected by
titanium

particles

added

to

cortical

and

trabecular

bone.

43


Introduction
The success of dental implants treatment is highly dependent on the integration
between dental implant and the surrounded tissue (5, 50). Successfully
osseointegrated dental implants can present a crestal bone breakdown ranging from
1.5 mm to 2 mm that commonly occurs in the early stages of osseointegration (51, 52).
Implants that present more bone loss in the initial stages of the healing process are
more affected for late bone loss overtime and prone to an uncertain prognostic (31,
53). The integrity of periimplant bone tissue is the key to establish a long-term success
of dental implants and, continuous bone breakdown represents a threat to implant
longevity. The etiologies behind initial bone break down must be deeply investigating
and controlled for long-term success of dental implant treatment (54).
In order to enhance the healing process and improve the prognostic of dental
implant treatment, modifications on the titanium surfaces were made, usually by
increasing surface roughness. However, during implant insertion the peaks created to
increase roughness are prone to break culminating in the released of titanium particles
in the periimplant region (23, 24, 55). Orthopedics studies demonstrated that osteolysis
could be stimulated by titanium particles from wear debris (20, 56). Titanium particles
stimulate macrophages that overexpress cytokines that leads to osteolysis (57).
Following that thought of reasoning, titanium particles shed from rough surfaces during
dental implant insertion into bone could contribute to the early marginal bone loss
around dental implants in the cortical region.
Moreover, the evaluation of the main genes related to bone formation and bone
remodeling process is another reliable way to access the early bone response and
understand the mechanisms related to bone loss. The gene Runx2 has been reported
as a percursor to osteoblast-related genes responsable for bone matrix formation as
ocitocalcin (OCN), osteopontin (OPN), collagen 1 (ColA1), bone sialoprotein (BSP),
alkaline phosphatese (ALP) (Kirkham 2007). Osteopontin can be also related to
osteoclastic activity. Osterix (OSX) is a gene especific to osteoblast ossification, bone

44


morphogenetic protein 2 (BMP2) a growth factor related to bone fomation and
parathyroid hormone (PTH) that is associated to an increase in the concentration of
ionic calcium (Ca2+) uptaked from bone (Gyurko 2005; Granchi 2010).
Therefore, this animal study was proposed to investigate the early bone
response at the dental implant-bone interface on surgical sites in the presence of
titanium microparticles.
1. Materials and Methods
1.1 Titanium particles
Microparticles of pure titanium (<20micron, 93%, Alfa Aesar, Ward Hill, MA,
USA) was used in this experiment. The particles were weight and separated in 15 ml
tubes (Fischer Scientific, Waltham, Massachusetts, EUA) containing 25mg each.
Commercially available titanium particles can present an amount of endotoxin (10-20
units/ml), therefore a cleaning procedure was necessary (Schawab 2005, Ragab 1999;
Bi 2001).
1.1.1 Cleaning procedure of titanium particles
The titanium particles were cleaned using nitric acid 25% for 2 h followed by 3
washes in Phosphate-buffered saline (PBS) (Invitrogen, Waltham, Massachusetts,
USA) for 5 minutes each time and placed in 95% ethanol with 0.1N of NAOH for 24h,
followed by 3 washes in PBS (Ragab et al 1999; Jin et al 2011). After the cleaning
procedure, the presence of endotoxins was measured using LAL Chromogenic
Endotoxin Quantitation Kit (Thermo Fisher Scientific, Grand Island, NY, USA) following
the manufacture protocol. The detection measured was <0.01endotoxin units/ml,
confirming the effectiveness of the cleaning procedure (Schwab et al 2005). The
titanium particles were kept in PBS 25mg/ml at 4C (Han et al., 2013; Montiel et al.,
2012) and the solution was agitated for 20 min prior each usage (Zhang et al., 2012).

45


1.2. Histological and Histomorphometric analysis
New Zealand white rabbits (UCAR #2014-031) were used for histological and
histomorphometric evaluation (n=14 animals). Before the surgery the animals were
knocked down under general anesthesia with 0.3mg/ml intramuscular fentanyl and
10mg/ml fluanisone followed by 2.5 mg intraperitoneal diazepam. The legs were
shaved and disinfected with chlorhexidine before injection of 1 ml of lidocaine into each
insertion site. The skin and fascia layers were opened and bone drilling was performed
with profuse irrigation with saline solution.
Before the insertion of the implant with turned surface (n=56 implants), test
group received titanium microparticles that were previously diluted in 100l of saline,
and applied homogeneously with a pipette in the implant surface. For test group, the
implants (n=28 implants) were placed in tibia (n= 14 implants) received 3 mg of titanium
microparticles and in femur (n=14 implants) only 1 mg. For control group (n=28
implants) 100l of saline was placed in the implant for both tibia and femur
implantation. The implants were inserted with a rotation of 25 rpm and the fascia layers
were closed with absorbable suture while skin layer with polypropylene.
After 1 and 4 weeks after surgery the animals were euthanized. General
anesthesia was induced by Ketamine 44mg/kg and Xylazine5mg /kg SQ with 100m/kg
sodium phenobarbital via ear vein. The implants and surrounding bone were removed
and fixed with 4% neutral buffered formaldehyde, dehydrated in graded series of
ethanol and the specimens were embedded in light curing resin (Technovit 7200 VLC,
Kltzer & Co, Germany). The slides were prepared following the Donaths technique
(Donath K. et al, 1982). Examinations were performed with a Nikon 80i microscope
(Nikon Instruments, Melville, NY, USA) equipped with an image software analysis
(NIS-Elements BR 3.2, Nikon, USA) using 1X to 100X objectives for descriptive
evaluation and morphometric measurements. The qualitative analysis aimed at
describing the early bone formation events at the control and test implants. The
histomorphometrical evaluations comprised measurements of the degree of bone

46


implant contact limited by the first and third coronal thread at a distance of
approximately 600m from the thread valleys.
2.3 Osteogenic genes analysis
For that analysis, the surgerys were perfomed in the tibia of 6 New Zealand
White rabbits. Test group received 3mg of titanium particles diluted in 100 l of saline,
and the control group received 100l of saline. The animals were euthanized after 3
and 7 days. After euthanesia the implants were remove with contratoque and the
adherent cells (Fig 14) were collected for gene analyses.
The RNA was extracted using TRIzol Reagent (Invitrogen, Carlsbad, CA, USA)
following the manufacture protocol. The RNA was analyzed using Nanodrop (ND-1000
Spectrophotometer Wilmington, DE, USA) and electrophoresis agar gel 0.8%. Total
RNA extracted was cleaned using DNA-free DNA Removal Kit (Ambion, Life
Technologies, Carlsbad, California, USA) and purified using RNeasy Mini Kit (Qiagen,
Valencia, CA, USA). The purified RNA was converted to cDNA in a reverse
transcriptase reaction using a PrimeScrip RT reagent kit (Qiagen, Valencia, CA, USA).
The Real Time Reverse Transcriptase-PCR (RT-PCR) was performed using the
PerfeCta SYBR Green FastMix Kit (Quanta Biosciences, Gaithersburg, Maryland,
USA) and StepOnePlus real-time PCR system (Life Technologies) following 40 cycles
of 95oC for 10s, and 60oC for 30s and 95oC for 10s. The comparative quantification
algorithm (Ct) method was used to data analysis using relative expression level of
the osteogenic genes compared to the housekeeping gene Glyceraldehyde 3phosphate dehydrogenase (GAPDH), the reactions were run in triplicate.
Results
Histological evaluation

47


The implant site in the femur consisted mainly of trabecular bone, whereas a
cortical layer of 1.5 mm in height characterized tibia sites. The original trabecular bone
in the femur were in contact with the top 4th to 5th threads, and the cortical layer in the
tibia was in contact to the 2nd to 3rd top threads. The apical part of test and control
implants in the tibia (approximately 2.5mm) was inside the bone marrow cavity.

Figure 1. A. In control group after 1 week it is possible to observe absence of

resorption and new bone formation. B. After 1 week in test group areas of bone resorption (

48


red circle) is observed near to titanium particles. C. After 4 weeks in control group many areas
of new bone formation can be observed near areas of bone resorption, but usually the
resorption areas are associated to new bone formation( red square). D. After 4 weeks in
experimental group many areas of new bone formation can be observed and it is possible to
see titanium particles traped into bone (red arrow).

1 week
Histological evaluation demonstrated that after 1 week, in control group, (Fig 1)
remodeling process did not start. A normal healing process for one-week period was
observed (9) with no signs of bone resorption and few areas of new bone formation.
The areas between threads showed gaps of 150-200m, these areas where filled with
blood cells and small pieces of drilled bone.
Experimental group, presented areas of resorption in the first three threads (Fig
2) not presenting new bone formation. Also, was possible to observe presence of
titanium particles (2-30 m) between bone/implant at the cortical level within the
threads interface.
4 weeks
After 4 weeks, control group showed areas of resorption associated to new bone
formation (Fig. 3) characterizing the remodeling process, a normal finding for this
period of healing (Lang et al 2011; Terheyden et al 2011).
The experimental group presented extensive scalloped areas indicative of bone
resorption and presence of titanium particles (15-30 m) surrounded by new bone
formation (Fig 4). The particles were at least 200 m of distance from the titanium
surface suggesting that they were released from the implant (Franchi et al., 2007).

49


2.4 Histomorphometric evaluation
The bone-to-implant contact (BIC) in the first three treads (Fig. 5) was measured
using a microscope (80i; Nikon Instruments, USA) equipped with an image software
analysis (NIS-Elements BR 3.2, Nikon, USA).
The BIC results showed that bone contact decrease in test compared to control
group after 1 and 4 weeks (Chart 1). A reduction of 23,4% (femur) and 43,4% (tibia)
of BIC values was observed for test compared to control groups after 1 week. After 4
weeks, a reduction of 20.2% (femur) and 21.08% (tibia) of BIC values was observed
for test compared to control groups.
Chart 1. Bone to implant contact analyzed after 1 and 4 weeks for Tibia and
femur.

4. Scanning electron microscope(SEM) and EDAX ( Energy Dispersive

X-RAY Spectroscopy)
The slides used for histological analyses were sputtered coated (Denton
Vaccum, Moorestown, New Jersey, USA) with 60 angstroms of gold, this process
makes the surface electrically conductive, allowing them to be imaged with a SEM

50


(Zeiss Auriga SEM/FIB with EDAX, Dublin, California, USA). The images samples
were analyzes on SEM with a Backscatterd probe, that shows small changes in sample
chemistry. The SEM used for this study also included an EDAX detector for Energy
Dispersive X-RAY Spectroscopy, this tool allowed to make chemical maps of the
sample comproving the presence of titanium particles (Fig. 5 and 6).

Figure 2. For experimental group after 1 week. In A the histological image

in the region were titanium particles were observed. The presence of titanium particles
(red arrows) was confirmed using a EDX mapping. The red line represents the interface
between bone and titanium implant.

51


A

Figure 3. For experimental group after 4 weeks, the presence of titanium

(red arrow) observed in the histological (A) analysis was confirmed using a SEM/EDX
graphic. The green arrow represents the peak of titanium.
5. Osteogenic analysis
The results (Fig 7) showed that after 3 days the presence of titanium particles
was stimulating gene expression of osteogenic genes, compared to control (Piolette et
al 2004). The fold increase in OPN (1.1 fold), as a pre-osteoclast gene and PTH (1.3
fold), a marker of ion calcium and the increase of RUNX2 (0.7 fold) and OSX (0.5 fold)
osteoblast markers, strongly suggest bone formation (Haynes 2004).
At 7 days (Fig.8) a downsregulation in RUNX2(-1.2 fold) and OSX (-2.0 fold)
indicated a decrease in osteoblastic activity and the upregulation of OPN (1.0 fold) and
PTH (1.4 fold) showed a maintenance of osteoclast activity, indicating bone loss
(Gyurko 2005; Granchi 2010). BMP-2 (1.1 fold) was upregulated indicating that even

52


with the evidence of osteoclast activity, the osteoblast possibly were differentiating and
starting the cells recruitment for bone formation.

Fig. 4. Osteogenic gene expression, showing fold differences at 3 days and 7

days compared to control.

Statistical Analysis
The multiple regression mixed models were used to study the effect of group on
the outcomes, adjusting for endpoint and site. The calculated effect sizes were
adjusted for multiple comparisons using DunnettHsus correction. All analyses were
performed using SAS, release 9.2 (SAS Institute Inc., Cary, NC, USA). The values that
p<0.05 were considered significant.
Discussion
Overall marginal bone loss (MBL) is higher during the first year and
limited thereafter. MBL during the first year ranging from 1.5 mm to 2 mm is considered

53


a normal finding (58). The marginal bone breakdown, even as a normal finding, it is
critical for implant prognosis and is related to later bone loss (53). Titanium particles
are shed from rough treated surfaces during implant placement into bone and the
particles can be trapped in the cortical region, possibly contributing to the initial bone
breakdown (23, 24, 55, 59). This study was developed to analyze the influence of
titanium particles, shed from rough treated titanium surfaces in the cortical region
during implant insertion, in the initial marginal bone loss in dental implants.
Histological evaluation demonstrated that after 1week test group had more sites
of resorption in the first three threads than control group. Also was possible to observe
titanium particles near the implant surface in the entire implant for test group, mainly
in the cortical region (19, 23, 55). The presence of titanium particles near the resorption
sites indicated that osteolysis was related to titanium particles (Kaar et al 2001). Areas
of new bone formation were rarely in control and test and it was a normal finding for a
1week of evaluation (Terheyden et al 2012). After 4 weeks of healing, many areas of
new bone formation and areas of resorption could be observed in test and control
group, these findings were expected for this period of healing, related to the remodeling
process (9). Test group presented titanium particles around 20 m surrounded by new
bone formation, the particles were at least 200 m of distance from the surface,
suggesting that larger particles of titanium and/or agglomerates of particles were
trapped in the bone matrix (59).
The bone/implant contact (BIC) results showed that bone contact decrease in
test compared to control group after 1 and 4 weeks for tibia and femur. A reduction of
23,4% (femur) and 43,4% (tibia) of BIC values was observed for test compared to
control groups, as a result of enhanced bone resorption triggered by Ti particle after 1
week. After 4 weeks, a reduction of 20.2% (femur) and 21.08% (tibia) of BIC values
were observed for test compared to control groups. In tibia was used 3 mg of titanium
particles, and for femur was used 1mg. The sites that received more titanium particles
presented more bone resorption suggesting a possible dose-dependent reaction
(Goodman et al., 2014; Shin et al., 2012). The dose-dependency behavior, in this

54


study, cannot be confirmed because tibia has more cortical bone and femur more
trabecular structures.
The histological analyses and mRNA expression of osteogenic genes can be
correlated. At 3 days the upregulation of RUNX2 and OSX with the upregulation of
PTH and OSX for test group is confirmed in the histological after 7 days, results
showing presence of bone resorption in the firt three treads for test group and new
bone formation in the endosteum. At 7 days an downregulation of the genes
responsible for matrix production (BSP, COL1A1, OCN, ALP) and for ossification
(RUNX-2, OSX) and an upregulation of genes related to the liberation of the ion Ca
(PTH and OPN) suggest bone resorption. The upregulation of BMP-2 at 7 days in test
group indicated the begining of osteoblast recruitment that can start the process of
bone formation, that was possible to observe in the histological images after 4 weeks
bone formation on test group.
These results indicate that titanium particles can affect early stages of
osseintegration and have influence the initial marginal bone breakdown. The marginal
bone breakdown is critical in the maintenance of the dental implant treatment.
Controlling and managing the factors involved in the beginning of this osteolytic
process is crucial for the long-term survival of dental implants.
Conclusion
Early stages of osseointegration were affected by the presence of titanium
particles in the cortical and trabecular bone. Based on the results of this animal study,
a new etiology for early bone loss around dental implants is presented.
Acknowledgments
The authors declare no potential conflicts of interest with respect to the
authorship and/or publication of this article. We acknowledge the So Paulo Research
Foundation

for

granting

scholarships

FAPESP#

2013/19791-8

and

55


FAPESP#2014/10085-6 for the author Dr. Cindy Dodo during the development of this
study.

References
Albrektsson T, Buser D, Sennerby L (2012). Crestal bone loss and oral
implants. Clinical implant dentistry and related research 14(6):783-791.
Balshi TJ, Wolfinger GJ, Stein BE, Balshi SF (2015). A Long-term
Retrospective Analysis of Survival Rates of Implants in the Mandible. The International
journal of oral & maxillofacial implants 30(6):1348-1354.
Cochran DL, Nummikoski PV, Schoolfield JD, Jones AA, Oates TW (2009).
A prospective multicenter 5-year radiographic evaluation of crestal bone levels over
time in 596 dental implants placed in 192 patients. Journal of periodontology 80(5):725733.
Flatebo RS, Hol PJ, Leknes KN, Kosler J, Lie SA, Gjerdet NR (2011).
Mapping of titanium particles in peri-implant oral mucosa by laser ablation inductively
coupled plasma mass spectrometry and high-resolution optical darkfield microscopy.
J Oral Pathol Med 40(5):412-420.
Franchi M, Orsini E, Martini D, Ottani V, Fini M, Giavaresi G et al. (2007).
Destination of titanium particles detached from titanium plasma sprayed implants.
Micron 38(6):618-625.
Fransson C, Lekholm U, Jemt T, Berglundh T (2005). Prevalence of
subjects with progressive bone loss at implants. Clinical oral implants research
16(4):440-446.
Galindo-Moreno P, Leon-Cano A, Ortega-Oller I, Monje A, F OV, Catena A
(2014). Marginal bone loss as success criterion in implant dentistry: beyond 2 mm.
Clinical oral implants research.

56


Kaar SG, Ragab AA, Kaye SJ, Kilic BA, Jinno T, Goldberg VM et al. (2001).
Rapid repair of titanium particle-induced osteolysis is dramatically reduced in aged
mice. Journal of orthopaedic research : official publication of the Orthopaedic Research
Society 19(2):171-178.
Meyer U, Buhner M, Buchter A, Kruse-Losler B, Stamm T, Wiesmann HP
(2006). Fast element mapping of titanium wear around implants of different surface
structures. Clinical oral implants research 17(2):206-211.
Mints D, Elias C, Funkenbusch P, Meirelles L (2014). Integrity of implant
surface modifications after insertion. Int J Oral Maxillofac Implants 29(1):97-104.
Oh TJ, Yoon J, Misch CE, Wang HL (2002). The causes of early implant
bone loss: myth or science? Journal of periodontology 73(3):322-333.
Papaspyridakos P, Chen CJ, Singh M, Weber HP, Gallucci GO (2012).
Success criteria in implant dentistry: a systematic review. Journal of dental research
91(3):242-248.
Schwarz EM, Benz EB, Lu AP, Goater JJ, Mollano AV, Rosier RN et al.
(2000). Quantitative small-animal surrogate to evaluate drug efficacy in preventing
wear debris-induced osteolysis. Journal of orthopaedic research : official publication of
the Orthopaedic Research Society 18(6):849-855.
Senna P, Antoninha Del Bel Cury A, Kates S, Meirelles L (2013). Surface
Damage on Dental Implants with Release of Loose Particles after Insertion into Bone.
Clinical implant dentistry and related research.
Shin DK, Kim MH, Lee SH, Kim TH, Kim SY (2012). Inhibitory effects of
luteolin on titanium particle-induced osteolysis in a mouse model. Acta biomaterialia
8(9):3524-3531.
Terheyden H, Lang NP, Bierbaum S, Stadlinger B (2012). Osseointegration-communication of cells. Clinical oral implants research 23(10):1127-1135.
Vandeweghe S, Cosyn J, Thevissen E, Van den Berghe L, De Bruyn H
(2012). A 1-year prospective study on Co-Axis implants immediately loaded with a full
ceramic crown. Clinical implant dentistry and related research 14 Suppl 1(e126-138.

57

3 DISCUSSO

A literatura ortopdica demonstrou a influncia das partculas de titnio
provenientes do desgaste de implantes ortopdicos no processo osteoltico, que leva
a falha da prtese e que pode ser exacerbada na presena de endotoxinas
bacterianas. A presena de partculas de titnio na regio peri-implantar dental pode
ser um obstculo para a regenerao ssea, levando a perda de ssea marginal. Este
trabalho teve como objetivo analisar o comportamento dos macrfagos humanos na
presena de partculas de titnio liberados durante a insero de implantes dentrios,
associado a um patgeno da regio periimplantar P. Gingivalis, e analisar a influncia
das partculas de titnio na perda ssea marginal inicial em implantes dentrios.
Aps o contato com partculas de titnio e Lipopolissacardeos de
Porphyromonas gingivalis os macrfagos foram avaliados quanto a viabilidade celular.
Apesar de demonstrar viabilidade celular semelhantes entre os grupos, a expresso
gnica e a produo de citocinas poderia estar alterada, portanto comportamento
celular foi avaliado (Irshad et al., 2013; Zhang et al., 2011). Os resultados da
expresso gnica mostraram que TNF- e IL1- tiveram a expresso mais elevada
aps 12h e IL-6 aps 24 horas, seguindo o padro esperado do processo de
inflamao relacionada a presena de partculas de titnio (Cachinho et al., 2013;
Obando-Pereda et al., 2014). Os grupos com nanopartculas de titnio apresentaram
a expresso mais elevada para todos os genes, o que nos leva a concluir que quanto
menor o tamanho da partcula, maior a reao de inflamatria (Zhang et al., 2011).
Micropartculas de titnio tambm afetaram a expresso dos genes pr-inflamatrios,
confirmando a influncia de micro e nanopartculas de titnio na expresso de
citocinas pr-inflamatrias relacionadas com o processo osteoltico (Goodman et al.,
2014; Zhang et al., 2013).
Para as anlises de produo de citocinas pr-inflamatrias pelos macrfagos,
IL1- teve maior produo em todos grupos analisados. IL1- a citocina produzida

58


para iniciar o processo osteoltico e desempenha um papel importante na expresso
de TNF-, que modula a produo de RANK-L (Receptor activator of nuclear factor
kappa-B ligand), conduzindo a reabsoro ssea (Wei et al., 2009), estes resultados
sugerem que, se a anlise fosse feita em tempos maiores que 48h a produo de
TNF- poderia estar aumentada. Os grupos tratados com nanopartculas de titnio
apresentaram maior produo de citocinas aps 48h.
Pode-se observar que a expresso gnica e produo de citocinas no
apresentaram um comportamento paralelo. Por exemplo, o TNF- foi expresso aps
12h para os grupos N, LM, e LN e a produo de protena no ocorreu aps 12h ou
24h. Outro fator discrepante foi a expresso gnica de IL-6, que foi maior do que as
outras citocinas, entretanto IL1- foi a citocina mais produzida. Outros estudos na
literatura ortopdica descreveram resultados semelhantes ao nosso (Bi et al., 2001;
Obando-Pereda et al., 2014; Schwab et al., 2006; Trindade et al., 2001), mas o motivo
da falta de sincronia entre expresso e produo das citocinas ainda desconhecida.
Uma possvel explicao seria o processo ps-transcricional ou mecanismos
autcrinos que previnem uma reao inflamatria excessiva que pode ser prejudicial
ao organismo (Obando-Pereda et al., 2014).
Alm disso estudos da literatura ortopdica mostraram que as partculas de
titnio contribuem para o aumento da resposta inflamatria, e a presena de
endotoxinas pode exacerbar ainda mais reao inflamatria (Bi et al., 2001). Neste
estudo, a associao de partculas de titnio com um patgeno comum da cavidade
oral, LPS de P. gingivalis foi analisado, e no houve aumento da expresso ou da
produo de citocinas pr-inflamatrias quando associado com micro e nanopartculas
de titnio. LPS de P. gingivalis relatado por ser menos potente comparado a outras
bactrias Gram-negativa quanto a induo de citocinas pr-inflamatrias em vrios
tipos de clulas, incluindo moncitos / macrfagos (Diya et al., 2008; Lu et al., 2001;
Ogawa and Uchida, 1996; Trindade et al., 2001). Esta uma caracterstica que faz
com que esta bactria seja altamente invasiva sem alarmar o sistema imune do
hospedeiro (Holt et al., 1999).

59


Com relao a avaliao histolgica do estudo in vivo, notamos que o grupo
com partculas de titnio aps 1 semana teve mais stios de reabsoro nas trs
primeiras roscas que o grupo controle. Tambm foi possvel observar partculas de
titnio perto da superfcie do implante, em todo o corpo do implante para o grupo com
partculas, mas principalmente na regio cortical (Meyer et al., 2006; Mints et al., 2014;
Senna et al., 2015). A presena de partculas de titnio prximo as reas de
reabsoro ssea um forte indicativo da influncia destas partculas no processo
osteoltico (Kaar et al., 2001). reas de neoformao ssea foram raras tanto no
controle como no teste, e trata-se de um achado previsto para 1 semana aps a
implantao cirrgica (Terheyden et al., 2012). Aps 4 semanas de cicatrizao,
muitas reas de neoformao ssea e reas de reabsoro puderam ser observadas,
no grupo teste e controle, este resultado era esperado para este perodo de avaliao,
pois trata-se do processo de remodelao ssea (Terheyden et al., 2012). O grupo
teste apresentou partculas de titnio com cerca de 20m presos nas regies de
neoformao ssea, e estas partculas estavam a 200m de distncia da superfcie
do implante, o que sugere que as partculas maiores de titnio e/ou aglomerados de
partculas ficaram presos na matriz ssea aps a fagocitose por osteoclastos (Franchi
et al., 2007a).
Para o contato osso/implante (BIC) os resultados mostraram diminuio de BIC
do teste comparada ao controle aps 1 e 4 semanas para a tbia e o fmur. Observouse uma reduo de 23,4% (fmur) e 43,4% (tbia) de valores BIC para teste em
comparao com controle, como resultado de uma maior reabsoro ssea
desencadeada pela presena de partculas de titnio aps 1 semana. Aps 4
semanas, observou-se uma reduo de 20,2% (fmur) e 21,08% (tbia) de valores BIC
para teste em comparao ao controle. Observa-se que ao longe do tempo a perda
ssea diminuiu, sugerindo uma retomada da formao ssea, em outras palavras as
partculas de titnio estariam afetando mais os estgios iniciais da osseointegrao
com uma retomada da formao ssea (Galindo-Moreno et al., 2014). Na tbia, foram
usados 3 mg de partculas de titnio, e no fmur foi usado 1 mg. Os stios que

60


receberam mais partculas de titnio apresentaram maior reabsoro ssea,
sugerindo uma possvel dose-dependncia (Goodman et al., 2014; Shin et al., 2012).
O comportamento de dose-dependncia neste estudo no pode ser confirmado, pois
a tbia possui mais osso cortical e o fmur estruturas mais trabeculares, o que poderia
influenciar na velocidade de migrao das clulas de defesa.
A avaliao dos principais genes relacionados com a formao e remodelao
ssea uma maneira de compreender os mecanismos relacionados com a perda
ssea. O gene Runt-related transcription factor 2 (RUNX2) est relacionado com a
presena de osteoblastos e precursor de genes relacionados com a formao de
matriz ssea como ocitocina (OCN), osteopontina (OPN), colgeno 1 (ColA1),
sialoproteina ssea (BSP), fosfatase alcalina (ALP) (Kirkham GR, 2007). OCN pode
tambm estar relacionado com a atividade dos osteoclastos. Osterix (OSX) um gene
especfico para a ossificao dos osteoblastos e a protena morfogentica ssea tipo
2 (BMP-2) um fator de crescimento relacionado com formao ssea. O
paratohormnio (PTH) est associado a um aumento na concentrao de clcio inico
(Ca2 +) removido do osso (Granchi et al., 2010; Gyurko et al., 2005).
A anlise histolgica e a expresso de genes osteognicos do estudo in vivo
podem ser correlacionadas. Aps 3 dias de avaliao houve um aumento da
expresso de RUNX2, OSX e PTH para o grupo de teste que confirmado na anlise
histolgica aps 7 dias, os resultados mostram presena de reabsoro ssea nas
trs primeiras roscas para grupo de teste e neoformao ssea na regio do endsteo.
Aps 7 dias uma diminuio da expresso dos genes responsveis pela produo de
matriz ssea foi observada BSP, COL1A1, OCN, ALP e dos genes relacionados a
calcificao ssea RUNX-2, OSX e um aumento na expresso dos genes
relacionados com a liberao de clcio PTH e OPN o que sugere reabsoro ssea.
O aumento na expresso de BMP-2 aps 7 dias para o teste pode indicar o incio do
recrutamento de osteoblastos para o incio do processo de formao do ssea, que
foi possvel observar nas imagens histolgicas aps 4 semanas a formao de osso
no grupo de teste.

61


Nos nossos resultados pudemos observar que a presena de partculas de
titnio pode afetar as clulas THP-1 com relao a expresso gnica e produo de
citocinas pr-inflamatrias relacionadas ao processo osteoltico e que a presena de
endotoxinas provenientes de P. Gingivalis no aumentou a produo dessas citocinas.
E com o estudo in vivo foi confirmamos que as partculas de titnio podem afetar os
estgios iniciais de ossseointegrao. A reabsoro ssea marginal um ponto crtico
para a manuteno do tratamento de implantes dentrios. O manejo e controle dos
fatores envolvidos no incio deste processo osteolico essencial para o bom
prognstico de implantes dentrios

4 CONCLUSO

A presena de micro e nanopartculas de titnio estimula a expresso e
produo de citocinas pr-inflamatrias relacionadas ao processo osteoltico, e as
partculas de menor tamanho exercem maior influncia nesta reao. A associao
de partculas de titnio com lipopolissacharideos de P.gingivalis no aumentou a
expresso gnica das citocinas pr- inflamatrias e diminuiu a produo em
comparao com os grupos tratados somente com partculas de titnio. O estgio
iniciail da osseointegrao afetado pela presena de partculas de titnio no osso
cortical e trabecular. Com base nos resultados deste estudo, apresentamos uma nova
etiologia para perda ssea marginal nos estgios inciais da osseointegrao.

62


Referncias

1.
Albrektsson T, Sennerby L. [Direct bone anchorage of oral implants: clinical and
experimental considerations of the concept of osseointegration]. Parodontologie.
1990;1(4):307-20.
2.
Neoh KG, Hu X, Zheng D, Kang ET. Balancing osteoblast functions and bacterial
adhesion on functionalized titanium surfaces. Biomaterials. 2012;33(10):2813-22.
3.
Albrektsson T, Sennerby L. Direct bone anchorage of oral implants: clinical and
experimental considerations of the concept of osseointegration. The International
journal of prosthodontics. 1990;3(1):30-41.
4.
Albrektsson T. Direct bone anchorage of dental implants. The Journal of
prosthetic dentistry. 1983;50(2):255-61.
5.
Albrektsson T, Buser D, Sennerby L. Crestal bone loss and oral implants. Clin
Implant Dent Relat Res. 2012;14(6):783-91.
6.
Wennerberg A, Albrektsson T. Effects of titanium surface topography on bone
integration: a systematic review. Clinical oral implants research. 2009;20 Suppl 4:17284.
7.
Albrektsson T, Jansson T, Lekholm U. Osseointegrated dental implants. Dental
clinics of North America. 1986;30(1):151-74.
8.
Borsari V, Giavaresi G, Fini M, Torricelli P, Salito A, Chiesa R, et al. Physical
characterization of different-roughness titanium surfaces, with and without
hydroxyapatite coating, and their effect on human osteoblast-like cells. Journal of
biomedical materials research Part B, Applied biomaterials. 2005;75(2):359-68.
9.
Terheyden H, Lang NP, Bierbaum S, Stadlinger B. Osseointegration-communication of cells. Clinical oral implants research. 2012;23(10):1127-35.
10. Albrektsson T, Zarb G, Worthington P, Eriksson AR. The long-term efficacy of
currently used dental implants: a review and proposed criteria of success. The
International journal of oral & maxillofacial implants. 1986;1(1):11-25.
11. Sykaras N, Iacopino AM, Marker VA, Triplett RG, Woody RD. Implant materials,
designs, and surface topographies: their effect on osseointegration. A literature review.
The International journal of oral & maxillofacial implants. 2000;15(5):675-90.
12. Sutter F, Schroeder A, Buser DA. The new concept of ITI hollow-cylinder and
hollow-screw implants: Part 1. Engineering and design. The International journal of oral
& maxillofacial implants. 1988;3(3):161-72.
13. Carr AB, Beals DW, Larsen PE. Reverse-torque failure of screw-shaped implants
in baboons after 6 months of healing. The International journal of oral & maxillofacial
implants. 1997;12(5):598-603.
14. Zhang Y, Yu W, Jiang X, Lv K, Sun S, Zhang F. Analysis of the cytotoxicity of
differentially sized titanium dioxide nanoparticles in murine MC3T3-E1 preosteoblasts.
Journal of materials science Materials in medicine. 2011;22(8):1933-45.
15. Goodman SB, Konttinen YT, Takagi M. Joint replacement surgery and the innate
immune system. Journal of long-term effects of medical implants. 2014;24(4):253-7.

63


16. Wei D, Zhou Y, Yang C. Structure, cell response and biomimetic apatite induction
of gradient TiO2-based/nano-scale hydrophilic amorphous titanium oxide containing Ca
composite coatings before and after crystallization. Colloids and surfaces B,
Biointerfaces. 2009;74(1):230-7.
17. Bi Y, Van De Motter RR, Ragab AA, Goldberg VM, Anderson JM, Greenfield EM.
Titanium particles stimulate bone resorption by inducing differentiation of murine
osteoclasts. The Journal of bone and joint surgery American volume. 2001;83-A(4):5018.
18. Ragab AA, Van De Motter R, Lavish SA, Goldberg VM, Ninomiya JT, Carlin CR, et al.
Measurement and removal of adherent endotoxin from titanium particles and implant
surfaces. Journal of orthopaedic research : official publication of the Orthopaedic
Research Society. 1999;17(6):803-9.
19. Meyer U, Buhner M, Buchter A, Kruse-Losler B, Stamm T, Wiesmann HP. Fast
element mapping of titanium wear around implants of different surface structures.
Clinical oral implants research. 2006;17(2):206-11.
20. Shin DK, Kim MH, Lee SH, Kim TH, Kim SY. Inhibitory effects of luteolin on
titanium particle-induced osteolysis in a mouse model. Acta biomaterialia.
2012;8(9):3524-31.
21. Obando-Pereda GA, Fischer L, Stach-Machado DR. Titanium and zirconia particleinduced pro-inflammatory gene expression in cultured macrophages and osteolysis,
inflammatory hyperalgesia and edema in vivo. Life sciences. 2014;97(2):96-106.
22. Senna P, Antoninha Del Bel Cury A, Kates S, Meirelles L. Surface Damage on
Dental Implants with Release of Loose Particles after Insertion into Bone. Clinical
implant dentistry and related research. 2015;17(4):681-92.
23. Mints D, Elias C, Funkenbusch P, Meirelles L. Integrity of implant surface
modifications after insertion. The International journal of oral & maxillofacial implants.
2014;29(1):97-104.
24. Flatebo RS, Hol PJ, Leknes KN, Kosler J, Lie SA, Gjerdet NR. Mapping of titanium
particles in peri-implant oral mucosa by laser ablation inductively coupled plasma mass
spectrometry and high-resolution optical darkfield microscopy. Journal of oral
pathology & medicine : official publication of the International Association of Oral
Pathologists and the American Academy of Oral Pathology. 2011;40(5):412-20.
25. Olmedo DG, Tasat DR, Evelson P, Guglielmotti MB, Cabrini RL. Biological response
of tissues with macrophagic activity to titanium dioxide. Journal of biomedical materials
research Part A. 2008;84(4):1087-93.
26. Rutar A, Lang NP, Buser D, Burgin W, Mombelli A. Retrospective assessment of
clinical and microbiological factors affecting periimplant tissue conditions. Clinical oral
implants research. 2001;12(3):189-95.
27. Leonhardt A, Bergstrom C, Lekholm U. Microbiologic diagnostics at titanium
implants. Clinical implant dentistry and related research. 2003;5(4):226-32.
28. Lee KH, Maiden MF, Tanner AC, Weber HP. Microbiota of successful
osseointegrated dental implants. Journal of periodontology. 1999;70(2):131-8.

64


29. Mombelli A, Marxer M, Gaberthuel T, Grunder U, Lang NP. The microbiota of
osseointegrated implants in patients with a history of periodontal disease. Journal of
clinical periodontology. 1995;22(2):124-30.
30. Lang NP, Berglundh T, Working Group 4 of Seventh European Workshop on P.
Periimplant diseases: where are we now?--Consensus of the Seventh European
Workshop on Periodontology. Journal of clinical periodontology. 2011;38 Suppl 11:17881.
31. Cochran DL, Nummikoski PV, Schoolfield JD, Jones AA, Oates TW. A prospective
multicenter 5-year radiographic evaluation of crestal bone levels over time in 596 dental
implants placed in 192 patients. Journal of periodontology. 2009;80(5):725-33.
32. Kirkham GR CS. Genes and proteins involved in the regulation of osteogenesis.
Ashammakhi N RR, Chiellini E, editors. , editor: Springer; 2007.
33. Gyurko R, Shoji H, Battaglino RA, Boustany G, Gibson FC, 3rd, Genco CA, et al.
Inducible nitric oxide synthase mediates bone development and P. gingivalis-induced
alveolar bone loss. Bone. 2005;36(3):472-9.
34. Granchi D, Ochoa G, Leonardi E, Devescovi V, Baglio SR, Osaba L, et al. Gene
expression patterns related to osteogenic differentiation of bone marrow-derived
mesenchymal stem cells during ex vivo expansion. Tissue engineering Part C, Methods.
2010;16(3):511-24.
35. Olmedo DG, Tasat DR, Evelson P, Guglielmotti MB, Cabrini RL. Biological
response of tissues with macrophagic activity to titanium dioxide. J Biomed Mater
Res A. 2008 Mar 15;84(4):1087-93. PubMed PMID: 17685404.
36. O'Brien-Simpson NM, Burgess K, Brammar GC, Darby IB, Reynolds EC.
Development and evaluation of a saliva-based chair-side diagnostic for the detection of
Porphyromonas gingivalis. Journal of oral microbiology. 2015;7:29129.
37. Schwab LP, Xing Z, Hasty KA, Smith RA. Titanium particles and surface-bound LPS
activate different pathways in IC-21 macrophages. Journal of biomedical materials
research Part B, Applied biomaterials. 2006;79(1):66-73.
38. Jin S, Park JY, Hong JM, Kim TH, Shin HI, Park EK, et al. Inhibitory effect of (-)epigallocatechin gallate on titanium particle-induced TNF-alpha release and in vivo
osteolysis. Experimental & molecular medicine. 2011;43(7):411-8.
39. Han SG, Newsome B, Hennig B. Titanium dioxide nanoparticles increase
inflammatory responses in vascular endothelial cells. Toxicology. 2013;306:1-8.
40. Montiel-Davalos A, Ventura-Gallegos JL, Alfaro-Moreno E, Soria-Castro E, GarciaLatorre E, Cabanas-Moreno JG, et al. TiO(2) nanoparticles induce dysfunction and
activation of human endothelial cells. Chemical research in toxicology. 2012;25(4):92030.
41. Zhang Y, Yu S, Xiao J, Hou C, Li Z, Zhang Z, et al. Wear particles promote endotoxin
tolerance in macrophages by inducing interleukin-1 receptor-associated kinase-M
expression. Journal of biomedical materials research Part A. 2013;101(3):733-9.
42. Diya Z, Lili C, Shenglai L, Zhiyuan G, Jie Y. Lipopolysaccharide (LPS) of
Porphyromonas gingivalis induces IL-1beta, TNF-alpha and IL-6 production by THP-1

65


cells in a way different from that of Escherichia coli LPS. Innate immunity.
2008;14(2):99-107.
43. Irshad M, Scheres N, Crielaard W, Loos BG, Wismeijer D, Laine ML. Influence of
titanium on in vitro fibroblast-Porphyromonas gingivalis interaction in peri-implantitis.
Journal of clinical periodontology. 2013;40(9):841-9.
44. Cachinho SC, Pu F, Hunt JA. Cytokine secretion from human peripheral blood
mononuclear cells cultured in vitro with metal particles. Journal of biomedical materials
research Part A. 2013;101(4):1201-9.
45. Wei S, Kitaura H, Zhou P, Ross FP, Teitelbaum SL. IL-1 mediates TNF-induced
osteoclastogenesis. The Journal of clinical investigation. 2005;115(2):282-90.
46. Trindade MC, Lind M, Sun D, Schurman DJ, Goodman SB, Smith RL. In vitro
reaction to orthopaedic biomaterials by macrophages and lymphocytes isolated from
patients undergoing revision surgery. Biomaterials. 2001;22(3):253-9.
47. Lu J, Yang Z, Jiang J, Wang Z, Zhu P. Regulative effect of P38MAPK on release of
TNFalpha and NO from alveolar macrophages under endotoxin stimulation. Chinese
journal of traumatology = Zhonghua chuang shang za zhi / Chinese Medical Association.
2001;4(2):75-7.
48. Ogawa T, Uchida H. Differential induction of IL-1 beta and IL-6 production by the
nontoxic lipid A from Porphyromonas gingivalis in comparison with synthetic
Escherichia coli lipid A in human peripheral blood mononuclear cells. FEMS immunology
and medical microbiology. 1996;14(1):1-13.
49. Holt SC, Kesavalu L, Walker S, Genco CA. Virulence factors of Porphyromonas
gingivalis. Periodontology 2000. 1999;20:168-238.
50. Balshi TJ, Wolfinger GJ, Stein BE, Balshi SF. A Long-term Retrospective Analysis of
Survival Rates of Implants in the Mandible. The International journal of oral &
maxillofacial implants. 2015;30(6):1348-54.
51. Vandeweghe S, Cosyn J, Thevissen E, Van den Berghe L, De Bruyn H. A 1-year
prospective study on Co-Axis implants immediately loaded with a full ceramic crown.
Clinical implant dentistry and related research. 2012;14 Suppl 1:e126-38.
52. Oh TJ, Yoon J, Misch CE, Wang HL. The causes of early implant bone loss: myth or
science? Journal of periodontology. 2002;73(3):322-33.
53. Galindo-Moreno P, Leon-Cano A, Ortega-Oller I, Monje A, F OV, Catena A. Marginal
bone loss as success criterion in implant dentistry: beyond 2 mm. Clinical oral implants
research. 2014.
54. Fransson C, Lekholm U, Jemt T, Berglundh T. Prevalence of subjects with
progressive bone loss at implants. Clinical oral implants research. 2005;16(4):440-6.
55. Senna P, Antoninha Del Bel Cury A, Kates S, Meirelles L. Surface Damage on
Dental Implants with Release of Loose Particles after Insertion into Bone. Clinical
implant dentistry and related research. 2013.
56. Kaar SG, Ragab AA, Kaye SJ, Kilic BA, Jinno T, Goldberg VM, et al. Rapid repair of
titanium particle-induced osteolysis is dramatically reduced in aged mice. Journal of

66


orthopaedic research : official publication of the Orthopaedic Research Society.
2001;19(2):171-8.
57. Schwarz EM, Benz EB, Lu AP, Goater JJ, Mollano AV, Rosier RN, et al. Quantitative
small-animal surrogate to evaluate drug efficacy in preventing wear debris-induced
osteolysis. Journal of orthopaedic research : official publication of the Orthopaedic
Research Society. 2000;18(6):849-55.
58. Papaspyridakos P, Chen CJ, Singh M, Weber HP, Gallucci GO. Success criteria in
implant dentistry: a systematic review. Journal of dental research. 2012;91(3):242-8.
59. Franchi M, Orsini E, Martini D, Ottani V, Fini M, Giavaresi G, et al. Destination of
titanium particles detached from titanium plasma sprayed implants. Micron.
2007;38(6):618-25.
60. Franchi M, Bacchelli B, Giavaresi G, De Pasquale V, Martini D, Fini M, et al.
Influence of different implant surfaces on peri-implant osteogenesis: histomorphometric
analysis in sheep. Journal of periodontology. 2007;78(5):879-88.