Vous êtes sur la page 1sur 348

DIRETRIZES SBD | 2015-2016

2015-2016

Diretrizes SBD 2015-2016 - CAP 00.indd 1

13/10/2015 16:09:27

Sumrio

Parte 1 | Princpios Bsicos, Avaliao e


Diagnstico do Diabetes Mellitus, 1

Parte 2 | Complicaes, Doenas Relacionadas


e Decorrentes do Diabetes Mellitus, 123

Epidemiologia e Preveno, 3

Diagnstico da Doena Coronariana Silenciosa, 125

Classificao Etiolgica, 7

Retinopatia Diabtica, 129

Mtodos e Critrios para o Diagnstico, 11

Neuropatia Diabtica, 133

anlise dos Marcadores de Resistncia Insulina


na Clnica Diria, 13

Diagnstico Precoce do P Diabtico, 137

avaliao do Controle Glicmico, 19

Crises Hiperglicmicas agudas, 166

Mtodos para avaliao do Controle Glicmico, 25

Diabetes e Substncias antipsicticas, 172

Monitoramento da Glicemia na Doena Renal Crnica, 33

Doena arterial Obstrutiva Perifrica | avaliao


e Conduta, 177

Gerenciamento Eletrnico do Diabetes | Uso da


Tecnologia para Melhor Controle Metablico do
Diabetes, 40

Doena Renal do Diabetes, 150

Manifestaes Reumatolgicas, 184


Diabetes e Doena Periodontal, 190

Diabetes Mellitus Tipo 2 no Jovem, 51

HIV, Diabetes e lipodistrofia, 196

Sndrome Metablica em Crianas e adolescentes, 58

Depresso | Diagnstico e Conduta, 201

alvos no Controle Clnico e Metablico de Crianas e


adolescentes com Diabetes Mellitus Tipo 1, 62

Diabetes e alteraes Cognitivas | Mecanismos e


Conduta, 207

Diabetes Mellitus Gestacional | Diagnstico, Tratamento


e acompanhamento Ps-Gestao, 69

Diabetes Mellitus Ps-Transplante, 211

Disglicemias na Gestao | Recomendaes para


Preparo e acompanhamento da Mulher com
Diabetes durante a Gravidez, 74
avaliao da Funo Endotelial e Marcadores
laboratoriais de Estresse Oxidativo no Diabetes, 82
Transtornos alimentares | Diagnstico e Conduta, 87
Princpios para Orientao Nutricional no Diabetes
Mellitus, 91
Hemoglobina Glicada | Manifestaes Clnicas, 111
Memria Metablica e Epigentica, 118

Diretrizes SBD 2015-2016 - CAP 00.indd 11

Infeces no Paciente com Diabetes, 214

Parte 3 | Tratamento do Diabetes Mellitus


e suas Complicaes, 221
Educao em Diabetes, 223
Como Prescrever o Exerccio no Tratamento do
Diabetes Mellitus, 230
Medicamentos no Tratamento do Diabetes Mellitus
Tipo 2 | Como Selecion-los de acordo com as
Caractersticas Clnicas dos Pacientes, 236
Uso da Insulina no Tratamento do Diabetes
Mellitus Tipo 1, 243

13/10/2015 16:09:35

XII Diretrizes SBD | 2015-2016

Uso da Insulina no Tratamento do Diabetes


Mellitus Tipo 2, 250

Tratamento de Dislipidemia associada ao Diabetes


Mellitus, 307

Prticas Seguras para o Preparo e aplicao


de Insulina, 256

Preveno Primria e Secundria da Doena


Macrovascular, 314

Indicaes e Uso da Bomba de Infuso de Insulina, 267

Tratamento com Insulina em Pacientes


Internados, 317

Tratamento Combinado | Frmacos Orais e Insulina


no Diabetes Mellitus Tipo 2, 272
Uso de antiagregantes Plaquetrios, 279
Tratamento de Crianas e adolescentes com Diabetes
Mellitus Tipo 1, 284

Preparo Pr e Ps-Operatrio do Paciente com


Diabetes Mellitus, 320
Cirurgia Baritrica, 324
Transplante de Pncreas, 329

Tratamento de Pacientes Idosos, 294

Transplante de Clulas-Tronco, 331

Tratamento da Hipertenso arterial, 301

Indicao de Vacinas, 335

Diretrizes SBD 2015-2016 - CAP 00.indd 12

13/10/2015 16:09:35

O GEN | Grupo Editorial Nacional, a maior plataforma editorial no segmento CTP (cient
fico, tcnico e profissional), publica nas reas de sade, cincias exatas, jurdicas, sociais
aplicadas, humanas e de concursos, alm de prover servios direcionados a educao,
capacitao mdica continuada e preparao para concursos. Conhea nosso catlogo,
composto por mais de cinco mil obras e trs mil ebooks, em www.grupogen.com.br.
As editoras que integram o GEN, respeitadas no mercado editorial, construram catlogos
inigualveis, com obras decisivas na formao acadmica e no aperfeioamento de vrias
geraes de profissionais ede estudantes de Administrao, Direito, Engenharia, Enfer
magem, Fisioterapia, Medicina, Odontologia, Educao Fsica e muitas outras cincias,
tendo se tornado sinnimo de seriedade e respeito.
Nossa misso prover o melhor contedo cientfico e distribulo de maneira flexvel e
conveniente, a preosjustos, gerando benefcios e servindo a autores, docentes, livreiros,
funcionrios, colaboradores e acionistas.
Nosso comportamento tico incondicional e nossa responsabilidade social e ambiental
so reforados pela natureza educacional de nossa atividade, sem comprometer o cresci
mento contnuo e a rentabilidade do grupo.

Diretrizes SBD 2015-2016 - CAP 00.indd 2

13/10/2015 16:09:29

Diretrizes SBD 2015-2016 - CAP 00.indd 3

13/10/2015 16:09:32

Os autores deste livro e a AC FARMACUTICA lTDa. empenharam seus melhores esforos para assegurar que as informaes
e os procedimentos apresentados no texto estejam em acordo com os padres aceitos poca da publicao, e todos os
dados foram atualizados pelos autores at a data da entrega dos originais editora. Entretanto, tendo em conta a evoluo
das cincias da sade, as mudanas regulamentares governamentais e o constante fluxo de novas informaes sobre
teraputica medicamentosa e reaes adversas a frmacos, recomendamos enfaticamente que os leitores consultem
sempre outras fontes fidedignas, de modo a se certificarem de que as informaes contidas neste livro esto corretas e
de que no houve alteraes nas dosagens recomendadas ou na legislao regulamentadora. Adicionalmente, os leitores
podem buscar por possveis atualizaes da obra em http://gen-io.grupogen.com.br.
Os autores e a editora se empenharam para citar adequadamente e dar o devido crdito a todos os detentores de
direitos autorais de qualquer material utilizado neste livro, dispondo-se a possveis acertos posteriores caso, inadvertida e
involuntariamente, a identificao de algum deles tenha sido omitida.
Direitos exclusivos para a lngua portuguesa
Copyright 2016 by Sociedade Brasileira de Diabetes
AC FARMACUTICA LTDA.
Uma editora integrante do GEN | Grupo Editorial Nacional
Travessa do Ouvidor, 11
Rio de Janeiro RJ CEP 20040-040
Tels.: (21) 3543-0770/(11) 5080-0770 | Fax: (21) 3543-0896
www.acfarmaceutica.com.br | www.grupogen.com.br | editorial.saude@grupogen.com.br
Reservados todos os direitos. proibida a duplicao ou reproduo deste volume, no todo ou em parte, em quaisquer
formas ou por quaisquer meios (eletrnico, mecnico, gravao, fotocpia, distribuio pela Internet ou outros), sem
permisso, por escrito, da aC FaRMaCUTICA lTDa.
Editorao eletrnica: adielson anselme
Ficha catalogrfica
D635

Diretrizes da Sociedade Brasileira de Diabetes (2015-2016) / Adolfo Milech...[et. al.]; organizao Jos Egidio Paulo de Oliveira, Srgio
Vencio - So Paulo: A.C. Farmacutica, 2016.
il.
ISBN 978-85-8114-307-1
1. Diabetes Mellitus. 2. Diabetes - Diagnstico. 3. Diabetes - Tratamento. I. Milech, Adolfo. II. Oliveira, Jos Egidio Paulo de. III. Vencio, Srgio.

15-25971

Diretrizes SBD 2015-2016 - CAP 00.indd 4

CDD: 616.462
CDU: 616.379-008.64

13/10/2015 16:09:32

SBD
Sociedade Brasileira de Diabetes
DIRETORIa | GESTO 2015-2016
Presidente

Segundo Secretrio

Walter Jos Minicucci


Endereo:
Rua afonso Braz, 579
conjuntos 72/74
Vila Nova Conceio
So Paulo SP
CEP 04511-011

luiz antonio de araujo

Vice-Presidentes

Conselho fiscal

Hermelinda Cordeiro Pedrosa


luiz alberto andreotti Turatti
Marcos Cauduro Troian
Rosane Kupfer
Ruy lyra da Silva Filho

antonio Carlos Pires


Denise Reis Franco
levimar Rocha arajo

Tesoureiro
antonio Carlos lerario
Segundo Tesoureiro
Edson Perrotti dos Santos

Suplente
Raimundo Sotero de Menezes Filho

Primeiro Secretrio
Domingos augusto Malerbi

ORGaNIZaDORES
Jos Egidio Paulo de Oliveira
Srgio Vencio

Diretrizes SBD 2015-2016 - CAP 00.indd 5

13/10/2015 16:09:33

VI Diretrizes SBD | 2015-2016

aUTORES
adolpho Milech
adriana Perez angelucci
airton Golbert
alessandra Matheus
alexandre Jos Faria Carrilho
ana Claudia Ramalho
ana Cristina Braccini de aguiar
ana Maria Calabria Cardoso
anelena Soccal Seyffarth
anita Sachs
anna Paula Camargo
antonio Carlos lerario
antonio Carlos Pires
antonio R. Ferreira
antonio Roberto Chacra
augusto Pimazoni Netto
Balduino Tschiedel
Belmiro Gonalves Pereira
Bernardo lo Wajchenberg
Brenno astiarraga
Bruno Geloneze
Camila Barcia
Carlos antonio Negrato
Carlos Eduardo Barra Couri
Carlos Eduardo Virgini Magalhes
Caroline Kaercher Kramer
Celeste Elvira Viggiano
Charles andr
Cludia lcia Barros de Castro
Claudia Mauricio Pieper
Cludio Gil S. arajo
Cristiane Bauermann leito
Daniel Deluiz
Daniel laguna Neto
Daniela de almeida
David Isaac
Dbora B. araujo de Pina Cabral
Debora Bohnen Guimares
Deise Regina Baptista
Denise Reis Franco
Durval Damiani
Edgard Dvila Niclewicz
Eduarda de Oliveira S
Eduardo Vera Tibiri
Elaine Christine Dantas Moiss
Elza Muscelli

Diretrizes SBD 2015-2016 - CAP 00.indd 6

Fabrcio Junqueira de Melo


Fernanda Castelo Branco
Fernanda Mazza
Fernando Csar Robles
Gerson Canedo de Magalhes
Gisele Rossi Goveia
Graa Maria de Carvalho Camara
Graziela Coelho amato Spado
Hermelinda Cordeiro Pedrosa
Iracema Calderon de andrade
Ivan dos Santos Ferraz
Janice Sepulveda Reis
Joo Felipe Mota
Joo Roberto de S
Jorge Eduardo da Silva Soares Pinto
Jorge luiz Gross
Jos Carlos da lima Jnior
Jos Egidio Paulo de Oliveira
Jos Petronio loureno Dias
Kariane aroeira Krinas Davison
larcio Joel Franco
leo Zagury
leida Reny Borges Bressane
lenita Zajdenverg
letcia Campos
levimar Rocha arajo
lvia Ferreira da Costa
luciana Bruno
luciano Oliveira
luis Eduardo P. Calliari
luis Henrique Canani
Marcelo Bertolucci
Marcia Camargo de Oliveira
Marcia Nery
Mrcia Puales
Mrcio C. Mancini
Marcio Krakauer
Marcio Miname
Marco andr Mezzasalma
Marco antonio Brasil
Marcos antnio Tambascia
Marcos vila
Marcos Tadashi Kakitani Toyoshima
Maria Gabriela Secco Cavicglioli
Maria Goretti Burgos
Maria Isabel Favaro

Maria lucia Giannella


Maria Regina Torloni
Maria Tereza Zanella
Marilia de Brito Gomes
Mario Saad
Maristela Bassi Strufald
Marlene Merino alvarez
Mauricio levy Neto
Mauro Sancovski
Mauro Scharf
Melanie Rodacki
Milton Csar Foss
Mirela Jobim de azevedo
Monica Gabbay
Monica Oliveira
Nanci Silva
Nelson Rassi
Paula M. Pascali
Paula Maia
Paulo Morales
Raul Dias Santos
Regina Clia Santiago Moiss
Renan Montenegro Junior
Renata Maria Noronha
Renata Szundy Berardo
Roberta arnoldi Cobas
Roberto luiz Zagury
Roseli Sinkvicio Monteiro de Barros
Rezende
Rosiane Mattar
Rosita Gomes Fontes
Ruy lyra da Silva Filho
Sandra Pinho Silveiro
Saulo Cavalcanti
Sergio atala Dib
Srgio Vencio
Sharon Nina admoni
Silmara leite
Silvana Emilia Speggiorin
Silvia Ramos
Sonia aurora alves Grossi
Sonia de Castilho
Sonia Fusaro
Tarcila Beatriz Ferraz de Campos
Valeria Diniz Duarte Piliakas
Vieira Francisco
Walter Jos Minicucci

13/10/2015 16:09:33

apresentao

a Sociedade Brasileira de Diabetes (SBD) lana anualmente as Diretrizes com o objetivo


de acompanhar os novos conhecimentos cientficos na rea de Diabetologia e entregar
sociedade mdica o que h de mais atual no tema. Esse ano no foi diferente; escrita
por profissionais com grande experincia clnica e conhecimento acadmico, sob coordenao editorial dos Drs. Jos Egidio Paulo de Oliveira e Srgio Vencio, a obra est se
tornando uma ferramenta cada vez mais importante para discutir temas relacionados
ao diabetes, tanto no meio acadmico como em hospitais e ambulatrios mdicos, e
conta com a difuso e o apoio da indstria, parceira nessa ao educativa. a cada ano, ao
receber o reconhecimento de mdicos e profissionais da sade quanto qualidade e
atualidade da informao disponibilizada nas Diretrizes, ns, da SBD, temos certeza de
estarmos contribuindo com os objetivos da Sociedade de trazer aperfeioamento profissional e assistncia mdica no tratamento do diabetes no Brasil.

Walter Jos Minicucci


Presidente da SBD Gesto 2015-2016

Diretrizes SBD 2015-2016 - CAP 00.indd 7

13/10/2015 16:09:34

Diretrizes SBD 2015-2016 - CAP 00.indd 8

13/10/2015 16:09:34

Grau de Recomendao
e Fora de Evidncia
Em razo da dificuldade em conseguir referncias bibliogrficas, a Sociedade Brasileira de Diabetes ir considerar nos artigos o posicionamento referente ao grau de recomendao, no julgando necessrio em todos o de nvel de evidncia
cientfica por tipo de estudo.

Grau de recomendao
A. Estudos experimentais ou observacionais de melhor consistncia.
B. Estudos experimentais ou observacionais de menor consistncia.
C. Relatos de casos (estudos no controlados).
D. Opinio desprovida de avaliao crtica, baseada em consensos, estudos fisiolgicos ou modelos animais.

Nvel de evidncia cientfica por tipo de estudo


Oxford Centre for Evidence-Based Medicine (maio de 2001)/Projeto Diretrizes aMB-CFM

Grau de
recomendao

Nvel de
Tratamento/
evidncia preveno-etiologia

1A

A
1B

1C

Diagnstico
preferencial/
prevalncia de
sintomas

Prognstico

Diagnstico

Reviso sistemtica
(com homogeneidade)
de ensaios clnicos
controlados e
randomizados

Reviso cientfica
(com homogeneidade)
de coortes desde o
incio da doena.
Critrio prognstico
validado em diversas
populaes

Reviso cientfica
(com homogeneidade)
de estudos diagnsticos
nvel 1. Critrio
diagnstico de estudo
nvel 1B em diferentes
centros clnicos

Reviso cientfica
(com homogeneidade)
de estudo de coorte
(contempornea ou
prospectiva)

Ensaio clnico controlado


e randomizado com
intervalo de confiana
estreito

Coorte, desde o incio


da doena, com perda
< 20%. Critrio
prognstico validado
em uma nica
populao

Coorte validada, com


bom padro de
referncia. Critrio
diagnstico testado em
um nico centro clnico

Estudo de coorte
(contempornea ou
prospectiva) com
poucas perdas

Resultados teraputicos
do tipo tudo ou nada

Srie de casos do tipo


tudo ou nada

Sensibilidade e
especificidade prximas
de 100%

Srie de casos do tipo


tudo ou nada
(continua)

Diretrizes SBD 2015-2016 - CAP 00.indd 9

13/10/2015 16:09:35

X Diretrizes SBD | 2015-2016

Nvel de evidncia cientfica por tipo de estudo


Oxford Centre for Evidence-Based Medicine (maio de 2001)/Projeto Diretrizes aMB-CFM (continuao)

Grau de
recomendao

Nvel de
Tratamento/
evidncia preveno-etiologia

Prognstico

Diagnstico

Reviso sistemtica
(com homogeneidade)
com estudos coorte

Reviso sistemtica
(com homogeneidade)
de coortes histricas
(retrospectivas) ou de
segmentos de casos
no tratados de grupo
de controle de ensaio
clnico randomizado

Reviso sistemtica
(com homogeneidade)
de estudos de
diagnsticos de
nvel > 2

Reviso sistemtica
(com homogeneidade)
de estudos sobre
diagnstico diferencial
de nvel maior ou
igual 2B

Estudo de coorte
(incluindo ensaio clnico
randomizado de menor
qualidade)

Estudo de coorte
histrica. Seguimento
de pacientes no
tratados de grupo de
controle de ensaio
clnico randomizado.
Critrio prognstico
derivado ou validado
somente em amostras
fragmentadas

Coorte exploratrio com


bom padro de
referncia. Critrio
diagnstico derivado ou
validado em amostras
fragmentadas ou banco
de dados

Estudo de coorte
histrica (coorte
retrospectiva) ou com
seguimento casos
comprometidos
(nmero grande de
perdas)

Observao de
resultados
teraputicos
(outcomes research).
Estudo ecolgico

Observao de
evolues clnicas
(outcomes research)

2A

2B

2C

3A

Diagnstico
preferencial/
prevalncia de
sintomas

Estudo ecolgico

Reviso sistemtica
(com homogeneidade)
de estudos
casos-controle

Reviso sistemtica
(com homogeneidade)
de estudos diagnsticos
de nvel maior ou
igual 3B

Reviso sistemtica
(com homogeneidade)
de estudos de nvel
maior ou igual 3B

Estudo caso-controle

Seleo no
consecutiva de casos,
padro de referncia
aplicado de forma
pouco consistente

Coorte com seleo


no consecutiva de
casos, ou populao
de estudo muito
limitada

Estudo caso controle;


ou padro de
referncia pobre ou
no independente

Srie de casos, ou
padro de referncia
superado

3B

Srie de casos
(e coorte prognstica
de menor qualidade)

Relato de casos
(incluindo coorte ou
caso-controle de
menor qualidade)

Opinio de especialista sem avaliao crtica ou baseada em matrias bsicas (estudo fisiolgico ou
estudo com animais)

Diretrizes SBD 2015-2016 - CAP 00.indd 10

13/10/2015 16:09:35

DIRETRIZES SBD | 2015-2016

2015-2016

Diretrizes SBD 2015-2016 - CAP 00.indd 13

13/10/2015 16:09:35

Diretrizes SBD 2015-2016 - CAP 00.indd 14

13/10/2015 16:09:36

Parte 1

Princpios Bsicos,
Avaliao e Diagnstico do
Diabetes Mellitus

Diretrizes SBD 2015-2016 - CAP 01.indd 1

05/10/2015 06:39:04

Diretrizes SBD 2015-2016 - CAP 01.indd 2

05/10/2015 06:39:04

Epidemiologia e Preveno
Magnitude do problema
Uma epidemia de diabetes mellitus (DM) est em curso. Atualmente, estima-se que a populao mundial com diabetes seja
da ordem de 387 milhes e que alcance 471 milhes em 2035.
Cerca de 80% desses indivduos vivem em pases em desenvolvimento, onde a epidemia tem maior intensidade e h crescente proporo de pessoas acometidas em grupos etrios mais
jovens, as quais coexistem com o problema que as doenas
infecciosas ainda representam (B).1
O nmero de diabticos est aumentando em virtude do
crescimento e do envelhecimento populacional, da maior urbanizao, da progressiva prevalncia de obesidade e sedentarismo, bem como da maior sobrevida de pacientes com DM.
Quantificar o predomnio atual de DM e estimar o nmero de
pessoas com diabetes no futuro importante, pois possibilita
planejar e alocar recursos de maneira racional (D).2
No Brasil, no final da dcada de 1980, estimou-se a prevalncia de DM na populao adulta em 7,6% (A);3 dados de 2010
apontam taxas mais elevadas, em torno de 15% em Ribeiro
Preto, no estado de So Paulo (A), por exemplo.4 Estudo recente, realizado em seis capitais brasileiras, com servidores de universidades pblicas, na faixa etria de 35 a 74 anos, porm com
medidas laboratoriais mais abrangentes, encontrou uma prevalncia de cerca de 20%, aproximadamente metade dos casos sem
diagnstico prvio.5 Em 2014, estimou-se que existiriam 11,9
milhes de pessoas, na faixa etria de 20 a 79 anos, com diabetes
no Brasil, podendo alcanar 19,2 milhes em 2035 (B).1
O Estudo Multicntrico sobre a Prevalncia do Diabetes no
Brasil evidenciou a influncia da idade na prevalncia de DM e
observou incremento de 2,7% na faixa etria de 30 a 59 anos para
17,4% na de 60 a 69 anos, ou seja, um aumento de 6,4 vezes (A).3
Em 2013, a Pesquisa Nacional de Sade PNS estimou
que, no Brasil, 6,2% da populao com 18 anos ou mais de
idade referiram diagnstico mdico de diabetes, sendo de
7,0% nas mulheres e de 5,4% nos homens. Em relao escolaridade, observou-se maior taxa de diagnstico de diabetes
(9,6%) entre os indivduos sem instruo ou com ensino fundamental incompleto. Em relao idade, as taxas variaram de
0,6% para a faixa etria de 18 a 29 anos a 19,9% para a de 65
a 74 anos. No foram verificados resultados estatisticamente
distintos entre brancos, pretos e pardos.6
H marcantes diferenas no predomnio de DM entre
diversos pases e grupos tnicos. Descreveram-se taxas mais
elevadas para Nauru, na Oceania, e para os ndios Pima, no
Arizona, nos EUA, onde praticamente metade da populao
adulta apresenta DM (B).7 No Brasil, j tem sido descrita uma

Diretrizes SBD 2015-2016 - CAP 01.indd 3

elevada prevalncia de diabetes entre os ndios Xavante: de


28,2% em ambos os sexos, de 18,4% em homens e de 40,6%
em mulheres, o que evidencia que este um grupo particularmente vulnervel e necessita ateno especial (A).8
Outros aspectos a destacar so as repercusses de mudanas no estilo de vida, em curto perodo de tempo, em grupos
de migrantes. No Brasil, um estudo realizado na comunidade
nipo-brasileira mostrou aumento vertiginoso na prevalncia de DM, cuja taxa passou de 18,3%, em 1993, para 34,9%,
em 2000, o que comprova o impacto de alteraes no estilo
de vida, em particular do padro alimentar, interagindo com
provvel suscetibilidade gentica (A).9
difcil conhecer a incidncia de DM tipo 2 (DM2) em
grandes populaes, pois requer seguimento durante alguns
anos, com medies peridicas de glicemia. Os estudos de incidncia so geralmente restritos ao DM tipo 1 (DM1), pois
suas manifestaes iniciais tendem a ser bem caractersticas.
A incidncia de DM1 mostra acentuada variao geogrfica,
apresentando taxas por 100 mil indivduos com menos de 15
anos de idade: 38,4 na Finlndia, 7,6 no Brasil e 0,5 na Coreia,
por exemplo (B).10 Atualmente, sabe-se que a incidncia de
DM1 tem aumentado, particularmente na populao infantil
com menos de 5 anos de idade (B).11
Frequentemente, na declarao de bito, no se menciona
DM pelo fato de serem suas complicaes, particularmente as
cardiovasculares e cerebrovasculares, as causas da morte. No
incio do sculo 21, estimou-se que se atriburam 5,2% de todos os bitos no mundo ao diabetes, o que torna essa doena
a quinta principal causa de morte. Parcela importante desses
bitos prematura, ocorrendo quando ainda os indivduos
contribuem economicamente para a sociedade (D).12
Dados brasileiros de 2011 mostram que as taxas de mortalidade por DM (por 100 mil habitantes) so de 33,7 para a
populao geral, 27,2 nos homens e 32,9 nas mulheres, com
acentuado aumento com o progredir da idade, que varia de
0,50 para a faixa etria de 0 a 29 anos a 223,8 para a de 60 anos
ou mais, ou seja, um gradiente de 448 vezes (B).13 Na maioria
dos pases desenvolvidos, verifica-se que o DM figura entre a
quarta e a oitava posio entre as principais causas bsicas de
bito. Estudos brasileiros sobre mortalidade por DM, na anlise das causas mltiplas de morte, ou seja, quando se menciona
DM na declarao de bito, mostram que a taxa de mortalidade por essa enfermidade aumenta at 6,4 vezes (B).14
Quando se investiga a importncia do DM como carga de
doena, ou seja, o impacto da mortalidade e dos problemas de
sade que afetam a qualidade de vida de seus portadores, por

05/10/2015 06:39:04

4 Diretrizes SBD | 2015-2016

meio do Disability Adjusted Life of Years (DALY), observa-se


que, em 1999, o DM apresentava taxa de 12 por mil habitantes, ocupando a oitava posio, sendo superado pelo grupo das
doenas infecciosas e parasitrias, neuropsiquitricas, cardiovasculares, respiratrias crnicas, do aparelho digestivo, neoplasias malignas e doenas musculoesquelticas (C).15 Nessa
comparao, deve-se considerar que o DM, como nica entidade, est sendo comparado a grupos de doenas, e, mesmo
assim, pode-se notar sua importncia.
Sua natureza crnica, a gravidade das complicaes e os
meios necessrios para control-las tornam o DM uma doena muito onerosa no apenas para os indivduos afetados e
suas famlias, mas tambm para o sistema de sade (D).16 Nos
EUA, estimou-se que os custos dos cuidados de sade para um
indivduo com diabetes eram duas ou trs vezes maiores do
que para algum sem a doena (C).18
Os custos do DM afetam o indivduo, a famlia e a sociedade, porm no so apenas econmicos. Os custos intangveis
(p. ex., dor, ansiedade, inconvenincia e perda de qualidade de
vida) tambm apresentam grande impacto na vida das pessoas
com diabetes e seus familiares, o que difcil de quantificar.
Os gastos diretos com DM variam entre 2,5 e 15% do oramento anual da sade de um pas, dependendo de sua prevalncia e do grau de complexidade do tratamento disponvel.
Estimativas do custo direto para o Brasil oscilam em torno de
3,9 bilhes de dlares, em comparao com 0,8 bilho para
a Argentina e 2 bilhes para o Mxico (C).20 Clculos recentes das despesas com o tratamento ambulatorial dos pacientes
diabticos pelo Sistema nico de Sade brasileiro (SUS) so da
ordem de US$ 2.108,00 por paciente, dos quais US$ 1.335,00
esto relacionados a custos diretos (B).17 Analisando o diabetes mellitus como diagnstico principal, temos um custo anual
de aproximadamente R$ 40,3 milhes, sendo 91% decorrentes
de internaes hospitalares. Possivelmente, esse valor subestimado, pois comum pacientes atendidos por outras doenas
relativas obesidade tambm apresentarem diabetes.19
Muitos diabticos so incapazes de continuar a trabalhar
em decorrncia de complicaes crnicas ou permanecem
com alguma limitao no desempenho profissional. Estimar
o custo social dessa perda de produtividade no fcil. Entretanto, em algumas situaes nas quais se tem feito esse clculo,
tais custos representam uma importante parcela dos gastos.
Por exemplo, em 2012, as estimativas para os EUA dos custos diretos para o tratamento de DM foram de 176 bilhes de
dlares em relao ao 69 bilhes de dlares para as despesas
decorrentes da perda de produtividade (C).18
Combinando-se as estimativas para 25 pases latino-americanos, calcula-se que os custos decorrentes da perda de produo em virtude do DM podem ser cinco vezes maiores que
os diretos. Esse fato ocorreria devido ao acesso limitado boa
assistncia sade, consequentemente com elevada incidncia
de complicaes, incapacitaes e morte prematura (D).20

A preveno primria protege indivduos suscetveis de


desenvolver DM, tendo impacto por reduzir ou retardar tanto
a necessidade de ateno sade como a de tratar as complicaes da doena.
Atualmente, a preveno primria de DM1 no tem uma base
racional que se possa aplicar a toda a populao. As intervenes
populacionais ainda so tericas e dependem de estudos que as
confirmem. As proposies mais aceitveis baseiam-se no estmulo do aleitamento materno e em se evitar a administrao do
leite de vaca nos primeiros 3 meses de vida. Entretanto, o recrutamento de indivduos de maior risco para participar de ensaios
clnicos justificvel. As intervenes propostas tm sido fundamentadas em imunomodulao ou imunossupresso (B).2,7
Quanto ao DM2, condio na qual a maioria dos indivduos tambm apresenta obesidade, hipertenso arterial e
dislipidemia, as intervenes devem abranger essas mltiplas
anormalidades metablicas, o que, alm de prevenir o surgimento de diabetes, evitaria tambm doenas cardiovasculares
e reduziria a mortalidade (A).2
H evidncias de que alteraes no estilo de vida, com nfase na alimentao e na reduo da atividade fsica, associam-se
a acentuado incremento na prevalncia de DM2. Os programas
de preveno primria do DM2 baseiam-se em intervenes na
dieta e na prtica de atividades fsicas, visando combater o excesso de peso em indivduos com maior risco de desenvolver
diabetes, particularmente nos com tolerncia glicose diminuda. O Finnish Diabetes Prevention Study (DPS) mostrou que
mudanas de estilo de vida, em 7 anos, diminuram a incidncia de DM em 43% (A).21 Os resultados do Diabetes Prevention Program (DPP) mostraram reduo de 34% em 10 anos
de acompanhamento na incidncia de casos de DM mediante
o estmulo a uma dieta saudvel e prtica de atividades fsicas (A).22 Em um estudo longitudinal com 84.941 enfermeiras e
seguimento de 16 anos, o controle de fatores de risco modificveis, como dieta habitual, atividade fsica, tabagismo e excesso
de peso, associou-se reduo de 91% na incidncia de DM e de
88% nos casos com histria familiar de DM (A).23
Quanto preveno secundria, h comprovaes de
que o controle metablico estrito tem funo importante no
combate ao surgimento ou progresso de suas complicaes
crnicas, conforme elucidaram o Diabetes Control and Complications Trial (DCCT) (A) para o DM1 e o United Kingdom
Prospective Diabetes Study (UKPDS) para o DM2 (A).24,25
Outras medidas importantes na preveno secundria so:

Preveno
Preveno efetiva tambm significa mais ateno sade de
modo eficaz. Isso pode ocorrer mediante preveno do incio
do DM (preveno primria) ou de suas complicaes agudas
ou crnicas (preveno secundria).

Diretrizes SBD 2015-2016 - CAP 01.indd 4

Tratamento da hipertenso arterial e dislipidemia, o que reduz substancialmente o risco de complicaes do DM (A)2
Preveno de ulceraes nos ps e de amputaes de membros inferiores por meio de cuidados especficos que podem reduzir tanto a frequncia e a durao de hospitalizaes quanto a incidncia de amputaes em 50% (A)2
Rastreamento para diagnstico e tratamento precoce da retinopatia, que apresenta grande vantagem do ponto de vista
de custo-efetividade, dada a importante repercusso nos
custos diretos, indiretos e intangveis da cegueira (B)2
Rastreamento para microalbuminria um procedimento
recomendvel para prevenir ou retardar a progresso da insuficincia renal, que possibilita intervir mais precocemente no curso natural da doena renal (B)2

05/10/2015 06:39:04

Epidemiologia e Preveno 5

Medidas de reduo do consumo de cigarro auxiliam no


controle do DM, visto que o tabagismo associa-se ao mau
controle do diabetes e causalmente hipertenso e doena
cardiovascular em pessoas com ou sem DM (B).2

Quadro 1 Recomendaes e concluses.


Recomendaes e concluses

Grau de
recomendao

A frequncia do diabetes mellitus est


assumindo propores epidmicas na
maioria dos pases

Na maioria dos pases em


desenvolvimento, o aumento da
incidncia do diabetes mellitus ocorre com
maior intensidade nos grupos etrios mais
jovens

A incidncia do diabetes tipo 1 est


aumentando, particularmente na
populao infantil com menos de 5 anos
de idade

As estatsticas de mortalidade e de
hospitalizaes por diabetes subestimam
sua real contribuio

As doenas cardiovasculares e
cerebrovasculares so as principais causas
de bito de portadores de diabetes

A parcela importante de bitos em


indivduos com diabetes prematura,
ocorrendo quando ainda contribuem
economicamente para a sociedade

Na atualidade, a preveno primria do


diabetes tipo 1 no tem uma base racional
que se possa aplicar populao geral

Intervenes no estilo de vida, com nfase


em alimentao saudvel e prtica regular
de atividade fsica, reduzem a incidncia
de diabetes tipo 2

Intervenes no controle da obesidade,


hipertenso arterial, dislipidemia e
sedentarismo, alm de prevenir o
surgimento do diabetes, tambm evitam
doenas cardiovasculares

O bom controle metablico do diabetes


previne o surgimento ou retarda a
progresso de suas complicaes crnicas,
particularmente as microangiopticas

Medidas de combate ao tabagismo


auxiliam no controle do diabetes e na
preveno da hipertenso arterial e de
doena cardiovascular

(A) Estudos experimentais e observacionais de melhor consistncia;


(B) Estudos experimentais e observacionais de menor consistncia; (C)
Relatos de casos estudos no controlados; (D) Opinio desprovida de
avaliao crtica, baseada em consenso, estudos fisiolgicos ou modelos
animais.

Diretrizes SBD 2015-2016 - CAP 01.indd 5

Referncias bibliogrficas
1. International Diabetes Federation. IDF Diabetes Atlas [Internet]. 6a ed. Brussels: International Diabetes Federation, 2014.
Disponvel em: <http://www.idf.org/diabetesatlas>. Acesso em:
19/01/2014.
2. World Health Organization. The World Health Organization
Report 2002: reducing risks, promoting healthy life. Geneve:
WHO, 2002.
3. Malerbi D, Franco LJ, the Brazilian Cooperative Group on the
Study of Diabetes Prevalence. Multicenter study of the prevalence of diabetes mellitus and impaired glucose tolerance in the
urban Brazilian population aged 30 a 69 years. Diabetes Care.
1992; 15(11):1509-16.
4. Moraes AS de, Freitas ICM de, Gimeno SGA et al. Prevalncia
de diabetes mellitus e identificao de fatores associados em
adultos residentes em rea urbana de Ribeiro Preto, So Paulo, Brasil 2006: Projeto OBEDIARP. Cad Sade Pblica. 2010;
26(5):929-41.
5. Schmidt MI, Hoffmann JF, Diniz MFS et al. High prevalence of
diabetes and intermediate hyperglycemia The Brazilian Longitudinal Study of Adult Health (ELSA-Brasil). Diabetol Metab
Syndr. 2014 nov; 6(123):1-9.
6. IBGE. Pesquisa Nacional de Sade 2013: percepo do estado de
sade, estilos de vida e doenas crnicas. Brasil, grandes regies
e unidades da federao. Rio de Janeiro, IBGE, 2014, 180p.
7. Eko JM, Rewers M, Williams R et al., eds. The epidemiology of
diabetes mellitus. 2nd ed. Oxford: Wiley-Blackwell, 2008.
8. Dal Fabbro AL, Franco LJ, da Silva A et al. High prevalence of
type 2 diabetes mellitus in Xavante Indians from Mato Grosso.
Ethn Dis. 2013; 24(1):35-40.
9. Gimeno SGA, Ferreira SRG, Cardoso MA et al. Weight gain
in adulthood and risk of developing glucose disturbance A
study of a Japanese-Brazilian population. J Epidemiol. 2000;
10(2):103-10.
10. Onkamo P, Vnnen S, Karvonen M et al. Worldwide increase
in incidence of type 1 diabetes: the analysis of the data on published incidence trends. Diabetologia. 1999; 42(12):1395-403.
11. Karvonen M, Viik-Kajander M, Moltchanova E et al. Incidence
of the childhood type 1 diabetes worldwide. Diabetes Care. 2000;
23:1516-26.
12. Roglic G, Unwin N, Bennett PH et al. The burden of mortality
attributable to diabetes: realistic estimates for the year 2000. Diabetes Care. 2005; 28(9):2130-5.
13. Brasil. Ministrio da Sade. Secretaria de Vigilncia em Sade.
Sistema de Informaes sobre Mortalidade. Disponvel em:
<http://www.datasus.gov.br>. Acesso em: 18/06/2014.
14. Franco LJ. Um problema de sade pblica. Epidemiologia. In:
Oliveira JEP, Milech A, eds. Diabetes mellitus: clnica, diagnstico, tratamento multidisciplinar. So Paulo: Atheneu, 2004. pp.
19-32.
15. Schramm JMA, Oliveira AF, Leite IC et al. Transio epidemiolgica e o estudo de carga de doena no Brasil. Cincia & Sade
Coletiva. 2004; 9(4):897-908.
16. World Health Organization. Diabetes: the cost of diabetes. WHO
fact sheet. 2002 sep, n. 236.
17. Bahia LR, Araujo DV, Schaan BD et al. The costs of type 2 diabetes mellitus outpatient care in the Brazilian Public Health System. Value in Health. 2011; 14:s137-40.
18. American Diabetes Association. Economic costs of diabetes in
the USA in 2012. Diabetes Care. 2013; 36:1033-46.
19. Bahia LR, Coutinho ESF, Araujo DV et al. The costs of overweight and obesity-related diseases in the Brazilian public
health system: cross-sectional study. BMC Public Health. 2012;
12:440.

05/10/2015 06:39:04

6 Diretrizes SBD | 2015-2016


20. Barcel A, Aedo C, Rajpathak S et al. The cost of diabetes in Latin America and the Caribean. Bull World Health Organ. 2003;
81(1):19-27.
21. Lindstrom J, Ilanne-Parikka P, Peltonen M et al. Finnish Diabetes
Prevention Study Group. Sustained reduction in the incidence of
type 2 diabetes by lifestyle intervention: follow-up of the Finnish
Diabetes Prevention Study. Lancet. 2006; 368:1673-9.
22. Knowler WC, Fowler SE, Hamman RF et al. Diabetes Prevention Program Research Group. 10-year follow-up of diabetes
incidence and weight loss in the Diabetes Prevention Program
Outcomes Study. Lancet. 2009; 374:1677-86.

Diretrizes SBD 2015-2016 - CAP 01.indd 6

23. Hu EB, Manson JE, Stamper MJ et al. Diet, lifestyle, and the
risk of type 2 diabetes mellitus in women. N Engl J Med. 2001;
345(11):790-7.
24. The Diabetes Control and Complications Trial Research Group.
The effect of intensive treatment of diabetes on the development
and progression of long-term complications in insulin-dependent diabetes mellitus. N Engl J Med. 1993; 329(14):977-86.
25. UK Prospective Diabetes Study (UKPDS) Group. Intensive blood
glucose control with sulphonylureas or insulin compared with
conventional treatment and risk of complications in patients with
type 2 diabetes. Lancet. 1999; 354 (9178):602.

05/10/2015 06:39:04

Classificao Etiolgica
Introduo
Diabetes mellitus (DM) no uma nica doena, mas um grupo heterogneo de distrbios metablicos que apresenta em
comum a hiperglicemia, resultante de defeitos na ao da insulina, na secreo de insulina ou em ambas.
A classificao atual do DM baseia-se na etiologia e no no
tipo de tratamento, portanto, os termos DM insulinodependente e DM insulinoindependente devem ser eliminados
dessa categoria classificatria. A classificao proposta pela Organizao Mundial da Sade (OMS) e pela Associao Americana de Diabetes (ADA), e aqui recomendada, inclui quatro
classes clnicas:13 DM tipo 1 (DM1), DM tipo 2 (DM2), outros
tipos especficos de DM e DM gestacional (Quadro 1). H ainda
duas categorias, referidas como pr-diabetes, que so a glicemia
de jejum alterada e a tolerncia glicose diminuda. Essas categorias no so entidades clnicas, mas fatores de risco para o
desenvolvimento de DM e doenas cardiovasculares (DCV).

Diabetes mellitus tipo 1


O DM tipo 1 caracterizado por destruio das clulas beta
que levam a uma deficincia de insulina, sendo subdivido em
tipos 1A e 1B.

Autoimune | Diabetes mellitus tipo 1A


Esta forma encontra-se em 5 a 10% dos casos de DM, sendo
o resultado da destruio imunomediada de clulas betapancreticas com consequente deficincia de insulina. Os marcadores de autoimunidade so os autoanticorpos anti-ilhota
ou antgenos especficos da ilhota e incluem os anticorpos
anti-insulina, antidescarboxilase do cido glutmico (GAD
65), antitirosina-fosfatases (IA2 e IA2B) e antitransportador
de zinco (Znt) (1A).48 Esses anticorpos podem ser verificados
meses ou anos antes do diagnstico clnico, ou seja, na fase
pr-clnica da doena, e em at 90% dos indivduos quando se
detecta hiperglicemia.
Quadro 1 Classicao etiolgica do diabetes mellitus (DM).
DM1
Autoimune
Idioptico
DM2
Outros tipos especficos de DM
DM gestacional

Diretrizes SBD 2015-2016 - CAP 02.indd 7

A fisiopatologia do DM tipo 1A envolve fatores genticos


e ambientais. uma condio polignica, na maioria dos casos, sendo que os principais genes envolvidos esto no sistema
do antgeno leucocitrio humano (HLA) classe II. Esses alelos
podem suscitar o desenvolvimento da doena ou proteger o
organismo contra ela.9,10 Entre os fatores ambientais potenciais para o desencadeamento da autoimunidade em indivduos geneticamente predispostos esto certas infeces virais, fatores nutricionais (p. ex., introduo precoce de leite bovino),
deficincia de vitamina D e outros.
A taxa de destruio das clulas beta varivel, sendo, em
geral, mais rpida entre as crianas. A forma lentamente progressiva ocorre em adultos, a qual se refere como diabetes autoimune latente do adulto (LADA, acrnimo em ingls de latent
autoimmune diabetes in adults).

Idioptico | Diabetes mellitus tipo 1B


Como o nome indica, no h uma etiologia conhecida para
essa forma de DM. Corresponde minoria dos casos de DM1
e caracteriza-se pela ausncia de marcadores de autoimunidade contra as clulas beta e no associao a hapltipos do sistema HLA. Os indivduos com esse tipo de DM podem desenvolver cetoacidose e apresentam graus variveis de deficincia
de insulina.
Devido avaliao dos autoanticorpos no se encontrar
disponvel em todos os centros, a classificao etiolgica do
DM1 nas subcategorias autoimune e idioptica pode no ser
sempre possvel.

Diabetes mellitus tipo 2


O DM2 a forma verificada em 90 a 95% dos casos e caracteriza-se por defeitos na ao e secreo da insulina e na regulao da produo heptica de glicose. A resistncia insulina
e o defeito na funo das clulas beta esto presentes precocemente na fase pr-clnica da doena. causada por uma interao de fatores genticos e ambientais. Nas ltimas dcadas,
foi possvel a identificao de numerosas variantes genticas
associadas a DM2, mas ainda uma grande proporo da herdabilidade permanece inexplicada. Entre os fatores ambientais associados esto sedentarismo, dietas ricas em gorduras e envelhecimento. A maioria dos pacientes com esse tipo de DM apresenta
sobrepeso ou obesidade, e cetoacidose raramente se desenvolve
de modo espontneo, ocorrendo quando associada a outras
condies, como infeces. O DM2 pode ocorrer em qualquer idade, mas geralmente diagnosticado aps os 40 anos.

05/10/2015 06:40:06

8 Diretrizes SBD | 2015-2016

Os pacientes no dependem de insulina exgena para sobreviver, porm podem necessitar de tratamento com insulina para
obter controle metablico adequado.
Diferentemente do DM1 autoimune, no h indicadores
especficos para o DM2. H, provavelmente, diferentes formas
de DM2, e com a identificao futura de processos patognicos
especficos ou defeitos genticos, o nmero de pessoas com
esse tipo de DM ir diminuir custa de mudanas para uma
classificao mais definitiva em outros tipos especficos de DM.

Outros tipos especficos de diabetes


mellitus
Pertencem a essa classificao formas menos comuns de DM
cujos defeitos ou processos causadores podem ser identificados. A apresentao clnica desse grupo bastante variada e
depende da alterao de base. Esto includos nessa categoria
defeitos genticos na funo das clulas beta, defeitos genticos na ao da insulina, doenas do pncreas excrino e outras
condies listadas no Quadro 2.
As formas associadas a defeitos genticos na funo das clulas beta incluem MODY, diabetes neonatal, diabetes mitocondrial e outros. MODY (acrnimo de maturity-onset diabetes of
the young) caracteriza-se por herana autossmica dominante,
idade precoce de aparecimento (em geral antes dos 25 anos de
idade) e graus variveis de disfuno da clula beta.11 Estima-se
que represente 1 a 2% de todos os casos de diabetes mellitus.
clnica e geneticamente heterogneo e pelo menos 13 diferentes
subtipos de MODY foram identificados decorrentes de mutaes em diferentes genes.1113 Os subtipos apresentam diferenas na idade de apresentao da doena, padro de hiperglicemia, resposta ao tratamento e manifestaes extrapancreticas
associadas. As causas mais comuns de MODY so derivadas
de mutaes nos genes HNF1A (MODY 3) e GCK (MODY 2).
MODY GCK apresenta-se com hiperglicemia leve, encontrada
desde o nascimento, no progressiva e geralmente no requer
tratamento com agentes orais ou insulina. Em vista do comportamento da hiperglicemia, leve e no progressiva, as complicaes crnicas do diabetes so raras. J pacientes com mutaes
no gene HNF1A (MODY3) apresentam uma falncia progressiva da funo das clulas beta que resulta em hiperglicemia com
aumento no decorrer da vida. Tal diabetes geralmente diagnosticado na adolescncia ou no adulto jovem e a frequncia
de suas complicaes crnicas, de forma semelhante aos portadores de diabetes mellitus tipo 1 ou tipo 2, relacionada com
o controle glicmico. Uma caracterstica dos pacientes com
MODY3 a sua sensibilidade ao hipoglicemiante das sulfonilureias, sendo essa classe a medicao de escolha para portadores de mutaes no gene HNF1A. Estima-se que a maioria
dos pacientes portadores de MODY seja inicialmente classificada como portador de DM tipo 1 ou tipo 2.
O diabetes neonatal uma forma monognica de diabetes,
diagnosticado nos seis primeiros meses de vida. Cerca de 50%
dos casos so transitrios, ocorrendo a remisso em semanas ou
meses, podendo recidivar por volta da puberdade, e os demais
so permanentes.14 O diabetes neonatal transitrio , na maioria dos casos, associado a anormalidades no cromossomo 6q24.
Os pacientes afetados apresentam baixo peso ao nascimento e a

Diretrizes SBD 2015-2016 - CAP 02.indd 8

Quadro 2 Outros tipos especficos de diabetes mellitus (DM).


Defeitos genticos na
funo das clulas beta

MODY 1 (defeitos no gene HNF4A)


MODY 2 (defeitos no gene GCK)
MODY 3 (defeitos no gene HNF1A)
MODY 4 (defeitos no gene IPF1)
MODY 5 (defeitos no gene HNF1B)
MODY 6 (defeitos no gene
NEUROD1)
Diabetes neonatal transitrio
Diabetes neonatal permanente
DM mitocondrial
Outros

Defeitos genticos na
ao da insulina

Resistncia insulina do tipo A


Leprechaunismo
Sndrome de Rabson-Mendenhall
DM lipoatrfico
Outros

Doenas do pncreas
excrino

Pancreatite
Pancreatectomia ou trauma
Neoplasia
Fibrose cstica
Pancreatopatia fibrocalculosa
Outros

Endocrinopatias

Acromegalia
Sndrome de Cushing
Endocrinopatias
Glucagonoma
Feocromocitoma
Somatostinoma
Aldosteronoma
Outros

Induzido por
medicamentos ou
agentes qumicos

Determinadas toxinas
Pentamidina
cido nicotnico
Glicocorticoides
Hormnio tireoidiano
Diazxido
Agonistas beta-adrenrgicos
Tiazdicos
Interferona
Outros

Infeces

Rubola congnita
Citomegalovrus
Outros

Formas incomuns de
DM autoimune

Sndrome de Stiff-Man
Anticorpos antirreceptores de
insulina
Outros

Outras sndromes
genticas por vezes
associadas ao DM

Sndrome de Down
Sndrome de Klinefelter
Sndrome de Turner
Sndrome de Wolfram
Ataxia de Friedreich
Coreia de Huntington
Sndrome de Laurence-Moon-Biedl
Distrofia miotnica
Sndrome de Prader-Willi
Outros

MODY: maturity-onset diabetes of the young.

05/10/2015 06:40:06

Classificao Etiolgica 9

hiperglicemia desenvolve-se nas primeiras semanas de vida. As


pessoas com diabetes neonatal permanente tambm tm peso
reduzido ao nascimento e a idade de aparecimento da hiperglicemia varivel, em geral nos trs primeiros meses de vida.
Habitualmente, o diabetes ocorre isoladamente, mas em uma
minoria dos casos pode estar acompanhado de alteraes neurolgicas caracterizadas por retardo do desenvolvimento, epilepsia
e fraqueza muscular, referida como sndrome DEND (acrnimo
em ingls de developmental delay, epilepsy and neonatal diabetes).
Em comparao com os portadores de diabetes neonatal permanente, os pacientes portadores da forma transitria apresentam
hiperglicemia em idade mais precoce, menor peso por ocasio
do diagnstico e necessitam de doses menores de insulina para
o controle metablico; porm, existe considervel sobreposio
do quadro clnico, no sendo possvel ao diagnstico definir se
a forma transitria ou permanente. Mutaes ativadoras nos
genes KCNJ11 e ABCC8 que codificam, respectivamente, as subunidades Kir 6.2 e SUR 1 do canal de potssio ATP-sensvel so
causa de diabetes neonatal transitrio e permanente. Mutaes
no gene KCNJ11 em heterozigose respondem por cerca de 30
a 40% dos casos de diabetes neonatal permanente e menos de
10% das ocorrncias de diabetes neonatal transitrio, enquanto
mutaes no gene ABCC8 ocasionam mais frequentemente diabetes neonatal transitrio. Em pacientes com mutaes nos genes KCNJ11 e ABCC8, possvel, em aproximadamente 80% dos
casos, a utilizao de sulfonilureia com boa resposta teraputica.
Ainda, mutaes em vrios outros genes (INS, GCK, PLAGL1
etc.) so causas de diabetes neonatal.
Defeitos genticos na ao da insulina podem ser decorrentes de mutaes no gene do receptor da mesma. A resistncia insulina tipo A caracteriza-se por resistncia insulina,
acanthosis nigricans e hiperandrogenismo na ausncia de
obesidade ou lipoatrofia. O leprechaunismo e a sndrome
de Rabson-Mendehall apresentam importante resistncia
insulina. O leprechaunismo consiste em retardo no crescimento intrauterino e ps-natal, diminuio do tecido adiposo subcutneo e acanthosis nigricans, representado por um
prognstico ruim com poucas crianas sobrevivendo aps o
primeiro ano de vida. A sndrome de Rabson-Mendenhall
associada a baixa estatura, abdome protuberante, anormalidades em dentes e unhas e hiperplasia pineal.
Doenas do pncreas excrino, como pancreatite, trauma, pancreatectomia e carcinoma pancretico, podem causar diabetes. Alm disso, endocrinopatias com aumento de
hormnios contrarreguladores da ao da insulina, entre os
quais hormnio de crescimento (GH), cortisol e glucagon,
podem ser causas de diabetes. Diferentes medicamentos so
associados a alteraes no metabolismo da glicose por meio
da diminuio da secreo ou ao da insulina. Os exemplos
mais comuns so os glicocorticoides, o cido nicotnico e os
antipsicticos atpicos.

Diabetes mellitus gestacional


Trata-se de qualquer intolerncia glicose, de magnitude varivel, com incio ou diagnstico durante a gestao. Entretanto, aquelas pacientes de alto risco e que na consulta inicial de
pr-natal, no primeiro trimestre de gestao, j preenchem os
critrios para diabetes fora da gestao, sero classificadas no

Diretrizes SBD 2015-2016 - CAP 02.indd 9

como diabetes gestacional, mas como diabetes mellitus tipo 2. Similar ao DM2, o DM gestacional associa-se tanto resistncia
insulina quanto diminuio da funo das clulas beta (A).1517
O DM gestacional ocorre em 1 a 14% de todas as gestaes,
dependendo da populao estudada, e relaciona-se com aumento de morbidade e mortalidade perinatais.1820 No Brasil,
cerca de 7% das gestaes so complicadas pela hiperglicemia
gestacional.21,22 Deve-se reavaliar pacientes com DM gestacional 4 a 6 semanas aps o parto e reclassific-las como apresentando DM, glicemia de jejum alterada, tolerncia glicose diminuda ou normoglicemia. Na maioria dos casos, h reverso
para a tolerncia normal aps a gravidez, porm h risco de 10
a 63% de desenvolvimento de DM2 dentro de 5 a 16 anos aps
o parto (B).2325

Classes intermedirias no grau de


tolerncia glicose
Referem-se a estados intermedirios entre a homeostase normal da glicose e o DM. A categoria glicemia de jejum alterada
est relacionada s concentraes de glicemia de jejum inferiores ao critrio diagnstico para DM, contudo mais elevadas
que o valor de referncia normal. A tolerncia glicose diminuda representa uma anormalidade na regulao da glicose
no estado ps-sobrecarga, diagnosticada por meio de teste
oral de tolerncia glicose (TOTG), o qual inclui a determinao da glicemia de jejum e de 2 h aps a sobrecarga com 75 g
de glicose. A glicemia de jejum alterada e tolerncia glicose
diminuda so categorias de risco aumentado para o desenvolvimento do DM, e o termo pr-diabetes tambm utilizado
para designar essas condies.
Quadro 3 Recomendaes e concluses.
Recomendaes e concluses

Grau de
recomendao

Classificao atual baseada na etiologia e


no no tipo de tratamento

Classes clnicas: DM tipo 1, DM tipo 2, DM


gestacional e outros tipos especficos de DM

Classes intermedirias: glicemia de jejum


alterada e tolerncia glicose diminuda

(A) Estudos experimentais e observacionais de melhor consistncia; (B)


Estudos experimentais e observacionais de menor consistncia; (C) Relatos
de casos estudos no controlados; (D) Opinio desprovida de avaliao
crtica, baseada em consenso, estudos fisiolgicos ou modelos animais.

Referncias bibliogrficas
1. Alberti KGMM, Zimmet PZ, World Health Organization Consultation. Definition, diagnosis and classification of diabetes mellitus
and its complications. Part 1: diagnosis and classification of diabetes mellitus. Report of a WHO Consultation. Geneva: WHO, 1999.
2. American Diabetes Association. Diagnosis and classification of
diabetes mellitus. Diabetes Care. 2014 (suppl 1):s81-90.
3. American Diabetes Association. Diagnosis and classification of
diabetes mellitus. Diabetes Care. 2015 (suppl 1):s8-16.
4. Palmer JP, Asplin CM, Clemons P et al. Insulin antibodies in
insulin-dependent diabetics before insulin treatment. Science.
1983; 222:1337.

05/10/2015 06:40:06

10 Diretrizes SBD | 2015-2016


5. Baekkeskov S, Aanstoof H, Christgau S et al. Identification of the 64
K autoantigen in insulindependent diabetes as the GABA-synthesizing enzyme glutamic acid decarboxilase. Nature. 1990; 347:151.
6. Rabin DU, Pleasic SM, Shapiro JA et al. Islet cell antigen 512 is
a diabetes-specific islet autoantigen related to protein tyrosine
phosphatases. J Immunol. 1994; 152:3183.
7. Gorus KF, Goubert P, Semakula C et al. IA-2-autoantibodies
complement GAD65-autoantibodies in new-onset IDDM patients and help predict impending diabetes in their siblings. The
Belgian Diabetes Registry. Diabetologia. 1997; 40:95.
8. Baekkeskov S, Aanstoot HJ, Christgau S et al. Identification
of the 64 K autoantigen in insulin-dependent diabetes as the
GABA-synthesizing enzyme glutamic acid decarboxylase. Nature. 1990; 347:151.
9. Todd JA, Bell JI, McDevin HO. HLADQb gene contributes to
susceptibility and resistance to insulindependent diabetes mellitus. Nature. 1987; 329:599.
10. Erlich H, Valdes AM, Noble J et al. HLA DR-DQ haplotypes and
genotypes and type 1 diabetes risk: analysis of the type 1 diabetes
genetics consortium families. Diabetes. 2008; 57:1084.
11. Fajans SS, Bell GI. MODY: history, genetics, pathophysiology
and clinical decision making. Diabetes Care. 2011; 1878-84.
12. Bowman P, Flanagan SE, Edghill EL et al. Heterozygous ABCC8
mutations are a cause of MODY. Diabetologia. 2012; 123-7.
13. Bonnefond A, Philippe J, Durand E et al. Whole-exome sequencing and high throughput genotyping identified KCNJ11 as the
thirteenth MODY gene. PLoS One 2012; 7:e37423.
14. Polak M, Cav H. Neonatal diabetes mellitus: a disease linked to
multiple mechanisms. Orphanet J Rare Dis. 2007; 2-12.
15. Kuhl C. Insulin secretion and insulin resistance in pregnancy
and GDM: implications for diagnosis and management. Diabetes. 1991; 40:18.

Diretrizes SBD 2015-2016 - CAP 02.indd 10

16. Kaulzky-Willer A, Prager R, Waldhausl W et al. Pronounced insulin resistance and inadequate B-cell secretion characterize lean
gestational diabetes during and after pregnancy. Diabetes Care.
1997; 20:1717.
17. Buchanan TA, Meltzger BE, Freinkel N et al. Insulin sensitivity
and B-cell responsiveness to glucose during late pregnancy in lean
and moderately obese women with normal glucose tolerance or
mild gestational diabetes. Am J Obstet Gynecol. 1990; 162:1008.
18. Coustan DR. Gestational diabetes. Diabetes in America. In: National Institutes of Diabetes and Digestive and Kidney Diseases. 2nd ed.
NIH Publicao n. 95-1468. Bethesda: NIDDK. 1995; 703-17.
19. Lawrence JM, Contreras R, Chen W et al. Trends in the prevalence of preexisting diabetes and gestational diabetes mellitus
among a racially/ethnically diverse population of pregnant women, 1999-2005. Diabetes Care. 2008; 31:899.
20. Dornhorst A, Paterson CM, Nicholls J et al. High prevalence
of gestational diabetes in women from ethnic minority groups.
Diabet Med. 1992; 9:820.
21. Schmidt MI, Duncan BB, Reichelt AJ et al. Gestational diabetes
mellitus diagnosed with a 2-h 75-g oral glucose tolerance test
and adverse pregnancy outcomes. Diabetes Care. 2001; 24:1151.
22. Schmidt MI, Matos MC, Reichelt AJ et al. Prevalence of gestational diabetes mellitus do the new WHO criteria make a difference? Diabet Med. 2000; 17:376-80.
23. Kim C, Newton KM, Knoop RH. Gestational diabetes and the
incidence of type 2 diabetes. Diabetes Care. 2002; 25:1862.
24. Jarvela IY, Juutinen J, Koskela P et al. Gestational identifies women at risk for permanent type 1 and type 2 diabetes in fertile age:
predictive role of autoantibodies. Diabetes Care. 2006; 29:607.
25. Henry OA, Beischer N. Long-term implications of gestational
diabetes for the mother. Baillieres Clinical Obstetrics and Gynecology. 1991; 5:461.

05/10/2015 06:40:06

Mtodos e Critrios para o


Diagnstico
Introduo

A evoluo para o diabetes mellitus tipo 2 (DM2) ocorre em


um perodo de tempo varivel, passando por estgios intermedirios que recebem a denominao de glicemia de jejum
alterada e tolerncia glicose diminuda. Tais estgios so decorrentes de uma combinao de resistncia ao insulnica
e disfuno de clula beta. No diabetes mellitus tipo 1 (DM1),
o incio geralmente abrupto, com sintomas que indicam de
maneira contundente a presena da enfermidade.1,2
O critrio para o diagnstico foi modificado, em 1997,
pela American Diabetes Association (ADA) e, posteriormente, aceito pela Organizao Mundial da Sade (OMS) e pela
Sociedade Brasileira de Diabetes (SBD).1,2 As modificaes foram realizadas com a finalidade de prevenir de maneira eficaz
as complicaes micro e macrovasculares do DM.35
Atualmente so trs os critrios aceitos para o diagnstico
do DM com utilizao da glicemia (Quadro 1):

Sintomas de poliria, polidipsia e perda ponderal acrescidos de glicemia casual 200 mg/d. Compreende-se por
glicemia casual aquela realizada a qualquer hora do dia, independentemente do horrio das refeies (A)1,2

Quadro 1 Valores de glicose plasmtica (em mg/d) para


diagnstico de diabetes mellitus e seus estgios pr-clnicos.
Categoria

Jejum*

2 h aps 75 g
de glicose

Glicemia
normal

< 100

< 140

Tolerncia
glicose
diminuda

100 a < 126

140 a < 200

Diabetes
mellitus

126

200

Casual**

200 (com
sintomas
clssicos)***

*O jejum definido como a falta de ingesto calrica por no mnimo 8 h.


**Glicemia plasmtica casual aquela realizada a qualquer hora do dia, sem
se observar o intervalo desde a ltima refeio.
***Os sintomas clssicos do DM incluem poliria, polidipsia e perda no
explicada de peso.
Nota: o diagnstico do DM deve sempre ser confirmado pela repetio
do teste em outro dia, a menos que haja hiperglicemia inequvoca com
descompensao metablica aguda ou sintomas bvios de DM.

Diretrizes SBD 2015-2016 - CAP 03.indd 11

Glicemia de jejum 126 mg/d (7 mmol/). Em caso de pequenas elevaes da glicemia, o diagnstico deve ser confirmado pela repetio do teste em outro dia (A)1,2
Glicemia de 2 h ps-sobrecarga de 75 g de glicose 200
mg/d (A).1,2

O teste de tolerncia glicose deve ser feito com os cuidados preconizados pela OMS, com coleta para diferenciao de
glicemia em jejum e 120 min aps a ingesto de glicose.
reconhecido um grupo intermedirio de indivduos nos
quais os nveis de glicemia no preenchem os critrios para o
diagnstico do DM. So, entretanto, muito elevados para serem considerados normais.6 Nesses casos foram consideradas
as categorias de glicemia de jejum alterada e tolerncia glicose diminuda, cujos critrios so apresentados a seguir.

Glicemia de jejum alterada


A glicemia de jejum 100 mg/d e < 126 mg/d. Esse critrio ainda no foi oficializado pela OMS, porm j existe uma
recomendao da Federao Internacional de Diabetes (IDF)
acatando o ponto de corte para 100 mg/d.
A tolerncia glicose diminuda ocorre quando, aps uma
sobrecarga de 75 g de glicose, o valor de glicemia de 2 h situa-se
entre 140 e 199 mg/d (B).2-7
O mtodo preferencial para determinao da glicemia sua
aferio no plasma. O sangue deve ser coletado em um tubo
com fluoreto de sdio, centrifugado, com separao do plasma,
que dever ser congelado para posterior utilizao. Caso no se
disponha desse reagente, a determinao da glicemia dever ser
imediata ou o tubo mantido a 4C por, no mximo, 2 h.8
Para a realizao do teste de tolerncia glicose oral, algumas consideraes devem ser levadas em conta:8





Perodo de jejum entre 10 e 16 h


Ingesto de pelo menos 150 g de glicdios nos 3 dias anteriores realizao do teste
Atividade fsica normal
Comunicao da presena de infeces, ingesto de medicamentos ou inatividade
Utilizao de 1,75 g de glicose por quilograma de peso at
o mximo de 75 g
No usar as fitas com reagentes para o diagnstico, pois no
so to precisas quanto as dosagens plasmticas.

05/10/2015 06:40:30

12 Diretrizes SBD | 2015-2016

Em julho de 20099 foi proposta a utilizao de hemoglobina glicada (HbA1c) como critrio de diagnstico para o
DM. A alegao que a medida da HbA1c avalia o grau de
exposio glicemia durante o tempo e os valores se mantm
estveis aps a coleta. Em janeiro de 2010, a ADA modificou
o critrio inicial. As recomendaes atuais so as seguintes:10

Em concluso, os critrios para diagnstico do DM por


glicemia plasmtica apresentam nvel A de evidncia. Para a
hemoglobina glicada, estudos mais recentes sugerem nvel B
de evidncia.

Diabetes: HbA1c 6,5% a ser confirmada em outra coleta.


Dispensvel em caso de sintomas ou glicemia 200 mg%
Indivduos com alto risco para o desenvolvimento de diabetes: HbA1c entre 5,7 e 6,4%.

1. American Diabetes Association. Diagnosis and classification of


diabetes mellitus. Diabetes Care. 2015; 38(Suppl):S8-S16.
2. American Diabetes Association. Guide to diagnosis and classification of diabetes mellitus and ofter categories of glucose intolerance. Diabetes Care. 1997; 20(Suppl):215-25.
3. Bennet PH. Definition, diagnosis and classification of diabetes
mellitus and impaired glucose tolerance. In: Kahn CR, Weir GC,
editors. Joslins Diabetes Mellitus. 13th ed. Philadelphia: Lea &
Febiger; 1994; p. 193-15.
4. Charles MA, Shipley MJ, Rose G et al. Risk factors for NIDDM
in white population. Paris Prospective Study. Diabetes. 1991;
40:796-9.
5. Decode Study Group. Glucose tolerance and mortality: Comparison of WHO and American Diabetes Association diagnostic
criteria. Lancet. 1999;354:617-21.
6. Fuller JM, Shipley MJ, Rose G et al. Coronary heart disease
risk and impaired glucose: the Whitehall study. Lancet. 1980;
1:1373-6.
7. Engelgau MM Thompson TJ, Herman WH et al. Comparison
of fasting and 2 hours glucose and HbA1c levels for diagnosing
diabetes. Diagnostic criteria and performance revisited. Diabetes
Care. 1997;20:785-91.
8. Report of Expert Committee on the Diagnosis and Classification
of Diabetes Mellitus. Diabetes Care. 1997; 20:1183-97.
9. The Expert Committee on the Diagnosis and Classification of
Diabetes Mellitus. Follow-up report on the diagnosis of diabetes
mellitus. Diabetes Care. 2003; 26:3160-7.
10. The International Expert Committee. International expert committee report on the role of the A1c assay in the diagnosis of
diabetes. Diabetes Care. 2009; 32(7):1327-34.
11. Ziemer DC, Kolm P, Weintraub WS et al. Glucose-Independent,
BlackWhite differences in hemoglobin A1c levels. Ann Intern
Med. 2010; 152:770-7.
12. John WG; UK Department of Health Advisory Committee on
Diabetes. Use of HbA1c in the diagnosis of diabetes mellitus
in the UK. The implementation of World Health Organization
guidance 2011. Diabet Med. 2012;29(11):1350-7.
13. World Health Organization (WHO). Use of glycated haemoglobin (HbA1c) in the diagnosis of diabetes mellitus. [internet].
2011. Disponvel em: http://www.who.int/diabetes/publications/
report-hba1c_2011.pdf. Acesso em: 21 mai. 2013.
14. Tsugava Y, Mukamal KJ, Davis RB et al. Should the hemoglobin
A1c diagnostic cutoff differ between blacks and whites?: a crosssectional study. Ann Intern Med. 2012; 157(3):153-9.
15. Zhang X, Gregg EW, Williamson DF et al. A1c levels and future risk of diabetes: a systematic review. Diabetes Care. 2010;
33:1665-1673.
16. Ackerman RT, Cheng YJ, Williamson DF, Gregg EW. Identifying
adults at high risk for diabetes and cardiovascular disease using
hemoglobin A1c. National Health and Nutrition Examination
Survey 2005-2006. Am J Prev Med. 2011; 40:11-7.

O valor de 6,5% foi escolhido com base no ponto de inflexo


para a prevalncia de retinopatia. O valor de 5,7 apresenta uma
sensibilidade de 66% e uma especificidade de 88% para predizer
o desenvolvimento do diabetes mellitus nos 6 anos subsequentes.1
Entretanto, existem alguns problemas para a aplicao desse parmetro como critrio diagnstico do DM, mesmo com
a excluso de imperfeies na padronizao: hemoglobinopatias, anemias hemoltica e ferropriva.
Outro ponto a considerar a discordncia entre os resultados da glicemia e da HbA1c quando, mesmo aps a repetio
deles, somente um permanecer anormal. Nesse caso, a pessoa
deve ser considerada diabtica.
Recentemente11 foi levantada a questo da influncia das
etnias. Os indivduos afrodescendentes apresentam nveis mais
elevados de HbA1c do que os caucasoides para valores iguais
de glicemia em todas as categorias: tolerncia normal glicose, pr-diabetes e DM. Um estudo no Reino Unido demonstrou que os asiticos tambm apresentavam nveis de HbA1c
mais elevados quando comparados a caucasoides com nveis
glicmicos semelhantes.12
A OMS, por outro lado, recomenda que a HbA1c de 6,5%
seja compatvel com o diagnstico do DM, contudo considera
indivduos com nveis entre 6 e 6,4% com alto risco de evoluir
para DM.13
Outro estudo recente concluiu que a concentrao de
HbA1c associada incidncia de retinopatia mais baixa nos
afrodescendentes do que nos caucasoides.14 As razes para
essa discrepncia ainda no foram elucidadas.
Pesquisas ainda mais recentes15,16 reforam o critrio de
considerar o nvel de HbA1c entre 5,7 e 6,4% como um importante preditor de desenvolvimento do diabetes mellitus. Em uma
reviso sistemtica incluindo 44.203 indivduos de 16 estudos
de coorte, com um intervalo mdio de seguimento de 5,6 anos,
os que apresentavam HbA1c entre 5,5 e 6,0% apresentavam um
risco de incidncia do diabetes mellitus em 5 anos de at 25%.
Entre 6,0 e 6,5%, o risco chegava a at 50% em 5 anos e um
risco relativo de at 20 vezes, quando comparados a indivduos
com HbA1c de 5,0%. Outro estudo sugere que HbA1c de 5,7%
estaria associada a um risco de desenvolver diabetes mellitus semelhante aos indivduos da categoria de alto risco participantes
do estudo Diabetes Prevention Program (DPP).

Diretrizes SBD 2015-2016 - CAP 03.indd 12

Referncias bibliogrficas

05/10/2015 06:40:30

Anlise dos Marcadores de


Resistncia Insulina na Clnica Diria
Introduo | Aspectos clnicos relevantes
O conceito de sensibilidade insulina foi introduzido por Sir
Harold Himsworth, em 1939, ao estudar a resposta de pacientes
diabticos ao estmulo glicmico e insulina.1 Define-se resistncia insulina (RI) como uma perturbao das vias de sinalizao mediadas pela insulina em que as concentraes normais
do hormnio produzem uma resposta biolgica subnormal.2
Um aumento da funo beta celular pode compensar a RI, resultando em tolerncia normal glicose (NGT). Todavia, quando a RI excede a capacidade funcional e adaptativa das clulas
beta, instaura-se a deteriorao da tolerncia glicose, que pode
culminar com o diabetes mellitus de tipo 2 (DM2).2,3 Quando
ocorre a descompensao da funo beta celular, a insulinemia
deixa de ser um bom parmetro para estimar a RI.
A insulina influencia ou controla um grande nmero de processos fisiolgicos, embora seja conhecida, sobretudo, por suas
aes na homeostase da glicose. Em resposta elevao da glicemia, a secreo de insulina aumenta estimulando a captao
de glicose, a sntese de glicognio e a inibio da glicogenlise e
da gliconeognese.3 A insulina apresenta outros efeitos metablicos, como regulao da expresso de genes, metabolismo dos
lipdios no msculo e no tecido adiposo, crescimento, desenvolvimento e sobrevivncia celular. A resistncia s aes hormonais um fenmeno relativamente comum em endocrinologia.
Entretanto, surpreendente o quanto a RI prevalente na populao (25 a 30%),4 sendo componente de condies fisiolgicas
como puberdade e gravidez, e de condies patolgicas como
DM2 (em mais de 90% dos pacientes), obesidade, hipertenso
arterial,5 sndrome metablica,6 alteraes do metabolismo da
glicose,2,3 dislipidemia, sndrome do ovrio policstico, esteato-hepatite no alcolica (NASH), entre outras. Nesses casos, a RI
uma alterao fisiopatolgica de base, precedendo (mesmo
por vrios anos) e/ou contribuindo para o surgimento da respectiva condio patolgica.
Em 1988, Reaven props a denominao de sndrome X,7
que originou as atuais definies de sndrome metablica ou sndrome da resistncia insulina,4 para alteraes que englobam
simultaneamente a deteriorao do metabolismo da glicose, o
aumento das lipoprotenas de muito baixa densidade (VLDL), a
diminuio das lipoprotenas de alta densidade (HDL), alterao
de fatores hemodinmicos, obesidade e hipertenso arterial. A
proposta incluiu a RI como fator essencial na gnese e no aumento do risco cardiovascular. Portanto, a avaliao, o acompanhamento e o tratamento da RI so importantes na prtica clnica.

Diretrizes SBD 2015-2016 - CAP 04.indd 13

Os efeitos da insulina so mediados por receptores localizados


na membrana plasmtica das clulas-alvo, altamente conservados
em mamferos.4 A ligao ao receptor ativa a cascata de sinalizao intracelular que induz a translocao dos transportadores de
glicose (GLUT 1-4) para a membrana celular e/ou a modificao
de diversos processos metablicos. Os mecanismos envolvidos na
reduo da funo insulnica incluem antagonistas extracelulares
ou, principalmente, defeitos nas clulas-alvo ao nvel dos receptores insulnicos ou da cascata de eventos ps-receptores. A homeostase da glicose resultado da interao da secreo de insulina
por parte das clulas betapancreticas com a captao de glicose
por parte dos tecidos perifricos sensveis insulina. O aumento
da glicemia estimula a secreo de insulina, a qual reduz a concentrao de glicose de modo dose/tempo-dependente.8 Sabe-se
que a hiperinsulinemia prolongada inibe tanto a secreo como
a ao da insulina.8,9 J a hiperglicemia crnica capaz de inibir
tanto a secreo de insulina induzida por glicose quanto a sensibilidade celular insulina.9,10 A deteriorao da funo da clula
beta e da ao insulnica inicia-se anos antes do diagnstico do
diabetes, e, comumente, a hiperglicemia crnica est associada
secreo insulnica deficiente e RI.11
A obesidade, especialmente a visceral, um dos fatores mais
importantes para o desenvolvimento do diabetes, por meio de
diversos mecanismos, como aumento dos cidos graxos livres
circulantes (FFA), diminuio da adiponectina e secreo pelo
tecido adiposo de citocinas (p. ex., o fator de necrose tumoral alfa
[TNF-a] e a interleucina-6) que, em ltima anlise, exacerbam a
RI.12 O acmulo de gordura em outros tecidos, como os do fgado, do msculo e do pncreas, reduz a capacidade do fgado e do
msculo em metabolizar a glicose, sendo a infiltrao gordurosa
heptica particularmente relacionada com a RI. No pncreas endcrino, contribui para a disfuno da clula beta e sua destruio pela apoptose e pelo estresse oxidativo, quadro denominado
lipotoxicidade. Uma vez instalada a hiperglicemia, seus efeitos
adversos nos tecidos constituem a glicotoxicidade: no msculo
esqueltico, a hiperglicemia interfere na ao da insulina por uma
variedade de mecanismos; no pncreas, aumenta o estresse oxidativo, reduzindo ulteriormente a secreo de insulina. A glicotoxicidade altera o equilbrio do ciclo apoptose-regenerao da
clula beta aumentando a perda de massa celular.2,10

Mtodos de avaliao
A RI pode ser acessada diretamente utilizando-se testes de
diagnstico laboratorial. A avaliao direta, considerada

05/10/2015 06:41:45

14 Diretrizes SBD | 2015-2016

padro-ouro, pressupe a medida da ao da insulina exgena, como no clamp euglicmico hiperinsulinmico (EHC);
ou da insulina endgena liberada a partir de um estmulo: glicose intravenosa, como no TTG minimal model de Bergman e
no clamp hiperglicmico;13 ou aps estmulos por via oral com
glicose (teste oral de tolerncia glicose, TOTG) ou com alimentos como o mixed meal tolerance test contendo composio
estandardizada e predeterminada (MTT). O EHC interrompe o
mecanismo de feedback fisiolgico existente entre a glicemia e
a secreo de insulina, enquanto, nos demais testes, o feedback
fisiolgico no interrompido e, outros fatores envolvidos (p.
ex., a funo beta celular), o efeito dos hormnios incretnicos
e a produo heptica de glicose (EGP) devem ser considerados na avaliao final da sensibilidade insulina.
Entretanto, alguns destes mtodos no so de uso comum
na prtica clnica pelo alto custo, pela dificuldade tcnica e pelo
tempo de execuo. Dessa maneira, vrios autores buscam marcadores laboratoriais ou clnicos mais acessveis para a prtica
clnica. Marcadores, como o HOMA-IR, so usados corriqueiramente e apresentam, sobretudo, a vantagem de serem calculados a partir de uma nica amostra de sangue obtida em jejum.

Clamp euglicmico hiperinsulinmico


Tcnica considerada padro-ouro e referncia para outros testes.14 Foi desenvolvida inicialmente por Andres et al.15 que, em
1966, fizeram uma analogia com o mtodo do clamp de voltagem, utilizado em estudos de neurocincia. As medidas so altamente reprodutveis, pois so obtidas em um estado que se
aproxima do equilbrio, havendo um coeficiente de variao
intraindividual em torno de 10%. O clamp pode ser realizado
mesmo em pacientes com grave disfuno da clula beta, porque no depende da secreo hormonal. A tcnica prev a infuso de insulina regular humana, na forma de um bolus seguido
de infuso contnua por todo o estudo, com o objetivo de obter
uma insulinemia que reproduza os nveis normais do perodo
ps-prandial. A glicemia mantida estvel, nos nveis do jejum (isoglicmico) ou em nveis predeterminados de 100 mg/
dl (euglicmico), por meio da infuso intravenosa de glicose
hipertnica, em velocidade varivel. Alcanada a condio de
equilbrio steady state, as taxas de infuso de glicose so iguais
captao pelos tecidos sensveis insulina (taxa metablica ou
M value) desde que ocorra supresso total da produo endgena de glicose (EGP). Nos casos em que a EGP no completamente inibida pela hiperinsulinemia, a captao de glicose ser
igual soma da taxa de infuso de glicose e da EGP. Para avaliar
adequadamente a EGP, necessrio infundir glicose marcada
com istopos estveis ou radioativos, o que complica ulteriormente o mtodo. Deve-se ressaltar, porm, que a EGP durante o
clamp parcialmente inibida, mesmo em pacientes diabticos,16
validando o M value do clamp sem a medida concomitante da
EGP. Pode-se realizar qualquer combinao entre glicose e insulina, possibilitando investigar diferentes situaes, por exemplo,
a secreo de hormnios contrarreguladores da hipoglicemia.
O clamp pode ser combinado com outros procedimentos para
avaliar aes especficas da insulina: com glicose marcada avalia o efeito na EGP; com cidos graxos e aminocidos marcados, analisa a liplise e a degradao proteica; com a calorimetria indireta, a termognese e a oxidao de substratos; com o

Diretrizes SBD 2015-2016 - CAP 04.indd 14

PETscan contendo glicose marcada avalia a captao regional


de glicose estimulada pela insulina.
O ponto de corte RI/sensibilidade normal para o M value
foi avaliado em 28 mmol/min/kg de massa magra mediante
anlise dos resultados de um grande nmero de pessoas submetidas ao clamp com infuso de insulina a 40 mU/m2/min,17
embora diferenas populacionais tenham sido descritas.
O clamp examina a ao insulnica nas condies experimentais em que se realiza: paciente em repouso e em jejum,
com insulinemia e glicemia determinadas pelo experimentador. A sensibilidade insulina estimada pode no se correlacionar com a sensibilidade em jejum, quando a EGP, predominantemente heptica, e a utilizao de glicose independente
da insulina coordenam a homeostase. O clamp tambm no
simula o feedback entre glicose e insulina durante as modificaes fisiolgicas destes. Apesar dessas limitaes, vem sendo
adotado em inmeros estudos experimentais, em poucos estudos populacionais, como nos ndios Pima e no EGIR-RISC
Study,18,19 e em alguns estudos clnicos.

Clamp hiperglicmico
Utilizado principalmente para avaliar a secreo de insulina,
examina tambm a sensibilidade insulina. Apresenta boa
correlao de resultados com o clamp euglicmico. A glicose infundida inicialmente em bolus e, depois, em velocidade
varivel para alcanar e manter a hiperglicemia constante, induzindo assim uma fase rpida e uma fase lenta de secreo
hormonal. A RI pode ser estimada por meio da relao entre a
insulinemia alcanada e a taxa de infuso de glicose exgena,
relao que proporcional ao insulnica.14

Teste de tolerncia insulina


Talvez seja a maneira mais simples de avaliar a ao insulnica diretamente. O teste avalia a clearance da glicose em resposta a um
bolus de insulina exgena (0,1 U/kg) a partir de coletas frequentes realizadas durante os primeiros 15 min do teste (variaes
com coletas a 30 e 60 min foram propostas). O teste de tolerncia
insulina (ITT) assume que a taxa de clearance da glicose seja
linear e dependente unicamente da infuso da insulina exgena,
produzindo uma constante (K). A resposta hormonal contrarregulatria pode mascarar os resultados principalmente em indivduos normoglicmicos, enquanto a hipoglicemia decorrente
pode ser um efeito colateral importante. Apresenta fraca correlao com o EHC (r = 0,68).20

Teste de tolerncia glicose intravenosa com o


modelo matemtico mnimo de Bergman
O modelo matemtico mnimo (frequently sampled intravenous glucose tolerance test [FSIVGTT]), proposto por Bergman
et al.,13 envolve a infuso intravenosa de glicose (0,3 g/kg) na
forma de bolus com coleta frequente de amostras. O teste associado a um modelo matemtico que representa a cintica da
glicose em distribuio monocompartimental. O exame avalia
a captao de glicose, um ndice de sensibilidade insulina (SI)
que estima o clearance fracional de glicose pelos tecidos com
insulinemia basal. Analisa ainda a primeira e a segunda fase
de secreo de insulina (j1 e j2) e a glucose effectiveness (SG).

05/10/2015 06:41:45

Anlise dos Marcadores de Resistncia Insulina na Clnica Diria 15

A SI calculada a partir da inclinao da curva (slope) de decaimento da glicose plasmtica e no considera a insulinemia.
Logo, o ndice no pode discernir entre captao de glicose
promovida pela insulina, inibio da EGP e a captao produzida pela prpria concentrao de glicose. Esse mtodo e
o clamp hiperglicmico, tambm considerados como padro-ouro, so utilizados menos frequentemente que o clamp euglicmico, e, para avaliar a RI, dependem de secreo insulnica
bastante preservada, no sendo aconselhados em indivduos
com funo beta celular muito reduzida.14

Marcadores da resistncia
insulnica em jejum
Marcadores, markers ou ndices simples de sensibilidade insulina podem ser obtidos a partir de amostras de sangue em
jejum ou por meio de testes menos invasivos, como o TOTG ou

MTT. Esses marcadores so as ferramentas mais usadas para a


avaliao da RI pelo baixo custo e pela fcil execuo e aceitao
por parte dos pacientes. Uma de suas limitaes a dificuldade
de interpretao de certos ndices, como a razo glicose/insulina em indivduos diabticos que apresentam hiperglicemia em
jejum, ou ainda hiperinsulinemia acompanhada de hiperglicemia em jejum. A insulinemia de jejum apresenta, em algumas
condies, boa correlao com os mtodos diretos de avaliao
da RI, mas menos precisa em indivduos diabticos, obesos e
idosos. Variaes biolgicas dos nveis plasmticos de insulina
podem alterar os ndices de RI obtidos. Alguns autores sugerem
a coleta de trs amostras de sangue em jejum (com intervalos
de 5 min entre elas) para reduzir as discrepncias relacionadas
com as variaes pulsteis da secreo de insulina, existentes
sobretudo em indivduos saudveis e em menor intensidade em
pacientes intolerantes glicose (IGT) e portadores de DM2.21
No Quadro 1, so apresentados alguns dos marcadores para
o diagnstico da RI.

Quadro 1 Principais marcadores para estimar a sensibilidade/resistncia insulina (SI/RI) na prtica clnica.
Marcador

Amostra/teste

Frmula

Comentrios

Ref.

HOMA-IR

Insulinemia (FPI) e
glicemia (FPG) em
jejum

[(FPI mU/ml FPG mmol/l)/22,5]

Valores de RI descritos como porcentagem


da populao de referncia. Derivado de
modelo matemtico; correlaciona bem com
a RI heptica
HOMA2-S: www.dtu.ox.ac.uk/
homacalculator/index.php

22

Critrio clnico +
HOMA (modelos
1, 2 e 3 de Stern)

ndice de massa
corporal e HOMA-IR

HOMA-IR > 4,65 ou IMC > 28,9


kg/m2 ou HOMA-IR > 3,60 e IMC
> 27,5 kg/m2

Critrios obtidos a partir da anlise de 2.138


clamps em indivduos no diabticos de
origem multitnica; altas especificidade e
sensibilidade

17

QUICKI,
revised QUICKI

Insulinemia (FPI) e
glicemia (FPG) em
jejum e FFA em
jejum

[1 (log FPI mU/ml+ log FPG mg/


dl)]
[1 (log FPI mU/ml + log FPG mg/
dl + log (FFA mmol/l)]

ndice quantitativo de sensibilidade insulnica,


com resoluo semelhante ao HOMA-IR. A
adio dos FFA formula original (revised)
aumenta sua correlao ao clamp

23

TyG index

Glicemia e
triglicerdios (TG) em
jejum

[Ln TG mg/dl FPG mg/dl/2]

Comparado ao clamp euglicmico em


pacientes com diferentes graus de
tolerncia glicose: boa especificidade e
sensibilidade

40

ISI composite

Glicemia e
insulinemia em
jejum e mdias de
um TOTG standard

10.000/l FPG FPI Glic mdia


Ins mdia

Criado por Matsuda e DeFronzo, apresenta


boa correlao com o clamp euglicmico

30

ISI Stumvol

Glicemia e
insulinemia em
jejum e mdias de
um TOTG standard

MCR = 13 a 0,0042 Ins 120


0,384 Glic 90 0,0209 FPI
ISI = 0,157 a 4,576 105 Ins
120 0,00519 Glic 90
0,0002999 FPI

Outras duas frmulas incluem o ndice


de massa corporal (IMC). Clearance
metablico da insulina (MCR) e sensibilidade
insulina (SI)

32

KITT

Glicemia em jejum e
aps estmulo com
insulina

(KITT = (0,693/t1/2) 100)

Bolus de insulina intravenosa;


relao entre o tempo e grau de
reduo da glicemia estima a sensibilidade.
Ao contrrio do clamp e do FSIVGTT que
so muito seguros, o ITT, de fcil e rpida
realizao, pode induzir hipoglicemia

14

24

FFA: free fatty acids (cidos graxos livres); FPG: fasting plasma glucose (glicose plasmtica em jejum); FPI: fasting plasma insulin (insulina plasmtica em jejum)
FSIVGTT: frequently sampled intravenous glucose tolerance test; ITT: insulin tolerance teste; TOTG: teste oral de tolerncia glicose.

Diretrizes SBD 2015-2016 - CAP 04.indd 15

05/10/2015 06:41:46

16 Diretrizes SBD | 2015-2016

Mtodos como o HOMA-IR e o QUICKI,22,23 e o revised


QUICKI, que medem a insulinemia em relao glicemia,24
so mais precisos que a insulinemia isoladamente (Quadro 1).
A associao desses ndices a critrios clnicos melhora o
diagnstico da RI, como demonstrado por Stern et al.,17 que
obtiveram especificidade e sensibilidade de 78,7 e 84,9% para
HOMA-IR > 4,65 ou ndice de massa corporal (IMC) > 28,9
kg/m2 ou HOMA-IR > 3,60 e IMC > 27,5 kg/m2 quando comparados ao clamp. O revised QUICKI apresentou as melhores
correlaes com as medidas do clamp, prximas aos ndices
derivados do TOTG (Stumvoll MCR, OGIS, Stumvoll ISI e
GUT index), em extensa metanlise.25 Aps o revised QUICKI, as melhores correlaes em jejum foram obtidas pelo
QUICKI, log HOMA-IR e HOMA2-S.25 Existem diferenas na
IR e na secreo de insulina relacionadas com as origens tnicas de uma populao,26 relativas aos tecidos perifricos (msculo e adiposo) e ao fgado.27 No Brasil, com uma populao
miscigenada de diferentes origens tnicas, no se tem um valor de referncia. Como consequncia, utilizam-se valores obtidos, sobretudo, na populao europeia. Um estudo brasileiro
sugeriu 2,71 como ponto de corte para RI no HOMA-IR,28
entretanto, novos estudos so necessrios para confirmao.
Salientamos a importncia da obesidade e da obesidade
central como fatores preditivos da RI. De fato, o IMC e a medida da cintura correlacionam-se muito bem com os resultados
do clamp euglicmico. A circunferncia do pescoo tambm
tem sido associada resistncia insulina. Um estudo isolado
determinou pontos de corte para a circunferncia do pescoo
na populao brasileira: maior que 39,6 cm no homem e maior
que 36,1 cm na mulher so associados a maior probabilidade
de resistncia insulina e sndrome metablica.28
Recentemente, foi identificada, por meio da metabolmica, uma forte associao entre a-hidroxibutirato (um produto
da degradao de aminocidos) e RI.29 A partir de amostra de
sangue em jejum e com a utilizao da populao do estudo
RISC, foi desenvolvido um teste contendo uma combinao de
metablitos QuantoseTM. Este teste apresentou valor preditivo para a deteriorao de NGT a IGT em follow-up de 3 anos.30
Em outra populao, detectou a resposta da RI ao tratamento
com pioglitazona, discriminou os grupos NGT, IGT e DM2
em relao a RI e apresentou alta correlao com o teste de
Matsuda e FSIVGTT, demonstrando potencial utilidade como
teste laboratorial para esta avaliao.31

ndices de sensibilidade insulina |


Estmulo com glicose via oral e/ou com
alimentos
O TOTG utilizado, principalmente, como ferramenta para
classificar a tolerncia aos carboidratos. A resposta glicmica e
insulinmica durante o teste reflete a relao entre a funo da
clula beta em produzir e secretar insulina e a ao insulnica
nos tecidos sensveis. O MTT verifica a resposta no s glicose, mas tambm s protenas e aos lipdios.
A sensibilidade insulina durante o TOTG e o MTT pode
ser estimada pelo clearance de glicose com o uso de glicose
marcada (mtodo padro-ouro nesta condio, mas dispendioso e que necessita expertise) ou por diversos ndices, como

Diretrizes SBD 2015-2016 - CAP 04.indd 16

o insulin sensitivity from oral glucose (OGIS) e o Matsuda.33,34


O OGIS equivale ao clamp euglicmico no clculo da captao
de glicose, pois tem como caracterstica estimar o clearance da
glicose. Trata-se de um ndice derivado de um modelo matemtico e validado com as medidas obtidas com o clamp. Pode
ser calculado online: <http://webmet.pd.cnr.it/ogis/ogis.php>.
O seu uso foi estendido ao MTT, obtendo-se boa discriminao entre pacientes portadores de DM2 e voluntrios com
NGT ou IGT.35
Vrios marcadores de resistncia/sensibilidade insulina
correlacionam-se com os resultados do clamp euglicmico,
com um ndice de correlao em torno de 0,50 a 0,70, demonstrando a utilidade, mas tambm a limitao dessas medidas e
estimativas.36,37

Avaliao da ao da insulina sobre a


produo endgena de glicose
Essa avaliao, particularmente complicada, envolve o uso
de glicose marcada (mtodo padro-ouro), preferivelmente
com istopos estveis como o deutrio, concomitantemente
ao clamp, ao TOTG ou ao MTT, e anlise com modelos de
cintica da distribuio da glicose. A resistncia heptica insulina , ento, calculada como o produto da EGP e da insulinemia basal e correlacionada com a resistncia perifrica
insulina.38
Recentemente, a EGP foi avaliada no estudo RISC durante um clamp euglicmico. A seguir, obteve-se um ndice para
estimar a EGP, com boa correlao medida padro, usando
parmetros mais simples: Liver IR index = 0,091 + (log ins
AUC0-120 min *0,400) + (log fat mass % *0,346) (log HDL
cholesterol *0,408) + log BMI *0,435), no qual AUC = rea sob
a curva de insulina no TOTG, BMI = body mass index (ndice
de massa corporal), e a fat mass (%) foi avaliada por impedanciometria.39 Esse ndice foi sucessivamente correlacionado
com fatores de risco cardiovascular em 8.750 homens no diabticos em estudo sobre sndrome metablica.40 A correlao
com alguns fatores de risco, como colesterol total, triglicerdios e protena C reativa, mostrou-se maior do que a observada com o SI de Matsuda, o que sugere validade do ndice.

Monitoramento laboratorial da
resistncia insulina
Idealmente, a RI deveria ser avaliada usando-se o clamp euglicmico hiperinsulinmico. O fato de este procedimento no
ser possvel na prtica clnica no diminui a importncia de
avaliar e, em determinados casos, tratar a RI. O uso de marcadores substitutivos muito til, desde que se considerem os
pontos positivos e negativos inerentes a cada mtodo.
Alguns cuidados bsicos no acompanhamento de um paciente quanto avaliao de sua RI so a escolha do mtodo
ou marcadores e a sua reprodutibilidade. No h protocolo
standard definido nem uma frequncia estabelecida para a reavaliao. Estabelecer pontos de corte para a normalidade dos
diversos marcadores particularmente difcil, devido s diferenas populacionais e carncia de padronizao dos ensaios
de dosagem da insulina, primordial para a maioria das medidas
e marcadores. Esses parmetros no tm valor isoladamente;

05/10/2015 06:41:46

Anlise dos Marcadores de Resistncia Insulina na Clnica Diria 17

por isso, deveriam ser utilizados comparando os resultados


aos de indivduos normais da mesma populao, ou comparando-os antes e aps interveno clnica ou cirrgica.

Perspectivas futuras, novos exames e suas


aplicaes na prtica clnica
Existe um interesse muito grande em conseguir marcadores
para a sensibilidade insulina, que idealmente deveriam ser
de simples obteno, baixo custo, capazes de identificar a RI e
as suas mudanas e ter valor preditivo.
Marcadores eficientes seriam uma nova ferramenta para o
tratamento especfico dos defeitos fisiopatolgicos envolvidos,
com a utilizao de uma abordagem mltipla quando necessrio. Os objetivos no seriam apenas o controle glicmico, uma
vez estabelecido o diabetes, mas sim o screening rotineiro e o
tratamento da RI antes do aparecimento do diabetes, da doena cardiovascular etc., embora os reais benefcios do tratamento da RI em pessoas no diabticas devam ser melhor documentados por novos trials clnicos. Frmacos que induzem RI
podero ser evitados, quando caracterizados. Esses marcadores ideais possibilitariam ainda monitorar a resposta teraputica e poderiam ser empregados em estudos epidemiolgicos.
Quadro 2 Recomendaes e concluses.
Recomendaes e concluses

Grau de
recomendao

Em resumo, a RI insulina pode ser medida


por testes padro-ouro como os clamps

Podemos definir, na prtica clnica, que um


paciente tem RI quando ele se enquadra
nos critrios dos modelos 1, 2 ou 3
propostos por Stern et al.17

A escolha do ndice de sensibilidade


insulina depende de fatores, como o
nmero de indivduos estudados, e das
possibilidades relacionadas com as coletas
de sangue e dosagens de glicose, insulina
ou outros metablitos (Otten et al.25)

(A) Estudos experimentais e observacionais de melhor consistncia; (B)


Estudos experimentais e observacionais de menor consistncia; (C) Relatos
de casos estudos no controlados; (D) Opinio desprovida de avaliao
crtica, baseada em consenso, estudos fisiolgicos ou modelos animais.

Referncias bibliogrficas
1. Himsworth HP, Kerr RB. Insulin-sensitive and insulin-insensitive types of diabetes mellitus. Clin Sci. 1939; 4:119-52.
2. Taylor SI, Accili D, Imai Y. Insulin resistance or insulin deficiency.
Which is the primary cause of NIDDM? Diabetes. 1994; 43:735-40.
3. DeFronzo RA. From the triumvirate to the ominous octet: a new
paradigm for the treatment of type 2 diabetes mellitus. Diabetes.
2009; 58:773-95.
4. Ferrannini E. The insulin resistance syndrome. Current Opinion
in Nephrology and Hypertension. 1992; 1:291-8.
5. Hanley AJ, Williams K, Stern MP et al. Homeostasis model assessment of insulin resistance in relation to the incidence of cardiovascular disease: the San Antonio Heart Study. Diabetes Care.
2002; 25:1177-84.

Diretrizes SBD 2015-2016 - CAP 04.indd 17

6. Hu G, Qiao Q, Tuomilehto J. The metabolic syndrome and cardiovascular risk. Curr Diabetes Rev. 2005; 1:137-43.
7. Reaven GM. Role of insulin resistance in human disease. Diabetes. 1988; 37:1595-607.
8. DeFronzo RA, Binder C, Wahren J et al. Sensitivity of insulin
secretion to feedback inhibition by hyperinsulinemia. Acta Endocrinol (Copenh). 1981; 98:81-4.
9. Del Prato S, Leonetti F, Simonson DC et al. Effect of sustained
physiologic hyperinsulinaemia and hyperglycaemia on insulin
secretion and insulin sensitivity in man. Diabetologia. 1994;
37:1025-35.
10. Unger RH, Grundy S. Hyperglycaemia as an inducer as well as
a consequence of impaired islet cell function and insulin resistance: implications for the management of diabetes. Diabetologia. 1985; 28:119-25.
11. Ferrannini E. Insulin resistance versus insulin deficiency in noninsulin-dependent diabetes mellitus: problems and prospects.
Endocrine Reviews. 1998; 19:477-90.
12. Ravussin E, Smith SR. Increased fat intake, impaired fat oxidation, and failure of fat cell proliferation result in ectopic fat storage, insulin resistance, and type 2 diabetes mellitus. Ann N Y
Acad Sci. 2002; 967:363-7.
13. Bergman RN, Phillips LS, Cobelli C. Physiologic evaluation of
factors controlling glucose tolerance in man: measurement of
insulin sensitivity and beta-cell glucose sensitivity from the response to intravenous glucose. J Clin Invest. 1981; 68:1456-67.
14. Ferrannini E, Mari A. How to measure insulin sensitivity. J Hypertens. 1998; 16:895-906.
15. Andres R, Swerdloff R, Pozefsky T et al. Manual feedback technique for the control of blood glucose concentration. In: Skeggs
LT Jr, ed. Automation in analytical chemistry. New York: Mediad, 1966. b486-91.
16. Bonadonna RC, Groop L, Kraemer N et al. Obesity and insulin
resistance in humans: a dose-response study. Metabolism. 1990;
39:452-9.
17. Stern SE, Williams K, Ferrannini E et al. Identification of individuals with insulin resistance using routine clinical measurements. Diabetes. 2005; 54:333-9.
18. Lillioja S, Mott DM, Spraul M et al. Insulin resistance and insulin
secretory dysfunction as precursors of non-insulin-dependent
diabetes mellitus. Prospective studies of Pima Indians. N Engl J
Med. 1993; 329:1988-92.
19. Ferrannini E, Natali A, Muscelli E et al. Natural history and physiological determinants of changes in glucose tolerance in a non-diabetic population: the RISC Study. Diabetologia. 2011; 54:1507-16.
20. Gelding SV, Robinson S, Lowe S et al. Validation of the low dose
short insulin tolerance test for evaluation of insulin sensitivity.
Clin Endocrinol (Oxf). 1994 may; 40(5):611-5.
21. Polonsky KS, Given BD, Hirsch LJ et al. Abnormal patterns of
insulin secretion in non-insulin-dependent diabetes mellitus. N
Engl J Med. 1988; 318:1231-9.
22. Matthews DR, Hosker JP, Rudenski AS et al. Homeostasis model
assessment: insulin resistance and beta-cell function from fasting plasma glucose and insulin concentrations in man. Diabetologia. 1985; 28:412-9.
23. Katz A, Nambi SS, Mather K et al. Quantitative insulin sensitivity
check index: a simple, accurate method for assessing insulin sensitivity in humans. J Clin Endocrinol Metab. 2000; 85:2402-10.
24. Perseghin G, Caumo A, Caloni M et al. Incorporation of the fasting plasma FFA concentration into QUICKI improves its association with insulin sensitivity in nonobese individuals. Journal
of Clinical Endocrinology & Metabolism. 2001; 86:4776-81.
25. Otten J, Ahrn B, Olsson T. Surrogate measures of insulin sensitivity vs the hyperinsulinaemic-euglycaemic clamp: a metaanalysis. Diabetologia, 2014.

05/10/2015 06:41:46

18 Diretrizes SBD | 2015-2016


26. Komada K, Tojjar D, Yamada S et al. Ethnic differences in the
relationship between insulin sensitivity and insulin response.
Diabetes Care. 2013; 36:1789-96.
27. Ellis AC, Alvarez JA, Granger WM et al. Ethnic differences in
glucose disposal, hepatic insulin sensitivity, and endogenous
glucose production among African American and European
American women. Metabolism. 2012; 61:634-40.
28. Stabe C, Vasques ACJ, Lima MMO. Neck circumference as a
simple tool for identifying the metabolic syndrome and insulin
resistance: results from the Brazilian Metabolic Syndrome Study.
Clinical Endocrinology. 2013; 78:874-81.
29. Gall WE, Beebe K, Lawton KA et al. Alpha-hydroxybutyrate is an
early biomarker of insulin resistance and glucose intolerance in a
nondiabetic population. PLoS One. 2010; 5:e10883.
30. Cobb J, Gall W, Adam KP et al. A novel fasting blood test for insulin resistance and prediabetes. J Diabetes Sci Technol. 2013;
7:100-10.
31. Tripathy D, Cobb JE, Gall W et al. A novel insulin resistance index to monitor changes in insulin sensitivity and glucose tolerance: the ACT NOW Study. J Clin Endocrinol Metab. 2015 may;
100(5):1855-62.
32. Stumvoll M, Mitrakou A, Pimenta W et al. Use of the oral glucose tolerance test to assess insulin release and insulin sensitivity.
Diabetes Care. 2000; 23:295-301.

Diretrizes SBD 2015-2016 - CAP 04.indd 18

33. Mari A, Pacini G, Murphy E et al. A model-based method for


assessing insulin sensitivity from the oral glucose tolerance test.
Diabetes Care. 2001; 24:539-48.
34. Matsuda M, DeFronzo RA. Insulin sensitivity indices obtained from
oral glucose tolerance testing. Diabetes Care. 1999; 22:1462-70.
35. Muscelli E, Casolaro A, Gastaldelli A et al. Mechanisms for the
antihyperglycemic effect of sitagliptin in patients with type 2 diabetes. J Clin Endocrinol Metab 2012. J Clin Endocrinol Metab.
2012 aug; 97(8):2818-26.
36. Muscelli E, Lazarin MACT, Souza ICP et al. Comparison of insulin sensitivity measured by euglicemic hyperinsulinemic clamp
and indexes obtained from oral glucose tolerance test in lean and
obese patients. Int J Obes. 2002; 26:21.
37. Mari A, Pacini G, Brazzale AR et al. Comparative evaluation of
simple insulin sensitivity methods based on the oral glucose tolerance test. Diabetologia. 2005; 48:748-51.
38. Gastaldelli A, Casolaro A, Pettiti M et al. Effect of pioglitazone
on the metabolic and hormonal response to a mixed meal in type
II diabetes. Clin Pharmacol Ther. 2007; 81:205-12.
39. Vangipurapu J, Stankov A, Kuulasmaa T et al. A novel surrogate
index for hepatic insulin resistance. Diabetologia. 2011; 54:540-3.
40. Vangipurapu J, Stankov A, Kuulasmaa T et al. Association between liver insulin resistance and cardiovascular risk factors. J
Intern Med. 2012; 272:402-8.

05/10/2015 06:41:46

Avaliao do Controle Glicmico


Introduo
Na prtica clnica, a avaliao do controle glicmico feita mediante a utilizao de dois recursos laboratoriais: os testes de glicemia e os de hemoglobina glicada (HbA1c), cada um com seu
significado clnico especfico e ambos considerados recursos
complementares para a correta avaliao do estado de controle glicmico em pacientes diabticos (A),1 como mostra a
Figura 1.
Os testes de glicemia refletem o nvel glicmico atual e instantneo no momento exato em que foram realizados, enquanto os testes de HbA1c revelam a glicemia mdia pregressa dos
ltimos 4 meses. Uma maneira didtica bastante simples para
explicar aos pacientes os significados e as implicaes dos testes
de glicemia e de HbA1c a comparao com os termos j bastante familiares queles que utilizam os servios bancrios: os
testes de glicemia revelariam o saldo atual da conta bancria,
ou seja, a quantidade exata de glicose sangunea no momento
do teste. Por outro lado, os testes de HbA1c apontariam o saldo
mdio da conta bancria durante os ltimos 4 meses.
Os valores de correspondncia entre os nveis de HbA1c e
os respectivos nveis mdios de glicemia nos ltimos 4 meses
foram inicialmente determinados com base nos resultados do
Diabetes Control and Complications Trial (DCCT) (A).2 Estudo conduzido mais recentemente reavaliou as correlaes entre os nveis de HbA1c e os correspondentes nveis de glicemia
mdia estimada (A), conforme mostra o Quadro 1. Note-se,
por exemplo, que um resultado de HbA1c = 7% corresponderia, pelos padres dos estudos originais, a uma glicemia mdia
de 170 mg/dl. Agora, de acordo com os novos parmetros,
este mesmo nvel de HbA1c = 7% corresponde, na realidade, a
um nvel de glicemia mdia estimado de 154 mg/dl.
Testes tradicionalmente utilizados para avaliar o controle glicmico

Testes de glicemia

Testes de HbA1c

Mostram o nvel
glicmico
instantneo no
momento do teste

Mostram a glicemia
mdia pregressa
dos ltimos dois a
quatro meses

Saldo atual

Saldo mdio

Figura 1 Testes tradicionais para avaliao do controle glicmico.

Diretrizes SBD 2015-2016 - CAP 05.indd 19

Quadro 1 Correspondncia entre os nveis de HbA1c (%) e os


nveis mdios de glicemia dos ltimos 4 meses (mg/dl).
Nvel de HbA1c (%)

Estudos originais

Novos estudos

65

70

100

98

135

126

7
META SBD/ADA

170

154

205

183

240

212

10

275

240

11

310

269

12

345

298

Tanto os testes de glicemia quanto os de HbA1c so considerados tradicionais para a avaliao do controle glicmico.
Desde o incio de 2008, dois outros parmetros de avaliao
do controle glicmico foram desenvolvidos e ainda tm penetrao muito baixa entre os mdicos que cuidam do diabetes,
em virtude de no estarem totalmente familiarizados com as
vantagens desses novos parmetros. So eles: a glicemia mdia
estimada (GME) (A) e a variabilidade glicmica,3 um importante fator que vem sendo considerado como de risco isolado
para as complicaes do diabetes, independentemente dos valores elevados de glicemia mdia (A).4,5 Assim, considerando
os mtodos tradicionais e as novas tcnicas para avaliao do
controle glicmico, agora so quatro parmetros que podem
ser utilizados para tal fim, como mostra o Quadro 2.
As metas estabelecidas para a caracterizao do bom controle glicmico pelos mtodos tradicionais esto resumidas no
Quadro 3.
Quadro 2 Mtodos novos e tradicionais para a avaliao do
controle glicmico.
Mtodos
tradicionais

Mtodos novos

Testes de glicemia Monitoramento contnuo da glicose (CGMS)


Testes de HbA1c

Glicemia mdia estimada


(Avaliada por meio de perfis glicmicos)
Variabilidade glicmica
(Avaliada mediante desvio padro)

CGMS = continuous glucose monitoring system.

06/10/2015 10:13:22

20 Diretrizes SBD | 2015-2016


Quadro 3 Metas laboratoriais para o tratamento do diabetes tipo 2.
Metas laboratoriais
Parmetro

Metas teraputicas

Nveis tolerveis

Hemoglobina glicada

Em torno de 7% em adultos, sendo entre 7,5


e 8,5% em idosos, dependendo do estado
de sade

As metas devem ser individualizadas de acordo com a


durao de diabetes, idade/expectativa de vida,
comorbidades, doena cardiovascular, complicaes
microvasculares e hipoglicemia no percebida

Glicemia de jejum

< 110 mg/dl

At 130 mg/dl

Glicemia pr-prandial

< 110 mg/dl

At 130 mg/dl

Glicemia ps-prandial

< 160 mg/dl

At 180 mg/dl

Adaptado de American Diabetes Association. Standards of Medical Care in Diabetes 2015. Diabetes Care. 2015; 38(suppl 1)54:S1-S94. DOI: 10.2337/
dc15-S003.

Conceito e implicaes clnicas da


hemoglobina glicada
No decorrer dos anos ou das dcadas, a hiperglicemia prolongada promove o desenvolvimento de leses orgnicas extensas
e irreversveis, que afetam os olhos, os rins, os nervos, os vasos
grandes e pequenos, assim como a coagulao sangunea. Os nveis de glicose sangunea persistentemente elevados so txicos
ao organismo por meio de trs mecanismos diferentes: promoo da glicao de protenas, hiperosmolaridade e aumento dos
nveis de sorbitol dentro da clula. mediante esse processo de
glicao das protenas que a glicose sangunea liga-se molcula de hemoglobina (D),2 conforme mostra a Figura 2.
A quantidade de glicose ligada hemoglobina diretamente proporcional concentrao mdia de glicose no sangue. Uma vez que os eritrcitos tm um tempo de vida de
aproximadamente 120 dias, a medida da quantidade de glicose
ligada hemoglobina pode fornecer uma avaliao do controle glicmico mdio no perodo de 60 a 120 dias antes do
exame. Este o propsito dos exames de HbA1c, sendo mais
frequente a avaliao da hemoglobina A1c (D).2
Tradicionalmente, a HbA1c tem sido considerada representativa da mdia ponderada global das glicemias mdias dirias
(inclusive glicemias de jejum e ps-prandial) durante os ltimos

4 meses. Na verdade, a glicao da hemoglobina ocorre ao longo


de todo o perodo de vida do glbulo vermelho, que por volta de
120 dias. Porm, dentro desse perodo, a glicemia recente a que
mais influencia o valor da HbA1c. De fato, os modelos tericos e
os estudos clnicos sugerem que um paciente em controle estvel
apresentar 50% de sua HbA1c formados no ms precedente ao
exame, 25% no ms anterior e os 25% remanescentes no terceiro
e quarto meses antes do exame (D),2 como mostra a Figura 3.
O impacto de qualquer variao significativa (em sentido
ascendente ou descendente) na glicemia mdia ser diludo
dentro de 4 meses, nos nveis de HbA1c. A glicemia mais recente causar o maior impacto nos nveis de HbA1c. Os exames
de HbA1c devero ser realizados regularmente em todos os pacientes com diabetes. Inicialmente, para documentar o grau de
controle glicmico em sua avaliao inicial e, subsequentemente, como parte do atendimento contnuo do paciente (D).2

Importante
Frequncia recomendada para os testes de HbA1c: os testes
de HbA1c devem ser realizados pelo menos duas vezes ao ano
por todos os pacientes diabticos e quatro vezes ao ano (a
cada 3 meses) por aqueles que se submeteram a alteraes
do esquema teraputico ou no estejam alcanando os objetivos recomendados com o tratamento vigente.

Para uma avaliao correta do resultado do teste de HbA1c,


necessrio conhecer a tcnica laboratorial utilizada na sua
realizao. Mtodos laboratoriais distintos apresentam faixas
de valores normais igualmente distintas. Em princpio, os laboratrios clnicos deveriam utilizar apenas os mtodos laboratoriais certificados pelo National Glyco-hemoglobin Standardization Program (NGSP), o qual analisa o desempenho
1 ms antes

2 meses antes

50%

25%

3 meses antes

4 meses antes

25%

Data da coleta de sangue para o teste de HbA1c

Figura 2 Molcula da hemoglobina mostrando a glicao das molculas de glicose.

Diretrizes SBD 2015-2016 - CAP 05.indd 20

Figura 3 Impacto das glicemias mais recentes versus as mais antigas sobre os nveis de hemoglobina glicada.

06/10/2015 10:13:22

Avaliao do Controle Glicmico 21

do mtodo analtico empregado e verifica se uma determinada


tcnica laboratorial ou no rastrevel a ele durante o estudo
DCCT. Esses mtodos certificados pelo NGSP medem especificamente a frao de hemoglobina glicada definida como
HbA1c, frao esta que efetivamente est relacionada com o
risco cardiovascular. Para esse grupo de testes certificados, a
faixa de normalidade varia de 4 a 6% e a meta clnica definida
de um nvel de HbA1c < 6,5% ou < 7%, conforme recomendaes de diferentes sociedades mdicas (D).2

Conceito e implicaes clnicas dos


testes de glicemia
Os testes de glicemia podem ser realizados por meio de tcnicas laboratoriais tradicionais executadas por laboratrios clnicos ou pela prtica do automonitoramento domiciliar, que,
quando realizada de modo racional, pode proporcionar uma
viso bastante realista do nvel do controle glicmico durante
todo o dia, o qual pode ser conseguido pela realizao de perfis
glicmicos de seis pontos (trs testes pr-prandiais e trs testes
ps-prandiais realizados 2 h aps as principais refeies). Para
pacientes insulinizados, recomenda-se a realizao de mais
um teste glicmico durante a madrugada para a deteco de
eventual hipoglicemia (D).6
Desde seu posicionamento oficial com o Standards of Medcal Care in Diabetes 2008, a American Diabetes Association
(ADA) considera o automonitoramento glicmico (AMG) parte
integrante do conjunto de intervenes e componente essencial
de uma efetiva estratgia teraputica para o controle adequado
do diabetes. Esse procedimento possibilita ao paciente avaliar
a resposta individual terapia e possibilita tambm ajuizar se
as metas glicmicas recomendadas esto sendo efetivamente
obtidas. Os resultados do AMG podem ser teis na preveno
da hipoglicemia, na deteco de hipo e hiperglicemias no sintomticas e no ajuste da conduta teraputica medicamentosa e
no medicamentosa, tanto para portadores de diabetes mellitus
do tipo 1 (DM1) quanto do tipo 2 (DM2), que varia apenas a
frequncia recomendada, a qual deve ser definida pelas necessidades individuais e metas de cada paciente (D).1
A funo do AMG nos cuidados com as pessoas que sofrem
de diabetes foi extensamente avaliada por uma conferncia global
de consenso, publicada como um suplemento do The American
Journal of Medicine, de setembro de 2005. De acordo com este
consenso, o AMG uma parte integral, porm subutilizada, da
estratgia integrada de gerenciamento da doena, tanto em portadores de DM1 quanto de DM2. As diretrizes sobre as frequncias recomendadas e os horrios para a realizao dos testes de
glicemia variam entre as associaes internacionais de diabetes.
Alm disso, por falta de informaes, os pacientes frequentemente desconhecem as aes mais adequadas que deveriam tomar em resposta aos resultados da glicemia obtidos pelo AMG.
O objetivo dessa conferncia global de consenso foi definir o
AMG como uma ferramenta de auxlio para otimizar o controle glicmico e complementar informaes proporcionadas pela
HbA1c, alm de detectar excurses ps-prandiais e padres
inaceitveis de perfil glicmico, ajudando os pacientes a avaliar
a eficcia de suas aes de estilo de vida e de seu esquema teraputico. O AMG tambm contribui para reduo do risco de
hipoglicemia e manuteno de uma boa qualidade de vida (D).7

Diretrizes SBD 2015-2016 - CAP 05.indd 21

A importncia do automonitoramento no DM1 universalmente aceita. Por outro lado, sua utilidade para a avaliao
do controle no DM2 tem sido contestada. Na verdade, o automonitoramento tambm fundamental para os portadores
de DM2, principalmente aqueles com tratamento insulnico.
No se deve discutir mais se essa prtica ou no til no DM2,
e sim qual frequncia de testes seria a mais recomendada e a
mais racional para cada paciente em particular.
Ao definir o esquema de automonitoramento da glicemia,
deve-se ter em conta o grau de estabilidade ou de instabilidade da glicemia, bem como a condio clnica especfica em
que o paciente encontra-se em um determinado momento. As
principais condies nas quais a frequncia de testes deve ser
ampliada esto descritas no Quadro 4 (D).6
Uma vez obtido o controle glicmico e aps se certificar de
que o paciente j tem conhecimentos operacionais suficientes
para gerenciar seu controle glicmico, a frequncia de testes de
glicemia deve ser ajustada de acordo com trs critrios principais: tipo de diabetes, esquema teraputico utilizado e grau
de estabilidade ou instabilidade do controle glicmico, como
mostra o Quadro 5.

Importante
No existe esquema padro de frequncia de testes glicmicos que seja aplicvel a qualquer paciente, indistintamente.
importante saber que a frequncia de testes para portadores
de DM2 deve ser determinada exclusivamente com base no
perfil de resposta clnica do paciente ao tratamento institudo.

Quadro 4 Fase de avaliao aguda: frequncias sugeridas de


testes de glicemia capilar, conforme a situao clnica.
Situao clnica

Frequncia de testes

Necessidade maior de
testes

Perfil glicmico: 3 dias por


semana e seis testes por dia

Incio do tratamento

Testes pr-prandiais: antes do


caf da manh, do almoo e do
jantar

Ajuste da dose do
medicamento

Testes ps-prandiais: 2 h aps o


caf da manh, o almoo e o
jantar

Mudana de medicao

Testes adicionais para pacientes


do tipo 1 ou do tipo 2 usurios
de insulina: na hora de dormir e
de madrugada (3 h da manh)

Estresse clnico e cirrgico


(infeces, cirurgias etc.)
Terapia com substncias
diabetognicas
(corticosteroides)
Episdios de hipoglicemias
graves
HbA1c elevada com
glicemia de jejum normal
Adaptado de Pimazoni Netto A, Lerrio AC, Minicucci W et al. Automonitoramento glicmico e monitoramento contnuo da glicose. Posicionamento
Oficial SBD no 1. Revista Brasileira de Medicina, 2006 (suplemento especial 1).6

06/10/2015 10:13:22

22 Diretrizes SBD | 2015-2016


Quadro 5 Fase de estabilidade: frequncias sugeridas de testes de
glicemia capilar, de acordo com a situao clnica.
Situao clnica

Frequncia de testes

Necessidade menor de
testes

Frequncia varivel, conforme


tipo, tratamento e grau de
estabilidade glicmica

Condio clnica estvel

Tipo 1: trs testes ou mais por dia


em diferentes horrios, sempre

Baixa variabilidade nos


resultados dos testes,
com HbA1c normal ou
quase normal

Tipo 2 insulinizado: trs testes por


dia em diferentes horrios,
dependendo do grau de
estabilizao glicmica
Tipo 2 no insulinizado: pelo
menos dois a quatro testes por
semana, em diferentes horrios,
dependendo do grau de
estabilizao glicmica

Quadro 6 Principais indicaes reconhecidas pela SBD para o


monitoramento contnuo da glicose.
A indicao mais importante do MCG facilitar os ajustes na
conduta teraputica, com o objetivo de melhorar o controle
glicmico
Os referidos ajustes incluem:
Substituio da insulina rpida pelo anlogo de insulina
ultrarrpida ou acrscimo de aplicaes adicionais de
insulina de ao rpida ou de anlogo de insulina de ao
ultrarrpida
Troca da insulina NPH por um anlogo de insulina de
longa durao ou incluso de aplicaes adicionais de
insulina NPH
Ajustes de doses de insulina basal e prandial
Alteraes na composio de carboidratos da dieta
Modificaes nas metas desejveis para glicemia pr ou
ps-prandial
Quantificao da resposta a um agente antidiabtico

Adaptado de Pimazoni Netto A, Lerrio AC, Minicucci W et al. Automonitoramento glicmico e monitoramento contnuo da glicose. Posicionamento Oficial SBD n o 1. Revista Brasileira de Medicina, 2006
(suplemento especial 1).6

Avaliao do impacto de modificaes do estilo de vida sobre o


controle glicmico

Conceito e implicaes clnicas do


monitoramento contnuo da glicose

Diagnstico e preveno da hipoglicemia assintomtica e


noturna

O monitoramento contnuo da glicose (MCG) proporciona


informaes sobre a direo, a magnitude, a durao, a frequncia e as causas das flutuaes nos nveis de glicemia. Em
comparao com o AMG convencional, que engloba algumas
determinaes dirias e pontuais da glicemia, o sistema de
MCG proporciona uma viso muito mais ampla dos nveis de
glicose durante todo o dia, alm de proporcionar informaes
sobre tendncias de nveis glicmicos capazes de identificar e
prevenir perodos de hipo ou hiperglicemia. Por outro lado,
o AMG tem ampla indicao para uso frequente e rotineiro
pelo portador de diabetes, enquanto o MCG tem suas indicaes restritas a um grupo de condies clnicas especiais. As
manifestaes clnicas para a realizao do exame de MCG
incluem situaes que exigem informao detalhada sobre as
flutuaes da glicemia, as quais somente podem ser detectadas
mediante monitoramento contnuo (A).8
O procedimento do MCG est indicado para pacientes
com DM1 ou DM2, desde que seja devidamente caracterizada
a necessidade mdica de um perfil glicmico completo, com a
finalidade de identificar alteraes significativas das flutuaes
glicmicas ocorridas durante as 24 h do dia. O Quadro 6 mostra resumidamente as principais indicaes reconhecidas pela
Sociedade Brasileira de Diabetes (SBD) para a realizao do
MCG, com base nas recomendaes de Klonoff (A).8

Conceito e implicaes clnicas da


glicemia mdia semanal e da
variabilidade glicmica
Novos conceitos e mtodos de avaliao do controle glicmico
esto sendo mais intensamente divulgados desde 2008. Estudo
clnico recentemente publicado ressalta a importncia da utili-

Diretrizes SBD 2015-2016 - CAP 05.indd 22

Monitoramento das condies nas quais um controle glicmico


intensivo desejado (diabetes gestacional, diabetes em
crianas, pacientes em UTI)

Diagnstico e preveno da hipoglicemia ps-prandial

zao do conceito de glicemia mdia, definindo as correlaes


matemticas entre os nveis de HbA1c e os nveis mdios de
glicemia, de tal modo a priorizar a utilizao das mdias glicmicas em substituio aos valores de HbA1c (A).3
Na prtica clnica, h uma necessidade urgente do desenvolvimento de mtodos confiveis de fcil implementao e utilizao e de baixo custo para a avaliao em curto
prazo do controle glicmico e da adequao da conduta
teraputica. Essas informaes possibilitaro reorientar a
definio de novas abordagens de tratamento, com o objetivo maior de otimizar a teraputica e combater a inrcia
clnica e seu impacto nocivo sobre a progresso das complicaes crnicas do diabetes. Tanto a HbA1c quanto a frutosamina so mtodos de avaliao de longo e mdio prazos,
respectivamente.
A utilizao espordica e no estruturada de testes de glicemia capilar no fornece os elementos necessrios para a avaliao completa do estado glicmico. Por outro lado, a realizao
de pelo menos trs perfis glicmicos dirios de 6 ou 7 pontos
(trs glicemias pr-prandiais + trs glicemias ps-prandiais +
uma glicemia durante a madrugada para pacientes insulinizados) por semana possibilita estimar a glicemia mdia semanal (GMS) e viabilizar a avaliao do nvel de controle glicmico e da adequao da conduta teraputica em curtssimo
prazo, quando esse mtodo utilizado em avaliaes semanais durante o perodo de diagnstico glicmico e de ajustes
teraputicos.
Alm disso, a glicemia mdia mostrou ser o melhor preditor de complicaes macrovasculares no DM1 em comparao com a HbA1c, sendo provavelmente a melhor maneira de

06/10/2015 10:13:22

Avaliao do Controle Glicmico 23

se avaliar o risco cardiovascular (A).9 Outros estudos em pacientes com DM1 confirmaram as correlaes entre os nveis
de HbA1c e os nveis mdios de glicemia mediante sistemas de
monitoramento contnuo da glicose (CGMS) (A).1012
Estudos mais recentes confirmam a importncia da variabilidade glicmica como um fator de risco isolado, visto que
oscilaes muito amplas da glicemia ao redor de um valor
mdio ativam o estresse oxidativo e promovem dano tissular. Alis, a importncia da variabilidade glicmica pode ser
maior que a dos nveis elevados de HbA1c na determinao do
risco de complicaes cardiovasculares no paciente diabtico
tipo 2 (A).4,5

Consideraes especiais sobre a utilizao da


glicemia mdia semanal para a avaliao do
controle glicmico
Uma abordagem intensiva de controle do diabetes foi desenvolvida pelo Grupo de Educao e Controle do Diabetes
Centro de Hipertenso e Metabologia Cardiovascular do Hospital do Rim da Universidade Federal de So Paulo (Unifesp).
Esse mtodo uma derivao do automonitoramento domiciliar, que avalia o controle glicmico do paciente por meio
da realizao de trs perfis glicmicos de 6 ou 7 pontos por
semana. Os pacientes so atendidos semanalmente por uma
equipe interdisciplinar e recebem monitor de glicemia e tiras

reagentes necessrias para a realizao dos perfis glicmicos.


Os resultados das glicemias so baixados para um computador
e, com o auxlio de um software especfico, calculam-se a mdia e o desvio padro dos resultados semanais. Os novos parmetros utilizados por esse mtodo incluem a glicemia mdia
semanal, a variabilidade glicmica (desvio padro) e a anlise
grfica do perfil glicmico (C).
De posse desses dados, a equipe de atendimento pode verificar vrias informaes de importncia, as quais possibilitam
um ajuste semanal da conduta teraputica com base na GMS,
nos padres de glicemia apresentados pelos perfis glicmicos
e no desvio padro obtido a partir dos resultados dos perfis
glicmicos.
A Figura 4 mostra o grfico de desempenho glicmico de
uma paciente que se recusava a receber tratamento insulnico
e, depois de devidamente convencida pela equipe de atendimento, concordou em ser insulinizada. O grfico revela que,
aps 3 semanas do incio do tratamento insulnico, a paciente
entrou em pleno controle glicmico, assim definido quando
so obtidos nveis de GMS < 150 mg/dl e desvio padro < 50
mg/dl. Neste caso, o acompanhamento semanal com base nos
parmetros mencionados possibilitou que se alcanasse perfeita adequao da conduta teraputica s necessidades teraputicas da paciente em curtssimo prazo (3 semanas), sem ter
de aguardar a avaliao dos resultados dos testes de HbA1c, os
quais demoram de 3 a 4 meses para manifestar a totalidade do
efeito teraputico da conduta adequada.

Semana 1 = GMS 342 mg/dl e DP = 60 mg/dl


3 semanas aps incio de insulina: GMS 112 mg/dl e DP = 25 mg/dl
71 anos, sexo feminino, com diabetes no controlado h 10 anos
Semanas
400

350

300
Gs (mg/dl)

Incio do tratamento
insulnico

Normalizao da
glicemia e do desvio
padro em trs
semanas
6

250
200

150
100
50
0
03
Maro

10

17

24

31

07
Abril

14

21

28

2008

Figura 4 Grfico de desempenho glicmico mostrando normalizao da glicemia e do desvio padro 3 semanas aps o incio da terapia
insulnica. Reduo da glicemia mdia semanal (GMS) de 342 mg/dl para 112 mg/dl e diminuio do desvio padro (DP; expresso da
variabilidade glicmica) de 60 mg/dl para 25 mg/dl.

Diretrizes SBD 2015-2016 - CAP 05.indd 23

06/10/2015 10:13:23

24 Diretrizes SBD | 2015-2016


Quadro 7 Recomendaes e concluses (continuao).

Quadro 7 Recomendaes e concluses.


Recomendaes e concluses

Grau de
recomendao

A reduo dos nveis de HbA1c para valores


< 7% demonstrou diminuir as complicaes
microvasculares e neuropticas e,
possivelmente, as complicaes
macrovasculares do diabetes, sobretudo no
diabetes tipo 1

A meta de HbA1c para indivduos


selecionados deve ser estabelecida o mais
prximo possvel do limite superior da
normalidade (< 6%), sem aumentar o risco
de hipoglicemias significativas

A utilizao da GMS e do clculo do desvio


padro como modo de expresso da
variabilidade glicmica possibilita a
avaliao em curto prazo do nvel de
controle glicmico e da adequao da
conduta teraputica

A glicemia mdia estimada um novo


conceito na avaliao do controle glicmico
e sua utilizao, em conjunto com os
resultados da HbA1c, est sendo
recomendada por entidades mdicas
internacionais relacionadas com o diabetes

A variabilidade glicmica pode ser


considerada um fator de risco independente
para as complicaes do diabetes

A utilizao de perfis glicmicos de 6 ou 7


pontos constitui-se em mtodo mais preciso
de avaliao da glicemia do que a realizao
de testes glicmicos isolados

A frequncia recomendada para o


automonitoramento da glicemia deve ser
definida em funo do tipo de diabetes, do
grau de estabilidade ou instabilidade
glicmica e das condies clnicas de cada
paciente

O automonitoramento glicmico tambm


contribui para reduo do risco de
hipoglicemia e manuteno de uma boa
qualidade de vida

O MCG est indicado em situaes que


exigem informaes detalhadas sobre as
flutuaes da glicemia, as quais somente
podero ser detectadas mediante
monitoramento eletrnico da glicose
intersticial

Referncias bibliogrficas

(continua)

Diretrizes SBD 2015-2016 - CAP 05.indd 24

Grau de
recomendao

(A) Estudos experimentais e observacionais de melhor consistncia;


(B) Estudos experimentais e observacionais de menor consistncia; (C)
Relatos de casos estudos no controlados; (D) Opinio desprovida de
avaliao crtica, baseada em consenso, estudos fisiolgicos ou modelos
animais.

Metas menos rgidas de HbA1c devem ser


D
adotadas para pacientes com histria de
hipoglicemia grave, crianas, indivduos com
comorbidades importantes, pessoas com
expectativas limitadas de vida e para
aquelas com diabetes de longa durao e
sem complicaes microvasculares
Testes de HbA1c devero ser realizados pelo
menos duas vezes ao ano para os pacientes
com controle razovel, e a cada 3 meses
para os mais instveis

Recomendaes e concluses

1. American Diabetes Association. Standards of Medical Care in


Diabetes 2015. Diabetes Care. 2015; 38(suppl 1)54:S1-S94.
2. Grupo Interdisciplinar de Padronizao da Hemoglobina Glicada A1 c. Posicionamento Oficial 2004 A Importncia
da hemoglobina glicada (A1 c) para a avaliao do controle
glicmico em pacientes com diabetes mellitus: manifestaes
clnicas e laboratoriais. SBD, SBEM, ALAD, SBPC e FENAD,
2004 abr.
3. Nathan DM, Kuenen J, Borg R et al. A1 c-Derived Average Glucose Study Group. Translating the A1C assay into estimated average glucose values. Diabetes Care. 2008; 31:1473-8.
4. Monnie L, Colette C. Glycemic variability: should we and can we
prevent it? Diabetes Care. 2008; 31(suppl 2):S150-S4.
5. Ceriello A, Esposito K, Piconi L et al. Oscillating glucose is more
deleterious to endothelial function and oxidative stress than
mean glucose in normal and type 2 diabetic patients. Diabetes.
2008; 57:1349-54.
6. Pimazoni Netto A, Lerrio AC, Minicucci W et al. Automonitoramento glicmico e monitoramento contnuo da glicose. Posicionamento Oficial SBD. Rev Bras Med. 2006; 1(suppl 1).
7. Bergenstal RM et al. The role of self-monitoring of blood glucose in the care of people with diabetes: Report of a Global Consensus Conference. The American Journal of Medicine. 2005;
118(9A):S1- S6.
8. Klonoff DC. Continuos glucose monitoring. Diabetes Care. 2005;
28:1231-9.
9. Kilpatrick ES, Rigby AS, Atkin SL. Mean blood glucose compared with HbA1c in the prediction of cardiovascular disease in
patients. Diabetologia. 2008; 51(2):365-71.
10. Diabetes Research in Children Network (DirecNet) Study Group.
Relationship of A1 c to glucose concentrations in children with
type 1 diabetes. Diabetes Care. 2008; 1:381-5.
11. Wolpert HA. The nuts and bolts of achieving end points with
realtime continuous glucose monitoring. Diabetes Care. 2008; 31
(suppl 2):S146-S9.
12. Nathan DM, Turgeon H, Regan S. Relationship between glycated
hemoglobin levels and mean glucose levels over time. Diabetologia. 2007; 50(11):2239-44.

06/10/2015 10:13:23

Mtodos para Avaliao do


Controle Glicmico
Introduo
O controle da glicemia reduz de maneira significativa as complicaes do diabetes mellitus (DM).1,2 Assim, mtodos que
avaliam a frequncia e a magnitude da hiperglicemia so essenciais no acompanhamento do DM, pois visam aos ajustes
no tratamento. At a dcada de 1970, a avaliao do controle
glicmico era feita apenas com medida domiciliar da glicosria e dosagens ocasionais de glicemia de jejum. Desde ento,
houve avanos significativos nos mtodos utilizados, com o
desenvolvimento de testes que avaliam o controle glicmico
em longo prazo, como a hemoglobina glicada (HbA1c), assim
como aqueles que detectam flutuaes da glicemia ao longo
do dia, por exemplo, o automonitoramento da glicemia capilar
(AMGC) e o sistema de monitoramento contnuo da glicose
em lquido intersticial (CGMS).

Dosagem de glicemia
A dosagem da glicemia geralmente feita no soro ou plasma,
mas alguns laboratrios medem-na no sangue total, que 10
a 15% mais baixa. O mtodo mais utilizado atualmente para
dosagem de glicemia o enzimtico, com oxidase ou hexoquinase. O tubo ideal para coleta de sangue visando dosagem da
glicemia deve conter fluoreto. A coleta sem fluoreto pode ser
efetuada, mas deve ser centrifugada logo aps a venopuno.
O armazenamento prolongado da amostra, sem centrifugao
e sem fluoreto, possibilita o metabolismo da glicose pelas hemcias, as quais no necessitam de insulina para captao de
glicose. A temperatura ambiente pode acelerar esse processo.
Em refrigerador, a glicose permanece estvel por algumas horas na amostra de sangue. A adio de fluoreto nos tubos evita
esses processos, posto que inibe a gliclise.3
A dosagem de glicemia normalmente realizada em jejum
(sendo recomendada a ausncia de qualquer ingesta alimentar, exceto gua, por pelo menos 8 h). Hoje, sabe-se que a glicemia de jejum (GJ) insuficiente para acompanhamento do
controle glicmico de pacientes com DM, pois reflete apenas
uma medida pontual, no momento da coleta de sangue.
A dosagem de glicemia ps-prandial tambm pode ser
efetuada (1 a 2 h aps o incio da ingesta alimentar) e avalia
picos hiperglicmicos ps-prandiais associados a risco cardiovascular, estresse oxidativo e aumento da mortalidade.4 Entretanto, tambm representa uma medida pontual, que pode no

Diretrizes SBD 2015-2016 - CAP 06.indd 25

refletir o que ocorre nos demais dias e horrios no avaliados,


mas pode ser til em pacientes com DM tipo 2 (DM2) que no
realizam AMGC.
A dosagem de glicemia simultaneamente realizao de
uma aferio da glicemia capilar pode ser utilizada para testar
a acurcia dos resultados do automonitoramento. Esse teste
deve ser feito de preferncia em jejum, j que a concentrao
de glicose no sangue venoso e capilar semelhante nesse estado, mas as amostras ps-prandiais podem ser 20 a 25% mais
elevadas no sangue capilar. O uso de sangue venoso no glicosmetro, em vez do sangue capilar, pode eliminar tal problema.5

Hemoglobina glicada
A medida da HbA1c um mtodo que possibilita avaliao
do controle glicmico em longo prazo. Deve ser solicitada rotineiramente a todos pacientes com DM duas a quatro vezes
ao ano, desde a avaliao inicial, para determinar se o alvo do
controle da glicemia foi obtido e/ou mantido. Recentemente,
o teste foi reconhecido como um dos critrios para o diagnstico de DM, quando 6,5% e pr-diabetes, entre 5,7 e 6,4%.6
O termo hemoglobina glicada utilizado para designar
a hemoglobina conjugada glicose, processo que ocorre de
maneira lenta, no enzimtica e diretamente proporcional
glicose no ambiente. Como as hemcias so livremente permeveis glicose, a medida de HbA1c reflete o histrico da
glicemia ao longo dos 120 dias prvios, tempo de vida mdio
dos eritrcitos. A HbA1c uma das formas de hemoglobina
glicada. Sua mensurao representa o controle glicmico de
modo mais fidedigno do que a medida do total de hemoglobinas glicadas.7
A dosagem de HbA1c pode ser realizada por diversos
mtodos, sendo o ideal a cromatografia lquida de alta performance (HPLC). A padronizao dos resultados da HbA1c est
sendo realizada mundialmente. Preconiza que, mesmo por diferentes mtodos aceitos para dosagem, os resultados sejam
calibrados de modo a ter a mesma faixa de referncia, de acordo com a utilizada no Diabetes Control and Complications
Trial (DCCT).8 fundamental que os laboratrios brasileiros
tambm participem dessa iniciativa, e isto vem acontecendo
nos ltimos anos.
Ao mensurar a HbA1c, avalia-se a mdia das glicemias do
paciente nos ltimos 120 dias. Este perodo no analisado de
maneira homognea, j que eventos mais recentes contribuem

05/10/2015 06:42:30

26 Diretrizes SBD | 2015-2016

de modo mais significativo para o resultado final. Enquanto a


participao do perfil glicmico nos ltimos 30 dias de cerca
de 50% do total, os dias 30 a 60 apresentam 25% e os ltimos
60 dias so responsveis por 25% apenas. Assim, o teste pode
ser solicitado aps 1 ms de modificaes do tratamento para
avaliar respostas a mudanas teraputicas.3
Alm disso, h variaes das contribuies da glicemia
de jejum e ps-prandial conforme o nvel da HbA1c. Em pacientes com HbA1c prxima ao limite da normalidade, a contribuio da glicemia ps-prandial mais significativa. Para
nveis mais elevados de HbA1c ( 8,5%), a contribuio da
glicemia de jejum preponderante.9
Deve-se medir a HbA1c rotineiramente em todos os pacientes com diabetes. Naqueles em uso de antidiabticos orais
que no utilizam insulina e apresentam controle glicmico satisfatrio e estvel, a avaliao pode ser feita pelo menos duas
vezes por ano (A).10 Nos demais, a medida recomendada pelo
menos trs a quatro vezes ao ano. A frequncia da mensurao
de HbA1c precisa ser individualizada, dependendo da condio
clnica do paciente e das mudanas efetuadas no tratamento.11
A maioria dos pacientes no gestantes deve ficar com
HbA1c < 7%, pois mostrou-se que este valor reduz complicaes microvascular e se for desde o incio do tratamento pode
reduzir complicaes macrovasculares no futuro.
Para pessoas com diabetes recente, longa expectativa de vida,
sem doenas cardiovasculares e pouco risco de hipoglicemias,
poderamos ser mais rgidos, com metas de HbA1c < 6,5%.
Ao contrrio, pacientes com expectativa de vida mais curta,
riscos maiores de hipoglicemia, problemas cardiovasculares,
diabetes de longa durao, insulinizados e com complicaes
crnicas do diabetes, podem ser tratados menos rigidamente,
com HbA1c < 8,5 ou 8%.12
Tem sido proposta a utilizao da glicemia mdia estimada
(GME) como meio de traduzir melhor aos pacientes o significado prtico da HbA1c. A GME estabelecida por meio de um
clculo matemtico simples, sendo GME = 28,7 A1c 46,7.11,13
Embora a HbA1c seja um excelente indicativo do controle glicmico na maioria dos casos, h fatores capazes de
influenciar este parmetro independentemente da glicemia,
falseando os resultados obtidos.7,8,13 Estes fatores devem ser
suspeitados nos casos em que h discrepncia entre a HbA1c e
as glicemias capilares ao longo do perodo estudado, os quais
esto enumerados a seguir:

Anemias e hemoglobinopatias: a hemlise pode interferir


na determinao da HbA1c, pois hemcias mais antigas so
mais glicadas do que as mais jovens. Assim, se o tempo de
vida das hemcias for reduzido (como ocorre na anemia
hemoltica), a HbA1c pode ser falsamente baixa. Por outro lado, se a eritropoese interrompida, como na anemia
aplsica, haver uma populao de hemcias mais antigas
e, consequentemente, mais glicadas, o que pode resultar
em HbA1c falsamente elevada. Anemia ferropriva leva a
resultados falsamente mais altos do que o esperado. Hemoglobinopatias tambm podem confundir os resultados da
HbA1c, no apenas por alterar a sobrevida das hemcias,
mas porque existe a possibilidade de hemoglobinas (Hb)
anormais apresentarem sobreposio em seus picos eletroforticos com HbA1c, afetando o seu resultado por alguns

Diretrizes SBD 2015-2016 - CAP 06.indd 26

mtodos. Certos mtodos de HPLC identificam e quantificam as Hbs variantes; outros apenas expressam resultados
muito baixos ou altos. Os mtodos imunolgicos parecem
no ser afetados por essa interferncia3,8,9
Uremia: em pacientes urmicos, a Hb sofre processo de carbamilao, e a medida de Hb carbamilada um indicador
til do estado urmico. Em pacientes com DM e insuficincia renal, a carbamilao da Hb pode interferir em sua glicao e levar a resultados falsamente mais elevados. Outro
problema adicional em pacientes com insuficincia renal
o encurtamento da meia-vida das hemcias, o que tambm
pode interferir na HbA1c3,7,14
Substncias: o AAS pode levar formao de um derivado de Hb acetilado, o qual pode interferir na determinao de HbA1c por alguns mtodos, resultando em valores
falsamente elevados. O consumo abusivo de lcool, semelhante ao AAS, pode levar formao do mesmo derivado
acetilado, interferindo tambm nas dosagens de HbA1c.
A utilizao prolongada das vitaminas C e E tambm tem
sido estudada como possvel fonte de interferncia negativa nas dosagens de HbA1c por inibio direta da glicao
da hemoglobina. Contudo, os resultados destes estudos so
contraditrios e no est claro, at o momento, se o uso
das vitaminas C ou E altera verdadeiramente os valores de
HbA1c7
Dislipidemia: hipertrigliceridemia muito acentuada pode
interferir na mensurao de HbA1c por alguns mtodos, ao
menos o turbidimtrico, simulando resultados falsamente
mais baixos do que aqueles correspondentes ao controle
glicmico.15

Ainda controverso se h interferncia na HbA1c por idade, etnia ou fatores individuais.


Recentemente, desenvolveu-se um monitor porttil de
hemoglobina glicada que utiliza cinco microlitros de sangue
capilar e fornece o resultado em porcentagem aps 5 min.
um mtodo com tima acurcia,16 certificado pela NGSP,17 o
qual pode ajudar no controle dos pacientes ambulatoriais para
tomada de decises teraputicas, como recomenda a ADA.18,19
Entretanto, no se encontra disponvel no mercado brasileiro.

Automonitoramento domiciliar
das glicemias
O desenvolvimento do AMGC revolucionou o manejo do DM.
Tal mtodo bastante til para avaliao do controle glicmico, de modo complementar dosagem de HbA1c, e possibilita que os prprios pacientes identifiquem a glicemia capilar
(GC) em diversos momentos do dia e corrijam rapidamente
picos hiperglicmicos ou episdios de hipoglicemia.
O AMGC efetuado com a insero de uma gota de sangue
capilar em uma fita biossensora descartvel contendo glicose
desidrogenase ou glicose oxidase acoplada a um dispositivo
mdico (glicosmetro). A maioria dos glicosmetros utilizados
quantifica glicose plasmtica (esta informao est disponvel
na caixa de fitas). Aps sofrer ao enzimtica, h uma reao
eletroqumica diretamente proporcional concentrao de
glicose. A faixa de medio vai de 10 a 600 mg/dl (dependendo da marca do monitor).

05/10/2015 06:42:30

Mtodos para Avaliao do Controle Glicmico 27

Fitas reativas para medio de glicemia sem glicosmetro,


mediante leitura visual por comparao com escala de cores,
tambm esto disponveis. O teste usa a reao glicose-oxidase/peroxidase que, com o auxlio de corantes, acarreta uma
alterao na cor da fita, a qual diretamente proporcional
concentrao de glicose na amostra de sangue capilar. Esse
teste, mais barato, no recomendado, pois bastante subjetivo, sujeito interpretao do paciente e dependente da sua
acuidade visual.
O AMGC atualmente preconizado para pacientes com
todos os tipos de DM, j que o mtodo reduz o risco de hipoglicemias e melhora o entendimento do efeito dos diversos
alimentos, do estresse, das emoes e dos exerccios sobre a
glicemia. Alm disso, pode ser usado para tomada de decises
sobre a dose de insulina a ser utilizada em tempo real.20 Possibilita ainda ajustes de insulina de maneira retrospectiva, nas
consultas mdicas, com base nos resultados obtidos ao longo
de semanas e meses. Estes resultados podem ser registrados
manualmente pelo paciente durante este perodo ou transferidos diretamente para um computador com programas informatizados especficos. A avaliao com transferncia computadorizada permite obter resultados mais fidedignos, evitando
erros decorrentes da alterao de resultados pelo paciente, seja
voluntariamente ou por equvocos nas anotaes, devendo ser
encorajado a isso.
Para pacientes em tratamento intensivo com mltiplas injees de insulina ou sistema de infuso contnua, o AMGC
deve ser realizado, no mnimo, 4 vezes/dia, geralmente antes e
aps as refeies e ao deitar.10 Nesses casos, a GC essencial
para a determinao da dose de insulina a ser utilizada antes
de cada refeio. Esta ltima determinada pela contagem
de carboidratos + correo da glicemia, sendo esta determinada por glicemia atual glicemia-alvo/fator sensibilidade.
O fator sensibilidade determinado por 1.800/dose total de
insulina em uso para pacientes que utilizam anlogos ultrarrpidos de insulina e 1.500/dose total de insulina para aqueles em uso de insulina regular. Atualmente, h disponveis
softwares e aplicativos chamados de calculadora de bolus.
So ferramentas que recebem a informao da contagem dos
carboidratos e do valor da glicemia e oferecem uma sugesto do bolus a ser ministrado naquele momento. Levam em
considerao no s tais dados, mas outros parmetros, como
alvo da glicemia, mdia de subida da glicemia, insulina ativa
etc. Estas calculadoras mostraram-se melhores que o clculo
manual no controle glicmico de DM1 em usurios de bombas de insulina.21 Medidas mais frequentes da glicemia so
recomendadas em situaes especiais (gestao, doenas intercorrentes, cirurgias, alta variabilidade glicmica, hipoglicemias no percebidas ou assintomticas e perodos de intenso
estresse emocional) ou em alguns dias selecionados de cada
ms. AMGC tambm deve ser indicado antes de dirigir e realizar atividade fsica.10
Monitoramento ps-prandial pode ser recomendado a pacientes: (1) com HbA1c elevada e glicemias de jejum dentro
do alvo; (2) em incio de tratamento intensivo, com problemas
em obter o controle glicmico; (3) que estejam fazendo ajustes
na contagem de carboidrato ou do fator sensibilidade. Medida
de sete GC ao dia (pr e ps-prandial e ao deitar) por 3 dias
pode ser bastante til para avaliao do perfil glicmico como

Diretrizes SBD 2015-2016 - CAP 06.indd 27

um todo em indivduos em insulinoterapia intensiva do tipo


basal-bolus,22 a cada 3 ou 4 meses. Pacientes com DM2 em uso
de esquemas menos agressivos de insulina geralmente podem
necessitar de uma frequncia menor de medidas por dia (duas
ou trs ao dia) do que aqueles em esquema basal-bolus.
Ainda no h consenso sobre a utilizao de AMGC em
pacientes com DM2 tratados apenas com antidiabticos orais.
Alguns recomendam seu uso em todos os casos (embora em
uma frequncia menor do que a preconizada para os usurios de insulina), sugerindo que essa conduta poderia tornar
os pacientes mais independentes, cooperativos, motivados e
cientes dos fatores que afetam suas glicemias. As diretrizes da
SBD recomendam monitoramento em todos os tipos de DM,
inclusive em casos de pacientes com DM2. razovel indicar
o teste para casos selecionados, como aps grandes mudanas teraputicas, em momentos de descompensao metablica ou pocas de instabilidade do controle glicmico.22 Monitoramento ocasional da GC aps as refeies pode ser til
em pacientes que usam medicamentos atuantes na glicemia
ps-prandial.23
Uma importante limitao da AMGC a necessidade de
obteno do sangue capilar na polpa digital. Embora o uso de
dispositivos capazes de obter sangue com pouca ou nenhuma
dor tenha reduzido esse problema, isso ainda um incmodo
para diversos pacientes. Em alguns glicosmetros, permitido
utilizar sangue capilar coletado de locais alternativos do corpo, como o antebrao, para resguardar a polpa digital. Apesar
de teis, podem demonstrar at 20% de diferena em relao
ao sangue obtido em polpa digital, especialmente em perodos de mudanas rpidas da glicemia, como o ps-prandial ou
ps-exerccio, devendo ser evitados em situaes de hipoglicemias ou ps-prandiais.3 O desenvolvimento de novas tcnicas
de monitoramento da glicose no invasivas tem sido alvo de
diversas pesquisas. Exemplo o desenvolvimento de monitor
de glicose via pulso de luz (espectroscopia) totalmente no invasivo, lentes de contato e outros.

Sistema de monitoramento
contnuo da glicose
Este mtodo possibilita medio contnua da glicose no lquido intersticial, o que pode identificar tendncias do perfil glicmico no verificadas anteriormente pelo AMGC. O sistema
funciona mediante a implantao de um sensor no tecido subcutneo que transmite informaes a um aparelho monitor, as
quais podem ser transferidas para um computador. Apesar de
o CGMS ser bastante til em diversas situaes clnicas, nem
sempre est disponvel no nosso meio, especialmente no Sistema nico de Sade (SUS).
O sensor implantado de modo semelhante ao cateter de
uma bomba de insulina e contm glicose oxidase. A glicose
difunde-se por uma membrana para alcanar a camada com
a enzima. Esta converte a glicose em sinal eletrnico, diretamente proporcional concentrao de glicose. Os sensores
disponveis no mercado brasileiro devem ser trocados a cada
3 dias (SOFT) ou 6 dias (ENLITE). Alm disso, este novo
modelo quase 70% menor que o anterior, mais preciso e tem
insero em 90, aumentando e muito a adeso ao tratamento.24 A medida da glicose feita a cada 10 s e as mdias so

05/10/2015 06:42:30

28 Diretrizes SBD | 2015-2016

armazenadas a cada 5 min, o que perfaz, portanto, 288 mdias


ao dia. H um atraso de 10 a 15 min em relao GC e necessria calibrao pela glicemia capilar 2 a 4 vezes/dia.24
Os resultados obtidos com o sensor so transferidos para o
monitor, aparelho semelhante a um holter, que armazena os dados e utilizado para calibrao. Nos modelos que possibilitam
visualizao em tempo real da glicose, estes resultados so apresentados no monitor. O sensor pode ser conectado ao monitor
por meio de um cabo ou no conter fios, com transmisso dos
resultados por radiofrequncia. No Brasil, j se dispe de mtodo de diagnstico cego (sem conhecimento dos resultados pelo
paciente usurio) que utiliza sensor de glicose (Ipro2 Medtronic) e no tem fios conectando os sensores aos monitores.
Isto facilita a identificao de alteraes glicmicas em situaes
especficas, por 3 a 6 dias, que fornecem um relatrio retrospectivo para posterior tomada de decises da equipe de sade.
O CGMS pode ser utilizado por um perodo limitado de
tempo (geralmente 72 h) para avaliao retrospectiva do perfil
glicmico, ou por tempo indeterminado, como parte do tratamento. No primeiro caso, atualmente, o paciente utiliza o
mtodo por cerca de 72 h, aps as quais os dados so transferidos para um computador e analisados retrospectivamente. As variaes da glicemia so identificadas e associadas
alimentao, ao uso de insulina, ao sono e atividade fsica
dos pacientes. Estes dados devem ser registrados em um dirio pelos prprios pacientes. Para essa modalidade de uso,
o CGMS deve ter, preferencialmente, leitura cega. As principais indicaes deste exame so: HbA1c discrepante de GC
(nestes casos tambm aconselhvel dosar a frutosamina, pois
pode tratar-se de condio que altere a Hb ou sua glicao),
incapacidade de detectar tendncias de hiperglicemia em pacientes com HbA1c elevada e relato de ausncia de sintomas
de hipoglicemia. Alguns autores recomendam sua utilizao
peridica por todos os usurios de sistema de infuso subcutnea de insulina. Aps observaes detalhadas das informaes
obtidas, podem ser realizados ajustes de insulina para melhorar o controle metablico e evitar episdios de hipoglicemia.25
Uma metanlise de estudos randomizados utilizando CGMS
retrospectivo em DM1 revelou que, de modo geral, este no foi
mais eficaz do que o AMGC para reduzir a HbA1c, mas melhorou a deteco da hipoglicemia noturna assintomtica.26
O CGMS de forma mantida pode ser utilizado em pacientes usurios de insulina, normalmente diabticos do tipo 1, em
esquema basal-bolus, para guiar o uso de insulina. Neste caso,
essencial que a leitura seja disponvel ao paciente em tempo real.
As informaes disponveis so as mdias de glicose exibidas
a cada 5 min no monitor, setas que demonstram se a GC est
caindo ou subindo e em qual velocidade (1, 2, 3 ou mais de 3
mg/dl/min para mais ou para menos), grficos com indicativos do comportamento da glicose ao longo do tempo e alarmes
para hipo e hiperglicemia. De modo geral, saber a tendncia da
glicemia tambm muito importante assim como conhecer seu
nmero absoluto. Estas informaes podem reduzir o tempo
de exposio hiperglicemia, prevenir hipoglicemias, diminuir
amplas flutuaes da glicemia e modificar comportamentos
por parte dos pacientes.27,28 O monitoramento da GC continua
recomendado para a tomada de decises no manejo de hiper
ou hipoglicemia, mesmo em pacientes que utilizam monitoramento contnuo. J uma realidade no mercado brasileiro o uso

Diretrizes SBD 2015-2016 - CAP 06.indd 28

de sensores de glicemia acoplados bomba infusora, em que o


prprio display da bomba o receptor para o sensor, evitando
dois aparelhos na cintura do paciente. Alm disso, os dados do
sensor podem ser utilizados na calculadora de bolus inserida na
bomba para correes das glicemias.
Um grande estudo prospectivo comparando esquema basal-bolus com e sem CGMS em pacientes com DM1 demonstrou que, nos indivduos com 25 anos de idade ou mais, o uso
de monitoramento contnuo, com leitura dos resultados em
tempo real, foi eficaz para reduzir a HbA1c. O benefcio do
tratamento foi associado adeso ao mesmo (tempo de uso
do sensor durante o perodo de estudo). A falta de adeso
foi um importante fator limitante ao sucesso do tratamento
em populaes mais jovens.29,30 O Sensor-Augmented Pump
Therapy for A1C Reduction 3 Trial (STAR 3) demonstrou recentemente o benefcio do seu uso em todos os grupos etrios,
sem aumento do risco de hipoglicemia.31
importante lembrar que nem todos pacientes com DM1
so candidatos ao uso do CGMS como parte do seu tratamento. Alm de ser um procedimento caro, necessita de grande
adeso, motivao e conhecimento acerca do DM. Para seu
incio, o paciente e sua famlia devem ser esclarecidos acerca
dos procedimentos a seguir e da persistncia da necessidade
de medir glicemias capilares regularmente. Atualmente, o uso
de CGMS pode ser recomendado a pessoas com DM1 que
demonstrem adeso satisfatria ao tratamento para reduzir a
HbA1c em casos selecionados (boa motivao, boa adeso e
incapacidade de alcanar HbA1c < 7%), assim como em exemplos de hipoglicemias frequentes ou assintomticas. Tambm
pode ser til em ocasies de glicemia lbil, gestantes, atletas,
pacientes com gastroparesia ou que tenham medo de hipoglicemia capaz de limitar o uso adequado de insulina. Como
no possvel disponibilizar esse procedimento pelo SUS em
todos os casos, ele deve ser indicado apenas queles em que
o controle glicmico adequado (sem hiper ou hipoglicemias
significativas) no foi obtido com todos os outros recursos
disponveis (uso de anlogos, sistema de infuso subcutnea
de insulina, orientao diettica, reviso do estilo de vida e
educao adequada) e quando houver adeso ao tratamento.
Vale ressaltar tambm que o mtodo apresenta limitaes,
como o atraso de 10 a 15 min em relao s glicemias capilares, pode subestimar hipoglicemias, tem uma incidncia de erro
de aproximadamente 15%, alto custo e ainda no h protocolos
definidos para ajuste de dose de insulina com base nos resultados obtidos em tempo real. Mesmo nos usurios de sistema de
infuso subcutnea de insulina acoplado ao CGMS (ao menos
nos modelos disponveis comercialmente em nosso meio), no
h comunicao total entre a medida de glicose e a aplicao de
insulina. Por conta disso, h a necessidade de que o paciente seja
treinado para realizar os ajustes devidos no seu tratamento com
os resultados obtidos, o que pode ser bastante complexo. Em
2014, foi lanada no mercado brasileiro uma bomba de insulina
com funcionamento em conjunto a um sensor de glicose, a qual
pode ser programada para suspenso automtica da infuso de
insulina por at 2 h quando a glicemia alcana um determinado
valor definido pela equipe mdica.
No final de 2014, foi lanado no mercado europeu um
sensor de glicose com pretenses de substituir as medidas de
glicemia capilar. Trata-se de um sensor com uma tecnologia

05/10/2015 06:42:30

Mtodos para Avaliao do Controle Glicmico 29

que utiliza glicose oxidase e smio para evitar interferncia de


oxignio e, por isso, no necessita de calibrao pela glicemia
capilar. Tem excelente acurcia e preciso (prximo a 10%) e
cada sensor dura 14 dias. Para leitura da glicemia basta passar o
leitor sobre o sensor. possvel realizar uma leitura a cada minuto. Recomenda-se colocar o sensor atrs do brao. Os dados
obtidos so baixados para o computador pelo software AGP
(Ambulatory Glucose Profile). Est previsto o lanamento do
produto no mercado brasileiro para o incio de 2016.
Tm-se desenvolvido tambm diversos tipos de sensores
de glicose no invasivos, sem utilizao de sangue capilar. Entre eles, sensores de luz na polpa digital, que utilizam tecnologia para medir a glicemia nos dedos como feito atualmente
nas oximetrias. Outros tipos so sensores com nanopartculas
em tatuagens, sensores para medir a glicose nos olhos, como
lentes de contato, sensores de respirao, entre outros. Tambm h o desenvolvimento de sensores invasivos, intravasculares para medir a glicemia em unidades de terapia intensiva
com acurcia e preciso muito grandes, e de modo contnuo.32
Assim, o CGMS representa um importante avano, porm
ainda uma tecnologia em evoluo, com muitos aspectos a
serem aprimorados ao longo dos prximos anos. Entretanto,
com os dados disponveis, o CGMS pode ser til para:

Melhora do controle glicmico em pacientes com DM1 que


estejam motivados a us-los durante a maior parte do tempo
Identificar tendncias de hiper ou hipoglicemias no detectadas apenas com o AMGC.

Gerenciamento de dados
Atualmente, esto disposio de profissionais de sade, bem
como de pacientes, softwares para fazer o gerenciamento dos
dados obtidos tanto pelos monitores de glicose quanto pelos
sensores de glicose e tambm das prprias bombas de infuso
de insulina.33 Todas as marcas de glicosmetro disponveis no
mercado desenvolveram softwares para essa finalidade. Em
comum, os monitores devem sempre estar com data e horrio acertados para poderem transferir seus dados. As informaes disponveis podem ser visualizadas em vrios modos. Os
mais utilizados so o modo de tendncias, no qual a glicemia
aparece evolutivamente por data, e, talvez o mais importante, o de agrupamento dos dados de glicemia pelo horrio do
dia (MODAL). Com este modo, podem-se ajustar as doses de
medicamentos e das insulinas basal e de bolus. Porm, ainda
temos outros modos como logbook, grficos de pizza e outros.
Com um pouco de prtica, possvel rapidamente tirar vrias
concluses importantes para a tomada de deciso durante a
avaliao do paciente. As desvantagens seriam a necessidade
de um computador para essa finalidade e, principalmente, porque cada marca de monitor usa um software prprio. Portanto,
necessita-se de vrios softwares e cabos para a transmisso dos
dados. possvel que, no futuro, haja uma unificao da utilizao deles por alguma empresa ou universidade independente.

Pncreas artificial
O conceito de pncreas artificial deve ser bem esclarecido. At
o momento, o que chamamos de pncreas artificial (PA) o
acoplamento de sensores de glicose com as bombas de infuso.

Diretrizes SBD 2015-2016 - CAP 06.indd 29

Este acoplamento d-se por meio de softwares extremamente


especficos, com algoritmos muito complexos para que possam trabalhar sozinhos. Esse o ponto atual da dificuldade.
Tais algoritmos devem entender a medida da glicemia pelo
sensor e decidir o quanto de insulina tem de ser injetado em
determinado momento.34 O verdadeiro PA vir quando no
houver mais a necessidade da ajuda humana para a tomada
de decises. Estuda-se ainda o desenvolvimento de PA com
infuso de insulina e glucagon (chamado de pncreas binico), bem como de sensores de glicose que podero ser tambm
infusores de insulina e, quem sabe, glucagon, deixando, assim,
o mnimo de materiais acoplados ao corpo do paciente. O desenvolvimento do PA algo que permanece em fases iniciais,
porm certamente muito conhecimento ser adquirido a partir desses estudos.

Outros mtodos
Frutosamina
Mede a glicao das protenas sricas de um modo geral, das
quais a principal a albumina. Como a albumina tem um
turnover de 2 semanas, a frutosamina reflete o controle glicmico ao longo deste perodo. uma alternativa til nos casos
em que a confiabilidade da dosagem de HbA1c comprometida por fatores que interferem neste parmetro, como anemias
ou hemoglobinopatias. Entretanto, uma associao entre os
nveis de frutosamina e o desenvolvimento de complicaes
crnicas do DM no foi to bem estabelecida quanto para os
nveis de HbA1c.3

1,5-anidroglucitol
O 1,5-anidroglucitol (1,5-AG) o principal poliol circulante e tem sido proposto como um indicador de hiperglicemia
ps-prandial. Sua reabsoro nos tbulos renais inibida de
maneira competitiva pela glicose. Desse modo, conforme aumenta a filtrao glomerular de glicose em vigncia de hiperglicemia, cai a sua reabsoro tubular, o que provoca elevao
de sua excreo renal e queda de seu nvel srico. Consequentemente, o 1,5-AG srico reflete inversamente a glicosria e
o tempo permanecido em hiperglicemia.35 Esse teste tem
sido proposto como um ndice de labilidade do controle glicmico e tempo de exposio hiperglicemia, especialmente
ps-prandial. Estudos indicam que a reduo de 1,5-AG um
marcador de hiperglicemia ps-prandial mesmo quando a
HbA1c est dentro do alvo teraputico.36 Este exame no rotineiramente disponvel na prtica clnica, mas possvel que
sua importncia clnica cresa ao longo dos prximos anos.

Metas de controle glicmico |


O objetivo a se alcanar
As metas para controle glicmico incluem controle das glicemias de jejum, ps-prandial e HbA1c. Os objetivos do tratamento devem ser individualizados, diferindo conforme a idade do paciente, suas comorbidades, expectativa de vida e grau
de percepo de hipoglicemias. Os Quadros 1 e 2 resumem as
principais recomendaes atuais para metas de controle glicmico por diferentes sociedades mdicas.11,37

05/10/2015 06:42:31

30 Diretrizes SBD | 2015-2016


Quadro 1 Recomendaes de controle glicmico para adultos com DM, de acordo com as diversas sociedades mdicas.
Instituies

Glicemia pr-prandial
(mg/dl)

Glicemia ps-prandial
(mg/dl)

HbA1c (%)

Associao Americana de Diabetes (ADA)

80 a 130

< 180

<7

Federao Internacional de Diabetes (IDF)

< 115

< 160

<7

Associao Americana de Endocrinologistas Clnicos (AACE)

< 110

< 140

< 6,5

Sociedade Brasileira de Diabetes (SBD)

< 100

< 160

<7

Quadro 2 Recomendaes da ISPAD e ADA para o controle glicmico de crianas e adolescentes de todas as faixas etrias.
Jejum ou pr-prandial (mg/dl)

Ps-prandial (mg/dl)

Ao dormir

Hemoglobina glicada (%)

Ideal
ISPAD

65 a 100

80 a 126

80 a 100

< 6,05

timo
ISPAD

90 a 145

90 a 180

120 a 180

< 7,5%

ADA

90 a 130

90 a 150

< 7,5%

ISPAD: The International Society for Pediatric and Adolescent Diabetes; ADA: Associao Americana de Diabetes.

De modo geral, o alvo de HbA1c preconizado pode ser < 7%.


Entretanto, em casos selecionados, a meta pode ser mais rgida
(< 6,5%), desde que isso seja seguro ao paciente e com baixa
frequncia de hipoglicemias. O uso de metas mais rgidas nestes casos, sem doena cardiovascular e preferencialmente desde
o incio do tratamento, pode ser baseado na reduo do risco
microvascular obtido em anlises de subgrupos dos estudos
DCCT, United Kingdom Prospective Diabetes Study (UKPDS)
e Action in diabetes and vascular disease: Preterax and Diamicron MR controlled evaluation (ADVANCE), que evidenciaram
reduo do risco de complicaes microvasculares com valores
de HbA1c prximos normalidade.1,2,38,39
Em outras situaes clnicas, por outro lado, o alvo glicmico pode ser um pouco mais elevado do que o habitual, como
insuficincia renal ou heptica, as quais predispem ao aparecimento de hipoglicemia. O mesmo pode ser preconizado
para indivduos com hipoglicemias assintomticas ou graves,
idosos, pacientes com baixa expectativa de vida ou complicaes micro ou macrovasculares significativas.40 Um controle
menos rgido da glicemia tambm parece razovel em indivduos com longa durao do DM que tenham mantido um mau
controle metablico por longos perodos, levando em considerao estudos como o Action to Control Cardiovascular Risk
in Diabetes (ACCORD), o qual demonstrou que instituio do
controle intensivo da glicemia em pacientes com DM2, longa
durao da doena e HbA1c elevada foi associada a aumento da mortalidade.41,42 Por outro lado, pacientes com DM que
adotaram o controle intensivo da glicemia desde o incio do
tratamento apresentaram claros benefcios do controle glicmico, tanto na reduo de complicaes micro quanto macrovasculares, conforme demonstrado pelo UKPDS.38
Recentemente, tem sido reconhecida a importncia da variabilidade de glicose em pacientes com DM. Estudos indicam
que grandes variaes da glicemia esto associadas ao desenvolvimento de estresse oxidativo e complicaes crnicas da
doena. Clculos matemticos baseados na amplitude mdia
de picos hiperglicmicos durante a realizao do CGMS ou
no desvio padro das GC obtidas com o AMGC esto sendo

Diretrizes SBD 2015-2016 - CAP 06.indd 30

avaliados como modo de medir esta variabilidade e, possivelmente, iro tornar-se parte dos objetivos do tratamento do
DM nos prximos anos.43
Quadro 3 Recomendaes e concluses.
Recomendaes e concluses

Grau de
recomendao

A medida da glicemia de jejum insuficiente


para monitoramento do controle metablico
do DM

A medida peridica da HbA1c


recomendada duas a quatro vezes ao ano a
todos os pacientes com DM. A frequncia
deste teste deve ser estabelecida de acordo
com a condio clnica do paciente e as
mudanas efetuadas no tratamento

O objetivo da HbA1c tem de ser


individualizado conforme a idade do
paciente, suas comorbidades e o tempo de
DM. Na maioria dos pacientes adultos sem
complicaes significativas, um alvo < 7%
deve ser preconizado

O automonitoramento da glicemia capilar


essencial para o controle metablico de
pacientes com DM em insulinoterapia intensiva
com esquema basal-bolus, devendo ser
realizado 4 vezes/dia. Nos demais pacientes, a
frequncia do automonitoramento precisa ser
individualizada

Avaliao da glicemia ps-prandial pode ser


til em pacientes: (1) com HbA1c elevada e
glicemias de jejum dentro do alvo; (2) ainda
no incio de tratamento intensivo, com
problemas em obter o controle glicmico; (3)
que estejam fazendo ajustes na contagem de
carboidrato ou do fator sensibilidade; (4)
usurios de medicamentos para o controle
da glicemia ps-prandial

(continua)

05/10/2015 06:42:31

Mtodos para Avaliao do Controle Glicmico 31


Quadro 3 Recomendaes e concluses (continuao).
Recomendaes e concluses
O sistema de monitoramento contnuo da
glicose com avaliao retrospectiva dos
resultados parece ser uma ferramenta til
para detectar hipoglicemias noturnas
assintomticas e auxiliar na reduo da
HbA1c em pacientes com DM1

Grau de
recomendao
B

B
O sistema de monitoramento contnuo da
glicose com leitura dos resultados em tempo
real pelo paciente pode ser benfico para
reduzir a HbA1c e o risco de hipoglicemias
em indivduos com DM1, desde que estes
estejam dispostos a utilizar o dispositivo pela
maior parte do tempo e sejam extremamente
motivados
(A) Estudos experimentais e observacionais de melhor consistncia; (B)
Estudos experimentais e observacionais de menor consistncia; (C) Relatos
de casos (estudos no controlados); (D) Opinio desprovida de avaliao
crtica, baseada em consensos, estudos fisiolgicos ou modelos animais.

Referncias bibliogrficas
1. DCCT Research Group. The effect of intensive treatment of diabetes on the development and progression of long-term complications in insulin-dependent diabetes mellitus. N Engl J Med.
1993; 329:977-86.
2. UK Prospective Diabetes Study (UKPDS) Group. Intensive blood
glucose control with sulphonylureas or insulin compared with
conventional treatment and the risk of complications in patients
with type 2 diabetes (UKPDS 33). Lancet. 1998; 352:837-53.
3. Goldstein DE, Little RR, Lorenz RA et al. Tests of glycemia in
diabetes. Diabetes Care. 2004; 27(7):1761-73.
4. Choi SW, Benzie IF, Ma SW et al. Acute hyperglycemia and oxidative stress: direct cause and effect? Free Radic Biol Med. 2008;
44(7):1217-31.
5. Sacks DB, Bruns DE, Goldstein DE et al. Guidelines and recommendations for laboratory analysis in the diagnosis and management of diabetes mellitus. Diabetes Care. 2003; 25:750-86.
6. The International Expert Committee. International Expert Committee report on the role of the A1c assay in the diagnosis of
diabetes. Diabetes Care. 2009 jul; 32(7).
7. Camargo JL, Gross JL. Glico-hemoglobina (HbA1 c): Aspectos
clnicos e analticos. Arq Bras Endocrinol Metab. 2004; 48(4):451-63.
8. Saudek CD, Brick JC. The clinical use of hemoglobin A1c. Journal of Diabetes Science and Technology. 2009; 3(4):629-34.
9. Monnier L, Lapinski H, Colette C. Contributions of fasting and
post-prandial plasma glucose increments to the overall diurnal
hyperglycemia of type 2 diabetic patients: variations with increasing levels of HbA1 c. Diabetes Care. 2003; 26:881-5.
10. Guilfoyle SM, Crimmins NA, Hood KK. Blood glucose monitoring and glycemic control in adolescents with type 1 diabetes: meter
downloads versus self-report. Pediatr Diabetes. 2011 sep; 12(6):5606. doi: 10.1111/j.1399-5448.2010.00735.x. [Epub 2011; Mar 11].
11. American Diabetes Association. Standards of medical care in
diabetes 2010. Diabetes Care. 2010 jan; 33:S11-S61.
12. American Diabetes Association. Standards of medical care in
diabetes 2014. Diabetes Care. 2014 jan; 37(Suppl 1):S14-S80.
13. Nathan DM, Kuenen J, Borg R et al. A1 c-Derived Average Glucose Study Group. Translating the A1 c assay into estimated average glucose values. Diabetes Care. 2008; 31:1473-8.

Diretrizes SBD 2015-2016 - CAP 06.indd 31

14. Hammounda AM, Mady GE. Correction formula for carbamylated haemoglobin in diabetic uraemic patients. Ann Clin
Biochem. 2001; 38(Pt 2):115-9.
15. Garrib A, Griffiths W, Eldridge P et al. Artefactually low glycated
haemoglobin in a patient with severe hypertriglyceridaemia. J
Clin Pathol. 2003; 56:394-5.
16. Bode BW et al. Advances in hemoglobin A1C point of care technology. Journal of Diabetes Science and Technology. 2007; 1:319-25.
17. Knaebel J, McKiernan W, Xie C et al. Correlation of A1C now+
glycated hemoglobina (A1C) assay to an NGSP standardized
laboratory, 2008.
18. Cagliero E, Levina EV, Nathan DM. Immediate feedback of
HbA1 c levels improves glycemic control in type 1 and insulintreated type 2 diabetic patients. Diabetes Care. 1999; 22:1785-89.
19. Miller CD, Barnes CS, Phillips LS et al. Rapid A1 c availability
improves clinical decision-making in an urban primary care
clinic. Diabetes Care. 2003; 26:1158-63.
20. Coster S, Gulliford MC, Seed PT et al. Monitoring blood glucose
control in diabetes mellitus: a systematic review. Health Technol
Assess. 2000; 4(12):i-iv; 1-93.
21. Lepore G, Dodesini AR, Nosari I et al. Bolus calculator improves
long-term metabolic control and reduces glucose variability in
pump-treated patients with type 1 diabetes. Nutr Metab Cardiovasc Dis. 2012 Aug; 22(8):e15-6.
22. Karter AJ, Ackerson LM, Darbinian JA et al. Self-monitoring of
blood glucose levels and glycemic control: the Northern California
kaiser permanente diabetes registry. Am J Med. 2001; 111:1-9.
23. Evans JM, Newton RW, Ruta DA et al. Frequency of blood glucose monitoring in relation to glycaemic control: observational
study with diabetes database. BMJ. 1999; 319:83-6.
24. Keenan DB, Mastrototaro JJ, Zisser H et al. Accuracy of the Enlite 6-day glucose sensor with guardian and Veo calibration algorithms. Diabetes Technol Ther. 2012 Mar;14(3):225-31.
25. Joslin Diabetes Center. Clinical Guideline for adults with diabetes, 2010. pp. 1-3.
26. Farmer A, Wade A, Goyder E et al. Impact of self monitoring of
blood glucose in the management of patients with non-insulin
treated diabetes: open parallel group randomized trial. BMJ.
2007; 335:132.
27. Fabiato K, Buse J, Duclos M et al. Clinical experience with continuous glucose monitoring in adults. Diabetes Technol Ther.
2009 jun; 11(Suppl 1):S93-S103.
28. Gilliam LK, Hirsch IB. Practical aspects of real-time continuous
glucose monitoring. Diabetes Technol Ther. 2009 jun; 11(Suppl
1):S75-82.
29. Chetty VT, Amulla A, Odueyungbo A et al. The effect of continuous subcutaneous glucose monitoring (CGMS) versus intermittent whole blood fingerstick glucose monitoring (SBGM)
on hemoglobin A1c (HBA1c) levels in type 1 diabetic patients: a
systematic review. Diabetes Res Clin Pract. 2008 jul; 81(1):79-87.
30. Montagnana M, Lippi G, Guidi GC et al. The juvenile diabetes research foundation continuous glucose monitoring study
group. NEJM. 2008 oct; 359(14):1464-76.
31. Bergenstal RM, Tamborlane WV, Ahmann A et al. Star 3 Study
Group. Effectiveness of sensor-augmented insulin pump therapy
in type 1 diabetes. NEJM. 2010; 363(4):311-20.
32. Skjaervold NK, Solligard E, Hjelme DR et al. Continuous measurement of blood glucose: validation of a new intravascular sensor. Anesthesiology. 2011 jan; 114(1):120-5.
33. Guilfoyle SM, Crimmins NA, Hood KK. Blood glucose monitoring and glycemic control in adolescents with type 1 diabetes: meter
downloads versus self-report. Pediatr Diabetes. 2011 sep; 12(6):5606. doi:10.1111/j. 1399-5448. 2010. 00735.x. [Epub 2011 Mar 11.]
34. OGrady MJ, Retterath AJ, Keenan DB et al. The use of an automated, portable, glucose control system for overnight glucose control in

05/10/2015 06:42:31

32 Diretrizes SBD | 2015-2016

35.
36.
37.

38.
39.

adolescents and young adults with type 1 diabetes. Diabetes Care.


Department of Endocrinology and Diabetes, Princess Margaret
Hospital for Children, Perth, Western Australia, Australia, 2012 aug.
Dungan KM. 1,5-anhydroglucitol (GlycoMark) as a marker of
short-term glycemic control and glycemic excursions. Expert
Rev Mol Diagn. 2008; 8(1):9-19.
Yamanouci T, Akanuma Y. Serum 1,5 anhydroglucitol (1,5 AG):
new clinical marker for glycemic control. Diabetes Res Clin
Pract. 1994; (Suppl):S261-S8.
AACE Diabetes Mellitus Clinical Practice Guidelines Task Force.
American Association of Clincal Endocrinologists Medical
Guidelines for clinical practice for the management of diabetes
Mellitus. Endocrine Practice. 2007; 13(Suppl 1):18.
Holman RR, Paul SK, Bethel MA et al. 10-year follow-up of intensive glucose control in type 2 diabetes. N Engl J Med. 2008;
359:1577-89.
Patel A, MacMahon S, Chalmers J et al. ADVANCE Collaborative
Group. Intensive blood glucose control and vascular outcomes in
patients with type 2 diabetes. N Engl J Med. 2008; 358:2560-72.

Diretrizes SBD 2015-2016 - CAP 06.indd 32

40. Retinopathy and nephropathy in patients with type 1 diabetes


four years after a trial of intensive therapy. The diabetes control and complications trial/epidemiology of diabetes interventions and complications research group. N Engl J Med. 2000;
342:381-9.
41. Skyler JS, Bergenstal R, Bonow RO et al. American Diabetes Association, American College of Cardiology Foundation, American Heart Association. Intensive glycemic control and the prevention of cardiovascular events: implications of the ACCORD,
ADVANCE and VA diabetes trials: a position statement of the
American Diabetes Association and a scientific statement of the
American College of Cardiology Foundation and the American
Heart Association. Diabetes Care. 2009; 32:187-92.
42. Gerstein HC, Miller ME, Byington RP et al. Action to control cardiovascular risk in diabetes study group. Effects of intensive glucose lowering in type 2 diabetes. N Engl J Med. 2008; 358:2545-59.
43. Kilpatrick ES. Arguments for and against the role of glucose variability in the development of diabetes complications. J Diabetes
Sci Technol. 2009 jul 1; 3(4):649-65.

05/10/2015 06:42:31

Monitoramento da Glicemia na
Doena Renal Crnica
Introduo
O diabetes tipo 2 (DM2) uma doena crnica altamente prevalente em todo o mundo, acometendo 18 a 20% dos adultos
com mais de 65 anos. Estima-se que aproximadamente 285
milhes de pessoas no mundo todo (7%), entre 20 e 79 anos,
tenham diabetes atualmente, dos quais 70% vivem em pases
de rendas mdias e baixas. Espera-se que esse nmero cresa
em mais de 50% nos prximos 20 anos, caso programas preventivos no sejam implementados. A expectativa de que,
em 2030, em torno de 438 milhes de pessoas (ou 8% da populao adulta) tenham diabetes. O maior crescimento esperado em regies em desenvolvimento, como no Brasil. No
pas, a prevalncia de 5 a 7% do total da populao; ou seja,
em torno 7,6 milhes de pessoas.1
O tratamento do diabetes exige uma expertise que envolve
desde o conhecimento da fisiopatologia da doena, as possveis complicaes, os tratamentos mais atualizados disponveis, assim como as mudanas na propedutica. Isso tudo,
aliado a um conhecimento detalhado do paciente, a nica
maneira de se tentar obter um excelente controle glicmico,
evitando-se as complicaes que podem ser causadas pela tentativa de se otimizar o tratamento.2
Antes do United Kingdom Prospective Diabetes Study
(UKPDS) no existia a evidncia de que um controle glicmico
intensivo, determinado por uma terapia mais agressiva aliada
ao monitoramento e acompanhamento mdico mais frequente, pudesse diminuir as complicaes a longo prazo causadas
pelo diabetes tipo 2.3
Embora a hiperglicemia seja o marco bioqumico do diabetes, a hemoglobina glicada (A1c) tornou-se lentamente a
pedra fundamental para o diagnstico e o acompanhamento
do diabetes desde a sua introduo rotineira na prtica clnica
em 1976.4
Obviamente, h fatores confundidores na dosagem da A1c;
dentre eles, destacamos a diferena no equilbrio intracelular-extracelular da glicose, o tempo de sobrevivncia das hemcias
(anemia hemoltica) e os determinantes genticos no glicmicos da glicao da hemoglobina. Por essa razo, basear-se na
A1c como o nico critrio para o diagnstico de diabetes em
no caucasianos pode levar a erros de classificao. Em adio
ao seu papel recente como um marcador de diagnstico, a A1c
utilizada na avaliao do grau de controle metablico em diabticos e na predio de risco de complicaes vasculares.5

Diretrizes SBD 2015-2016 - CAP 07.indd 33

H evidncias conflitantes sobre o papel da A1c em refletir


o controle glicmico a longo prazo em pacientes com doena
renal crnica (DRC). Alm disso, a associao entre controle
glicmico e os desfechos pode ser diferente em pacientes com
ou sem DRC. A uremia constri um ambiente interno nico, o
que requer a anlise de cada caso, existindo assim a necessidade de avaliar marcadores para monitorar o controle da glicemia especificamente na populao com DRC.6

O diabtico portador de doena


renal crnica
O nmero de pessoas com DRC que necessitam de dilise
cresce de modo assustador. O censo da Sociedade Brasileira
de Nefrologia mostrou que 91 mil pacientes dependem de dilise no pas.
Esse nmero tem relao direta com o aumento do DM,
visto que, juntamente com a hipertenso arterial, o diabetes
constitui a principal causa da DRC. Frente s evidncias de
que o controle glicmico diminui a velocidade de progresso
da insuficincia renal, importante um bom controle da hiperglicemia desde estgios mais precoces das DRC.7
A DRC considerada atualmente um problema de sade pblica e constitui uma das principais complicaes nos
pacientes com diabetes. Cerca de 20 a 40% dos pacientes
com DM2 acabam evoluindo para nefropatia. O manejo da
hiperglicemia nos pacientes com insuficincia renal desafiador devido ao risco elevado de episdios de hipoglicemia.
Assim, opes teraputicas so limitadas para esse perfil de
pacientes.8

Marcadores de controle glicmico


Nveis elevados de glicemia promovem o desenvolvimento de
leses orgnicas extensas e irreversveis, afetando a retina, os
rins, os nervos e os vasos sanguneos grandes e pequenos. A
hiperglicemia continuada txica para o organismo por trs
mecanismos distintos: promoo da glicao de protenas, hiperosmoralidade e aumento dos nveis de sorbitol intracelular.9
O monitoramento glicmico visando preveno de
complicaes agudas e crnicas fundamental no manejo do
diabetes. Dessa maneira, abordaremos os principais marcadores de controle glicmico e as suas limitaes nos pacientes
com DRC.

06/10/2015 10:16:40

34 Diretrizes SBD | 2015-2016

Dosagem da glicose

Principais interferentes tcnicos

A glicose a fonte primria de energia e, para alguns tecidos


em especial, a nica fonte de energia (p. ex., para o sistema
nervoso e retina). Uma concentrao constante de glicose deve
estar disponvel para ser utilizada, mantendo a homeostase.10
A metodologia de dosagem da glicemia bem menos precisa
e acurada do que a maioria dos mdicos percebe. Estudos mostram que 41% dos instrumentos tm um vis significativo com o
mtodo de referncia que resultaria em potencial erro de classificao de at 12% dos pacientes. Alm disso, a manipulao da
amostra (ou seja, do sangue total coletado contendo anticoagulante EDTA) pode levar a erros pr-analticos potenciais.11

Mtodo de ponto final


Valores de bilirrubina maiores que 10 mg/dl produzem interferncias negativas. Para amostras contendo concentrao de triglicerdios maior que 1.100 mg/dl, pode-se minimizar o efeito
da turvao utilizando o branco de amostra ou diluindo-a com
NaCl 150 mmol/l (0,85%) e repetindo a medio.

Mtodo cintico
Valores de bilirrubina at 10 mg/dl, hemoglobina at 150 mg/dl
e triglicerdios at 3.500 mg/dl no produzem interferncias
significativas. cido ascrbico em concentraes acima de 100
mg/dl tambm interfere na reao, produzindo resultados falsamente diminudos.

Principais mtodos laboratoriais utilizados


O mtodo enzimtico colorimtrico, com a enzima glicose oxidase, utilizando-se plasma obtido aps centrifugao do sangue
venoso, o mais empregado e utiliza as enzimas hexoquinase e
glucose-6-fosfato-desidrogenase.12 A linearidade do mtodo
de 700 mg/dl.
possvel utilizar plasma ou soro. Para o plasma, necessrio realizar a coleta do sangue utilizando um antiglicoltico contendo um inibidor da gliclise (em geral, fluoreto). As amostras
de sangue no contendo antiglicoltico devem ser centrifugadas
e o soro, separado imediatamente. Nos casos em que h demora
nesse procedimento, a queda da glicose pode ser significativa e
alterar o diagnstico ou o monitoramento do paciente diabtico.

Condies clnicas que interferem no mtodo


Pacientes diabticos em uso continuado de clorpropamida podem desenvolver hipoglicemias importantes, muito difceis de
serem corrigidas. Nos casos de pessoas em jejum prolongado
ou de obesos submetidos a dietas de baixssimo valor calrico,
a glicemia pode ser diminuda. Nas 24 horas que sucedem a
ingesto de lcool, ocorre reduo da glicemia.
Vrias outras substncias podem afetar o metabolismo da
glicose; dentre elas esto glicocorticoides, tiazdicos e outros
diurticos, que podem aumentar a glicemia. O Quadro 1 cita
alguns exemplos de alterao glicmica devido a medicaes.
Nos pacientes com doena renal, comum que seja necessrio realizar modificaes no tratamento do diabetes
medida que a doena progride, levando em considerao os
fatores que predispem hipoglicemia, como uso de medicamentos com excreo preponderantemente renal. Em geral,
as sulfonilureias de curta ao so metabolizadas pelo fgado

Armazenamento e estabilidade da amostra


O analito estvel por 8 h em amostras coletadas com antiglicoltico. No plasma, soro e outros lquidos j separados das
clulas, a glicose permanece estvel por 3 dias, entre 2 e 8C, se
no houver contaminao bacteriana.

Quadro 1 Interferncia de medicamentos em exames laboratoriais do perfil glicdico.


Aumento da glicemia

Diminuio da glicemia

Interferente

Mecanismo

Interferente

Mecanismo

Estradiol

Contrainsulnico

AAS

sensibilidade tecidual

Fenitona

secreo de insulina

cido ascrbico

Interferncia analtica

Tetraciclina

Interferncia analtica

Metronidazol

Interferncia analtica

Levotiroxina

Mobilizao de glicognio

Paracetamol

Interferncia fisiolgica e analtica

Quetiapina

Mobilizao de glicognio

Betabloqueadores

mobilizao de glicose

Tiazdicos

secreo de insulina

Flufenazina

Haloperidol

Imipramina

Isoniazida

Ltio

Meperidina

Nortriptilina

Sildenafila

Levodopa

Desconhecido

Modificado de Costa Junior WL Jr. Disponvel em www.crfsp.org.br, consulta em 09 de junho de 2015.

Diretrizes SBD 2015-2016 - CAP 07.indd 34

06/10/2015 10:16:40

Monitoramento da Glicemia na Doena Renal Crnica 35

para formas inativas que so excretadas pela urina; enquanto


as de ao mais longa tm menor metabolizao heptica e so
excretadas intactas na urina.
As sulfonilureias so especialmente contraindicadas em pacientes urmicos. A aceto-hexamida e a tozalamida so rapidamente metabolizadas pelo fgado. A aceto-hexarmida metabolizada a uma forma reduzida, a hidroxi-hexamida, que duas
vezes mais potente que o produto original; 75% so excretados
pelo rim nesta forma, produzindo frequentes hipoglicemias. A
clorpropamida a sulfonilureia de ao mais prolongada, com
vida mdia de 36 h, praticamente no metabolizada no fgado,
e tem excreo renal; tambm pode provocar reteno hdrica e
hiponatremia devido sua ao sobre a secreo de hormnio
antidiurtico. Como todas essas so sulfonilureias de primeira
gerao, praticamente no so mais utilizadas no Brasil.
As sulfonilureias de segunda gerao (tais como glibenclamida, glipizida, gliquidona e glicazida) so mais potentes
que as anteriores, mais rapidamente metabolizadas e apresentam vida mdia curta e rpida excreo renal. A exceo entre
elas a gliquidona, que eliminada preferencialmente por via
blio-intestinal, podendo ser utilizada em pacientes com reduo da funo renal ainda no avanada. No Brasil, no entanto,
no h disponibilidade.
Quando a doena renal est em estgio mais avanado,
geralmente opta-se por manter mdia glicmica mais alta. Assim, a glicemia dosada em jejum poder estar mais elevada
sem que signifique mau controle do DM.
A metformina pertence classe das biguanidas, agindo perifericamente aumentando a sensibilidade insulina; a medicao mais utilizada nos diabticos tipo 2, sendo a primeira
opo. Um tero metabolizado no fgado e 2/3 so excretados
pela urina. Como os metablitos so inativos e a excreo renal
rpida, a ao hipoglicemiante menos intensa que a das sulfonilureias de curta durao, e no costuma alterar a glicemia de
maneira significativa nas fases iniciais da doena renal.

Preparo para o exame


Para finalidade diagnstica, a coleta deve ser precedida por jejum
de 8 a 12 h, com ingesto livre de gua. Recomenda-se atividade
fsica e alimentao habituais no dia anterior ao exame e dieta
padronizada com 150 g de carboidratos. Se o paciente j for diabtico e o exame for solicitado como parte da avaliao peridica,
recomenda-se que seja realizada a ceia normalmente e que o sangue seja coletado o mais cedo possvel aps o paciente se levantar, de modo a evitar hipoglicemia devido ao prolongamento do
jejum. Aps a coleta, a medicao habitual ento administrada.

Monitoramento glicmico domiciliar


ou automonitoramento
Monitoramento glicmico domiciliar ou automonitoramento
(AM) um recurso de grande valia tanto para o paciente como
para o mdico, pois , sem dvida, dentre os marcadores de
controle glicmico, o que fornece o maior nmero de informaes sobre o dia a dia alimentar e as respostas glicmicas
obtidas. Pimazzoni-Netto et al. estabelecem os seguintes critrios, que devem ser seguidos visando produo de resultados
favorveis, otimizando o uso do AM:9

Diretrizes SBD 2015-2016 - CAP 07.indd 35

O paciente deve estar orientado quanto ao uso adequado e


aos benefcios proporcionados pela correta prtica do automonitoramento
O paciente deve seguir uma prtica continuada de educao em diabetes, no apenas na fase inicial da descoberta
da doena, mas tambm conforme a evoluo da doena
No existe uma frequncia de testes que possa ser recomendada para todos os pacientes. Muito pelo contrrio, essa frequncia deve ser individualizada e adaptada s condies
clnicas de cada paciente
Os resultados do automonitoramento devem ser efetivamente utilizados pelo mdico e pelos demais profissionais
de sade, com o objetivo de promover ajustes constantes na
conduta teraputica e na orientao complementar das reas de enfermagem, nutrio, psicologia e educao fsica.

O AM no apresenta interferentes relacionados com os diabticos com DRC; suas limitaes se referem necessidade de
treinamento e acesso econmico s fitas. Contudo, no h dvida de que fundamental estabelecer um padro de variao
glicmica. A importncia da variabilidade glicmica como um
fator isolado de risco cardiovascular bem estabelecida.13
Outro dado importante em relao ao AM a possibilidade de fazer o download das informaes em softwares especficos para esse fim, produzindo grficos de acompanhamento
que facilitam a compreenso e a tomada de deciso.

Hemoglobina glicada
A glicao uma reao no enzimtica de ligao da glicose
protena neste caso, hemoglobina , originando o termo
hemoglobina glicada (A1c). Em vista disso, o termo hemoglobina glicosilada incorreto. O termo genrico hemoglobina
glicada refere-se a um conjunto de substncias formadas com
base em reaes entre a hemoglobina A (HbA) e alguns acares. Tal processo consiste em concentrao e tempo-dependente. Em termos prticos, significa que quanto maior a concentrao de glicose disponvel, maior ser a concentrao de
A1c. Com relao ao tempo, ocorre o contrrio, pois quanto
maior o tempo decorrido, menor a ligao da glicose molcula de hemoglobina.12
Em contraste com a glicose no plasma, a A1c representa glicao no enzimtica, que depende da concentrao
de glicose no compartimento intraeritrcito. Embora vrios
estudos tenham encontrado uma boa correlao (positiva)
entre as concentraes de A1c e glicose em pacientes diabticos com e sem DRC, a relao varivel entre A1c e glicose
mdia estimada (eAG) continua a ser uma fonte potencial de
preocupao.14
interessante notar que geralmente 97% da hemoglobina
HbA. Somente 6% da HbA sofre o processo de glicao, sendo
chamada de HbA1. Noventa e quatro por cento da HbA no
sofre ao de nenhum acar, e chamada de HbA0. Por sua
vez, a HbA1 dividida em subpartes de acordo com o tipo de
acar que produz a glicao. Vinte por cento da HbA1 recebe
influncia da frutose 1,6-difosfato e da glicose 6-fosfato, constituindo HbA1a e HbA1b. O restante (ou seja, 80% da HbA1)
glicado de acordo com a variao da glicemia, recebendo o
nome de HbA1c.

06/10/2015 10:16:41

36 Diretrizes SBD | 2015-2016

Principais mtodos laboratoriais utilizados


Os mtodos aprovados pelo National Glycohemoglobin Standardization Program (NGSP) so os seguintes:

Cromatografia lquida de alta performance (HPLC) mtodo que foi aplicado no estudo Diabetes Control and Complication Trials (DCCT)
Cromatografia de afinidade (HPLC) pelo cido bornico
Enzimtico
Imunoensaio
Eletroforese por capilaridade.

Como os diversos mtodos quantificam propores diferentes de hemoglobina glicada, os resultados no so equivalentes.
No entanto, em uma amostra sem variantes de hemoglobinas
ou presena de interferentes, h excelente correlao entre eles.
Por meio do NGSP, os resultados da hemoglobina glicada podem ser expressos por um meio que fornea resultados que informem de maneira equivalente sobre o status glicmico do paciente, independentemente do mtodo utilizado; de modo que
o mesmo critrio possa ser aplicado a qualquer um deles. Essa
entidade padronizou esses mtodos de forma que os resultados
sejam comparveis aos do DCCT, no qual se estabeleceu a relao entre a mdia da glicose no sangue e o risco para complicaes vasculares. Alm disso, em seu site, fornecem uma lista de
mtodos e de laboratrios em todo o mundo, cuja certificao
depende da demonstrao de preciso aceitvel, bem como que
estejam de acordo com os padres do DCCT (www.ngsp.org).12

Interferentes tcnicos mais importantes


So possveis interferentes na dosagem de A1c, dependendo do
mtodo:

Aumentando: insuficincia renal (a ureia aumentada liga-se


hemoglobina, produzindo hemoglobina carbamilada que interfere no ensaio da A1c); uso de cido acetilsaliclico (liga-se
hemoglobina, produzindo hemoglobina acetilada, interferindo no ensaio de A1c; em geral, ocorre com doses elevadas de
AAS); hipertrigliceridemia; hiperbilirrubinemia
Diminuindo: fatores inibidores da glicao da hemoglobina
(p. ex., vitaminas C e E).

Condies clnicas que interferem no mtodo


So possveis interferentes na dosagem de A1c, dependendo do
mtodo:

Aumentando: policitemia, anemia por deficincia de ferro,


cido flico ou vitamina B12; alcoolismo crnico; opiceos
Diminuindo: condies que encurtam a meia-vida das hemcias (p. ex., anemias hemolticas, hemorragias); intoxicao
por chumbo; deficincia de eritropoetina secundria insuficincia renal; mieloma mltiplo; hipertireoidismo; leucemia;
queimaduras graves com perda de lquido e protenas.12

Preparo para o exame


No necessrio jejum para a coleta do material. O sangue
pode ser armazenado em refrigerador por 1 semana; amostras
heparinizadas devem ser dosadas, no mximo, em 48 h.

Diretrizes SBD 2015-2016 - CAP 07.indd 36

A A1c recebe outras influncias que no a glicemia, e a est


a principal razo pela qual a sua dosagem questionada em pacientes com DRC. Dentre essas influncias, destacamos as apresentadas a seguir.

Eritropoese e vida mdia das hemcias


A formao da HbA1c depende da interao (intensidade e
durao) entre as concentraes de glicose e hemcias do sangue. Em mdia, as hemcias sobrevivem 117 dias em homens
e 106 dias em mulheres. Em determinado momento, uma
amostra de sangue contm hemcias de diferentes idades, com
predominncia de elementos mais jovens e diferentes graus de
exposio hiperglicemia.15 A HbA1c expressa a mdia da glicemia nos ltimos 90 dias, mas o Quadro 2 mostra o impacto
das glicemias recentes no nvel de A1c.
Uma discordncia sem causa aparente entre A1c e outras
medidas de controle da glicemia pode ser, em parte, o resultado
de diferenas no tempo de vida eritrocitria. Uma diminuio
da eritropoese, decorrente de deficincia de ferro ou de vitamina B12 ou de anemia aplsica, leva a aumento do nmero de
hemcias envelhecidas e, em conformidade, a aumento progressivo da HbA1c no relacionado com o controle da glicemia.16
Anemia por deficincia de ferro provoca aumento na HbA1c
de at 2%, o que pode ser revertido com a suplementao de ferro. Ao contrrio, observa-se diminuio na HbA1c aps a administrao de eritropoetina, ferro e vitamina B12 e nos casos de
anemia hemoltica. Devido a uma reduo da sobrevivncia das
hemcias, as hemcias mais jovens tm menos tempo de exposio ao ambiente glicmico e, portanto, menos glicao.17

Hemoglobinopatias
As hemoglobinopatias, cujo exemplo mais comum a anemia
de clulas falciformes e talassemias, podem levar a problemas de interpretao da HbA1c. Nessas alteraes, alm do
fenmeno normal de glicao de HbA0 para formar HbA1c,
outros produtos de glicao derivados de HbC (populaes
africanas), HbD (populaes indgenas), HbE (populaes
asiticas) ou HbS (anemia falciforme) so formados em complemento ou em substituio de HbA1c.16

Glicao da hemoglobina
No terceiro National Health and Nutrition Examination Survey, o consumo de lcool foi associado a baixos nveis de
HbA1c entre 1.024 adultos com diabetes. Esses achados foram
confirmados em um grande estudo de follow-up com 38.564
pacientes adultos com diabetes tipo 1 ou 2. O aumento do consumo de lcool prediz valores menores de A1c. Nveis de pH
dentro da hemcia podem aumentar (baixo pH de hemcias)
ou diminuir (pH elevado de hemcia) a HbA1c. Em pacientes
com insuficincia renal crnica, a peroxidao lipdica de Hb
pode aumentar a glicao da hemoglobina. A ingesto crnica
de cido acetilsaliclico e de altas doses de antioxidantes (p.
Quadro 2 Impacto das glicemias recentes no nvel de HbA1c.
1 ms
antes

2 meses
antes

50%

25%

3 meses
antes

4 meses
antes
25%

06/10/2015 10:16:41

Monitoramento da Glicemia na Doena Renal Crnica 37

ex., vitaminas C e E) pode reduzir a HbA1c devido inibio


da glicao. No est claro se esses fenmenos poderiam levar
a uma mudana de conduta na prtica clnica.18

Ensaios laboratoriais
Alm das alteraes descritas anteriormente, importante destacar que novas metodologias detectam de maneira diferente a
presena das hemoglobinopatias e da hemoglobina carbamilada
que pode interferir na dosagem. HbA1c dosada por HPLC detecta a frao carbamilada diferentemente da imunoturbidimetria que no identifica essa frao; em consequncia, pacientes
com insuficincia renal apresentam nveis de A1c mais elevada
se dosada por HPLC.
O Quadro 3 descreve a capacidade de deteco das hemoglobinopatias pelas principais metodologias.

Albumina glicada
A dosagem de albumina glicada (AG) est ganhando interesse
como um potencial marcador de controle glicmico. AG uma
cetoamina formada a partir da oxidao no enzimtica da albumina pela glicose. Como a meia-vida da albumina de aproximadamente 15 dias, a AG uma medida de controle glicmico a
curto prazo (ou seja, 2 a 3 semanas) e, como tal, pode atuar como
um ndice de tempo intermedirio do controle glicmico.19
Vrias metodologias podem ser utilizadas para a dosagem
da AG dentre elas, cromatografia de afinidade, cromatografia de permuta inica, HPLC, tcnicas de imunoensaio, eletroforese capilar e outros ensaios eletroforticos e enzimticos.
No influenciada por sexo, tempo de vida das hemcias e teraputica com eritropoetina. Para a concentrao de albumina
do soro, os resultados se a AG estaria mais baixa so conflitantes; portanto, no paciente com DRC e hipoalbuminemia,
necessrio que o resultado seja interpretado com cautela.
No entanto, os resultados podem ser afetados por idade,
estado nutricional, albuminria, cirrose, disfuno da tireoide
e tabagismo. Recomenda-se a no utilizao da FG quando a
albumina for inferior a 3,0 g/dl. AG inversamente influenciada pelo ndice de massa corporal, massa de gordura corporal e tecido adiposo visceral.20

Frutosamina glicada
Frutosamina o nome genrico dado a todas as protenas glicadas, das quais a albumina a frao plasmtica majoritria, depois da hemoglobina. Embora a dosagem de frutosamina possa
ser automatizada, apresente menor custo e seja mais rpida que
a dosagem de A1c, no h consenso da sua utilidade clnica.21
O nvel de frutosamina se correlaciona melhor com os nveis mdios de glicose nos ltimos 10 a 14 dias. Por se tratar de

uma medida de protenas totais do soro glicada com albumina


glicada representando algo em torno de 90% dessas protenas,
as concentraes de frutosamina podem ser influenciadas
pelas concentraes de protenas sricas e perfil de protenas
diferentes.
Alm disso, a frutosamina influenciada pela concentrao
de bilirrubina e de substncias com baixo peso molecular, como
o cido rico e a ureia, podendo apresentar resultados duvidosos
no paciente com ureia significativamente elevada. A frutosamina
glicada (FG) no modificada por alteraes do metabolismo de
hemoglobina, mas afetada por alteraes no turnover de protenas. Os valores de referncia dependem da idade, do sexo, da
populao da amostra e do mtodo de ensaio aplicado.22
Negativamente, dados mostram resultados contraditrios relativos correlao entre frutosamina e a concentrao de glicose
em pacientes com DRC. Mudanas significativas na concentrao
de protenas e tempo de meia-vida podem ter efeito na proporo
de protena glicada. Assim, os resultados devem ser analisados
com cautela ou at invalidados em pacientes com sndrome nefrtica. Recomenda-se a no utilizao da FG quando a albumina for inferior a 3,0 g/dl. Outros fatores so doenas da tireoide,
administrao de glicocorticoides, cirrose heptica e ictercia.22

1,5-Anidroglucitol
1,5-Anidroglucitol (1,5-AG) outro marcador de glicemia, um
poliol plasmtico de ocorrncia natural na dieta que mantido constante durante a normoglicemia mediante filtrao e
reabsoro renal. A funo fisiolgica e o metabolismo do 1,5AG no esto totalmente definidos. 1,5-Anidroglucitol (1,5AG) um anlogo da glicose no metabolizvel encontrado
no plasma aps ingesto. Caracteriza-se pela excreo urinria,
filtrao atravs dos glomrulos, taxa de 5 a 10 g/l e reabsoro
tubular muito alta (> 99%), que inibida pela glicose durante
perodos de hiperglicemia.23 Praticamente todo o 1,5-AG filtrado pelo rim reabsorvido em condies normais. Contudo,
quando as concentraes glicmicas ultrapassam o limiar renal,
ocorre diminuio da concentrao plasmtica de 1,5-AG devido inibio competitiva com a glicose pela reabsoro tubular
proximal. No se sabe at que ponto poderia ser afetado pela
DRC. Com relao interferncia analtica, a creatinina somente altera o 1,5-AG quando est acima de 10 mg/dl.
Os nveis de 1,5-AG no sangue se alteram em menos de 24
h aps episdios hiperglicmicos, cuja repetio diminui drasticamente a sua concentrao. Os valores de 1,5-AG refletem
a hiperglicemia ao longo de aproximadamente 1 semana. A
medio de 1,5-AG poderia desempenhar papel adjuvante no
controle do diabetes, especialmente como um marcador nico
a curto prazo para excurses de hiperglicemia para alm do
limiar glucosrico.24

Quadro 3 Deteco das hemoglobinopatias pelas principais metodologias.


Mtodo

HbC

HbS

HbE

HbD

HbF

HPLC troca inica

No

No

Sim

Sim

Sim (> 5%)

Imunoturbidimetria

No

No

No

No

Sim

HPLC afinidade

Sim

No

Sim

No

No

HPLC: cromatografia lquida de alta performance.

Diretrizes SBD 2015-2016 - CAP 07.indd 37

06/10/2015 10:16:41

38 Diretrizes SBD | 2015-2016

Em indivduos no diabticos, o 1,5-AG apresenta correlao positiva com a creatinina. Nos indivduos no diabticos
com DRC, observou-se que o aumento de creatinina e a uremia
podem estar associados ao aumento deste analito. Em diabticos, enquanto alguns estudos relataram correlao negativa em
diabticos tipo 1, outros no observaram qualquer correlao.
Esse analito no sofre interferncia significativa de hemlise moderada (at 125 mg/dl de hemoglobina), ictercia (at
53 mg/dl de bilirrubina) e de lipemia (at 1.153 mg/dl de triglicerdios), cido ascrbico (at 25 mg/dl) e cido rico (at
20 mg/dl).
A Figura 1 mostra a correlao entre cada marcador e o
tempo de hiperglicemia que ele reflete.

Discusso
A relao entre A1c e glicose mais complexa em estgios mais
avanados da DRC em virtude de uma grande variabilidade na
hemoglobina, estado nutricional e inflamao. Alm disso, essas comorbidades subjacentes tambm podem dificultar o valor
prognstico da A1c.
As diretrizes atuais recomendam a A1c como o biomarcador preferido do controle glicmico em pacientes com DRC
com meta de 7% para evitar ou retardar a progresso das complicaes microvasculares do diabetes, incluindo nefropatia
diabtica.3 No entanto, essas orientaes se referem principalmente a estgios iniciais da DRC. Em pacientes diabticos
com doena avanada, sugere-se que o objetivo de um controle glicmico muito intensivo, A1c < 6,5%, possa estar associado a aumento da mortalidade.
Um estudo de coorte avaliando 54.757 diabticos em hemodilise observou que a A1c mdia > 8% ou a glicemia mdia > 200 mg/dl pareciam estar associadas a maior mortalidade cardiovascular por todas as causas.25
Uma recente metanlise investigando a relao entre A1c e
risco de morte em pacientes diabticos em hemodilise mostrou que o nvel de A1c continua a ser uma ferramenta clnica
til na predio de risco de mortalidade.26
Embora a albumina glicada apresente vantagens em pacientes com DRC, alguns autores argumentam que esta caracterizada por uma homeostase de albumina anormal, e que
o limiar de albumina srica em que o risco de morte aumenta
varia por modalidade de dilise.27 Na presena de hipoalbuminemia, a glicao das protenas do plasma est aumentada.
No entanto, a albumina glicada parece refletir o percentual de
albumina que glicada, independentemente da concentrao

Glicose

Marcadores de controle glicmico

1,5-AG

Frutosamina

HbA1c
Albumina glicada

5
6
7
8
9
Tempo em semanas

10

11

12

Figura 1 Tempo em semanas de cada marcador de controle


glicmico.

Diretrizes SBD 2015-2016 - CAP 07.indd 38

de albumina srica total; no entanto, para comprovar essa observao, so necessrios mais estudos em grande escala com
pacientes em dilise.28
A albumina glicada parece ser um marcador superior
na capacidade de refletir a exatido do controle glicmico
em comparao com a HbA1c em pacientes com nefropatia
diabtica. No entanto, devido aos dados limitados, ausncia
de estudos sobre os resultados de interveno com base em
albumina glicada e sua metodologia cara e laboriosa, parece
prematuro abandonar a A1c em favor da albumina glicada.29
Desse modo, recomendamos que os pacientes diabticos com
DRC sejam monitorados da melhor maneira possvel, em uma
tentativa de preveno de progresso da doena e aumento das
complicaes. Para isso, a sugesto o monitoramento da A1c
a cada 3 meses, associado ao automonitoramento domiciliar,
quando possvel. Outros exames como a frutosamina glicada, a
albumina glicada e o 1,5-AG poderiam ser utilizados como ferramentas adicionais, e no substituindo a hemoglobina glicada.
Quadro 4 Recomendaes e concluses.
Recomendaes e concluses

Grau de
recomendao

A HbA1c o marcador de controle glicmico


de escolha no diabtico

O nvel de HbA1c se correlaciona


diretamente com a incidncia de
complicaes crnicas do diabetes mellitus

O valor de meta da HbA1c deve variar de


acordo com o paciente, a depender de uma
srie de fatores, especialmente comorbidades

A DRC uma complicao importante do DM B


e as alteraes secundrias falncia renal
dificultam o monitoramento do controle
glicmico
A hemodilise e a dilise peritoneal
introduzem interferentes especficos que
alteram a confiabilidade nos mtodos de
avaliao do controle glicmico

Em pacientes com DM associado DRC, a


frutosamina pode ser til no monitoramento
do controle glicmico.

A HbA1c uma ferramenta clnica til na


predio de risco de mortalidade em
pacientes com DM e DRC

Em pacientes com DM e DRC, com anemia


importante, a albumina glicada parece ser
superior HbA1c na avaliao do controle
glicmico

O automonitoramento um excelente
mtodo para avaliao do controle glicmico

A associao de vrios mtodos de anlise


do controle glicmico do paciente diabtico
com DRC parece trazer mais confiabilidade
ao clnico

(A) Estudos experimentais e observacionais de melhor consistncia; (B)


Estudos experimentais e observacionais de menor consistncia; (C) Relatos
de casos (estudos no controlados); (D) Opinio desprovida de avaliao
crtica, baseada em consensos, estudos fisiolgicos ou modelos animais.

06/10/2015 10:16:41

Monitoramento da Glicemia na Doena Renal Crnica 39

Referncias bibliogrficas
1. American Diabetes Association. Standards of in diabetes 2014.
Diabetes Care. 2014 Jan.; 37 Suppl 1.
2. Stratton IM, Adler AI, Neil HA et al. Association of glycaemia
with macrovascular and microvascular complications of type
2 diabetes (UKPDS 35): prospective observational study. BMJ
2000; 321: 405-12.
3. National Kidney Foundation. KDOQI Clinical Practice Guideline for Diabetes and CKD: 2012 Update. Am J Kidney Dis. 2012;
60: 850-86.
4. UK Prospective Diabetes Study Group. Effect of intensive blood
glucose control with metformin on complications in overweight patients with type 2 diabetes: UKPDS 34. Lancet. 1998; 352: 854-65.
5. American Diabetes Association, European Association for the
Study of Diabetes, International Federation of Clinical Chemistry and Laboratory Medicine et al. Consensus statement on the
worldwide standardization of the HbA1c measurement. Diabetologia. 2007; 50: 2042-3.
6. Kilpatrick ES, Rigby AS, Atkin SL. Variability in the relationship between mean plasma glucose and HbA1c: implications
for the assessment of glycemic control. Clin Chem. 2007; 53:
897-901.
7. U.S. Renal Data System (2011). USRDS 2011 Annual Data Report: Chapter: Incidence, Prevalence, Patient Charateristics and
Treatment Modalities. National Institutes of Health, National Institute of Diabetes and Kidney Diseases: Bethesda, MD, 2011.
8. Sesso RC, Lopes AA, Thome FS et al. [Report of the Brazilian
Chronic Dialysis Census 2012]. J Bras Nefrol. 2014; 36: 48-53.
9. Pimazoni-Netto A, Rodbard D, Zanella MT. Rapid improvement
of glycemic control in type 2 diabetes using weekly intensive
multifactorial interventions: structured glucose monitoring, patient education, and adjustment of therapy a randomized controlled trial. Diabetes Technology & Therapeutics. 2011; 13(10):
997-1004.
10. Alberti KG, Zimmet PZ for the WHO Consultation. Definition,
diagnosis and classification of diabetes mellitus and its complications. Part 1 Diagnosis and classification of diabetes mellitus. Provisional report of a WHO consultation. Diabet Me. 1998; 15: 539.
11. Nathan D, Davidson MB, Defronzo RA et al. Impaired fasting
glucose and impaired glucose tolerance. Diabetes Care. 2007; 30:
753-9.
12. Vencio S, Fontes R, Scharf M. Manual de exames laboratoriais na
prtica do endocrinologista. Rio de Janeiro: AC Farmacutica.
2013; p. 298.
13. Ceriello A, Esposito K, Piconi L et al. Oscillating glucose is more
deleterious to endothelial function and oxidative stress than
mean glucose in normal and type 2 diabetic patients. Diabetes.
2008; 57: 1349-54.

Diretrizes SBD 2015-2016 - CAP 07.indd 39

14. Chen HS, Wu TE, Lin HD et al. Hemoglobin A(1c) and fructosamine for assessing glycemic control in diabetic patients with
CKD stages 3 and 4. Am J Kidney Dis. 2010; 55(5):867-74.
15. Cohen RM, Franco RS, Khera PK et al. Red cell life span heterogeneity in hematologically normal people is sufficient to alter
HbA1c. Blood. 2008; 112: 4284-91.
16. Gallagher EJ, Le Roith D, Bloomgarden Z. Review of hemoglobin
A(1c) in the management of diabetes. J Diabetes. 2009; 1: 9-17.
17. Uzu T, Hatta T, Deji N et al. Target for glycemic control in type 2 diabetic patients on hemodialysis: effects of anemia and erythropoietin
injection on hemoglobin A(1c). Ther Apher Dial. 2009; 13: 89-94.
18. Speeckaert M, Van Biesen W, Delanghe J, Slingerland R, Wiecek
A, Heaf J et al for the European Renal Best Practice Guideline
Development Group on Diabetes in Advanced CKD. Are there
better alternatives than haemoglobin A1c to estimate glycaemic
control in the chronic kidney disease population? Nephrol Dial
Transplant. 2014; 1-11.
19. Schleicher ED, Olgemller B, Wiedenmann E et al. Specific glycation of albumina depends on its half-life. Clin Chem. 1993; 39:625-8.
20. Okada T, Nakao T, Matsumoto H et al. Influence of age and nutritional status on glycated albumina values in hemodialysis patients. Intern Med. 2009; 48: 1495-9.
21. Cohen RM, Holmes YR, Chenier TC et al. Discordance between
HbA1c and fructosamine: evidence for a glycosylation gap and its
relation to diabetic nephropathy. Diabetes Care. 2003; 26: 163-7.
22. Mittman N, Desiraju B, Fazil I et al. Serum fructosamine versus
glycosylated hemoglobin as an index of glycemic control, hospitalization, and infection in diabetic hemodialysis patients. Kidney Int Suppl. 2010; 117: S41-5.
23. Yamanouchi T, Akanuma Y. Serum 1,5-anhydroglucitol (1,5
AG): new clinical marker for glycemic control. Diabetes Res Clin
Pract.1994; 24: S261-8.
24. Nerby CL, Stickle DF. 1,5-anhydroglucitol monitoring in diabetes: a mass balance perspective. Clin Biochem. 2009; 42: 158-67.
25. Ricks J, Molnar MZ, Kovesdy CP et al. Glycemic control and cardiovascular mortality in hemodialysis patients with diabetes: a
6-year cohort study. Diabetes. 2012; 61: 708-15.
26. Hill CJ, Maxwell AP, Cardwell CR et al. Glycated hemoglobin
and risk of death in diabetic patients treated with hemodialysis:
a meta-analysis. Am J Kidney Dis. 2014; 63(1):84-94.
27. Spiegel DM, Breyer JA. Serum albumina: a predictor of long-term
outcome in peritoneal dialysis patients. Am J Kidney Dis. 1994; 23:
283-5.
28. Freedman BI. A critical evaluation of glycated protein parameters in advanced nephropathy: a matter of life or death: time to
dispense with the hemoglobina A1C in end-stage kidney disease.
Diabetes Care. 2012; 35: 1621-4.
29. Little RR, Rohlfing CL, Tennill AL et al. Measurement of Hba(1C) in
patients with chronic renal failure. Clin Chim Acta. 2013; 418: 73-6.

06/10/2015 10:16:41

Gerenciamento Eletrnico do
Diabetes | Uso da Tecnologia para
Melhor Controle Metablico do Diabetes
Introduo
Desde o final do sculo 20, aconteceram grandes avanos tecnolgicos no tratamento do diabetes. Esses avanos possibilitaram que milhares de pacientes pudessem ter melhoria nos
resultados do tratamento da doena, facilitaram o seu manejo e contriburam para um entendimento mais profundo
das variaes glicmicas e de como obter o melhor controle
sobre elas.
Neste captulo, citaremos os mais importantes desses avanos que possibilitaram o gerenciamento eletrnico do diabetes,
contribuindo para melhora dos controles glicmicos, diminuio dos episdios de hipoglicemia e hiperglicemia e facilidade
de clculos e manejo do diabetes, pela equipe de sade e pelo
paciente e sua famlia. Os avanos so:

A bomba de infuso de insulina, que, embora tenha sido


desenvolvida e seu uso difundido nos EUA desde 1970, no
Brasil chegou h cerca de 15 anos e est sendo cada vez mais
conhecida e prescrita
Os sensores de glicose: desde os de uso mdico at os novos
sensores de tempo real de uso individual e acoplados a sistemas de infuso contnua de insulina
Os softwares, que, mediante seu acesso, seja pela internet,
seja pelo celular, possibilitam um gerenciamento mais eficaz do diabetes e das excurses glicmicas pelo paciente,
por seus familiares e pela equipe de sade.

Bomba de infuso de insulina


O objetivo da teraputica com o sistema de infuso contnua
(SIC) de insulina, mais comumente chamado de bomba de infuso de insulina, simular ao que ocorre no organismo da
pessoa sem diabetes, mantendo a liberao de insulina durante 24 h para tentar obter nveis normais de glicose entre as refeies e liberar insulina nos horrios de alimentao.
Dessa maneira, em vez de receberem mltiplas doses de
injees subcutneas de insulina de curta a longa durao, os
pacientes, em uso da bomba, passam a receber uma infuso
subcutnea contnua de anlogos ultrarrpidos em forma de
doses basais ao longo do dia e bolus antes das refeies.1

Diretrizes SBD 2015-2016 - CAP 08.indd 40

A bomba de infuso de insulina um dispositivo mecnico com comando eletrnico, do tamanho de um pager, pesando cerca de 80 a 100 g. Colocada externamente ao corpo,
presa na cintura, pendurada por dentro da roupa ou no pescoo, a bomba de infuso deve ser usada ao longo das 24 h do
dia. Na maioria dos sistemas de infuso de insulina, a bomba
ligada a um tubo plstico fino, que tem uma cnula flexvel
de teflon, com uma agulha-guia, a qual inserida sob a pele,
geralmente no abdome, e, por ela, envia insulina ao tecido
subcutneo do paciente continuamente em microdoses, de
acordo com a dosagem previamente definida pelo mdico.
Outros locais de aplicao da cnula que podem ser usados,
mas que normalmente tm menor absoro de insulina, so a
regio lombar, as coxas e at mesmo os membros superiores.2
reas com lipodistrofia, cicatrizes ou quaisquer outras alteraes na pele devem ser evitadas.3 As bombas de insulina
so muito precisas. A liberao de insulina durante as 24 h
automtica e feita por meio de uma programao prvia, podendo ser constante ou varivel. Podem-se programar doses
to pequenas quanto 0,025 UI/h, ou nenhuma insulina por
algumas horas, adaptando-se s diferentes necessidades de
cada perodo do dia.
Por no ser prova dgua, ela deve ser desconectada da
cnula (por perodo mximo de at 2 h) quando o paciente
quiser nadar ou tomar banho.
Os implementos da bomba de infuso de insulina so:


Reservatrio da insulina
Conjunto de infuso (cateter e cnula)
Baterias.

Algumas bombas de infuso j so equipadas tambm com


um controle remoto eletrnico para sua operao por tecnologia Bluetooth.
O reservatrio de insulina contm de 176 a 315 unidades
de insulina, dependendo do tipo de bomba utilizada.3 Existem
diversos tipos de conjuntos de infuso, com diferentes modelos de cateteres. So utilizados os seguintes tipos:

De 6 mm, para pessoas com tecido subcutneo normal ou


pouco espesso

06/10/2015 09:50:00

Gerenciamento Eletrnico do Diabetes | Uso da Tecnologia para Melhor Controle Metablico do Diabetes 41

De 9 mm, para pessoas com tecido subcutneo mais espesso, aplicado em 90 (Quick-set, Ultraflex e FlexLink)
De 17 mm, para uso geral, aplicado em 45 (Silouette,
Tender, Comfort e Tenderlink), ou menos, dependendo
da quantidade de tecido celular subcutneo.

Todos os conjuntos de infuso utilizam adesivos na pele


para a fixao da cnula, e a escolha do tipo dos conjuntos de
infuso, aps o perodo inicial de adaptao, feita pelo paciente com base em critrios de preo e conforto. A cnula um cateter fino e flexvel de teflon. Todas as cnulas tm agulhas-guia,
que so retiradas aps a sua aplicao. Elas podem ser colocadas
manualmente ou por intermdio de um aplicador.
O kit de infuso (cnula e extenso) deve ser trocado frequentemente: a cnula, a cada 3 dias, e todo o conjunto de infuso (cnula e cateter), a cada 6 dias. O uso do mesmo kit de
infuso por um perodo maior que 3 dias est associado a deteriorao no controle glicmico e maior risco de infeces no
local de implantao do cateter. Os anlogos ultrarrpidos (lispro, asparte ou glulisina) so as insulinas preferencialmente
usadas na bomba, uma vez que causam menos hipoglicemias
do que a insulina rpida (R), alm de produzirem melhores
valores de glicemia ps-prandiais.4
O paciente deve ser alertado para carregar nas suas viagens
frascos extras de insulina, acessrios para as bombas e seringas e/ou canetas contendo anlogos sem pico e ultrarrpido,
para o caso de acontecer algum problema com o equipamento,
com a bomba ou com o kit de infuso.
J existem bombas sem fio (ainda no disponveis no Brasil),
nas quais a cnula integrada bomba e um controle remoto
manual usado para ajustar as doses e programar a liberao de
insulina.3 Outras bombas, como a Medtronic Paradigm VeoTM,
dispem de um mecanismo de suspenso automtica da infuso de insulina (low glucose suspend ou suspenso por hipo).
Elas so conectadas a um aparelho de monitoramento contnuo
de glicose (MCG) e previnem hipoglicemias significativas, suspendendo a infuso de insulina por 2 h quando os nveis de glicose alcanam valores muito baixos.5,6
Mais recentemente, os estudos relacionados com o sistema chamado de pncreas artificial tm ganhado cada vez
mais destaque e so um grande desafio. Ele tem como objetivo
melhorar o controle glicmico, reduzir o risco de hipoglicemia e melhorar a qualidade de vida dos pacientes. Para isso,
o sistema utiliza as informaes oriundas do MCG (leitura da
glicemia em tempo real) para, por meio de complexos algoritmos clculos realizados por um software em um computador externo , ajustar e liberar automaticamente a quantidade
ideal de insulina necessria sem a necessidade de interveno
do paciente.7,8

Infuso basal de insulina


Clculo da dose basal de insulina
A infuso basal geralmente representa 40 a 60% da dose total
de insulina/dia e seu objetivo suprimir a produo de glicose entre as refeies, bem como durante a noite. Pode-se programar as bombas de infuso para liberar doses constantes ou
variveis a cada hora, durante as 24 h, adaptando-se, assim, s
necessidades variveis dos diferentes perodos do dia, como,

Diretrizes SBD 2015-2016 - CAP 08.indd 41

por exemplo, o de maior resistncia ao da insulina, que


ocorre nos perodos do alvorecer e do entardecer.9 A infuso
de cada hora pode ser mais bem programada aps realizao
de monitoramento contnuo de glicose, estabelecendo, com
isso, quais os horrios de maior necessidade de insulina de
cada paciente.10 Alm disso, a dose da infuso basal pode ser
mudada a qualquer momento durante as 24 h do dia.
Dependendo do modelo, as bombas de infuso de insulina
podem liberar taxas basais de 0,025 a 50 unidades/h (em gradaes de 0,025 a 0,1 unidade), bem como ser programadas
para at 48 diferentes taxas basais em 24 h.7 Em alguns casos, sobretudo em crianas, podem-se usar doses to pequenas quanto 0,1 unidade por hora, e at suspender a infuso
de insulina por algumas horas. A dose basal total calculada
segundo a frmula apresentada a seguir no Quadro 1.
Pode-se dividir a dose basal encontrada aps o clculo demonstrado no Quadro 1 pelo perodo de 24 h a fim de se obter
a relao inicial de insulina basal por hora (normalmente entre 0,5 a 1,0 U/h). Essa taxa pode ser depois ajustada de acordo
com as necessidades de cada paciente, de modo a liberar mais
ou menos insulina em determinadas horas do dia, baseado no
monitoramento de glicose.3

Bolus de refeio
O bolus alimentar ou de refeio liberado no momento das
refeies, pelo paciente, de acordo com a quantidade de carboidratos que ser ingerida, sendo a contagem de carboidratos
muito utilizada para esse fim. Em mdia, usamos uma unidade
de insulina para cada 15 g de carboidrato ingerido em adultos
e uma unidade de insulina para 20 a 30 g de carboidrato em
crianas e adultos magros mais sensveis substncia. possvel calcular essa relao usando a frmula descrita a seguir:
550
DTID

= gramas de carboidrato por cada unidade de insulina

DTID = dose total de insulina diria no incio da terapia com


bomba de infuso
Bolus adicionais de insulina podem ser liberados durante as
refeies ou aps seu trmino, o que muito vantajoso quando se trata de crianas, de pacientes com gastroparesia ou aps
o consumo de alimentos com grande quantidade de gordura,
como pizza ou massas com queijo (D).11
As bombas mais modernas em uso no Brasil possibilitam
alterar o modo e a durao do bolus que usado para as refeies, utilizando esquemas de onda quadrada ou onda dupla
Quadro 1 Clculo da dose basal de insulina.
Soma da insulina total/dia (N, L, glargina ou detemir) +
(R, lispro ou asparte)*
Reduo de 10 a 20% da dose prvia se o paciente estiver bem
controlado (hemoglobina glicada [HbA1c] < 6,5%) ou
manuteno da dose total diria se o paciente no estiver
controlado
Diviso do total obtido por 2
*Dose previamente utilizada.

06/10/2015 09:50:00

42 Diretrizes SBD | 2015-2016

para adequarem-se quantidade e aos tipos de alimentos ingeridos. No esquema de bolus estendido (ou quadrado), uma
dose constante de insulina liberada durante algumas horas,
segundo uma programao prvia, enquanto no esquema de
bolus bifsico (ou de onda dupla), primeiro libera-se uma dose
de insulina imediatamente aps a refeio e, a seguir, o restante da dose. O bolus estendido pode ser usado durante uma
festa ou um churrasco. O bolus bifsico utilizado aps refeio rica em gorduras e em carboidrato, como pizza ou lasanha,
quando h necessidade de efeito mais prolongado da insulina.

Fator de sensibilidade e bolus corretivo


O fator de sensibilidade determina, aproximadamente, qual
o efeito de uma unidade de insulina nos nveis de glicemia do
paciente. Ele calculado por meio da regra de 1.800, quando
se divide esse valor pela quantidade total de insulina utilizada
por dia.
1.800
DTID

= diminuio de glicemia mg/dl/unidade de insulina

DTID = dose total de insulina/dia no incio da terapia com


bomba de infuso
Esse fator tambm pode ser calculado para valores de glicemia em milimol/litro da seguinte maneira: 11/DTID = diminuio da glicemia em mmol/l.
O bolus corretivo (BC) usado para corrigir a hiperglicemia e leva em conta a sensibilidade insulina, a qual individual. Muitos pacientes j utilizam calculadoras de bolus para
estimar a dose de insulina que devem utilizar. Algumas bombas de infuso tambm j vo com essa opo.
Bolus de correo = valor de glicemia meta glicmica
Fator de sensibilidade
Exemplo: 520 a 120 mg/dl = 400/fator de sensibilidade =
400/50 = 8 unidades de insulina ultrarrpida

Algumas das bombas de insulina mais modernas tm


softwares que as capacitam para calcular a dose da insulina a
ser injetada na forma de bolus, considerando no s o consumo de carboidratos calculado pelo paciente e introduzido na
bomba, mas, tambm, os resultados da glicemia medidos no
momento da aplicao. A possibilidade de incluso de diferentes coeficientes de relao insulina/carboidrato, de fatores de
correo variveis de acordo com diferentes horrios do dia e
o clculo da insulina residual e a correo automtica da dose
de insulina do bolus a ser liberado so outras caractersticas
positivas dessas novas bombas.

Indicaes para a prescrio da


bomba de insulina
Deve-se motivar o paciente candidato a utilizar a bomba de insulina, porm importante observar se o mesmo conseguir lidar
com ela, responder a seus alarmes, monitorar a glicose de 4 a 8
vezes/dia e calcular seu bolus de refeio de acordo com a quantidade de carboidratos. As bombas de insulina no so apropriadas
para pacientes que no atendam a esses critrios e no devem ser
utilizadas para substituir uma pobre educao em diabetes e precria habilidade de automonitoramento.12 A seguir, as indicaes
mdicas para a utilizao da bomba de insulina:

Sensibilidade insulina e ajustes de doses


Ela varia em diferentes perodos, podendo ser menor no perodo pr-menstrual, em situaes de doenas infecciosas, estresse,
depresso, quando o paciente ganha peso ou at mesmo em diferentes horrios do dia, nos quais preciso lidar com nveis glicmicos muito elevados, quando existe o efeito glicotxico com
diminuio da sensibilidade insulina. A sensibilidade tambm
pode ser estimada em 50 mg/dl para adultos e 75 a 100 mg/dl
para crianas e adultos magros com boa sensibilidade insulina.
Sempre que o paciente medir a glicemia, ele deve usar esse
fator como modo de calcular quanta insulina necessria a
fim de reduzi-la ao valor desejado. Para todos os pacientes,
deve-se fixar uma meta glicmica a ser alcanada. No caso de
crianas, por exemplo, melhor fixar o valor da meta glicmica de 100 a 120 mg/dl durante o dia e de 150 mg/dl antes de
deitar, e, a partir da, calcular a correo. Ajustes na teraputica podem ser feitos em situaes especiais, tanto nas taxas basais quanto na relao dos bolus em diferentes situaes, como
exerccio, doena, menstruao e estresse.

Diretrizes SBD 2015-2016 - CAP 08.indd 42

Pacientes que estiverem com dificuldades para manter esquemas de mltiplas aplicaes ao dia ou que, mesmo usando
esses esquemas, ainda no consigam controle adequado (D)11
Quando houver controle inadequado da glicemia ou ocorrerem grandes oscilaes glicmicas
Ocorrncia do fenmeno do alvorecer (dawn phenomenon)
com nveis de glicemia de jejum > 140 a 160 mg/dl
Ocorrncia do fenmeno do entardecer
Em casos de hipoglicemias frequentes e graves, hipoglicemia
noturna frequente ou hipoglicemia assintomtica (B)1315
Em pessoas com grandes variaes das rotinas dirias ou
com necessidade de maior flexibilidade no estilo de vida16
Cetoacidoses recorrentes
Gastroparesia
Mulheres com diabetes grvidas ou que queiram engravidar
Todas as pessoas motivadas que desejem ter autocontrole (A).17

Vantagens da terapia com bomba de


infuso de insulina
As principais vantagens da terapia com bomba de insulina so:

Eliminar a necessidade de mltiplas aplicaes de insulina


Tornar mais fcil o controle do diabetes, possibilitando
ajuste mais fino da dose de insulina a ser injetada e liberar
doses necessrias com mais exatido do que com as injees
Na maioria dos casos, podemos obter menores variaes
dos nveis de glicemia, melhorando a qualidade de vida e os
nveis de HbA1c (nvel 1)18
Reduzir significativamente os episdios de hipoglicemias
graves e assintomticas (C)17
Eliminar os efeitos imprevisveis das insulinas de ao intermediria ou prolongada

06/10/2015 09:50:00

Gerenciamento Eletrnico do Diabetes | Uso da Tecnologia para Melhor Controle Metablico do Diabetes 43

Possibilitar a prtica de exerccios sem exigir a ingesto de


grandes quantidades de carboidratos
Melhorar a qualidade de vida (nvel 2).18

A vantagem da infuso contnua de insulina subcutnea


(CSII) sobre a terapia de mltiplas doses de insulina (MDI)
, a princpio, o resultado de melhor cintica da insulina. Somente a insulina ultrarrpida usada atualmente no tratamento com CSII e seu percentual de variabilidade na absoro
menor do que a das insulinas neutral protamine Hagedorn
(NPH) e glargina, resultando em maior reprodutibilidade dos
nveis glicmicos.
Outro fator que contribui para uma absoro mais constante da insulina a utilizao de um s local de aplicao a
cada 2 a 3 dias por meio do uso de um cateter, trocado aps
este perodo de tempo, o que no ocorre quando feito o
rodzio dos locais de aplicao no esquema de MDI. Alm
disso, esse sistema elimina a maioria dos depsitos de insulina subcutnea existentes com o uso de doses maiores de
insulina NPH ou as de ao mais prolongada. O controle
glicmico noturno melhorado com as bombas de insulina,
pois minimizam o aumento da glicemia anterior ao caf da
manh (o fenmeno do alvorecer), observado em pacientes
com diabetes mellitus tipo 1 (DM1) tratados com injees de
insulina.19
Por outro lado, o uso da bomba de insulina pode levar ao
aumento de peso, desencadear cetoacidose diabtica (CAD)
por obstruo de cateter e tem custo mais elevado entre todas
as opes disponveis de insulinoterapia, alm de ser desconfortvel para alguns pacientes.

Situaes especiais e o uso de bomba de infuso


de insulina
Gravidez
O rgido controle glicmico oferece benefcios indiscutveis tanto para a gestante diabtica quanto para o feto e o recm-nascido.
Esse controle pode ser obtido com estratgias teraputicas que
utilizam mltiplas injees dirias de insulina ou bomba de insulina. Nas grvidas com diabetes, a teraputica com a bomba
de infuso de insulina possibilita a diminuio das excurses
glicmicas, principalmente as glicemias pr-prandiais, a melhora do manejo do enjoo matinal e um reequilbrio ps-parto
mais facilitado. Por outro lado, alguns estudos relatam que a
cetoacidose durante a gestao, a qual pode ocorrer durante
uma falha da bomba, por exemplo, tem consequncias que
podem ser preocupantes e deve ser avaliada na indicao da
terapia.3
Embora exista uma tendncia a julgar superior o tratamento com bomba de insulina em mulheres com diabetes durante
a gravidez em relao aos esquemas de mltiplas injees dirias, a superioridade desse tipo de tratamento no foi confirmada por outros estudos.20

Crianas e adolescentes
Nas crianas com diabetes, uma das grandes dificuldades do
tratamento seguir uma dieta fixada em horrios, quantidades e qualidade das refeies, alm das variaes da atividade

Diretrizes SBD 2015-2016 - CAP 08.indd 43

fsica que ocorrem diariamente. Esses fatores podem resultar


em grandes oscilaes glicmicas ao longo do dia. O uso do
sistema de infuso de insulina diminui as restries dietticas
e melhora o controle glicmico nessa populao, reduzindo o
risco de hipoglicemia e melhorando a qualidade de vida delas,
tornando-se uma opo teraputica importante para esse grupo de pacientes (nvel 3).18
Assim, todas as crianas com diabetes, independentemente da idade, podem ser potencialmente elegveis para a terapia
com bomba de insulina, desde que tenham pais motivados e
aceitem realizar de seis a nove testes dirios de glicemia, alm
de concordar em usar o aparelho.21,22
Em crianas, o ndice de hiperglicemias graves/cetoacidose
ocorre devido ao maior nmero de episdios de dobra de cateter com obstruo. Esse risco pode ser diminudo com a troca
de cateter de 2 em 2 dias e com monitoramento frequente.
No caso de adolescentes, algumas variveis que tornam o
tratamento mais difcil, como a no adeso, atividades variadas durante o dia e alteraes do padro de sono, so melhor
administradas com a terapia de infuso contnua de insulina.3

Fatores preditores de sucesso na terapia com


bomba de infuso de insulina
Entre os fatores preditivos de sucesso no uso de bomba de infuso de insulina, podemos citar: a seleo adequada de pacientes, a frequncia das medidas dirias de glicose no dia e a
presena de uma equipe entrosada.
Os resultados de HbA1c so to melhores quanto maior
for o nmero de medidas de glicemias no dia, alm de quanto mais vezes forem feitas correes de glicemias ao longo do
dia, j que a maioria dos pacientes que mede a glicemia capilar
cinco ou mais vezes/dia tem HbA1c mdias < 7%.23 Alm disso, embora essa teraputica possibilite uma vida sem qualquer
tipo de restries alimentares, aqueles pacientes que preferem
seguir uma dieta mais regrada, com horrios e estilo de alimentao mais normais, contando corretamente os carboidratos e ingerindo dietas com menor teor de gorduras, costumam
ter melhores resultados.
fundamental tambm, para que o resultado do tratamento com bomba de infuso de insulina seja bom, que se
meam as glicemias capilares, no mnimo 3 vezes/dia antes
das refeies. O ideal que sejam medidas 6 a 8 vezes/dia nas
pr-refeies e 2 h aps, alm da hora de deitar-se e 2 vezes/
semana, entre 3 e 4 h da manh. S assim possvel alcanar
melhor controle glicmico com menos hiperglicemia, menos
hipoglicemia assintomtica e consequente melhora da qualidade de vida.9

Complicaes resultantes do uso da bomba de


infuso de insulina
Vrios trabalhos mostram aumento das complicaes em pacientes em uso de terapia com bomba de infuso de insulina
em relao terapia com MDI e convencional, como infeco
dos locais de aplicao, cetoacidose e coma hipoglicmico.24,25
No entanto, importante salientar que muitos desses trabalhos so anteriores dcada de 1990, quando as bombas de infuso eram menos sofisticadas, com mecanismos de controle

06/10/2015 09:50:00

44 Diretrizes SBD | 2015-2016

inferiores e menor tecnologia agregada do que os aparelhos


atuais. Mesmo assim, ainda nos dias de hoje, existem complicaes no uso dessa teraputica, as quais sero descritas adiante.

Hiperglicemia | Cetoacidose
Aumentos importantes das taxas de glicemia podem ocorrer
sempre que houver interrupo do fluxo de insulina por causa do
uso das bombas de infuso de insulina ultrarrpida, resultando
em CAD, a qual pode ser prevenida se a pessoa que usa a bomba
fizer medies frequentes da glicemia e corrigir as alteraes glicmicas sempre que elas se manifestarem. A cetoacidose ocorre
com a mesma frequncia em pessoas com MDI e em pacientes
com diabetes instvel. Ademais, a frequncia de cetoacidose
igual dos pacientes em outras terapias, embora parea haver
leve vantagem a favor do uso da bomba de infuso de insulina.19
Como no rara essa ocorrncia, sobretudo no incio da
terapia, o paciente deve saber que hiperglicemias inexplicveis
e mantidas a despeito de correes so uma indicao de que
est havendo interrupo da liberao de insulina, mesmo sem
ter havido a mensagem de obstruo (no delivery) na bomba.
Por conta disso, o conjunto de infuso deve ser trocado e a insulina ultrarrpida aplicada com caneta ou seringa no mesmo
momento da substituio do conjunto.

Infeces de pele
Infeces de pele, embora raras, podem ocorrer no local da colocao do cateter em virtude da falta de cuidados na assepsia do
local de aplicao ou de limpeza das mos. Podem aparecer desde
uma pequena ferida infeccionada a grandes abscessos, dependendo da extenso da contaminao e do estado de sade do paciente.2 Geralmente, antibiticos sistmicos resolvem e com pouca
frequncia necessrio associar drenagens nesses casos.

Falha da bateria, acusada pelos sensores da bomba, no


muito frequente e pode ser facilmente resolvida.

Contraindicaes para o uso da bomba de infuso


de insulina
As nicas contraindicaes para o uso da bomba de infuso
de insulina so:

Abandono e descontinuidade do uso de bomba


de infuso de insulina
Os motivos mais comuns para abandonar a bomba de infuso de insulina so: inabilidade para us-la, falta de suporte
familiar em adolescentes, custo do tratamento ou distoro de
imagem corporal.24 Infeces de pele, problemas psiquitricos, aumento da frequncia e/ou gravidade de hipoglicemias
ou outras emergncias so algumas indicaes para descontinuidade do uso da bomba.3

Vantagens e desvantagens da utilizao de


bomba de insulina
Principais vantagens da utilizao de bomba de insulina:

Falhas das bombas

So muito raras, uma vez que elas tm inmeros mecanismos


de autocontrole e alarmes capazes de detectarem as falhas assim que ocorrem.

Hipoglicemia

Embora ocorra, menos frequente do que durante a terapia


intensiva (MDI).17 Seus riscos podem ser diminudos com
medidas regulares da glicemia, sobretudo antes das refeies,
de madrugada e antes de dirigir. Erros de dose de bolus de refeio e de correo so causas frequentes de hipoglicemias.
Pacientes com hipoglicemia assintomtica parecem beneficiar-se da teraputica com bomba de infuso, tendo menos
episdios dessa complicao aps o incio de seu uso. Alm
disso, pode-se interromper ou reduzir a infuso de insulina
durante episdios de hipoglicemia e j existem bombas que
fazem essa interrupo automaticamente conforme programao prvia e comunicao com o sensor de glicose.

Outras complicaes
Vazamento do cateter, o qual pode ser percebido pelo aumento
das taxas de glicemia, ou porque a pessoa notou que sua roupa
ficou molhada ou, ainda, por sentir o cheiro de insulina.

Diretrizes SBD 2015-2016 - CAP 08.indd 44

Pessoas com baixa capacidade de entendimento ou sem suporte familiar ou apoio de enfermagem para as determinaes do basal, bolus e troca dos conjuntos de infuso, reservatrios de insulina e baterias
Pessoas que no estejam dispostas a medir a glicemia capilar no mnimo 3 vezes/dia
Indivduos com problemas psiquitricos ou distrbios alimentares, como anorexia nervosa e bulimia.

Elimina a necessidade de vrias aplicaes de insulina durante o dia


Libera as doses necessrias com mais exatido do que as
injees
Frequentemente, melhora os nveis de HbA1c
Em geral, resulta em variaes menores na oscilao habitual dos nveis de glicemia
Torna mais fcil o controle do diabetes e possibilita um
ajuste mais fino da dose de insulina a ser injetada
Com frequncia, melhora a qualidade de vida
Reduz significativamente os episdios de hipoglicemia grave
Possibilita a prtica de exerccios sem exigir a ingesto de
grandes quantidades de carboidratos.
Principais desvantagens da utilizao de bomba de insulina:

Pode promover aumento de peso


Pode desencadear CAD se o cateter for desconectado ou
obstrudo por tempo prolongado
Custo mais elevado entre as opes disponveis de insulinoterapia
Para alguns pacientes, carregar uma bomba de insulina permanentemente pode ser desconfortvel
Requer treinamento especializado.

06/10/2015 09:50:00

Gerenciamento Eletrnico do Diabetes | Uso da Tecnologia para Melhor Controle Metablico do Diabetes 45

Aspectos emocionais e qualidade de vida


A terapia de infuso contnua com bomba de insulina proporciona ao usurio maior flexibilidade com parcial liberao da
dieta, melhora o controle com exerccio fsico e promove maior
facilidade com turnos de trabalho e viagens. Atua incisivamente
no controle metablico com menor frequncia e gravidade dos
episdios de hipoglicemia, melhor controle glicmico e menores excurses glicmicas, alm de ter benefcio sobre o controle de peso. Emocionalmente, diminui a ansiedade e aumenta
a confiana no tratamento por parte do paciente e da famlia.
Oferece ao usurio maior independncia e aceitao da doena,
alm de ter um ndice de desistncia baixo (Figuras 1 e 2).26

Monitoramento contnuo de glicose


e sensores de glicose
As medidas de glicemia capilar vm ganhando cada vez mais espao como ferramentas importantes no controle das pessoas com
diabetes, embora ainda tenham limitaes importantes, como:


Adeso do paciente
Dados incompletos com poucos valores medidos durante o
dia
Esquecimento pelo paciente e/ou familiar do dirio glicmico na consulta.

Figura 1 Paradigm.

Figura 2 ACCU-CHECK Spirit.

Diretrizes SBD 2015-2016 - CAP 08.indd 45

Devido a esses fatores, comeou-se a desenvolver sistemas


mais confortveis e precisos para a avaliao contnua de glicemia. Assim, atualmente, um grande nmero de equipamentos
foi desenvolvido e testado: desde relgios de pulso que medem a
glicose intersticial, lentes de contato capazes de mudar de cor de
acordo com os nveis de glicose da lgrima at sensores implantados e testados no tecido celular subcutneo. Nesse caminho,
muitos equipamentos foram abandonados depois dos primeiros
testes, outros foram lanados comercialmente e esquecidos aps
algum tempo e outros se firmaram como instrumentos importantes no controle das pessoas com diabetes.27
No momento, no Brasil e nas Amricas, o sistema de monitoramento contnuo de glicose (CGMS) o nico sensor em
uso. O CGMS um tipo de Holter de glicose.28 Ele mede e
registra os nveis de glicose no tecido celular subcutneo e tem
o tamanho de uma bomba de infuso de insulina. O sensor
mede a glicose no fluido intersticial (que se correlaciona bem
com a glicose plasmtica), por meio de uma pequena cnula
inserida sob a pele, semelhante ao set de infuso da bomba de
insulina.29
Ele conectado, com um pequeno cabo eltrico, a um aparelho eletrnico (monitor) que pode ser levado preso no cinto
ou dentro do bolso.
A leitura dos valores de glicose pelo sensor feita mediante uma reao eletroqumica da enzima glicose oxidase, a qual
converte a glicose intersticial em sinais eletrnicos, que so enviados continuamente por um cabo para o monitor. O monitor
capta os sinais a cada 10 segundos e registra a mdia dos sinais
a cada 5 min, totalizando 288 medidas ao dia, durante 3 dias. A
amplitude de variao das medidas de 40 mg/dl a 400 mg/dl.
As leituras no so mostradas pelo visor no decorrer dos 3
dias de uso do equipamento. Para o seu funcionamento adequado, fundamental que os usurios insiram, no mnimo,
trs medidas de glicemia capilar por dia na memria do monitor a fim de possibilitar a calibrao, alm de registrarem todas
as vezes que se alimentam, exercitam, injetam insulina e quando tm hipoglicemias em uma espcie de dirio. Os pacientes
tambm devem manter um registro de todas essas variveis
mais os horrios, a quantidade e a qualidade das refeies. Esses dados so usados para melhor avaliao dos fatores que
interferem no controle glicmico.
Aps as medidas, as informaes do paciente armazenadas
no monitor so transferidas para um computador pessoal (
feito um download) por um software. Aps o download dos
registros, as informaes ficam disponveis para anlise e interpretao por meio de grficos, relatrios estatsticos, tabelas
e relatrio geral e so analisadas pelo mdico.
As medidas apresentadas como grficos ou tabelas tornam
possveis a identificao de padres e tendncias de glicose
que ocorrem durante as 24 h do dia. O efeito das refeies nos
nveis de glicemias das aplicaes de insulina ultrarrpidas ou
rpidas, das reaes hipoglicemia e ao exerccio fsico tambm pode ser percebido, alm da hipoglicemia da madrugada
quando existente, facilitando, assim, mudanas e ajustes no
tratamento tanto dos pacientes com DM1 quanto daqueles
com DM2 e controle insatisfatrio do diabetes.
Todos os pacientes com DM1, em insulinizao intensiva
ou no, grvidas com DM, com hipoglicemias frequentes, com
DM2 e controle insatisfatrio, ou mesmo aqueles com HbA1c

06/10/2015 09:50:01

46 Diretrizes SBD | 2015-2016

normal, mas com muitos episdios de hipoglicemias, tm indicao, ao menos uma vez ao ano, de usar este instrumento
de propedutica (D).
O uso do CGMS possibilita o ajuste das glicemias das pessoas com DM, pois ajuda a melhorar o controle glicmico ao
detectar e reduzir o risco de eventos hipoglicmicos, e, assim,
contribui para o fornecimento de melhores esquemas de insulinizao intensiva, com maior ajuste do basal e dos bolus de
refeio e correo. O Quadro 2 mostra as principais indicaes reconhecidas pela Sociedade Brasileira de Diabetes (SBD)
para a realizao do MCG, com base nas recomendaes de
Klonoff (A).27

Sensores de uso pessoal e de medida em


tempo real
Apresentam-se como mais um meio de melhora no manejo do
diabetes, tanto para pacientes com DM1 quanto com DM2 e
aqueles que se encontram em esquemas de insulinizao intensiva. Vrios desses equipamentos j esto em uso. Outros
permanecem em fase final de registro e de experimento clnico.
A maioria implantada no tecido celular subcutneo (TCSC),
com a possibilidade de leituras de glicose em tempo real e de
disparar alarmes de hipoglicemia e hiperglicemias (Quadro 3).

Entre as vantagens apresentadas por esses sistemas, podemos citar: melhora nas excurses glicmicas, reduo na durao e gravidade dos episdios de hipoglicemias e melhora
do controle glicmico em pacientes com DM1 (B).30,31 Esse
sucesso est relacionado com aderncia ao uso dos sensores.29
Tais equipamentos j esto sendo usados no Brasil de maneira contnua, pela maior parte dos pacientes, ou por alguns
dias. Eles so portteis, do tamanho de uma bomba de insulina ou pouco menores. Constam de trs partes: um sensor, um
transmissor e um receptor.
O sensor introduzido no TCSC. Trata-se de um tubo pequeno, com uma agulha-guia, revestido internamente de glicose oxidase. A glicose medida tem seu valor transformado
em impulsos eltricos, que so enviados pelo transmissor por
meio de comunicao sem fio (radiofrequncia) para o monitor. necessrio calibrao do aparelho com a insero de
resultados da glicose plasmtica medida pelos pacientes em
diferentes horas do dia (em geral, no mnimo trs e preferencialmente antes das refeies). O monitor mostra em seu visor
as medidas em tempo real.
O Enlite, da Medtronic MiniMed, um novo sensor utilizado para o sistema de monitoramento contnuo. Uma das
novidades no mbito do monitoramento, ele mais fino e curto (8,75 mm, com uma agulha de introduo de 10,5 mm) e

Quadro 2 Principais indicaes reconhecidas pela SBD para o monitoramento contnuo da glicose (MCG).
A indicao mais importante do MCG facilitar os ajustes na conduta teraputica, com o objetivo de melhorar o controle glicmico.
Os referidos ajustes incluem:
Substituio da insulina rpida pelo anlogo de insulina ultrarrpida ou adio de aplicaes adicionais de insulina de ao rpida
ou de anlogo de insulina de ao ultrarrpida
Troca da insulina NPH por um anlogo de insulina de longa durao ou incluso de aplicaes adicionais de insulina NPH
Ajustes de doses de insulinas basal e prandial
Alteraes na composio de carboidratos da dieta
Modificaes nas metas desejveis para glicemia pr ou ps-prandial
Quantificao da resposta a um agente antidiabtico
Avaliao do impacto de modificaes do estilo de vida sobre o controle glicmico
Monitoramento das condies nas quais um controle glicmico intensivo desejado (diabetes gestacional, diabetes em crianas e
pacientes em UTI)
Diagnstico e preveno das hipoglicemias assintomtica e noturna
Diagnstico e preveno da hipoglicemia ps-prandial

Quadro 3 Caractersticas dos sensores de tempo real.


Guardian
Paradigm 722
com MiniLink

Navigator
(Figura 3)

Dexcom
(Figura 4)

rea de alcance (wireless)

1,8 m

3m

1,8 m

Alarmes

Sim

Sim

No

Setas de tendncias

Sim

Sim

No

Resistente gua

Sim (90 cm por 30 min)*

Sim (90 cm por 30 min)

No

Nmero mnimo de calibraes/dia

Duas vezes/dia

Uma vez/dia

Duas vezes/dia

Frequncia de medida de glicose

A cada 5 min

A cada 1 min

A cada 5 min

*Bomba no resistente gua.

Diretrizes SBD 2015-2016 - CAP 08.indd 46

06/10/2015 09:50:01

Gerenciamento Eletrnico do Diabetes | Uso da Tecnologia para Melhor Controle Metablico do Diabetes 47

Figura 3 Navigator.

Figura 4 Conjunto Dexcom com aplicador.

introduzido em um ngulo de 90 com a pele. Essa nova gerao


de sensores pode ser calibrada a qualquer momento, mesmo
quando h grandes variaes na glicemia ou quando ela se encontra em valores muito baixos ou muito altos (diferentemente dos outros sensores, que devem ser calibrados com valores
glicmicos mais estveis). Os resultados do monitoramento
mostram-se mais acurados em diferentes concentraes de
glicose e taxas de variao. Ele pode ser utilizado como sensor
para Paradigm VeoTM MMT 754, Paradigm Real-Time 722 e
Guardian Real-Time da Medtronic (citados a seguir).32
O sensor funciona efetuando medidas de glicose a cada 1 a
5 min. Essas medidas so mostradas na tela do receptor, assim
como grficos dos resultados do monitoramento, dependendo do modelo, que podem armazenar os resultados a serem
transferidos para um sistema de gerenciamento de dados via
internet.29,33 Por enquanto, um dos equipamentos em uso no
Brasil o Guardian Real-Time (Figura 5), um monitor contnuo de glicose que exibe a cada 5 min as medies da glicose
lidas do subcutneo em tempo real mediante um sensor. Ele
disponibiliza no display do monitor: grficos de 3, 6, 12 e 24 h
de monitoramento, setas de velocidade de oscilao das glicoses, alerta e disparo de um alarme em condies limtrofes,
previamente programados para cada paciente, alm do status
do monitor e do sensor.

Figura 5 Guardian Real-Time.

Diretrizes SBD 2015-2016 - CAP 08.indd 47

O outro sistema o Paradigm Real-Time 722 com MiniLink (Medtronic Comercial Ltda.) (Figura 6), que integra,
em um s equipamento, a bomba de insulina e o monitor de
glicose descrito anteriormente.31
Uma novidade anunciada recentemente e j disponvel em
outros pases o FreeStyle Libre Flash Glucose Monitoring System, apresentado como um sistema que substitui o teste convencional de glicemia capilar, mas dispe da tecnologia dos sensores de monitoramento contnuo. Para a medida da glicemia com
esse sistema, basta aproximar o monitor de um sensor redondo
de aproximadamente 35 mm de dimetro que aplicado na regio posterior do brao. Um mesmo sensor pode permanecer
no paciente por 14 dias e no so necessrias calibraes com as
medidas de glicemia capilar. Dessa maneira, a grande vantagem
apresentada pela empresa a reduo do desconforto com as
perfuraes cutneas necessrias para as medidas em glicosmetros convencionais e para a calibrao exigida pelos sistemas
de monitoramento contnuo de glicose. Alm disso, ao realizar
o escaneamento para a medida da glicose, o monitor mostra
tambm informaes sobre os nveis sanguneos de glicose nas
ltimas 8 h, caracterstica que o aproxima dos aparelhos de monitoramento contnuo de glicose. Esses escaneamentos podem
ser feitos quantas vezes o paciente quiser ao longo do dia. Uma
desvantagem seria a necessidade de realizar medies habituais
da glicemia capilar (pontas de dedo) durante perodos de rpidas variaes dos nveis de glicose sangunea, visto que o sensor
recebe dados a partir do fluido intersticial, podendo haver diferenas nas leituras.3438
Alguns equipamentos, inclusive os atualmente em uso no
Brasil e o novo sensor descrito anteriormente, mostram no
visor um grfico com as oscilaes registradas a cada 5 min,
alm de sugerir com setas apontadas para cima ou para baixo
a tendncia de queda ou subida. Essas setas, que possibilitam
saber e calcular a velocidade de mudana da variao da glicose (de 1 a 2 mg/dl/min), podem ser programadas para emitir
alarmes sonoros de hipo e hiperglicemia.
As medidas glicmicas podem ser vistas nos receptores ou
descarregadas diretamente em um computador, desde que se
tenha o software e o cabo de conexo (Dexcom) (Figura 4), ou
observadas nos aparelhos receptores e armazenadas na internet
para, posteriormente, serem examinadas pela equipe de sade.
Isto possvel quando o paciente ou um membro da equipe
de sade faz um upload dos dados armazenados no receptor

Figura 6 Paradigm Real-Time 722 com Minilink.

06/10/2015 09:50:01

48 Diretrizes SBD | 2015-2016

mediante um cabo ou espcie de pen drive especial que se


conecta ao computador (Guardian e Paradigm 722 com
ComLink). O descarregamento destes dados feito na home
page do fabricante, que depois pode ser acessada pelo paciente,
seu mdico ou pela equipe de sade, desde que seja usada a senha autorizada pelo paciente.
O software de leitura e anlise de dados de sistemas de monitoramento contnuo chamado Ambulatory Glucose Profile
(AGP) em portugus: perfil de glicose ambulatorial um
sistema criado por Mazze et al.34 e mais profundamente desenvolvido pelo International Diabetes Center (IDC), o qual faz a
leitura de qualquer aparelho, independentemente do fabricante. Aps colher os dados, o sistema faz uma anlise estatstica
e fornece relatrios que buscam mostrar de maneira mais homognea e de fcil compreenso os perfis de variao glicmica do paciente. O objetivo do produto padronizar a forma de
anlise dos dados provenientes de sistemas de monitoramento
contnuo e criar um formato universal, que facilite a interpretao pelos mdicos e a sua utilizao em benefcio do paciente,
guiando melhorias no tratamento insulnico. O novo sistema
de monitoramento que est sendo desenvolvido pela empresa
Abbott, FreeStyle Libre, oferece como outra novidade o uso do
AGP como software para leitura dos dados, dando um passo
no sentido a otimizar o uso das informaes fornecidas pelos
sensores e iniciando essa nova forma de compilao de dados
universal, provvel tendncia para os monitores futuros.3438

Outros sistemas e ferramentas | Softwares,


acessos por telemetria e aplicativos de celulares
Alm dos equipamentos j citados, alguns sistemas que utilizam telefones celulares ou glicosmetros acoplados a transmissores tambm esto entrando no mercado brasileiro e prometem auxiliar o controle do diabetes, ao enviarem os dados
obtidos de glicemia e de outros registros feitos pelo paciente
via celular, internet ou por telemetria.
GlicOnLine um desses programas j disponveis e que
pode auxiliar o paciente, seus familiares e cuidadores e os profissionais da sade a manejarem melhor o diabetes, pois possibilita, por meio de um software especialmente desenvolvido e
utilizado por telefone celular, orientar o paciente com relao
dose de insulina tipo bolus adequada para a quantidade de carboidrato que est sendo ingerida e a glicemia do momento.39
A utilizao deste sistema s possvel aps a prescrio
eletrnica do paciente pelo seu mdico, que dever inserir no
sistema, via internet, os parmetros a serem empregados para
o clculo da dose de insulina a ser administrada para cobrir a
refeio e corrigir a glicemia. O uso do sistema tambm faz com
que os pacientes no tenham a necessidade de registrar diariamente as suas glicemias capilares, a quantidade de carboidratos
ingeridos e as doses de insulina aplicadas, visto que os dados
ficam armazenados no servidor e podem ser acessados a qualquer momento. Esse sistema foi desenvolvido por um grupo
com larga experincia em tratamento intensivo de pessoas com
diabetes e j foi testado no Hospital das Clnicas de So Paulo.
Outro sistema (este j comercial) que tambm promete facilitar o gerenciamento do diabetes por meio de pgina na internet
um programa desenvolvido nos EUA chamado de Nutrihand,
que j est traduzido para o portugus e disponvel na internet.40

Diretrizes SBD 2015-2016 - CAP 08.indd 48

Sistemas de gerenciamento do controle glicmico de grande nmero de pacientes, mediante o envio das medidas de
glicemia capilar obtidas por glicosmetros por telemetria para
centros regionais com softwares aplicados, possibilitam gerenciar o controle glicmico de um grande nmero de pacientes.
Um desses sistemas, concebido e utilizado no Brasil, o Yara
Telemedicine System (YTS).4143
O In-Car Glucose Sensing sensor usado no carro grava
os ltimos nveis de glicose enquanto o paciente est dirigindo
e avisa sobre hipoglicemia antes que alcance nveis perigosos.
Os dispositivos BGStar e iBGStarTM utilizam uma tecnologia que garante leituras de glicemia precisas e confiveis,
sem necessitar codificao. O BGStar est tambm equipado com diversas funcionalidades, como alertas, programador de alarmes e notas para explicar os resultados. Ultracompacto, o iBGStarTM pode ser ligado a um iPhone ou iPod
touch e oferece a visualizao dos resultados dos valores da
glicose no sangue em uma tela ttil em cores. Pode tambm
ser usado separadamente para fazer uma medio da glicose
no sangue em qualquer altura. A aplicao do iBGStarTM Diabetes Manager foi especificamente concebida para tornar possvel uma gesto fcil dos dados, bem como a sua transmisso
aos profissionais da sade.44
Por fim, existem diversos aplicativos para smartphones criados com o intuito de ajudar o paciente diabtico no registro das
glicemias e controle das medicaes utilizadas, possibilitando,
por meio de alarmes, maior ateno do paciente ao tratamento.
Alguns desses aplicativos tambm confeccionam grficos para
anlise das glicemias. So exemplos destes aplicativos: Glucose
Tracker, Glucose Buddy, Glucose Charter, entre outros.45

Concluso
A terapia com bomba de infuso de insulina to segura
quanto a MDI e tem vantagens sobre esta, sobretudo em pacientes com hipoglicemias frequentes, fenmeno do alvorecer
importante e gastroparesia na gravidez, em crianas e em pacientes com DM1 e com um estilo de vida errtico. A terapia
com bomba de infuso de insulina possibilita maior probabilidade de alcanar melhor controle glicmico com menos hipoglicemia, hipoglicemias assintomticas e melhor qualidade
de vida.19,25
A segurana e a eficcia do uso da bomba de insulina so
altamente dependentes da seleo adequada do paciente, de seu
nvel de educao em diabetes, de sua adeso s recomendaes
teraputicas e do nvel tcnico e da competncia da equipe multiprofissional responsvel por seu atendimento (D).15
As bombas de infuso de insulina existentes no mercado
nacional at 2007 eram Disetronic HPlus e Medtronic 508,
produzidas respectivamente pelos maiores produtores mundiais de bombas de infuso de insulina, Roche e Medtronic, as
quais so de boa qualidade e atendem s necessidades fundamentais da teraputica intensiva com o uso de bomba de infuso de insulina. As bombas de insulina mais modernas, como
a ACCU-CHEK Spirit e ACCU-CHEK Combo (Roche) e a
Paradigm 715 e Paradigm 722 (Medtronic), utilizadas atualmente no mercado nacional, possibilitam obter melhores
resultados desta teraputica, desde que seus recursos sejam
adequadamente empregados.

06/10/2015 09:50:01

Gerenciamento Eletrnico do Diabetes | Uso da Tecnologia para Melhor Controle Metablico do Diabetes 49
Quadro 4 Recomendaes e concluses.
Recomendaes e concluses
A bomba de insulina est indicada a todos
os pacientes motivados que desejem ter
autocontrole
A segurana e a eficcia do uso da bomba
de insulina so altamente dependentes da
seleo adequada do paciente, de seu nvel
de educao em diabetes, de sua adeso s
recomendaes teraputicas e do nvel
tcnico e da competncia da equipe
multiprofissional responsvel por seu
atendimento

Grau de
recomendao

8.

9.

10.
D
11.

A bomba de insulina est indicada a


pacientes que estiverem com dificuldades
para manter esquemas de mltiplas
aplicaes ao dia ou que, mesmo usando
estes esquemas, ainda no consigam
controle adequado

A bomba de insulina est indicada a


pacientes com hipoglicemias frequentes e
graves, hipoglicemia noturna frequente ou
hipoglicemia assintomtica

O MCG est indicado em situaes que


exigem informaes detalhadas sobre as
flutuaes da glicemia, as quais somente
podero ser detectadas mediante
monitoramento eletrnico da glicose
intersticial
Os sistemas de sensores de mensurao da
glicemia melhoram as excurses
glicmicas, reduzem a durao e a
gravidade dos episdios de hipoglicemias
e contribuem para um melhor controle
glicmico em pacientes com DM1

12.
13.
14.
15.
16.
A

17.
18.

(A) Estudos experimentais e observacionais de melhor consistncia; (B)


Estudos experimentais e observacionais de menor consistncia; (C) Relatos
de casos estudos no controlados; (D) Opinio desprovida de avaliao
crtica, baseada em consenso, estudos fisiolgicos ou modelos animais.

19.
20.
21.

Referncias bibliogrficas
1. Fowler MJ. Diabetes devices. Clinical Diabetes. 2008; 26(3):130-3.
2. Minicucci WJ. Diabetes: uso de bomba de infuso contnua e
sensores de glicose. In: Lyra R, Cavalcanti N, orgs. Diabetes mellitus. Rio de Janeiro: Diagraphic Editora, 2006.
3. Pickup JC. Insulin-pump therapy for type 1 diabetes mellitus.
New Engl J Med. 2012; 366:1616-24.
4. Bode B, Weinstein R, Bell D et al. Comparison of insulin as part
with buffered regular insulin and insulin lispro in continuous
subcutaneous insulin infusion: a randomized study in type 1
diabetes. Diabetes Care. 2002; 25:439-44.
5. Agrawal P, Welsh JB, Kannard B et al. Usage and effectiveness of
the low glucose suspend feature of the Medtronic Paradigm Veo
insulin pump. J Diabetes Sci Technol. 2011 sep; 5(5):1137-41.
6. Choudhary P, Shin J, Wang Y et al. Insulin pump therapy with
automated insulin suspension in response to hypoglycemia. Diabetes Care. 2001 sept; 34.
7. Hovorka R, Nodale M, Haidar A et al. Assessing performance
of closed-loop insulin delivery systems by continuous glucose

Diretrizes SBD 2015-2016 - CAP 08.indd 49

22.
23.
24.
25.
26.

27.

monitoring: drawbacks and way forward. Diabetes Technology


& Therapeutics. 2013; 15(1).
Beck RW, Calhoun P, Kollman C. Challenges for outpatient
closed loop studies: how to assess efficacy. Diabetes Technology
& Therapeutics. 2013; 15(1).
Boland EA, Grey M, Oesterle A et al. Continuous subcutaneous
insulin infusion. A new way to lower risk of severe hypoglycemia, improve metabolic control, and enhance coping in adolescents with type 1 diabetes. Diabetes Care. 1999; 22(11):1779-84.
Bode B, Weinstein R, Bell D et al. Comparison of insulin aspart
with buffered regular insulin and insulin lispro in continuous
subcutaneous insulin infusion: A randomized study in type 1
diabetes. Diabetes Care. 2002 mar; 25(3):439-44.
ADA. Insulin infusion pump therapy. In: Klingensmith GJ, ed.
Intensive diabetes manegement. 3rd ed. American Diabetes Association. 2003. pp. 102-20.
Inzucchi SE. Diabetes facts and guidelines. Yale Diabetes Center,
2011.
Bode BW, Steed RD, Davidson PC. Reduction in severe hypoglycemia with long-term continuous subcutaneous insulin infusion
in type 1 diabetes. Diabetes Care. 1996; 19:324-7.
Hirsch IB, Farkas-Hirsch R, Creyer PE. Continuous subcutaneous insulin infusion for the treatment of diabetic patients with
hypoglycemic unawareness. Diabet Nutr Metab. 1991; 4:41.
Minicucci W, Figueiredo Alves ST, Arajo LR et al. O papel da
bomba de insulina nas estratgias de tratamento do diabetes. Posicionamento Oficial SBD 2007. Rev Bras Med. 2007; 6(suppl 6).
Weissberg-Benchell J, Antisdel-Lomaglio J, Seshadri R. Insulina pump therapy: A meta-analysis. Diabetes Care. 2003; 26(4):
1079-87.
Pickup J, Keen H. Continuous subcutaneous insulin infusion at
25 years: Evidence base for the expanding use of insulin pump
therapy in type 1 diabetes [review]. Diabetes Care. 2002; 25:593-8.
Craig ME, Twigg SM, Donaghue KC et al. National evidence
based clinical care guidelines for type 1 diabetes in children,
adolescents and adults. Canberra: Australian Government Department of Health and Ageing, 2011.
Bode BW, Tamborlane WV, Davidson PC. Insulin pump therapy in
the 21 st century: strategies for successful use in adults, adolescents
and children with diabetes [review]. Postgrad Med. 2002; 111:69-77.
Farrar D, Tuffnell DJ, West J. Continuous subcutaneous insulin
infusion versus multiple daily injections of insulin for pregnant
women with diabetes. Cochrane Database Syst Rev. 2007; 3.
Phillip M et al. Use of insulin pump therapy in the pediatric agegroup: consensus statement from the European Society for Paediatric Endocrinology, the Lawson Wilkins Pediatric Endocrine
Society and the International Society for Pediatric and Adolescent
Diabetes, endorsed by the American Diabetes Association and the
European Association for the Study of Diabetes. Diabetes Care.
2007; 30(6):1653-62.
Kaufman FR, Halvorson M, Carpenter S et al. View 2: insulin therapy in young children with diabetes. Diabetes Spectrum. 2001; 14(2).
Bode B. Insulin pump therapy. In: Lebovitz HE, ed. Therapy for
diabetes melitus and related disorders. 4th ed. American Diabetes Association, 2004. pp. 224-31.
Walsh J, Roberts R. Pumping insulin. 3th ed. San Diego, CA: Torrey Pines Press, 2000.
Minicucci WJ. Uso de bomba de infuso subcutnea de insulina
e suas indicaes. Arq Bras Endocrinol Metab. 2008; 52(2).
Pickup JC, Sutton AJ. Severe hypoglycaemia and glycaemic control
in type 1 diabetes: meta-analysis of multiple daily insulin injections
compared with continuous subcutaneous insulin infusion. Diabet
Med. 2008; 25:765.
Klonoff DC. Continuos glucose monitoring. Diabetes Care. 2005;
28:1231-9.

06/10/2015 09:50:01

50 Diretrizes SBD | 2015-2016


28. Gross TM, Mastrotrotaro JJ. Efficacy and reliability of the continuous glucose monitoring system. Diabetes Technology & Therapeutics. 2000; 2(1):S19-S26.
29. Standards of Medical Care in Diabetes. 2012. Disponvel em:
<http://care.diabetesjournals.org/content/35/Supplement_1/
S11.full.pdf+html>.
30. Garg S, Zisser H, Schwartz S et al. Improvement in glycemic excursions with a transcutaneous, real-time continuous glucose
monitor. Diabetes Care. 2006; 29(1):44-50.
31. Deiss D, Bolinder J, Riveline JP et al. Improved glycemic control in poorly controlled patients with type 1 diabetes using
real-time continuous glucose monitoring. Diabetes Care. 2006;
29(12):2730-2.
32. Timothy SB, Andrew A, Ronald B et al. 39 Accuracy and acceptability of the 6-day enlite continuous subcutaneous glucose sensor. Diabetes Technology & Therapeutics. 2014; 16(5).
33. Skyler JS. Continuous subcutaneous insulin infusion an historical perspective. Diabetes Technal & Ther. 2010; 12(S1):S5-9.
34. Mazze RS, Lucido D, Langer O et al. Ambulatory glucose profile: representation of verified self-monitored blood glucose data.
Diabetes Care. 1987; 10(1):111-7.

Diretrizes SBD 2015-2016 - CAP 08.indd 50

35. Mazze RS. An overview of continuous glucose monitoring and


the ambulatory glucose profile. Minnesota Medicine. 2011 aug.
36. Richard M, Bergenstal MD. Recommendations for standardizing glucose reporting and analysis to optimize clinical decision
making in diabetes: the ambulatory glucose profile. Journal of
Diabetes Science and Technology. 2013 mar; 7(2).
37. Stephan M. Assessing the value of the Ambulatory Glucose Profile in clinical practice. Br J Diabetes Vasc Dis. 2014; 14:148-52.
38. Stephan M, Ramiro AD, Emanuele B et al. Consensus recommendations for the use of ambulatory glucose profile in clinical
practice. Br J Diabetes Vasc Dis. 2014;14:153-7.
39. Mastrototaro J, Shin J, Marcus A et al. The accuracy and efficacy of
real-time continuous glucose monitoring sensor in patients with
type 1 diabetes. Diabetes Technology & Therapeutics. 2008; 10(5).
40. Disponvel em: <tylenavigator.com/ab_nav/>. Acesso em: 16/08/2008.
41. Disponvel em: <conline.com.br>. Acesso em: 10/08/2008.
42. Disponvel em: <trihand.com.br/>. Acesso em: 16/08/2008.
43. Disponvel em: <http:/www.yaratelemedicine.com>. Acesso em:
16/08/2008.
44. Disponvel em: <fi-aventis.com.br>. Acesso em: 28/10/2010.
45. Disponvel em: <http://www.apple.com.br>. Acesso em: 20/10/2010.

06/10/2015 09:50:02

Diabetes Mellitus Tipo 2 no Jovem


Introduo
O aumento da incidncia do diabetes mellitus tipo 2 (DM2)
entre crianas e adolescentes vem sendo observado em vrias
regies do mundo. Ainda no so conhecidos os motivos
responsveis pela ecloso da doena nessa faixa etria. Inicialmente, h duas dcadas, esses relatos referiam-se a grupos
homogneos com maior suscetibilidade doena ndios
americanos e canadenses , e h dez anos envolvendo minorias tnicas, sobretudo os americanos de origem hispnica e os
afro-americanos, alm da descrio do aumento em 20 vezes
na incidncia do DM2 na populao de adolescentes japoneses. No Japo, o DM2 em jovens j mais comum que o DM1.
O aumento da prevalncia de DM2 tem sido ainda associado ao crescimento da industrializao e desenvolvimento
socioeconmico. Dados divulgados pela Organizao Mundial da Sade (OMS) sugerem que 19% da populao diabtica
mundial residem na ndia, onde screening realizado em 126
estudantes indianos encontrou 8, 79 e 13% respectivamente
de alto, moderado e baixo risco de desenvolver a doena (B).2
A avaliao recente da incidncia e caractersticas de DM2 em
crianas canadenses verificou idade mdia ao diagnstico de
13,7 anos, sendo 8% (19 de 227) diagnosticados antes dos 10
anos. Minorias tnicas predominaram, mas 25% (57 de 227)
das crianas com DM2 eram caucasianas, sendo a prevalncia
encontrada maior que a esperada pela variabilidade regional.3
Novos resultados de DM2 em jovens europeus foram divulgados (A),4 mas sua predominncia ainda inferior da populao americana, que vem aumentando ao longo dos anos.5 Avaliao de DM1 e DM2 em jovens americanos, durante o perodo
de 2001 e 2009, apontou um aumento da ocorrncia da doena
de 30,5% (intervalo de confiana de 95% [95% IC] 17,3 a 45,1%).
Em 2001, 588 de 1,7 milho de jovens foram diagnosticados com
DM2, com uma prevalncia de 0,34 por 1.000 (95% IC 0,31 a
0,37). J em 2009, o mesmo tipo da doena havia sido constatada em 819 de 1,8 milho, o que demonstrou um predomnio de
0,46 por 1.000 (95% IC 0,43 a 0,49). Tal aumento foi observado
em ambos os sexos, em todas as faixas etrias avaliadas (10 a 19
anos), em brancos, hispnicos e negros, com nenhuma alterao
significativa na prevalncia entre asiticos, moradores das ilhas
do Pacfico e ndios americanos. Essas projees sugerem, portanto, que o nmero de DM2 ir subir de 22.820 em 2010 para
84.131 em 2050; um aumento de quatro vezes.5
No Brasil, entretanto, os estudos ainda so raros. Avaliao
de 100 adolescentes com antecedentes familiares para DM2 e
outros fatores de risco para o desenvolvimento da doena no
encontrou nenhum caso de diabetes (B).6

Diretrizes SBD 2015-2016 - CAP 09.indd 51

O aumento na predominncia da obesidade na adolescncia registrado nos ltimos anos explicaria, em grande parte, o
avano do DM2 nas populaes jovens, assim como o desenvolvimento da sndrome metablica e de doenas cardiovasculares na maturidade (C, C, B).79 Estudo realizado na regio
da Espanha no verificou DM2 em jovens caucasianos obesos,
contudo, revelou intolerncia glicose (IGT) em 9,6% e resistncia insulnica (RI) em 13,5%, havendo correlao dos dois
parmetros com a gravidade da obesidade, acantose nigricans
(AN) e risco cardiovascular,10 o que mostra o carter varivel da prevalncia. Em adolescentes com DM2, a avaliao do
efeito do diabetes e da obesidade sobre complacncia vascular
encontrou aumento da rigidez dos vasos, demonstrando que
o DM2 de incio precoce pode ser mais agressivo do ponto
de vista cardiovascular do que em adultos (A, C, B).1113 As
elevadas taxas de obesidade na infncia e na adolescncia esto relacionadas com sedentarismo crescente e mudana nos
hbitos alimentares, frequentemente associadas a dietas hipercalricas e hipergordurosas (B).14
Os possveis candidatos que ligam obesidade alterao
do metabolismo dos carboidratos seriam os cidos graxos livres aumentados, as citocinas inflamatrias e os baixos nveis
de adiponectina. A transio de tolerncia normal glicose
para a intolerncia glicose e dessa etapa para o diabetes est
associada a um aumento significativo de peso. A elevao contnua do peso tem efeito sobre os nveis glicmicos, independentemente de mudanas na sensibilidade insulnica ou na demanda da clula beta (C),15 e por essa razo que um quarto
das crianas obesas e 22% dos adolescentes obesos apresentam
intolerncia glicose (B).16
Uma das grandes preocupaes do diagnstico de DM2
no jovem que algumas comorbidades, como a nefropatia,
apresentam-se to comuns na criana quanto no adulto DM2.
Avaliao retrospectiva de dados de 48 pacientes encontrou
hipertenso arterial em 52%, microalbuminria em 35% e
esteatose heptica em 33%. Nenhum caso de retinopatia foi
diagnosticado (B).4
Esse desenvolvimento de complicaes precoces ter implicaes para o resto da vida tanto para criana quanto para o
oramento da sade pblica (A).17

Fisiopatologia
Enquanto no DM1 as caractersticas genticas ficam cada vez
mais claras, no DM2 a questo ainda obscura. H maior risco
de desenvolvimento da doena em irmos do que na populao geral (10% vs. 3%) (B).18 O DM2 clssico caracteriza-se

05/10/2015 06:44:37

52 Diretrizes SBD | 2015-2016

pela combinao de resistncia ao da insulina (RI) e


incapacidade da clula beta em manter adequada a secreo
desse hormnio (B).19 Nos jovens com DM2, assim como nos
adultos, existem comprometimento tanto da sensibilidade insulnica quanto da funo da clula beta, alm de aumento da
produo da glicose heptica. Em comparao com o grupo
de adolescentes obesos no diabticos, o prejuzo na funo
da clula beta parece ser de maior magnitude relativa sensibilidade insulnica (C).20 A relao com alguns fatores (genticos, raciais, puberdade, obesidade e peso ao nascimento)
na expresso da RI demonstrada pela hiperinsulinemia em
parentes de primeiro grau, no diabticos, de pacientes com
DM2 (fatores genticos) (C);21 pela sensibilidade insulina
30% menor em afro-americanos do que em caucasianos (fatores tnicos explicam a maior prevalncia de DM2 nos grupos
minoritrios) (C);22 pela idade mdia dos jovens ao diagnstico do DM2, de aproximadamente 13 anos, que coincide com o
perodo de maior RI relativa, no qual h diminuio de aproximadamente 30% da ao da insulina (puberdade) (C);23 por
nveis aumentados de insulina de jejum e resposta exagerada
da insulina glicose intravenosa (obesidade) (A); e24, finalmente, pelo baixo peso ao nascer, o que aumenta em sete vezes
o risco de RI na vida adulta.
Avaliao de mais de 1.000 pacientes no Chile mostrou
que crianas que haviam nascido grandes para a idade gestacional (GIG) tinham maior risco de evoluir com obesidade,
enquanto outras com antecedente familiar de DM2 apresentavam maior prevalncia de sndrome metablica (B).25 Em
So Paulo, estudo realizado com crianas e adolescentes evidenciou elevao na RI em portadores de excesso de peso com
antecedentes familiares de DM2, sugerindo que, j nessa faixa
etria, como observado no adulto, a ao da insulina pode ser
dificultada pela obesidade (C),26 condio de risco para o desenvolvimento do diabetes.
O antecedente familiar tem funo fundamental na ocorrncia do DM2 nessa faixa etria. Os indivduos afetados apresentam pelo menos um dos parentes de primeiro ou segundo
grau afetados e 65% deles, ao menos um familiar de primeiro
grau com DM2 (D).27 Observou-se que irmos com sobrepeso de jovens com DM2 tm risco quatro vezes maior de manifestar intolerncia glicose que outras crianas com sobrepeso. Isso alerta para uma abordagem preventiva especfica a ser
adotada nesse grupo de alto risco (B).28 Em estudo que avaliou aumento da incidncia de DM2 em jovens abaixo de 15
anos na Nova Zelndia, 68% (34/48) dos pacientes apresentavam ao menos um dos pais com DM2 (54% um dos pais, 14%
ambos) (B).4
Para comear a tentar explicar os resultados epidemiolgicos, foram encontrados valores mais baixos de adiponectina
em crianas obesas filhas de pais diabticos do que em crianas obesas sem antecedentes familiares de DM2 (C).29

50% so referidos ao servio especializado, devido glicosria


ou hiperglicemia em exame de rotina. Entre os pacientes,
30% apresentam poliria, polidipsia leve e emagrecimento
discreto. Algumas pacientes podem revelar histria de monilase vaginal.30
O maior estudo na rea denominado TODAY (Treatment
Options for type 2 Diabetes in Adolescents and Youth) acompanhou 704 crianas e adolescentes americanos com DM2 por 2 a
6 anos. Os primeiros dados clnicos publicados apontaram prevalncia de aproximadamente 65% de meninas, idade mdia de
14 anos, com histria familiar de DM positiva em 89,4%, 41,1%
hispnicos, 31,5% no hispnicos negros; 26,3% com presso
arterial (PA) percentil 90 e baixo nvel socioeconmico (A).31
Cerca de 33% dos pacientes podem apresentar cetonria ao
diagnstico, e 5 a 25% com possibilidades de evoluir para cetoacidose. Nesses casos, o diagnstico diferencial com DM1 pode
ser realizado durante a histria clnica ou a evoluo da doena,
medida que a necessidade diria de insulina diminui alm do
esperado, no perodo de lua de mel habitual (D).31
A obesidade, conforme exposto, apresenta-se de modo
constante no DM2 do jovem. Aproximadamente 70 a 90% dessas crianas so obesas; 38% apresentam obesidade mrbida.
A obesidade e a histria familiar parecem ter efeito aditivo no
risco de desenvolvimento da doena, uma vez que o impacto
da obesidade no risco do DM2 maior em crianas com histria familiar positiva para essa doena.31
A AN, diagnosticada em quase 90% dessas crianas, manifestao cutnea de RI que consiste em hiperpigmentao de
aspecto aveludado com espessamento das regies flexurais do
pescoo, das axilas e da regio inguinal (B).32
Distrbios lipdicos, caracterizados por aumento do colesterol total e do LDL-c, assim como dos triglicerdios e da
hipertenso arterial sistmica, tambm ocorrem nas crianas
com DM2, em uma frequncia de 6 a 15% (C).33
Sinais da sndrome dos ovrios policsticos (SOP) com
hirsutismo e distrbios menstruais associados a baixos nveis plasmticos de globulina ligadora dos hormnios sexuais
(SHBG) e predominncia do hormnio luteinizante ou alterao ultrassonogrfica esto em 26% das meninas (C).34
Finalmente, a microalbuminria pode ocorrer em 20 a
40% dos jovens DM2 nos primeiros anos aps o diagnstico
(B).35 Estudo retrospectivo recente, que avaliou 48 pacientes,
encontrou hipertenso arterial em 52% deles, 35% com microalbuminria e 33% com esteatose heptica. Nenhum caso de
retinopatia foi diagnosticado (B).4
Em crianas canadenses com DM2, 95% (206 de 216) eram
obesas, 37% (43 de 115) tinham ao menos uma comorbidade ao diagnstico e 13% (15 de 115) j apresentavam trs ou
mais comorbidades ao diagnstico. Estes resultados reforam
as recomendaes de realizar-se screening para diagnstico de
comorbidades logo ao diagnstico de DM2 no jovem.3

Quadro clnico

Diagnstico

A idade de maior incidncia do DM2 no jovem prxima dos


13 anos, guardando relao com o estdio III da classificao
de Tanner, e uma proporo de 2:1 para meninas em relao
aos meninos. As crianas com DM2 so geralmente assintomticas ou oligossintomticas por longos perodos, sendo que

Os critrios diagnsticos de DM, segundo a Associao Americana de Diabetes (ADA), so:

Diretrizes SBD 2015-2016 - CAP 09.indd 52

Hemoglobina glicada (HbA1c) 6,5% (teste realizado em


um laboratrio devidamente certificado); ou

05/10/2015 06:44:38

Diabetes Mellitus Tipo 2 no Jovem 53


Glicemia de jejum (definida como ausncia de ingesta calrica durante perodo mnimo de 8 h) 126 mg/dl (7,0
mmol/l); ou
Glicemia plasmtica no teste de tolerncia oral glicose no
tempo de 2 h 200 mg/dl (11,1 mmol/l), devendo o teste
ser realizado de acordo com recomendao da OMS, utilizando soluo de glicose contendo 75 g de anidro glicose
diluda em gua; ou
Glicose plasmtica aleatria 200 mg/dl (11,1 mmol/l)
com sintomas tpicos de hiperglicemia (poliria, polidipsia,
perda de peso).36

O diagnstico de DM2, na maioria dos pacientes, poder


ser baseado na apresentao clnica e no curso da doena. O
diagnstico de DM2 deve ser suspeito, sobretudo em pacientes
adolescentes, negros, obesos, muitas vezes sem queixas clnicas, com histria familiar positiva para a doena e apresentando hiperglicemia e/ou glicosria em exame de rotina.30
Os indivduos com maturity onset diabetes of the young
(MODY) devem ser diferenciados do DM2 no jovem. No
MODY, observa-se histria familiar proeminente de DM, envolvendo trs ou mais geraes consecutivas, o que compatvel com um padro autossmico dominante de transmisso
hereditria. O tipo mais comum de apresentao a hiperglicemia leve e assintomtica, em crianas ou adolescentes no
obesos. Alguns pacientes podem apresentar somente discretas hiperglicemias de jejum durante anos, enquanto outros
exibem graus variveis de intolerncia glicose por vrios
anos antes da ecloso do diabetes. Estima-se que as variantes
MODY correspondam a 1 a 5% de todos os tipos de DM nos
pases industrializados (B).37
Em um indivduo com diabetes de incio abrupto, deve-se
verificar se h obesidade. mais provvel que o paciente com
incio agudo, no obeso e no pertencente a grupo tnico de
risco seja diabtico tipo 1. Quando ele for obeso, outros testes
podem ser necessrios, como a determinao do peptdio C
de jejum e, ocasionalmente, a dosagem de autoanticorpos contra as clulas beta. Nos jovens com DM2, geralmente no so
observados os autoanticorpos e os nveis de peptdio C esto
comumente normais ou elevados, apesar de no to elevados
como esperado para o grau de hiperglicemia. A dosagem do
peptdio C deve ser efetuada aps a compensao clnica, com
glicemia de jejum prxima de 120 mg/dl, para afastar-se um
possvel efeito glicotxico sobre a clula beta.
Assim, valores do peptdio C no jejum maiores que 0,6
ng/ml (0,2 nmol/l), ou aps sobrecarga com Sustacal oral
maior que 1,5 g/ml (0,6 nmol/l), demonstram reservas de
insulina significativas (C).38 Os autoanticorpos positivos contra insulina, descarboxilase do cido glutmico (GAD) ou
tirosina-fosfatase (IA2) esto em 85 a 98% dos pacientes com
DM1 de origem autoimune. J em obesos com histria sugestiva de DM2 que desenvolveram cetoacidose ao diagnstico,
a prevalncia de autoanticorpos (anti-ilhotas-ICA, anti-IA2 e
anti-GAD 65) no mximo de 15% (C).39 No entanto, estudos
europeus encontraram pelo menos um anticorpo positivo em
36% dos adolescentes diagnosticados como DM2 (B).40 Interessantemente, no Search for Diabetes in Youth Study, a avaliao de indivduos diabticos com menos de 20 anos de idade
revelou positividade para anticorpo GAD em 66% dos DM1

Diretrizes SBD 2015-2016 - CAP 09.indd 53

e 22% dos DM2. Alm disso, um tero dos jovens com DM2
utilizava insulina e somente 22% dos com DM1 no apresentavam insulina endgena, sugerindo que uma grande frao
desses jovens parece ter diabetes de etiologia mista (A).41
A frequncia de autoanticorpos contra clula beta em crianas caucasianas saudveis de 1 a 4%, de modo que a ocorrncia
isolada de autoanticorpos no suficiente para excluir o DM2
em jovens ou afirmar o diagnstico de DM1.
O diagnstico de DM2 na infncia dever ser feito levando-se em considerao critrios clnicos, como idade e sexo
do paciente, obesidade e histria familiar positiva para DM2.
Devido alta miscigenao brasileira, no existem dados, at o
momento, para considerar a cor como fator de risco.
Aps esses critrios, os casos duvidosos, sobretudo aqueles com cetoacidose inicial, devem ser submetidos pesquisa
para avaliao da funo da clula beta pela dosagem do peptdio C e da deteco de marcadores do processo autoimune a
partir da pesquisa de autoanticorpos anti-ilhota (anti-GAD,
anti-IA2, ICA e anti-insulina).
Segundo o consenso da ADA, dever submeter-se triagem
para DM2 na infncia toda criana obesa (ndice de massa corporal [IMC] maior que o percentil 85 para idade e sexo, ou peso
maior que 120% do ideal para estatura) que apresente dois ou
mais dos fatores de risco a seguir: (1) histria familiar positiva
para DM2 em parentes de primeiro ou segundo grau; (2) grupo
tnico de risco (ndios americanos, afro-americanos, hispnicos, asiticos/habitantes de ilhas do pacfico); (3) sinais de RI
ou condies associadas RI (AN, hipertenso arterial, dislipidemia, sndrome dos ovrios policsticos [SOP]). A triagem
dever ser realizada, preferentemente, com a glicemia de jejum,
a cada 2 anos, com incio aps os 10 anos de idade (D).42
Os nveis para a glicemia de jejum, com base nos critrios atualmente adotados para o diagnstico do DM2, so os
mesmos para adultos ou crianas. Entretanto, interessante
comunicar que na classificao, em percentis, das glicemias
de jejum obtidas em um grupo de 305 crianas e adolescentes normais da grande So Paulo, apenas 5% esto entre 106
e 108 mg/dl (C).26
Ainda segundo consenso publicado pela Academia Americana de Pediatria (A),36 com a colaborao da ADA, Sociedade
de Endocrinologia Peditrica, Academia Americana de Mdicos de Famlia e Academia de Nutrio e Dieta, no intuito de
melhor guiar o tratamento de pacientes entre 10 e 18 anos de
idade com diagnstico de DM2, deve-se considerar o diagnstico de DM2 tpico neste grupo de pacientes quando apresentarem os seguintes critrios:


Sobrepeso ou obesidade (respectivamente para sexo e idade


com percentil do IMC 85 a 94 e > P95)
Forte histria familiar de DM2
Substancial capacidade residual de secreo de insulina
ao diagnstico (comprovada por concentrao elevada ou
normal de insulina e peptdio C)
Incio insidioso da doena
RI (evidncia clnica de SOP e de AN)
Excluso de existncia de diabetes autoimune (autoanticorpos tipicamente associados ao DM1 negativos). Esses
pacientes apresentam mais comumente hipertenso e dislipidemia do que pacientes portadores de DM1.

05/10/2015 06:44:38

54 Diretrizes SBD | 2015-2016

Tratamento
As metas para o tratamento do DM2 no jovem no diferem das
propostas para o DM1, como manter assintomtico, prevenir
complicaes agudas e crnicas da hiperglicemia, tentando alcanar normoglicemia, sem hipoglicemias frequentes, e sustentar um ritmo normal de crescimento e desenvolvimento, alm
do controle do peso. Entretanto, vrios so os desafios enfrentados no tratamento do jovem com DM2. A natureza insidiosa
da sndrome, o atraso na procura pela assistncia mdica e o
reconhecimento tardio pelo pediatra, ainda pouco familiarizado com a doena, esto entre os fatores considerados nesse sentido. O adolescente, quando da ecloso da doena, j tem um
padro de comportamento estabelecido em relao alimentao e atividade fsica. A baixa adeso ao tratamento decorre
da resistncia s mudanas de hbitos, somada s caractersticas
prprias da idade e, ainda, ao fato de esses indivduos no apresentarem sintomas.
A importncia do envolvimento familiar no manejo do DM2
na infncia foi demonstrada em um estudo comparando dois
grupos de crianas afro-americanas. Em um grupo, o cuidador
participou ativamente do manejo do diabetes, enquanto no outro a participao do cuidador foi aleatria. A superviso direta
da criana com DM2 teve efeito positivo no controle glicmico
(B).43 Outro estudo refora esse conceito, mediante avaliao da
capacidade dos pais em treinarem seus filhos a alimentarem-se
melhor. Nesse grupo, houve reduo significativa do IMC, apesar de no terem recebido nenhuma orientao especfica sobre
dieta ou exerccios, indicando que a obesidade peditrica um
problema do complexo familiar (C).44
O ponto fundamental do tratamento a modificao do
estilo de vida, a qual inclui modificaes dietticas e aumento
da atividade fsica. A dieta com restrio calrica adequada
idade melhora a tolerncia glicose e a sensibilidade insulnica devido ao fato de diminuir a produo heptica de glicose.
O exerccio aumenta a sensibilidade perifrica insulina por
meio da diminuio da massa gorda.
A dieta sugerida para crianas e adolescentes deve ser
equilibrada e com restrio calrica orientada para que a perda ponderal possa ocorrer de modo gradual. Estudo randomizado controlado com jovens portadores de DM2, que foram
submetidos a um programa de perda de peso, mostrou melhora do HOMA-IR, do percentual de gordura corporal e do
escore Z-IMC em 24 meses (A).45
Entretanto, devido dificuldade de se conseguirem bons resultados com dieta e exerccio, at dietas com muito baixo valor
calrico e cetognicas foram estudadas. O efeito dessas dietas por
um perodo foi avaliado em adolescentes com DM2, o qual levou
a retirada de medicaes, reduo de IMC e de HbA1c (C).46
O sucesso do tratamento com dieta e exerccio obtido
quando o paciente mantm um crescimento normal, com
controle de peso, glicemia de jejum prximo da normalidade
(> 120 mg/dl) e hemoglobina glicada perto dos seus valores
normais. Quando as metas do tratamento no so alcanadas
apenas com as mudanas de estilo de vida, a terapia farmacolgica deve ser indicada.
O tratamento medicamentoso do DM2 em crianas e adolescentes, inicialmente baseado no tratamento de adultos com
DM2, vem sendo cada vez mais alvo de estudos. Esses levanta-

Diretrizes SBD 2015-2016 - CAP 09.indd 54

mentos comeam a oferecer informaes sobre quais condutas


podem ser adotadas e quais medicamentos tm sido estudados
para uso com segurana nesta faixa etria.
Como os adolescentes com DM2 apresentam forte RI, a
primeira escolha medicamentosa recai sobre a metformina
(C).47 A metformina age pela diminuio da produo heptica de glicose, aumentando a sensibilidade do fgado insulina e a captao de glicose no msculo, sem efeito direto nas
clulas b-pancreticas. Esse medicamento tem a vantagem,
sobre as sulfonilureias, de reduzir igualmente a hemoglobina
glicada, sem os riscos de hipoglicemia, e de contribuir para a
diminuio do peso ou, pelo menos, para a sua manuteno.
Alm disso, favorece a reduo dos nveis de LDL-c e triglicerdios e contribui para a normalizao das alteraes ovulatrias em meninas com SOP. Em um estudo multicntrico,
confirmaram-se a segurana e a efetividade da metformina
no tratamento do DM2 peditrico (A).48 Os efeitos colaterais
encontrados em at 25% dos jovens foram diarreia e/ou dor
abdominal no incio do tratamento, sendo reduzidos significantemente com o tempo e a diminuio das doses de metformina. A acidose lctica uma complicao rara, porm grave,
por isso, a metformina contraindicada a pacientes com diminuio da funo renal ou heptica e hipoxia ou infeco
intensa.
Metformina tambm apresentou efeitos favorveis modestos no peso, composio corporal e homeostase glicmica em
estudo com 100 crianas obesas com RI que participaram de
um programa de reduo de peso (B).49
No entanto, h outras evidncias de que a metformina, apesar de ser efetiva para crianas com DM2, pode no ser suficiente como monoterapia de longo prazo. Em uma anlise retrospectiva, a HbA1c mostrou tendncia a aumentar aps 2 anos
de terapia e poucos pacientes mantiveram perda de peso, independentemente do regime de tratamento (C).47 Concordante
com essa opinio, estudo prolongado (5 anos) com anlise retrospectiva de 89 jovens afro-americanos e hispano-caribenhos
com DM2 revelou que 18% deles necessitaram de insulina (< 0,4
UI/kg/dia) em associao medicao oral (B).50
Outro estudo retrospectivo, com tempo mdio de tratamento de 2,4 anos, dividiu 48 pacientes em dois grupos, tratados
inicialmente com insulina ou antidiabtico oral (metformina)
e mudana de estilo de vida. Pacientes com insulina apresentaram queda importante da HbA1c nos primeiros 12 meses de
tratamento em relao ao grupo da metformina e estilo de vida
(7,1% vs. 8,1%, p < 0,05). Entretanto, aps 12 meses de tratamento, ambos os grupos mostraram aumento progressivo da
HbA1c (B).4
Um estudo que revisou dados de 1.625 pacientes com diagnstico de DM detectou 184 casos de DM2 para avaliar a variao teraputica com o passar do tempo. Foram separados
em trs grupos conforme o tratamento para avaliar a dependncia da utilizao de insulina. As caractersticas associadas
dependncia insulina no final do estudo foram insulina como
primeiro tratamento (p < 0,0001), HbA1c inicial (p < 0,0001) e
raa (p < 0,02; raa branca foi menos dependente de insulina).51
A avaliao da correlao entre hemoglobina glicada e
vrios parmetros, como ter melhor educao em diabetes,
ter uma meta glicmica, fazer download e/ou cadernos com
anotaes das glicemias, carregar pastilhas de glicose para

05/10/2015 06:44:38

Diabetes Mellitus Tipo 2 no Jovem 55

hipoglicemias, encontrou melhora na HbA1c em pacientes


com DM1, mas no em DM2. A HbA1c foi menor na coorte
com DM2 em que os pacientes tinham durao do DM < 1 ano
em relao queles com durao > 10 anos (p < 0,0001) (95%
IC 4,776 a 1,424). Pacientes com tempo de DM2 entre 5 e 10
anos apresentaram maior HbA1c 10,1 + 2,5% (95% IC 3,804
a 0,9961). A melhora no controle glicmico foi maior, quanto
maior o envolvimento dos pais ou de ambos, pais e paciente no
controle de crianas com DM1, mas no em crianas com DM2.
Portanto, DM2 na infncia parece apresentar falha da terapia
oral mais rapidamente do que o relatado em adultos.52
O grupo das tiazolidinedionas atua melhorando a sensibilidade insulnica perifrica nos msculos e no tecido adiposo,
porque age por meio da ativao do receptor ativado pelo proliferador de peroxissomos gama (PPAR-g), e poderia ser uma
opo medicamentosa nos pacientes com DM2 jovens, assim
como j o nos adultos diabticos. Atualmente, no existem
medicamentos aprovados para o tratamento de RI isolada em
jovens no diabticos. No entanto, a rosiglitazona vs. o placebo
foi avaliada por 4 meses, em um estudo duplo-cego controlado randomizado, em 21 adolescentes obesos com intolerncia
oral glicose (IOG). A restaurao da tolerncia normal glicose
(TNG) foi associada a aumento significativo nos nveis de sensibilidade insulnica (p < 0,04), sugerindo que a rosiglitazona pode
melhorar a RI e a funo das clulas b. No houve mudanas significativas no IMC (escore Z) ou outros eventos adversos (B).53
No final de 2011, foi concluda a parte clnica do maior
ensaio clnico multicntrico prospectivo e randomizado, o
TODAY Study, realizado pelo National Institutes of Health
(NIH)/Instituto Nacional de Diabetes e Doenas Digestivas e
do Fgado (NIDDK). Foram avaliados 699 jovens com DM2, divididos em trs grupos de acordo com o tratamento: (a) metformina em monoterapia (dose de 500 mg a 1.000 mg, 2 vezes/dia);
(b) metformina + rosiglitazona (rosiglitazona = 4 mg, 2 vezes/
dia) e (c) metformina associada a mudanas de estilo de vida.
As trs terapias foram comparadas quanto ao tempo de falha do
tratamento, definido como valor de hemoglobina glicada persistentemente elevado (> 8%) por um perodo maior que 6 meses ou descompensao metablica persistente. A hemoglobina
glicada foi dosada a cada 2 meses no primeiro ano do estudo, e
a cada 3 meses no perodo subsequente. Aderncia foi medida
pela contagem das plulas utilizadas em cada retorno, com meta
de ao menos 80% de aderncia.
A metformina como monoterapia alcanou controle glicmico durvel em metade dos participantes nesse estudo. A
combinao de metformina mais rosiglitazona (indisponvel no
mercado brasileiro) melhorou a durabilidade do controle glicmico, e metformina combinada com interveno no estilo de
vida no foi melhor que metformina isolada em manter o controle glicmico. Os nveis de falha no tratamento desse estudo
foram maiores que em estudos de coorte similares em adultos
tratados com metformina. Apesar da combinao de rosiglitazona com metformina ter apresentado pequeno aumento no IMC
e massa gorda no grupo, houve melhora dos ndices de falha no
tratamento, quando comparada com monoterapia com metformina. Anlise dos subgrupos quanto ao sexo, raa e grupo tnico
sugeriu que metformina mais rosiglitazona foi mais efetiva nas
meninas que nos meninos e metformina isolada, menos eficaz
nos participantes negros no hispnicos que em outros grupos

Diretrizes SBD 2015-2016 - CAP 09.indd 55

tnicos ou raciais (A);54 contudo, preocupaes atuais sobre os


resultados negativos com tiazolinedionas em adultos tm atualmente limitado a sua utilizao em pediatria (C).55
A glimepirida tambm foi avaliada em relao metformima como monoterapia em pacientes peditricos com DM2
em estudo randomizado que analisou 285 pacientes durante
perodo de 24 semanas. A concluso foi de que a glimepirida
reduz HbA1c igual metformina, porm com maior ganho de
peso (B).56
Na fase inicial, a insulina dever ser utilizada em todos os
casos com quadro clnico muito sintomtico, nos quais houve
cetoacidose e glicemias superiores a 300 mg/dl. Aps a confirmao do diagnstico de DM2, a dose de insulina deve ser
descontinuada progressivamente medida que o paciente permanea euglicmico, at a retirada completa, quando, ento, o
paciente poder manter-se com a dieta e exerccios associados
metformina, se necessrio. Essa parece ser uma conduta comum entre os mdicos, j que levantamento com 130 endocrinopediatras, realizado nos EUA e no Canad, mostrou que
48 a 50% das crianas com DM2 foram tratadas inicialmente
com insulina.57
Interessante reviso de literatura sobre medicamentos orais
utilizados em DM2 peditrico, avaliando segurana, eficcia e
farmacocintica, revela que os dados disponveis atualmente
sobre segurana e eficcia so limitados e refora a metformina como medicamento de primeira linha (A).58
Vrias so as condutas empregadas pelos mdicos nesses pacientes, como demonstrado em pesquisa com 527 endocrinopediatras sobre o manejo do DM2 em crianas. Dos 210 questionrios respondidos, conclui-se que h grande variabilidade
no controle do DM2 na infncia, e frequentemente as condutas
divergem das recomendaes da ADA. Os mdicos mais jovens
foram os que realizaram screenings mais agressivos e tiveram
condutas mais concordantes com as guidelines da ADA.59
importante finalizar com o que foi demonstrado, em
uma populao adulta americana, que a interveno na mudana do estilo de vida (dieta associada aos exerccios fsicos)
foi mais efetiva que o tratamento medicamentoso para reduzir
a incidncia de diabetes (D),60 e o mesmo foi recentemente
verificado na populao obesa peditrica (B).61
Em 2013, guideline da Academia Americana de Pediatria
(A),36 supracitada forneceu algumas recomendaes no manejo
do paciente jovem portador de DM2, resumidas no Quadro 1.

Concluso
Pode-se afirmar que, at o momento, a prevalncia do DM2 no
jovem est aumentando, mas o termo epidemia no deve ser
utilizado. No entanto, h uma epidemia de obesidade na infncia, que est associada a patologias, como hipertenso, dislipidemia e doena gordurosa do fgado, mais comumente que o
DM2. Se considerarmos os achados, quase unnimes, de que as
taxas de falha de tratamento oral nos adolescentes so mais elevadas que nos adultos, fica evidente que o ideal seria direcionar
aes (campanhas, orientao para pediatras) para preveno
de obesidade na infncia, especialmente nos grupos de risco.
Desse modo, ao avaliar-se um jovem com sobrepeso, os
mdicos devem levar em considerao um quadro metablico mais amplo e considerar outras intervenes alm do peso

05/10/2015 06:44:38

56 Diretrizes SBD | 2015-2016

para diminuir os riscos das condies associadas. Entretanto,


se houver progresso para DM2, o tratamento atual preconizado com modificaes no estilo de vida e metformina.
Insulina est indicada ao diagnstico, quando for verificada
descompenso ou se HbA1c e glicemias estiverem muito elevadas, ou se ocorrer falha da teraputica com a medicao oral.
Quadro 1 Resumo das recomendaes da Academia Americana
de Pediatria para tratamento e acompanhamento de jovens
portadores de DM2.
Insulina: a introduo de tratamento com insulina deve ser
assegurada em crianas e adolescentes com DM2 que tenham
cetose ou cetoacidose diabtica, em pacientes nos quais a
distino entre DM1 e DM2 no for evidente e sempre que o
paciente apresente, em coleta aleatria de glicose plasmtica
ou venosa, valor 250 mg/dl ou HbA1c > 9%
Metformina: a metformina deve ser o medicamento de
primeira escolha para jovens e adolescentes e, em todas as
outras situaes, no momento do diagnstico e durante o
tratamento, sendo sempre associada a programa de
modificao de estilo de vida, incluindo orientao nutricional
e de atividade fsica
Hemoglobina glicada: o monitoramento com coleta de
HbA1c deve ser realizado a cada 3 meses. Caso as metas de
glicemia capilar e concentrao de HbA1c (< 7%) no sejam
obtidas, recomenda-se a intensificao do tratamento, por
meio do aumento do nmero de controles de glicemia capilar
e ajuste de dose e tipo de medicao, no intuito de normalizar
as concentraes de glicose sangunea
Glicemia capilar: a realizao de glicemia capilar deve ser
aconselhada em pacientes que utilizem insulina ou outras
medicaes com risco de hipoglicemia; estejam iniciando ou
modificando o regime de tratamento; no tenham alcanado
as metas ou apresentem intercorrncia de sade (doenas
febris ou que afastem o paciente da rotina normal diria)
Orientao nutricional: sugerir, na orientao da dieta e
nutrio de crianas com DM2, seja no momento do
diagnstico ou durante o tratamento, que se utilizem as
recomendaes do consenso da Academia de Nutrio e
Diettica Pediatric Weight Management Evidence-Based
Nutrition Practice Guidelines61
Atividade fsica: crianas e adolescentes portadores de DM2
devem ser incentivados pelo mdico a realizar atividade fsica
de moderada a intensa, durante no mnimo 60 min
diariamente. recomendado tambm que o tempo de tela
no acadmica (televiso, videogame etc.) seja limitado a, no
mximo, 2 h/dia

Referncias bibliogrficas
1. Pinhas-Hamel O, Zeitler P. The global spread of type 2 diabetes
mellitus in children and adolescents. J Pediatr. 2005; 146:693-700.
2. Pranita A, Phadke AV, Kharche JS et al. Screening of young adults
for future risk of type 2 diabetes mellitus a big concern for society & nation. Journal of Clinical and Diagnostic Research. 2012
nov; 6(9):1610-11.
3. Amed S, Dean HJ, Panagiotopoulos C et al. A prospective national
surveillance study. Type 2 diabetes, medication-induced diabetes,
and monogenic diabetes in Canadian children. Diabetes Care.
2010; 33:786-91.

Diretrizes SBD 2015-2016 - CAP 09.indd 56

4. Jefferies C, Carter P, Reed PW et al. The incidence, clinical features, and treatment of type 2 diabetes in children less than 15
yr in a population-based cohort from Auckland New Zealand,
1995-2007. Pediatr Diabetes. 2012 jun; 13(4):294-300.
5. Writing Group for the SEARCH for Diabetes in Youth Study
Group. Prevalence of type 1 and 2 diabetes among children and adolescents from 2001 to 2009. JAMA. 2014 may 7; 311(17):1778-86.
6. Silva RCQ, Miranda WL, Chacra AR et al. Metabolic syndrome
and insulin resistance in normal glucose tolerance Brazilian adolescents with family history of type 2 diabetes. Diabetes Care.
2005; 28:716-8.
7. Goran MI, Davis J, Kelly L et al. Low prevalence of pediatric type
2 diabetes. Wheres the epidemic? J Pediatr. 2008; 152:753-5.
8. Gortmaker SL, Dietz WH, Sobol AM et al. Increasing pediatric
obesity in the United States. Am J Dis Child. 1987; 141:535-40.
9. Chinn S, Rona RJ. Prevalence and trends in overweight and obesity in three cross sectional studies of British children 1974-1994.
BMJ. 2001; 322:24-6.
10. Aguayo A, Vela A, Aniel-Quiroga A et al. Absence of diabetes
mellitus type 2 in obese children and adolescents in the north of
Spain. J Pediatr Endocr Met. 2013; 26(1-2):25-9.
11. Srinivasan SR, Bao W, Wattigney WA et al. Adolescent overweight is associated with adult overweight and related multiple
cardiovascular risk factors: the Bolgalusa Heart Study. Metabolism. 1996; 45:235-40.
12. Gungor N, Thompson T, Sutton-Tyrrell K et al. Early signs of
cardiovascular disease in youth with obesity and type 2 diabetes.
Diabetes Care. 2005; 28:1219-21.
13. Hillier T, Pedula LK. Complications in young adults with earlyonset type 2 diabetes. Diabetes Care. 2003; 26:2999-3005.
14. Kitagawa T, Owada M, Urakami T et al. Increased incidence of
non-insulin dependent diabetes mellitus among Japanese school
children correlates with an increased intake of animal proteins
and fat. Clin Pediatr. 1998; 37:111-5.
15. Caprio S, Hyman LD, Limb C et al. Central adiposity and its
metabolic correlates in obese adolescent girls. Am J Physiol Endocrinol Metab. 1995; 269(1 Pt 1):E118-E26.
16. Sinha R, Fisch G, Teague B et al. Prevalence of impaired glucose
tolerance among children and adolescents with marked obesity.
N Engl J Med. 2002; 346:802-10.
17. Krakoff J, Lindsay RS, Looker HC et al. Incidence of retinopathy
and nephropathy in youth-onset compared with adult-onset type
2 diabetes. Diabetes Care. 2003; 26:76-81.
18. Medici F, Hawa M, Ianari A et al. Concordance rates for Type 2
diabetes mellitus in monozygotic twins-actuarial analysis. Diabetologia. 1999; 42:146-50.
19. Zimmet P, Collins V, Dowse G et al. Hyperinsulinaemia in youth
is a predictor of type 2 (non-insulin-dependent) diabetes mellitus. Diabetologia. 1992; 35:534-41.
20. Gungor N, Bacha F, Saad R et al. Youth type 2 diabetes: insulin resistance, beta cell failure or both? Diabetes Care. 2005; 28:638-44.
21. Arslanian SA, Suprasongsin C. Differences in the vivo insulin secretion and sensitivity of healthy black versus white adolescents.
J Pediatr. 1996; 129:440-3.
22. Eriksson J, Franssila K, Eksrtrand A. Early metabolic defects in
people at increased risk for non-insulin dependent diabetes mellitus. N Engl J Med. 1989; 321:337-43.
23. Pinhas-Hamiel O, Standifort D, Hamiel D et al. The type 2 family: a setting for development and treatment of adolescent type 2
diabetes mellitus. Arch Pediatr Adolesc Med. 1999; 153:1063-7.
24. McCance DR, Pettitt DJ, Hanson RL et al. Glucose, insulin concentration and obesity in childhood and adolescence as predictors of NIDDM. Diabetologia. 1994; 37:617.
25. Eyzguire F, Bancalari R, Roman R et al. Prevalence of components
of themetabolic syndrome according to birth weigth among

05/10/2015 06:44:38

Diabetes Mellitus Tipo 2 no Jovem 57

26.

27.
28.
29.
30.
31.
32.
33.
34.
35.

36.
37.
38.
39.
40.
41.
42.
43.

overweight and obese children and adolescents. J Pediatr Endocrinol Metabolism. 2012; 25(1-2):51-6.
Cesarini PR. Influncia do antecedente familiar de diabetes mellitus tipo 1 e tipo 2 sobre o ndice de massa corprea, funo de
clula beta, sensibilidade insulina e a presena de autoanticorpos anti-GAD e IA2 em crianas e adolescentes. 2001. [Tese de
doutorado]. Universidade Federal de So Paulo, So Paulo.
Rosembloom A, Joe J, Young R et al. Emerging epidemic of type
2 diabetes in youth. Diabetes Care. 1999; 22:345-54.
Magge SN, Stettler N, Jawad AF et al. Increased prevalence of abnormal glucose tolerance among obese siblings of children with
type 2 diabetes. J Pediatr. 2009; 154:562-6.
Oh YJ, Nam HK, Rhie YJ et al. Low serum adiponect in levels in
Korean children with a family history of type 2 diabetes mellitus.
Horm Res Paediatr. 2012 jul; 3:382-7.
American Diabetes Association. Type 2 diabetes in children and
adolescents. Diabetes Care. 2000; 23:381-9.
Kenneth C et al. Characteristics of adolescents and youth with
recent-onset type 2 diabetes: the today cohort baseline. Journal
of Clinical End and Metabolism. 2011 jan; 96(1):159-67.
Stuart CA, Gilkison R, Smith MM et al. Acanthosisnigrigans as
a risk factor for non-insulin dependent diabetes mellitus. Clin
Pediatr. 1998; 37:73-80.
Ehtisham S, Barett TG, Shaw NJ. Type 2 diabetes mellitus in UK
children: an emerging problem. Diabet Med. 2000; 17:867-71.
Shield JPH, Lynn R, Wan KC et al. Management and 1 year outcome for UK children with type 2 diabetes. Arch Dis Child. 2009;
94:206-9.
Pavkov ME, Bennett PH, Nelson RG et al. Effect of youth-onset
type 2 diabetes mellitus on incidence of end-stage renal disease
and mortality in young and middle-aged Pima Indians. JAMA.
2006; 296:421-6.
Copeland KC, Silverstein J, Moore KR et al. Management of
newly diagnosed type 2 diabetes mellitus (T2DM) in children
and adolescents. Pediatrics. 2013; 131(2):364-82.
Fajans SS, Bell GI, Polnsky KS. Mechanisms of disease: molecular mechanisms and clinical pathophysiology of maturity-onset
diabetes of the young. N Engl J Med. 2001; 345:971-80.
Katzeff H, Savage P, Barclay-White B et al. C-peptide measurement
in the differentiation of type 1 (insulin-dependent) and type 2 (noninsulin-dependent) diabetes mellitus. Diabetologia. 1985; 28:264-8.
Libman I, Pietropaolo M, Trucco M et al. Islet cell autoimmunity
in white and black children and adolescents with IDDM. Diabetes Care. 1998; 21:1824-7.
Reinehr T, Schober E, Wiegand S et al. DPV-Wiss Study Group.
Beta-cell autoantibodies in children with type 2 diabetes mellitus:
subgroup or misclassification? Arch Dis Child. 2006; 91:473-7.
Dabelea D, Bell RA, DAgostino RB Jr et al. Writing Group for
the SEARCH for Diabetes in Youth Study Group. Incidence of
diabetes in youth in the United States. JAMA. 2007; 297:2716-24.
Castells S. Management of hyperglycemia in minority children
with type 2 diabetes mellitus. J Pediatr Endocrinol Metabol.
2002; 15(suppl 1):531-50.
Bradshaw B. The role of the family in managing therapy in minority children with T2DM diabetes mellitus. J Pediatr Endocrinol Metab. 2002; 15:547-51.

Diretrizes SBD 2015-2016 - CAP 09.indd 57

44. Brotman LM, Dawson-Mcclures, Huang KY et al. Early childhood family intervention and long-term obesity prevention
among high-risk minority youth. Pediatrics. 2012; 129:621-8.
45. Savoye M, Nowicka P, Shaw M et al. Long-term results of an obesity program in an ethnically diverse pediatric population. Pediatrics. 2011; 1127:402-10.
46. Willi SM, Martin K, Datko FM et al. Treatment of type 2 diabetes in
childhood using a very-low-calorie diet. Diabetes care. 2004; 27:2.
47. Zuhri-Yafi MI, Brosnan PG, Hardin DS. Treatment of type 2 diabetes mellitus in children and adolescents. J Pediatr Endocrinol
Metabol. 2002; 15(suppl 1):541-6.
48. Jones KL, Arslanian S, Peterokova VA et al. Effect of metformin
in pediatric patients with type 2 diabetes: a randomized controlled trial. Diabetes Care. 2002; 25:89-94.
49. Yanovski JA, Krakoff J, Salaita CG et al. Effects of metformin on
body weight and body composition in obese insulin-resistant
children: a randomized clinical trial. Diabetes, 2011.
50. Rinstein G et al. Presentation and 5-year follow-up of T2DM
diabetes mellitus in African-American and Caribbean-Hispanic
adolescents. Horm Res. 2003; 60:121-6.
51. Barnes NS, White PC, Hutchison MR. Time to failure of oral
therapy in children with type 2 diabetes: a single center retrospective chart review. In: Barnes NS, White PC, Hutchison MR.
Pediatr Diabetes, 2012 may 31 [Epub ahead of print].
52. Rodriguez LM, Krishnavathana VH, Rhodes J et al. The relationship between self-management and glycemic control in a cohort
of children with type 1 and type 2 diabetes. J Diabetes Metab.
2013; 15:4 [author manuscript; available in PMC 2014 sep 23].
53. Cali AM, Pierpont BM, Taksali SE et al. Rosiglitazone improves
glucose metabolism in obese adolescents with impaired glucose
tolerance: a pilot study. Obesity. 2011; 19:94-9.
54. Zeitler P, Hirst K, Pyle L et al. TODAY Study Group. A clinical
trial to maintain glycemic control in youth with type 2 diabetes.
N Engl J Med. 2012 jun 14; 366(24):2247-56.
55. Mizokami-Stout K, Cree-Green M, Nadeau KJ. Insulin resistance
in type 2 diabetic youth. Curr Opin Endocrinol Diabetes Obes.
2012 aug; 19(4):255-62.
56. Gottschalk M et al. Glimepiride versus metformin as monotherapy in pediatric patients with type 2 diabetes: a randomized, singleblind comparative study. Diabetes Care. 2007 apr; 30(4):790-4.
57. Christensen ML, Franklin BE, Momper JD et al. Pediatric drug
development programs for type 2 diabetes: a review. J Clin Pharmacol. 2015 jul; 55(7):731-8.
5 8. Wong K et al. Pediatric endocrinologists management of children with type 2 diabetes. Diabetes Care. 2010 mar; 33(3):512-4.
59. Knowler W, Narayan K, Hanson R et al. Preventing non insulindependent diabetes. Diabetes. 1995; 44:483-8.
60. Savoye M, Shaw M, Dziura J et al. Effects of a weight management program on body composition and metabolic parameters
in overweight children: a randomized controlled trial. JAMA.
2007; 297:2697-704.
61. American Dietetic Association. Recommendations summary: pediatric weight management (PWM) using protein sparing modified fast diets for pediatric weight loss. Disponvel em: <http://
www.adaevidencelibrary.com/template.cfm?template=guide_
summary&key=416>. Accesso em: 13/08/2012.

05/10/2015 06:44:38

Sndrome Metablica em
Crianas e Adolescentes
Introduo
A prevalncia da obesidade tem aumentado entre crianas e
adolescentes, e h maior risco de doenas e associao de doenas ligadas obesidade (A).1 Algumas das causas do aumento do
nmero de crianas obesas so a disponibilidade abundante de
alimentos com alto teor calrico e o sedentarismo ligado a atividades como televiso, jogos eletrnicos e computadores. Com
o crescimento da obesidade infantil, as complicaes associadas
tornam-se mais comuns. Assim como no adulto, a obesidade
infantil leva ao aparecimento de doenas como diabetes mellitus tipo 2 (DM2), hipertenso arterial sistmica e dislipidemia,
que conferem aumento do risco de eventos cardiovasculares. O
DM2, por exemplo, tem crescido de maneira dramtica entre os
adolescentes nos ltimos 20 anos (A).2
No adulto, a associao entre obesidade e doena coronariana est bem estabelecida. Essa associao levou, em anos mais
recentes, criao do termo sndrome metablica (SM) para
definir aqueles indivduos que teriam mais chances de desenvolver eventos cardiovasculares devido a uma base fisiopatolgica comum entre os componentes da sndrome, possivelmente
orquestrada pela obesidade central. De qualquer modo, independentemente da terminologia usada, os riscos cardiovasculares so bem estabelecidos e fica cada vez mais claro que as crianas, j em tenra idade, podem comear a apresentar alteraes
metablicas preditivas de problemas mais srios futuramente.3-5
Dentre os fatores includos na SM esto a obesidade visceral, a
dislipidemia aterognica, a hipertenso e a resistncia insulina,
mas outras comorbidades (como esteato-hepatite no alcolica
e apneia obstrutiva do sono) esto comumente associadas.6-9

Critrios para a definio de sndrome


metablica em crianas e adolescentes
No estabelecimento de critrios para definir a SM em crianas
e adolescentes, um primeiro desafio que se impe a medida
da circunferncia abdominal (CA). Critrio importante que
faz parte de vrias definies de SM, apontado como importante indicativo de obesidade visceral, leva ao questionamento
de como medir a CA na criana.
H diferenas entre os estudos no que concerne medida da circunferncia abdominal. Alguns autores a definem no
ponto mdio entre o rebordo costal e o topo da crista ilaca
(D)10 (mesmo procedimento utilizado em adultos), enquanto

Diretrizes SBD 2015-2016 - CAP 10.indd 58

outros no descrevem o modo de medio em seu artigo (D),11


inferindo-se que seja semelhante ao usado pelos primeiros autores, visto que os critrios basearam-se no National Cholesterol Education Program Adult Treatment Panel III (NCEP/
ATP-III) para adultos. Outros compararam a prevalncia de
SM em crianas utilizando os critrios definidos pelo NCEP/
ATP-III e pela Organizao Mundial da Sade (OMS), preferindo usar o ponto entre a cicatriz umbilical e a crista ilaca
superior (D).12 Um estudo com meninas de 6 a 9 anos usou a
medida no ponto mdio entre a dcima costela e a crista ilaca
(D).13 de suma importncia a normatizao de uma medida
no intuito de no haver discordncia de resultados, tanto para
uso clnico como para estudos epidemiolgicos.
A classificao de SM em adultos, apesar de ainda amplamente discutida, bem estabelecida. As duas principais definies so a da OMS, criada em 1998 (D),14 e a do NCEP/
ATP-III (D),15 definida em 2001. A primeira apresenta como
obrigatria a resistncia insulina, enquanto pode estar ausente na segunda. Apesar da diferena, os estudos mostram
prevalncia semelhante em adultos ao comparar as duas classificaes (D).16 Uma nova proposta de classificao foi apresentada em 2005 pela International Diabetes Federation (IDF)
(D),17 que considera a obesidade visceral o mais importante
marcador, determinada pela medida da cintura, pela primeira
vez com propostas de limites especficos por etnia.
Ao tentar usar essas classificaes em crianas e adolescentes, observam-se resultados conflitantes. Goodman et al. (D)12
tentaram determinar a prevalncia de SM entre adolescentes
usando a definio da OMS e do NCEP/ATP-III. Foram utilizados os mesmos pontos de corte para os fatores de risco das
duas classificaes, com exceo da obesidade, que foi definida como ndice de massa corporal (IMC) percentil 95%,
de acordo com o grfico de IMC ajustado para sexo e idade
(disponvel em http://www.cdc.gov).
Dentre os 1.513 indivduos arrolados no estudo, o autor encontrou prevalncia de 4,2%, usando-se a primeira definio
(OMS), e de 8,4%, aplicando-se a segunda (NCEP/ATP-III).
Alm da enorme diferena encontrada entre os dois grupos, o
que chama a ateno uma prevalncia bem menor que a encontrada em adultos, estimada em 24% (D).16 A provvel justificativa seria a prevalncia menor de obesidade em adolescentes em comparao com adultos. possvel conjeturar que
pode no ter havido tempo suficiente para a obesidade central
deflagrar os mecanismos responsveis para o aparecimento

05/10/2015 06:45:56

Sndrome Metablica em Crianas e Adolescentes 59

dos fatores de risco associados. Assim, nas ltimas dcadas,


tm sido propostas classificaes com base em modificaes
dos critrios para adultos, no intuito de identificar crianas e
adolescentes com SM (Quadro 1).
Um dos primeiros estudos analisando a SM em crianas
foi realizado por Cook et al. em 2003 (D).10 Utilizando dados
do Third National Health and Nutrition Examination Survey
(NHANES III, 1988-1994), o autor avaliou os adolescentes de
12 a 19 anos aplicando os critrios definidos para SM, de acordo com o NCEP/ATP-III, com algumas modificaes. A primeira delas que obesidade foi definida como CA 90% para
idade e sexo. O ponto de corte da presso arterial foi extrado
de valores publicados pelo National Blood Pressure Education
Program (NBPEP) (D).19 Alm disso, os valores de referncia
para o perfil lipdico foram retirados do National Cholesterol
Education Report on Lipid Levels in Children (D).20
Os resultados mostraram prevalncia de 4,2% de SM na
amostra analisada. Quando estratificados pelo IMC, 28,7%
dos adolescentes obesos (IMC 95% por percentil para idade
e sexo) preencheram critrio para SM. Essa prevalncia no
surpreendente, se considerarmos que em torno de 7% dos
adultos entre 20 e 29 anos so afetados pela SM (D).16 Os autores, no trabalho, defendem o uso da medida de CA em vez
de outras medidas de obesidade, como o IMC, e afirmam ser a
distribuio corporal de gordura um forte indicativo de correlao com risco cardiovascular.
A mesma populao foi analisada por De Ferranti et al.
em 2004,11 mas foram usados critrios diferentes para definio de SM. Neste estudo, tambm foram utilizados os critrios
definidos pelo NCEP/ATP-III, com modificaes. O resultado mostrou prevalncia de 9,2% de indivduos com SM na
amostra e 31,2%, quando estratificado para crianas com IMC
percentil 85% para idade e sexo. O que explica essa prevalncia consideravelmente maior que a encontrada por Cook et
al. so os pontos de corte em relao CA e ao perfil lipdico.
Em relao CA, o ponto de corte utilizado foi o percentil
> 75%, em vez de 90% usado por Cook et al. Diferentes pontos
de corte tambm foram utilizados para o perfil lipdico. Isso
levou a uma definio menos restrita e ampliou o nmero de
adolescentes que se encaixavam nos critrios.
Os autores defendem os critrios utilizados por eles e
afirmam que estes esto relativamente mais prximos daqueles usados nos adultos. Exemplificando: o HDL-c de 40 mg/
dl apontado por Cook et al. representa o percentil 10 a 25%

em meninos e 10 a 15% em meninas, menor que o percentil


correspondente a 40 mg/dl de adultos. O nvel de triglicerdios de 110 mg/dl representa o percentil peditrico de 85 a
95%, tambm maior que o percentil adulto de 75 a 85%. Por
fim, o ponto de corte no percentil 90% usado para CA bem
maior que o percentil 75% usado no critrio de adultos do
NCEP/ATP-III. Portanto, no estudo de Ferranti et al., foi utilizada uma definio peditrica com base no modo particular
nos critrios adultos definidos pelo NCEP/ATP-III.
Em um estudo que envolveu 429 crianas classificadas como
obesas, Weiss et al. (D)18 analisaram indivduos de 4 a 20 anos e
encontraram o valor de 38,7% de SM no grupo definido como
obesos moderados (IMC com escore Z de 2 a 2,5) e 49,7% no
grupo definido como obesos graves (IMC com escore Z > 2,5).
Nesse estudo, foram utilizados critrios diferentes para definir a
SM, dentre eles a obesidade, que foi avaliada por meio do IMC,
em vez da CA utilizada em outros estudos. Os autores defendem
o uso do IMC e dizem ser este menos sujeito a variaes decorrentes da puberdade ou raa. Alm disso, afirmam que o IMC
tem forte correlao com adiposidade visceral e que ele se correlaciona melhor com a presso arterial e com o perfil lipdico
em comparao com a medida de CA (A).21
Alguns autores sugerem que os valores de corte para lipdios devem ser especficos por etnia, pois crianas afro-americanas apresentam valores de triglicerdios mais baixos e mais
elevados de colesterol HDL, apresentando prevalncia menor
de sndrome metablica em relao s crianas caucasianas
(apesar de apresentarem taxas mais elevadas de obesidade abdominal, disglicemia e hipertenso).22
Em 2007, a IDF desenvolveu uma nova definio de SM
para crianas (Quadro 2) (D),23 na qual a populao peditrica
foi dividida em grupos de acordo com a idade, pelo fato de haver diferenas de desenvolvimento entre crianas e adolescentes de 6 a 10 anos, de 10 a 16 anos e acima de 16 anos. Crianas
menores de 6 anos foram excludas pela falta de dados com
relao a essa faixa etria.
A entidade sugere que a SM no deve ser diagnosticada
em crianas com menos de 10 anos; no entanto, a reduo
de peso deve ser fortemente recomendada para aquelas com
obesidade abdominal. Acima de 10 anos, a SM diagnosticada pela presena de obesidade abdominal associada a dois
ou mais critrios clnicos. Com exceo da medida de CA,
os pontos de corte para os outros critrios, como presso
arterial, perfil lipdico e glicemia, foram estabelecidos me-

Quadro 1 Propostas de classificao de sndrome metablica em crianas e adolescentes.


Cook et al.10

De Ferranti et al.11

Weiss et al.18

Trs ou mais dos seguintes critrios


Adiposidade: CA ou IMC

CA p 90%

CA > p 75%

IMC escore Z 2

Glicemia de jejum ou no teste


oral de tolerncia glicose
(TTGO) (mg/dl)

Glicemia de jejum 110

Glicemia de jejum 110

Glicemia no TOTG de 140 a 200

Presso arterial

p 90%

> p 90%

> p 95%

Colesterol da lipoprotena de alta 40


densidade (HDL-c) (mg/dl)
Triglicerdios (mg/dl)

110

< 50 (meninas) e < 45 (meninos) < p 5%


100

> p 95%

CA: circunferncia abdominal; IMC: ndice de massa corporal; p: percentil.

Diretrizes SBD 2015-2016 - CAP 10.indd 59

05/10/2015 06:45:56

60 Diretrizes SBD | 2015-2016


Quadro 2 Definio de sndrome metablica (SM) para crianas e adolescentes de acordo com a IDF.
6 a 9 anos

10 a 16 anos

> 16 anos

Diagnstico de SM

No estabelecido

Sim (presena de obesidade abdominal


em mais de dois critrios)

Sim (presena de obesidade


abdominal em mais de dois critrios)

Obesidade abdominal (CA)

percentil 90

percentil 90

Mesmos critrios usados em adultos

Glicemia de jejum (mg/dl)

100

Mesmos critrios usados em adultos

Presso arterial (mmHg)

Sistlica/diastlica 130 ou 85

Mesmos critrios usados em adultos

Colesterol HDL (mg/dl)

< 40

Mesmos critrios usados em adultos

Triglicerdios (mg/dl)

150

Mesmos critrios usados em adultos

diante valores fixos, sem considerar os ndices de percentil


para idade e sexo. Isso vai contra a tendncia observada nas
outras classificaes, em que os valores em termos de percentis vm sendo cada vez mais usados, haja vista as alteraes
corporais e metablicas que existem entre as diferentes faixas
etrias da adolescncia.
Apesar de se mostrar mais adequado, um dos problemas
do uso de percentis para idade e sexo, na avaliao dos critrios para SM, o ajuste do valor de corte na transio para a
fase adulta.24 No adulto, os critrios no se baseiam em distribuio de percentis, mas sim em valores fixos. Assim, enquanto na criana utilizado o ponto de corte de 90% para a
CA, no adulto, o valor fixo (102 cm para homens e 88 cm para
mulheres pelos critrios do NCEP/ATP-III) corresponderia a
um percentil entre 75 e 90% para homens e 75% para mulheres. Dessa maneira, um indivduo de 18 anos poderia ser classificado como tendo obesidade central na definio de adultos
e como no tendo se fosse usada a classificao para crianas.
Em 2014, foi realizada uma anlise de prevalncia de SM
com critrios sugeridos pelo estudo IDEFICS com 18.745
crianas com idade entre 2 e 10 anos. Foi encontrada prevalncia de 5,5% nveis maiores que os encontrados em estudos
com critrios anteriormente propostos. Os critrios utilizados
foram: CA percentil 90%, presso arterial percentil 90%,
triglicerdios percentil 90% ou colesterol HDL percentil
10% e HOMA IR percentil 90% ou glicemia de jejum percentil 90%.25

Concluso
Como concluso, as crianas e os adolescentes esto sendo vtimas da epidemia de obesidade observada atualmente. Alm
do aumento do risco de sndrome metablica persistente na
idade adulta,20 as complicaes futuras dessa situao podem
ser catastrficas caso no sejam institudas medidas de interveno preventiva. Para isso, necessrio identificar aqueles
indivduos com maior risco de desenvolver complicaes decorrentes do excesso de peso. Nesse contexto, o termo SM, usado geralmente em adultos, pode ser aplicado s faixas etrias
menores. Alguns modelos de classificao de SM em crianas
j foram apresentados e observa-se considervel divergncia
entre eles. Assim, embora uma padronizao de critrios para
a classificao de SM em crianas e adolescentes seja necessria e ainda carea de estudos e discusses, os autores sugerem
a aplicao dos critrios da IDF. So recomendadas revises
sobre o tema.26-34

Diretrizes SBD 2015-2016 - CAP 10.indd 60

Diretriz
Aplicao dos critrios da IDF (Quadro 2) para o diagnstico
de SM na infncia e adolescncia para indivduos de 10 a 16
anos de idade (D).
Quadro 3 Recomendaes e concluses.
Recomendaes e concluses

Grau de
recomendao

O aumento global da prevalncia da


obesidade em crianas e adolescentes
resulta em maior risco de desenvolvimento
de diabetes tipo 2, hipertenso arterial e
dislipidemia

Os critrios para definir a SM em crianas e


adolescentes no so especficos para essa
faixa etria

Na definio de sndrome metablica para


crianas e adolescentes pela IDF, nos
indivduos com mais de 16 anos,
utilizam-se os mesmos critrios adotados
para adultos

No h normatizao da medida da
circunferncia abdominal nessa faixa etria

O IMC teria correlao com a adiposidade


visceral e se correlacionaria melhor com a
presso arterial e com o perfil lipdico do
que a medida da circunferncia abdominal

No h normatizao dos pontos de corte


para presso arterial, HDL-c e triglicerdios
nesta faixa etria

(A) Estudos experimentais e observacionais de melhor consistncia; (B)


Estudos experimentais e observacionais de menor consistncia; (C) Relatos
de casos estudos no controlados; (D) Opinio desprovida de avaliao
crtica, com base em consenso, estudos fisiolgicos ou modelos animais.

Referncias bibliogrficas
1. DAdamo E, Santoro N, Caprio S. Metabolic syndrome in pediatrics: old concepts revised, new concepts discussed. Pediatr Clin
North Am. 2011; 58(5): 1241-55.
2. van Vliet M, Heymans MW, von Rosenstiel IA et al. Cardiometabolic risk variables in overweight and obese children: a worldwide
comparison. Cardiovasc Diabetol. 2011; 10: 106.
3. Damiani D et al. Metabolic syndrome in children and adolescents: doubts about terminology but not about cardiometabolic
risks. Arq Bras Endocrinol Metab. 2011; 55: 576-82.

05/10/2015 06:45:56

Sndrome Metablica em Crianas e Adolescentes 61


4. Nelson RA, Bremer AA. Insulin resistance and metabolic syndrome in the pediatric population. Metab Syndr Relat Disord.
2010; 8(1): 1-14.
5. Ford ES, Li C. Defining the metabolic syndrome in children and
adolescents: will the real definition please stand up? J Pediatr.
2008; 152(2): 160-4.
6. Alisi A, Cianfarani S, Manco M et al. Non-alcoholic fatty liver
disease and metabolic syndrome in adolescents: pathogenetic
role of genetic background and intrauterine environment. Ann
Med. 2012; 44(1): 29-40.
7. Pacifico L, Nobili V, Anania C et al. Pediatric nonalcoholic fatty
liver disease, metabolic syndrome and cardiovascular risk. World
J Gastroenterol. 2011; 17(26): 3082-91.
8. Sundaram SS, Zeitler P, Nadeau K. The metabolic syndrome and
nonalcoholic fatty liver disease in children. Curr Opin Pediatr.
2009; 21(4): 529-35.
9. Krner A, Kratzsch J, Gausche R et al. Metabolic syndrome in
children and adolescents-risk for sleep-disordered breathing and
obstructive sleep-apnoea syndrome? Arch Physiol Biochem. 2008;
114(4): 237-43.
10. Cook S, Weitzman M, Auinger P et al. Prevalence of a metabolic
syndrome phenotype in adolescents: findings from NHANESIII, 1988-1994. Arch Pediatr Adolesc Med. 2003; 157: 821-7.
11. De Ferranti S, Gauvreau K, Ludwig D et al. Prevalence of the
metabolic syndrome in American adolescents. Circulation. 2004;
110: 2494-7.
12. Goodman E, Daniels SR, Morrison JA et al. Contrasting prevalence of and demographic disparities in the World Health Organization and National Cholesterol Education Program Adult
Treatment Panel III definitions of metabolic syndrome among
adolescents. J Pediatr. 2004; 145: 445-51.
13. Golley RK, Magarey AM, Steinbeck KS et al. Comparison of
metabolic syndrome prevalence using six different definitions in
overweight pre-pubertal children enrolled in a weight management study. Int J Obes. 2006; 30: 853-60.
14. World Health Organization. Definition, diagnosis and classification of diabetes mellitus and its complications. Part 1: Diagnosis
and classification of diabetes mellitus, department of non communicable disease surveillance. Geneva: WHO. 1999.
15. Expert Panel on Detection, Evaluation and Treatment of High
Blood Cholesterol in Adults. Executive summary of the Third
Report of The National Cholesterol Education Program (NCEP)
Expert Panel on Detection, Evaluation And High Blood Cholesterol in Adults (Adult Treatment Panel III). JAMA. 2001; 285:
2486-97.
16. Ford ES, Giles WH. A comparison of the prevalence of the metabolic syndrome using two proposed definitions. Diabetes Care.
2003; 26: 575-81.
17. Alberti KG, Zimmet P, Shaw J. IDF Epidemiology Task Force
Consensus Group. The metabolic syndrome A new worldwide
definition. Lancet. 2005; 366: 1059-62.

Diretrizes SBD 2015-2016 - CAP 10.indd 61

18. Weiss R, Dziura J, Burgert TS et al. Obesity and the metabolic


syndrome in children and adolescents. N Engl J Med. 2004; 350:
2362-74.
19. National High Blood Pressure Education Program Working Group
no Hypertension Control in Children and Adolescents. Update on
the 1987 Task Force Report on High Blood Pressure in Children
and Adolescents: a working group report from the National High
Blood Pressure Education Program. Pediatrics. 1996; 98: 649-58.
20. Expert Panel on Detection, Evaluation and Treatment of High
Blood Cholesterol in Adults. Executive Summary of the Third Report of The National Cholesterol Education Program (NCEP) Expert Panel on Detection, Evaluation, and High Blood Cholesterol
in Adults (Adult Treatment Panel III). JAMA. 2001; 285: 2486-97.
21. Daniels SR, Khoury PR, Morrison JA. Utility of different measures of body fat distribution in children and adolescents. Am J
Epidemiol. 2000; 152: 1179-84.
22. Sumner AE. Ethnic differences in triglyceride levels and high-density lipoprotein lead to underdiagnosis of the metabolic syndrome
in black children and adults. J Pediatr. 2009; 155(3): S7.e7-11.
23. Alberti KGMM, Zimmet PZ, Shaw JE. The metabolic syndrome
in children and adolescents. Lancet. 2007; 369: 2059-61.
24. Goodman E. Pediatric metabolic syndrome: Smoke and mirrors
or true magic? J Pediatrics. 2006; 148: 149-51.
25. Ahrens W, Moreno LA, Mrild S et al. IDEFICS consortium. Metabolic syndrome in young children: definitions and results of the
IDEFICS study. Int J Obes (Lond). 2014; 38(Suppl 2): S4-14.
26. Halpern A, Mancini MC, Magalhes ME et al. Metabolic syndrome, dyslipidemia, hypertension and type 2 diabetes in youth:
from diagnosis to treatment. Diabetol Metab Syndr. 2010; 2: 55.
27. Mancini MC. Metabolic syndrome in children and adolescents
Criteria for diagnosis. Diabetol Metab Syndr. 2009; 1(1): 20.
28. Pergher RN, de Melo ME, Halpern A et al. Is a diagnosis of metabolic syndrome applicable to children? J Pediatr (Rio J). 2010;
86(2): 101-8.
29. Lee L, Sanders RA. Metabolic syndrome. Pediatr Rev. 2012; 33(10):
459-66.
30. DAdamo E, Santoro N, Caprio S. Metabolic syndrome in pediatrics: old concepts revised, new concepts discussed. Pediatr Clin
North Am. 2011; 58(5): 1241-55.
31. Biltoft CA, Muir A. The metabolic syndrome in children and adolescents: a clinicians guide. Adolesc Med State Art Rev. 2009; 20(1):
109-20.
32. Lee L, Sanders RA. Metabolic syndrome. Pediatr Rev. 2012; 33(10):
459-66.
33. Alterio A, Alisi A, Liccardo D et al. Non-alcoholic fatty liver and
metabolic syndrome in children: a vicious circle. Horm Res Paediatr. 2014; 82(5): 283-9.
34. Weber DR, Leonard MB, Shults J et al. A comparison of fat and
lean body mass index to BMI for the identification of metabolic
syndrome in children and adolescents. J Clin Endocrinol Metab.
2014; 99(9): 3208-16.

05/10/2015 06:45:56

Alvos no Controle Clnico e


Metablico de Crianas e Adolescentes
com Diabetes Mellitus Tipo 1
Introduo
O diabetes mellitus tipo 1 (DM1) a segunda doena crnica mais frequente da infncia (menos prevalente apenas que a
asma) e sua incidncia vem aumentando nas ltimas dcadas,
especialmente nas faixas etrias menores (B).1-3
O DM1 responsvel por 90% dos casos de diabetes na
infncia; no entanto, apenas 50% dos casos so diagnosticados antes dos 15 anos. Dados epidemiolgicos publicados no
Atlas de Diabetes 2013, da International Diabetes Federation
(IDF), estimam uma prevalncia de cerca de 500 mil crianas
menores de 15 anos com diabetes tipo 1 no mundo. Dentre
os pases com maior nmero de casos novos por ano, figuram
EUA (13 mil), ndia (10.900) e Brasil (5 mil).4-7
As caractersticas prprias dessa faixa etria levam a inmeros questionamentos quanto aos parmetros de tratamento, pois os objetivos devem incluir no apenas o bom controle da doena, mas um plano que possibilite crescimento
e desenvolvimento adequados, evitando sequelas e proporcionando um ambiente emocional saudvel para o amadurecimento do indivduo (D).8,9 Alm disso, necessrio levar em considerao mudanas na sensibilidade insulina
conforme a evoluo puberal e maior vulnerabilidade hipoglicemia e, possivelmente, hiperglicemia do crebro em
desenvolvimento.
Apesar da necessidade de normatizao clara, crianas
costumam ser excludas de ensaios clnicos e, at o momento,
vrias questes relacionadas com o tratamento do DM1 nessa
faixa etria carecem de evidncias claras. Assim, a maioria das
recomendaes para tratamento em crianas deriva de dados
de ensaios clnicos realizados em adultos ou de consensos de
especialistas.9-13
Neste captulo, sero abordados os alvos do controle clnico e metablico do diabetes em crianas, enquanto questes
teraputicas sero abordadas em outro captulo.

Objetivos glicmicos
O Diabetes Control and Complications Trial (DCCT) demonstrou a importncia do controle glicmico em pacientes
com DM1 e documentou a relao entre melhora no controle

Diretrizes SBD 2015-2016 - CAP 11.indd 62

glicmico e reduo no desenvolvimento de complicaes microvasculares, tornando-se um marco que definiu mudanas
nos objetivos de controle em adultos (A).14
No entanto, o DCCT no envolveu crianas, sendo o grupo
mais jovem o de adolescentes entre 13 e 17 anos de idade. O
tratamento intensivo demonstrou reduo no desenvolvimento de complicaes similar dos adultos, mas os valores de hemoglobina glicada obtidos foram mais elevados que nos adultos, refletindo a dificuldade do controle metablico nessa faixa
etria. Alm disso, houve aumento ainda maior da taxa de hipoglicemia que em adultos no grupo intensivo. Assim, a extrapolao dos dados do DCCT para crianas em idade pr-puberal
depara-se com alguns obstculos, principalmente o risco de
hipoglicemia.15,16
Previamente, acreditava-se que crianas pequenas apresentariam risco de problemas cognitivos relacionados com hipoglicemia, mas tais dados no foram confirmados. Por outro
lado, evidncias recentes sugerem que tanto a hiper quanto a
hipoglicemia alteram agudamente o funcionamento e a performance social, e que ambos podem, a longo prazo, afetar o
desenvolvimento cerebral. (B)13-17
Somando-se a esses dados, trabalhos de seguimento do
DCCT (como o EDIC) vm mostrando a importncia de um
bom controle desde o diagnstico para a preveno de complicaes precoces, visto que 5 a 7 anos de controle glicmico
ruim, mesmo durante a adolescncia, resultam em risco aumentado de doena micro e macrovascular nos 6 a 7 anos subsequentes (B).18-21
Alm disso, trabalhos recentes mostraram que o controle glicmico no primeiro ano da doena em crianas, avaliado pela hemoglobina glicada (HbA1c) de 1 ano, um bom preditor de controle a longo prazo, enfatizando a importncia de se obter bom
controle desde tal momento, mesmo em crianas pequenas.22,23
O Hvidoere Childhood Diabetes Study Group demonstrou
que determinar objetivos de HbA1c mais baixos est relacionado com a obteno destes.24
Comparando-se os resultados de hemoglobina glicada do
Prospective Diabetes Follow-up Registry (Diabetes Patienten
Verlaufsdokumenation [DPV]) e do T1D Exchange Study em
crianas < 6 anos, usando os objetivos do ISPAD e da ADA
de HbA1c, respectivamente, as crianas no T1D Exchange

05/10/2015 06:46:22

Alvos no Controle Clnico e Metablico de Crianas e Adolescentes com Diabetes Mellitus Tipo 1 63

apresentaram HbA1c mdia de 8,2 1,0 (66 11 mmol/l)


comparada com 7,4 0,9 (57 10 mmol/l) na coorte do DPV;
56% das crianas no DPV tinham HbA1c < 7,5%, enquanto
somente 22% do T1D Exchange alcanaram essa meta.25
Assim, em 2014, a ADA mudou seu posicionamento referente meta de hemoglobina glicada para menor que 7,5% em
todas as faixas etrias, corroborando a recomendao anterior
do ISPAD nas Guidelines de 2011 (Quadro 1) (D).10,26

Importante
Meta de hemoglobina glicada (ISPAD e ADA): HbA1c < 7,5%
em todas as faixas etrias peditricas.

Podem ser definidos objetivos at menores (A1c < 7%),


com base em uma avaliao de risco/benefcio. O uso de novas
modalidades teraputicas tais como anlogos de insulina de
curta e longa durao, sistemas de infuso contnua de insulina com suspenso por hipoglicemia e sensores de glicose
possibilita obter mais facilmente esses nveis sem incorrer em
um maior risco de hipoglicemias.
necessrio ajustar os objetivos individualmente, levando-se em considerao o comprometimento da famlia, a capacidade de cuidado e a percepo de hipoglicemia. As metas
podem ser aumentadas em crianas com hipoglicemias recorrentes ou assintomticas.
De acordo com ambos os consensos, os objetivos de hemoglobina glicada para adolescentes deveriam obedecer s
recomendaes para adultos, com valores menores que 7%.
No entanto, sabe-se que nessa faixa etria que os pacientes
mais se distanciam da meta. Pela extrema dificuldade em se
obterem esses nveis, sem elevar demasiadamente a incidncia
de hipoglicemia, conforme j discutido, a ADA admite o valor
de 7,5% como um objetivo mais realista nessa faixa etria (D).
Em um estudo-piloto em adolescentes com mau controle,
observou-se que a superviso da realizao de testes e a aplicao de insulina (por enfermeira escolar), em associao troca
da insulina basal por glargina, foram capazes de melhorar o
controle glicmico, com reduo da hemoglobina glicada em
1,6%, sugerindo uma possvel estratgia de interveno nesse
grupo (B).25
O automonitoramento glicmico essencial para alcanar
as metas de controle, com no mnimo trs a quatro testes por
dia, podendo ser usados at oito testes para ajustes especficos,
tais como relao insulina-carboidrato e exerccios fsicos. Alm
disso, recomendada a dosagem de hemoglobina glicada quatro a seis vezes ao ano em crianas pequenas e pelo menos trs
vezes nos maiores.27 Recomendam-se medidas ps-prandiais
quando houver disparidade entre hemoglobina glicada e controle pr-prandial (D).28,29

Hipoglicemia
No existe uma definio clara de valor para hipoglicemia. H
certo consenso na literatura de que valores entre 60 e 70 mg/dl
indicam um risco de hipoglicemia grave. Nesses nveis, j h
alteraes nos sistemas contrarregulatrios, e glicemias abaixo
desse valor associam-se a sintomas de hipoglicemia e prejuzo da
funo cerebral (A).30 Em crianas, pode-se observar deteriorao aguda da funo cerebral em valores inferiores a 60 mg/dl
(A).31 Recomendao da ADA sugere o nvel de 70 mg/dl como
definio para trabalhos de pesquisa e alvo glicmico inferior no
controle de crianas e adolescentes com diabetes (D).30
No h evidncia demonstrando qual a gravidade ou frequncia de episdios hipoglicmicos que estaria associada a
sequelas. Estas parecem ser mais relacionadas com episdios
graves (com convulso) ou repetidos, principalmente em uma
idade mais precoce. Pacientes com maior risco para comprometimento cognitivo so aqueles diagnosticados antes dos 6
anos de vida, que podem cursar com deficincias em testes
de memria verbal e visuoespacial. Em um nico estudo que
precisa ser confirmado, a performance acadmica encontra-se
comprometida em pacientes pouco tempo depois do diagnstico, com piora progressiva do desempenho, parecendo atingir
um plat na adolescncia (B).32
Alguns estudos iniciais em crianas relacionaram hipoglicemias graves com comprometimento neurocognitivo em
funes visuoespaciais. No entanto, em adultos, no houve
declnio cognitivo substancial em pacientes seguidos aps o
DCCT, apesar de uma taxa elevada de hipoglicemias, inclusive
com convulso (B).15,33
A realizao de exerccio fsico no perodo da tarde foi associada maior frequncia de hipoglicemia na noite subsequente sua realizao do que em dias sedentrios; indicando
uma clara necessidade de ajuste na teraputica aps atividade
fsica para minimizar esse risco (C).34
Crianas pequenas e seus cuidadores apresentam menor
acurcia na percepo de hipoglicemia; portanto, necessrio encorajar medidas frequentes de glicemia, especialmente
em momentos com flutuaes previstas, tais como durante a
noite, nos picos de ao de insulina, durante doenas e aps
exerccio fsico intenso (D).35,36
Outros fatores de risco para hipoglicemia, alm da idade, so:
histria prvia de hipoglicemia grave, hipoglicemias despercebidas, doses mais altas de insulina, nveis menores de hemoglobina
glicada, maior durao da doena e sexo masculino (B).31
Pacientes diabticos, especialmente crianas, devem sempre dispor de uma fonte de carboidrato de absoro rpida
para consumo imediato (A).37
A conduta diante de um paciente hipoglicmico varia em
funo da gravidade do quadro. Hipoglicemias leves (caracterizadas por fome, tremor, nervosismo, ansiedade, sudorese,

Quadro 1 Recomendaes para o tratamento em todas as faixas etrias.


Jejum ou pr-prandial (mg/dl)

Ps-prandial (mg/dl)

Dormir

Hemoglobina glicada (%)

ISPAD ideal

65 a 100

80 a 126

80 a 100

< 6,05

ISPAD timo

90 a 145

90 a 180

120 a 180

< 7,5%

ADA

90 a 130

90 a 150

< 7,5%

Diretrizes SBD 2015-2016 - CAP 11.indd 63

05/10/2015 06:46:22

64 Diretrizes SBD | 2015-2016

palidez, taquicardia, dficit de ateno e comprometimento cognitivo leve) ou assintomticas podem ser tratadas com 15 g de
carboidrato, preferencialmente glicose.32 Se no estiverem disponveis tabletes de glicose, possvel utilizar uma colher de
sopa de acar ou mel, 150 ml de suco de laranja ou 150 ml de
refrigerante comum. Nos casos moderados a graves com cefaleia, dor abdominal, agressividade, viso turva, confuso, tontura, dificuldade para falar ou midrase, deve-se oferecer imediatamente 30 g de carboidrato (acar ou glicose) por via oral (D).27
A quantidade de carboidrato necessria depende da idade
e do tamanho da criana, do tipo de insulina utilizado, da ltima aplicao e se houve exerccio fsico vigoroso. Em geral,
quando frutose oferecida, so necessrias quantidades maiores do que quando so utilizados tabletes de glicose. Alimentos gordurosos, como leite e chocolates, causam absoro mais
lenta do acar e devem ser evitados no tratamento inicial da
hipoglicemia. Aps o tratamento, necessrio reavaliar a glicemia em 10 a 15 min. Caso no haja melhora, todo processo
deve ser repetido (D).27
Se o paciente estiver inconsciente ou apresentando convulses, o tratamento extra-hospitalar de escolha o glucagon,
na dose de 0,5 mg por via subcutnea (SC), para menores de 5
anos, e 1 mg, para maiores de 5 anos, sendo possvel repeti-lo
em 10 min caso no haja resposta. O tratamento hospitalar
consiste em infuso venosa de glicose 0,3 a 0,5 mg/kg, seguida
por glicose intravenosa (IV) de manuteno (A).27,28,30,31

Objetivos nutricionais
No existem determinaes das necessidades nutricionais especficas de crianas com diabetes tipo 1. As recomendaes
atualmente propostas derivam das necessidades de crianas e
adolescentes em geral (D).32 O ISPAD recomenda que todas as
crianas e as suas famlias recebam orientao nutricional ao
diagnstico, em duas ocasies subsequentes e pelo menos anualmente, seguindo os preceitos de alimentao saudvel para
todos (Quadro 2).38 No h estudos especficos para pacientes
diabticos, mas o foco do planejamento alimentar alcanar
os objetivos glicmicos, evitando hipoglicemia. H diversas
recomendaes da Associao Americana de Diabetes (ADA)
em relao nutrio de pacientes diabticos em geral (D).39
No deve haver restrio de carboidratos em crianas com
diabetes tipo 1, para evitar efeitos deletrios no crescimento.
Em adultos, h evidncias de que a quantidade de carboidrato
ingerida em uma refeio mais importante que a fonte ou o
tipo de carboidrato na determinao da glicemia ps-prandial
e, consequentemente, na dose de insulina necessria, havendo maior satisfao e melhor controle glicmico com o uso de
dieta por contagem de carboidratos e ajuste da dose de insulina por refeio.40 Para crianas, ainda no h estudos semelhantes, mas a possibilidade de adequar o apetite ingesto
de carboidratos e dose de insulina, tornando o tratamento
mais flexvel, pode reduzir os problemas com a irregularidade
alimentar, comumente observada em pr-escolares. Estudos
recentes mostram que a preciso da contagem de carboidratos
efetuada pelos pais associa-se reduo dos nveis de hemoglobina glicada em crianas (B).41
No h evidncias de que um mtodo de contagem de carboidratos (substituio por pores, gramas, ndices ou carga

Diretrizes SBD 2015-2016 - CAP 11.indd 64

Quadro 2 Distribuio do valor energtico total (VET).


Carboidrato: 50 a 55%
Sacarose: < 10% VET
Gorduras: 30 a 35%
< 10% saturada
< 10% poli-insaturada
> 10% monoinsaturada
mega 3: 0,15 g/dia
Protena: 10 a 15%

glicmica) seja superior aos demais. Em diabticos adolescentes, o menor consumo de acar simples e a maior ingesto
de fibras na dieta, alm dos padres regulares de alimentao,
foram associados a melhor controle glicmico (C).42
necessrio realizar a adequao do plano alimentar em
funo do crescimento e desenvolvimento acompanhados basicamente por peso e altura.38 De modo semelhante, preciso
efetuar ajustes em funo do ndice de massa corporal (IMC),
com restrio calrica, caso haja evoluo para sobrepeso.43
Estudo recente avaliou a trajetria de IMC no primeiro
ano aps o diagnstico de DM1 em crianas de 2 a 18 anos.
Foi encontrado um ganho de IMC importante ao longo dos
primeiros 3 meses de tratamento, refletindo provavelmente
um retorno ao estado metablico anterior ao catabolismo.
Tal ganho ponderal foi especialmente marcante nas crianas
menores de 5 anos. Sabendo-se que a obesidade em pacientes
com DM1 est relacionada com o desenvolvimento de sndrome metablica, esse risco deve ser monitorado, com intervenes precoces para evit-lo.43

Avaliao do crescimento e
desenvolvimento
O acompanhamento do crescimento parte essencial do exame fsico peditrico. Todas as crianas devem ser medidas e
pesadas a cada consulta peridica, com os dados plotados nos
grficos de referncia adotados nos servios.44 A velocidade
de crescimento normal um timo ndice de sade global;
enquanto dficits de crescimento indicam mau controle ou
doenas associadas, tais como hipotireoidismo ou doena celaca, que devem ser rastreadas nessas situaes (D).25
A avaliao do desenvolvimento puberal importante, pois
a evoluo adequada tambm reflete o bom controle metablico. Alm disso, conforme a puberdade progride, h aumento
fisiolgico da resistncia insulnica, indicando a necessidade
de ajustes nas doses de insulina, alm de maior vigilncia devido dificuldade esperada no controle.

Screening de doenas autoimunes


O diabetes frequentemente associado a outras doenas autoimunes, tais como doena autoimune tireoidiana, doena
celaca e deficincia de vitamina B12 por gastrite autoimune.
A presena dessas doenas pode comprometer o crescimento
e o desenvolvimento e piorar o controle glicmico, por vezes
sem sintomatologia clssica (da a recomendao de rastreio
rotineiro conforme detalharemos a seguir).

05/10/2015 06:46:22

Alvos no Controle Clnico e Metablico de Crianas e Adolescentes com Diabetes Mellitus Tipo 1 65

Outras doenas menos comuns, mas que tambm ocorrem


com frequncia aumentada nos pacientes portadores de DM1,
devem ser lembradas (p. ex., doena de Addison, hepatite autoimune, dermatomiosite e miastenia gravis) e devem ser pesquisadas caso surja sintomatologia sugestiva.
As doenas tireoidianas autoimunes so as principais associadas ao DM1, em uma frequncia que varia de 17 a 30%. A presena de anticorpos tireoidianos positivos preditiva para disfuno
tireoidiana, principalmente hipotireoidismo. O rastreio ao diagnstico com dosagens dos anticorpos antiperoxidase e antitireoglobulina, seguidos por medidas a cada 1 a 2 anos de hormnio
tireoestimulante (TSH), uma recomendao razovel (E).
Doena celaca pode afetar 1 a 6% dos indivduos com
diabetes e , muitas vezes, assintomtica ou pode apresentar
sintomas como falncia de crescimento, flatulncia, hipoglicemias, constipao intestinal e dor abdominal. O screening
realizado utilizando-se medidas de antitransgutaminase IgA
e a dosagem dos nveis de IgA total, visando excluir falso-negativos por deficincia seletiva de IgA. Uma biopsia intestinal recomendada para confirmar o diagnstico. Indivduos
com sorologias altamente positivas e que sejam sintomticos
podem prescindir da mesma. Em crianas pequenas ou com
diagnsticos duvidosos, pode ser realizado teste gentico (C).
A confirmao do diagnstico e a introduo de uma dieta
isenta de glten garantem normalizao dos sintomas e melhora no controle glicmico. As recomendaes sugerem rastreio ao diagnstico e posteriormente, caso surjam sintomas,
ou a cada 3 a 5 anos, sem evidncias claras para determinar
qual a periodicidade ideal (E).10

Objetivos lipdicos
Pesquisas como Bogalusa Heart Study (BHS), dentre outras,
demonstraram que o processo de aterosclerose inicia-se na infncia e a extenso da doena relaciona-se com o nmero e a
gravidade dos fatores de risco cardiovascular encontrados.45
Diabetes um fator de risco isolado para o desenvolvimento
de doena coronariana em adultos35 e contribui tambm para
aterosclerose precoce em crianas (A).46
O estudo SEARCH, que avaliou jovens com diabetes mellitus tipo 1, indicou alta frequncia de dislipidemia nesses pacientes, com 3% dos pacientes apresentando LDL-c > 160 mg/
dl, 15% > 130 mg/dl e 48% > 100 mg/dl. No entanto, somente
1% desses pacientes recebia teraputica medicamentosa hipolipemiante, mostrando claramente um hiato entre as recomendaes clnicas mais agressivas e sua aplicao clnica (A).47
As recomendaes da Academia Americana de Pediatria
(AAP) de 2007 para crianas sugerem screening seletivo em
pacientes com risco, que consiste em histria familiar de doena cardiovascular precoce ou de dislipidemia, ou a presena
de fatores de risco como diabetes (tipo 1 ou 2), obesidade e
hipertenso (D). Na mesma poca, o United States Preventive
Services Task Force (USPSTF) concluiu no haver evidncias
suficientes para a recomendao do screening universal (C).48
Recomendaes mais recentes do Expert Panel Integrated
Guidelines for Cardiovascular Health and Risk Reduction in
Children and Adolescents foram publicadas em 2011, endossando screening universal de crianas entre 9 e 11 anos e um
segundo rastreio aps os 17 anos. As dosagens de LDL antes

Diretrizes SBD 2015-2016 - CAP 11.indd 65

da puberdade mantm um padro estvel na vida adulta. J as


dosagens realizadas durante a puberdade podem refletir nveis
menores de LDL devido influncia hormonal.
Independentemente da falta de evidncias em relao ao
screening de dislipidemia na populao peditrica em geral, h
consenso de que a populao diabtica deve ser rastreada, pois
faz parte do grupo de pacientes com pelo menos um fator de
risco cardiovascular, nos quais a avalio deve ser feita a partir dos 2 anos. O posicionamento da ADA 2003 e 2005 indica
screening para dislipidemia em crianas com diabetes tipo 1
a partir dos 2 anos de idade, repetindo-se a cada 5 anos se a
avaliao inicial for normal. Para pacientes com diabetes tipo
2, a avaliao inicial deve ser feita com o diagnstico e a cada
2 anos (D).48,50
Nveis limtrofes (LDL = 100 a 129 mg/dl) ou anormais
(LDL > 130 mg/dl) devem ser checados novamente e, caso
confirmados, recomenda-se tratamento nutricional inicial, reduzindo gorduras saturadas para < 7% das calorias dirias e
limitando a ingesto de colesterol a < 200 mg/dia. Indica-se
tratamento medicamentoso para nveis de LDL > 160 mg/dl
ou que se mantm > 130 mg/dl aps interveno nutricional
e de mudana de estilo de vida ou associado a outros fatores
de risco(D).48
A AACE recomenda farmacoterapia para crianas e adolescentes maiores de 8 anos que no respondem suficientemente a mudanas no estilo de vida, falhando em alcanar os
seguintes critrios (B): LDL-c 190 mg/dl, ou LDL-c 160
mg/dl na presena de dois ou mais fatores de risco (diabetes,
inclusive).
O posicionamento recente da American Heart Association
(AHA) insere os pacientes diabticos tipo 1 em um grupo de
alto risco para desenvolver doena cardiovascular precoce (A),
recomendando nveis de LDL colesterol inferiores a 100 mg/dl,
associados a IMC < 90%, presso arterial inferior a 90% do valor recomendado para idade e sexo e controle glicmico com
HbA1c menor que 7%. Caso esses objetivos no sejam alcanados, recomenda-se o uso de medicaes hipolipemiantes (D).48
Ensaios clnicos de curta durao demonstraram eficcia e
segurana no uso de sinvastatina, lovastatina e pravastatina em
crianas e adolescentes (A).50 Os objetivos teraputicos so LDL-c
< 100 mg/dl e HDL-c > 35 mg/dl e triglicerdios < 150 mg/dl.
Apesar das recomendaes, at o momento, no existem evidncias de desfecho cardiovascular a longo prazo para o tratamento
farmacolgico em jovens com diabetes tipo 1 e 2 (D).51,52

Objetivos pressricos
Considera-se hipertenso em crianas e adolescentes uma mdia
de presso sistlica ou diastlica maior que 95% para idade e sexo,
em trs medidas distintas, uma vez excludas outras causas.53,54
Hipertenso predispe ao desenvolvimento de aterosclerose em
crianas e adultos jovens, constituindo-se em um fator de risco
cardiovascular bem estabelecido em adultos. Crianas e adolescentes hipertensos tm mais chance de serem hipertensos na vida
adulta. Em crianas com hipertenso leve, detecta-se hipertrofia
ventricular esquerda em 40 a 45% dos pacientes.
A hipertenso arterial uma comorbidade comum do
DM, podendo contribuir tanto para leses micro quanto macrovasculares.55,56

05/10/2015 06:46:22

66 Diretrizes SBD | 2015-2016

Existem diversos ensaios clnicos randomizados demonstrando que o tratamento de hipertenso reduz o risco cardiovascular e a mortalidade. (A) Em crianas, as evidncias so
indiretas, indicando interveno para reduo de presso arterial (PA) (Quadro 3).
O tratamento inclui medidas farmacolgicas e no farmacolgicas e envolve interveno alimentar, exerccios e
controle de peso (B) (adulto).57 Se no houver eficcia em 3
a 6 meses, ser indicado tratamento farmacolgico, sendo a
classe de medicamentos de escolha a dos inibidores da enzima de converso da angiotensina (IECA) ou bloqueadores do
receptor de angiotensina. O uso dos IECA efetivo e seguro
em crianas, e estudos clnicos randomizados demonstraram
as mesmas aes de reduo de presso e proteinria encontradas em adultos (A), mas no existem estudos especficos
relativos DM (D).
Em 2004, o National High Blood Pressure Education Program Working Group (NHBPEP) reviu os objetivos pressricos para cada grupo. Em pacientes com comorbidades como
diabetes, os objetivos so PA menor que o percentil 90 para
idade, sexo e altura.58

Rastreio de complicaes microvasculares


Raramente as complicaes microvasculares surgem nos anos
pr-puberais ou antes de 5 anos de doena; no entanto, o controle glicmico estrito e o monitoramento adequado so essenciais na sua preveno.
Recomenda-se realizao de microalbuminria e determinao do clearance de creatinina como referncia inicial aps 5
anos de doena ou conforme o controle glicmico e a idade do
paciente. Feito isso, o screening deve ser realizado anualmente,
utilizando-se microalbuminria ou relao albuminria/creatinina. O tratamento com IECA deve ser institudo caso sejam
detectadas duas de trs amostras com microalbuminria > 30
mg/dl, em associao intensificao do controle glicmico e
de presso arterial.
Da mesma maneira, apesar de raramente encontrado em
crianas antes da puberdade, o screening para retinopatia
deve ser realizado aos 10 anos de idade ou aps 3 a 5 anos de

doena, com exame oftalmolgico completo aps dilatao


(B). Depois da avaliao inicial, exames rotineiros podem ser
realizados a cada 1 a 2 anos, dependendo da avaliao especfica do oftalmologista (D).
A neuropatia tambm deve ser avaliada aps 10 anos de
idade ou 5 anos de doena, com exame detalhado dos ps, incluindo palpao de pulsos, teste de reflexos, deteco de reas
de presso e calosidade, exame de propriocepo e sensibilidade com microfilamento.
A inspeo dos ps pode ser realizada a cada consulta
como meio de educao sobre a necessidade de cuidados.
Quadro 4 Recomendaes e concluses.
Grau de
recomendao

Recomendaes ou concluses
O bom controle glicmico deve ser
objetivo do tratamento em crianas e
adolescentes, pois a gnese de
complicaes micro e macrovasculares tem
incio j nessa faixa etria

Os objetivos de hemoglobina glicada


devem ser < 7,5%, mas com
individualizao

Eventos de hipoglicemia grave devem ser


evitados, pois podem levar a prejuzo
neuropsicomotor a longo prazo

Rastreio de complicaes deve ter incio


na adolescncia, aps 10 anos de idade
ou 5 anos de doena (o que ocorrer
primeiro)

Tratamento adequado das comorbidades


dislipidemia, hipertenso para reduo de
risco cardiovascular deve ser
realizado

(A) Estudos experimentais e observacionais de melhor consistncia;


(B) Estudos experimentais e observacionais de menor consistncia; (C)
Relatos de casos estudos no controlados; (D) Opinio desprovida de
avaliao crtica, baseada em consenso, estudos fisiolgicos ou modelos
animais.

Quadro 3 Percentis de presso arterial conforme altura e sexo.


Altura (cm)

Meninos
PAS p 90%

Meninos
PAS p 95%

Meninos
PAD p 90%

100

109

112

65

110

113

118

68

Meninos
PAD p 95%

Meninas
PAS p 90%

Meninas
PAS p 95%

Meninas
PAD p 90%

Meninas
PAD p 95%

70

110

113

66

70

110

112

115

68

72

120

115

120

70

112

114

118

70

74

130

117

122

72

114

118

123

72

75

140

120

124

73

118

122

126

73

76

150

125

130

74

123

125

130

74

77

160

133

138

75

126

129

134

75

78

170

140

146

77

130

133

138

76

80

180

144

151

79

134

190

143

148

81

138

Presso arterial medida em mmHg; PAS: presso arterial sistlica. PAD: presso arterial diastlica; p: percentil.
Fonte: www.nhlbi.nih.gov/health/prof/heart/hbp/hbp_ped.pdf

Diretrizes SBD 2015-2016 - CAP 11.indd 66

05/10/2015 06:46:22

Alvos no Controle Clnico e Metablico de Crianas e Adolescentes com Diabetes Mellitus Tipo 1 67

Referncias bibliogrficas
1. Sperling MA. Aspects of the etiology, prediction, and prevention
of insulin-dependent diabetes mellitus in childhood. Pediatr
Clin North Am. 1997; 44(2): 269-84.
2. DIAMOND Project Group. Incidence and trends of childhood
type 1 diabetes worldwide 1990-1999. Diabet Med. 2006; 23:
857-66.
3. Rennert OM, Francis GL. Update on the genetics and pathophysiology of type 1 diabetes mellitus. Pediatr Ann. 1999; 28(9): 570-5.
4. Patterson C, Guariguata L, Dahlquist G et al. Diabetes in the
young a global view and worldwide estimates of numbers of
children with type 1 diabetes. Diab Res Clin Pract. 2014; 103(2):
161-175.
5. Aschner P, Aguilar-Salinas C, Aguirre L et al. Diabetes in South
and Central America: An update. Diab Res Clin Prac. 2014;
103(2): 238-243.
6. Tamayo T, Rosenbauer J, Wild SH et al. Diab Res Clin Prac. 2014;
103(2): 206-217.
7. Yisahak SF, Beagley J, Hambleton IR et al. Diabetes in North
America and The Caribbean: An update. Diab Res Clin Prac.
2014; 103(2): 223-230.
8. Kaufman FR. Diabetes in children and adolescents. Areas of controversy. Med Clin North Am. 1998; 82 (4): 721-38.
9. Burt A. Type 1 diabetes in children Touching the void in research of evidence. Cochrane Collaboration, 2004.
10. American Diabetes Association. Children and adolescents. Sec.
11. In Standards of Medical Care in Diabetes 2015. Diabetes
Care. 2015; 38(Suppl. 1): S70-S75.
11. Barnea-Goraly N, Raman M, Mazaika P et al.; Diabetes Research
in Children Network (DirecNet). Alterations in white matter
structure in young children with type 1 diabetes. Diabetes Care.
2014; 37: 332-340.
12. American Diabetes Association. Diagnosis and classification of
diabetes mellitus. Diabetes Care. 2009; 32: S62-S67.
13. Craig ME, Hattersley A, Donaghue KC. Definition, epidemiology and classification of diabetes in children and adolescents.
Ped Diab. 2009; 10(Suppl. 12): 3-12.
14. Diabetes Control and Complications Trial Research Group. The
effect of intensive treatment of diabetes on the development and
progression of long-term complications in insulin-dependent
diabetes mellitus. N Engl J Med. 1993; 329: 977-86.
15. Ryan CM, Atchison J, Puczynski S et al. Mild hypoglycemia associated with deterioration of mental efficiency in children with
insulin-dependent diabetes mellitus. J Pediatr. 1990; 117: 32-8.
16. Diabetes Control and Complications Trial Research Group.
Long-term effect of diabetes and its treatment on cognitive function. N Engl J Med. 2007; 356: 1842-52.
17. Martin DD, Davis EA, Jones TW. Acute effects of hyperglycaemia in children with type 1 diabetes mellitus: the patients perspective. J Pediatr Endocrinol. 2006; 19: 927-36.
18. Sochett E, Daneman D. Early diabetes-related complications in
children and adolescents with type 1 diabetes. Implications for
screening and intervention. Endocrinol Metab Clin North Am.
1999; 28(4): 865-81.
19. Holl RW, Lang GE, Grabert M et al. Diabetic retinopathy in pediatric patients with type 1 diabetes: effects of diabetes duration,
prepubertal and pubertal onset of diabetes, and metabolic control. J Pediatr. 1998; 132(5): 791-4.
20. Writing Team for the Diabetes Control and Complications Trial/
Epidemiology of Diabetes Interventions and Complications Research Group. Sustained effect of intensive treatment of type 1
diabetes mellitus on development and progression of diabetic
nephropathy: The Epidemiology of Diabetes Interventions and
Complications (EDIC) study. JAMA. 2003; 290: 2159-67.

Diretrizes SBD 2015-2016 - CAP 11.indd 67

21. Donaghue KC, Fung AT, Hing S et al. The effect of prepubertal
diabetes duration on diabetes. Microvascular complications in
early and late adolescence. Diabetes Care. 1997; 20: 77-80.
22. Shalitin S, Phillip M. Which factors predict glycemic control in
children diagnosed with type 1 diabetes before 6,5 years of age?
Acta Diabetol. 2011 Aug 25.
23. Viswanathan V, Sneeringer MR, Miller A et al. The utility of
hemoglobin A1c at diagnosis for prediction of future glycemic
control in children with type 1 diabetes. Diabetes Res Clin Pract.
2011; 92(1): 65-8.
24. de BeaufortKarin CE, Lange K, Swift PG et al. Metabolic outcomes in young children with type 1 diabetes differ between
treatment centers: the Hvidoere Study in Young Children. Pediatr Diabetes. 2009: 14: 422-428.
25. Maahs DM, Hermann JM, DuBose SN et al., for the DPV Initiative and the T1D Exchange Clinic Network. Contrasting the
clinical care and outcomes of 2,622 children with type 1 diabetes less than 6 years of age in the United StatesT1D Exchange
and German/Austrian DPV registries. Diabetologia. 2014: 57:
1578-1585.
26. Nambam B, Hirsch IB, Danne T et al. Lowering targets for hemoglobin A1c in children with type 1 diabetes: raising the bar.
Pediatric Diabetes. 2015: 16: 16-21.
27. Rewers M, Pihoker C, Donaghue K et al. Assessment and monitoring of glycemic control in children and adolescents with diabetes. Pediatric Diabetes. 2009: 10 (Suppl. 12): 71-81.
28. American Diabetes Association. Care of children and adolescents with type 1 diabetes. Diabetes Care. 2005; 28(1): 186-212.
29. Nguyen TM, Mason KJ, Sanders CG et al. Targeting blood glucose management in school improves glycemic control in children with poorly controlled type 1 diabetes mellitus. J Pediatr.
2008; 153(4): 575-8.
30. Workgroup on hypoglycemia, ADA. Defining and reporting
hypoglycemia in diabetes: a report from the American Diabetes
Association Workgroup on Hypoglycemia. Diabetes Care. 2005;
28: 1245-49.
31. Ryan CM, Becker DJ. Hypoglycemia in children with type 1 diabetes mellitus. Risk factors, cognitive function and management.
Endocrinol Metabol Clin North Am. 1999; 28(4): 1-18.
32. Northam EA, Anderson PJ, Werther GA et al. Neuropsychological complications of IDDM in children 2 years after disease onset. Diabetes Care. 1998; 21: 379-84.
33. Bloomgarden ZT. Treatment issues in type 1 diabetes. Diabetes
Care. 2002; 25(1): 230-6.
34. The Diabetes Research in Children Network Study Group. Impact of exercise on overnight glycemic control in children with
type 1 diabetes. J Pediatr. 2005 Oct; 147 (4): 528-34.
35. Cryer PE, Davis SN, Shamoon H. Hypoglycemia in diabetes.
Diabetes Care. 2003; 26(6): 1902-12.
36. Nordefeldt S, Johansson C, Carlsson E et al. Prevention of severe hypoglycaemia in type 1 diabetes: A randomized controlled
population study. Arch Dis Child. 2003; 88: 240-5.
37. Institute of Medicine. Dietary reference intakes: energy, carbohydrate, fiber, fat, fatty acids, cholesterol, protein, and amino acids.
Washington, DC: National Academy Press; 2000.
38. ISPAD Clinical Practice Consensus Guidelines 2009 Compendium. Pediatric Diabetes. 2009: 10 (Suppl. 12): 134-145.
39. American Diabetes Association. Evidence-based nutrition principles and recommendations for the treatment and prevention of
diabetes and related complications (position statement). Diabetes Care. 2003; 26(Suppl. 1): S51-61.
40. Wolever TM, Hamad S, Chiasso JL et al. Day-today consistency
in amount and source of carbohydrate associated with improved
blood glucose control in type 1 diabetes. J Am Coll Nutr. 1999;
18: 242-7.

05/10/2015 06:46:22

68 Diretrizes SBD | 2015-2016


41. Mehta SN, Quinn N, Volkening LK et al. Impact of carbohydrate
counting on glycemic control in children with type 1 diabetes.
Diabetes Care. 2009; 32(6): 1014-6.
42. Overby N, Margeirsdottir H, Brunborg C et al. The influence of
dietary intake and meal pattern on blood glucose control in children and adolescents using intensive insulin treatment. Diabetologia. 2007; 50: 2044-51.
43. Pediatric Diabetes Consortium. Body mass index changes in the
first year after type 1 diabetes diagnosis. Youth J Pediatric. 2015;
166: 1265-9.
44. Kuczmarski RJ, Ogden CL, Grunner-Strawn LM et al. CDC growth
charts: United States. Advance data from vital and health statistics,
n. 314. Hyattsville: National Center for Health Statistics; 2000.
45. Berenson GS, Srinivasan SR, Bao W et al. Association between
multiple cardiovascular risk factors and athe-rosclerosis in children and young adult: the Bogalusa Heart Study. N Eng J Med.
1998; 338: 1650-6.
46. Koivisto VA, Stevens LK, Mattock M et al. Cardiovascular disease and its risk factors in IDDM in Europe: EURODIAB IDDM
Complications Study Group. Diabetes Care. 1996; 19: 689-97.
47. Kershnar AK, Daniels SR, Imperatore G et al. Lipid abnormalities are prevalent in youth with type 1 and type 2 diabetes: The
SEARCH for Diabetes in Youth study. J Pediatr. 2006; 149: 314-9.
48. Kavey RE, Allada V, Daniels SR et al. Cardiovascular risk reduction in high-risk pediatric patients: a scientific statement from
the American Heart Association Expert Panel on Population and
Preventions Science. Circulation. 2006; 114: 2710-38.
49. American Diabetes Association. Management of dyslipidemia in
children and adolescents with diabetes (consensus statement).
Diabetes Care. 2003; 26: 2194-7.
50. National Heart Lung and Blood Institute. Integrated Guidelines
for Cardiovascular Health and Risk Reduction in Children and

Diretrizes SBD 2015-2016 - CAP 11.indd 68

51.

52.
53.

54.

55.
56.

57.
58.

Adolescents. Report of the Expert Panel. 2011 Dec. http://www.


nhlbi.nih.gov/guidelines/cvd_ped/index.htm. Acesso em: 26 de
outubro de 2012.
de Jongh S, Ose L, Szamosi T et al. Efficacy and safety of statin
therapy in children with familial hypercholesterolemia: a randomized, double-blind, placebo-controlled trial with simvastatin. Circulation. 2002; 106: 2231-7.
Maahs DM, Wadwa RP, Bishop F et al. Dyslipidemia in youth
with diabetes: to treat or not to treat? J Pediatr. 2008; 153:
458-65.
Donaghue KC, Chiarelli F, Trotta D et al. Microvascular and
macrovascular complications associated with diabetes in children and adolescents. Pediatric Diabetes. 2009; 10(Suppl. 12):
95-203.
Orchard TJ, Forrest KYZ, Kuller LH et al. Lipid and blood pressure treatment goals for type 1 diabetes: 10-year incidence data
from the Pittsburgh Epidemiology of Diabetes Complications
Study. Diabetes Care. 2001; 24: 1053-9.
Thompson M, Dana T, Bougatsos C et al. Screening for hypertension in children and adolescents to prevent cardiovascular
disease. Pediatrics. 2013; 131: 490.
Juhola J, Magnussen CG, Berenson GS et al. Combined effects
of child and adult elevated blood pressure on subclinical atherosclerosis: the International Childhood Cardiovascular Cohort
Consortium. Circulation. 2013; 128: 217.
I Diretriz de Preveno da Ateroesclerose na Infncia e Adolescncia. Arquivos Brasileiros de Cardiologia. 2005; 85(VI).
National High Blood Pressure Education Program Working
Group on High Blood Pressure in Children and Adolescents.
The fourth report on the diagnosis, evaluation, and treatment
of high blood pressure in children and adolescents. Pediatrics
2004; 114: 555.

05/10/2015 06:46:22

Diabetes Mellitus Gestacional |


Diagnstico, Tratamento e
Acompanhamento Ps-Gestao

Crescimento fetal excessivo, polidrmnio, hipertenso


ou pr-eclmpsia na gravidez atual

gravidez. Caso glicemia plasmtica em jejum seja 92 mg/dl


e < 126 mg/dl, feito o diagnstico de DMG. Em ambos os
casos, deve ser confirmado o resultado com uma segunda dosagem da glicemia de jejum. Caso a glicemia seja < 92 mg/dl,
a gestante deve ser reavaliada no segundo trimestre.
A investigao de DMG deve ser feita em todas as gestantes
sem diagnstico prvio de diabetes. Entre a 24a e a 28a semana
de gestao, deve-se realizar TOTG com dieta sem restrio de
carboidratos ou com, no mnimo, ingesto de 150 g de carboidratos nos 3 dias anteriores ao teste, com jejum de 8 h. H diferentes mtodos sendo atualmente utilizados para o diagnstico
do DMG (Quadro 2). Em 2010, a International Association of
the Diabetes and Pregnancy Study Groups (IADPSG) decidiu
que os critrios diagnsticos do DMG deveriam basear-se nos
resultados do estudo Hyperglycemia and Adverse Pregnancy
Outcomes (HAPO), uma pesquisa observacional que tinha
como meta encontrar um ponto de corte que ligasse a hiperglicemia materna a eventos perinatais adversos.8 Foram propostos,
ento, novos pontos de corte para o jejum, em 1 e 2 h, que so
92 mg/dl, 180 mg/dl e 153 mg/dl, respectivamente. De
acordo com esses novos critrios, um valor anormal j leva ao
diagnstico de DMG (ver Quadro 2). Em 2013, a OMS endossou o uso desses pontos de corte para o diagnstico de DMG,
destacando que glicemia de jejum igual ou maior que 126 mg/dl
ou aps sobrecarga acima de 200 mg/dl seriam critrios diagnsticos para diabetes mellitus franco e no DMG.1 A utilizao
do critrio proposto pela IADPSG/OMS no consenso mundial (Quadro 3). A SBD sugere a utilizao dos novos critrios
internacionais, pois so os nicos determinados por estudo que
demonstrou associao entre os valores da glicemia materna e
os desfechos perinatais (Quadro 3). As pacientes classificadas
com DMG so as que apresentam glicemia de jejum de 92 a 125
mg/dl, 1 h 180 mg/dl ou 2 h de 153 a 199 mg/dl, sendo que
um ponto alterado na curva j faz o diagnstico de DMG.

Antecedentes obsttricos de abortamentos de repetio,


malformaes, morte fetal ou neonatal, macrossomia
ou DMG

Tratamento

Introduo
Diabetes mellitus gestacional (DMG) uma intolerncia a carboidratos de gravidade varivel, que se iniciou durante a gestao atual e no preenche os critrios diagnsticos de diabetes
mellitus franco.1 o problema metablico mais comum na
gestao e tem prevalncia entre 3 e 25% das gestaes, dependendo do grupo tnico, da populao e do critrio diagnstico
utilizado.2-4 Muitas vezes, representa o aparecimento do diabetes mellitus tipo 2 (DM2) durante a gravidez. A incidncia
de DMG est aumentando em paralelo com o aumento do
DM2 e da obesidade feminina. Os fatores de risco para DMG
so mostrados no Quadro 1.

Rastreamento e diagnstico
At o momento, no h consenso sobre a indicao do rastreamento e sobre o mtodo diagnstico do DMG. A maioria das
recomendaes advm de consensos de especialistas (D).1,5-7
A Sociedade Brasileira de Diabetes recomenda que sejam
seguidos os critrios aceitos em 2013 pela OMS.1
Na primeira consulta pr-natal, deve ser solicitada glicemia de jejum. Caso o valor encontrado seja 126 mg/dl, feito o diagnstico de diabetes mellitus franco diagnosticado na
Quadro 1 Fatores de risco para diabetes gestacional.
Idade materna avanada
Sobrepeso, obesidade ou ganho excessivo de peso na
gravidez atual
Deposio central excessiva de gordura corporal
Histria familiar de diabetes em parentes de
primeiro grau

Sndrome de ovrios policsticos


Baixa estatura (menos de 1,5 m)9

Diretrizes SBD 2015-2016 - CAP 12.indd 69

Evidncias sugerem que a interveno em gestantes com


DMG possa diminuir a ocorrncia de eventos adversos na gravidez (B).14-16

05/10/2015 06:59:08

70 Diretrizes SBD | 2015-2016


Quadro 2 Diagnstico de DMG com TOTG com ingesto de 75 g
de glicose.

OMS/20131**

International
Association
of the Diabetes and
Pregnancy Study
Groups**
(IADPSG, 20108
ADA/201110
7
NIH/2012 * SBD/2011)

Jejum 92 a 125 mg/dl

95 mg/dl

92 mg/dl

1h

180 mg/dl

180 mg/dl

180 mg/dl

2h

153 a 199 mg/dl 155 mg/dl

153 mg/dl

*Dois valores alterados confirmam o diagnstico.


**Um valor alterado j confirma o diagnstico.
OMS: Organizao Mundial da Sade; NIH: National Institute of Health/
EUA; SBD: Sociedade Brasileira de Diabetes; TOTG: teste de tolerncia oral
glicose; ADA: American Diabetes Association.

Quadro 3 Potenciais vantagens e desvantagens do uso do


critrio diagnstico para DMG proposto pela International
Association of the Diabetes and Pregnancy Study Groups
(IADPSG) e aceito pela OMS 2013.
Prs

Contras

nico cujos valores so


determinados pelo risco de
complicaes perinatais

No h validao da eficcia
da interveno

Tem potencial de evitar


epidemia de obesidade

Percentual significativo de
macrossomia fetal no tem
correlao com DMG

Capacidade de detectar
precocemente o risco de
macrossomia e
hiperinsulinemia fetal

Aumento do nmero de
indicao de parto cirrgico

Custo-eficcia para preveno


de DM2 na mulher afetada e
na reduo de complicaes
perinatais11-13

Faltam estudos custo-eficcia


nacionais
Sobrecarga do sistema de
sade

O tratamento inicial do DMG consiste em orientao alimentar que possibilite ganho de peso adequado e controle
metablico (A).17 O clculo do valor calrico total da dieta
pode ser feito de acordo com o ndice de massa corporal
(IMC)17, na frequncia e intensidade de exerccios fsicos,
no padro de crescimento fetal e visando ao ganho de peso
adequado em torno de 300 a 400 g por semana, a partir do
segundo trimestre de gravidez. O valor calrico total prescrito deve ter 40 a 45% de carboidratos, 15 a 20% de protenas
e 30 a 40% de gorduras (A).18 possvel utilizar adoantes
artificiais (aspartame, sacarina, acessulfame-K e sucralose)
com moderao (B).19
A prtica de atividade fsica deve fazer parte do tratamento do DMG, respeitando-se as contraindicaes obsttricas (B).20
Recomenda-se o monitoramento das glicemias capilares 4 a 7 vezes/dia pr e ps-prandiais, especialmente nas
gestantes que usam insulina. Se aps 2 semanas de dieta os

Diretrizes SBD 2015-2016 - CAP 12.indd 70

nveis glicmicos permanecerem elevados (jejum 95 mg/


dl e 1 h ps-prandial 140 mg/dl, ou 2 h ps-prandiais
120 mg/dl), deve-se iniciar tratamento farmacolgico (B).18
O critrio de crescimento fetal para iniciar a insulinoterapia
uma alternativa sugerida quando a medida da circunferncia abdominal fetal for igual ou superior ao percentil 75
em uma ecografia realizada entre a 29a e a 33a semana de
gestao (B).21
A dose inicial de insulina deve ser em torno de 0,5 U/kg,
com ajustes individualizados para cada caso (B);22 em geral,
associam-se insulinas humanas de aes intermediria e rpida. Os anlogos de insulina asparte e lispro tm vantagens
sobre a insulina regular, promovendo melhor controle dos
nveis de glicemia ps-prandiais com menor ocorrncia de
hipoglicemias (B).23,24 Em 2015, a agncia reguladora norte-americana, Food and Drug Administration (FDA), e a
Agncia Nacional de Vigilncia Sanitria (Anvisa) classificaram como categoria A o anlogo de insulina detemir.25 O uso
de insulina glargina ainda no est oficialmente recomendado, apesar de muitos relatos (com um nmero pequeno de
casos) evidenciarem a segurana dessa insulina na gravidez
(C).26,27 No existem, at o momento, estudos conclusivos
com uso dos anlogos de insulina glulisina e degludeca durante a gestao.
Um nmero crescente de estudos no mostra efeitos deletrios do uso na gestao de metformina.28,29 Com relao
glibenclamida, dados recentes mostraram que est associada
a aumento no risco de hipoglicemia neonatal, maior ganho de
peso materno, maior ganho de peso neonatal e macrossomia,
sugerindo que deva ser utilizada com precaues.30,31 Como
os dois medicamentos ultrapassam a barreira placentria,32,33
os estudos que avaliam crianas expostas a eles na gestao,
a longo prazo, deveriam ser realizados para maior segurana
na utilizao destas medicaes (B). Outros agentes orais so
contraindicados.

Parto
A conduta obsttrica de uso de corticosteroides para maturao
pulmonar fetal no contraindicada, mas eles devem ser administrados de modo concomitante ao monitoramento intensivo
da glicemia e aos ajustes na dose da insulina. Caso o obstetra
indique o uso de tocoltico de efeito adrenrgico a dose de insulina deve ser aumentada durante o perodo de administrao
do medicamento.22
As gestantes com timo controle metablico e que no apresentam antecedentes obsttricos de morte perinatal, macrossomia ou complicaes associadas (p. ex., hipertenso) podem
aguardar a evoluo espontnea para o parto at o termo.18,22
No se indica cesariana pelo DMG, sendo a via de parto uma
deciso obsttrica.
No parto programado, necessrio que a gestante permanea em jejum, devendo-se suspender a insulina neutral protamine Hagedorn (NPH) e infundir uma soluo de glicose a 5 ou
10% intravenosamente, com controle horrio da glicemia capilar. Se necessrio, administra-se infuso contnua de insulina regular intravenosa com baixas doses (uma a duas unidades/hora)
ou insulina regular, lispro ou asparte subcutnea, conforme as
glicemias capilares. Quando o parto for de incio espontneo e

05/10/2015 06:59:08

Diabetes Mellitus Gestacional | Diagnstico, Tratamento e Acompanhamento Ps-Gestao 71

j se tiver administrado a insulina diria, recomenda-se manuteno de um acesso venoso com infuso contnua de soluo
de glicose, alm do monitoramento da glicemia capilar a cada
hora. Durante o trabalho de parto, deve-se manter a glicemia
em nveis entre 70 e 140 mg/dl.18 recomendada a presena de
um neonatologista na sala de parto (D).

Ps-parto
No primeiro dia aps o parto, os nveis de glicemia devem ser
observados e a insulina basal deve ser suspensa; orienta-se a
manuteno de uma dieta saudvel. A maioria das mulheres
apresenta normalizao das glicemias nos primeiros dias aps
o parto. necessrio estimular o aleitamento materno;34 caso
ocorra hiperglicemia durante esse perodo, a insulina o tratamento indicado. Deve-se evitar a prescrio de dietas hipocalricas durante o perodo de amamentao.
recomendado reavaliar a tolerncia glicose a partir
de 6 semanas aps o parto com glicemia de jejum35 ou com
um teste oral com 75 g de glicose,36 dependendo da gravidade do quadro metablico apresentado na gravidez (B).
Nas revises ginecolgicas anuais, fundamental recomendar a manuteno do peso adequado, revisando as orientaes sobre dieta e atividade fsica, e incluir a medida da glicemia de jejum.22 Em torno de 15 a 50% das mulheres com
DMG desenvolvem diabetes ou intolerncia glicose aps
a gestao.37
O aleitamento materno por perodos maiores que 3 meses est relacionado com a reduo do risco de desenvolvimento de DM2 aps a gestao.34,38 Por outro lado, o uso
de contraceptivos compostos apenas de progestgenos est
relacionado com o risco aumentado de desenvolvimento de
DM2 aps o parto.39 Mulheres com intolerncia glicose e
histrico de DMG quando reduzem 7% do peso corporal,
com prtica de atividade fsica regular ou quando utilizam
metformina, apresentam decrscimo de 53% da incidncia
de DM2.40,41
Quadro 4 Recomendaes e concluses.
Recomendaes e concluses

Grau de
recomendao

Na primeira consulta pr-natal, deve


ser solicitada glicemia de jejum em todas
as gestantes. Caso 126 mg/dl,
confirmado em duas medidas, feito
diagnstico de diabetes franco
diagnosticado na gravidez, e essa
gestante deve ser acompanhada como as
com diabetes pr-gestacional

O diagnstico de DMG deve ser


investigado em todas as grvidas sem
diabetes pr-gestacional pela realizao, a
partir da 24a semana de gestao, de um
TOTG com 75 g de glicose anidra VO

B
A quantidade de calorias ingeridas deve
basear-se no IMC. O valor calrico total
recomendado deve ser composto por: 40 a
45% de carboidratos, 15 a 20% de protenas
e 30 a 40% de lipdios
(continua)

Diretrizes SBD 2015-2016 - CAP 12.indd 71

Quadro 4 Recomendaes e concluses (continuao).


Recomendaes e concluses

Grau de
recomendao

A prtica de atividade fsica promover


sensao de bem-estar, menos ganho
de peso, reduo da adiposidade
fetal, melhor controle glicmico e
menos problemas durante o parto.
A atividade fsica contraindicada em
casos de hipertenso induzida pela
gravidez, ruptura prematura de
membranas, parto prematuro,
sangramento uterino persistente aps
o segundo trimestre e restrio de
crescimento intrauterino

A recomendao de medicamentos
antidiabticos orais glibenclamida e
metformina no diabetes gestacional tem
sido utilizada em alguns pases. Estudos
recentes tm mostrado a segurana da
metformina durante a gravidez; no
entanto, ainda existem dvidas dos efeitos
a longo prazo para a me e o filho. A
glibenclamida est associada a piores
desfechos perinatais quando comparada a
metformina e insulina

O uso de anlogos de insulina de ao


rpida, como a insulina aspart e lispro,
seguro durante a gravidez, propiciando
melhor controle dos nveis de glicemia
ps-prandial e menor ocorrncia de
hipoglicemia. A insulina NPH humana
a primeira escolha entre as insulinas
basais

C
O anlogo de insulina de ao prolongada
glargina tem se mostrado seguro para
utilizao no diabetes gestacional, mas os
relatos so de um nmero pequeno de
casos e no tornam possvel a sua indicao
generalizada
Em 2015, a agncia reguladora
norte-americana, Food and Drug
Administration (FDA), e a Agncia
Nacional de Vigilncia Sanitria (Anvisa)
classificaram como categoria A o anlogo
de insulina detemir

O uso de metformina ou de
glibenclamida deve ser indicado
apenas nos casos em que no se
alcanou controle adequado da glicemia
com medidas no farmacolgicas nos
quais o uso de insulina no vivel.
Glibenclamida pode estar relacionada
com pior desfecho fetal

Deve-se realizar um TOTG com 75 g de


glicose 6 semanas aps o parto para
avaliar o status glicmico da paciente. Caso
o teste esteja normal, necessrio realizar
ao menos uma glicemia de jejum
anualmente

(continua)

05/10/2015 06:59:08

72 Diretrizes SBD | 2015-2016


Quadro 4 Recomendaes e concluses (continuao).
Recomendaes e concluses
Mulheres com histrico de DMG, com o
objetivo de evitar DM2, devem ser
orientadas a reduzir peso corporal,
manter atividade fsica regular e evitar
uso de contraceptivos compostos
apenas de progestgenos. O uso de
metformina pode ser indicado para
aquelas que apresentam intolerncia
glicose

Grau de
recomendao
B

(A) Estudos experimentais e observacionais de melhor consistncia;


(B) Estudos experimentais e observacionais de menor consistncia; (C)
Relatos de casos estudos no controlados; (D) Opinio desprovida de
avaliao crtica, com base em consenso, estudos fisiolgicos ou modelos
animais.

Referncias bibliogrficas
1. World Health Organization. Diagnostic criteria and classification of hyperglycaemia first detected in pregnancy: a World
Health Organization Guideline. Diabetes Res Clin Pract. 2013;
103(3):341-63.
2. Lawrence JM et al. Trends in the prevalence of preexisting diabetes and gestational diabetes mellitus among a racially/ethnically
diverse population of pregnant women, 1999-2005. Diabetes
Care. 2008; 31(5):899-904.
3. Trujillo J et al. Impact of the International Association of Diabetes and Pregnancy Study Groups criteria for gestational diabetes.
Diabetes Res Clin Pract. 2015; 108(2):288-95.
4. Sacks DA et al. Frequency of gestational diabetes mellitus at
collaborating centers based on IADPSG consensus panel-recommended criteria: the Hyperglycemia and Adverse Pregnancy Outcome (HAPO) Study. Diabetes Care. 2012; 35(3):
526-8.
5. American College of Obstetricians and Gynecologists (ACOG).
Gestational diabetes mellitus. Washington (DC): American College of Obstetricians and Gynecologists (ACOG); 2013 Aug. 11p.
(ACOG Practice Bulletin, 137.)
6. National Collaborating Centre for Womens and Childrens
Health. NICE Guideline. NG3. Diabetes in pregnancy: management of diabetes and its complications from preconception to
the postnatal period. February 2015. Disponvel em: http://www.
nice.org.uk/guidance/ng3.
7. National Institutes of Health Consensus Development Conference: Diagnosing Gestational Diabetes Mellitus. 2013 march. Disponvel em: https://prevention.nih.gov/cdp/conferences/2013/
gdm/final-statement.aspx.
8. Metzger BE et al. International association of diabetes and pregnancy study groups recommendations on the diagnosis and classification of hyperglycemia in pregnancy. Diabetes Care. 2010;
33(3): 676-82.
9. Branchtein L et al. Short stature and gestational diabetes in Brazil. Brazilian Gestational Diabetes Study Group. Diabetologia.
2000; 43(7):848-51.
10. American Diabetes Association. Standards of medical care in
diabetes2011. Diabetes Care. 2011; 34(Suppl 1): S11-61. doi:
10.2337/dc11-S011.
11. Mission JF et al. Gestational diabetes screening with the new
IADPSG guidelines: a cost-effectiveness analysis. Am J Obstet
Gynecol. 2012; 207(4):326.e1-9.

Diretrizes SBD 2015-2016 - CAP 12.indd 72

12. Duran A et al. Introduction of IADPSG criteria for the screening


and diagnosis of gestational diabetes mellitus results in improved
pregnancy outcomes at a lower cost in a large cohort of pregnant
women: the St. Carlos Gestational Diabetes Study. Diabetes Care.
2014; 37(9):2442-50.
13. Werner EF et al. Screening for gestational diabetes mellitus: are
the criteria proposed by the International Association of the Diabetes and Pregnancy Study Groups cost-effective? Diabetes Care.
2012; 35(3):529-35.
14. Crowther CA et al. Effect of treatment of gestational diabetes
mellitus on pregnancy outcomes. N Engl J Med. 2005; 352(24):
2477-86.
15. Landon MB et al. A multicenter, randomized trial of treatment
for mild gestational diabetes. N Engl J Med. 2009; 361(14):
1339-48.
16. Hartling L et al. Benefits and harms of treating gestational diabetes mellitus: a systematic review and meta-analysis for the U.S.
Preventive Services Task Force and the National Institutes of
Health Office of Medical Applications of Research. Ann Intern
Med. 2013; 159(2):123-9.
17. Institute of Medicine. Weight gain during pregnancy: Reexamining the guidelines. Washington, DC: IOM; 2009.
18. American Diabetes Association. Medical management of pregnancy complicated by diabetes. 3rd ed. American Diabetes Association, Clinical Education Series. 2000.
19. La Vecchia C. Low-calorie sweeteners and the risk of preterm delivery: results from two studies and a meta-analysis. J Fam Plann
Reprod Health Care. 2013; 39(1):12-3.
20. Colberg SR, Castorino K, Jovanovic L. Prescribing physical activity to prevent and manage gestational diabetes. World J Diabetes. 2013; 4(6): 256-62.
21. Kjos SL, Schaefer-Graf UM. Modified therapy for gestational
diabetes using high-risk and low-risk fetal abdominal circumference growth to select strict versus relaxed maternal glycemic
targets. Diabetes Care. 2007; 30(Suppl 2):S200-5.
22. Negrato CA et al. Dysglycemias in pregnancy: from diagnosis to
treatment. Brazilian consensus statement. Diabetol Metab Syndr.
2010; 2:27.
23. Mecacci F et al. Maternal metabolic control and perinatal
outcome in women with gestational diabetes treated with
regular or lispro insulin: comparison with non-diabetic pregnant women. Eur J Obstet Gynecol Reprod Biol. 2003; 111(1):
19-24.
24. Di Cianni G et al. Maternal metabolic control and perinatal outcome in women with gestational diabetes mellitus treated with
lispro or aspart insulin: comparison with regular insulin. Diabetes Care. 2007; 30(4):e11.
25. Mathiesen ER et al. Maternal efficacy and safety outcomes in a
randomized, controlled trial comparing insulin detemir with
NPH insulin in 310 pregnant women with type 1 diabetes. Diabetes Care. 2012; 35(10):2012-7.
26. Negrato CA et al. Glargine vs. NPH insulin therapy in pregnancies complicated by diabetes: an observational cohort study. Diabetes Res Clin Pract. 2010; 89(1):46-51.
27. Pollex E et al. Safety of insulin glargine use in pregnancy: a systematic review and meta-analysis. Ann Pharmacother. 2011;
45(1):9-16.
28. Rowan JA et al. Metformin versus insulin for the treatment of
gestational diabetes. N Engl J Med. 2008; 358(19):2003-15.
29. Rowan JA et al. Metformin in gestational diabetes: the offspring
follow-up (MiG TOFU): body composition at 2 years of age. Diabetes Care. 2011; 34(10):2279-84.

05/10/2015 06:59:09

Diabetes Mellitus Gestacional | Diagnstico, Tratamento e Acompanhamento Ps-Gestao 73


30. Balsells M et al. Glibenclamide, metformin, and insulin for the
treatment of gestational diabetes: a systematic review and metaanalysis. BMJ. 2015; 350:h102.
31. Jiang YF et al. Comparative efficacy and safety of OADs in
management of GDM: network meta-analysis of randomized controlled trials. J Clin Endocrinol Metab. 2015; 100(5):
2071-80.
32. Schwartz RA et al. Glyburide transport across the human placenta. Obstet Gynecol. 2015; 125(3):583-8.
33. Kovo M et al. Determination of metformin transfer across
the human placenta using a dually perfused ex vivo placental
cotyledon model. Eur J Obstet Gynecol Reprod Biol. 2008;
136(1):29-33.
34. Gunderson EP et al. Lactation intensity and postpartum
maternal glucose tolerance and insulin resistance in women
with recent GDM: the SWIFT cohort. Diabetes Care. 2011;
35(1):50-6.
35. Guideline Development Group. Management of diabetes from
preconception to the postnatal period: summary of NICE guidance. BMJ. 2008; 336:714-7.

Diretrizes SBD 2015-2016 - CAP 12.indd 73

36. Metzger BE et al. Summary and recommendations of the Fifth


International Workshop-Conference on Gestational Diabetes
Mellitus. Diabetes Care. 2007; 30(Suppl 2):S251-60.
37. Feig DS et al. Risk of development of diabetes mellitus after diagnosis of gestational diabetes. CMAJ. 2008; 179(3):229-34.
38. Ziegler AG et al. Long-term protective effect of lactation on the
development of type 2 diabetes in women with recent gestational
diabetes mellitus. Diabetes. 2012; 61(12):3167-71.
39. Xiang AH et al. Long-acting injectable progestin contraception and risk of type 2 diabetes in Latino women with prior
gestational diabetes mellitus. Diabetes Care. 2006; 29(3):
613-7.
40. Ratner RE et al. Prevention of diabetes in women with a history
of gestational diabetes: effects of metformin and lifestyle interventions. J Clin Endocrinol Metab. 2008; 93(12):4774-9.
41. Aroda VR et al. The effect of lifestyle intervention and metformin on preventing or delaying diabetes among women with and
without gestational diabetes: the Diabetes Prevention Program
outcomes study 10-year follow-up. J Clin Endocrinol Metab.
2015; 100(4):1646-53.

05/10/2015 06:59:09

Disglicemias na Gestao |
Recomendaes para
Preparo e Acompanhamento da
Mulher com Diabetes durante a
Gravidez
Introduo
A disglicemia , atualmente, a alterao metablica mais comum na gestao, e o diabetes gestacional a forma mais prevalente, cuja definio uma intolerncia a carboidratos de
gravidade varivel, que se iniciou durante a gestao atual e
no preenche os critrios diagnsticos de diabetes mellitus
franco.1,2 A ocorrncia de gestaes em mulheres com diabetes
pr-gestacional tem aumentado nas ltimas dcadas. Um estudo na populao dos EUA revelou que, no incio dos anos 2000,
o diabetes mellitus tipo 1 (DM1) estava presente em 7%, e o diabetes mellitus tipo 2 (DM2) em 4,7% das gestaes complicadas
pelo diabetes.3
muito importante a diferenciao entre os tipos de diabetes, uma vez que causam impactos diversos sobre o curso da
gravidez e o desenvolvimento fetal. O diabetes pr-gestacional pode resultar em complicaes graves, pois seu efeito comea na fertilizao e implantao, afetando de modo particular a organognese. Esse fato faz aumentar o risco de aborto
precoce, defeitos congnitos graves e retardo no crescimento
fetal, sobretudo nos casos tratados de maneira inadequada.4 Alm das complicaes no concepto, as manifestaes
maternas tambm so relevantes, em especial na presena prvia de complicaes, tais como retino, neuro, nefro e
vasculopatia.5
Mais recentemente, as recomendaes da International Association of Diabetes and Pregnancy Study Groups
(IASDPG) indicam solicitar a medida da glicemia de jejum
na primeira consulta pr-natal, com o objetivo de detectar a
presena de DM em uma fase precoce da gravidez. Caso a glicemia seja 126 mg/dl ou a hemoglobina glicada (HbA1c)
seja 6,5%, provvel que se trate de um diabetes de qualquer
tipo, j existente na fase pr-gestacional, mas no diagnosticado previamente. Esse rastreamento tem como objetivo evitar
as complicaes mais graves nessas mulheres.6

Diretrizes SBD 2015-2016 - CAP 13.indd 74

Recomendaes para pacientes com


diabetes pr-gestacional
Orientaes pr-concepcionais
Da adolescncia em diante, necessrio aconselhar as mulheres a evitar a gravidez no planejada (B). Deve-se informar s
pacientes e s famlias o modo como o diabetes pode complicar a gravidez e como sua ocorrncia pode agravar o diabetes
(Quadro 1).7
necessrio oferecer cuidado pr-concepcional e aconselhamento s pacientes que planejam engravidar antes que elas
descontinuem o mtodo contraceptivo que vm utilizando.
Alm disso, elas devem ser informadas de que um bom controle glicmico antes da concepo e durante toda a gravidez
reduz, mas no elimina, os riscos de aborto, malformao congnita, natimortalidade e morte neonatal (B).
Para mulheres que estejam planejando engravidar, necessrio disponibilizar, ainda, um programa de educao continuada que fornea melhor compreenso sobre o binmio
diabetes-gravidez no que diz respeito a dieta, contagem de
carboidratos, autoaplicao de insulina e automonitoramento
de glicemia capilar; isso deve ser feito o mais precocemente
possvel. As pacientes devem ser avaliadas quanto presena
de nefropatia, neuropatia, retinopatia, doena cardiovascular,
hipertenso, dislipidemia, depresso e disfunes tireoidianas;
quando diagnosticadas quaisquer dessas doenas, trat-las.8

Controle glicmico antes e durante a gravidez


Deve-se aconselhar as pacientes com diabetes preexistente, que
estejam planejando engravidar, a manter os nveis de HbA1c
o mais prximo possvel dos valores normais, sem a ocorrncia de hipoglicemias.9 O nvel ideal de HbA1c < 6%, se
utilizado o mtodo de cromatografia lquida de alta eficincia

05/10/2015 06:59:59

Disglicemias na Gestao | Recomendaes para Preparo e Acompanhamento da Mulher com Diabetes durante a Gravidez 75
Quadro 1 Temas a serem abordados com pacientes diabticas
em perodo pr-gestacional e seus familiares.
O impacto do mau controle do diabetes sobre o curso da
gravidez e sobre o risco materno e fetal
A importncia da dieta, do controle do peso corporal e da
prtica regular de exerccio fsico (incluindo aconselhamento
para perda de peso em pacientes com ndice de massa corporal
[IMC] > 25)
O aumento do risco do nascimento de um beb macrossmico,
o que aumentaria as chances de tocotraumatismos, tanto para
a me quanto para o feto
A importncia do controle glicmico materno antes, durante e
aps o parto, e tambm a importncia da amamentao
precoce do recm-nascido, com o intuito de reduzir o risco de
hipoglicemia neonatal
A possibilidade da ocorrncia de internao do recm-nascido
em unidade de terapia intensiva, por hipoglicemia ou
imaturidade pulmonar, dentre outras situaes
O risco aumentado que o recm-nascido tem de desenvolver
obesidade e/ou diabetes no futuro
A necessidade de suplementao com cido flico at a
12a semana de gestao para reduzir os riscos de ocorrncia de
malformao do tubo neural
Os riscos de hipoglicemia clnica ou at mesmo assintomtica
durante a gravidez e os efeitos das nuseas e do vmito no
controle glicmico durante a gravidez
A necessidade de se avaliar a existncia de retinopatia e
nefropatia antes, durante e aps o trmino da gravidez, e o
risco de piora dessas complicaes

(HPLC), ou at 1% acima do valor mximo informado pelo laboratrio de anlises clnicas onde os testes so feitos. A dosagem de HbA1c deveria preferencialmente ser feita usando-se
um mtodo semelhante ao utilizado no Diabetes Control and
Complications Trial (DCCT)/HPLC (B).9 necessrio enfatizar para as pacientes que qualquer reduo nos nveis de
HbA1c visando ao alvo de 6% tende a diminuir o risco de malformaes fetais e abortamentos.10 A gravidez deve ocorrer
quando o diabetes estiver bem controlado e, preferencialmente, com valores de HbA1c dentro da normalidade. Mulheres
com HbA1c > 10% devem ser desencorajadas a engravidar at
que seja alcanado melhor controle glicmico.
A HbA1c deve ser medida na primeira consulta pr-natal;
depois, mensalmente, at que valores < 6% sejam alcanados,
quando ento poder ser avaliada a cada 2 ou 3 meses. necessrio motivar cada paciente a realizar glicemias capilares antes e
1 h aps as refeies, ao se deitar e, esporadicamente, entre 2 e 4
h da manh (C).11 Esses testes devem ser feitos, de preferncia,
nos dedos das mos, no utilizando locais alternativos, uma vez
que eles podem no identificar mudanas rpidas dos nveis de
glicemia, o que caracterstico da gravidez com diabetes (C).11
O controle glicmico durante a gravidez considerado timo quando os valores de glicemia pr-prandial ficam entre 65
e 95 mg/dl, com um pico 1 h ps-prandial at 140 mg/dl. Em
mulheres com risco aumentado de hipoglicemia, esses alvos
devem ser aumentados para um valor de glicemia de jejum de
at 99 mg/dl e ao deitar-se, ou entre 2 e 4 h da madrugada de

Diretrizes SBD 2015-2016 - CAP 13.indd 75

80 at 120 mg/dl (D). Os ndices de glicemia ps-prandial de


1 h aps o incio das refeies so os que melhor refletem os
valores dos picos ps-prandiais avaliados pelo monitoramento
contnuo de glicose (C).11 O uso de monitoramento contnuo
da glicose em tempo real pode estar indicado nos casos de gestantes com grande variabilidade glicmica ou naquelas com
risco de hipoglicemia sem aviso (D).12

Terapia nutricional
As gestantes com diagnstico de diabetes devem receber orientao diettica individualizada, necessria para alcanar as metas do tratamento. A dieta deve conter os nutrientes essenciais
para o adequado desenvolvimento do concepto. A quantidade
de calorias deve basear-se no ndice de massa corporal (IMC),
na frequncia e na intensidade de exerccios fsicos, no padro
de crescimento fetal e visando ao ganho de peso adequado (E).13
Em mulheres com IMC pr-gestacional entre 18,5 e 24,9 kg/m2,
o ganho de peso esperado ao longo da gestao de 11,5 a 16 kg.
J nas gestantes com IMC pr-gestacional 30 kg/m2, considerado seguro ganho at o final da gravidez entre 5 e 9 kg (C).14
A distribuio recomendada do contedo calrico :


40 a 45% de carboidratos
15 a 20% de protenas (no mnimo, 1,1 g/kg/dia)
30 a 40% de gorduras.

A dieta tambm deve ser planejada e distribuda ao longo


do dia, objetivando-se evitar episdios de hiperglicemia, hipoglicemia ou cetose. preciso ter ateno especial quanto
adequao de doses de insulina e horrios de sua administrao
e ao contedo dos nutrientes fornecidos em cada refeio. Em
geral, deve-se fracionar a ingesto alimentar em trs refeies
grandes e trs pequenas (C).15 A ceia tem grande importncia,
em especial para as mulheres que fazem uso de insulina noite,
e deve conter 25 g de carboidratos complexos, alm de protenas
ou lipdios, para evitar hipoglicemia durante a madrugada.
Mulheres que utilizam insulina podem ser orientadas a ajustar a dose prandial de insulina de ao rpida pelo clculo do
contedo de carboidrato de cada refeio. A relao insulina/
carboidrato deve ser individualizada (D). Os adoantes artificiais no nutritivos (p. ex., aspartame, sacarina, acessulfame-K e
sucralose) podem ser utilizados com moderao (C).16 O consumo de lcool est contraindicado durante a gestao (A).

Suplementao de vitaminas e minerais


O uso de cido flico (600 mg a 5 mg/dia) desde o perodo
pr-concepcional at a 12a semana de gravidez recomendado
para reduzir o risco de nascimento de uma criana com defeito no fechamento do tubo neural (A).17 A suplementao com
outras vitaminas e sais minerais dever ser realizada quando
detectadas deficincias nutricionais (C).15

Exerccios fsicos
A prtica regular de exerccios fsicos causa sensao de bemestar, diminuio do ganho de peso, reduo da adiposidade fetal, melhora do controle glicmico e diminuio de problemas

05/10/2015 06:59:59

76 Diretrizes SBD | 2015-2016

durante o trabalho de parto.18 A atividade fsica reduz a resistncia insulina, facilitando a utilizao perifrica de glicose,
com consequente melhora do controle glicmico.
Atividade fsica de baixa intensidade deve ser encorajada para mulheres previamente sedentrias. Aquelas que j
praticavam alguma atividade podem fazer exerccios de moderada intensidade durante a gravidez (E). Est contraindicada a prtica de exerccio fsico durante a gravidez em
caso de:19









Doena hipertensiva induzida pela gravidez sem controle


adequado
Ruptura prematura de membranas
Trabalho de parto prematuro
Sangramento uterino persistente aps o segundo trimestre
Incompetncia istmocervical
Restrio de crescimento intrauterino
Sndrome nefrtica
Retinopatia pr-proliferativa grave e proliferativa
Hipoglicemia sem aviso
Neuropatia perifrica avanada e disautonomia.

Pacientes que no tenham contraindicaes para realizar


exerccios devem faz-los diariamente por pelo menos 30 min
(B),19 de preferncia aps as refeies. Deve-se monitorar a
glicemia capilar antes e aps os exerccios e manter boa hidratao. preciso orientar a prtica de exerccios que no tenham alto risco de quedas ou traumas abdominais e que no
levem ao aumento da presso arterial, contraes uterinas ou
sofrimento fetal (B).19

Tratamento medicamentoso |
Insulinoterapia, segurana dos
medicamentos usados no controle do
diabetes e suas complicaes antes e
durante a gravidez
Atualmente, devido segurana e eficcia comprovadas do uso
da insulina para o controle da glicemia, prevalece a orientao
de descontinuao do uso de antidiabticos orais, garantindo-se
sua imediata substituio por insulina, de preferncia antes da
gravidez ou logo aps seu diagnstico (E). At o momento, no
existem estudos controlados que comprovem se seguro o uso
dos antidiabticos orais em gestantes com DM2. A glibenclamida atravessa minimamente a placenta20 e a metformina o faz
em quantidades significativas.21 Portanto, necessrio ter cautela na indicao rotineira dessas medicaes a mulheres com
diabetes pr-gestacional.
Para obter controle glicmico adequado em mulheres
com DM1 e DM2, deve-se utilizar esquemas intensivos de insulinizao, com mltiplas doses subcutneas de insulina de
ao intermediria, rpida ou ultrarrpida, ou mediante infuso subcutnea contnua. Em mulheres que usavam insulina
antes da gravidez, costuma ser necessrio reduzir a sua dose
em 10 a 20%, durante o primeiro trimestre. Entre a 18a e a 24a
semana de gestao, essa dose pode ser aumentada. No 3o trimestre, o aumento da produo de hormnios placentrios

Diretrizes SBD 2015-2016 - CAP 13.indd 76

com ao antagnica da insulina resulta em uma necessidade ainda maior de elevao da dose de insulina, chegando ao dobro ou triplo da dose usada pr-gravidez. Pacientes
com DM2 geralmente precisam de uma dose inicial diria de
0,7 unidade/kg de peso. As doses devem ser frequentemente
ajustadas conforme os resultados do automonitoramento da
glicemia capilar.
Aps o parto, as necessidades de insulina caem abruptamente e, muitas vezes, nos dias subsequentes, a dose deve ser
ajustada para 30% da dose final na gestao ou para a dose
pr-gravdica. Os anlogos de insulina de ao ultrarrpida,
como as insulinas asparte e lispro, so seguros durante a gestao e levam melhora dos nveis de glicemia ps-prandial e
diminuio da ocorrncia de hipoglicemias (B).22 A insulina
humana neutral protamine Hagedorn (NPH) a primeira escolha como insulina basal (A). Recentemente, um estudo randomizado controlado comparativo no mostrou inferioridade
do anlogo de ao prolongada detemir em relao insulina
NPH em gestantes com DM1.23 Em 2015, a agncia reguladora norte-americana, Food and Drug Administration (FDA),
e a Agncia Nacional de Vigilncia Sanitria (Anvisa) classificaram como categoria A o anlogo de insulina detemir. Os
estudos at o momento publicados com o uso do anlogo de
insulina glargina na gravidez no so randomizados e controlados.24,25 Embora esses estudos tenham mostrado resultados
promissores e sem complicaes a curto prazo, a insulina glargina tem classificao C para uso na gestao. No existem,
at o momento, estudos conclusivos com uso dos anlogos de
insulina glulisina e degludeca durante a gestao. Quando disponvel, a bomba de infuso contnua de insulina pode ser utilizada. A maioria dos estudos no mostrou superioridade do
uso da bomba em relao ao tratamento intensivo em termos
de doses usadas de insulina, controle glicmico e ocorrncia
de eventos maternos e fetais adversos.26 Isso leva concluso
de que o fator mais importante para a obteno de bons resultados em uma gravidez acompanhada de diabetes o bom
controle glicmico. A indicao do uso de bomba de infuso
contnua pode ser especificamente vantajosa nos casos de gestantes que experimentam episdios frequentes de hipoglicemia ao longo do dia e da noite.27
necessrio suspender o uso de inibidores da enzima de
converso da angiotensina (IECA) e bloqueadores do receptor
da angiotensina (BRA) devido sua associao a embriopatias
e fetopatias, antes da gravidez ou to logo esta seja confirmada,
e substitu-los por agentes anti-hipertensivos seguros durante
a gestao (A).28,29 Os anti-hipertensivos a serem utilizados
so a metildopa, os bloqueadores de canais de clcio no di-hidropiridnicos de durao prolongada e os betabloqueadores
com atividade beta-agonista parcial, como carvedilol, labetalol
e pindolol. O uso de atenolol tem sido associado restrio
de crescimento fetal e, portanto, deve ser evitado (C).30,31 Embora ainda no estejam totalmente estabelecidos os riscos do
uso de estatinas, recomenda-se suspender sua administrao
antes ou to logo a gravidez seja confirmada, em razo de seus
potenciais efeitos teratognicos (B).32,33
Como no est claro se o uso dos fibratos na gravidez
seguro, sua indicao deve ocorrer apenas nos casos mais graves de hipertrigliceridemia (quando h risco de evoluo para
pancreatite aguda) e que no respondam dietoterapia (C).34

05/10/2015 06:59:59

Disglicemias na Gestao | Recomendaes para Preparo e Acompanhamento da Mulher com Diabetes durante a Gravidez 77

Emergncias e complicaes do diabetes


durante a gravidez
Deve-se alertar as pacientes em insulinoterapia sobre os riscos de hipoglicemia, em especial durante a noite e a madrugada, e estabelecer medidas de preveno. Alm disso, preciso orientar seus parceiros e familiares sobre esses riscos e
como prestar os primeiros socorros (B). A gestao promove
um estado fisiolgico de catabolismo acelerado, com aumento
do risco de desenvolver cetonria e cetonemia, mesmo com
nveis glicmicos normais ou pouco elevados.35 Deve-se descartar a presena de cetoacidose diabtica caso a paciente com
DM1 apresente intercorrncias infecciosas, desidratao e aumento da glicemia (D).7
O controle das funes renal e teraputica das complicaes retinianas deve ser feito antes, durante e aps a gravidez
nas pacientes com diabetes preexistente, visto que algumas
complicaes tais como retinopatia, nefropatia clnica e insuficincia renal podem se agravar com a gestao. O risco
de piora da retinopatia proliferativa extremamente elevado
nas mulheres que no fizeram tratamento prvio com laser. A
cardiopatia isqumica, quando no tratada, est associada a
altos ndices de mortalidade. A presena de nefropatia diabtica aumenta de maneira significativa os riscos de complicaes
perinatais, tais como pr-eclmpsia, restrio do crescimento
intrauterino e prematuridade (B).7,36

Cuidados na assistncia pr-natal


Deve-se oferecer s pacientes diabticas grvidas um programa de educao em diabetes fornecido por equipe multiprofissional. As consultas devem ser direcionadas para o cuidado do
diabetes, alm de toda a rotina pr-natal bsica (A).37
A avaliao do controle glicmico deve ser feita a cada 1
ou 2 semanas pelo mdico assistente ou por um membro da
equipe multiprofissional. Nas pacientes com diabetes pr-gestacional, entre a 24a e a 28a semana de gravidez, prioritrio
realizar uma ecocardiografia fetal para a avaliao das quatro
cmaras cardacas, objetivando a visualizao de disfuno
anatmica ou funcional do corao fetal (A).38 Os objetivos
da avaliao fetal so verificar a vitalidade no primeiro trimestre, a integridade estrutural no segundo trimestre e monitorar o crescimento e o bem-estar fetal no terceiro trimestre
(Quadro 2).
Nas pacientes com controle glicmico inadequado e nas
hipertensas, os testes para avaliar o bem-estar fetal devem
ser antecipados e realizados em intervalos menores de tempo, uma vez que o risco de morte fetal proporcional ao grau
de hiperglicemia materna e, mais frequente, em gestantes com
complicaes vasculares (B).

Parto
Trabalho de parto pr-termo
No contraindicado o uso de corticosteroides para maturao pulmonar fetal, assim como de tocolticos, mas
necessrio administr-los de modo concomitante com monitoramento intensivo da glicemia e ajustes da dose da insulina (D).7

Diretrizes SBD 2015-2016 - CAP 13.indd 77

Quadro 2 Avaliao fetal na gravidez complicada por diabetes.


1o trimestre

US para avaliar idade gestacional/


translucncia nucal para avaliar possibilidade
de malformaes fetais

2o trimestre

US morfolgica para avaliar malformaes


20a a 24a semana
Doppler das artrias uterinas e artrias
umbilicais 26a semana
Ecocardiograma fetal 24a a 28a semana (em
casos de diabetes preexistente)
US mensal a partir da 24a semana para avaliar
o crescimento fetal e polidrmnio

3o trimestre

US mensal at o parto. Em caso de suspeita


de restrio de crescimento ou feto grande
para idade gestacional, realizar avaliao a
cada 15 dias
CTG basal a partir de 34 semanas (semanal)
Doppler de artrias umbilicais se houver
hipertenso arterial sistmica, toxemia ou
vasculopatia
Contagem de movimentos fetais: orientar a
partir de 28 semanas

US: ultrassonografia; CTG basal: cardiotocografia basal.

Momento e tipo de parto


O diabetes no uma indicao absoluta de cesariana. Nas
gestantes bem controladas, a indicao da via de parto obsttrica. O uso de anestesia de bloqueio permitido para alvio
das dores do trabalho de parto. necessrio controlar os nveis de glicemia capilar a cada hora durante todo o trabalho
de parto e em todo o perodo ps-anestsico. O parto eletivo
pode ser realizado, por induo do trabalho de parto ou cesariana, se houver indicao materna ou fetal (D).7

Controle glicmico durante o parto


Deve-se controlar a glicemia capilar de hora em hora durante
o parto para manter os nveis entre 70 e 140 mg/dl. Caso a
glicemia no seja mantida nesses nveis, preciso fazer uso intravenoso de glicose e/ou insulina em forma de infuso contnua intravenosa (D).7 Usurias de bomba de infuso contnua
de insulina devem ter ajustada a programao da infuso do
medicamento, dependendo do tipo de parto realizado.

Cuidados iniciais com o recm-nascido


As pacientes devem ser aconselhadas a dar luz em hospitais
onde existam unidades de cuidados intensivos com atendimento 24 h. preciso manter o recm-nascido com a me,
a no ser que surja uma complicao clnica que necessite de
internao em unidade de terapia intensiva (A).7
O recm-nascido deve ser amamentado o mais rpido possvel
aps o parto (dentro de 30 min) e depois a cada 2 ou 3 h, at que
a amamentao mantenha as concentraes de glicose sangunea
entre as mamadas em pelo menos 40 mg/dl. preciso medir a
concentrao de glicose sangunea a cada 2 a 4 h aps o nascimento. Medidas adicionais, tais como alimentao por sonda ou
injeo de glicose intravenosa, devem ser adotadas somente em
caso de concentraes de glicose sangunea < 40 mg/dl em duas

05/10/2015 06:59:59

78 Diretrizes SBD | 2015-2016

medidas consecutivas ou na presena de sinais clnicos sugestivos


de hipoglicemia ou, ainda, se o recm-nascido no conseguir se
alimentar de modo eficaz por via oral. Alm disso, necessrio
testar os nveis de glicose sangunea em recm-nascido que apresente sinais clnicos de hipoglicemia (como hipotonia muscular,
nvel de conscincia rebaixado e apneia) e iniciar tratamento com
glicose intravenosa o mais precocemente possvel (A).7 preciso
fazer ecocardiograma no recm-nascido com sinais sugestivos de
doena cardaca congnita ou cardiomiopatia.
Exames confirmatrios devem ser realizados nos casos de
presena de sinais clnicos sugestivos de policitemia, hiperbilirrubinemia, hipocalcemia ou hipomagnesemia. importante ter critrios bem-definidos para admisso em uma unidade
de terapia intensiva neonatal, tais como hipoglicemia, sinais
clnicos anormais que sugiram imaturidade pulmonar, descompensao cardaca ou encefalopatia neonatal.

Cuidado ps-natal com o diabetes


Deve-se reduzir a dose de insulina imediatamente aps o parto
em mulheres que a utilizavam no perodo pr-gestacional. Alm
disso, preciso monitorar os nveis de glicemia de maneira rigorosa (para estabelecer a dose apropriada) e informar s pacientes acerca do risco aumentado de hipoglicemia no perodo
ps-natal, especialmente se estiverem amamentando (D).
As pacientes com diabetes pr-gestacional devem ser encaminhadas para seus locais originais de tratamento, sendo
necessrio lembr-las da importncia da contracepo e dos
cuidados pr-concepcionais que devem ter, caso estejam planejando engravidar no futuro.

Aleitamento
O aleitamento ao seio deve ser incentivado, pois a amamentao exclusiva a nutrio ideal para o beb e promove proteo contra infeces em crianas (A).39 O aleitamento materno

exclusivo durante mais de 6 meses se associou reduo do


risco de desenvolvimento de doena celaca e autoimunidade
pancretica em filhos de mulheres com diabetes tipo 1 e menor incidncia de obesidade desses conceptos (B).39-41
possvel considerar o retorno ou a continuao do uso de
agentes antidiabticos orais, como metformina e glibenclamida, imediatamente aps o parto em pacientes com DM2 preexistente que estiverem amamentando. Apenas 0,4% da dose de
metformina ingerida pela me detectada no leite materno,
e a presena da medicao no leite independe do horrio da
tomada. Estudos com pequena casustica (no mximo, nove
crianas) no detectaram a substncia nos lactentes.42,43 A glibenclamida e a glipizida no foram detectadas no leite materno e no foi verificada hipoglicemia nos bebs, embora seja
muito reduzido o nmero de casos estudados (Quadro 3).44
A quantidade mdia total de carboidrato secretado no leite
materno de 160 mg/dia.45 Portanto, mulheres que utilizam
insulina devem ingerir 15 g de carboidrato, preferencialmente
junto com protena, antes ou durante o aleitamento, a fim de
evitar hipoglicemia (D). Durante o aleitamento noturno, deve
ser feito o automonitoramento da glicemia, com o objetivo de
evitar hipoglicemia (D). O consumo de lcool pela lactante
deve ser evitado (D).

Tratamento de comorbidades aps o parto


Terapia anti-hiperlipemiante
As estatinas e os fibratos no devem ser usados durante a amamentao, pois so excretados pelo leite materno e podem
apresentar potenciais efeitos adversos para o beb (recomendao dos fabricantes). Quando os nveis de triglicerdios esto acima de 1.000 mg/dl, mesmo com uma dieta adequada, e
na presena de alto risco de pancreatite, devero ser considerados a niacina, o leo de peixe (sem adio de mercrio) ou
at mesmo a interrupo da amamentao (D).

Quadro 3 Uso de medicaes antidiabticas em mulheres com diabetes durante a amamentao.


Substncia

Presena no leite materno

Permisso para uso


durante a lactao

Referncia

Glibenclamida

No

Sim

44

Glicazida

Desconhecida

No

No publicada

Glipizida

No

Sim

44

Glimepirida

Desconhecida

No

No publicada

Metformina

Menos que 1%

Sim

42 e 43

Acarbose

Menos que 2%

No

FDA*

Pioglitazona

Estudos em animais mostram pequena quantidade

No

FDA*

Sita, vilda, saxa e


linagliptina

Sitagliptina secretada pelo leite de ratas lactantes


em uma razo leite: plasma de 4:1; no se sabe se a
sitagliptina excretada pelo leite humano.
Vildagliptina no tem dados publicados

No

FDA*

Exenatida e liraglutida

No h estudos em humanos
Estudos em camundongos revelaram 2,5% da
dose de exenatida no leite; 50% da dose de
liraglutida do plasma so secretados pelo leite
de ratas

No

FDA*

*Fonte: http://www.fda.gov

Diretrizes SBD 2015-2016 - CAP 13.indd 78

05/10/2015 06:59:59

Disglicemias na Gestao | Recomendaes para Preparo e Acompanhamento da Mulher com Diabetes durante a Gravidez 79

Terapia anti-hipertensiva
Inibidores da enzima conversora da angiotensina (IECA), bloqueadores dos canais de clcio, baixas doses de diurticos tiazdicos e metildopa durante a amamentao, mesmo sendo transferidos para o leite em quantidades pequenas, so seguros.30 O
uso de atenolol est associado bradicardia e hipotenso em
bebs (C).31 O propranolol e o metoprolol podem estar indicados, mas os bebs devem ser observados quanto a manifestaes clnicas que sugiram um betabloqueio (C).30

Contracepo
O aconselhamento contraceptivo um mtodo efetivo para
evitar as consequncias indesejveis de uma gravidez no planejada. No h um mtodo contraceptivo que seja apropriado
para todas as mulheres com diabetes; portanto, esse aconselhamento deve ser individualizado.46
Se um contraceptivo oral for a melhor escolha, uma plula combinada com baixa dose (estrgeno + progestgeno) ou
uma plula sequencial com 35 mg de estrgeno e um progestgeno novo (levonorgestrel, desogestrel, gestodeno ou norgestimato) em baixas doses podem ser a melhor opo, mas o
risco de alteraes pr-aterognicas no perfil lipdico deve ser
considerado. Plulas que contenham somente progestgenos
so uma alternativa, mas existe a possibilidade de aumento
dos nveis sricos de lipdios e outros efeitos adversos.
O uso de progestgeno injetvel, de longa durao, no
recomendado para pacientes diabticas.
Dispositivos intrauterinos (DIU) so seguros (B). Mtodos
de barreira, como diafragma com espermicida ou preservativo, apresentam alto grau de falha.
Controle de gravidez por tabela aumenta o risco de falha,
uma vez que as mulheres diabticas podem apresentar ciclos
menstruais irregulares.
Quando a prole estiver completa, a esterilizao permanente (quando permitida) das pacientes diabticas ou de seus
parceiros pode representar um meio conveniente para evitar
uma gravidez no planejada, em comparao com outros mtodos contraceptivos.47

Consideraes finais
Os medicamentos que podem ser usados por gestantes com
diabetes so mostrados no Quadro 4, e os itens mais importantes focados neste consenso esto no Quadro 5. Ambos
apresentam os devidos nveis de evidncia das principais recomendaes e concluses.
Quadro 4 Uso de medicamentos em mulheres com diabetes,
durante a gravidez e a amamentao.

Substncia

Uso
durante a
gravidez

Uso
durante a
lactao

Grau de
recomendao

Adoantes artificiais
Aspartame,
sacarina,
acessulfame-K
e sucralose

Com
moderao

Com
C
moderao

Uso
durante a
gravidez

Uso
durante a
lactao

Grau de
recomendao

Glibenclamida

Falta
consenso

Sim

Glicazida

No

No

Substncia
Antidiabticos orais

Glipizida

No

Sim

Glimepirida

No

No

Metformina

Falta
consenso

Sim

Acarbose

No

No

Rosi e
pioglitazona

No

No

Sita, vilda,
lina e
saxagliptina

No

No

Exenatida,
liraglutida,
lixisenatida

No

No

Insulinas
NPH

Sim

Sim

Regular

Sim

Sim

Lispro

Sim

Sim

Asparte

Sim

Sim

Glargina

No

Sim

Detemir

Sim

Sim

Glulisina

No

Sim

Degludeca

No

Sim

Anti-hiperlipemiantes
Genfibrozila

No

No

Estatinas

No

No

Enalapril

No

Com
precauo

Captopril

No

No

Anti-hipertensivos

Lisinopril

No

No

Metildopa

Sim

Sim

Losartana

No

Com
precauo

Candesartana

No

No

Hidroclorotiazida
(baixas doses)

Sim

Sim

Inibidores dos
canais de clcio

No

Sim

etabloqueadores Sim
(labetalol,
metoprolol,
propranolol)

Sim

Atenolol

No

Sim

No

Hormnios tireoidianos
Levotiroxina
(continua)

Diretrizes SBD 2015-2016 - CAP 13.indd 79

Quadro 4 Uso de medicamentos em mulheres com diabetes,


durante a gravidez e a amamentao (continuao).

Sim

(continua)

05/10/2015 07:00:00

80 Diretrizes SBD | 2015-2016


Quadro 4 Uso de medicamentos em mulheres com diabetes,
durante a gravidez e a amamentao (continuao).
Uso
durante a
gravidez

Uso
durante a
lactao

Grau de
recomendao

Com
precauo
Evitar no
primeiro
trimestre

Sim

Propiltiouracila

Sim

Iodo radioativo

Quadro 5 Recomendaes e concluses (continuao).


Recomendaes e concluses

Grau de
recomendao
A

O uso de cido flico antes da gravidez at


o fechamento do tubo neural
recomendado para todas as mulheres,
inclusive as diabticas

Sim

A dosagem de TSH e anticorpo


antitireoperoxidase deve ser realizada em
mulheres com diabetes tipo 1, idealmente
quando estiverem planejando a gestao
ou na primeira consulta pr-natal

No

No

Fluoxetina

No

No

Paroxetina

Com
precauo

Sim

Tricclicos
(amitriptilina,
nortriptilina,
clomipramina)

Com
precauo

Sim

Nimesulida

Com
precauo

Com
precauo

cido
mefenmico,
cetoprofeno,
diclofenaco,
ibuprofeno,
meloxicam

Com
precauo

Sim

A prtica de atividade fsica promover


sensao de bem-estar, menos ganho de
peso, reduo da adiposidade fetal, melhor
controle glicmico e menos problemas
durante o parto. A atividade fsica
contraindicada em casos de hipertenso
no controlada induzida pela gravidez;
ruptura prematura de membranas; parto
prematuro; sangramento uterino
persistente aps o segundo trimestre;
incontinncia istmocervical; restrio de
crescimento intrauterino; sndrome
nefrtica; retinopatia pr-proliferativa e
proliferativa; hipoglicemia sem sinais
clnicos de aviso; neuropatia perifrica
avanada e disautonomia
A recomendao descontinuar o uso de
medicamentos antidiabticos orais e
substitu-los por insulina, antes da gravidez,
ou imediatamente aps seu diagnstico

Paracetamol

Sim

Sim

No

No

O uso de anlogos de insulina de ao


rpida, tais como insulina aspart e lispro,
seguro durante a gravidez, promove melhor
controle dos nveis de glicemia ps-prandial
e menor ocorrncia de hipoglicemia. A
insulina NPH humana e o anlogo de ao
prolongada detemir so seguros e eficazes
para uso durante a gestao

Substncia
Antitireoidianos
Metimazol

Antidepressivos

Anti-inflamatrios

Antibiticos
Quinolonas
(norfloxacino,
moxifloxacino,
ciprofloxacino)

Quadro 5 Recomendaes e concluses.


Recomendaes e concluses

Grau de
recomendao

Pacientes diabticas devem engravidar em


condies metablicas ideais (HbA1c < 6%
ou at 1% acima do valor mximo
informado pelo laboratrio de anlises
clnicas)

Deve-se motivar pacientes a realizar


glicemias capilares antes e 1 h aps as
refeies, ao deitar-se e, esporadicamente,
entre 2 e 4 h da madrugada

(A) Estudos experimentais e observacionais de melhor consistncia; (B)


Estudos experimentais e observacionais de menor consistncia; (C) Relatos
de casos estudos no controlados; (D) Opinio desprovida de avaliao
crtica, com base em consenso, estudos fisiolgicos ou modelos animais.

Referncias bibliogrficas

B
A quantidade de calorias ingeridas deve
basear-se no IMC. O valor calrico total
recomendado deve ser composto por: 40 a
45% de carboidratos, 15 a 20% de protenas
(mnimo de 1,1 mg/kg/dia) e 30 a 40% de
gordura
(continua)

Diretrizes SBD 2015-2016 - CAP 13.indd 80

Deve-se descontinuar o uso de IECA, BRA e A


estatinas, em decorrncia de sua associao
a embriopatias e fetopatias, antes da
gravidez ou assim que esta seja confirmada

1. World Health Organization. Diagnostic criteria and classification of hyperglycaemia first detected in pregnancy. 2013.
2. Negrato CA et al. Dysglycemias in pregnancy: from diagnosis to
treatment. Brazilian consensus statement. Diabetol Metab Syndr.
2010; 2: 27.
3. Albrecht SS et al. Diabetes trends among delivery hospitalizations in the US, 1994-2004. Diabetes Care. 2010; 33(4): 768-73.
4. Ray JG, OBrien TE, Chan WS, Preconception care and the risk
of congenital anomalies in the offspring of women with diabetes
mellitus: a meta-analysis. QJM. 2001; 94(8): 435-44.

05/10/2015 07:00:00

Disglicemias na Gestao | Recomendaes para Preparo e Acompanhamento da Mulher com Diabetes durante a Gravidez 81
5. Diabetes Control and Complications Trial Research Group. Effect of pregnancy on microvascular complications in the Diabetes
Control and Complications Trial. Diabetes Care. 2000; 23: 84-91.
6. Metzger BE et al. International association of diabetes and pregnancy study groups recommendations on the diagnosis and classification of hyperglycemia in pregnancy. Diabetes Care. 2010; 33(3):
676-82.
7. NICE guideline NG3, Diabetes in pregnancy: management of diabetes and its complications from preconception to the postnatal
period. 2015. https://www.nice.org.uk/guidance/ng3. Acessado
em 05/03/2015
8. Kitzmiller JL et al. Managing preexisting diabetes for pregnancy:
summary of evidence and consensus recommendations for care.
Diabetes Care. 2008; 31(5): 1060-79.
9. Mosca A et al. Reference intervals for hemoglobina A1 c in pregnant women: data from an Italian multicenter study. Clin Chem.
2006; 52(6): 1138-43.
10. Jovanovic L et al. Elevated pregnancy losses at high and low extremes of maternal glucose in early normal and diabetic pregnancy: evidence for a protective adaptation in diabetes. Diabetes
Care. 2005; 28(5): 1113-7.
11. Manderson JG et al. Preprandial versus postprandial blood glucose monitoring in type 1 diabetic pregnancy: a randomized
controlled clinical trial. Am J Obstet Gynecol. 2003; 189(2):
507-12.
12. Secher AL et al. Real-time continuous glucose monitoring as a tool
to prevent severe hypoglycaemia in selected pregnant women with
Type 1 diabetes an observational study. Diabet Med. 2014; 31(3):
352-6.
13. Rasmussen KM, Catalano PM, Yaktine AL. New guidelines for
weight gain during pregnancy: what obstetrician/gynecologists
should know. Curr Opin Obstet Gynecol. 2009; 21(6): 521-6.
14. IOM (Institute of Medicine) and NRC (National Research
Council). Weight Gain During Pregnancy: Reexamining the
Guidelines. Washington, DC: The National Academies Press.
2009.
15. Procter SB, Campbell CG. Position of the Academy of Nutrition
and Dietetics: nutrition and lifestyle for a healthy pregnancy outcome. J Acad Nutr Diet. 2014; 114(7): 1099-103.
16. Fitch C, Keim KS. Position of the Academy of Nutrition and Dietetics: use of nutritive and nonnutritive sweeteners. J Acad Nutr
Diet. 2012; 112(5): 739-58.
17. Barua S, Kuizon S, Junaid MA. Folic acid supplementation in pregnancy and implications in health and disease. J Biomed Sci. 2014;
21: 77.
18. Kumareswaran K et al. Physical activity energy expenditure and glucose control in pregnant women with type 1 diabetes: is 30 minutes
of daily exercise enough? Diabetes Care. 2013; 36(5): 1095-101.
19. ACOG Committee opinion. Number 267, Exercise during pregnancy and the postpartum period. Obstet Gynecol. 2002; 99(1): 171.
20. Schwartz RA et al. Glyburide transport across the human placenta. Obstet Gynecol. 2015; 125(3): 583-8.
21. Kovo M et al. Carrier-mediated transport of metformin across
the human placenta determined by using the ex vivo perfusion of
the placental cotyledon model. Prenat Diagn. 2008; 28(6): 544-8.
22. Lambert K, Holt RI. The use of insulin analogues in pregnancy.
Diabetes Obes Metab. 2013; 15(10): 888-900.
23. Mathiesen ER et al. Maternal efficacy and safety outcomes in
a randomized, controlled trial comparing insulin detemir with
NPH insulin in 310 pregnant women with type 1 diabetes. Diabetes Care. 2012; 35(10): 2012-7.
24. Negrato CA et al. Glargine vs. NPH insulin therapy in pregnancies complicated by diabetes: an observational cohort study. Diabetes Res Clin Pract. 2010; 89(1): 46-51.

Diretrizes SBD 2015-2016 - CAP 13.indd 81

25. Pollex E et al. Safety of insulin glargine use in pregnancy: a systematic review and meta-analysis. Ann Pharmacother. 2011;
45(1): 9-16.
26. Ranasinghe PD et al. Comparative effectiveness of continuous
subcutaneous insulin infusion using insulin analogs and multiple daily injections in pregnant women with diabetes mellitus:
a systematic review and meta-analysis. J Womens Health (Larchmt). 2015; 24(3): 237-49.
27. Simmons D et al. Use of insulin pumps in pregnancies complicated by type 2 diabetes and gestational diabetes in a multiethnic
community. Diabetes Care. 2001; 24(12): 2078-82.
28. Cooper WO et al. Major congenital malformations after first-trimester exposure to ACE inhibitors. N Engl J Med. 2006; 354(23):
2443-51.
29. American College of Obstetricians and Gynecologists, ACOG
Practice Bulletin N. 125: Chronic hypertension in pregnancy.
Obstet Gynecol. Abstract. 2012; 119(2 Pt 1): 396-407.
30. Hale TW. Maternal medications during breastfeeding. Clin Obstet Gynecol. 2004; 47(3): 696-711.
31. Tabacova S et al. Atenolol developmental toxicity: animal-to-human comparisons. Birth Defects Res A Clin Mol Teratol. 2003;
67(3): 181-92.
32. Bateman BT et al. Statins and congenital malformations: cohort
study. BMJ. 2015; 350: h1035.
33. Kazmin A, Garcia-Bournissen F, Koren G. Risks of statin use
during pregnancy: a systematic review. J Obstet Gynaecol Can.
2007; 29(11): 906-8.
34. Whitten AE, Lorenz RP, Smith JM. Hyperlipidemia-associated
pancreatitis in pregnancy managed with fenofibrate. Obstet Gynecol. 2011; 117(2 Pt 2): 517-9.
35. Felig P. Maternal and fetal fuel homeostasis in human pregnancy.
Am J Clin Nutr. 1973; 26(9): 998-1005.
36. Young EC et al. Effects of pregnancy on the onset and progression of diabetic nephropathy and of diabetic nephropathy on
pregnancy outcomes. Diabetes Metab Syndr. 2011; 5(3): 137-42.
37. Owens LA et al. Atlantic DIP: closing the loop: a change in clinical practice can improve outcomes for women with pregestational diabetes. Diabetes Care. 2012; 35(8): 1669-71.
38. McNamara JM, Odibo AO. Sonographic evaluation and the pregnancy complicated by diabetes. Curr Diab Rep. 2011; 11(1): 13-9.
39. World Health Organization Collaborative Study Team on the
role of breastfeeding on the prevention of infant mortality. Effect
of breastfeeding on infant and child mortality due to infectious
diseases in less developed countries: A pooled analysis. Lancet.
2000; 355(9202): 451-5.
40. Lund-Blix NA et al. Infant feeding in relation to islet autoimmunity and type 1 diabetes in genetically susceptible children: the
MIDIA Study. Diabetes Care. 2015; 38(2): 257-63.
41. Marseglia L et al. Obesity and breastfeeding: The strength of association. Women Birth. 2015.
42. Hale TW et al. Transfer of metformin into human milk. Diabetologia. 2002; 45(11): 1509-14.
43. Briggs GG et al. Excretion of metformin into breast milk and the
effect on nursing infants. Obstet Gynecol. 2005; 105(6): 1437-41.
44. Feig DS et al. Transfer of glyburide and glipizide into breast milk.
Diabetes Care. 2005; 28(8): 1851-5.
45. Reader D, Franz MJ. Lactation, diabetes, and nutrition recommendations. Curr Diab Rep. 2004; 4(5): 370-6.
46. Visser J, Snel M, Van Vliet HA. Hormonal versus non-hormonal
contraceptives in women with diabetes mellitus type 1 and 2. Cochrane Database Syst Rev. 2013; 3: CD003990.
47. Schwarz EB, Maselli J, Gonzales R. Contraceptive counseling
of diabetic women of reproductive age. Obstet Gynecol. 2006;
107(5): 1070-4.

05/10/2015 07:00:00

Avaliao da Funo Endotelial e


Marcadores Laboratoriais de Estresse
Oxidativo no Diabetes
Introduo
O estresse oxidativo e a disfuno endotelial so considerados
eventos precoces no desenvolvimento de complicaes tanto
micro quanto macrovasculares do diabetes, e poderiam ser
julgados os denominadores comuns por meio dos quais a hiperglicemia, a hipertenso arterial e a dislipidemia atuam na
patognese de tais complicaes.
Define-se estresse oxidativo como o estado de desequilbrio
entre a produo de espcies reativas de oxignio (EROs) e as
defesas antioxidantes, apresentando como consequncias danos
a protenas, carboidratos, lipdios e ao DNA celular. Apresenta-se
aumentado no diabetes, desde as fases iniciais, piorando com a
evoluo da doena. EROs so molculas quimicamente instveis e altamente reativas, produzidas constantemente nos organismos aerbios.1 Funcionam como mensageiros secundrios na
regulao da expresso de genes sensveis ao sinal redox (p. ex.,
gene do fator nuclear kappa-beta [NFB]) e na sntese de molculas fisiologicamente ativas (p. ex., mediadores inflamatrios).
O aumento da glicose intracelular determinante do dano
tecidual causado pelo diabetes, e a participao do estresse
oxidativo nesse processo de grande importncia. Acredita-se
que possa participar como fator desencadeante ou perpetuador do dano celular.
A auto-oxidao da glicose tambm capaz de produzir radicais livres. Postula-se que o nion superxido (O) mitocondrial atue como um fator iniciador de uma cascata de eventos
que resulta em maior produo de EROs e espcies reativas de
nitrognio (ERNs), mediante a ativao do NFB com produo de citocinas inflamatrias, a ativao da proteinoquinase
C (PKC) e da fosfato de nicotinamida adenina dinucleotdio
[NADPH] oxidase. A ativao da PKC regula uma srie de
funes vasculares, tais como permeabilidade vascular, contratilidade, proliferao celular, sntese de matriz extracelular
e transduo de sinais para produo de citocinas. Paralelamente, os principais mediadores das complicaes crnicas
do diabetes (p. ex., hiperglicemia, estresse oxidativo e fatores
inflamatrios) podem levar desregulao de mecanismos
epigenticos, afetando a estrutura da cromatina e a expresso
gnica. A persistncia dessas alteraes epigenticas poderia
ser responsvel pelo mecanismo de memria metablica.

Diretrizes SBD 2015-2016 - CAP 14.indd 82

O nion superxido capaz de inativar o xido ntrico


(NO) derivado do endotlio. Como consequncia, desenvolve-se a disfuno endotelial, considerada a alterao mais precocemente detectvel nas doenas vasculares. Adicionalmente, no endotlio de pacientes diabticos, a xido ntrico sintase
(NOS) pode desviar a produo de NO para produzir O em
condies de deficincia de arginina ou tetraidropterina.1,2
Quando ambos so produzidos, ocorre formao de peroxinitrito (NOO), causador de dano a estruturas celulares.3
Sabe-se que o endotlio um tecido dinmico que apresenta aes crticas para a homeostase sistmica.4 Dentre as
suas principais funes, possvel citar: manuteno da fluidez sangunea, controle do tnus vascular por meio da secreo de substncias vasoativas, regulao da proliferao das
clulas musculares lisas vasculares (VSMC), participao na
reao inflamatria local e hemostasia sangunea.
As EROs so neutralizadas por um sistema antioxidante
que inclui enzimas (superxido dismutase, glutationa peroxidase, catalase) e sistemas no enzimticos (glutation, vitaminas A, C e E). Quantitativamente, albumina e cido rico so
os principais antioxidantes.
Atualmente, vrios fatores plasmticos ou urinrios so
considerados marcadores de disfuno endotelial, podendo
ser utilizados na prtica diria como preditores de doena
cardiovascular. So citados na literatura: o fator de von Willebrand, o inibidor do ativador do plasminognio 1 (PAI-1),
a albuminria, a endotelina 1, a protena C reativa (PCR), a
homocistena e vrios outros associados a coagulao, fibrinlise, inflamao e regulao do tnus vascular.4,5 No entanto,
estudos prospectivos so necessrios para estabelecer a vantagem de utilizarmos tambm esses fatores na estratificao do
risco cardiovascular em conjunto com os fatores clssicos j
estabelecidos.6-8

Marcadores do estresse oxidativo


no diabetes
Um marcador de estresse oxidativo ideal deve ser capaz de fornecer indicao precoce da doena e/ou de sua progresso. Suas
caractersticas devem ser: um produto estvel, no suscetvel

05/10/2015 06:47:33

Avaliao da Funo Endotelial e Marcadores Laboratoriais de Estresse Oxidativo no Diabetes 83

induo por artefatos, oxidao ou perda durante o processamento, a anlise e o armazenamento; acessvel por meio do
tecido-alvo ou de um material biolgico derivado deste tecido;
detectado em concentraes suficientes; especfico da ERO a
ser avaliada e no sofrer interferncia de fatores confundidores derivados da dieta; avaliado de maneira invasiva; especfico, sensvel e reprodutvel; de fcil deteco em estudos populacionais; e apresentar pouca variabilidade intraindividual.9
Sabe-se que h evidncia clnica e experimental do aumento
do estresse oxidativo em ambos os tipos de diabetes, inclusive em suas fases precoces; h, no entanto, controvrsias sobre
qual marcador de estresse oxidativo seria mais confivel e aplicvel na prtica clnica.10

Nitrotirosina
A exposio a EROs em altas concentraes e/ou por tempo
prolongado, principalmente ao peroxinitrito, leva nitrao
de resduos de tirosina (causando modificaes oxidativas de
protenas e resultando em mudanas estruturais e funcionais)
ou, frequentemente, inibio de funo enzimtica ou maior
degradao proteoltica.11 Em estudo experimental, foi demonstrado que enzimas como Mn-superxido dismutase ou
sarcoplasmic reticulum calcium ATPase type 2 (SERCA2), importantes no controle do tnus vascular, so nitradas em um ou
mais locais de tirosina em estados patolgicos, tais como aterosclerose, diabetes, hipertenso arterial sistmica (HAS) induzida por angiotensina-2, assim como no envelhecimento.12
A nitrotirosina, um produto da leso dos peroxinitritos
sobre as protenas, j foi identificada em placas aterosclerticas e um marcador de estresse oxidativo. Nveis plasmticos
aumentados foram descritos no diabetes e no estado de hiperglicemia ps-prandial aguda.13

Isoprostanos e outros marcadores da


peroxidao lipdica
Os isoprostanos constituem uma srie de compostos semelhantes s prostaglandinas formados in vivo por um mecanismo no enzimtico envolvendo peroxidao do cido araquidnico por EROs, independente da ciclo-oxigenase.14 So
produzidos fisiologicamente e podem ser mediadores na regulao do tnus vascular.
A primeira classe de isoprostanos descoberta foi a F2-isoprostano, assim denominada por conter um anel prostano
anlogo prostaglandina F2 alfa (PGF2-alfa).15
A dosagem urinria de 8-epi-PGF2, um dos produtos do
cido araquidnico mais estveis formado por oxidao no
enzimtica, foi associada a estresse oxidativo.16
Outros produtos derivados da peroxidao enzimtica do
cido araquidnico incluem tromboxana B2 e seu metablito
11-deidrotromboxano B2.
O malonildialdedo (MDA), os conjugados dienos e os hidroperxidos lipdicos tambm so considerados marcadores
de peroxidao lipdica. O MDA um cetoaldedo produzido pela decomposio peroxidativa de lipdios insaturados
que apresenta nveis plasmticos aumentados no diabetes,
e foi demonstrado em placas aterosclerticas de pacientes
diabticos.17-19

Diretrizes SBD 2015-2016 - CAP 14.indd 83

Capacidade antioxidante total do plasma


A medida plasmtica direta de EROs difcil, devido alta
reatividade dessas molculas. Alguns estudos tm focado a
medida da capacidade total antioxidante do plasma (total antioxidant buffering capacity of plasma), que reflete a resposta
do sistema antioxidante presena de EROs.
A atividade de enzimas antioxidantes como superxido
dismutase e glutationa peroxidase foi menor em pacientes
com diabetes em comparao com controles, mas no foi associada presena de retinopatia.20

Outros possveis marcadores de estresse


oxidativo
Outro possvel marcador srico de estresse oxidativo encontrado em nveis elevados no diabetes tipo 2 a glutathionyl
hemoglobin, resultado da incubao da hemoglobina e do glutation reduzido com perxido de hidrognio.9
Outra candidata a marcador de estresse oxidativo foi a chamada idade oxidativa, avaliada por Phillips et al. e que demonstrou estar aumentada nos diabetes tipos 1 e 2. Tal ndice
foi calculado pela correo da rea sob a curva da concentrao respiratria de compostos orgnicos volteis avaliados por
cromatografia gasosa, pela idade cronolgica.21
Outros compostos orgnicos avaliados in vitro como possveis indicadores de estresse oxidativo so as substncias reativas do cido tiobarbitrico (TBARS).22
A atividade da enzima paraoxonase do colesterol da lipoprotena de alta densidade (HDL-c) foi menor em pacientes
portadores de diabetes mellitus tipo 1 (DM1) em comparao
com controles, o que poderia predispor a maior oxidao do
colesterol da lipoprotena de baixa densidade (LDL-c).23

Marcadores de leso oxidativa ao DNA


Nveis sricos maiores de 8-hidroxideoxiguanosina (8-OHdG)
foram demonstrados em pacientes com diabetes tipo 2 em
comparao aos controles e relacionados com a presena de
retinopatia.24

Mtodos de avaliao da funo endotelial


em diabticos
A disfuno endotelial aparece como um denominador comum na fisiopatologia das complicaes crnicas no diabetes. Alm disso, ainda necessria uma definio precisa pelo
fato de a clula endotelial apresentar mltiplas funes.25 A
integridade na produo de NO, que evidencia a vasodilatao
dependente do endotlio, pode ser avaliada, sobretudo, por estmulos fisiolgicos, tais como hiperemia reativa ps-oclusiva
e hiperemia trmica e, ainda, por estmulos farmacolgicos,
como a resposta vasodilatora aps a administrao transcutnea de acetilcolina. Por sua vez, a vasodilatao produzida
pela administrao de nitroprussiato de sdio (NPS) ou derivados (doador de NO) reflete a integridade estrutural do vaso;
ou seja, a resposta independente do endotlio.26
O mtodo padro-ouro para a avaliao do fluxo sanguneo in vivo a mensurao por cateter intravascular do fluxo
coronariano por angiografia e por Doppler, ambos invasivos e

05/10/2015 06:47:34

84 Diretrizes SBD | 2015-2016

dispendiosos, acarretando riscos para o paciente, tendo sido


realizada apenas em poucos centros de pesquisa.25 De modo
geral, o custo, a subjetividade, a alta variabilidade e a ausncia
de validao tm reduzido a confiabilidade de outros mtodos
funcionais como a ultrassonografia, a pletismografia e a tomografia com emisso de psitrons.
Em virtude da crescente relevncia da predio do risco
cardiovascular a longo prazo, vem aumentando o interesse
nas tcnicas no invasivas de avaliao da funo endotelial.27
Inmeras tcnicas podem ser utilizadas, dentre as quais a fluxometria por laser-Doppler, a tonometria da artria perifrica
(Endo-PAT) e o laser speckle imagem de contraste (LSCI) despontam como tcnicas no invasivas promissoras.
Atualmente, as sofisticadas tcnicas de imagens para o estudo da funo endotelial tais como a tomografia com emisso de psitrons em trs dimenses, a ressonncia magntica
e a ecografia contrastada apresentam como principal limitao sua aplicabilidade os elevados custos envolvidos.28

Pletismografia de ocluso venosa


Possibilita a mensurao das alteraes do fluxo sanguneo
muscular do antebrao em resposta a manobras fisiolgicas
ou farmacolgicas, representando uma avaliao funcional
dos vasos de resistncia (macro e microcirculao).29 Alm
de constituir uma tcnica, a princpio, no invasiva, as principais vantagens consistem no baixo custo da aparelhagem e
na possibilidade de avaliao da funo endotelial mediante
a infuso intra-arterial (artria radial) de acetilcolina ou metacolina.29 A tcnica foi concebida para utilizao isolada, e a
variabilidade dos resultados ao longo do tempo dificulta sua
utilizao em estudos clnicos com interveno a longo prazo.

Ultrassonografia de alta resoluo |


Vasodilatao da artria braquial
mediada pelo fluxo
Esta tcnica no invasiva, que pode ser correlacionada com a
funo coronariana, avalia a resposta da vasodilatao mediada
pelo fluxo na artria braquial.30 Utiliza-se a hiperemia reativa
ps-oclusiva, que consiste na induo de isquemia no antebrao
e na avaliao da resposta vasodilatadora ps-isqumica pela
medida do dimetro da artria braquial por meio de ultrassonografia. A isquemia induzida com o uso de manguito de presso
arterial inflado pelo menos 30 mmHg acima da presso sistlica
do paciente, durante 3 a 5 min, e a resposta vasodilatadora mxima ocorre aproximadamente de 30 a 60 s aps a rpida liberao da ocluso arterial. O aumento abrupto do fluxo sanguneo
induz aumento de shear stress (foras de cisalhamento), o que
resulta em liberao de xido ntrico. Ao contrrio da pletismografia, essa tcnica avalia essencialmente a funo endotelial
da macrocirculao. Alm disso, caracteriza-se por ser muito
dependente do operador e de execuo laboriosa.

Fluxometria laser-Doppler
Em relao tcnica de ultrassonografia, a fluxometria laserDoppler tem como principais vantagens ser de utilizao simples e possibilitar a obteno de resultados imediatos, alm

Diretrizes SBD 2015-2016 - CAP 14.indd 84

de ser razoavelmente independente do operador.31 No entanto, a variabilidade inter e intraindivduo fica em torno de 20 a
30%.31,32 Alm disso, indica-se a avaliao da funo endotelial
pela utilizao simultnea de testes farmacolgicos (acetilcolina) e fisiolgicos (hiperemias trmica e ps-oclusiva). Na literatura, est descrita a reduo da vasodilatao endotlio-dependente (acetilcolina) nos diabticos tipo 1, quando comparados
com controles.33,34
A avaliao da perfuso tecidual feita mediante o aumento de fluxo sanguneo cutneo, resultante de manobras como
hiperemia reativa e aquecimento local. Essa tcnica, acoplada
iontoforese, oferece a vantagem de avaliar, de maneira no
invasiva, estmulos farmacolgicos no endotlio, por meio
da administrao transdrmica de pequenas quantidades de
substncias vasoativas, usadas em pequena corrente eltrica.
O princpio que rege essa tcnica tem como base a carga positiva ou negativa das molculas da substncia em soluo, que,
desse modo, migram atravs da pele, sob a influncia de uma
corrente monopolar aplicada.26

Laser speckle imagem de contraste


O LSCI surge como uma tcnica recente, de excelente reprodutibilidade,35 til para medir o fluxo sanguneo nos tecidos
em tempo real. Alm disso, torna-se atraente, pois supera a
fluxometria por laser-Doppler, visto que oferece resoluo
espacial e temporal excelentes, podendo ser facilmente combinada com outras modalidades de imagem.36 Essa tcnica
consiste na iluminao do tecido examinado pela luz laser,
que produz um padro randmico de interferncia o padro
speckle na superfcie do tecido. Devido ao alto custo desse aparelho, poucos centros na atualidade dispem dessa tecnologia
mundialmente.37

EndoPATTM
O teste da tonometria arterial perifrica (EndoPAT TM) uma
tcnica destinada avaliao no invasiva da funo endotelial, validada em diversos estudos e com tima reprodutibilidade, alm de j ter sido demonstrada correlao com a
disfuno coronariana.38-41 Esse mtodo tambm possibilita
a avaliao quantitativa da funo endotelial, sendo definidos
valores de normalidade com base no EndoScore, que so calculados automaticamente. Baseia-se na mensurao das alteraes no tnus vascular, mediadas pelo endotlio, captadas
por biossensores colocados nas polpas digitais. Essas alteraes so produzidas com uso de uma resposta hipermica induzida por uma ocluso de 5 min da artria braquial de um
brao. A mensurao no brao contralateral utilizada como
controle simultneo das alteraes no tnus vascular no dependentes do endotlio.38
Quadro 1 Recomendaes e concluses.
Recomendaes e concluses
O controle glicmico da presso arterial e
da dislipidemia diminui o risco de evoluo
para as complicaes crnicas vasculares
do diabetes

Grau de
recomendao
A

(continua)

05/10/2015 06:47:34

Avaliao da Funo Endotelial e Marcadores Laboratoriais de Estresse Oxidativo no Diabetes 85


Quadro 1 Recomendaes e concluses (continuao).
Recomendaes e concluses

Grau de
recomendao

O estresse oxidativo e a disfuno


endotelial so os elementos iniciais na
patognese das complicaes crnicas
vasculares do diabetes

Marcadores de estresse oxidativo tm sido


identificados em pacientes diabticos

Complicaes maiores do diabetes tm


sido associadas ao aumento do estresse
oxidativo, incluindo retinopatia, nefropatia,
neuropatia e doena arterosclertica

A memria celular glicmica e do estresse


oxidativo contribui para que haja
perpetuao dos mecanismos intracelulares
responsveis pela patognese das
complicaes crnicas vasculares do diabetes

A fluxometria laser-Doppler cutnea


indicada para o diagnstico de
microangiopatia diabtica e para a
avaliao de efeitos microcirculatrios de
intervenes teraputicas

B
H correlao estreita entre a funo
endotelial das circulaes coronariana e
perifrica quando esta ltima avaliada na
artria braquial por meio de ultrassonografia
(vasodilatao mediada pelo fluxo)
A avaliao das variaes de fluxo
sanguneo do antebrao por meio de
pletismografia de ocluso venosa fornece
dados referentes funo endotelial macro
e microvascular

Um cut-off do EndoScore de 1,67 fornece


sensibilidade de 82% e especificidade de
77% para diagnosticar disfuno endotelial
coronariana

(A) Estudos experimentais e observacionais de melhor consistncia; (B)


Estudos experimentais e observacionais de menor consistncia; (C) Relatos
de casos estudos no controlados; (D) Opinio desprovida de avaliao
crtica, com base em consenso, estudos fisiolgicos ou modelos animais.

Referncias bibliogrficas
1. Berry C, Brosnan MJ, Fennell J et al. Oxidative stress and vascular damage in hypertension. Curr Opin Nephrol Hypertens.
2001; 10: 247-55.
2. Channon KM, Guzik TJ. Mechanisms of superoxide production
in human blood vessels: Relationship to endothelial dysfunction, clinical and genetic risk factors. J Physiol Pharmacol. 2002;
53(4): 515-24.
3. Ballinger SW, Patterson C, Yan CN et al. Hydrogen peroxide and
peroxynitrite-induced mitochondrial DNA damage and dysfunction in vascular endothelial and smooth muscle cells. Circ
Res. 2000; 86: 960-6.
4. Eliasson A, Cederholm J, Nilsson P, Gudbjornsdottir S for the
Steering Committee of the Swedish National Diabetes Register.
The gap between guidelines and reality: Type 2 diabetes in a national diabetes register 1996-2003. Diabetic Medicine. 2005; 22:
1420-6.

Diretrizes SBD 2015-2016 - CAP 14.indd 85

5. Dawber TR, Meadors G, Moore FEJ. Epidemiological approaches to heart disease. The Framingham Study. Am J Public Health.
1951; 41: 279-86.
6. Pearson TA. New tools for coronary risk assessment. What are
their advantages and limitations. Circulation. 2002;105: 886-92.
7. Wang TJ, Gona P, Larson MG et al. Multiple biomarkers for the
prediction of first major cardiovascular events and death. N Engl
J Med. 2006; 355: 2631-9.
8. Widlansky ME, Gokce N, Keaney Jr. JF et al. The clinical implications of endothelial dysfunction. J Am Coll Cardiol. 2003; 42:
1149-60.
9. Hartnett ME, Stratton RD, Browne RW et al. Serum. Markers of
Oxidative Stress and Severity of Diabetic Retinopathy. Diabetes
Care. 2000; 23: 234-40.
10. Marra G, Cotroneo P, Pitocco D et al. Early increase of oxidative
stress and reduced antioxidant defenses in patients with uncomplicated type 1 diabetes. A case for gender difference. Diabetes
Care. 2002; 25: 370-5.
11. Viappiani S, Schulz R. Detection of specific nitrotyrosine-modified proteins as a marker of oxidative stress in cardiovascular
disease. Am J Physiol Heart Circ Physiol. 2006; 290: 2167-8.
12. Xu S, Ying J, Jiang B et al. Detection of sequence-specific tyrosine nitration of manganese SOD and SERCA in cardiovascular
disease and aging. Am J Physiol Heart Circ Physiol. 2006; 290:
H2220-7.
13. Moriel P, Abdalla DS. Nitrotyrosine bound to beta-VLDLapoproteins: A biomarker of peroxynitrite formation in experimental atherosclerosis. Biochem Biophys Res Commun. 1997; 232:
332-5.
14. Morrow JD, Hill KE, Burk RF et al. Proc Natl Acad Sci USA.
1990; 87: 9383-7.
15. Milne GL, Yin H, Morrow JD. Human Biochemistry of the Isoprostane Pathway. J Biol Chemestry. 2008; 283: (23):15533-7.
16. Roberts LJ, Morrow JD. The generation and actions of isoprostanes. Biochim Biophys Acta. 1997; 1345: 121-35.
17. Peerapatdit T, Likidlilid A, Patchanans N et al. Antioxidant status
and lipid peroxidation end products in patients of type 1 diabetes
mellitus. J Med Assoc Thai. 2006; 89(Suppl 5): S141-6.
18. Likidlilid A, Patchanans N, Peerapatdit T et al. Lipid peroxidation and antioxidant enzyme activities in erythrocytes of type 2
diabetic patients. J Med Assoc Thai. 2010; 93(6): 682-93.
19. Slatter DA, Bolton CH, Bailey AJ. The importance of lipid-derived malondialdehyde in diabetes mellitus [Review]. Diabetologia. 2000; 43: 550-7.
20. Hartnett ME, Stratton RD, Browne RW et al. Serum markers of
oxidative stress and severity of diabetic retinopathy. Diabetes
Care. 2000; 23: 234-40.
21. Phillips M, Cataneo RN, Cheema T et al. Increased breath biomarkers of oxidative stress in diabetes mellitus. Clinica Chimica
Acta. 2004; 344: 189-94.
22. De Zwart LL, Meerman JHN, Commandeur JNM et al. Biomarkers of free radical damage applications in experimental animals
and in humans. Free Radic BiolMed. 1999; 26: 202-26.
23. Mackness B, Durrington PN, Boulton AJ et al. Serum paraoxonase activity in patients with type 1 diabetes compared to
healthy controls. Eur J Clin Invest. 2002; 32: 259-64.
24. Pan HZ, Zhang H, Chang D et al. The change of oxidative stress
products in diabetes mellitus and diabetic retinopathy. Br J Ophthalmol. 2008; 92: 548-51.
25. Bonetti PO, Lerman LO, Lerman A. Endotelial dysfunction: A
marker of atherosclerotic risk. Arterioscler Thromb Vasc Biol.
2003; 23: 168-75.
26. Alam TA, Seifalian AM, Baker DA. Review of Methods Currently
Used for Assessment of in vivo Endothelial Function. European
Journal of Vascular and Endovascular Surgery. 2005; 29: 269-76.

05/10/2015 06:47:34

86 Diretrizes SBD | 2015-2016


27. Cohn JN, Quyyumi AA, Hollenberg NK et al. Surrogate markers for cardiovascular disease: Functional markers. Circulation.
2004; 109(4): 31-46.
28. Struijker-Boudier HAJ, Rosei AE, Bruneval P et al. Evaluation of
the microcirculation and hypertension and cardiovascular disease. European Heart Journal. 2007; 28 (23): 2834-40.
29. Yvonne-Tee GB, Rasool AH, Halim AS et al. Noninvasive assessment of cutaneous vascular function in vivo using capillaroscopy,
plethysmography and laserDoppler instruments: Its strengths and
weaknesses. Clin Hemorheol Microcirc. 2006; 34: 457-73.
30. Al-Qaisi M, Kharbanda RK, Mittal TK et al. Measurement of endothelial function and its clinical utility for cardiovascular risk.
Vasc Health Risk Manag. 2008; 4: 647-52.
31. Turner J, Belch JJ, Khan F. Current concepts in assessment of
microvascular endothelial function using laser Doppler imaging
and iontophoresis. Trends Cardiovasc Med. 2008; 18: 109-16.
32. Tibiri E, Matheus ASM, Nunes B et al. Repeatability of the
evaluation of systemic microvascular endothelial function using
laser Doppler perfusion monitoring: Clinical and statistical implications. Clinics. 2011; 66: 1-6.
33. Gomes MB, Matheus AS, Tibiri E. Evaluation of microvascular endothelial function in patients with type 1 diabetes using
laser-Doppler perfusion monitoring: Which method to choose?
Microvasc Res. 2008; 76: 132-3.

Diretrizes SBD 2015-2016 - CAP 14.indd 86

34. Matheus ASM, Tibiri E, da Silva PB et al. Uric acid levels are
associated with microvascular endothelial dysfunction in patients with Type 1 diabetes. Diabet Med. 2011; 28: 1188-93.
35. Roustit M, Millet C, Blaise S et al. Excellent reproducibility of
laser speckle contrast imaging to assess skin microvascular reactivity. Microv Res. 2010; 80: 505-11.
36. Boas DA, Dunn AK. Laser speckle contrast imaging in biomedical optics. J Biomed Opt. 2010; 15 (10): 11-7.
37. Millet C, Roustit M, Blaise S et al. Comparison between laser
speckle contrast imaging and laser Doppler imaging to assess
skin blood flow in humans. Microvascular Research. 2011; 82:
147-51.
38. Bonetti PO, Pumper GM, Higano ST et al. Noninvasive identification of patients with early coronary atherosclerosis by
assessment of digital reactive hyperemia. JACC. 2004; 44:
2137-41.
39. Kuvin JT, Mammen A, Mooney P et al. Assessment of peripheral
vascular endothelial function in the ambulatory setting. Vascular
Medicine. 2007; 12: 13-6.
40. Reisner Y, Lusky R, Shay-El Y et al. Reproducibility of endothelial function and arterial stiffness assessed using finger peripheral
arterial tonometry. EHJ. 2007; 28 (Suppl.): 484.
41. Flammer AJ, Anderson T, Celermajer DS et al. The assessment of
endothelial function. Circulation. 2012; 126: 753-67.

05/10/2015 06:47:34

Transtornos Alimentares |
Diagnstico e Conduta
Introduo
Transtornos alimentares caracterizam-se por graves distrbios
nos hbitos ou no comportamento alimentar, podendo estar associados a distrbios da imagem corporal. So classificados nas
doenas psiquitricas (Diagnostic and Statistical Manual of Mental Disorders DSM-IV) e na CID 10 (Classificao Internacional
de Doenas) como bulimia, anorexia e transtornos alimentares
no especificados (TANEs). No DSM-V, lanado recentemente, o
transtorno compulsivo alimentar (TCA) tornou-se reconhecido
tambm como um distrbio alimentar (Quadro 1) (D).1,2
A natureza crnica do diabetes poderia predispor ao desenvolvimento de distrbios alimentares (Figura 1), especialmente
na adolescncia. A correlao entre transtornos alimentares e
diabetes provavelmente relacionada com a insatisfao com
a imagem corporal e com o desejo de perder o peso que pode
ser adquirido com o uso de insulina. Alm disso, pensamentos obsessivos sobre comida e a crena de que diabetes deve
ser enfrentado como um desafio dirio para o seu autocontrole
podem contribuir. Pessoas com diabetes tm a oportunidade
nica de manipular deliberadamente as dosagens de insulina
para controlar o peso. Tal prtica passou a ser conhecida com
o nome de diabulimia, atualmente reconhecida pela comunidade cientfica.
A prevalncia de portadores de diabetes mellitus tipo 1
(DM1) nas adolescentes e nas jovens adultas que apresentam
transtornos de aproximadamente 7 a 11% (B)3 (A);4 j nos
portadores de tipo 2 (DM2), varia de 6,5 a 9%. A bulimia e os
TANEs com variedade compulsivo purgativa so mais prevalentes nos diabticos tipo 1 e TCA nos diabticos tipo 2 (em
torno de 59,4%) (A)4 (C)5 (A).6
Em pesquisa recente realizada em um centro de tratamento de transtornos alimentares com uma amostra de 2.342
pacientes pareados com populao em geral (N = 9.638),
verificou-se que antes de entrar para o tratamento de transtornos alimentares, o risco de diabetes tipo 2 foi substancialmente aumentado em pacientes comparados com os
controles. No final do perodo de estudo, a prevalncia de
diabetes tipo 2 foi de 5,2% entre os pacientes, 1,7% entre os
controles e, em pacientes do sexo masculino, foi significativamente maior em comparao com as mulheres. Daqueles
tratados para o TCA, a cada trs havia um caso de diabetes
tipo 2 at o final do perodo de estudo (A).7 Estudos atuais demonstraram que adolescentes portadores de DM1 do

Diretrizes SBD 2015-2016 - CAP 15.indd 87

sexo feminino e masculino apresentam mais sintomas de


bulimia e comportamentos bulmicos quando comparados
aos no diabticos. ndice de massa corporal (IMC) mais
elevado e pior controle glicmico tm sido apontados tambm como fatores significativos na ocorrncia de transtornos alimentares.8
Comorbidades psiquitricas tais como depresso, ansiedade e distrbios de personalidade podem ocorrer, agravando o quadro clnico, sobretudo quando presente no paciente
diabtico (C).9
As consequncias dos transtornos alimentares so graves,
podendo levar inclusive ao bito e, no caso dos portadores de
diabetes, podem ser a causa do mau controle e do surgimento
mais precoce de complicaes crnicas (A).8
O Diabetes Control and Complications Trial (DCCT) mostrou evidncias de que tende a ser mais difcil obter o controle metablico nos adolescentes diabticos. Fatores relativos
prpria puberdade, familiares e psicossociais esto envolvidos
(A).10 Na presena de transtornos alimentares, so observados
nveis mais altos de hemoglobina glicada (HbA1c), atraso de
crescimento fsico e puberal, cetoacidoses recorrentes, hipoglicemias graves e a instalao de complicaes crnicas microvasculares mais precoces (A).10,11 A durao da omisso de insulina tem sido demonstrada em estudos, de modo significativo,
como o fator que mais se associa ao aparecimento de retinopatia
e nefropatia diabtica em jovens portadoras de DM1 (A).12

Anorexia e diabetes mellitus


Anorexia (AN) representada por uma distoro da imagem
corporal, em que ocorre medo mrbido de engordar e, na
maioria das vezes, restrio e/ou seleo de alimentos. Modificaes no comportamento alimentar, como a realizao constante de diferentes tipos de dieta com o objetivo de perda de
peso, tambm podem ser fatores predisponentes de anorexia.
No quadro clnico, ocorre perda de peso importante, geralmente maior que 15% do peso ideal, caracterizando-se por um
ndice de massa corporal (IMC) menor ou igual a 17,5 kg/m,
acompanhado de distrbio de imagem corporal. No sexo feminino, de acordo com os parmetros atuais do DSM-V, devem ser
investigados ciclos menstruais irregulares (no sendo necessria a
presena de amenorreia de pelo menos 3 meses); no sexo masculino, pode estar presente diminuio da libido (A).2 A anorexia
classificada como restritiva ou purgativa (ver Quadro 1).

05/10/2015 06:47:56

88 Diretrizes SBD | 2015-2016


Quadro 1 Classificao das doenas pela Diagnostic and
Statistical Manual of Mental Disorders (DSM-V), novos critrios.

Sentimentos negativos
sobre o peso e a forma
corporal

Critrios diagnsticos para anorexia nervosa


A. Restrio da ingesta calrica com relao s necessidades,
levando a um peso corporal significativamente baixo no
contexto de idade, gnero, trajetria do desenvolvimento e
sade fsica. Peso significativamente baixo definido como
inferior ao peso mnimo normal ou, no caso de crianas e
adolescentes, menor que o minimamente esperado
B. Medo intenso de ganhar peso ou engordar ou presena de
comportamentos persistentes que interferem no ganho de
peso, mesmo estando com o peso significativamente baixo
C. Perturbao no modo como o prprio peso ou a forma
corporal so vivenciados, influncia indevida do peso ou da
forma do corpo sobre a autoavaliao, ou ausncia
persistente de reconhecimento da gravidade do baixo peso
corporal atual
Para notificao, de acordo com a CID-10:
F 50.01 Tipo restritivo: durante os ltimos 3 meses de anorexia
nervosa, o indivduo no se envolveu regularmente em um
comportamento de comer compulsivamente ou de purgao
(i. e., autoinduo de vmito ou uso indevido de laxantes,
diurticos ou enemas). Esse subtipo descreve apresentaes
nas quais a perda de peso seja conseguida essencialmente por
meio de dieta, jejum e/ou exerccio excessivo.
F 50.02 Tipo de compulso alimentar purgativa: durante os
ltimos 3 meses de anorexia nervosa, o indivduo envolveu-se
em episdios de compulso alimentar purgativa (i. e.,
autoinduo de vmito ou uso indevido de laxantes, diurticos
ou enemas)
Critrios diagnsticos para bulimia nervosa
A. Episdios recorrentes de compulso. Um episdio de
compulso alimentar caracterizado pelos seguintes aspectos:
Ingesto em um determinado perodo de tempo (p. ex.,
a cada 2 h) de uma quantidade de alimentos
definitivamente maior do que a maioria das pessoas
consumiria durante um perodo similar e sob
circunstncias similares
Sentimento de falta de controle sobre o comportamento
alimentar durante o episdio (p. ex., incapacidade de
parar de comer ou de controlar o que ou quanto est
comendo)
B. Comportamentos compensatrios inadequados e
recorrentes, a fim de evitar aumento de peso, tais como
autoinduo de vmito, uso indevido de laxantes,
diurticos, enemas ou outros medicamentos, jejuns ou
exerccios excessivos
C. A compulso alimentar e os comportamentos
compensatrios inapropriados ocorrem, em mdia, pelo
menos 1 (uma) vez por semana, durante 3 meses
D. A autoavaliao indevidamente influenciada pela forma e
pelo peso do corpo
E. O distrbio no ocorre exclusivamente durante episdios
de anorexia nervosa
Especificar a gravidade: leve (mdia de 1 a 3 episdios de comportamentos
inapropriados por semana); moderada (mdia de 4 a 7 episdios de
comportamentos inapropriados por semana); grave (mdia de 8 a 13
episdios de comportamentos inapropriados por semana); extrema (mdia
de 14 ou mais episdios de comportamentos inapropriados por semana).

Diretrizes SBD 2015-2016 - CAP 15.indd 88

Diminuio no
autocuidado do
diabtico e uso
da insulina

Depresso/
ansiedade

Energia
Libido
Autoestima
Concentrao

Isolamento social
Irritabilidade
Alta taxa de
acar no sangue
Culpa
Sigilo
Medo
Sentimento de
desamparo

Energia
Sono

Figura 1 Diabetes tipo 1 e transtornos alimentares (Ann GoebelFabbri; PhD).

No paciente com DM1 com anorexia, a alimentao irregular ou perodos de jejum podem levar a quadros frequentes
e graves de hipoglicemia. A prtica exagerada de exerccios
fsicos tambm pode causar episdios hipoglicmicos, nos
quais deve ser observada a durao da atividade, visto que a
hipoglicemia pode ser tardia (4 a 5 h aps). Quando a anorexia
do tipo purgativo, so realizadas formas de compensao,
tais como vmito, uso de laxantes e diurticos e, mais frequentemente, manipulao da dose de insulina, como diminuio
ou omisso da dose, podendo causar cetoacidose diabtica
(B)13 (C).14,15 Quando os nveis de glicemia esto elevados de
maneira crnica, tambm podem ocorrer perodos de amenorreia ou de alterao da menstruao, bem como retardo
no desenvolvimento e dos caracteres sexuais secundrios
(atraso puberal).

Bulimia e diabetes mellitus


A bulimia nervosa (BN) o transtorno alimentar mais frequente em pacientes diabticos com DM1, podendo ocorrer
em cerca de 30% das jovens portadoras da doena (1% em
diabticas na faixa etria de 9 aos 13 anos, 14% dos 12 aos 18
anos e 34% nas jovens de 16 aos 22 anos) (B)3,4 (C)12 (B).13 Na
bulimia ocorre uma tentativa de compensao aps a ingesto
alimentar, sendo dividida em dois tipos: purgativa e no purgativa. A purgativa caracteriza-se nos portadores de DM1 pela
alterao deliberada da dose de insulina, diminuindo a dose
ou deixando de us-la visando perda de peso. Pode ocorrer
tambm a prtica de vmitos, uso de laxantes, enemas e/ou
diurticos.1,2,15
A omisso de insulina est includa como uso imprprio
de medicamentos para a perda de peso no DSM-IV para os
critrios de bulimia e TANE (A).1 A forma no purgativa caracteriza-se pela prtica de atividade fsica excessiva, objetivando tambm conseguir perder peso.
No DSM-V (A)2 houve uma pequena mudana, aparecendo com a seguinte descrio: indivduos com anorexia nervosa
podem fazer uso abusivo de medicamentos como, por exemplo,

05/10/2015 06:47:57

Transtornos Alimentares | Diagnstico e Conduta 89

pela manipulao de dosagem, a fim de conseguir perda de peso


ou evitar aumento de peso. Indivduos com diabetes mellitus
podem omitir ou reduzir as doses de insulina, a fim de minimizar o metabolismo de carboidratos.
Pacientes portadores de diabetes com bulimia apresentam
frequncia maior de internaes devido a complicaes agudas, tais como episdios recorrentes de cetoacidose e hipoglicemias graves e tambm complicaes crnicas, especialmente retinopatia, nefropatia e neuropatia diabticas.11,15

Transtorno compulsivo alimentar e


diabetes mellitus
O TCA foi aprovado para incluso no DSM-V como sua prpria categoria de transtorno alimentar. Transtorno de compulso alimentar definido como episdios recorrentes de comer
significativamente mais alimentos em um curto perodo de
tempo do que a maioria das pessoas consumiria sob circunstncias similares, com episdios marcados por sentimentos de
falta de controle. Um indivduo com transtorno de compulso
alimentar pode comer muito rapidamente, mesmo sem fome.
A pessoa pode apresentar sentimentos de culpa, vergonha ou
desgosto e pode comer sozinha para ocultar o comportamento.
Os episdios de compulso ocorrem, em mdia, pelo menos
1 vez/semana, durante 3 meses.
mais comum em pacientes com DM2, sendo que pode estar associada a um quadro de sobrepeso ou obesidade, ou at
mesmo preced-lo (C).5 O TCA tem sido relatado em 1/3 dos
indivduos que esto em tratamento para o controle de peso, e
a prevalncia nos diabticos estudada em vrios grupos varivel: 30 a 59,4% (A).4 Os pacientes com TCA comem compulsivamente, mas no fazem nenhuma prtica compensatria, apresentando grande sentimento de culpa posteriormente (A).1,2
Isto dificulta o controle do diabetes e a perda de peso, promovendo de modo mais precoce o aparecimento de complicaes agudas e crnicas, em que a cardiopatia uma das principais responsveis pela morte do portador de DM2.

Transtorno alimentar no especificado


A categoria transtorno alimentar aplica-se a apresentaes em
que sintomas caractersticos de um transtorno alimentar causam sofrimento clinicamente significativo ou prejuzo no funcionamento social, profissional ou em outras reas importantes
da vida do indivduo; predominam, mas no satisfazem todos
os critrios para qualquer transtorno alimentar especfico.2

Causas provveis para o desenvolvimento


de transtornos alimentares em pacientes
com diabetes tipo 1
Ganho de peso e consequente insatisfao com o
corpo, possivelmente associado a insulinoterapia
efetiva e intensiva no momento do diagnstico
Durante perodos de mau controle metablico costuma ocorrer
perda de peso e, para algumas jovens no perodo pr-puberal
ou puberal, essa perda de peso pode ser plenamente desejvel.

Diretrizes SBD 2015-2016 - CAP 15.indd 89

A introduo de insulina em mltiplas doses visando melhora


do controle metablico (glicmico) pode levar a ganho de peso,
afetando negativamente a adolescente.10,12

Manejo nutricional do diabetes


Dietas mais tradicionais para o controle do diabetes com base
em pores e quantidades restritas de alimentos, assim como
dietas mais flexveis para o plano alimentar (p. ex., contagem
de carboidratos), podem ser percebidas por muitas jovens
como um tipo de restrio.16,17

Fatores psicolgicos e enfrentamento dos pais


Na fase da adolescncia, ocorrem confrontos e necessidade
de questionamentos. Como modo de controle, o jovem com
diabetes passa a estabelecer esse mecanismo por meio do uso
inadequado da insulina.
A omisso deliberada de insulina ou manipulao da dose
como um meio para o controle de peso so fatores frequentes como mtodo de purgao entre as jovens portadoras de
diabetes; de 15 a 39% omitem ou reduzem a dose de insulina
como maneira de perder peso.18,19

Sinais e sintomas de alerta para o


diagnstico de transtorno alimentar no
paciente com diabetes
importante que a equipe multiprofissional esteja atenta para
os seguintes sinais e sintomas de alerta:












Episdios recorrentes de cetoacidose diabtica (CAD)/hiperglicemia e/ou de hipoglicemias


Nveis sempre elevados de HbA1c
Atraso na puberdade ou maturao sexual ou menstruao
irregular
Idas frequentes ao banheiro, sobretudo aps alimentaes
Episdios frequentes de infeces
Nuseas e dores de estmago
Atraso na cicatrizao de infeces/contuses
Problemas dentrios (perda do esmalte)
Flutuaes no peso/perda grave ou ganho rpido de peso
sem explicaes clnicas
Osteopenia e/ou osteoporose
Anemia e outras deficincias vitamnicas e de eletrlitos
Incio precoce das complicaes, especialmente neuropatia,
retinopatia e nefropatia
Presena de comorbidades psiquitricas, tais como depresso, ansiedade ou outros como, por exemplo, personalidade
borderline
Pedidos frequentes para mudar o plano alimentar
Insistncia na autoadministrao de insulina de maneira
privada
A crena fundamental de que a insulina faz engordar
Conhecimento enciclopdico do teor de carboidratos dos
alimentos
Caso ocorra concomitante com hipotireoidismo: uso abusivo de levotiroxina
Uso abusivo de metformina.

05/10/2015 06:47:57

90 Diretrizes SBD | 2015-2016

Conduta teraputica
Quanto mais precocemente o transtorno alimentar for diagnosticado e tratado, melhor o prognstico de cura. Deve-se
determinar, no momento do diagnstico, se h risco vida e
necessidade de hospitalizao.
O tratamento deve ser feito com equipe multiprofissional,
sendo a presena da nutricionista fundamental no acompanhamento do paciente e em torno da reeducao sobre o alimento.
Alm disso, h necessidade do tratamento psicoterpico individual com o intuito de trabalhar autoestima e imagem corporal e
estabelecer um apoio psicolgico famlia (B)20 (B).21
Na anorexia, a terapia envolve trs fases principais: (1) restituio do peso perdido, utilizando-se, quando necessrio, suplementos alimentares e reposio vitamnica; (2) tratamento
de distrbios psicolgicos, tais como distoro da imagem
corporal, baixa autoestima e conflitos interpessoais. Orientao deve ser dada ao paciente e famlia quanto necessidade
de reduzir ou parar a atividade fsica (B).20 Medicaes antidepressivas devem ser evitadas na fase inicial do tratamento, pois
a recuperao de peso corporal tambm diminui os sintomas
de depresso. Quando necessrio, os indicados so os inibidores de recaptao da serotonina (A)20 (A).21
Na bulimia, o primeiro objetivo do tratamento consiste na
reduo dos comportamentos de compulso alimentar e purgativos. Psicoterapia individual, principalmente a cognitivo-comportamental ou interpessoal, alm da terapia familiar, est indicada como mais efetiva no tratamento do quadro de bulimia.
Deve-se associar o tratamento psicoterpico ao medicamentoso
para melhora do comportamento de compulso-purgao. Os
inibidores da recaptao da serotonina, como a fluoxetina, so
teis para o tratamento de depresso, ansiedade, obsesses e,
em doses mais elevadas (p. ex., 60 a 80 mg), so considerados
seguros e ajudam na reduo da compulso no apenas na bulimia, como tambm nos quadros de TCA (D)21 (B).22
O topiramato, frmaco estabilizador do humor, tambm
tem sido utilizado como coadjuvante no tratamento do quadro de compulso alimentar (B)20 (B).21,22
Indivduos com transtornos alimentares frequentemente
no reconhecem ou admitem que esto doentes. Isso mais difcil ainda de ser percebido pelo paciente e pela prpria famlia
quando o diabetes tambm est presente. Como resultado, podem ocorrer hipoglicemias e/ou quadros de cetoacidose diabtica recorrentes, dificuldades para controle metablico adequado
(hemoglobinas glicadas elevadas) e instalao de complicaes
crnicas mais precoces, tais como retinopatia, nefro e neuropatia diabticas. fundamental que a equipe multidisciplinar que
atende ao paciente diabtico (mdico, nutricionista, enfermeira,
psicloga, dentista) esteja atenta e apta para a suspeita da presena de um transtorno alimentar (B)20 (A)22 (B).23-26

Referncias bibliogrficas
1. American Psychiatric Association (APA). Diagnostic and statistical manual of mental disorders. 4 ed. Washington DC,
1994. (D)
2. American Psychiatric Association. Diagnostic and statistical
manual of mental disorders. 5 ed. May 2013.
3. Jones JM. Prevalence of eating disorders in girls with type 1 diabetes. Diabetes Spectrum. 2002; 15(2): 86-9. (B)

Diretrizes SBD 2015-2016 - CAP 15.indd 90

4. Jones JM, Lawson ML, Daneman D et al. Eating disorders in adolescent females with and without type 1 diabetes: cross sectional
study. BMJ. 2000; 320: 1563-6. (A)
5. Herpertz ST, Albus Ch, Wagener R et al. Comorbidity of diabetes
mellitus and eating disorders: Does diabetes control reflect disturbed eating behavior? Diabetes Care. 1998; 21:1-7. (C)
6. Herpetz S, Albus C, Lichtblau K et al. Relationship of weight and
eating disorders in type 2 diabetic patients: A multicenter study.
Int J Eat Disord. 2000; 28: 68-77. (A)
7. Raevuori A, Suokas J, Haukka J et al. Highly increased risk of
type 2 diabetes in patients with binge eating disorder and bulimia nervosa. Int J Eat Disord. 2014; 00: 000-000. (A)
8. Hsu YYA et al. Disturbed eating behaviors in Taiwanese adolescents with type 1 diabetes mellitus: a comparative study. Pediatr.
Diabetes. 2009 Feb; 10(1): 74-81. (A)
9. Papelbaum M, Moreira RO, Ellinger VCM et al. Comorbidade psiquitrica no paciente diabtico. Psiq Prat Med. 2001; 34(3): 82-5. (C)
10. The DCCT Research Group. The effect of intensive treatment of
diabetes on the development and progression of long term complications in insulin-dependent diabetes mellitus. N Engl J Med.
1993; 329: 977-86. (A)
11. Rydall AC, Rodin GM, Olmsted MP et al. Disordered eating beaviour
and microvascular complications in young women with insulin dependent diabetes mellitus. N Engl J Med. 1997; 336: 1849-53. (C)
12. Rydall A. Effects of eating disorders in adolescent girls and young
women with type 1 diabetes. Diabetes Spectrum. 2002; 15(2):
90-4. (B)
13. Takii M, Uchigata Y et al. The relationship between the age of onset of type 1 diabetes and the subsequent development of a severe
eating disorder by female patients. Pediatr Diabetes. 2010 Aug 18.
PubMed PMID: 20723101. (A)
14. Criego A. Eating disorders and diabetes: screening and detection. Diabetes Spectrum. 2009; 22(3) 144-6. (B)
15. Takii M et al. The duration of severe Insulin omission is the factor most closely associated with the microvascular complications
of type 1 diabetic females with clinical eating disorders. Int J Eat
Disord. 2008; 41: 259-64. (B)
16. Daneman D. Eating disorders in adolescent girls and young adult
women with type 1 diabetes. Diabetes Spectrum. 2002; 15(2):
83-5. (B)
17. Affenito SG, Backstrand JR, Welch GW et al. Subclinical and
clinical eating disorders in iddm negatively affect metabolic control. Diabetes Care. 1997; 20: 182-4. (C)
18. Sztainer-Neumark D, Patterson J, Mellin A et al. Weigth control
practices and disordered eating behaviours among adolescent females and males with type 1 diabetes. Diabetes Care. 2002; 25(8):
1289-96. (C)
19. PolonsKy WP, Anderson, BJ, Aponte JA et al. Insulin omission in
females with IDDM. Diabetes Care. 1994; 17: 1178-85. (A)
20. American Psychiatric Association (APA) Work Group on Eating
Disorders. Practice Guidelines for treatment of patients with eating disorders, 2002. (B)
21. Marcus M. Adapting treatment for patients with binge-eating disorder. In: Garner D, Garfinkel P (Eds.). Handbook of treatment for
eating disorders. New York: The Guilford Press, 1997; 484-93. (B)
22. Agras WS. Pharmacotherapy of bulimia nervosa and binge eating disorder: longer-term outcomes. Psychopharmacology Bulletin. 1992; 33(3): 433-6. (B)
23. Davison K. Eating disorders and diabetes: current perspectives.
Canadian Journal of Diabetes. 2003; 27(1): 62-73. (A)
24. Goebel-Fabri AE et al. Improvement and emergence of insulin
restriction in women with type 1. Diabetes Diabetes Care. 2011;
34: 545-50. (A)
25. Schmitt TL. Disordered eating in adolescent females with T1DM.
Nurse Pract. 2012 Sep 10; 37(9): 38-42.
26. Markowitz JT et al. Brief screaning tool for disordered eating in
diabetes. Diabetes Care. 2010; 33: 495-501.

05/10/2015 06:47:57

Princpios para Orientao


Nutricional no Diabetes Mellitus
Terapia nutricional | Princpios bsicos
A importncia da terapia nutricional (TN) no tratamento do
diabetes mellitus tem sido enfatizada desde a sua descoberta,
bem como sua funo desafiadora na preveno, no gerenciamento da doena existente e na preveno do desenvolvimento das complicaes decorrentes.1,2
Evidncias cientficas tm demonstrado que a interveno
nutricional apresenta impacto importante na reduo da hemoglobina glicada (HbA1c) em pessoas com diabetes tipos 1 e
2, aps 3 a 6meses de seguimento com profissional especialista, independentemente do tempo de diagnstico da doena.3,4
Sabe-se tambm que, quando associado a outros componentes do cuidado em diabetes, o acompanhamento nutricional
pode melhorar ainda mais os parmetros clnicos e metablicos, decorrentes da melhor aderncia ao plano alimentar
prescrito.1,46
Embora o aparecimento do diabetes mellitus tipo 1(DM1)
no seja evitvel, o diabetes mellitus tipo 2 (DM2) pode ser
retardado ou prevenido, por meio de modificaes de estilo de
vida, que incluem dieta e atividade fsica. Apesar de a suscetibilidade gentica parecer desempenhar um papel importante
na ocorrncia do DM2, a atual epidemia provavelmente reflete mudanas no estilo de vida, caracterizadas pelo aumento
da ingesto energtica e reduo da atividade fsica que, em
conjunto com sobrepeso e obesidade, parecem exercer papel
preponderante no aparecimento do diabetes.2,79
As recomendaes para o manejo nutricional do diabetes
mellitus tm como base a melhor evidncia cientfica disponvel, aliada experincia clnica, e so publicadas periodicamente pelas sociedades cientficas internacionais e nacionais. Nesse
sentido, os guias da American Diabetes Association, Diabetes
Care Advisory Comitee of DM (UK), Canadian Diabetes Association e The Royal Australian College sobre o tratamento do
diabetes enfatizam que alcanar as metas de tratamento propostas nessa doena crnica requer esforo, o qual envolve a equipe
de sade composta por educadores em diabetes mellitus, nutricionista especializado e a pessoa com diabetes.2,79
A conduta nutricional preconizada atualmente para pessoas com DM 1 e 2, pr-diabetes e diabetes gestacional (DMG),
baseia-se em alimentao variada e equilibrada que atenda s
necessidades nutricionais, considerando todas as fases da vida.
A TN tem como foco a manuteno/obteno de peso saudvel,
metas de controle, buscando glicemias estveis tanto no jejum

Diretrizes SBD 2015-2016 - CAP 16.indd 91

quanto nos perodos pr e ps-prandiais, nveis de lipdios sricos e pressricos adequados, bem como o uso de frmacos para
a preveno de complicaes de curto e mdio prazos.2,79
A nutrio equilibrada estabelecida a partir de concentraes adequadas de macronutrientes e micronutrientes, prescritos de maneira individualizada, deve basear-se nos objetivos
do tratamento. A ingesto diettica recomendada (Quadro1)
segue recomendaes semelhantes quelas definidas para a
populao geral, considerando todas as faixas etrias.10

Educao nutricional em diabetes


Educao para autogesto do diabetes o processo de facilitar
conhecimentos, habilidades e capacidades necessrios para o
autocuidado da doena. Os objetivos globais da educao em
diabetes so apoiar a tomada de deciso, comportamentos de
autogerenciamento, resoluo de problemas e colaborao ativa
com a equipe de sade, para melhorar os resultados clnicos,
estado de sade e qualidade de vida de uma maneira eficaz em
termos de custos.2
A American Association of Diabetes Educators (AADE) relata que a construo de comportamentos saudveis apropriada
para um programa de autogerenciamento do diabetes, servindo como base para pessoas com a doena incorporarem uma
alimentao saudvel em seu autocuidado e estilo de vida. Essa
construo apoia mudanas na dieta e atividade fsica e tem como
objetivo conseguir a perda de peso ou manuteno. Educar as
pessoas com diabetes a seguir um plano de alimentao saudvel
deve ser prioridade para todos os programas de diabetes.11
Indivduos com DM tipos 1 e 2 e seus familiares devem
ser inseridos em programa de educao nutricional a partir
do diagnstico, mediante conscientizao da importncia do
autocuidado e da independncia quanto a decises e atitudes
em relao alimentao para o controle do DM (B).2 Educao nutricional faz parte do plano alimentar como ferramenta
para otimizar a aderncia terapia nutricional. Por meio do
conhecimento possvel, para o portador de diabetes, compreender a importncia e a influncia dos alimentos na homeostase glicmica e preveno de complicaes tardias.11,12
Estratgias educacionais incluem atividades em grupos
operativos, oficinas e palestras. A alimentao est diretamente relacionada com questes psicossociais e culturais, sendo,
portanto, necessrio que essas abordagens estejam inseridas
no processo educativo (C).12

06/10/2015 09:52:37

92 Diretrizes SBD | 2015-2016


Quadro 1 Composio nutricional do plano alimentar indicado
para pessoas com diabetes mellitus.2,6,8-11
Macronutrientes

Ingesto recomendada/dia

Carboidratos (CHO)

Carboidratos totais: 45 a 60%


No inferiores a 130 g/dia

Sacarose

At 10%

Frutose

No se recomenda adio nos


alimentos

Fibra alimentar

Mnimo 14 g/1.000 kcal


DM2: 30 a 50 g

Gordura total (GT)

25 a 35% do VET

cidos graxos saturados (AGS)

< 7% do VET

cidos graxos
poli-insaturados (AGPI)

At 10% do VET

cidos graxos
monoinsaturados (AGMI)

5 a 15% do VET

Colesterol

< 300 mg/dia

Protena

15 a 20% do VET*

Micronutrientes

Ingesto recomendada/dia

Vitaminas e minerais

Segue as recomendaes da
populao no diabtica

Sdio

At 2.000 mg

*VET:

valor energtico total considerar as necessidades in dividuais,


utilizando parmetros semelhantes aos da populao no diabtica, para
todas as faixas etrias.

Os profissionais responsveis pela educao devem ser treinados no somente em DM, mas, principalmente, em educao
em sade/nutrio. Tcnicas educativas devem ser diferenciadas de acordo com as caractersticas do indivduo, como idade,
escolaridade e tempo de diagnstico. um processo contnuo
e tem como objetivos: adeso ao plano alimentar prescrito; independncia quanto a trocas alimentares; atitudes e decises
em situaes no rotineiras e conscientizao da influncia das
escolhas alimentares no controle glicmico e na preveno de
complicaes agudas e crnicas. Educao nutricional a estratgia que confere melhor qualidade de vida e reduo de custos
institucionais (B).2

Preveno de diabetes mellitus tipo 2


O alerta mundial para a preveno do DM2 reforado pelo
substancial aumento na prevalncia dessa doena nas ltimas dcadas. A TN um componente integrante na preveno do diabetes, tendo sua importncia reconhecida por entidades cientficas
como um componente essencial para um estilo de vida saudvel.2
Indivduos em risco de desenvolver DM2 devem ser estimulados a mudanas de estilo de vida, a partir de programas educativos baseados em perda moderada de peso corporal e prtica
semanal de atividade fsica (150min/semana) (A). As estratgias nutricionais incluem reduo energtica e de gorduras (A),
ingesto de 14g fibras/1.000kcal, mediante oferta de gros integrais, leguminosas, hortalias e frutas (B), e limitar a ingesto de
bebidas aucaradas (B).2 Tais medidas devem ser pactuadas de
acordo com a realidade sociocultural do indivduo.

Diretrizes SBD 2015-2016 - CAP 16.indd 92

Balano energtico
Para adultos com sobrepeso ou obesos com DM2 ou em risco
para o diabetes, reduzir o consumo de energia, mantendo um
padro alimentar saudvel, recomendado para promover a
perda de peso (A).2
Modesta perda de peso pode fornecer benefcios clnicos
em alguns indivduos com diabetes, especialmente aqueles no
incio do processo da doena. Para conseguir a perda de peso
modesta, as intervenes de estilo de vida intensivo, como
aconselhamento sobre TN, atividade fsica e mudana de comportamento, com apoio contnuo, so recomendados (A).2
Estudos de perda de peso tm usado uma variedade de padres alimentares de restrio calrica, sem evidncia clara de
um padro ideal do que comer ou de distribuio de macronutrientes, sugerindo que as propores de macronutrientes
devem ser individualizadas.13,14
Estima-se que 80 a 90% das pessoas com DM2 esto com
sobrepeso ou obesidade. Portanto, estratgias que incluem restrio de energia para alcanar perda de peso so uma considerao primria. Uma modesta perda de peso, de 5 a 10%
do peso corporal inicial, pode melhorar substancialmente a
sensibilidade insulina, o controle glicmico, a hipertenso e
a dislipidemia nos indivduos com DM2 e naqueles em risco
de desenvolver a doena. A sustentabilidade da perda de peso
mantm os benefcios de preveno do diabetes. Em caso de
alterao da funo renal, ver tpico Doena renal crnica.

Macronutrientes
Carboidratos
A ingesto diettica de carboidratos para pessoas com diabetes
segue recomendaes semelhantes s definidas para a populao em geral, respeitando concentraes entre 45 e 60% do
requerimento energtico.2,15,16 Embora o carboidrato seja um
importante preditor da glicemia ps-prandial, os alimentos
que contm esse nutriente so tambm fontes importantes de
energia, fibra, vitaminas, minerais, contribuindo ainda com a
palatabilidade da dieta.
Alguns estudos evidenciam que adequadas concentraes
de carboidratos melhoram a sensibilidade ao da insulina,
e a Organizao Mundial da Sade no recomenda concentraes inferiores a 130g/dia desse macronutriente.2 Os carboidratos devem ser monitorados pela sua contagem ou substituio, considerando os grupos de alimentos (B). Assim, a
avaliao da quantidade de carboidratos, seja por contagem de
carboidratos ou estimativa baseada na experincia, continua a
ser fundamental para alcanar o controle glicmico (B).17
A quantidade de carboidratos e a insulina disponvel podem ser os fatores mais importantes que influenciam a resposta glicmica aps as refeies e devem ser considerados
ao desenvolver o plano de alimentao (A).
A ingesto de carboidratos a partir de vegetais, frutas, gros
integrais, legumes e produtos lcteos deve ser aconselhada sobre a ingesto de outras fontes de carboidratos, especialmente
aqueles que contm acrscimo de gordura, acar ou sdio (B).2
A resposta glicmica de vrios alimentos pode ser quantificada tambm pelo ndice glicmico (IG). Este ndice fornece uma avaliao da qualidade dos carboidratos contidos nos

06/10/2015 09:52:37

Princpios para Orientao Nutricional no Diabetes Mellitus 93

alimentos baseada em sua habilidade de aumentar a glicose no


sangue. Um conceito interessante na teoria, mas que na prtica
revela algumas limitaes e tem suscitado controvrsias entre
os especialistas em diabetes. Essa discusso tem como base
fatores que podem influenciar a variabilidade glicmica dos
alimentos, por exemplo, origem, clima, solo, preparo, tempo
de cozimento e outros componentes da refeio, como teor de
gorduras, protenas, fibras, temperatura e acidez.
Apesar de a literatura a respeito do ndice glicmico (IG) e
carga glicmica (CG) em indivduos com diabetes ser controversa em alguns aspectos, redues de HbA1c de 0,2 a 0,5% foram demonstradas em alguns estudos, aps uso de dietas com
baixo IG.18,19 Muitas vezes, difcil discernir o efeito independente, por exemplo, da ingesto de fibra comparado com o do
IG no controle da glicemia ou outros resultados; por isso, no
se recomenda utilizar o mesmo como estratgia primria de
tratamento nutricional para diabetes.2
Embora a aplicao clnica do ndice glicmico como estratgia nutricional de primeira escolha ainda seja controversa, existe concordncia de que a quantidade e a qualidade
do carboidrato consumido afetam a resposta glicmica, bem
como a observao do ndice e carga glicmica podem oferecer benefcios adicionais quando o total de carboidratos da
refeio contabilizado (B).2,16
Para diminuir a resposta glicmica da ingesto diettica, alimentos com alto ndice glicmico podem ser substitudos por alimentos de baixo ndice glicmico, sobretudo quando consumidos
de maneira isolada. Exemplos de alimentos de baixo ndice glicmico so feijes, ervilhas, lentilhas, massas, po de centeio, arroz
parboilizado, cevada, aveia, quinoa e frutas, como ma, pera, laranja, pssego, ameixa, damasco, cereja e frutas vermelhas.16
A sacarose no aumenta mais a glicemia do que outros carboidratos quando ingerida em quantidades equivalentes. Dessa
maneira, seu consumo pode ser inserido no contexto de uma
dieta saudvel (A)2 contribuindo com 10% do requerimento
energtico definidos para esse nutriente (D). Como a sacarose
no aumenta a glicemia mais do que quantidades isocalricas
de amido ou outro carboidrato, no necessita ser restringida por
pessoas com diabetes, no entanto, deve ser substituda por outra fonte de carboidrato ou, se adicionada, deve ser compensada
com doses adicionais de insulina ou outro medicamento hipoglicemiante (A).2 Para os indivduos que necessitam reduzir o
excesso de peso, a orientao para o consumo de preparaes
que contenham sacarose deve ser cuidadosa, sobretudo porque
tais preparaes podem incluir na sua composio altas concentraes de gorduras e so geralmente elevadas em calorias.
O consumo deve ser minimizado para evitar modificar escolhas
alimentares ricas em nutrientes (A).2,20
A frutose consumida como frutose livre (que ocorre naturalmente em alimentos como frutas) pode resultar em melhor controle glicmico em comparao com a ingesto isocalrica de sacarose ou amido (B), e no suscetvel de ter efeitos
prejudiciais sobre os triglicerdios, contanto que a ingesto
no seja excessiva (at 12% da energia ingerida) (C).
Pessoas com diabetes devem limitar ou evitar o consumo
de bebidas adoadas com acares (a partir de qualquer adoante calrico, incluindo a frutose, xarope de milho e sacarose) para reduzir o risco de ganho de peso e piora do perfil
cardiometablico (B).

Diretrizes SBD 2015-2016 - CAP 16.indd 93

Fibras
Algumas fibras dietticas podem atenuar a resposta insulina
e, assim, auxiliar na preveno contra o DM2. Diversas evidncias epidemiolgicas apontam para esse efeito protetor da
fibra e revelam que os efeitos benficos so decorrentes principalmente da ingesto de fibras solveis.2123
As fibras consumidas atuam de maneira diversa no controle do diabetes. As fibras solveis apresentam efeitos benficos na glicemia e no metabolismo dos lipdios, enquanto as
insolveis agem contribuindo para a saciedade e o controle de
peso, alm da preservao da sade intestinal.24,25 As fibras so
encontradas nos vegetais, principalmente em folhas, razes, talos, sementes e bagaos. As principais fontes alimentares so
frutas, verduras, legumes, farelo de aveia e de cevada, semente
de linhaa, alm de leguminosas.26
Estudos evidenciam que a adio de fibra solvel como produtos de aveia, feijes, cevada, psyllium, entre outros, auxilia no
retardo do esvaziamento gstrico, contribuindo positivamente
para o controle glicmico ps-prandial (B).27 Alguns estudos de
coorte demonstram que dietas ricas em fibra diettica esto associadas a menor risco de doena cardiovascular. A 5a Diretriz
Brasileira de Dislipidemias e Preveno da Aterosclerose refora a magnitude e a evidncia de que o consumo de fibras solveis est associado reduo do LDL-c e colesterol total (A).28
Ademais, estudo realizado para avaliao da suplementao
de fibras solveis em pacientes dislipidmicos e com diabetes
observou que, aps 12semanas de consumo de 44gramas de
farinha da casca do maracuj, pacientes suplementados tiveram
reduo nos nveis de glicose (p = 0,035).29
A escolha de alimentos ou suplementos de fibras permite ao profissional decidir o melhor tipo de fibra e a forma de
administrao na alimentao, tendo em vista a variao no
consumo alimentar da populao brasileira. Devido aos efeitos benficos e cientificamente comprovados do consumo de
fibras, atualmente, as Associaes Canadense e Americana de
Diabetes30 recomendam um consumo maior de fibras para a
populao diabtica tipo 2comparada populao geral. Cerca de 30 a 50g por dia. Sendo que a recomendao mnima
de 14g/1.000kcal.2

Lipdios
A recomendao da quantidade total de lipdios para portadores de diabetes ainda inconclusiva, devendo a meta ser individualizada (C). A qualidade do tipo de cido graxo parece ser
mais importante do que a quantidade (B). A distribuio desse
macronutriente deve ser baseada na avaliao individualizada
e nos padres alimentares, preferncias e metas metablicas
(E).31 De acordo com a recomendao do Institute of Medicine
(IOM), a ingesto de lipdios deve ser entre 25 e 35% do total
de calorias, sem definio do mximo tolervel.32 Todavia, esta
recomendao no especfica para pessoas com diabetes, e o
baixo consumo de lipdios e alto de carboidratos aumentam o
risco cardiovascular.3335
De acordo com as diretrizes do American College of Cardiology (ACC)/American Heart Association (AHA), de 2014,
a recomendao de cido graxo saturado e trans com o objetivo de reduzir o LDL-c de 5 a 6% e menor do que 1% do total
de calorias, respectivamente (A).36 A restrio de cido graxo

06/10/2015 09:52:38

94 Diretrizes SBD | 2015-2016

saturado tambm pode reduzir as concentraes de HDL-c, mas,


devido sua efetividade em baixar as concentraes de LDL-c,
segue-se esta recomendao. A quantidade reduzida de cido
graxo saturado pode ser substituda por cido graxo monoinsaturado, com resultados positivos sobre o HDL-c em alguns pacientes (ACC/AHA, 2014). No h evidncia suficiente de que a
reduo de colesterol reduza o LDL-c (ACC/AHA, 2014). Para o
portador de diabetes em geral, a recomendao de cidos graxos
fica em <10% do total de calorias, <300mg de colesterol alimentar/dia e evitar ao mximo o consumo de gordura trans.31
Algumas fontes de cidos graxos saturados so carnes gordas,
manteiga, leos de dend, leite integral, bacon, torresmo, embutidos (linguia, salame, presunto, salsicha e mortadela). Gordura
hidrogenada vegetal, frituras, tortas industrializadas, bolos, fast
foods, pipoca de micro-ondas, sorvete de massa, biscoitos salgados, recheados e do tipo waffer so fontes de gordura trans.
Estudos clnicos randomizados, de coorte e revises sistemticas mostram que o consumo de dieta rica em cido graxo
monoinsaturado promove o controle glicmico e reduz marcadores de risco cardiovascular.3745 Estes estudos apontam para
um consumo de cido graxo monoinsaturado superior a 12%
do total de energia, ou para uma simples substituio de 5 a 10%
do total de energia de carboidrato ou cido graxo saturado por
monoinsaturado. Uma alternativa para as dietas ricas em carboidrato e baixa em lipdios seria sua substituio pela dieta mediterrnea, por ser rica em cidos graxos monoinsaturados.31,46
O consumo de cidos graxos -3 est associado a menor
incidncia de DM2.47 A suplementao com cidos graxos poli-insaturados -3pode reduzir as concentraes de triacilgliceris em pessoas com diabetes,28,48 bem como modular a resposta inflamatria nesses indivduos,49 alm de reduzir a resistncia
insulina.50 O consumo de cido graxo -3de fontes como peixes ou por meio de suplementos aponta reduo nos riscos cardiovasculares.50,51 Um recente estudo de coorte observou que o
consumo de peixe e de cidos graxos -3reduziu a mortalidade por qualquer tipo de doena.52 O consumo de duas ou mais
pores de peixes por semana, com exceo dos fritos, pode ser
recomendado (B). Em altas doses (4 a 10g ao dia), os cidos
graxos -3 reduzem os triacilgliceris e aumentam discretamente o HDL-c, podendo, entretanto, elevar o LDL-c.28 Existe
evidncia limitada em pessoas com diabetes sobre os efeitos dos
cidos graxos -6. cidos graxos poli e monoinsaturados so
recomendados como substitutos da gordura saturada ou trans.31

Protenas
As evidncias so inconclusivas para determinar a recomendao de ingesto proteica que otimize a glicemia ou reduza
fatores de risco para doena cardiovascular em portadores de
DM sem sinais de doena renal. A prescrio de protena deve
ser individualizada, considerando o diagnstico nutricional e
o controle glicmico (C).53 As protenas devem compor a oferta de energia em 15 a 20% para aqueles com DM que apresentam funo renal normal ou 0,8 a 1 g/kg/peso.54 No h
evidncia de que o consumo habitual de protena tenha de ser
modificado para as pessoas com diabetes.55
Ao comparar dieta hipocalrica com oferta adequada de
carboidratos, protenas e gorduras com as dietas hipocalricas,
hipoglicdicas, hiperproteicas e normolipdicas, observa-se

Diretrizes SBD 2015-2016 - CAP 16.indd 94

que a perda de peso semelhante entre elas (B).53 Alguns estudos tm sugerido que a restrio calrica o principal fator
para perda de peso bem-sucedida, em vez de macronutrientes
propriamente ditos.56
A oferta proteica deve provir de fontes de aminocidos essenciais, carnes magras (bovina, aves, peixes), soja, leite, queijos
e iogurtes de baixo teor de gordura e tambm de fontes vegetais,
como leguminosas, cereais integrais e frutas oleaginosas.
Aminocidos so estimuladores da secreo de insulina em
indivduos com DM2sem incrementar a glicemia ps-prandial,
por isso, alimentos proteicos sem ou com baixo teor de carboidratos no devem ser usados para tratar ou prevenir hipoglicemia (B). O efeito da protena na glicemia de pessoas com DM1
ainda no est esclarecido.31

Micronutrientes
Vitaminas e minerais
A deficincia de vitaminas e minerais frequente em indivduos com diabetes.2 As principais causas so perdas na urina,
diminuio na capacidade intestinal de absoro, alm da baixa
ingesto diettica.57 Para atingir as necessidades dirias de vitaminas e minerais, indivduos com diabetes devem ter um plano alimentar variado com o consumo mnimo de duas a quatro
pores de frutas, sendo pelo menos uma rica em vitamina C
(frutas ctricas) e de trs a cinco pores de hortalias cruas e cozidas. importante variar os tipos e as cores desses vegetais, pois
cada cor corresponde a um perfil nutricional especfico (A).2
Estudos mostram benefcios com a utilizao de alimentos
funcionais com potenciais efeitos antioxidantes, tais como caf,
ch, cacau e canela.5860 Experimentalmente, a modulao do
estresse oxidativo por antioxidantes parece ter um resultado
positivo, mas estudos de interveno no recomendam suplementao de antioxidante com o nico propsito de prevenir
o DM2.61 Uma alimentao rica em frutas e hortalias pode
proporcionar melhor combinao de antioxidantes.62 A suplementao rotineira de antioxidantes no aconselhvel devido falta de evidncias de eficcia e preocupao relacionada
com a segurana a longo prazo (A).2
Em alguns grupos como idosos, gestantes ou lactentes, vegetarianos restritos ou aqueles em restrio calrica, a suplementao de multivitamnicos pode ser necessria.63 Outras
excees so feitas ao folato, para preveno de doenas congnitas e ao clcio para prevenir doena ssea.
Uma das provveis causas da neuropatia diabtica a
deficincia de vitamina B12.2 O uso prolongado de metformina pode causar a deficincia dessa vitamina, sendo necessria a
suplementao com doses teraputicas.64 A deficincia de vitamina D tambm evidente em indivduos com diabetes e est
relacionada com o mau controle glicmico. Os efeitos positivos
da vitamina D seriam a secreo e sensibilidade insulina, bem
como a diminuio do estado inflamatrio.65 Todavia, no h
evidncias suficientes quanto ao benefcio da suplementao de
vitaminas e minerais em portadores de diabetes que no apresentem deficincia desses nutrientes (A).2
Com relao aos minerais, as deficincias so mais evidentes no metabolismo do zinco e do magnsio. Essas alteraes
parecem estar associadas ao aumento das concentraes de

06/10/2015 09:52:38

Princpios para Orientao Nutricional no Diabetes Mellitus 95

hemoglobina glicada, a progresso do diabetes e complicaes.66 A suplementao de zinco mostra benefcios no controle
glicmico de pessoas com diabetes tipos 1 e 2.67 O zinco parece
regular a funo das ilhotas pancreticas e promover a homeostase glicmica.68 Diabticos sem deficincia de zinco no
apresentam efeitos adicionais da suplementao.69 Um recente
estudo mostrou que a ingesto abundante de leo de peixe,
incluindo -3 e zinco, pode exercer efeitos antiarteriosclerticos por meio do aumento dos nveis sricos de HDL-c.70
A depleo crnica de magnsio em DM1 tem sido associada polineuropatia, e sua suplementao influencia favoravelmente a progresso da doena.71 Outro estudo com
portadores de diabetes tipo 1 concluiu que a suplementao
de magnsio est relacionada com a reduo das fraes lipdicas aterognicas.72 Em uma metanlise, foi observado que
a suplementao de magnsio por via oral durante 4 a 16semanas pode ser eficaz na reduo das concentraes plasmticas de glicose em jejum e aumentar o HDL-c em pacientes
com DM2.73 A suplementao de micronutrientes no deve
ser uma prtica rotineira porque precisa ser individualizada e
mediante sua deficincia. Mais estudos so necessrios a fim
de se comprovarem os reais efeitos da suplementao e avaliar
possveis efeitos colaterais (A).2
Os suplementos base de ervas no so recomendados para
pessoas com diabetes2,74 e podem apresentar interaes medicamentosas.75 Suplementos comercialmente disponveis para
venda no so padronizados e variam em quantidade de ingredientes ativos.

Sdio
Segundo a Organizao Mundial da Sade (OMS), o Ministrio da Sade (MS) e a Sociedade Brasileira de Cardiologia
(SBC), o consumo de sdio deve ser limitado a 2.000mg/dia,
o que equivale a 5 g de sal de cozinha, ou seja, no mximo
3colheres de caf rasas de sal (3g de sal + 2g de sal dos prprios alimentos). O Ministrio da Sade salienta que o consumo populacional acima dessa meta causa importante de
hipertenso arterial.76
As recomendaes da American Diabetes Association
(ADA) ressaltam que portadores de DM apresentam risco aumentado para hipertenso e doenas cardiovasculares e podem
ter benefcios com a adoo da dieta DASH, isto , uma dieta rica
em frutas, legumes e produtos lcteos pobres em gorduras com
um contedo reduzido de gordura saturada e total, que inclui,
nas suas recomendaes, a reduo no consumo de sdio (B).2
A SBC tambm refora essa conduta, tendo em vista que estudos
indicam que mesmo redues modestas no sal so geralmente
eficientes na diminuio da presso arterial. Essa orientao de
suma importncia, tendo em vista que o povo brasileiro consome mais de duas vezes o recomendado para consumo.76
Produtos alimentcios que, alm de conter sal (cloreto de
sdio), so ricos em ingredientes fontes de sdio, devem ser evitados (p. ex., conservantes, corantes e acidulantes, entre outros).
Podem ser chamados de sal escondido, pois contm sdio em
abundncia, porm, ao contrrio do sal, no agregam sabor salgado aos alimentos, o que pode favorecer o consumo inadequado sem que a pessoa perceba. So exemplos desses alimentos no
recomendados: embutidos, conservas, enlatados, defumados,

Diretrizes SBD 2015-2016 - CAP 16.indd 95

salgados de pacote, macarro instantneo, pipoca para microondas, temperos em cubos ou sach e molhos prontos. Os produtos diet ou light tambm podem conter teores elevados de
sdio, sendo, portanto, fundamental consultar as informaes
nutricionais nos rtulos para fazer escolhas adequadas.76
Tendo em vista a relevncia dessa questo e com o objetivo
de promover a sade e prevenir doenas, o Ministrio da Sade
est trabalhando em conjunto com as indstrias alimentcias,
de modo a reduzir progressivamente o teor de sdio desses
alimentos.76
A alimentao com teor adequado de sdio que auxilia a
prevenir ou tratar a hipertenso deve, ento, incluir temperos
naturais, escolha consciente de alimentos processados com
menor teor de sdio, alm de frutas, vegetais, laticnios magros
e outros alimentos saudveis.76 Alm disso, deve-se considerar
palatabilidade, disponibilidade, custo adicional dos produtos
com baixo teor de sdio e dificuldade de obt-los em uma
dieta nutricionalmente adequada.77

Bebidas alcolicas
As mesmas precaues com relao ao consumo de lcool na
populao em geral aplicam-se a pessoas com diabetes.2,8 A
ingesto de bebidas alcolicas em conjunto com uma refeio, inclusive carboidratos, pode levar, inicialmente, a maiores
nveis glicmicos e insulinmicos em pacientes com diabetes
tipo 2. Dependendo da natureza dos carboidratos na refeio,
ou em perodo de jejum, poder ocorrer hipoglicemia reativa que,2 nos adolescentes, poder prolongar-se por at 16h.78
Para adultos com diabetes, a ingesto diria de lcool deve ser
limitada a 1dose ou menos para mulheres e 2doses ou menos para homens.2,79 Entende-se por 1dose 150 ml de vinho
(1taa) ou 360 ml de cerveja (1lata pequena) ou 45 ml de
destilados (1dose com dosador padro), medida equivalente
em mdia a 15 g de etanol.2 Nesses casos, deve ser ingerido
com carboidrato antes e/ou durante o uso da bebida, sendo
necessrio, em alguns casos, ajuste na dose de insulina ou secretagogos de insulina. Se exerccio fsico acompanhar a bebida alcolica, em perodo noturno, o monitoramento da glicemia dever ser feito durante a noite e no dia seguinte.2
A Associao Canadense de Diabetes mais tolerante com
recomendao limite de 2doses/dia e <10drinques por semana para mulheres e 3doses ou <15drinques por semana para
homens. A ingesto de lcool, dependendo da sensibilidade
individual e quantidade, poder mascarar os sintomas de hipoglicemia, reduzir a produo heptica de glicose e aumentar
a produo de corpos cetnicos.8
A ingesto excessiva de etanol (>30g/dia) associada a
alterao da homeostase glicmica, elevao da resistncia
insulina, hipertrigliceridemia e presso arterial, podendo
tambm ser fator de risco para acidente vascular cerebral.79,80
Cada incremento de 10g de etanol, acima de 30g/dia, aumenta a presso sistlica em 1 a 2mmHg e diastlica em 1mmHg.
Ingesto alcolica acima de 3doses/dia associada, na populao saudvel, elevao da incidncia de diabetes em 43%,
alm de risco alto de distrbios metablicos, ganho em peso,
declnio cognitivo com a idade e perda da sade ssea.27 Restrio total de bebidas alcolicas deve ser feita a portadores
de diabetes adolescentes, gestantes, lactantes, pessoas com

06/10/2015 09:52:38

96 Diretrizes SBD | 2015-2016

pancreatite, hipertrigliceridemia grave, dependentes de lcool


e com neuropatia diabtica avanada, em virtude dos graves
efeitos deletrios.20,73
Os profissionais de sade devem discutir o uso de lcool com seus pacientes para inform-los do possvel ganho
ponderal e os riscos de hipoglicemia.2,27

Contagem de carboidratos como


ferramenta nutricional
A contagem de carboidratos uma importante ferramenta
no tratamento do diabetes e deve ser inserida no contexto
de uma alimentao saudvel.81 Tal estratgia prioriza o total de carboidratos consumidos por refeio, considerando
que sua quantidade determinante para a resposta glicmica
ps-prandial. Isso porque os carboidratos so 100% convertidos em glicose, em um perodo que varia de 15min a 2h,
enquanto 35 a 60% das protenas e somente 10% das gorduras
passam por essa converso, em um perodo de 3 a 4h e 5h,
respectivamente.27
Reconhecida como um mtodo que permite maior flexibilidade nas escolhas alimentares pelo estudo Diabetes Control
and Complications Trial (DCCT), a contagem de carboidratos pode ser utilizada por qualquer pessoa com DM, tendo a
sua aplicao atualmente mais consolidada no tratamento do
DM1.83 A participao de indivduos com este tipo de diabetes
em programas intensivos de educao, envolvendo insulinoterapia e contagem de carboidratos, tende a resultar em melhora
do controle glicmico (A).2
Dentre os mtodos de contagem esto a lista de equivalentes
ou substituio e a contagem em gramas de carboidratos.82 Os mtodos permitem que se faa o ajuste das doses de insulina antes
das refeies com base na quantidade de carboidratos consumida, sendo a abordagem mais efetiva no controle ps-prandial
do DM1.83
Em pacientes com controle alimentar exclusivo e/ou em
uso de antidiabtico oral, importante estimular a ingesto
das mesmas quantidades de carboidratos por refeio, sempre
nos mesmos horrios.81 A maioria dos pacientes necessita de
treinamento especfico, realizado por nutricionista, a fim de
estabelecer a quantidade de carboidratos das refeies, aprender a medir e/ou estimar o tamanho das pores.83,84
A contagem de carboidratos pode ser realizada tambm na
gestao por meio de um plano alimentar individualizado,81
no qual haja incentivo ao fracionamento das refeies, que
devem ocorrer de 3 em 3h.85 Deve-se atentar para provveis
alteraes das relaes de bolus versus carboidratos ao longo
do dia, conforme o ciclo gestacional.81

Recomendaes complementares
O plano alimentar deve assegurar todas as necessidades nutricionais do DM. Recomenda-se que o plano alimentar seja fracionado em cinco a seis refeies, sendo trs principais e dois a
trs lanches. Essa recomendao considera os efeitos benficos
para todo o corpo (E).
Quanto forma de preparo dos alimentos, deve-se dar
preferncia aos grelhados, assados, cozidos no vapor ou at
mesmo crus.

Diretrizes SBD 2015-2016 - CAP 16.indd 96

Os alimentos diet, light ou zero podem ser indicados no


contexto do plano alimentar e no utilizados de maneira exclusiva. necessrio respeitar as preferncias individuais e o
poder aquisitivo do paciente e da famlia (C).2,20

Ciclos da vida e situaes especiais


Crianas e adolescentes
Planos alimentares individualizados e regimes intensivos de
insulina podem fornecer flexibilidade s crianas e aos adolescentes com DM na acomodao do tempo e dos horrios
de refeies irregulares, em situaes de variao de apetite
e nveis de atividade fsica (A). As necessidades de nutrientes
para crianas e adolescentes com DM tipos 1 e 2so similares
s de outros indivduos da mesma idade (B).83 Desse modo,
sugerem-se, para o plano alimentar da criana e do adolescente com DM, as mesmas caractersticas para macronutrientes
indicadas no Quadro 1, adaptadas respectiva faixa etria.
Ressalta-se que o objetivo prioritrio da conduta nutricional
nessa faixa etria manter o crescimento e o desenvolvimento
e, posteriormente, adequar aos aspectos relacionados com o
controle glicmico (D).2
Cada vez mais vem sendo utilizado o esquema de insulina
baseado em basal/bolus para chegar-se meta do tratamento em crianas e adolescentes com DM1. Nesse tratamento,
recomenda-se o uso do mtodo de contagem de carboidrato
como estratgia nutricional para individualizar e flexibilizar a
ingesto alimentar e obter bom controle glicmico (A).2
A glicemia dentro da meta deve ser estimulada, uma vez
que a hiperglicemia crnica pode produzir sequelas neurocognitivas em crianas, e, por outro lado, a hipoglicemia, em
crianas pequenas, pode causar danos graves.2 Portanto, a
orientao alimentar de quantidades consistentes de carboidratos em horrios frequentes (3/3h) deve ser priorizada a fim
de evitar essas alteraes importantes na glicemia.
Nos episdios de hipoglicemia nos quais a criana esteja
lcida, sugere-se o uso de 15g de carboidratos de rpida absoro, o que equivale a uma colher (sopa) de acar para 200
ml de gua ou 200 ml suco de laranja ou 200 ml de refrigerante regular ou cinco sachs (3g) de mel ou trs balas macias
(15g de CHO).81 O uso de biscoitos doces ou chocolates no
recomendado para a correo da hipoglicemia porque esses
alimentos contm alto contedo de gorduras, o que retarda a
absoro do carboidrato, acarretando aumento exacerbado da
glicemia horas mais tarde (D). Recomenda-se que a criana
leve para escola, alm da merenda, um kit com balas macias ou
acar para ser usado nos casos de hipoglicemia (E).
Crianas e adolescentes, em geral com sobrepeso, que j
apresentam presso arterial percentil 90para idade, sexo e
estatura, devem ser incentivadas atividade fsica e alimentao saudvel. A interveno nutricional objetiva principalmente o controle do peso e a restrio do excesso de sdio.
Recomenda-se alimentao balanceada nos macronutrientes
(de acordo com a meta do tratamento), restrio do uso excessivo de produtos ultraprocessados (p.ex., macarro instantneo, biscoitos salgados, enlatados, embutidos, refeies prontas etc.), controle do sal de adio com a retirada do saleiro de
mesa (D).

06/10/2015 09:52:38

Princpios para Orientao Nutricional no Diabetes Mellitus 97

Com relao s dislipidemias, recomenda-se que o perfil


lipdico de crianas com mais de 2 anos seja solicitado logo
aps o diagnstico de diabetes (assim que o controle glicmico estiver restabelecido). Para aquelas que apresentam exame normal e histrico familiar de hipercolesterolemia ou de
evento cardiovascular antes dos 55 anos ou com sobrepeso, o
exame deve ser realizado anualmente. Para as demais crianas
sem hipercolesterolemia nem histrico familiar, o perfil lipdico pode ser monitorado a partir da puberdade (>10 anos) (E).
Entretanto, o monitoramento deve ser anual para as crianas
de todas as idades que apresentarem alterao do perfil lipdico ou sobrepeso (E).2 A conduta nutricional deve priorizar,
alm do controle glicmico, a restrio da gordura saturada,
considerando sempre as necessidades nutricionais para a idade (E). Dados de estudos randomizados com crianas e adolescentes indicam que a restrio de gordura (<7% gordura saturada e 200 mg/dl de colesterol) no interfere no crescimento
e desenvolvimento normal.2 Recomenda-se a substituio dos
produtos com gorduras trans e/ou ricos em gordura saturadas
por alimentos in natura ou integrais.
Outras doenas autoimunes podem ocorrer em crianas
e adolescentes com DM1 e, por isso, necessitam ser investigadas.2 A que necessita de restrio alimentar especfica a
doena celaca. Esta enfermidade apresenta como caractersticas dficit de crescimento, perda ponderal e/ou sintomas gstricos (diarreias, dor abdominal, m absoro). O diagnstico
confirmado por meio de biopsia intestinal e todo o glten
deve ser retirado do plano alimentar. O paciente com DM
com diagnstico de doena celaca precisa ser encaminhado
ao nutricionista para orientao do plano alimentar isento de
glten.2 Deve-se realizar a substituio dos alimentos com glten (pes, bolos, macarro, biscoitos etc.) por outros, sem essa
protena, que apresentem funes similares (D).
Com o aumento do excesso de peso e da obesidade em
crianas e adolescentes aparecem tambm, de maneira importante, a sndrome metablica e o DM2.83 No Brasil, em um
estudo realizado com uma amostra probabilstica de adolescentes de escolas pblicas, foram observadas alteraes metablicas naqueles com maior resistncia insulina e sobrepeso.87 O tratamento para sndrome metablica e DM2 em
adolescentes deve priorizar a modificao no estilo de vida,
tendo como meta a perda ponderal e a diminuio do sedentarismo.2 O incentivo alimentao saudvel, a diminuio
do consumo de bebidas aucaradas, como refrigerantes, e a
restrio da ingesto de alimentos ultraprocessados, ricos em
gorduras saturadas e sdio promovem benefcios tanto no
controle glicmico quanto na dislipidemia e presso arterial,88
comumente associados ao DM2 (D).
A alimentao na escola um importante aspecto na abordagem nutricional da criana. A merenda escolar deve ter seu
horrio adaptado ao esquema de insulina utilizado pela criana e no ultrapassar o intervalo de mais de 3h da ltima refeio. No que diz respeito ao tipo de alimento, o ideal pactuar
escolhas saudveis disponveis na escola ou para levar de casa.
O uso de sanduches com po integral e frios acompanhados
por sucos/frutas pode ser alternado por biscoitos e bebidas de
baixas calorias. O planejamento dos lanches deve considerar
o total de gramas de carboidratos proposto para o horrio do
lanche, de acordo com o plano alimentar orientado previa-

Diretrizes SBD 2015-2016 - CAP 16.indd 97

mente pelo nutricionista. Nos dias de educao fsica, pode


ser necessrio adicionar cotas a mais de carboidratos (frutas)
no lanche para evitar hipoglicemias aps a atividade.88

Gestao e lactao
As gestantes com diabetes devem ser avaliadas, do ponto de
vista nutricional, por meio de curvas que considerem a idade
gestacional, o peso atual e a estatura.88 Devem receber orientaes nutricionais individualizadas de modo a contemplar as
necessidades nutricionais, com base no IMC (kg/m), na frequncia e na intensidade de exerccios fsicos, no padro de
crescimento fetal e ganho de peso adequado de acordo com o
perodo gestacional.89
A distribuio energtica deve basear-se nas recomendaes de alimentao saudvel e equilibrada, sendo composta
por 40 a 55% de carboidratos e 20 a 35% de gorduras.2,90 Com
relao s protenas, a American Diabetes Association (ADA)
considera como distribuio aceitvel um total de 15 a 20% do
VET, priorizando as fontes proteicas de alto valor biolgico.91
A necessidade de vitaminas e minerais e o aporte de fibras (20
a 35g/dia ou 14g/1.000kcal) semelhante ao recomendado
para gestantes no acometidas pelo diabetes.91,92
A adeso ao plano alimentar saudvel, atendendo aos princpios de quantidade, qualidade, padro das refeies e adequao do ganho de peso, fundamental para o bom controle
glicmico, contribuindo para a incorporao de adequado estilo de vida, mesmo aps o trmino da gestao.2,88,92
Para evitar episdios de hiperglicemia, hipoglicemia ou
cetose, a distribuio do valor energtico total (VET) deve ser
dada em trs pequenas refeies (lanche da manh, merenda
e lanche noturno) e trs refeies maiores (desjejum, almoo
e jantar).88 No caso das gestantes que fazem uso de insulina,
importante atentar que o lanche noturno precisa conter cerca de 25g de carboidratos complexos, alm de protenas e/ou
gorduras para evitar a ocorrncia de hipoglicemia durante a
madrugada. Essas mulheres tambm devem ser orientadas
a ajustar a dose pr-prandial de insulina de ao rpida, por
meio do clculo de carboidrato de cada refeio. O fracionamento da alimentao pode colaborar tambm para amenizar
nuseas e vmitos, alm da indicao de alimentos com baixo
teor de gordura e pouco condimentados.93
Para preveno e correo da constipao intestinal, alm da
oferta das fibras alimentares, deve-se estimular a hidratao com
gua.94 O uso de cido flico desde o perodo pr-concepcional
at o fechamento do tubo neural recomendado para todas
as mulheres, inclusive para aquelas que tm diabetes (A).2
A suplementao com outras vitaminas e sais minerais pode
ser realizada quando detectada a presena de deficincias
nutricionais.89
Os adoantes artificiais acessulfame-K, aspartame, sacarina, sucralose e neotame so seguros durante a gestao e podem ser utilizados com moderao.95
O aleitamento materno recomendado para as mulheres
com diabetes prvio ou com diabetes gestacional,2 sendo vrios os benefcios associados ao estado metablico tanto da
me quanto do beb.96 Entretanto, necessrio um planejamento alimentar de modo a contemplar as perdas nutricionais
da me em detrimento da produo de leite. Alm do ajuste

06/10/2015 09:52:38

98 Diretrizes SBD | 2015-2016

da dose de insulina, quando ela administrada, necessrio


aumentar o aporte de energia e protenas para evitar grandes
flutuaes glicmicas. Vale ressaltar que o consumo de carboidratos antes ou durante o aleitamento auxilia na preveno da
hipoglicemia.

Pessoas idosas
importante estar atento ao ganho ou perda de peso involuntria em idosos, de modo a prevenir possveis desvios nutricionais, comuns nos mais velhos, nos quais a desnutrio
mais comum do que o excesso de peso.97 Se houver excesso
de peso, interessante a reduo do VET e considerar que as
necessidades de energia nessa faixa etria so menores do que
em adultos mais jovens e a mesma reduo energtica pode
resultar em menor perda de peso do que no jovem. Quando h
restrio energtica, pode haver necessidade de suplementos
multivitamnicos (C).
Associada ao plano alimentar, a atividade fsica pode ser benfica para auxiliar no controle glicmico, na perda ponderal
e no aumento da massa muscular, o que deve colaborar para a
reduo da resistncia insulina (A). Especial ateno deve ser
dada aos idosos em uso de insulina ou agentes secretagogos, de
modo a evitar hipoglicemias. Nesse caso, a alimentao precisa
ser ajustada aos horrios e intensidade dos exerccios.2

est focado na suplementao adequada de carboidratos


para preveno de hipoglicemias com ou sem alteraes de
insulina. Pela falta de evidncias que justifiquem o contrrio, o plano alimentar para o indivduo com diabetes direcionado prtica de esportes no difere do plano alimentar
para qualquer pessoa sem diabetes.99 Contudo, seguem, no
Quadro2, alguns aspectos sobre nutrio, citados na literatura para o atleta.

Hipoglicemia no atleta
Muitos atletas preferem ficar mal controlados para no ter hipoglicemias. O monitoramento frequente antes, durante (a
cada 30 a 40min) e aps atividade fsica aumenta a performance e segurana.106 Hipoglicemias noturnas so acentuadas
quando a atividade fsica feita tarde. Reduo na basal noturna + ingesto de 15 a 30g de carboidrato no lanche noturno
podem atenuar os sintomas de hipoglicemia.107
Quadro 2 Aspectos nutricionais relacionados com o atleta.
Carboidratos

A recomendao de carboidratos dirios


nos esportes de endurance de 6 a 10 g de
carboidrato/kg peso ou mais para atleta de
ultraendurance. Atividades no endurance
5 a 6 g de carboidrato/kg peso16

Protena

No existe consenso acerca do melhor


horrio (antes, durante e aps) e do tipo
(casena e do soro do leite): 1,2 a 1,7 g/kg
de peso101103

Gordura

importante salientar que dietas ricas em


gordura atrapalham a performance: 1 g/kg
de peso, totalizando 20 a 30% do valor
energtico total104

gua

A necessidade de gua baseada na taxa


de suor, temperatura ambiente e altitude
Recomenda-se determinar a necessidade
de gua por meio da diferena do peso do
indivduo antes e aps a atividade fsica
Outra maneira seria solicitar ao atleta para
checar, pela cor, se a urina est
concentrada.
Para cada 0,5 kg perdido, a reposio deve
ser de no mnimo 450 a 600 ml por hora105

Micronutrientes

No existem recomendaes claras para


suplementao de vitaminas e sais minerais
direcionadas a atletas de endurance
Algumas pesquisas sugerem necessidades
aumentadas das vitaminas C e E. Para
vitamina C, indica-se a ingesto diria de
100 a 1.000 mg/dia para atletas de alto
nvel,104 mas ainda so necessrios estudos
mais consistentes sobre o tema
A deficincia de ferro comum em atletas,
especialmente mulheres. Para as atletas de
alta performance, sugere-se uma
recomendao diria maior que as
necessidades normais. Maratonistas,
ultramaratonistas, mulheres em idade frtil
e vegetarianos devem ter seus exames
avaliados frequentemente, para possvel
suplementao106

Atleta com diabetes


A contribuio da atividade fsica em diabetes indiscutvel
para o controle do diabetes, no entanto, atividades fsicas planejadas ou no so uma das causas mais comuns de hipoglicemia no indivduo com diabetes. Por outro lado, no exerccio
fsico intenso, como o do atleta, no so raros os episdios de
hiperglicemia durante e aps a atividade, com possibilidade de
hipoglicemia tardia.98
A utilizao de energia e resposta glicmica durante o
exerccio depende do sistema nervoso simptico e do sistema
endcrino. Enquanto h a contrao do msculo, tem-se um
aumento na captao de glicose pelo msculo esqueltico, o
qual normalmente compensado pelo aumento de glicogenlise e gliconeognese e mobilizao de cidos graxos livres e
aminocidos para a energia.99 No incio da atividade fsica, e
com o aumento da intensidade dela, o corpo utiliza predominantemente o carboidrato como energia, desde que o mesmo
esteja disponvel nos estoques hepticos e musculares. Assim
que aumenta a durao do exerccio, o glicognio depletado
e o indivduo passa a depender da gliconeognese e da mobilizao de gordura e aminocidos para energia.100
A insulina ajuda a regular a captao da glicose pelo msculo
esqueltico durante o repouso. Ajustes na alimentao e na medicao, especialmente, podem ser necessrios pela capacidade hipoglicemiante do exerccio, j que a atividade aumenta a
sensibilidade do msculo insulina para facilitar a repleo do
estoque de glicognio. O efeito da hipoglicemia pode ocorrer
at 72h aps o exerccio. A exceo regra acontece com o exerccio de alta intensidade, que aumenta a produo de catecolaminas, resultando em uma imediata hiperglicemia.98,99
No existem pesquisas publicadas na literatura que determinem o melhor padro alimentar para atletas ou praticantes de atividade fsica com diabetes. O material disponvel

Diretrizes SBD 2015-2016 - CAP 16.indd 98

06/10/2015 09:52:38

Princpios para Orientao Nutricional no Diabetes Mellitus 99

Ajustes na dose de insulina so altamente recomendveis.


O monitoramento da glicemia, a leitura dos dirios alimentares e de atividade fsica e de glicemias so teis para avaliao
e idealizao da melhor estratgia.
Na atividade fsica planejada, o momento da oferta do nutriente importante para maximizar o treinamento e a competio. A ingesto diria de carboidratos para manter o estoque
de glicognio recomendada, com uma vantagem adicional,
nos dias que antecedem uma competio (5 a 7dias), de um
aumento desta ingesto.108 H evidncia cientfica ressaltando
que a ingesto de protena e carboidrato 3 a 4h antes do exerccio mais vantajosa, em uma relao de 1 a 2g de carboidrato por kg de peso e 0,15 a 0,25g de protena por kg de peso
do que quando ofertado o carboidrato sozinho.105 A oferta de
nutrientes diferente para os perodos antes, durante e aps
atividade fsica.

importante reconhecer o valor da nutrio na atividade


fsica no meramente para normalizar a glicemia. Os requerimentos de energia so diferentes para o atleta ou praticante de
atividade fsica ocasional com diabetes. Entender as mudanas da sensibilidade insulnica e do transporte de glicose aps
a atividade fsica so importantes para minimizar o excesso
da ingesto de carboidratos alm da necessidade fisiolgica,
assim como reduzir a ansiedade e o medo da hipoglicemia
durante o exerccio. O acompanhamento de um nutricionista
pode ser o diferencial no atleta ou praticante de atividade fsica que quer segurana e performance no esporte.99

Doenas agudas
Hiperglicemia

Amplamente demonstrado que a ingesto de carboidratos


durante a atividade fsica com durao maior que 1 h crtica para performance, porm, quanto maiores a durao do
esporte e a intensidade do exerccio, maior a necessidade de
carboidrato.108
O profissional deve adequar a oferta desse nutriente de
maneira prtica, levando em considerao particularidades de
cada prtica esportiva, oferecendo opes para facilitar a vida
do atleta ou praticante de atividade fsica.

Durante as doenas agudas em que h hiperglicemia e cetose,


importante manter aporte suficiente de carboidratos e hidratao (B). Para adultos, recomendada a ingesto de 45a 50g
de carboidratos a cada 3 a 4 h para evitar cetoacidose.2 Em
hospitalizao, deve-se implementar um plano alimentar disciplinado que contemple um aporte de carboidratos suficiente
e constante, adequado a cada situao especfica, sendo indispensvel o acompanhamento de equipe de nutrio treinada
em diabetes (D). A necessidade proteica encontra-se entre 1e
1,5g por quilo de peso corporal atual ao dia, sendo esse o limite superior fornecido para os pacientes em estado de maior
estresse metablico (A).2 Quanto ao VET, recomendam-se 25
a 35kcal/kg, observando-se a resposta metablica, de modo a
no exacerbar a hiperglicemia.
Quando h necessidade de dietas especiais, com alterao
na consistncia ou por via de acesso no oral, necessrio ajuste
dos macronutrientes de forma a viabilizar o controle metablico
e atender s necessidades clnicas e nutricionais do momento.
Dietas lquidas devem conter pelo menos 200g de carboidrato/dia, divididos em pores equivalentes pelas diversas refeies ao longo do dia. As frmulas de alimentao por sondas devem conter 50% de carboidratos e, quando necessrio,
reduzir para 35 a 40% do total dirio de energia.

Aps a atividade fsica

Hipoglicemia

Para melhor recuperao dos msculos e diminuio dos episdios de hipoglicemias, o consumo de carboidrato junto
protena aps at 30 min do trmino da atividade fsica so
cruciais.109,110 Fornecer 1 a 1,5g de carboidrato/kg e relao
4:1 (carboidrato protena).
Na atividade fsica no planejada, o uso extra de carboidrato pode fazer se necessrio a cada hora extra de atividade
fsica, preferencialmente carboidratos de ao rpida, como
sucos, gua de coco, picols de fruta comuns.98
comum o uso de suplementos para auxiliar os atletas a
atenderem suas necessidades nutricionais especficas e para
auxiliar no desempenho do exerccio. Os suplementos mais
utilizados por atletas so gel de carboidrato, maltodextrina,
bebidas isotnicas, vitaminas, BCAA, Whey protein, contudo
muitos outros existem no mercado. Entretanto, no se dispe
ainda de estudos conclusivos em atletas saudveis nem tampouco em atletas com diabetes que suportem o uso regular
desses produtos.

A hipoglicemia a complicao aguda mais frequente em pessoas


com DM1. Entretanto, pode ser observada em pessoas com DM2
tratadas com insulina e, menos comumente, em pacientes tratados com hipoglicemiantes orais. Os sintomas podem variar entre
leve e moderado (tremor, palpitao e fome) a grave (mudanas
no comportamento, confuso mental, convulses e coma).
Outro item a ser pontuado a falta de reconhecimento dos
sintomas da hipoglicemia, especialmente naqueles pacientes
com DM1 de longa data. Treinamento para o reconhecimento
de sintomas neste caso aconselhado.
Uma vez detectada a hipoglicemia, ela pode ser facilmente
tratada pelo prprio paciente ou pelos pais de uma criana.
Hipoglicemia leve (50 a 70 mg/dl) pode ser tratada com 15g
de carboidrato, que equivale a 150 ml de suco comum ou refrigerante comum ou 1colher de sopa de acar. Se a prxima
refeio no for acontecer dentro do perodo de uma hora, um
pequeno lanche deve ser feito imediatamente aps o episdio
da hipoglicemia.

Antes da atividade fsica


A quantidade de carboidratos deve estar relacionada com a
glicemia pr-exerccio.108 Sugere-se 0,7 a 1,1g de carboidratos/kg por hora. Muitas vezes, esta quantidade de carboidratos dividida antes e durante a atividade fsica. Entretanto,
se a glicemia estiver baixa, 10 a 15g de carboidratos devem
ser ingeridos ou efetuam-se ajustes na insulina para prevenir hipoglicemia. Se a atividade fsica for mais extenuante, os
carboidratos dessa refeio podem requerer bolus de insulina
adicional.109

Durante a atividade fsica

Diretrizes SBD 2015-2016 - CAP 16.indd 99

06/10/2015 09:52:38

100 Diretrizes SBD | 2015-2016

J em hipoglicemias graves, abaixo de 50 mg/dl, se o paciente estiver consciente, 30g de carboidratos devem ser oferecidos. Se estiver inconsciente, deve-se evitar qualquer tipo
de lquido devido ao perigo de aspirao. Mel, acar ou carboidrato em gel podem ser algumas das formas de tratamento.
Em casos de inconscincia ou ineficincia na capacidade de
deglutir, a melhor opo a aplicao do glucagon (deve ser
aconselhado ao paciente t-lo em casa).111
Os pacientes tm de ser orientados sobre a preveno da
hipoglicemia. Devem reconhecer situaes que aumentam o
risco da hipoglicemia, como jejum para exames ou procedimentos, durante ou aps exerccio e durante a noite. A hipoglicemia tambm pode aumentar o risco de acidentes com carro.
Por fim, salienta-se a importncia de estes pacientes serem
treinados a balancear o uso da insulina e a ingesto de carboidratos, levando em considerao a atividade fsica.2

Doenas crnicas
Hipertenso arterial
Uma modesta perda de peso, quando h sobrepeso, afeta, de
maneira benfica, a presso sangunea (B).112 A necessidade
diria de sdio para os seres humanos a contida em 5g de
cloreto de sdio ou sal da cozinha.76
A adoo dos princpios da Dietary Approaches to Stop
Hypertension (DASH) tem sido efetivamente correlacionada
com a reduo da presso arterial, efeito atribudo ao alto teor
de minerais como potssio, magnsio e clcio, entre outros fatores. O plano alimentar dirio baseado na abordagem DASH
inclui seleo e controle na ingesto de gorduras e carnes,
consumo de frutas e hortalias diversificadas e, em boa quantidade, ingesto de gros e alimentos integrais, consumo de
oleaginosas, sementes e leguminosas e reduo no consumo
de sdio/sal, de produtos industrializados e de doces (A).2
Sugere-se que as metas de PA (presso arterial) a serem
atingidas no adulto devem ser 130/80mmHg, por tratar-se de
pacientes de alto risco para eventos cardiovasculares. Estudos
demonstram no haver benefcios adicionais com reduo da
PA, em pessoas com diabetes, inferior a esses valores.113,114

Dislipidemias
O perfil lipdico comumente encontrado em portadores de
diabetes consiste em hipertrigliceridemia e reduo do HDL-c.
As concentraes do LDL-c no apresentam diferenas quantitativas quando em comparao com as de pacientes no diabticos. No entanto, do ponto de vista qualitativo, distinguem-se
por perfil de elevada aterogenicidade com maior proporo de
partculas pequenas e densas de LDL-c. A interveno nutricional deve ser adaptada de acordo com a idade do paciente,
tipo de diabetes, tratamento farmacolgico, nvel lipdico e outras condies mdicas, alm de estar focada na substituio
de gordura saturada e de gordura trans pela gordura monoinsaturada e/ou -3.31,36
O acrscimo de esteris de plantas favorece a reduo do
colesterol total e do LDL-c (D).115 Os fitosteris so encontrados apenas nos vegetais e desempenham funes estruturais
anlogas s do colesterol em tecidos animais. O b-sitosterol,
extrado dos leos vegetais, o principal fitosterol encontrado

Diretrizes SBD 2015-2016 - CAP 16.indd 100

nos alimentos. Ele reduz a colesterolemia por competir com a


absoro do colesterol do lmen intestinal. Uma dieta balanceada com quantidades adequadas de vegetais fornece aproximadamente 200a 400mg de fitosteris. No entanto, necessria a
ingesto de 2g ao dia de fitosteris para a reduo mdia de 10 a
15% do LDL-c. Os fitosteris no influenciam os nveis plasmticos do HDL-c e dos triacilgliceris. A ingesto de 3 a 4g/dia de
fitosteris pode ser utilizada como adjuvante no tratamento hipolipemiante (C).31,115 O consumo de fibras solveis ajuda a reduzir
as concentraes de colesterol total e LDL-c. As fibras solveis
formam um gel que se aglutina com as gorduras alimentares e o
sal biliar que contm colesterol, impedindo sua absoro.116 Alm
disso, as fibras fermentam no intestino e produzem cidos graxos
de cadeia curta, aumentando a depurao do LDL-c e inibindo a
enzima responsvel por produzir colesterol endgeno (3-hidroxi-3-metil-glutaril-coenzima-A redutase [HMGCoA-R]).116 Para
indivduos com triacilgliceris plasmticos elevados, recomenda-se ingesto adequada de fibras, reduo de carboidratos na contribuio total de calorias e aumento na quantidade
de cido graxo -3 e cis-monoinsaturado.117
Uma alternativa para reduzir os fatores de risco cardiovasculares o consumo de nozes e oleaginosas. Em uma recente reviso,118 foi observado que os amendoins so capazes
de reduzir as concentraes de plasmticas de triacilgliceris,
colesterol total, substncias reativas ao cido tiobarbitrico,
ndice aterognico, resposta glicmica, colesterol heptico e o
risco de doena coronariana, enquanto aumenta a glutationa e
o HDL-c. Pistache, nozes, avels ou macadmia so indicados
para o tratamento de dislipidemia e sndrome metablica porque eles reduzem o LDL-c, colesterol total e apolipoprotena
B, enquanto aumentam o HDL-c. Pistache tambm reduz as
concentraes de triacilgliceris, glicose ps-prandial, o potencial antioxidante, a atividade e a estearoil-CoA dessaturase.
As amndoas tambm so teis no tratamento de dislipidemia
e na resistncia insulina, dado que reduzem o ndice glicmico de refeies de uma maneira dependente da dose. Alm
disso, o consumo de pequenas pores de nozes e oleaginosas, 2 a 6 vezes/semana reduz o risco de obesidade, infarto do
miocrdio, hipercolesterolemia e leses na aorta de indivduos
sadios. Por apresentarem efeitos diversos, o estudo conclui que
o consumo de uma mistura de nozes e oleaginosas seria o mais
indicado para reduo do risco cardiovascular.

Doena renal crnica


A reduo da funo renal contribui para a depleo de reservas de gorduras e protenas, especialmente de tecido muscular,
o que requer ateno para o diagnstico nutricional a partir de
antropometria e parmetros laboratoriais, a fim de conhecerem-se as reservas corporais. No diagnstico de distrofia nutricional, dever haver correo por meio de oferta suficiente
de energia para que no ocorra desnutrio ou sobrepeso. Na
fase no dialtica, carboidratos constituem o principal substrato energtico, considerando que h ocorrncia frequente de
dislipidemia e restrio proteica, o que posterga o incio da
terapia dialtica e reduz a sintomatologia urmica.119
A ingesto proteica entre 0,8 e 1g/kg/dia para indivduos
com diabetes no estgio inicial da doena renal crnica (DRC)
e 0,8 g/kg/dia na fase posterior da DRC pode melhorar as

06/10/2015 09:52:38

Princpios para Orientao Nutricional no Diabetes Mellitus 101

medidas da funo renal (taxa de excreo de albumina na


urina, taxa de filtrao glomerular).120 A reduo da ingesto de protena para menos de 0,8g/kg/dia (baseado no peso
ideal) no recomendada, uma vez que no melhora o controle glicmico, o risco cardiovascular nem o curso do declnio da
filtrao glomerular (A).2,8,121125
O tipo de protena utilizada na dieta pode ter importante
implicao na doena renal. Alguns estudos demonstram que
a substituio da carne vermelha pela de frango mostrou-se
capaz de reduzir a excreo urinria de albumina em pacientes
com DM2 e nefropatia diabtica (D).125
Evidncias clnicas tm apontado uma relao inversa
entre o nvel de vitamina D e o grau de albuminria. Esses
achados sugerem que a vitamina D pode ter um efeito antiproteinrico, exercendo funes moduladoras nos sistemas renal,
cardiovascular e imune (C).126
necessrio ainda que a prescrio nutricional considere as
recomendaes de eletrlitos, minerais, vitaminas e lquidos, os
quais dependem da fase da doena e devem ser individualizados.

Paciente em terapia renal substitutiva


importante destacar que, aps o incio da hemodilise ou dilise peritoneal, as recomendaes nutricionais devem ser reajustadas, devido perda de nutrientes durante o procedimento,
principalmente a perda proteica. Para esses pacientes, a recomendao de protena entre 1,2 e 1,4 g/kg/dia (C).127132 Mais
da metade dos pacientes consome menos de 1g de protena/kg/
dia, e o menor consumo proteico est relacionado com aumento
da mortalidade (A).116,117 A recomendao calrica em pacientes em terapia renal substitutiva de 30 a 35 kcal/kg/dia.127,130,131

Terapia nutricional enteral


As recomendaes internacionais para terapia nutricional
enteral (TNE) em diabetes foram iniciadas em 1998, quando
a Associao Americana de Diabetes (ADA) e a Associao
Europeia para Estudo em Diabetes (EASD) desenvolveram,
em Chicago/EUA, um consenso que estabeleceu propostas
para esse fim. Os ltimos consensos publicados pela ADA recomendam a presena de nutricionista habilitado na equipe
hospitalar, para conduzir plano realista sobre a TN.133
As indicaes da TN para os pacientes com diabetes devem
seguir as mesmas indicaes que para os demais pacientes.134
A via oral (VO) deve ser a preferencial quando a via digestiva
estiver disponvel e funcionando. Esta pode ser complementada com o uso de suplementos orais caso no alcance 60%
das necessidades energticas e proteicas do paciente. A TNE
utilizada em situaes de contraindicao da VO ou quando
o paciente ingerir menos que 60% de suas necessidades com
a VO. A terapia nutricional parenteral (TNP) est indicada
quando o trato gastrintestinal no estiver funcionando ou no
for possvel atingir no mnimo de 60% das necessidades nutricionais do paciente com a via enteral.135,136
primordial que se individualizem as necessidades nutricionais dos pacientes.137 Deve-se evitar a superalimentao,
sendo que o aporte energtico no deve passar de 35kcal/kg/
dia, devendo, em geral, permanecer entre 25 e 35kcal/kg/dia
(C) (D).27,138

Diretrizes SBD 2015-2016 - CAP 16.indd 101

Pacientes diabticos com indicao de TNE podem receber


frmulas enterais padro, que fornecem em torno de 50% do
valor energtico total (VET) na forma de carboidratos, preferencialmente frmulas polimricas e em infuso contnua lenta, para evitar fornecimento excessivo de glicose. Entretanto,
pacientes diabticos ou com hiperglicemia de estresse podem
se beneficiar de frmulas especializadas para DM, nas quais os
carboidratos representam de 33 a 40% do VET.119,139,140
As frmulas especficas para diabticos existentes no mercado nacional tm como objetivo reduzir complicaes metablicas relacionadas com a disglicemia. So produtos com
contedo total de carboidratos reduzido e acrscimo de fibras;
a recomendao de fibras para pacientes diabticos de no
mnimo 14g/1.000kcal ou 25g de fibra/dia (C).141 A incluso
de cidos graxos monoinsaturados tambm indicada nessas
frmulas, totalizando em torno de 20% do VET, por aumentarem a fluidez das membranas celulares, com consequente
reduo da resistncia ao da insulina.134,136 Ainda, preconiza-se limitar os cidos graxos saturados devido ao elevado
risco de doenas cardiovasculares nesse grupo de pacientes.
Alm do menor teor de carboidratos, essas frmulas so
compostas por carboidratos de absoro lenta, que atenuam a
resposta hiperglicmica ps-prandial (A).134142 As dietas enterais especializadas facilitam o controle glicmico e podem diminuir a necessidade de insulina, o que reduz o risco de hipoglicemia e, consequentemente, a variabilidade glicmica.134,140,142
A resposta glicmica dos pacientes no depende somente da dieta prescrita, mas tambm de outros fatores, como a
dosagem de insulina administrada, o grau de estresse, os diferentes mtodos de administrao da dieta enteral (bolus, contnua, intermitente), entre outros.
A presena da gastroparesia frequente em diabticos e
ocorre por degenerao das clulas nervosas do plexo mioentrico, determinando hipomotilidade antral, hipotonia gstrica,
contraes tnicas intensas no piloro e ausncia do esvaziamento de restos alimentares no estmago. Essa dismotilidade acomete tambm o intestino delgado. Eructaes, saciedade precoce, dor epigstrica, sensao de distenso abdominal, nuseas e
vmitos ps-prandiais so queixas comuns dos diabticos. Esses sintomas aumentam o risco de hipoglicemia, principalmente em pacientes que utilizam insulina, alm do risco nutricional
pelo dficit calrico e proteico.
As dietas isosmolares so esvaziadas mais facilmente no estmago do que as hipo ou hiperosmolares, assim como as dietas
hipoglicdicas com relao s hiperglicdicas. Assim, a escolha
do nutricionista por dieta isosmolar e hipoglicdica pode ser
mais benfica, j que favorece o esvaziamento gstrico. Os pacientes com gastroparesia diabtica podem ainda se beneficiar
com o uso de frmulas de alta densidade calrica, devido reduo no volume ofertado. Frmulas com menores quantidades
de fibras tambm podem ser benficas para atenuar os sintomas da gastroparesia. Outra opo a administrao via sonda nasojejunal, mas com cautela, pois a gastroparesia diabtica
acomete todo o trato gastrintestinal, o que aumenta o risco de
diarreia. Indica-se progresso baixa e lenta da taxa de infuso
(20 ml/h) com aumento de 10 a 20ml a cada 12h.136
Observar a ocorrncia de diarreia tambm importante,
que, em geral, noturna, de difcil controle, e decorrente da
neuropatia perifrica e autonmica. A presena de obstipao

06/10/2015 09:52:39

102 Diretrizes SBD | 2015-2016

intestinal pode ocorrer quando h reduo da motilidade colnica. Dietas ricas em fibras podem contribuir para o controle desses sintomas.

Suplementos orais
Os suplementos orais especializados para o controle glicmico
contm composio nutricional similar das dietas enterais
especializadas e, sendo assim, tambm podem contribuir para
o controle glicmico (C).136,140 Os efeitos benficos na melhora do controle glicmico esto relacionados com a composio
das frmulas, que fornecem menor teor de carboidratos, alm
de conterem carboidratos de baixo ndice glicmico e fibras,
que melhoram os nveis de glicemia ps-prandial. So formulaes com maiores concentraes de cidos graxos monoinsaturados, que aumentam a fluidez das membranas celulares
com consequente reduo da resistncia ao da insulina,
alm de controlarem os nveis de triglicerdios ps-prandiais e
o perfil lipdico. Reduzem ainda a glicemia ps-prandial, cuja
composio pode tambm diminuir a necessidade de insulina
e os episdios de hipoglicemia, bem como reduzir a variabilidade glicmica.134,136,140,143145
Em pacientes com baixo peso, risco nutricional ou consumo alimentar inferior a 60% das necessidades nutricionais, os
suplementos orais especializados podem ser indicados com o
intuito de aumentar aporte calrico, proteico e de micronutrientes. Para obter os benefcios de melhorar o estado nutricional e o controle glicmico, a indicao que o paciente
consuma de 2 a 3suplementos por dia (A).143145 Como a frmula especializada contm carboidratos de absoro lenta e
rica em gordura monoinsaturada e fibras, esta pode promover
saciedade prolongada e diminuir o consumo na refeio seguinte. O ideal que o consumo destes suplementos seja fracionado ao longo do dia ou utilizado como ceia, de maneira
que aumente aporte de nutrientes sem interferir nas demais
refeies.136
Com base nos benefcios metablicos dessas frmulas, estudos recentes tm comprovado tambm a eficcia dessa utilizao com o intudo apenas do controle glicmico, mesmo em
pacientes que no apresentam risco nutricional. Quando o objetivo somente o controle glicmico, o suplemento especializado
para diabetes deve substituir uma refeio isocalrica, sem resultar nem em acrscimo nem em dficit calrico.143,146,147

Terapia nutricional na cirurgia baritrica


A cirurgia baritrica (CB) pode ser considerada para diabticos tipo 2com IMC 35km/m2, especialmente se o diabtico
tem comorbidades de difcil controle, com terapia farmacolgica, alimentar e estilo de vida saudvel.2,148,149
Os pacientes submetidos a qualquer tcnica cirrgica ou
endoscpica necessitam de monitorao multidisciplinar em
perodos pr e ps-operatrio, por tempo indeterminado.2,150,151
Dependendo do procedimento cirrgico, a CB tem proporcionado normalizao total ou parcial da glicemia, dependendo
da tcnica cirrgica, em torno de 55 a 95%.99,103 Ao mesmo tempo, podero ocorrer deficincias nutricionais como hipovitaminoses, dficit de minerais, osteoporose e, mais raramente, grave
hipoglicemia, decorrente de hipersecreo insulnica.2,149,151

Diretrizes SBD 2015-2016 - CAP 16.indd 102

Terapia nutricional em pr-operatrio


O diagnstico nutricional (parmetros bioqumicos, antropomtricos, dietticos) dever ser realizado em todas as tcnicas,
para encaminhamento ao cirurgio do parecer nutricional.149,152
Quando ocorrer dficit de consumo em micronutrientes, mesmo sem dosagens bioqumicas, suplementao completa poder ser iniciada. Entendimento e disposio para mudanas do
comportamento alimentar, tanto no pr como no ps-cirrgico,
devem ser avaliados em todos os pacientes.149
Diretrizes atuais sugerem como rotinas nesse perodo:
profilaxia para gota rica nos pacientes de risco, uma vez que a
rpida perda ponderal poder precipitar novas crises durante
o ps-operatrio imediato; suspeita de abuso ou dependncia
de lcool encaminhado para avaliao e tratamento psiquitrico antes da cirurgia. No bypass gstrico nesses pacientes de
risco, evitar uso de lcool, por reduo do metabolismo do lcool e risco de alcoolismo.149,153
Na maioria dos pacientes, faz-se necessria a associao de
dieta hipocalrica e hiperproteica com dietas especializadas e/ou
associadas a suplementos alimentares ou farmacolgicos, para
anemia ferropriva, megaloblstica, hipovitaminose D, consumo
insuficiente de protenas de alto valor biolgico, micronutrientes
essenciais e fibra diettica.149,152,154 No perodo de 3 a 7dias que
antecede a cirurgia, indicada dieta lquida hipocalrica e hiperproteica para reduzir a gordura intra-abdominal, prevenir a sndrome intra-abdominal comportamental, reduzir a probabilidade de edema pulmonar ps-operatrio, entre outros benefcios.150
indicado o uso de suplementos industrializados lquidos
adicionados com fibras e suplementados com micronutrientes, sobretudo se o paciente continua nas atividades habituais
fora do seu domiclio.149,152

Terapia nutricional em ps-operatrio da


cirurgia baritrica
O objetivo da TN especializada evitar e/ou reduzir as possveis complicaes nutricionais imediatas, como dumping,
desidratao, vmitos (quando frequentes podero provocar
dficit de tiamina), desnutrio proteico-calrica, anemia
com/sem dficit de ferro,145 constipao intestinal, hipotenso,
nuseas, halitose, pirose, gases em grande quantidade, diarreia, anorexia, transtornos alimentares.152
No ps-operatrio imediato, so usados dieta lquida de
prova ou lquidos claros at a alta hospitalar no terceiro ao
quarto dia de ps-operatrio (DPO). Dieta lquida total sem
lactose e sacarose at o 15o DPO, hipocalrica, normolipdica,
hiperproteica (mnimo 60 a 90g/dia).155,157
Caso ocorra adaptao do trato gastrintestinal nesse perodo,
evoluir a dieta para semilquida, que proporcionar mais prazer
ao paciente, alm do horrio de refeies de 3/3h j estabelecido.
Exemplos de cardpios qualitativo e quantitativo, com base nos
alimentos que fazem parte do padro alimentar do paciente, adicionado a suplementos proteicos de fcil digesto, fibras solveis e
polivitamnicos/minerais lquidos at o 30o DPO.2,154,155,157
promovido o retorno dieta de consistncia normal, com
adaptaes de 3 a 7dias de alimentos e/ou preparaes que requeiram transio da dieta branda, sem irritantes gstricos.158
Lquidos podem ser ingeridos a partir de 30min aps as refeies

06/10/2015 09:52:39

Princpios para Orientao Nutricional no Diabetes Mellitus 103

principais, evitando, assim, sintomas gastrintestinais.149,152 A


ingesto proteica dever ficar em torno de 60 a 120g/dia, para
manuteno ou mnima perda de massa magra, durante a rpida perda de peso.135 A dietoterapia essencial para o sucesso
cirrgico, em que a orientao individualizada nas diversas fases, de pr e ps-operatrio, reduz os riscos clnico nutricionais
e metablicos a que a cirurgia predispe.2,152,154,156
Na tcnica de bypass, ocorre reduo da ingesto alimentar
para um volume inicial de 30 a 50ml associado excluso do
duodeno e parte significativa do jejuno, com efeitos na rpida
perda ponderal de grandes volumes de massa gorda, alm de
perdas significativas de massa magra.148,149 A adeso a um padro alimentar saudvel, composto de refeies hiperproteicas, dentro das condies socioeconmicas e culturais, constitui o eixo fundamental do atendimento nutricional.149,156
O monitoramento cliniconutricional por toda a vida previne
ou trata precocemente as deficincias nutricionais (Quadro3) e
reganho ponderal que podem ocorrer em mdio/longo prazo
(Quadro4).156 O monitoramento deve ser feito na dependncia
das principais tcnicas cirrgicas atuais, como banda gstrica
laparoscpica ajustvel (LAGB), gastrectomia vertical laparoscpica (LSG, do ingls laparoscopic sleeve gastrectomy), bypass
gstrico em Y de Roux (RYGB) e derivao biliopancretica laparoscpica/duodenal switch (BPD/DS), em pacientes diabticos ou no diabticos.156
Rotinas especficas de tratamento nutricional so sugeridas
na ltima Diretriz da Sociedade Americana de Cirurgia Baritrica e Metablica, que devem ser consideradas em cada caso
individualmente:

Hipofosfatemia leve ou moderada pode ocorrer por hipovitaminose D, com possibilidade de correo por meio de
suplemento oral de fosfato
Oxalose e clculos de oxalato de clcio: maior ingesto de lquidos (> 1,5 l/dia), dieta reduzida em oxalato e uso de
probiticos melhoram a excreo renal de oxalatos e os nveis

de supersaturao; em casos de deficincia de vitaminas lipossolveis com hepatopatia, coagulopatia ou osteoporose,


avaliar nveis de vitamina K1
Anemias nutricionais decorrentes de tcnicas mal-absortivas podem envolver deficincias de vitamina B12, cido
flico, protena, cobre, selnio e zinco; devem ser avaliados
quando anemia por deficincia de ferro for negativa
Screening para zinco realizado nos procedimentos mal-absortivos e considerado nos pacientes com grave queda de cabelo,
pica, disgeusia significante, em homens com hipogonadismo e
disfuno ertil. Com o intuito de evitar dficit de cobre, associar 1mg de cobre para cada 8 a 15mg de zinco suplementado
Suplementao de cobre (dose de 2mg/dia) deve ser includa na rotina com multivitamnico-mineral, avaliar em anemia, neutropenia, mielopatias e inadequada cicatrizao
de feridas; deficincia de tiamina na rpida perda de peso
(acima da mdia para a tcnica cirrgica), vmitos prolongados, nutrio parenteral, excesso de lcool, neuropatia,
encefalopatia ou insuficincia cardaca
Suspeita de supercrescimento bacteriano na ala biliopancretica aps derivao biliopancretica ou duodenal switch
(BPD ou DBP/DS) deve ser tratada empiricamente com metronidazol ou antibiticos; em casos de resistncia, Lactobacillus plantarum e Lactobacillus GG podem ser considerados
Nas alteraes gastrintestinais graves e persistentes com sintomas de nuseas, vmitos, dor abdominal, diarreia e constipao intestinal, necessria urgente avaliao do cirurgio
TNE ou TNP deve ser considerada nos casos de risco nutricional (NRS 2002 com pontuao 3) ou desnutrio
grave; esta ltima tratada em nvel hospitalar, seguindo diretrizes atuais de TN
A NP indicada quando no so atingidos 75% das necessidades nutricionais por via oral ou enteral, aps 5 a 7dias
com doena no crtica ou 3 a 7dias com doena grave e
na desnutrio proteica grave e/ou hipoalbuminemia no
responsiva suplementao proteica oral ou enteral.149

Quadro 3 Diagnstico e tratamento das deficincias nutricionais.156


Tratamento de 1a fase

Tratamento de 2a fase

Deficincias

Sinais/sintomas

Confirmao

Desnutrio
proteica

Fraqueza, perda de massa


magra, cabelos quebrados,
edema generalizado

Albumina srica e nveis Suplementos proteicos


de pr-albumina,
creatinina srica

Clcio/vitamina D

Hipocalcemia, tetania,
formigamento, cibras

Clcio total e ionizado,


PTH intacto, 25-OHD,
densitometria ssea

Vitamina B12

Anemia perniciosa, formigamento Contagem de clulas


nos dedos das mos e dos ps,
sanguneas, nveis
depresso, demncia
de B12

B12 oral cristalina,


350 mg/d

1.000 a 2.000 mg/2 a


3 meses IM

Folato

Anemia macroctica, palpitaes, Contagem de clulas


fadiga, defeitos no tubo neural
sanguneas, nveis de
folato e homocistena

Folato oral 400 mg/d,


includo em
polivitamnico

Folato oral 1.000 mg/d

Ferro (Fe)

Reduo de atividade,
palpitaes, fadiga, cabelos
quebradios, anemia

Contagem de clulas
sanguneas, Fe srico,
capacidade de fixao
do Fe, ferritina

Sulfato ferroso 300 mg


2 a 3 vezes/d, associado
vitamina C

Fe parenteral

Vitamina A

Xeroftalmia, cegueira noturna,


reduo da imunidade

Nveis de vitamina A

Vitamina A oral
5.000 a 10.000 UI/d

Vitamina A oral
50.000 UI/d

Enteral/parenteral/
reverso da tcnica
cirrgica

Citrato de clcio 1.200 a Calcitriol oral vitamina


2.000 mg oral; vitamina D 1.000 UI/d
D 50.000 UI/d

25-OHD: 25-hidrxi-vitamina D (calcidiol); PTH: paratormnio.

Diretrizes SBD 2015-2016 - CAP 16.indd 103

06/10/2015 09:52:39

104 Diretrizes SBD | 2015-2016


Quadro 4 Checklist para monitoramento ps-operatrio de cirurgia baritrica e metablica, especfico por tcnica cirrgica.
Cuidados no ps-operatrio imediato
Itens do checklist

LAGB*

LSG**

RYGB***

BPD/DS****

Progresso da dieta supervisionada por


nutricionista especialista (NE)

Educao alimentar realizada por NE

Polivitamnico-mineral (tablete com


requerimento mnimo)

Citrato de clcio 1.200 a 1.500 mg/d

Vitamina D mnimo 3.000 UI/d

Vit. B12, necessrio para normalidade

Adequada hidratao > 1,5 l/d

Monitorar glicose no diabetes e nos sintomas


hipoglicmicos

Visitas: inicial, intervalo at estveis, uma vez estveis (meses)

Follow-up
1, 1 a 2, 12

1, 3 a 6, 12

1, 3, 6 a 12

1, 3, 6

Monitorar progresso com perda ponderal e evidncias de


complicaes a cada visita

Contagem completa de clulas sanguneas/plaquetas, Fe


srico em pr e ps-cirrgico e capacidade de fixao de Fe

Considerar profilaxia para gota rica e colelitase em


determinados pacientes

Avaliar lipdios a cada 6 a 12 meses, na dependncia do risco e


da terapia realizada

Monitorar adeso atividade fsica

Avaliar necessidade de grupos de suporte

Densidade ssea a cada 2 anos (DEXA)

Excreo de Ca urinrio de 24 h, aos 6 meses e, aps,


anualmente

B12 anualmente e 3 a 6 meses se suplementado

Folato, estudos de ferro, 25-vitamina D, PTH

Vitamina A inicialmente e 6 a 12 meses se necessrio

Opcional

Cobre, zinco e selnio; avali-los com fins especficos

Avaliar tiamina com fins especficos

*LAGB: banda gstrica laparoscpica ajustvel; **LSG: gastrectomia vertical laparoscpica; ***RYGB: bypass gstrico em Y de Roux; ****BPD/DS, derivao
biliopancretica laparoscpica/duodenal switch.

Edulcorantes
Os edulcorantes, comumente chamados de adoantes, no so
essenciais ao tratamento do diabetes como a medicao oral/
insulina e o monitoramento da glicemia, mas podem favorecer
o convvio social e a flexibilidade do plano alimentar.
O uso de edulcorantes no nutritivos tem o potencial de
reduzir calorias e carboidratos na ingesto global se substiturem adoantes calricos sem compensao por ingesto de calorias adicionais de outras fontes alimentares (B). A Food and
Drug Administration (FDA) aprovou o consumo de acessulfame K, luo han guo, neotame, aspartame, sacarina sdica, estvia e sucralose. Todos esses edulcorantes foram submetidos
a rigorosa anlise, mostrando-se seguros quando consumidos
pelo pblico em geral, inclusive por pessoas com diabetes e
mulheres durante a gestao, quando a ingesto diria aceitvel (IDA) respeitada (A).159

Diretrizes SBD 2015-2016 - CAP 16.indd 104

Os edulcorantes aprovados pela Anvisa no Brasil so sorbitol, manitol, isomaltitol, maltitol, sacarina, ciclamato, aspartame, estvia, acessulfame de potssio, sucralose, neotame,
taumatina, lactitol, xilitol e eritritol.160

Uso de tecnologias
O gerenciamento de uma doena crnica exige embasamento
cientfico aliado a prtica clnica, habilidades tcnicas, atitudes
e capacidade de tomada de decises. Est bem documentado
que a tecnologia facilita a coleta, o processamento, o armazenamento e a troca de informaes, e, dentro de cada categoria,
englobam-se aplicativos que tm funes especficas em ambientes de sade.161
A Organizao Mundial da Sade (OMS) define e-sade
como o uso de tecnologias da informao e comunicao no
setor da sade e a considera como uma das reas de maior

06/10/2015 09:52:39

Princpios para Orientao Nutricional no Diabetes Mellitus 105

crescimento na sade atualmente.162 Ademais, em reviso


sistemtica identificou-se que servios de sade que adotam
a tecnologia de informao em sade melhoram o monitoramento e a aderncia dos pacientes ao tratamento, alm de
reduzir visitas s unidades de sade.163
Sabe-se que o cuidado nutricional em diabetes inclui determinar necessidades nutricionais especficas, para definio
do plano de cuidados, bem como transmitir a informao,
favorecendo a compreenso e adeso ao tratamento diettico prescrito. O grande desafio que isso requer tomada de
decises em ambientes que podem ou no apoiar o planejamento e a execuo dessas recomendaes. Nesse contexto, as
ferramentas tecnolgicas, quando bem indicadas e supervisionadas pela equipe, podem contribuir para maior confiana e
autonomia na implementao das orientaes nutricionais.161
Desse modo, os aplicativos de nutrio, disponveis para celulares iOS e Android, so ferramentas capazes de potencializar
a continuidade do plano estabelecido, pois possibilitam as seguintes vantagens:

Acessar banco de dados contendo grupos de alimentos em


uma tabela de equivalncia nutricional que auxilia a substituio de alimentos
Buscar informaes nutricionais especficas para a contagem de carboidratos
Registrar os alimentos consumidos e posterior consulta dos
dados
Simular as refeies antes do consumo para orientao das
decises
Incluir informaes nutricionais de novos alimentos fornecidos pelo nutricionista
Planejar refeies com alertas para horrios
Visualizar evoluo do seguimento do plano alimentar
prescrito e peso
Acompanhar o consumo por grupos de alimentos, apontando as tendncias ao desequilbrio
Enviar dados dos registros para avaliao do profissional
durante a consulta de nutrio.

Outra ferramenta comumente utilizada a mensagem de


texto por celular (conhecida como SMS, ou short message system), a qual se tem mostrado efetiva para a mudana de curto
prazo de comportamentos em sade, como o autocuidado em
diabetes, uma vez que o paciente recebe vrias mensagens diariamente, incentivando comportamentos saudveis.161
Mais recentemente, tem-se utilizado tambm o WhatsApp,
ferramenta com tima aceitao, nas diversas faixas etrias,
pelo diferencial quanto possibilidade de enviar e receber
informaes em tempo real, como os resultados do monitoramento da glicemia. Na literatura, j est muito bem documentado que as excurses glicmicas so potentes ativadores
do estresse oxidativo, um dos principais contribuintes para as
complicaes vasculares. Sendo assim, ter acesso a essas informaes atualizadas regularmente auxilia tambm na teraputica nutricional atual, cuja nfase reside nas intervenes
que minimizem a hiperglicemia ps-prandial, por meio do
prvio conhecimento da glicemia e da resposta glicmica dos
alimentos quando a glicemia avaliada antes das refeies e
2h ps-prandial.164166

Diretrizes SBD 2015-2016 - CAP 16.indd 105

No final da dcada de 1990, o monitoramento contnuo da


glicose abriu um novo mundo de oportunidades para avaliar a
resposta glicmica dos alimentos, das refeies, da atividade fsica, dos medicamentos, do estresse e de outras situaes do cotidiano. Atualmente, o monitoramento de glicose em tempo real
fornece leituras que mostram a variabilidade glicmica, a cada
poucos minutos, durante o dia e a noite, oferecendo feedback
imediato equipe e s pessoas com DM, possibilitando ajustes
da terapia com maior eficcia.167
Recentemente, tambm se tem utilizado o WhatsApp. Um
aplicativo de tima aceitao nas diversas faixas etrias, devido a possibilidade de enviar e de receber informaes em tempo real. Por meio dele o paciente pode enviar fotos das refeies e alimentos, bem como os resultados do monitoramento
da glicemia.
As inovaes tecnolgicas e cientficas oferecem vantagens
na aquisio de novos conhecimentos teraputicos, o que torna o campo de atuao do nutricionista mais amplo e eficiente
e possibilita ao profissional maior disponibilidade para coletar
e analisar dados, enriquecendo enormemente a prtica clnica.
Quadro 5 Recomendaes e concluses.
Recomendaes e concluses

Grau de
recomendao

Em indivduos com risco de desenvolver


DM2, deve-se estimular mudanas de
estilo de vida a partir de programas
educativos, baseados em perda moderada
de peso corporal e prtica semanal de
atividade fsica (150 min/semana)

O estabelecimento de um plano
alimentar para controle de pacientes
com DM associado a mudanas no
estilo de vida, incluindo a atividade fsica,
so considerados terapias de primeira
escolha

Os carboidratos oriundos de hortalias,


leguminosas, gros integrais, frutas e leite
desnatado devem ser incentivados dentro
do contexto de uma dieta saudvel

A sacarose pode ser substituda por outros


carboidratos e utilizada no contexto do
plano alimentar prescrito

Recomenda-se que o total de sacarose


no ultrapasse 10% do valor calrico total

Adoantes no nutritivos so seguros


quando consumidos at o nvel dirio
aceitvel de ingesto, estabelecido pela
Food and Drug Administration (FDA)

A carga glicmica oferece um modesto


benefcio adicional em relao
contagem de carboidrato

No so encontradas evidncias
suficientes para recomendar o uso de
alimentos de baixo ndice glicmico como
estratgia primria no plano alimentar

O mtodo de contagem de carboidratos


considerado a chave do tratamento
nutricional do DM1

(continua)

06/10/2015 09:52:39

106 Diretrizes SBD | 2015-2016


Quadro 5 Recomendaes e concluses (continuao).
Recomendaes e concluses

Quadro 5 Recomendaes e concluses (continuao).

Grau de
recomendao

Carboidrato e gordura monoinsaturada


juntos devem perfazer 60 a 70% da
ingesto energtica. Entretanto, o perfil
metablico e a necessidade de perda de
peso devem ser considerados quando se
determina a quantidade de gordura
monoinsaturada da dieta

Como para todas as pessoas, o consumo


de fibras alimentares deve ser encorajado
(14 g/1.000 kcal), mas no h razo para
recomendar aos portadores de DM o
consumo de maior de fibras

Os cidos graxos trans devem ter seu


consumo reduzido

A recomendao para ingesto do


colesterol alimentar < 200 mg

O consumo de duas ou mais pores


de peixes por semana, com exceo das
preparaes fritas, deve ser
recomendado

No existem evidncias de que sugiram


que a ingesto proteica normal deva ser
modificada quando a funo renal
normal

No h evidncias suficientes quanto


ao benefcio da suplementao de
vitaminas e minerais em portadores de
DM que no apresentem deficincia
desses nutrientes

A ingesto diria de lcool deve ser


limitada a uma quantidade moderada
(uma dose ou menos por dia para
mulheres e 2 doses ou menos ao dia para
homens). Uma dose definida como
360 ml de cerveja, 150 ml de vinho ou
45 ml de bebida destilada

As necessidades nutricionais na gestao/


lactao e para crianas/adolescentes so
similares s de outros indivduos de
mesma idade

As crianas e os adolescentes com


DM1 necessitam ser triados para
doena celaca. O glten deve ser retirado
do plano alimentar pelo profissional
nutricionista naqueles que apresentarem
diagnstico positivo para a doena celaca

Para correo de hipoglicemia, sugere-se


o uso de 15 g de carboidratos de rpida
absoro

O consumo de sdio deve ser limitado a


2.000 mg/dia, o que equivale a 5 g de
cloreto de sdio

A adoo dos princpios da dieta DASH


tem sido efetivamente correlacionada
com a reduo da presso arterial

Grau de
recomendao

O acrscimo de esteris de plantas


favorece a reduo do colesterol total
e do colesterol LDL

A recomendao para o cido graxo


saturado atingir < 7% do total de
energia

Na presena de microalbuminria e
indivduos com taxa de filtrao glomerular
> 70 ml/minuto, a oferta de protenas
dever ser mantida em 0,8 a 1,0 g/kg/dia, o
mesmo que para a populao no
diabtica. Quando a taxa estiver entre
70 ml e 30 g/min, recomenda-se restrio
proteica de 0,6 g/kg/dia

Referncias bibliogrficas

(continua)

Diretrizes SBD 2015-2016 - CAP 16.indd 106

Recomendaes e concluses

1. World Health Organization (WHO). Diet, nutrition and the


prevention of chronic diseases. Report of a joint FAO/WHO Expert Consultation. Geneva: Technical Report Series 916, 2003.
2. American Diabetes Association Standards of Medical Care in
Diabetes 2015. Diabetes Care. 2015 jan; 38(Suppl 1).
3. Pi-Sunyer FX, Maggio CA, McCarron DA et al. Multicenter
randomized trial of a comprehensive prepared meal program in
type 2diabetes. Diabetes Care. 1999; 22:191-7.
4. Kulkarni K, Castle G, Gregory R etal. Nutrition practice guide
Dietetic Practice Group. J Am Diet Assoc. 1998; 98:62-70.
5. Rickheim PL, Weaver TW, Flader JL etal. Assessment of group
versus individual diabetes education: a randomized study. Diabetes Care. 2002; 25:269-74.
6. Diabetes 1 and 2 Evidence Analysis Project: American Dietetic
Association evidence analysis library website. Disponvel em:
<fromhttps://www.adaevidencelibrary.com/topic.cfm?cat=1615>.
7. The implementation of nutritional advice for people with diabetes Nutrition Subcommittee of the Diabetes Care Advisory
Committee of Diabetes UK. Diabetes Medicine. 2003; 786-807.
8. Canadian Diabetes Association Clinical Practice Guidelines
Expert Committee. Canadian Diabetes Association 2013Clinical Practice Guidelines for the Prevention and Management of
Diabetes in Canada. Can J Diabetes. 2013; 37(Suppl 1):S1-S212.
9. General practice management of type 2 diabetes 201415.
Melbourne: The Royal Australian College of General Practitioners and Diabetes Australia, 2014.
10. Human Energy requeriments. Report of a joint FAO/WHO/
UNU. Expert Consultation. Rome, 2004.
11. Santos RD, Gagliardi ACM, Xavier HT etal. Sociedade Brasileira
de Cardiologia. I Diretriz sobre o Consumo de Gorduras e Sade
Cardiovascular. Arq Bras Cardiol. 2013; 100(1 Supl 3):1-40.
12. Funnel MM, Brown TL, Childs BP et al. National Standards
for diabetes self-management education. Diab Care. 2010 jan;
33(Suppl 1).
13. Wheeler ML, Dunbar SA, Jaacks LM et al. Macronutrients, food
groups, and eating patterns in the management of diabetes: a systematic review of the literature, 2010. Diabetes Care. 2012; 35:434-45.
14. American Diabetes Association. Position Statement. Nutrition
therapy recommendations for the management of adults with
diabetes. Diabetes Care. 2014 jan; 37(Suppl 1).
15. Nutrition Subcommittee of the Diabetes Care Advisory Committee of Diabetes UK. The implementation of nutritional advice for people with diabetes. Diabetes Medicine. 2003.

06/10/2015 09:52:39

Princpios para Orientao Nutricional no Diabetes Mellitus 107


16. Canadian Diabetes Association. Clinical Practice Guidelines for
the Prevention and Management of Diabetes in Canada. 2008
apr; 37(Suppl 1):323.
17. Kelley DE. Sugars and starch in the nutritional management of
diabetes mellitus. Am J Clin Nutr. 2003 oct; 78(4):S858-S64.
18. Wheeler ML, Dunbar SA, Jaacks LM etal. Macronutrients, food
groups, and eating patterns in the management of diabetes: a
systematic review of the literature, 2010. Diabetes Care. 2012;
35:434-45.
19. Thomas D, Elliott EJ. Low glycaemic index, or low glycaemic
load, diets for diabetes mellitus. Cochrane Database Syst Rev.
2009; 1:CD006296.
20. Brasil. Ministrio da Sade, Secretaria de Ateno Sade, Departamento de Ateno Bsica. Guia alimentar para a populao brasileira. 2a ed. Braslia: Ministrio da Sade, 2014. pp. 156.
21. Bernaud FSR, Rodrigues TC. Fibra alimentar Ingesto adequada e efeitos sobre a sade do metabolismo. Arq Bras Endocrinol Metab. 2013; 57:397-405.
22. Kang Yu MD etal. The impact of soluble fibre on gastric emptying, postprandial blood glucose and insulin in patients with
type 2diabetes. Asia Pac J Clin Nutr. 2014; 23(2):210-8.
23. Lindstrom J, Peltonen M, Eriksson JG etal. High Fiver, low fat
diet predicts long terme weight loss and decreased type 2diabetes risk: the Finnish Diabetes Prevention Study. Diabetologia.
2006; 49:912-20.
24. Bernaud FSR, Rodrigues TC. Fibra alimentar Ingesto adequada e efeitos sobre a sade do metabolismo. Arq Bras Endocrinol Metab. 2013; 57:397-405.
25. Kang Yu MD etal. The impact of soluble fibre on gastric emptying, postprandial blood glucose and insulin in patients with
type 2diabetes. Asia Pac J Clin Nutr. 2014; 2(2):210-8.
26. Kulkarni K, Castle G, Gregory R etal. Nutrition practice guideDietetic Practice Group. J Am Diet Assoc.1998; 98:62-70.
27. Franz MJ, Bantle JP, Beebe CA, Brunzell JD et al. Evidencebased nutrition principles and recommendations for the treatment and prevention of DM and related complications. Diabetes Care. 2003jan; 26(Suppl 1):S51-61.
28. Xavier HT et al. V Diretriz Brasileira de Dislipidemias e Preveno da Aterosclerose. Arq Bras Cardiol [online]. 2013; 101(4
Suppl 1).
29. Ramos SC, Fonseca FA, Kasmas SH et al. The role of soluble
fiberin take in patients under highly effective lipid-lowering
therapy. The role of soluble fiber intake in patient sunder highly
effective lipid-lowering therapy.
30. American Association of Diabetes Educators (AADE). Healthy
eating: incorporating nutritional management into lifestyle. The
Diabetes Educator. 2012jan-feb; 38(1):124-8.
31. Evert AB, Boucher JL, Cypress M etal. Nutrition therapy recommendations for the management of adults with diabetes.
Diabetes Care. 2014jan; 37(Suppl 1):S120-S43.
32. Institute of Medicine. Dietary reference intakes for energy, carbohydrate, fiber, fat, fatty acids, cholesterol, protein, and amino
acids. Washington, DC: National Academies Press, 2002.
33. Gower BA, Goss AM. A lower-carbohydrate, higher-fat diet
reduces abdominal and intermuscular fat and increases insulin
sensitivity in adults at risk of type 2diabetes. J Nutr. 2015jan;
145(1):S177-S83.
34. Nanri A, Mizoue T, Kurotani K etal. Japan Public Health Center-Based Prospective Study Group. Low-carbohydrate diet and
type 2diabetes risk in Japanese men and women: the Japan Public Health Center-Based Prospective Study. PLoS One. 2015feb
19; 10(2):e0118377. doi:10.1371/journal.pone.0118377.
35. Feinman RD, Pogozelski WK, Astrup A etal. Dietary carbohydrate restriction as the first approach in diabetes management:
critical review and evidence base. Nutrition. 2015jan; 31(1):1-13.

Diretrizes SBD 2015-2016 - CAP 16.indd 107

36. Eckel RH, Jakicic JM, Ard JD etal. American College of Cardiology/American Heart Association Task Force on Practice Guidelines. 2013 AHA/ACC guideline on lifestyle management to
reduce cardiovascular risk: a report of the American College of
Cardiology/American Heart Association Task Force on Practice
Guidelines. J Am Coll Cardiol. 2014jul 1; 63(25Pt B):2960-84.
37. Brehm BJ, Lattin BL, Summer SS etal. One-year comparison of
a high monounsaturated fat diet with a high carbohydrate diet
in type 2diabetes. Diabetes Care. 2009; 32:215-20.
38. Schwingshackl L, Strasser B, Hoffmann G. Effects of monounsaturated fatty acids on glycaemic control in patients with
abnormal glucose metabolism: a systematic review and metaanalysis. Ann Nutr Metab. 2011; 58:290-6.
39. Itsiopoulos C, Brazionis L, Kaimakamis M etal. Can the Mediterranean diet lower HbA1c in type 2diabetes? Results from a
randomized cross-over study. Nutr Metab Cardiovasc Dis. 2011;
21:740-7.
40. Tanasescu M, Cho E, Manson JE etal. Dietary fat and cholesterol and the risk of cardiovascular disease among women with
type 2diabetes. Am J Clin Nutr. 2004; 79:999-1005.
41. Esposito K, Maiorino MI, Ciotola M etal. Effects of a Mediterranean-style diet on the need for antihyperglycemic drug therapy
in patients with newly diagnosed type 2diabetes: a randomized
trial. Ann Intern Med. 2009; 151:306-14.
42. Estruch R, Ros E, Salas-Salvad J etal. PREDIMED Study Investigators. Primary prevention of cardiovascular disease with a
Mediterranean diet. N Engl J Med. 2013; 368:1279-90.
43. Brunerova L, Smejkalova V, Potockova J etal. A comparison of
the influence of a high-fat diet enriched in monounsaturated
fatty acids and conventional diet on weight loss and metabolic
parameters in obese nondiabetic and type 2 diabetic patients.
Diabet Med. 2007; 24:533-40.
44. Martnez-Gonzlez MA, Salas-Salvad J, Estruch R et al.
PREDIMED Investigators. Benefits of the Mediterranean diet:
insights from the PREDIMED Study. Prog Cardiovasc Dis.
2015may 1. pii:S0033-0620(15)00028-6.
45. Babio N, Toledo E, Estruch R et al. PREDIMED Study Investigators. Mediterranean diets and metabolic syndrome status in the PREDIMED randomized trial. CMAJ. 2014 nov 18;
186(17):E649-E57.
46. Khazrai YM, Defeudis G, Pozzilli P. Effect of diet on type 2 diabetes mellitus: a review. Diabetes Metab Res Rev. 2014 mar;
30(Suppl 1):24-33.
47. Takkunen MJ, Schwab US, de Mello VD et al. DPS Study Group.
Longitudinal associations of serum fatty acid composition with
type 2 diabetes risk and markers of insulin secretion and sensitivity in the Finnish Diabetes Prevention Study. Eur J Nutr. 2015
may 1. [Epub ahead of print].
48. West SG, Hecker KD, Mustad VA etal. Acute effects of monounsaturated fatty acids with and without omega-3fatty acids on
vascular reactivity in individuals with type 2diabetes. Diabetol.
2005jan; 48(1):113-22.
49. Kopecky J, Rossmeisl M, Flachs P etal. n-3PUFA: bioavailability and modulation of adipose tissue function. Proc Nutr Soc.
2009nov; 68(4):361-9.
50. Fedor D, Kelley DS. Prevention of insulin resistance by
n-3 polyunsaturated fatty acids. Curr Opin Clin Nutr Metab
Care. 2005mar; 12(2).
51. Mozaffarian D, Bryson CL, Lemaitre RN etal. Fish intake and
risk of incident heart failure. J Am Coll Cardiol. 2005jun 21;
45(12):2015-21.
52. Villegas R, Takata Y, Murff H et al. Fish, omega-3 long-chain
fatty acids, and all-cause mortality in a low-income US population: Results from the Southern Community Cohort Study.
Nutr Metab Cardiovasc Dis. 2015jul; 25(7):651-8.

06/10/2015 09:52:39

108 Diretrizes SBD | 2015-2016


53. Gannon MC, Nuttall FQ. Effect of a high-protein, low-carbohydrate diet on blood glucose control in people with type 2diabetes. Diabetes. 2004sep; 53(9):2375-82.
54. Mahan LK, Escott-Stump S. Krause. Alimentos, nutrio e dietoterapia. 11a ed. So Paulo: Roca, 2005.
55. Hamdy O, Horton ES. Protein content in diabetes nutrition
plan. Curr Diab Rep. 2011; 11:111-9.
56. Abbas EK, Kristin A, Jim YW etal. Effects of high-protein versus
high-carbohydrate diets on markers of b-cell function, oxidative
stress, lipid peroxidation, proinflammatory cytokines, and adipokines in obese, premenopausal women without diabetes: A randomized controlled trial. Diabetes Care. 2013 jul; 36(7):1919-25.
57. Chehade JM. The role of micronutrients in managing diabetes.
Diab Spec. 2009sep; 21(22):214-8.
58. Muniyappa R, Hall G, Kolodziej TL etal. Cocoa consumption
for 2wk enhances insulin-mediated vasodilatation without improving blood pressure or insulin resistance in essential hypertension. Am J Clin Nutr. 2008; 88:1685-96.
59. Pimentel GD, Zemdegs JC, Theodoro JA etal. Does long-term
coffee intake reduce type 2 diabetes mellitus risk? Diabetol
Metab Syndr. 2009sep 16; 1(1):6.
60. Roussel AM, Hininger I, Benaraba R etal. Antioxidant effects of
a cinnamon extract in people with impaired fasting glucose that
are overweight or obese. J Am Coll Nutr. 2009feb; 28(1):16-21.
61. Avignon A, Hokayem M, Bisbal C etal. Dietary antioxidants: do
they have a role to play in the ongoing fight against abnormal
glucose metabolism? Nutrition. 2012 jul; 28(7-8):715-21.
62. Bisbal C, Lambert K, Avignon A. Antioxidants and glucose metabolism disorders. Curr Opin Clin Nutr Metab Care. 2010jul;
13(4):439-46.
63. van Horn L, McCoin M, Kris-Etherton PM et al. Potential
mechanisms and needs for future research are summarized for
each relevant nutrient, food, or food component. J Am Diet Assoc. 2008feb; 108(2):287-331.
64. Reinstatler L, Qi YP, Williamson RS et al. Association of biochemical B12 deficiency with metformin therapy and vitamin
B12supplements: the National Health and Nutrition Examination Survey, 1999-2006. Diabetes Care. 2012feb; 35(2):327-33.
65. Chagas CE, Borges MC, Martini LA etal. Focus on vitamin D, inflammation and type 2diabetes. Nutrients. 2012jan; 4(1):52-67.
66. Viktorinova A, Toserova E, Krizko M etal. Altered metabolism
of copper, zinc, and magnesium is associated with increased levels of glycated hemoglobin in patients with diabetes mellitus.
Metabolism. 2009 oct; 58(10):1477-82.
67. Jayawardena R, Ranasinghe P, Galappatthy P etal. Effects of zinc
supplementation on diabetes mellitus: a systematic review and
meta-analysis. Diabetol Metab Syndr. 2012 apr 19; 4(1):13.
68. Wijesekara N, Chimienti F, Wheeler MB. Zinc, a regulator of
islet function and glucose homeostasis. Diabetes Obes Metab.
2009nov; 11(Suppl 4):202-14.
69. Seet RC, Lee CY, Lim EC etal. Oral zinc supplementation does
not improve oxidative stress or vascular function in patients
with type 2 diabetes with normal zinc levels. Atherosclerosis.2011nov; 219(1):231-9.
70. Takagi H, Kobayashi Y, Taguchi O etal. Influence of dietary intake of fish oil, magnesium, and zinc on metabolic parameters
among individuals tested for diabetes. Nutrition. 2015 jul-aug;
31(7-8):988-93.
71. De Leeuw I, Engelen W, De Block C etal. Long term magnesium
supplementation influences favourably the natural evolution of
neuropathy in Mg-depleted type 1 diabetic patients (T1 dm).
Magnes Res. 2004jun; 17(2):109-14.
72. Djurhuus MS, Klitgaard NA, Pedersen KK et al. Magnesium reduces insulin-stimulated glucose uptake and serum lipid concentrations in type 1diabetes. Metabolism. 2001dec; 50(12):1409-17.

Diretrizes SBD 2015-2016 - CAP 16.indd 108

73. Song Y, He K, Levitan EB etal. Effects of oral magnesium supplementation on glycaemic control in type 2diabetes: a metaanalysis of randomized double blind controlled trials. Diabet
Med. 2006 oct; 23(10):1050-6.
74. Yeh GY, Eisenberg DM, Kaptchuk TJ etal. Systematic review of
herbs and dietary supplements for glycemic control in diabetes.
Diabetes Care. 2003 apr; 26(4):1277-94.
75. Tariq SH. Herbal therapies. Clin Geriatr Med. 2004may; 20(2):
237-57.
76. VI Diretrizes Brasileiras de Hipertenso. Arquivos Brasileiros
de Cardiologia. Arq Bras Cardiol. 2010; 95(Suppl 1):1-51.
77. Maillot M, Drewnowski A. A conflict between nutritionally
adequate diets and meeting the 2010dietary guidelines for sodium. Am J Prev Med. 2012; 42:174-9.
78. van de Wiel A. Diabetes mellitus and alcohol. Diab Met Res Rev.
2004jul-aug; 20(4):263-7.
79. Rydena L, Granta PJ, Ankera SD etal. Guia de practica clinica
de la ESC sobre diabetes, prediabetes y enfermedad cardiovascular, en colaboracion con la European Association for the
Study of Diabetes. Rev Esp Cardiol. 2014. 67(2):136.e1-e56.
80. Soo-Jeong Kim, Dai-Jin Kim. Alcoholism and diabetes mellitus.
Diab Metab J. 2012; 36(2):108-15.
81. Sociedade Brasileira de Diabetes. Departamento de Nutrio.
Manual Oficial de Contagem de Carboidratos Regional. Rio de
Janeiro, 2009.
82. Sociedade Brasileira de Diabetes. Departamento de Nutrio e
Metabologia. Manual de Nutrio Profissional da Sade, 2009.
83. Lottemberg AMP. Caractersticas da dieta nas diferentes fases
da evoluo do diabetes mellitus tipo 1. Arq Bras Endocrinol
Metab. 2008; 52:250-9.
84. Dyson PA, Kelly T, Deakin T etal. Diabetes UK evidence-based
nutrition guidelines for the prevention and management of diabetes, 2011.
85. Dworatzek PD, Arcudi K, Gougeon R etal. Nutrition therapy
Canadian Diabetes Association Clinical Practice Guidelines
Expert Committee. Can J Diabetes. 2013; 37:45-55.
86. Rosembloom AL, Silverstein JH, Amemiya S. ISPAD Clinical Practice Consensus Guideline 2009Compendium. Type 2diabetes in
children and adolescents. Ped Diab. 2009; 10(Supp 12):17-32.
87. Alvarez MA, Vieira ACR, Moura AS et al. Insulin resistance
in Brazilian adolescent girls: association with overweight and
metabolic disorders. Diab Res Clin Prac. 2006; 74:183-8.
88. Thompson D, Berger B, Feig D et al. Diabetes and pregnancy
Canadian Diabetes Association Clinical Practice Guidelines
Expert Committee. Can J Diabetes. 2013; 37:168-83.
89. Atalah E, Castillo CL, Castro RS etal. Propuesta de um nuevo
estandar de evaluacion nutricional de embarazadas. Rer Med
Chile. 1997; 125:1429-36.
90. Food and Nutrition Board, Institute of Medicine: U.S. Dietary
Reference Intakes: energy, carbohydrates, fiber, fat, fatty acids,
cholesterol, protein, and amino acids. Washington, DC: National Academies Press, 2002.
91. American Diabetes Association. Nutrition recommendations
and interventions for diabetes. Gestational diabetes mellitus.
Diabetes Care. 2004; 27(Suppl 1):S88-S90.
92. American Diabetes Association. Nutrition recommendations and
interventions for diabetes. Diabetes Care. 2008; 30(Suppl 1):S61-S78.
93. American College of Obstetricians and Gynecologists. ACOG
practice bulletin: nausea and vomiting of pregnancy. Obstet Gynecol. 2004; 103:803-14.
94. Jewell DJ, Young G. Interventions for treating constipation in
pregnancy. Cochrane Database Syst Rev. 2001; (2):CD 001142.
95. ADA Reports. Position ofthe American Dietetic Association: use
of nutritive and nonnutritive sweeteners. J Am Diet Assoc. 2004;
255-75.

06/10/2015 09:52:39

Princpios para Orientao Nutricional no Diabetes Mellitus 109


96. Ziegler A, Wallner M, Kaiser I et al. Long-term protective effect of lactation on the development of type 2diabetes in women with recent gestational diabetes mellitus. Diabetes. 2012;
61:3167-71.
97. Horani MH, Mooradian AD. Management of obesity in the elderly: special considerations. Treat Endocrinol. 2002; 1:387-98.
98. Smart CE, Annan F, Bruno LPC etal. Nutritional management
in children and adolescents with diabetes. Pediatric Diabetes.
2014; 15(Suppl 20):136-54.
99. American College of Sports Medicine: Exercise and type 2diabetes: a joint position statement of the American Diabetes Association and American College of Sports Medicine. Med Sci
Sports Exerc. 2010; 42:2282-303.
100. Carla C. Diabetes Nutrition Therapy for sports and exercise,
American Diabetes Association guide to nutrition therapy for
diabetes. 2nd ed, 2012. pp. 204-23.
101. Dunford M, ed. Sports nutrition: a practice manual for professionals. 4th ed. Chicago, IL, American Dietetic Association, 2006.
102. Wilmore JH, Costill DL, Kenney WL. Physiology of sport and
exercise. Chicago II: Human Kinetics, 2008.
103. Tipton KD. Protein nutrition and exercise: whats the latest?
Scans Pulse. 2011; 30:1-5.
104. American College of Sports Medicine. Nutrition and athletic
performance: a joint statement of the American Dietetic Association, Dietitians of Canada and American College of Sports
Medicine. Med Sci Exerc. 2009; 41:709-31.
105. Armstrong LE, Maresh etal: urinary indices of hydration status.
Int J Sport Nut. 1994; 4:265-79.
106. Ceriello A. Post prandial hyperglycemia and diabetes complications is it time to treat? Diabetes, 2005 jan; 54.
107. McMahon SK, Ferreira LD, Ratnam N etal. Glucose requirements to maintain euglycemia after moderate-intensity afternoon exercise in adolescents with type 1 diabetes are increased in a biphasic manner. J Clin Endocrinol Metab. 2007;
92:963-68.
108. Kerkisick C etal. International Society of Sports Nutrition position stand: nutrient timing. J Inte Soc Sports Nutr. 2008; 5:17.
109. Perone C, Laitano O, Meyer F. Effect of carbohydrate ingestion
on the glycemic response of type 1diabetic adolescents during
exercise. Diabetes Care. 2005; 28: 2537-8.
110. Hernandez JM, Moccia T, Fluckey JD etal. Fluid snacks to help
persons with type1diabetes avoid late onset postexercise hypoglycemia. Med Sci Sports Exerc. 2000; 32:904-10.
111. Beaser RS, Jackson R. Joslins diabetes deskbook. A guide for
primary care providers. 2nd ed. Excerpt 1: what are the five
steps to patient adherence? Diabetes in Control. 2012; 75.
112. American Diabetes Association. Standards of Medical Care in
Diabetes. Diab Care. 2014jan; 37(Suppl 1).
113. Patel A, MacMahon S, Chalmers J etal. Effects of a fixed combination of perindopril and indapamide on macrovascular and
microvascular outcomes in patients with type 2 diabetes mellitus (the ADVANCE trial): a randomised controlled trial. Lancet. 2007; 370(9590):829-40.
114. The sixth report of the Joint National Committee of Prevention,
Detection, Evaluation, and Treatment of High Blood Pressure.
Arch Intern Med. 1997; 157(21):2413-46.
115. Baker WL, Baker EL, Coleman CI. The effect of plant sterols or
stanols on lipid parameters in patients with type 2diabetes: a
meta-analysis. Diabetes Res Clin Pract. 2009; 84:e33-7.
116. Bazzano LA. Effects of soluble dietary fiber on low-density lipoprotein cholesterol and coronary heart disease risk. Curr Atheroscler Rep.2008Dec; 10(6):473-7.
117. Chiu CJ, Wray LA, Beverly EA. Relationship of glucose regulation to changes in weight: a systematic review and guide to future research. Diabetes Metab Res Rev. 2010, jul; 26(5):323-35.

Diretrizes SBD 2015-2016 - CAP 16.indd 109

118. Souza RG, Gomes AC, Naves MM etal. Nuts and legume seeds
for cardiovascular risk reduction: scientific evidence and mechanisms of action. Nutr Rev. 2015jun; 73(6):335-47.
119. Gannon MC, Nuttall FQ. Effect of a high-protein, low-carbohydrate diet on blood glucose control in people with type 2diabetes. Diabetes. 2004sep; 53(9):2375-82.
120. Pan Y, Guo LL, Jin HM. Low-protein diet for diabetic nephropathy: a meta-analysis of randomized controlled trials. Am J Clin
Nutr 2008; 88:660-6.
121. Kirsztajn GM, Romo Jr JE, Souza E. Doena Renal Crnica (prterapia renal substitutiva): Tratamento. Diretrizes da Sociedade
Brasileira de Nefrologia, Associao Brasileira de Nutrologia, 2011.
122. American Diabetes Association. Nutrition therapy recommendations for the management of adults with diabetes. Diabetes
Care. 2013nov; 36(11):3821-42.
123. Pan Y, Guo LL, Jin HM. Low-protein diet for diabetic nephropathy: a meta-analysis of randomized controlled trials. Am J ClinNutr. 2008; 88:660-6.
124. Robertson L, Waugh N, Robertson A. Protein restriction for diabetic renal disease. Cochrane Database Syst Rev 2007; 4:CD002181.
125. Gross JL, de Azevedo MJ, Silveiro SP etal. Diabetic nephropathy:
diagnosis, prevention, and treatment. Diabetes Care. 2005jan;
28(1):164-76.
126. Kalantar-Zadeh K, Kovesdy CP. Clinical outcomes with active
versus nutritional vitamin D compounds in chronic kidney disease. Clin J Am Soc Nephrol. 2009; 4:1529-39.
127. Kim H, Lim H, Choue R. A better diet quality is attributable to
adequate energy intake in hemodialysis patients. Clin Nutr Res.
2015jan; 4(1):46-55.
128. Shinaberger CS, Kilpatrick RD, Regidor DL etal. Longitudinal
associations between dietary protein intake and survival in hemodialysis patients. Am J Kidney Dis. 2006; 48:37-49.
129. Cano N etal. ESPEN Guidelines on Enteral Nutrition: adult renal failure. Clin Nutr. 2006 apr; 25(2):295-310.
130. Clinical practice guidelines for nutrition in chronic renal failure. K/DOQI, National Kidney Foundation. Am J Kidney Dis.
2000; 35(6Suppl 2):S1-S140.
131. Martins, C, Cuppari, L, Avesani C etal. Terapia nutricional no
paciente com insuficincia renal crnica em dilise peritoneal.
In: DITEN: Projeto Diretrizes, volume IX. Associao Mdica
Brasileira. Braslia, DF: Conselho Federal de Medicina, 2011.
132. Kalantar-Zadeh K, Tortorici AR, Chen JL etal. Dietary restrictions in dialysis patients: is there anything left to eat? Semin
Dial. 2015; 28(2):159-68.
133. Blauw R. The use of specialised enteral formulae for patients
with diabetes melittus. S Afr J Clin Nutr. 2010; 23(1):55-7.
134. Borges VC, Correia MIT, Alvarez-Leite J. Terapia nutricional no
diabetes mellitus. In: Projeto Diretrizes DITEN, volume IX. Associao Mdica Brasileira. Braslia: Conselho Federal de Medicina, 2011.
135. Block AS, Mueller C. Suporte nutricional enteral e parenteral.
In: Krause. Alimentos, nutrio e dietoterapia. 10a ed. So Paulo:
Roca, 2002. pp. 448-66.
136. Campos LF, Polesel MG, Campos ACL. Terapia nutricional no
doente cirrgico diabtico. In: Tratado de nutrio e metabolismo em cirurgia. 1a ed. Rio de Janeiro: Rubio, 2012.
137. American Diabetes Association. Standards of Medical Care in
Diabetes. Diab Care. 2014jan; 37(Suppl 1).
138. Goldber PA, Siegel MD, Sherwin RS etal. Implementation of a
safe and effective insulin infusion protocol in a medical intensive care unit. Diabetes Care. 2004; 27:461-7.
139. Bantle JP, Wylie-Rosett J, Albright AL et al. Nutrition recommendations and interventions for diabetes. A position statement of the American Diabetes Association. Diabetes care.
2008; 31(Suppl 1):S61-S78.

06/10/2015 09:52:40

110 Diretrizes SBD | 2015-2016


140. Elia M, Ceriello A, Laube H et al. Enteral nutritional support
and use of diabetes-specific formulas for patients with diabetes.
Diabetes care. 2005; 28(9):2267-79.
141. Wheeler ML, Dunbar SA, Jaacks LM, etal. Macronutrients, food
groups, and eating patterns in the management of diabetes: a
systematic review of the literature, 2010. Diabetes Care. 2012;
35:434-45.
142. Alish CJ, Garvey WT, Maki KC etal. A diabetes-specific enteral
formula improves glycemic variability in patients with type 2diabetes. Diabetes Technol Ther. 2010jun; 12(6):419-25.
143. Mechanick Jl, Apovian C, Hamdy O etal. Diabetes-specific nutrition algorithm: a transcultural program to optimize diabetes
and prediabetes care. Curr Diab Resp. 2012; 12(2):180-94.
144. de Luis DA, Izaola O, de la Fuente B. A randomized clinical
trial with two doses of an enteral diabetes-specific suplements
in elderly patients with diabetes mellitus type 2. Eur ver Med
Pharmacol Sco. 2013; 17(12):1626-30.
145. Magnoni D, Carlette HFC, Rouws R etal. Long-term use of a
diabetes-specific oral nutritional supplement results in a lowpostprandial glucose response in diabetes patients. Diabetes
Research and Clinical Practice. 2008; 80(1):75-82.
146. Stenvers DJ, Schouten LJ, Jurgens J etal. Breakfast replacement
with a low-glycaemic response liquid formula in patients with
type 2 diabetes: a randomised clinical trial. Br J Nutr. 2014;
112(4):504-12.
147. Paniagua JA, de la Sacristana AG, Snchez E etal. A MUFArich diet improves posprandial glucose, lipid and GLP-1 responses in insulin-resistant subjects. J Am Coll Nutr. 2007;
26(5):434-44.
148. Mitka M. Bariatric surgery continues to show benefits for patients with diabetes. JAMA. 2012; 307(18):1901-2.
149. AACE/TOS/ASMBS. Bariatric surgery clinical practice guidelines. Endocr Pract. 2013; 19(2).
150. Linda A, Blankenship J, Buffington C etal. ASMBS Allied health
nutritional guidelines for the surgical weight loss patient. Surg
Obes Relat Dis. 2008; 4:S73-S108.
151. Heber D, Greenway FL, Kaplan LM etal. Endocrine and nutritional management of the post-bariatric surgery patient: an Endocrine Society Clinical Practice Guideline. J Clin Endocrinol
Metab. 2010; 95:4823-43.
152. Burgos MGPA. Abordagem dietoterpica nos diferentes procedimentos cirrgicos. In: Burgos MGPA, Lima DS, Coelho PBP. Nutrio em cirurgia baritrica. Rio de Janeiro: Rubio, 2011.
153. Heber D, Greenway FL, Kaplan LM C etal. Endocrine and nutritional management of the post-bariatric surgery patient: an

Diretrizes SBD 2015-2016 - CAP 16.indd 110

154.
155.
156.
157.
158.
159.
160.

161.
162.
163.
164.
165.

166.

167.

Endocrine Society. Clinical Practice Guideline. J Clin Endocrinol Metab. 2010nov; 95(11):4823-43.
Buchwald H, Estok R, Fahrbach K etal. Weight and type 2diabetes after bariatric surgery: systematic review and metaanalysis. Am J Med. 2009; 122:248-256.
Ellioty K. Nutritional considerations after bariatric surgery. Crit
Care Nurs Q. 2003; 26(2):133-8.
Bosnic G. Nutritional requirements after bariatric surgery. Crit
Care Nurs Clin North Am. 2014jun; 26(2):255-62.
Martin L, Benotti P. Preoperative evaluation and preparation of
bariatric surgery candidates. In: Martin LF, ed. Obesity surgery.
New York: McGraw-Hill. 2004. pp.95-109.
Randall A, Colucci, MS. Bariatric surgery in patients with
type 2diabetes: a viable option. Postgraduate Medicine. 2011;
123(1):242-50.
Position of the Academy of nutrition and dietetics: use of nutritive and nonnutritive sweeteners. Journal of the Academy of
Nutrition and Dietetics. 2012may; 112(5).
Cartilha de adoantes da Associao Brasileira da Indstria de
Alimentos para Fins Especiais e Congneres (ABIAD) com o
apoio da Anvisa (Agncia Nacional de Vigilncia Sanitria).
Disponvel em: <http://www.abiad.org>.
Powers AM, March BS, Evert A. Use of internet technology to
support nutrition and diabetes self-management care. Diabetes
Spectrum. 2008 apr 21; 2:91-9.
World Health Organization. E Health Tools & Services. Needs
of the member states. Report of the WHO Global Observatory
for e Health. Geneva, 2006.
Wu S, Chaudhry B, Wang J etal. Systematic review: impact of
health information technology on quality, efficiency, and costs
of medical care. Ann Intern Med. 2006; 144(10):742-52.
DirecNet Study Group. Impact of exercise on overnight glycemic control in children with type 1diabetes mellitus. J Pediatr.
2005; 147:528-34.
Ceriello A, Esposito K, Piconi L etal. Oscillating glucose is more
deleterious to endothelial function and oxidative stress than
mean glucose in normal and type 2diabetic patients. Diabetes.
2008; 57:1349-54.
Huang MC, Hsu HS. Wang prospective randomized controlled
trial to evaluate effectiveness of registered dietitian-led diabetes
management on glycemic and diet control in a primary care setting in Taiwan Diabetes Care. 2010; 33:233-9.
Freeman J, Lyons L. The use of continuous glucose monitoring
to evaluate the glycemic response to food. Diabetes Spectrum.
2008; 21(2).

06/10/2015 09:52:40

Hemoglobina Glicada |
Manifestaes Clnicas
Conceito
O termo genrico hemoglobina glicada refere-se a um conjunto
de substncias formadas com base em reaes entre a hemoglobina A (HbA) e alguns acares. J o termo hemoglobina
glicosilada tem sido erroneamente utilizado como sinnimo
de hemoglobina glicada (HbA1c). O processo de glicao de
protenas envolve uma ligao no enzimtica e permanente
com acares redutores como a glicose, ao contrrio do processo de glicosilao, que compreende uma ligao enzimtica
e instvel (Figura 1).1
A HbA a forma principal e nativa da hemoglobina, e a
HbA0 o principal componente da HbA. Na prtica, ela corresponde chamada frao no glicada da HbA. Por outro lado, a
HbA1 total corresponde a formas de HbA carregadas mais negativamente pela adio de glicose e outros carboidratos.
Existem vrios subtipos de HbA1 cromatograficamente distintos, como HbA1a1, HbA1a2, HbA1b e HbA1c. Desses todos,
a frao HbA1c, ou apenas A1c, a que se refere hemoglobina
glicada propriamente dita, cujo terminal valina da cadeia beta
est unido glicose por meio de uma ligao estvel e irreversvel (Figura 2).
No decorrer dos anos ou das dcadas, a hiperglicemia prolongada promove o desenvolvimento de leses orgnicas extensas e irreversveis, afetando olhos, rins, nervos, vasos grandes

e pequenos, assim como a coagulao sangunea. Os nveis de


glicose sangunea persistentemente elevados so txicos ao organismo por trs mecanismos diferentes: mediante a promoo
da glicao de protenas, pela hiperosmolalidade e pelo aumento dos nveis de sorbitol dentro da clula, conforme apresentado
na Figura 3 (A).2
A HbA1c a nica frao
que deve ser usada como
ndice de glicemia mdia
e como medida do
risco de complicaes

Hemoglobina
Hb

Hb0
Hemoglobina
no glicada

Hb1
Hemoglobina
glicada

HbA1a

HbA1b

HbA1c

Figura 2 As diferentes fraes da hemoglobina.

Hiperglicemia persistente

Sorbitol

Glicao
de substncia

Hiperosmolaridade

Complicaes diabticas

Figura 1 Molculas de glicose ligadas molcula de hemoglobina,


formando a hemoglobina glicada.

Diretrizes SBD 2015-2016 - CAP 17.indd 111

Polineuropatia
Retinopatia diabtica
Insuficincia renal
Hipercoagulabilidade
Catarata
Hipertenso

Infarto do miocrdio
Acidente vascular cerebral
Doena vascular perifrica
Amputaes
Perfuso placentria diminuda
na gravidez

Figura 3 Mecanismos de desenvolvimento das complicaes crnicas do diabetes. Adaptada de Lang F. Hormones Late complications of prolonged hyperglycemia (diabetes mellitus). In: Silbernagl S, Lang F. Color atlas of pathophysiology. New York: Thieme
Stuttgart, 2000. p. 291.

05/10/2015 06:51:37

112 Diretrizes SBD | 2015-2016

Implicaes clnicas dos nveis elevados de


hemoglobina glicada
A HbA1c, componente menor da hemoglobina, encontrada
em indivduos adultos no diabticos em uma proporo de 1 a
4%. Na prtica, os valores normais de referncia vo de 4 a 6%.
Nveis de HbA1c > 7% esto associados a risco progressivamente
maior de complicaes crnicas. Por isso, o conceito atual de tratamento do diabetes define a meta de 7% (ou de 6,5%, de acordo
com algumas sociedades mdicas) como limite superior acima
do qual est indicada a reviso do esquema teraputico em vigor.
As Figuras 4 e 5 mostram o impacto do mau controle glicmico
sobre o risco relativo de complicaes microvasculares no estudo
Diabetes Control and Complications Trial (DCCT) e do risco
de complicaes micro e macrovasculares no United Kingdom
Prospective Diabetes Study (UKPDS) (A).3,4

Testes diagnsticos com base na glicao


de protenas
O processo de glicao de protenas no se restringe apenas
ligao da glicose com a hemoglobina, formando a hemoglobina glicada. Muito pelo contrrio, esse processo estende-se,
Retinopatia

20

Nefropatia

Risco relativo

15
13

Neuropatia

11

Microalbuminria

9
7
5
3
1

789

10

12

11

HbA1c (%)

Figura 4 HbA1c e risco relativo de complicaes microvasculares:


DCCT. DCCT: Diabetes Control and Complications Trial.
Adaptado de Skyler JS. Endocrinol Metad Clin North Am. 1996;
25:243-54. DCCT. N Engl J Med. 1993;329:977-86. DCCT. Diabetes.
1995;44:968-83.

Reduo de risco (%)

DM tipo 2
Reduo no risco de complicaes para
cada 1% de reduo da HbA1c mdia
50
40

43

37

30
20

21

Qualquer
desfecho
relacionado
ao diabetes

bito
relacionado
ao diabetes

14

10
0

Microvascular

IM fatal e
no fatal

Amputao
ou bito
por DVP

Figura 5 HbA1c e risco relativo de complicaes micro e macrovasculares: UKPDS. UKPDS: United Kingdom Prospective Diabetes
Study; IM: infarto do miocrdio; DVP: doena vascular perifrica.
Adaptado de Stratton IM et al. Br Med J. 200;321:405-12.

Diretrizes SBD 2015-2016 - CAP 17.indd 112

praticamente, a muitas das protenas do organismo, contribuindo para a produo dos chamados produtos finais da
glicao avanada (AGE), os quais desempenham importante funo no aumento do risco das complicaes crnicas do
diabetes.
Do ponto de vista de recursos laboratoriais de avaliao
do controle da glicemia, a glicao da albumina outro processo decorrente da glicao das protenas, que forma a chamada albumina glicada. Esse analito considerado melhor
marcador do controle glicmico do que a HbA1c, uma vez
que a glicao da albumina no afetada pela alterao no
tempo de sobrevida das hemcias, como acontece no teste
de HbA1c, o qual pode ser profundamente influenciado pela
presena de processos hemolticos e de hemoglobinas anormais. Alguns autores consideram que o uso da albumina glicada est especialmente indicado a pacientes com diabetes
submetidos hemodilise. Entretanto, deve-se ressaltar que
os nveis ideais de albumina glicada ainda no foram definitivamente estabelecidos e os resultados desse teste podem
ser influenciados pela proteinria macia, doena intestinal
perdedora de protenas ou pelo tratamento com dilise peritoneal.5 O teste de albumina glicada reflete a mdia dos nveis glicmicos das ltimas 2 a 3 semanas, enquanto o teste
de HbA1c reflete a mdia dos nveis glicmicos dos ltimos
4 meses. No um teste regularmente disponvel na prtica
laboratorial diria (B).
O teste da frutosamina tambm tem como base a glicao de
protenas, sendo resultante da interao da glicose plasmtica
com a lisina, encontrada na molcula de albumina e de outras
protenas. mais comumente utilizado do que o teste de albumina glicada, embora no seja facilmente disponvel na prtica
laboratorial diria. Como a albumina, maior componente da
frutosamina, tem meia-vida curta, cerca de 2 a 3 semanas, o teste da frutosamina reflete o controle glicmico a curto prazo. A
utilidade clnica do teste de frutosamina no est bem estabelecida, sendo esse recurso geralmente recomendado em situaes
nas quais o teste de HbA1c apresente algum problema. Alm
disso, no h estudos que demonstrem a utilidade do teste como
marcador do desenvolvimento de complicaes relacionadas
com o diabetes (D).6

Correlao entre o nvel de hemoglobina


glicada e os nveis mdios de glicose
sangunea
O estudo DCCT forneceu a validao inicial da HbA1c como
uma ferramenta de prognstico para as complicaes crnicas
e, tambm, uma padronizao do mtodo laboratorial.3,4
Com base no DCCT e no UKPDS,4,5 estabeleceu-se que os
nveis de HbA1c > 7% esto associados a risco maior de complicaes crnicas. Por essa razo, o conceito de tratamento por
objetivos define 7% como o limite superior do valor aceitvel
para um paciente com diabetes bem controlado. Mais recentemente, a Sociedade Brasileira de Diabetes (SBD) estabeleceu a
meta de HbA1c < 7% para caracterizao do bom controle glicmico (D).7
Em agosto de 2008, foi publicado um trabalho de reviso dos valores de correspondncia entre nveis de HbA1c
e respectivos nveis de glicemia, com base nos achados do

05/10/2015 06:51:37

Hemoglobina Glicada | Manifestaes Clnicas 113

A1c-Derived Average Glucose Study Group (ADAG), revisando os valores inicialmente indicados pelo DCCT,8 conforme mostra o Quadro 1.
Com base nos resultados do ADAG, a Associao Americana de Diabetes (ADA), a Associao Europeia para o Estudo
do Diabetes (EASD) e a Federao Internacional de Diabetes (IDF) lanaram, em junho de 2008, uma intensa campanha de divulgao do novo conceito de glicemia mdia
estimada como um novo modo de expresso de resultados
em mg/dl para substituir a expresso usual de resultados
em termos de percentual de hemoglobina glicada atualmente
utilizada.8 A fim de facilitar os clculos de converso de nveis
de HbA1c para nveis de glicemia mdia estimada ou desta
para valores correspondentes de HbA1c, a ADA disponibiliza uma calculadora automtica no site <http://professional.
diabetes.org/glucosecalculator.aspx>.

da mdia ponderada global das glicemias mdias dirias (incluindo glicemias de jejum e ps-prandial) durante os ltimos
2 a 3 meses.
Na verdade, a glicao da hemoglobina ocorre ao longo de
todo o perodo de vida do glbulo vermelho, que de aproximadamente 120 dias. Porm, dentro destes 120 dias, a glicemia recente a que mais influencia o valor da HbA1c.
De fato, os modelos tericos e os estudos clnicos sugerem
que um paciente em controle estvel apresentar 50% de sua
HbA1c formada no ms precedente ao exame, 25% no ms
anterior a este e os 25% remanescentes no terceiro ou quarto
ms antes do exame (B).11
O impacto de qualquer variao significativa (em sentido
ascendente ou descendente) na glicemia mdia ser diludo
dentro de 3 ou 4 meses, em termos de nveis de HbA1c. A
glicemia mais recente causar o maior impacto nos nveis de
HbA1c.

Quadro 1 Novos valores de correspondncia entre nveis de


HbA1c e glicemia mdia estimada, segundo o ADAG.

Frequncia recomendada para a


realizao dos testes de hemoglobina
glicada

Valores de HbA1c (%)

Valores correspondentes de
glicemia mdia estimada (mg/dl)

68

97

126

154

183

212

10

240

11

269

12

298

Nathan DM et al. Translating the A1c assay into estimated average glucose
values. Diabetes Care. 2008; 31:1-6.8

Importante
Estudos clnicos publicados em 2008 mostraram que a variabilidade glicmica, caracterizada pela amplitude de variao dos
nveis glicmicos nos diversos horrios do dia, constitui-se em
um fator de risco isolado e independente dos nveis mdios
de glicemia em termos de potencial de risco para a funo
endotelial, favorecendo as complicaes cardiovasculares no
paciente diabtico.9,10 Como a HbA1c reflete apenas o nvel
mdio da glicemia nos ltimos 2 a 4 meses, h necessidade de
avaliar-se, tambm, o aspecto da variabilidade glicmica dos
dados de glicemia. Os fabricantes de monitores de glicemia
oferecem recursos informatizados para a anlise dos resultados
das glicemias, fornecendo os valores da glicemia mdia do perodo e do desvio padro da amostra (B)

Impacto das glicemias mais recentes em


relao ao das mais antigas
O impacto das glicemias mais recentes maior do que o das
mais antigas sobre os nveis de hemoglobina glicada. Tradicionalmente, a HbA1c tem sido considerada representativa

Diretrizes SBD 2015-2016 - CAP 17.indd 113

A quantidade de glicose ligada hemoglobina diretamente


proporcional concentrao mdia de glicose no sangue. Uma
vez que as hemcias tm um tempo de vida de aproximadamente 120 dias, a medida da quantidade de glicose ligada hemoglobina pode fornecer uma avaliao do controle glicmico
mdio no perodo de 120 dias antes do exame.
Em virtude de os resultados do exame concederem informao retrospectiva sobre 4 meses precedentes, a realizao
de um teste de HbA1c a cada 3 meses fornecer dados que
expressam a glicose sangunea mdia no passado recente.
Os exames de HbA1c devem ser realizados regularmente
em todos os pacientes com diabetes. A princpio, para documentar o grau de controle glicmico em sua avaliao inicial
e, subsequentemente, como parte do atendimento contnuo do
paciente. (Figura 6).
1 ms antes

2 meses antes

50%

25%

3 meses antes

4 meses antes

25%

Data da coleta de sangue para o teste de HbA1c

Figura 6 Impacto das glicemias mais recentes versus as mais


antigas sobre os nveis de HbA1c. Adaptada de Chandalia HB,
Krishnaswamy PR. Glycated hemoglobin. Current Science. 2002;
83(12):1522-32.11

Frequncia recomendada dos testes de


hemoglobina glicada
Os testes de HbA1c devem ser realizados, pelo menos, duas
vezes ao ano para todos os pacientes diabticos e quatro vezes por ano (a cada 3 meses) para pacientes que se submeterem a alteraes do esquema teraputico ou no estejam
alcanando os objetivos recomendados com o tratamento
vigente (D).12

05/10/2015 06:51:37

114 Diretrizes SBD | 2015-2016

Em gestantes com diabetes

As metas ideais de HbA1c em crianas e adolescentes ainda


no esto rigidamente determinadas, diferentemente do que
ocorre com os indivduos adultos. Devido ao aumento da prevalncia do diabetes nos jovens e o uso crescente da concentrao de HbA1c como indicador do controle da glicemia,
importante o desenvolvimento de nveis de referncia e padres de bom controle para essa faixa etria.
No estabelecimento dos objetivos para um bom controle
glicmico em crianas e adolescentes, os principais aspectos
que devem ser considerados so:

Crescimento e desenvolvimento adequados


Baixo risco de hipoglicemia (principalmente em crianas
com menos de 8 anos de idade, quando o desenvolvimento
neurolgico ainda no est completo)
O nvel de controle glicmico na faixa pr-puberal tambm
importante para prevenir o desenvolvimento futuro de
complicaes crnicas do diabetes
Durante a puberdade, pois h um aumento dos nveis de
HbA1c neste perodo.

A frequncia de testes de HbA1c na infncia e na adolescncia


depender das disponibilidades locais e do nvel de controle alcanado, podendo variar de dois a quatro por ano. aconselhvel
que se tenha pelo menos uma avaliao de HbA1c por ano.
Os objetivos devem ser individualizados, e as metas mais
baixas podem ser razoveis com base na avaliao benefciorisco. Ateno especial deve ser dada ao risco de hipoglicemias. O
Quadro 2 descreve as metas de controle segundo a ADA e ISPAD.

Em idosos com diabetes


Nos pacientes idosos, o alvo da HbA1c deve ser individualizado (D).12 Aqueles com boas condies clnicas e complicaes
microvasculares so os que, provavelmente, mais se beneficiariam de um controle glicmico intensivo. No entanto, os riscos
de um controle glicmico intensivo, incluindo hipoglicemia,
tratamentos concomitantes mltiplos, interaes de medicamentos e seus efeitos colaterais, devem ser considerados na
equao do risco-benefcio.
Para adultos idosos, porm saudveis, um nvel de HbA1c
< 7,5% estaria indicado. Idosos com condies clnicas mais
complexas podem alcanar uma HbA1c < 8%.
J em adultos idosos j fragilizados, indivduos com esperana de vida limitada e outros, nos quais os riscos do controle
glicmico intensivo so maiores do que os benefcios potenciais, um nvel de HbA1c de 8,5% pode ser mais apropriado.

Gestantes com diabetes apresentam risco aumentado de aborto


espontneo e de malformao congnita fetal (D).12,13 A magnitude destes riscos depende, principalmente, do grau de controle
metablico do diabetes no perodo pr-concepcional e no primeiro trimestre da gestao. A mulher diabtica que pretende
engravidar deve ser encorajada a obter o melhor controle metablico possvel antes e durante a gestao. Os nveis de HbA1c
recomendados para minimizar os riscos tambm so os menores possveis, no devendo ultrapassar o limite de 1% acima do
valor normal do mtodo. Durante a gestao, a HbA1c no deve
ser usada como parmetro de avaliao para eventuais alteraes da conduta teraputica devido ao longo perodo necessrio
para que os nveis glicmicos alterados possam se refletir nos
nveis de HbA1c observados. Durante a gravidez, muito mais
importante o controle rgido dos nveis de glicemias de jejum e
ps-prandiais do que dos nveis de HbA1c.

Nveis de hemoglobina glicada | Tempo


para retorno ao normal aps normalizao
dos nveis de glicose sangunea
Mesmo com tratamento adequado, os nveis de HbA1c no
retornam ao normal imediatamente aps a normalizao dos
nveis de glicose sangunea, pois demoram de 8 a 10 semanas,
aproximadamente, para serem totalmente estabilizados (B),11
como mostra a Figura 7.
Isso significa que, para a avaliao da eficcia do tratamento, os nveis de HbA1c devero ser avaliados somente 1 a 2
meses depois do incio ou da modificao da terapia. Antes
disso, os nveis de HbA1c no refletiro o verdadeiro efeito da
mudana recente do tratamento, o qual poder ser verificado
pela avaliao dos nveis de glicose sangunea, que reage mais
rapidamente ao incio ou alterao da terapia.
13
12
Nvel de HbA1c (%)

Nveis recomendados de
hemoglobina glicada
Em crianas e adolescentes com diabetes

11
10
9
8
7
6
5

10

12

Semanas

Figura 7 Taxa de reduo de HbA1c em pacientes bem controlados


com tratamento adequado. Adaptada de Chandalia HB, Krishnaswamy PR. Glycated hemoglobin. Current Science. 2002; 83(12):1522-32.11

Quadro 2 Recomendaes para o tratamento de crianas e adolescentes em todas as faixas etrias segundo ISPAD e ADA.12,14
ISPAD
ADA

Jejum ou pr-prandial (mg/dl)

Ps-prandial (mg/dl)

Ao dormir

Hemoglobina glicada (%)

65 a 100

80 a 126

80 a 100

< 6,05

timo

90 a 145

90 a 180

120 a 180

< 7,5

ADA

90 a 130

90 a 150

< 7,5

Ideal

Diretrizes SBD 2015-2016 - CAP 17.indd 114

05/10/2015 06:51:38

Hemoglobina Glicada | Manifestaes Clnicas 115

Meta de < 7% de hemoglobina


glicada | Quando aplic-la
A meta de < 7% de hemoglobina glicada aplicvel a alguns
mtodos laboratoriais, mas no a todos os mtodos disponveis. Essa uma questo muito importante: na realidade, a
meta de se atingir um nvel < 7% foi validada para o mtodo
utilizado no DCCT, baseado em diferenas na carga inica
(high performance liquid chromatography [HPLC] ou, em portugus, cromatografia lquida de alta eficincia [CLAE]).
Com o intuito de se evitarem problemas na interpretao
dos nveis de HbA1c obtidos pelos diversos mtodos laboratoriais, foi criado um projeto especial: o National Glycohemoglobin Standardization Program (NGSP), disponvel no site
<http://www.ngsp.org/prog/index.html>. Esse programa promove a padronizao das determinaes do teste de HbA1c
com relao ao mtodo utilizado no DCCT. Ao acessar o site,
escolha a opo Certified Methods/Labs UPDATED 11/08.
Nessa opo, esto disponveis a lista de mtodos certificados
pelo NGSP (opo: List of NGSP Certified Methods) e a lista
de laboratrios clnicos tambm certificados pelo NGSP (opo: List of NGSP Certified Laboratories).

Uso da hemoglobina glicada para o


diagnstico do diabetes
As recomendaes da ADA quanto utilizao da HbA1c
para fins diagnsticos define os seguintes pontos de corte para
a interpretao dos resultados: nveis de HbA1c 6,5% caracterizam a presena de diabetes, enquanto nveis de HbA1c
< 5,7% excluem o mesmo diagnstico. Portanto, nveis intermedirios entre 5,7 e 6,4% so indicativos de pr-diabetes,
conforme mostra a Figura 8.12
A polmica sobre o uso da HbA1c como parmetro diagnstico do diabetes e do pr-diabetes permanece longe de
ser resolvida. Ainda existem aspectos importantes que precisam ser esclarecidos antes que essa proposta seja definitivamente incorporada s prticas mdicas usuais na ateno
ao diabetes. Do ponto de vista conceitual, o teste de HbA1c
reflete efetivamente a mdia de controle glicmico dos ltimos 4 meses, sendo, portanto, um reflexo mais confivel da
existncia de hiperglicemia importante, em comparao com
A hemoglobina glicada no diagnstico do diabetes

Nveis de HbA1c
5,7%
Ausncia de
diabetes

Quadro 3 Critrios diagnsticos e os correspondentes valores


de HbA1c em termos de glicemia mdia estimada, conforme os
resultados do estudo ADAG.
Nvel de
hemoglobina
glicada (HbA1c)

Nvel equivalente
de glicemia mdia
estimada

Interpretao
diagnstica do
resultado

Acima de 6,5%

140 mg/dl

Presena de
diabetes

Entre 5,7 e 6,4%

117 a 137 mg/dl

Presena de risco
aumentado de
desenvolvimento
de diabetes
(pr-diabetes)

Abaixo de 5,7%

117 mg/dl

Ausncia de
diabetes

6,5%
Pr-diabetes

Diagnstico de
diabetes

Os pontos de corte mencionados referem-se utilizao de mtodos laboratoriais


certicados pelo National Glycohemoglobin Standardization Program (NGSP)2

Figura 8 Nveis de corte para o uso da HbA1c no diagnstico do


diabetes.

Diretrizes SBD 2015-2016 - CAP 17.indd 115

resultados pontuais dos testes de glicemia atualmente utilizados para a caracterizao clnica e laboratorial do diabetes e
do pr-diabetes.
De acordo com os conceitos tradicionalmente vigentes, os
pontos de corte para a caracterizao do pr-diabetes esto
definidos entre 100 mg/dl e 125 mg/dl. Acima desse ltimo
valor estaria caracterizado o diabetes. Surge, ento, a pergunta bvia: no estaramos utilizando padres extremamente
simplistas para o diagnstico dessas condies, assim como
resultados pontuais de glicemia, bastante sujeitos a variaes
intraindividuais que podem prejudicar a interpretao? O teste de HbA1c no seria um padro diagnstico mais confivel
pelo fato de refletir a glicemia mdia dos 2 a 4 meses anteriores
ao teste? Diante desse questionamento, como fazer a opo entre os testes pontuais de glicemia e o teste de HbA1c para fins
diagnsticos? O estudo ADAG definiu as correlaes entre os
nveis de HbA1c e seus correspondentes valores de glicemia
mdia em mg/dl e foi desenvolvido para simplificar a expresso dos resultados de HbA1c de uma maneira muito mais
compreensvel, tanto para o paciente quanto para o mdico.8
Assim, do ponto de vista da comunicao mdico-paciente,
faz muito mais sentido expressar o resultado de um teste
de HbA1c = 6,5% como equivalente a uma glicemia mdia
estimada de 140 mg/dl. Ao incorporar-se o teste de HbA1c
como recurso diagnstico, deve-se ressaltar que os pontos
de corte desse mtodo que utiliza a glicemia mdia estimada
diferem significativamente daqueles do mtodo que utiliza
os resultados de glicemias pontuais em mg/dl. O Quadro 3
resume os critrios diagnsticos e os correspondentes valores
de HbA1c em termos de glicemia mdia estimada, de acordo
com os resultados do estudo ADAG.8
No entanto, o debate no para por aqui. Um amplo estudo
conduzido na Austrlia,15 o qual avaliou a utilidade da HbA1c
para rastreio e diagnstico do diabetes na prtica diria,
mostrou que um resultado de HbA1c de 5,5% ou menos (e
no 5,7%, como recomenda a ADA) exclui a presena de
diabetes, enquanto um resultado de 7% ou mais (e no 6,5%,
como recomenda a ADA) confirma o diagnstico de diabetes.
Esse estudo foi publicado on-line no Diabetes Care em 12 de
janeiro de 2010.

Nathan DM et al. Translating the A1C assay into estimated average glucose
values (ADAG). Diabetes Care. 2008; 31:1-6.8

05/10/2015 06:51:38

116 Diretrizes SBD | 2015-2016

Implicaes clnicas na interpretao dos


resultados do teste de hemoglobina glicada
Tendo em vista a variabilidade dos mtodos laboratoriais disponveis e, consequentemente, a ampla faixa de variao de valores
normais, fundamental que o mdico clnico tenha uma noo
inteligente dos aspectos laboratoriais do teste de HbA1c. Somente
assim, ele poder esclarecer as prprias dvidas junto ao laboratrio clnico e, dessa maneira, acompanhar adequadamente e interpretar corretamente os resultados dos testes de HbA1c.
Com alguma frequncia, os resultados do teste de HbA1c
podem no estar compatveis com a condio clnica do paciente e/ou com os seus nveis efetivos de glicemia nos diversos horrios do dia. O Quadro 4 resume as principais condies clnicas que podem interferir no resultado do teste de
HbA1c, dificultando sua correta utilizao.7
Quadro 4 Principais condies clnicas que podem interferir no
resultado do teste de HbA1c.
Condies que promovem reduo do valor real da HbA1c
em funo da diminuio do nmero de hemcias, dos nveis
de hemoglobina e do hematcrito
Anemias hemolticas de
diferentes etiologias
Hemoglobinopatias (podem
resultar em valores
falsamente elevados ou
diminudos, conforme a
metodologia aplicada)
Comprometimento da
medula ssea por radiao,
toxinas, fibrose, tumores
Deficincias nutricionais de
cido flico, vitaminas
B6 e B12

Hipertireoidismo
Queimaduras graves, com
perda de lquido proteico
Leucemia
Mieloma mltiplo
Deficincia de eritropoetina
secundria a
comprometimento renal
Intoxicao por chumbo
Presena de grandes
quantidades de vitamina C e
E pode inibir a glicao da
hemoglobina

Condies que promovem aumento do valor real da HbA1c


Presena de hemoglobina
carbamilada (hemoglobina
quimicamente modificada e
resultante da ligao da ureia
hemoglobina), ocorrendo
em pacientes com
insuficincia renal
Deficincia nutricional de
ferro pode provocar aumento
significativo (> 2%) nos nveis
de HbA1c

Presena de hemoglobina
acetilada (hemoglobina
quimicamente modificada e
resultante da ligao do
salicilato com a hemoglobina)
ocorrendo em pacientes em
uso de doses elevadas de
cido acetilsaliclico
Condies que promovem
aumento do nmero de
glbulos vermelhos e/ou do
valor do hematcrito

Quadro 5 Recomendaes e concluses.


Recomendaes e concluses
Os nveis de glicose sangunea
persistentemente elevados so txicos ao
organismo por trs mecanismos diferentes:
mediante a promoo da glicao de
protenas, pela hiperosmolalidade e pelo
aumento dos nveis de sorbitol dentro da
clula

Grau de
recomendao
A

Recomendaes e concluses

Grau de
recomendao

Nveis de HbA1c acima de 7% esto


associados a um risco progressivamente
maior de complicaes crnicas

O teste de albumina glicada reflete a mdia


dos nveis glicmicos das ltimas 2 a 3
semanas, enquanto o teste de HbA1c
reflete a mdia dos nveis glicmicos dos
ltimos 4 meses

A utilidade clnica do teste de frutosamina


no est bem estabelecida, sendo esse
recurso, geralmente, recomendado em
situaes nas quais o teste de HbA1c
apresente algum problema. Alm disso, no
h estudos que demonstrem a utilidade do
teste como marcador do desenvolvimento de
complicaes relacionadas com o diabetes

Mais recentemente, a Sociedade Brasileira


de Diabetes estabeleceu a meta de HbA1c
menor que 7% para caracterizao do bom
controle glicmico

A variabilidade glicmica, caracterizada pela


amplitude de variao dos nveis glicmicos
nos diversos horrios do dia, constitui-se em
um fator de risco isolado e independente
dos nveis mdios de glicemia em termos de
potencial de risco para a funo endotelial,
favorecendo as complicaes
cardiovasculares no paciente diabtico

Os modelos tericos e os estudos clnicos


sugerem que um paciente em controle
estvel apresentar 50% de sua HbA1c
formada no ms precedente ao exame,
25% no ms anterior a este e os 25%
remanescentes no terceiro ou quarto ms
antes do exame

Os testes de HbA1c devem ser realizados,


pelo menos, duas vezes ao ano para todos
os pacientes diabticos e quatro vezes por
ano (a cada 3 meses) para pacientes que se
submeterem a alteraes do esquema
teraputico ou no estejam atingindo os
objetivos recomendados com o tratamento
vigente

As metas ideais para a HbA1c em crianas e


D
adolescentes ainda no esto rigidamente
determinadas, diferentemente do que ocorre
com os indivduos adultos. Para essa
definio, devem ser levadas em
considerao algumas condies, como idade
e estado de crescimento e desenvolvimento,
alm do risco de hipoglicemia
Em idosos, a definio da meta de HbA1c
deve levar em considerao os riscos de um
controle glicmico intensivo, incluindo
hipoglicemia, tratamentos concomitantes
mltiplos; interaes dos medicamentos e
os seus efeitos colaterais devem ser
considerados na equao do risco-benefcio

(continua)

Diretrizes SBD 2015-2016 - CAP 17.indd 116

Quadro 5 Recomendaes e concluses (continuao).

(continua)

05/10/2015 06:51:38

Hemoglobina Glicada | Manifestaes Clnicas 117


Quadro 5 Recomendaes e concluses (continuao).
Recomendaes e concluses

Grau de
recomendao

Gestantes com diabetes apresentam risco


aumentado de aborto espontneo e de
malformao congnita fetal.
A magnitude destes riscos depende,
principalmente, do grau de controle
metablico do diabetes no perodo
pr-concepcional e no 1o trimestre da
gestao

Os nveis de HbA1c no retornam ao


normal imediatamente aps a
normalizao dos nveis de glicose
sangunea, demorando de 8 a 10 semanas,
aproximadamente, para serem totalmente
normalizados

Apesar de ter sido indicada para fins de


diagnstico do diabetes, a utilizao da
HbA1c no rastreio ou no diagnstico da
doena uma opo diagnstica com
especificidade, porm, sem sensibilidade

5.

6.
7.

8.

(A) Estudos experimentais e observacionais de melhor consistncia; (B)


Estudos experimentais e observacionais de menor consistncia; (C) Relatos
de casos estudos no controlados; (D) Opinio desprovida de avaliao
crtica, baseada em consenso, estudos fisiolgicos ou modelos animais.

Referncias bibliogrficas
1. Ulrich P, Cerami A. Protein glycation, diabetes, and aging. Recent Progress in Hormone Research. 2001; 56:1-22.
2. Lang F. Hormones Late complications of prolonged hyperglycemia (diabetes mellitus). In: Silbernagl S, Lang F. Color atlas of
pathophysiology. New York: Thieme Stuttgart, 2000. p. 291.
3. DCCT Research Group. Diabetes Control and Complications
Trial (DCCT). The effect of intensive treatment of intensive
treatment of diabetes on the development and progression of

Diretrizes SBD 2015-2016 - CAP 17.indd 117

4.

9.
10.
11.
12.
13.
14.
15.

long-term complications in insulin-dependent diabetes mellitus.


N Engl J Med. 1993; 329:977-86.
UK Prospective Diabetes Study Group. Intensive blood glucose
control with sulphonylureas or insulin compared with conventional treatment and risk of complications in patients with type 2
diabetes. Lancet. 1998; 352:837-53.
Abe M, Matsumoto K. Glycated hemoglobin or glycated albumin for
assessment of glycemic control in hemodialysis patients with diabetes? Nat Clin Pract Nephrol. 2008; 4:482-3. Disponvel em: <http://
www.medscape.com/viewarticle/580573>. Acesso em: 21/11/2008.
American Diabetes Association. Fructosamine Test. Disponvel
em: <http://professional.diabetes.org/Disease_Backgrounder.aspx?
TYP=6&MID=262>. Acesso em: 21/11/2008.
Pimazoni Netto A, Wajchenberg BL, Eliaschewitz FG et al. Novas diretrizes da SBD para o controle glicmico do diabetes tipo
2 Posicionamento oficial SBD. Revista Brasileira de Medicina.
2007 set; 4(supl 4).
Nathan DM et al. Translating the A1C assay into estimated average glucose values. Diabetes Care. 2008; 31:1-16.
Ceriello A et al. Oscillating glucose is more deleterious to endothelial function and oxidative stress than mean glucose in normal and type 2 diabetic patients. Diabetes. 2008; 57:1349-54.
Monnier L, Colette C. Glycemic variability. Should we and can
we prevent it? Diabetes Care. 2008; 31(suppl 2):S150-S4.
Chandalia H, Krishnaswamy PR. Glycated hemoglobin. Current
Science. 2002; (83)12:1522-32.
American Diabetes Association. Standards of medical care in
diabetes 2015. Diabetes Care. 2015; 38(suppl 1):54:S1-S94.
The Diabetes Control and Complications Trial Research Group.
Pregnancy outcomes in the diabetes control and complications
trial. Am J Obstet Gynecol. 1996; 174:1343-53.
Nambam B, Hirsch IB, Danne T et al. Lowering targets for hemoglobin A1c in children with type 1 diabetes: raising the bar.
Pediatric Diabetes. 2015; 16:16-21.
Hemoglobin A1C (HbA1c) may be useful for diabetes screening
and diagnosis in routine clinical practice, according to the results
of a new study. Diabetes in Control. 2010; 506. Disponvel em:
<http://www.diabetesincontrol.com/index.php?option =com_co
nent&view=article&id=8868&catid=1&Itemid=17>

05/10/2015 06:51:38

Memria Metablica e
Epigentica
Memria metablica
O termo memria metablica foi usado pela primeira vez por
Engerman e Kern para se referir ao efeito deletrio prolongado
da hiperglicemia; a expresso foi cunhada aps os autores observarem a progresso da retinopatia em ces diabticos com
bom controle glicmico, depois desses animais passarem mais
de 2 anos com um controle glicmico inadequado.1
O termo foi retomado quando da reviso dos pacientes
que fizeram parte do Diabetes Control and Complication Trial
(DCCT), estudo realizado entre 1983 e 1993 que randomizou
pessoas com diabetes mellitus (DM) tipo 1 para o tratamento
convencional (pacientes mantiveram HbA1c mdia de 9,1%
ao longo de 6,5 anos) ou para o tratamento intensivo (mantiveram HbA1c mdia de 7,2%). Desde 1993, os pacientes
mantiveram-se no estudo observacional Epidemiology of Diabetes Interventions and Complications (EDIC) e foram orientados a manter o tratamento intensivo. Dessa maneira, nos anos
subsequentes, a HbA1c mdia dos dois grupos de tratamento
igualou-se. Apesar disso, nos primeiros 4 anos de seguimento do EDIC, as menores frequncias das complicaes crnicas observadas no grupo de tratamento intensivo durante o
DCCT at se acentuaram, o que evidenciou o efeito duradouro
de um bom controle metablico sobre a evoluo das complicaes crnicas, fenmeno aqui chamado de memria metablica, o qual durou pelo menos 10 anos.2
No estudo United Kingdom Prospective Diabetes Study
(UKPDS), que comparou os resultados do tratamento intensivo versus o tratamento convencional em pessoas com DM
tipo 2, tambm foram observados benefcios prolongados do
controle glicmico intensivo aps o final da interveno, o que
foi chamado de efeito legado.3
Entre as vias bioqumicas ativadas pela hiperglicemia, a via
dos produtos finais de glicao avanada pode explicar os efeitos deletrios prolongados da hiperglicemia.

Produtos finais de glicao avanada


A hiperglicemia o principal fator etiopatognico das complicaes crnicas do DM. A glicose contm um grupamento
aldedo capaz de reagir no enzimaticamente com o grupamento amino das protenas, levando formao dos produtos
de Amadori, dos quais o mais conhecido a HbA1c. Outras
reaes ocorrem a partir deste ponto para produzir um grupo

Diretrizes SBD 2015-2016 - CAP 18.indd 118

de compostos denominados produtos finais de glicao avanada (AGE, advanced glycation end-products), que se ligam irreversivelmente s protenas.
Acreditava-se, inicialmente, que os AGE se originavam da
reao entre glicose e protenas extracelulares, mas posteriormente se verificou que a taxa de formao de AGE a partir da
glicose muito menor do que a taxa de formao de AGE a
partir de precursores dicarbonil derivados de glicose produzidos no meio intracelular, tais como o glioxal, resultante da
auto-oxidao intracelular da glicose, e o metilglioxal, resultante da fragmentao do gliceraldedo-3-fosfato. Esses compostos reagem com o grupamento amino de protenas intra e
extracelulares para formar os AGE.
A produo intracelular de precursores de AGE lesam as
clulas por trs diferentes mecanismos:

Modificao de protenas intracelulares


Difuso para fora das clulas e modificao de protenas de
matriz extracelular, como o colgeno e a laminina, que tm
sua estrutura, funo e turnover comprometidos
Difuso para fora das clulas e modificao de protenas
circulantes, como a albumina.4

Os AGE so reconhecidos pelo receptor para AGE (RAGE), o


qual medeia a formao de espcies reativas de oxignio, ativao
do fator de transcrio NF-kB e transcrio de genes associados
ao estresse inflamatrio, ativao plaquetria, migrao de moncitos para a parede arterial, vasoconstrio e angiognese.5
A glicao de protenas de meia-vida longa, como aquelas
presentes na estrutura das artrias e dos glomrulos, pode ser
uma das explicaes para os efeitos deletrios persistentes da
hiperglicemia. Genuth et al. mediram os AGE no colgeno da
pele de participantes do DCCT que continuaram a ser acompanhados no EDIC e mostraram que os AGE se correlacionaram com o risco de progresso da retinopatia e da nefropatia
diabticas do final do DCCT at os 10 anos seguintes, mesmo
aps o ajuste para os valores de HbA1c.6
Mais recentemente, modificaes na cromatina tm sido reconhecidas como capazes de perpetuar as complicaes diabticas, uma vez que diversos estudos j mostraram que perodos
de hiperglicemia resultam em anormalidades permanentes, incluindo expresso gnica aberrante. Essa habilidade de sustentar as complicaes mesmo na ausncia da hiperglicemia evoca
os mecanismos epigenticos, que sero explicados a seguir.

05/10/2015 06:52:09

Memria Metablica e Epigentica 119

Epigentica
As modificaes epigenticas j so aceitas como relevantes na
patognese das doenas crnicas no transmissveis e tambm
na patognese das complicaes crnicas do DM.7,8
O termo epigentica foi cunhado pelo cientista britnico
Conrad Waddington nos anos 1940, integrando a palavra epigenesis (estudo da diferenciao e crescimento embriolgicos)
com a palavra gentica, para designar interaes dos genes com
o meio ambiente que influenciam o desenvolvimento embriolgico. Desde ento, a definio de Waddington evoluiu, especialmente na tentativa de contemplar aspectos moleculares, e,
recentemente, Skinner et al. propuseram como definio de
epigentica (inclusive o uso do prefixo epi como ao redor do
DNA) fatores moleculares e processos que ocorrem ao redor
do DNA, que so estveis durante a mitose e regulam a atividade do genoma independentemente da sequncia de DNA.
Os fatores moleculares e processos atualmente conhecidos so
trs: metilao de citosinas do DNA, modificaes em aminocidos das protenas que se agregam ao DNA (as histonas) e os
RNA no codificantes (os microRNA ou miRNA).9
A metilao do DNA uma modificao qumica (adio de
um grupamento CH3) que, em mamferos, ocorre predominantemente nas citosinas que fazem parte de dinucleotdios CpG
(citosina localizada ao lado de uma guanina). A metilao ocorre pela ao de enzimas DNA metiltransferases e um processo
dinmico que sofre reprogramao durante a gametognese e
nas primeiras fases da embriognese, participando de processos
celulares normais, como o imprinting genmico e a inativao
do gene X nas mulheres. Aproximadamente 4% das citosinas no
genoma humano so metiladas, sendo que a metilao tecido-especfica e geneticamente determinada.10 Metilao e desmetilao anormais podem ocorrer tambm durante o desenvolvimento de neoplasias e explicar a secreo ectpica de hormnios
por certos tumores; tumores carcinoides, por exemplo, podem
ter o gene POMC, que codifica a pr-opiomelanocortina, desmetilado, o que explica a secreo ectpica de ACTH e o consequente desenvolvimento de sndrome de Cushing.11
Os genes que esto sendo expressos em determinada clula
apresentam a sua regio promotora (regio onde se liga a maquinaria de sntese de RNA mensageiro) desmetilada, enquanto
genes no expressos apresentam as citosinas de dinucleotdios
CpG na regio promotora metiladas, o que impede a sntese de
RNA mensageiro e, portanto, a sntese proteica (Figura 1).
Com relao s modificaes nas histonas, preciso inicialmente mencionar que, nas clulas eucariontes, o nucleossomo
a unidade bsica que se repete na cromatina. Ele formado por
um octmero composto por duas molculas de cada uma das
histonas (H2A, H2B, H3 e H4) e por 146 pares de base de DNA
que do a volta nas histonas. Cada uma das histonas apresenta
uma cauda aminoterminal composta por 20 a 40 aminocidos
que, quando sofrem modificaes ps-traducionais frequentemente reversveis (acetilao ou desacetilao, fosforilao, metilao, entre outras) (Figura 2), modulam a expresso gnica
por promoverem mudanas na conformao do DNA.
Entre as enzimas envolvidas nesses processos, esto as
histonas acetiltransferases (HAT) e as histonas desacetilases
(HDAC). As HAT promovem a acetilao (adio de um grupamento COCH3) na poro aminoterminal das lisinas nas

Diretrizes SBD 2015-2016 - CAP 18.indd 119

NH2
N
O

NH2
DNA metiltransferase

Citosina

CH3

N
N

5`- Metilcitosina

Gene expresso
Regio codificada

Regio promotora

RNA mensageiro

AAAAAAA

cgagcggagccgccgttggcgccatcgtatcg
Expresso gnica reprimida
Regio codificada

Regio promotora
CH3

CH3

CH3 CH3

CH3

CH3

CH3

cgagcggagccgccgttggcgccatcgtatcg

Figura 1 DNA metiltransferases so as enzimas que promovem a


adio de um radical metil (CH3) na posio 5 das citosinas para
formar a 5-metilcitosina. Genes que esto expressos em uma determinada clula tm as citosinas de suas regies promotoras no
metiladas. Por outro lado, a metilao de citosinas que fazem parte de dinucleotdios CG na regio promotora reprime a expresso
gnica.

DNA dupla-fita

Nucleossomas

H2B H2A

Nucleossoma

H4

Cauda
aminoterminal
da histona H4

H4

H3

20 16
K K 12 8 5 1
K
Me Ac Ac K K S
Ac Ac P

Figura 2 Estrutura do nucleossoma, um octmero composto por


duas molculas de cada uma das histonas (H2A, H2B, H3 e H4) e
por 146 pares de base de DNA. Os aminocidos das extremidades
aminoterminais das histonas podem sofrer modificaes, como
acetilao, metilao e fosforilao, que alteram a estrutura da cromatina, aumentando ou diminuindo a expresso gnica. K: lisina;
S: serina; Me: metilao; Ac: acetilao; P: fosfato.

histonas H3 e H4, possibilitando a formao de eucromatina


(estado da cromatina em que o DNA est menos compactado);
j as HDAC desacetilam as histonas nas mesmas localizaes,
levando formao de heterocromatina (estado da cromatina
em que o DNA est mais compactado).

05/10/2015 06:52:10

120 Diretrizes SBD | 2015-2016

A cromatina ativa desmetilada e acetilada, apresentando


uma estrutura aberta, o que possibilita o acesso da maquinaria transcricional (RNA polimerase e fatores de transcrio). A
metilao de citosinas em dinucleotdios CpG capaz de recrutar um complexo de protenas chamado methylcytosine-binding
proteins (MBP), que por sua vez, recrutam HDAC. A desacetilao das histonas determina o silenciamento gnico, na medida
em que torna a estrutura da cromatina mais compacta, inacessvel maquinaria necessria para a transcrio gnica (Figura 3).
Enquanto a metilao das citosinas sempre est associada
ao silenciamento gnico, a metilao das histonas tem a capacidade de promover tanto a formao de heterocromatina
quanto de eucromatina, inativando ou ativando genes, respectivamente. O efeito da metilao depender do aminocido
modificado e do grau de metilao, ou seja, mono, di ou trimetilao. A mono, di ou trimetilao em diferentes resduos
de lisina das histonas so catalisadas pelas enzimas chamadas
histonas metiltransferases (HMT).12
Os miRNA so RNA no codificantes, ou seja, ao contrrio dos RNA mensageiros (mRNA), os miRNA no so
traduzidos em protenas. Eles se constituem em uma classe
de RNA pequenos (de 19 a 25 nucleotdios) que funcionam
como reguladores negativos da expresso gnica (Figura 4).

RNA
Pol II

Cromatina ativa: citosinas


no metiladas e com caudas
de histona acetiladas

DNA metiltransferases

RNA
Pol II

Protenas do domnio metil-ligador ou


Methyl-binding domain (MBD) proteins

Cromatina inativa: citosinas


metiladas e com caudas de
histona desacetiladas
Cauda de histona acetilada
Citosina metilada
Histona desacetilase

Figura 3 As citosinas metiladas pela ao de DNA metiltransferases recrutam um complexo de protenas (methylcytosine-binding
proteins, MBP) que, por sua vez, recrutam histonas desacetilases
(HDAC), enzimas capazes de retirar o radical acetil das histonas e
determinar o silenciamento gnico secundrio compactao da
cromatina.

Diretrizes SBD 2015-2016 - CAP 18.indd 120

Gene de
miRNA

Gene tpico

AAAA
RNA mensageiro

miRNA
Bloqueio
da traduo

Traduo

TR AAAA

3` U
Protena

5`

Figura 4 Diferentemente dos RNA mensageiros, os quais so traduzidos em protenas, os microRNA (miRNA) no do origem a
protenas, e sim regulam negativamente a expresso gnica de
seus RNA mensageiros-alvo, impedindo que os mesmos sejam traduzidos em protenas.

A maioria dos genes que d origem a miRNA est em regies intergnicas, mas alguns se localizam em ntrons de genes
conhecidos.
Os miRNA so sintetizados como transcritos primrios longos que so cortados ainda no ncleo por uma RNase chamada
Drosha, para formar molculas intermedirias, os pr-miRNA;
esses sero exportados para o citoplasma, onde sofrero clivagem por uma segunda RNase, a Dicer, para formar os miRNA
maduros.
Os miRNA ligam-se a stios especficos na regio 3 no
traduzida (3UTR, untranslated) nos mRNA-alvo, levando
inibio da traduo desses RNA por vrios mecanismos:
degradao completa dos mRNA, desestabilizao do mRNA
por clivagem ou desadenilao (retirada da cauda poli-A do
mRNA) ou ligao na regio 3UTR e represso direta da traduo.13 Estima-se que os miRNA controlem a expresso de
aproximadamente 60% dos genes e que cada miRNA possa
regular at 200 espcies de mRNA.14

Epigentica e memria metablica


Um dos primeiros relatos associando modificaes epigenticas e alteraes persistentes na expresso gnica demonstrou
que clulas endoteliais transitoriamente expostas a altas concentraes de glicose apresentaram aumento na monometilao da lisina na posio 4 da H3 (H3K4Me1) pela enzima
histona metiltransferase Set7 na regio promotora do gene
que codifica a subunidade p65 do NF-kB, levando expresso sustentada de genes pr-aterognicos responsivos a esse
fator de transcrio. O padro H3K4me1 favorece a ativao
transcricional e tambm foi observado em camundongos no
diabticos expostos hiperglicemia transitria at 6 dias aps
a normalizao da glicemia.15
Antes disso, Miao et al. haviam demonstrado que, em moncitos da linhagem THP-1 em cultura expostos a altas concentraes de glicose, nove genes candidatos apresentaram

05/10/2015 06:52:10

Memria Metablica e Epigentica 121

aumento na dimetilao da lisina 4 na H3 (H3K4Me2) em


comparao s clulas expostas a concentraes normais de
glicose, dos quais trs tinham expresso gnica aumentada e
quatro, expresso gnica diminuda. Em moncitos isolados
de sangue perifrico de pacientes com DM tipo 1 e tipo 2, esses
autores observaram aumento da dimetilao na lisina 9 da H3
(H3K9Me2) na regio promotora do gene que codifica a interleucina (IL)-1A e do gene PTEN em comparao a moncitos
de controles saudveis, e levantaram a hiptese de que essas
alteraes serviriam de memria da histria transcricional
iniciada pela hiperglicemia crnica.16
Miao et al. tambm avaliaram o efeito de modificaes
epigenticas em moncitos de 60 participantes do DCCT, dos
quais 30 pacientes haviam sido submetidos, inicialmente, ao
tratamento convencional e os outros 30, a princpio, ao tratamento intensivo. A acetilao da lisina 9 da H3 (H3K9Ac,
associada ao aumento da expresso gnica) foi maior nos pacientes submetidos inicialmente ao tratamento convencional.
Dentre as regies promotoras enriquecidas em H3K9Ac, estavam aquelas nos genes associados principalmente via de
NF-kB, como os que codificam o fator de necrose tumoral
e a IL-1A. Ao todo, 38 genes com regies enriquecidas em
H3K9Ac foram encontrados nos pacientes a princpio submetidos terapia convencional. Quando os pacientes dos dois
grupos foram combinados, o nvel de H3K9Ac no DNA dos
moncitos associou-se significantemente ao valor mdio da
HbA1c durante o DCCT e o EDIC.17
A hiperglicemia alterando a metilao do DNA foi demonstrada em modelos animais; Williams et al.18 apontaram
hipometilao genmica no fgado de ratos diabticos 2 semanas aps o incio da hiperglicemia (modelo de DM tipo 1) e,
paradoxalmente, hipermetilao do DNA no fgado de ratos
diabticos Zucker de 12 semanas de idade (modelo de DM
tipo 2).19
Bell et al. avaliaram o perfil de metilao (metiloma) de
DNA de portadores de DM tipo 1 com e sem nefropatia diabtica e identificaram 19 stios CpG que apresentaram correlao
com o desenvolvimento da nefropatia. Dentre esses, destacou-se
um stio prximo ao UNC13B, gene previamente associado
nefropatia diabtica.20
Estudo realizado com DNA extrado da saliva de portadores de DM tipo 1 e tipo 2 com mais de 10 anos de doena sem
nefropatia diabtica ou com doena renal crnica terminal em
hemodilise, mostrou que o padro de metilao de 27.000 stios CpG localizados em mais de 14.000 genes humanos diferente, sendo que muitos dos stios com diferenas significantes
no padro de metilao j haviam sido associados nefropatia diabtica em estudos prvios. Dentre os genes candidatos
mais interessantes, os autores deram nfase a MYL9, MMP10,
TIMP4 e MTHFR.21
Ko et al. analisaram o metiloma de DNA obtido de tbulos
microdissecados de rins de pacientes com doena renal crnica por nefropatia diabtica em relao a controles saudveis;
notaram-se diferenas significantes no perfil de metilao, especialmente em genes relacionados com a fibrose.22
O perfil global de metilao em DNA de leuccitos perifricos tambm foi comparado entre portadores de DM tipo
2 com e sem retinopatia diabtica. Observaram-se nveis de
metilao significantemente maiores nos pacientes com versus

Diretrizes SBD 2015-2016 - CAP 18.indd 121

sem retinopatia diabtica, sendo que o metiloma foi um fator


preditivo para retinopatia, independentemente da dislipidemia, hipertenso, hiperglicemia e durao do DM.23
Finalmente, inmeros estudos em modelos animais j demonstraram o envolvimento de miRNA na patognese da nefropatia e da retinopatia diabtica; recentemente, Argyropoulos et al. evidenciaram diferentes perfis de miRNA urinrio
entre grupos de pacientes em diferentes estgios de nefropatia
diabtica, o que poder ter implicaes clnicas para a estratificao de risco para essa complicao.24
Em um estudo com biopsia renal de portadores de DM tipo
2, Huang et al. mostraram o aumento na expresso dos miRNA
miR-146a e miR-155 em relao ao rim de controles no diabticos, sendo que a expresso do miR-155 se correlacionou com
os valores de creatinina plasmtica. Os autores mostraram ainda que, em clulas endoteliais glomerulares humanas expostas
a altas concentraes de glicose e transfectadas com mimticos
desses miRNA, houve aumento na expresso de fator de necrose tumoral, fator de crescimento transformante e NF-kB, todos
implicados na patognese da nefropatia diabtica.25
Estudo experimental realizado com clulas endoteliais da
retina evidenciou que os miRNA 15b e 16 esto diminudos em
clulas expostas a altas concentraes de glicose e o aumento
da expresso dos mesmos protege essas clulas da apoptose
induzida por hiperglicemia.26 Em outro trabalho, Qing et al.
avaliaram o perfil dos miRNA em soro de portadores de DM
com retinopatia diabtica e observaram que as concentraes
de miR-21, miR-181c e miR1179 estavam mais elevadas nos
pacientes com retinopatia proliferativa em relao aos pacientes com retinopatia no proliferativa.27
Os estudos expostos anteriormente evidenciam que, alm
das vias bioqumicas desencadeadas pela hiperglicemia, os
mecanismos epigenticos tambm participam da modulao
da expresso gnica no estabelecimento das complicaes crnicas do DM e podem explicar a memria metablica. Ainda h, no entanto, muitos aspectos a serem investigados, tais
como se modificaes no estilo de vida, com a adoo de dietas
saudveis e exerccios fsicos, poderiam reverter as alteraes
epigenticas,28 isso porque j se demonstrou que a metilao
do DNA, por exemplo, um processo dinmico e os exerccios
podem modificar o padro de metilao do tecido adiposo e
do tecido muscular.29,30
Um fator capaz de acrescentar complexidade ao entendimento das complicaes diabticas que deve existir a gentica da epigentica variantes genticas que predispem a mais
ou menos alteraes epigenticas frente a desarranjos metablicos semelhantes.

Referncias bibliogrficas
1. Engerman RL, Kern TS. Progression of incipient diabetic retinopathy during good glycemic control. Diabetes. 1987; 36:808-12.
2. Nathan DM for the DCCT/EDIC Research Group. The Diabetes
Control and Complications Trial/epidemiology of diabetes interventions and complications study at 30 years: overview. Diabetes Care. 2014; 37:9-16.
3. Chalmers J, Cooper ME. UKPDS and the legacy effect. N Engl J
Med. 2008; 359:1618-20.
4. Giacco F, Brownlee M. Oxidative stress and diabetic complications. Circulation Res. 2010; 107:1058-70.

05/10/2015 06:52:10

122 Diretrizes SBD | 2015-2016


5. Brownlee M. Biochemistry and molecular cell biology of diabetic
complications. Nature. 2001; 414:813-20.
6. Genuth S, Sun W, Cleary P et al. Glycation and carboxymethyllysine levels in skin collagen predict the risk of future 10-year
progression of diabetic retinopathy and nephropathy in the diabetes control and complications trial and epidemiology of diabetes
interventions and complications participants with type 1 diabetes. DCCT Skin Collagen Ancillary Study Group. Diabetes. 2005;
54:3103-11.
7. Gao Q, Tang J, Chen J et al. Epigenetic code and potential epigenetic-based therapies against chronic diseases in developmental
origins. Drug Discov Today. 2014; 19:1744-50.
8. Villeneuve LM, Natarajan R. Epigenetics of diabetic complications. Expert Rev Endocrinol Metab. 2010; 5:137-48.
9. Skinner MK, Manikkam M, Guerrero-Bosagna C. Epigenetic
transgenerational actions of environmental factors in disease etiology. Trends Endocrinol Metab. 2010; 21:214-22.
10. Breiling A1, Lyko F. Epigenetic regulatory functions of DNA
modifications: 5-methylcytosine and beyond. Epigenetics Chromatin. 2015; 8:24.
11. Newell-Price J. Proopiomelanocortin gene expression and DNA
methylation: implications for Cushings syndrome and beyond. J
Endocrinol. 2003; 177:365-72.
12. Marks P, Rifkind RA, Richon VM et al. Histone deacetylases and
cancer: causes and therapies. Nat Rev Cancer. 2001; 1:194-202.
13. Kim VN. MicroRNA biogenesis: coordinated cropping and dicing. Nat Rev Mol Cell Biol. 2005; 6:376-85.
14. Liang R, Bates DJ, Wang E. Epigenetic control of microRNA expression and aging. Curr Genomics. 2009; 10:184-93.
15. El-Osta A, Brasacchio D, Yao D et al. Transient high glucose
causes persistent epigenetic changes and altered gene expression during subsequent normoglycemia. J Exp Med. 2008; 205:
2409-17.
16. Miao F, Wu X, Zhang L et al. Genome-wide analysis of histone
lysine methylation variations caused by diabetic conditions in
human monocytes. J Biol Chem. 2007; 282:13854-63.
17. Miao F, Chen Z, Genuth S et al. Evaluating the role of epigenetic
histone modifications in the metabolic memory of type 1 diabetes. DCCT/EDIC Research Group. Diabetes. 2014; 63:1748-62.

Diretrizes SBD 2015-2016 - CAP 18.indd 122

18. Williams KT, Garrow TA, Schalinske KL. Type I diabetes leads to
tissue-specific DNA hypomethylation in male rats. J Nutr. 2008;
138:2064-9.
19. Williams KT, Schalinske KL. Tissue-specific alterations of methyl
group metabolism with DNA hypermethylation in the Zucker
(type 2) diabetic fatty rat. Diabetes Metab Res Rev. 2012; 28:123-31.
20. Bell CG, Teschendorff AE, Rakyan VK et al. Genome-wide DNA
methylation analysis for diabetic nephropathy in type 1 diabetes
mellitus. BMC Med Genomics. 2010; 3:33.
21. Sapienza C, Lee J, Powell J et al. DNA methylation profiling identifies epigenetic differences between diabetes patients with ESRD and
diabetes patients without nephropathy. Epigenetics. 2011; 6:20-8.
22. Ko YA, Mohtat D, Suzuki M et al. Cytosine methylation changes
in enhancer regions of core pro-fibrotic genes characterize kidney fibrosis development. Genome Biol. 2013; 14:R108.
23. Maghbooli Z, Hossein-nezhad A, Larijani B et al. Global DNA
methylation as a possible biomarker for diabetic retinopathy.
Diabetes Metab Res Rev. 2015; 31:183-9.
24. Argyropoulos C, Wang K, McClarty S et al. Urinary microRNA
profiling in the nephropathy of type 1 diabetes. PLoS One. 2013;
8:e54662.
25. Huang Y, Liu Y, Li L et al. Involvement of inflammation-related
miR-155 and miR-146a in diabetic nephropathy: implications
for glomerular endothelial injury. BMC Nephrol. 2014; 15:142.
26. Ye EA, Steinle JJ. miR-15b/16 protects primary human retinal
microvascular endothelial cells against hyperglycemia-induced
increases in tumor necrosis factor alpha and suppressor of cytokine signaling 3. J Neuroinflammation. 2015; 12:44.
27. Qing S, Yuan S, Yun C et al. Serum miRNA biomarkers serve as
a fingerprint for proliferative diabetic retinopathy. Cell Physiol
Biochem. 2014; 34:1733-40.
28. Reddy MA, Zhang E, Natarajan R. Epigenetic mechanisms in diabetic complications and metabolic memory. Diabetologia. 2015;
58:443-55.
29. Rnn T, Volkov P, Davegrdh C et al. A six months exercise intervention influences the genome-wide DNA methylation pattern in human adipose tissue. PLoS Genet. 2013; 9:e1003572.
30. Barrs R, Yan J, Egan B et al. Acute exercise remodels promoter
methylation in human skeletal muscle. Cell Metab. 2012; 15:405-11.

05/10/2015 06:52:10

Parte 2

Complicaes, Doenas
Relacionadas e Decorrentes
do Diabetes Mellitus

Diretrizes SBD 2015-2016 - CAP 19 - PARTE 2.indd 123

06/10/2015 09:53:17

Diretrizes SBD 2015-2016 - CAP 19 - PARTE 2.indd 124

06/10/2015 09:53:17

Diagnstico da Doena
Coronariana Silenciosa
Introduo
Embora diretrizes nacionais e internacionais classifiquem
portadores de diabetes mellitus (DM) na categoria de alto risco
para doena cardiovascular (DCV), o risco de desfechos cardiovasculares de curto prazo nessa populao extremamente
varivel.15 Um dos grandes desafios identificar indivduos
assintomticos, mas que apresentem risco elevado de desfechos cardiovasculares e beneficiem-se de tratamentos mais
agressivos em relao ao controle dos fatores de risco e possivelmente revascularizao do miocrdio.

Avaliao do risco com base em parmetros


clnicos e laboratoriais
Em geral, o DM adianta em 15 anos a idade para a ocorrncia
de DCV. Desse modo, homens e mulheres diabticos tipos 1
e 2, com idades respectivamente superiores a 40 e 50 anos geralmente apresentam risco de eventos coronarianos > 2% ao
ano.2,5 O risco de evento cardiovascular ou morte ser extremamente elevado quando houver diagnstico clnico de DCV,
ou seja, j ter havido infarto do miocrdio, acidente vascular
cerebral (AVC) ou ataque isqumico transitrio, angina do
peito, dispneia de origem isqumica (equivalente anginoso),
claudicao intermitente ou doena da aorta. No Quadro 1,
encontram-se descritos fatores clnicos que indicam risco elevado de DCV no DM.
Quadro 1 Fatores de risco clnico para DCV em diabticos.
Manifestao clnica prvia de doena aterosclertica: doena
coronariana, cerebrovascular ou vascular perifrica
Sexo feminino: risco relativo aumenta 5 vezes
Idade > 40 anos nos homens e > 50 anos nas mulheres
Durao elevada do diabetes; para cada 10 anos de diagnstico,
o risco aumenta 86% segundo o estudo de Framingham
Doena renal (perda de protena na urina, perda de funo renal)
Neuropatia diabtica autonmica
Fatores de risco: hipertenso arterial sistmica, dislipidemia,
tabagismo, sedentarismo, aterosclerose precoce na famlia e
sndrome metablica
Fibrilao atrial apresenta risco elevado de AVC emblico
Escores de risco de Framingham e Ferramenta UKPDS para avaliao do risco.

Diretrizes SBD 2015-2016 - CAP 19 - PARTE 2.indd 125

O grupo de Framingham desenvolveu um algoritmo para


predio de eventos cardiovasculares (coronarianos, morte,
AVC, insuficincia vascular perifrica e insuficincia cardaca) em indivduos assintomticos que pode ser aplicado para
pacientes diabticos.3 Este escore de risco global importante,
pois aumenta o poder preditivo para outras doenas graves,
alm da doena arterial coronariana (DAC), a qual frequentemente afeta indivduos com diabetes. importante enfatizar
que o risco determinado por essa escala avalia um perodo de
apenas 10 anos, e, principalmente em indivduos < 40 anos, dificilmente ela indicar um risco > 20% em 10 anos (alto risco).
Outra ferramenta para avaliar-se o risco de DAC em diabticos tipo 2 o United Kingdom Prospective Diabetes Study
(UKPDS) risk engine, que considera no s idade, lipdios,
tabagismo e presso arterial, mas utiliza tambm a durao
do diabetes e seu controle por meio da hemoglobina glicada
(HbA1c) e existncia ou no de proteinria.4

Avaliao do risco por exames


cardiovasculares
Testes de estresse para a deteco de isquemia
miocrdica e aterosclerose subclnica |
Calcificao da artria coronria
Sobrecarga ventricular esquerda, ondas Q e isquemia miocrdica ao eletrocardiograma (ECG) indicam risco elevado
de eventos cardiovasculares no DM,5 contudo esse exame
pouco sensvel. Infelizmente, ainda no existe consenso sobre
quais testes devem ser realizados para a deteco da DAC subclnica e/ou assintomtica em diabticos. As recomendaes
da Associao Americana de Diabetes (ADA) para pesquisa
da isquemia miocrdica silenciosa so muito conservadoras.1
A ADA sugere a pesquisa de isquemia miocrdica (IMi), por
meio do teste ergomtrico, em diabticos que mostrem sintomas cardacos tpicos (dor precordial, dispneia), sintomas
atpicos ou apresentem ECG de repouso alterado e em indivduos assintomticos com diagnstico de doena vascular
perifrica ou carotdea ou que tenham mais de 35 anos. Recomenda tambm a sedentrios que desejem comear um programa de atividades fsicas de alta intensidade. Infelizmente,
a sensibilidade da ergometria para a deteco da IMi ruim

06/10/2015 09:53:17

126 Diretrizes SBD | 2015-2016

mesmo nessa populao de risco relativamente elevado.6 importante enfatizar que cerca de um em cada cinco diabticos
apresentar IMi silenciosa e um em cada 15 ser grave quando
testes mais sensveis, como cintigrafia miocrdica ou ecocardiograma de estresse, so utilizados. A deteco de IMi nesses
exames implica risco de eventos coronarianos que varia de 4,7
a 13,8% por ano em indivduos no tratados. Obviamente, esse
risco ser maior quanto maior for a rea isqumica do ventrculo esquerdo (geralmente > 10%). Um fato preocupante
que, mesmo na ausncia de IMi, a taxa de eventos coronarianos graves em diabticos aps 2 anos de seguimento > 1,5%
ao ano.5,6 Contudo, dados do estudo Detection of Ischemia
in Asymptomatic Diabetics (DIAD) avaliaram a importncia
da pesquisa da isquemia IMi silenciosa em 1.123 diabticos
tipo 2 assintomticos submetidos a regimes mais intensivos de
controle de fatores de risco para a aterosclerose do que o realizado nos estudos anteriores.7 Os pacientes foram seguidos de
2000 at 2007 e randomizados para realizar ou no pesquisa
de IMi silenciosa pela cintigrafia miocrdica. A idade mdia
da populao era de 60 anos e a durao do diabetes, cerca de
8 anos. Diferentemente dos estudos anteriores, as taxas anuais
de eventos coronarianos foram de apenas 0,6% ao ano. No
houve diferena na taxa de eventos dos grupos randomizados
para sofrerem screening da isquemia ou no. As taxas de eventos coronarianos variaram de 0,4 a 2,4% ao ano, dependendo
da gravidade da isquemia miocrdica. Contudo, o valor preditivo positivo de uma isquemia moderada a grave foi de apenas
12%. Esses dados mostram que no h evidncia completa de
que a realizao de exames que pesquisem a IMi de maneira
rotineira ir modificar a histria natural da DAC em diabticos assintomticos com seus fatores de risco controlados de
modo adequado. Assim, destaca-se que os fatores de risco para
a aterosclerose devem ser tratados de maneira intensiva nessa
populao mesmo na ausncia de isquemia.
A deteco da aterosclerose subclnica representada pela calcificao da artria coronria (CAC) detectada pela tomografia
computadorizada (TC) til na avaliao do risco de eventos
coronarianos no DM.5,6,811 A CAC pode ser detectada sem
injeo de contraste iodado e com baixa exposio radiao.
Quanto maior a CAC (escores de clcio), maior a quantidade
de placas de ateroma (carga de placa), maior a chance de IMi e
maior o risco de morte e desfechos cardiovasculares. Em diabticos, a CAC pode indicar tanto obstruo coronariana, que leva
isquemia, quanto existncia de placas remodeladas no obstrutivas. vlido lembrar que, em diabticos, diferentemente
das pessoas que no apresentam essa doena, h maior proporo de placas obstrutivas no remodeladas, o que leva a eventos
coronarianos agudos com infarto do miocrdio, angina instvel
e morte sbita. Wong et al. avaliaram a CAC pela tomografia
computadorizada (TC) e a IMi pela medicina nuclear em 140
diabticos com ou sem sndrome metablica (SM) e 173 pessoas com SM. Independentemente de haver DM ou SM, escores de
clcio < 100 associaram-se a baixa taxa de isquemia miocrdica
(cerca de 2%).8 A ocorrncia de DM e/ou SM associou-se a 13%
de isquemia naqueles com CAC 100 a 399 vs. 3,6% na ausncia
dessas entidades. J CAC 400 em portadores de DM e/ou SM
associou-se isquemia em 23,4% vs. 13,6% na ausncia das mesmas. Anand et al. mostraram que cerca de 45% dos diabticos
tipo 2 assintomticos para DAC, na faixa etria entre 30 e 65

Diretrizes SBD 2015-2016 - CAP 19 - PARTE 2.indd 126

anos, apresentavam CAC definida como escore de clcio > 10


(n = 510).9 No mesmo estudo, a isquemia miocrdica aumentava medida que os escores de clcio cresciam: 0, 18,4, 22,9, 48,3
e 71,4% para aqueles com escores de clcio de 0 a 10, 11 a 100,
101 a 400, 401 a 1.000 e > 1.000, respectivamente (p < 0,0001).
Nesse estudo, a ocorrncia de CAC moderada (escores de clcio
100 a 400), grave (400 a 1.000) e muito grave (> 1.000) correlacionou-se com um risco relativo de eventos cardiovasculares
respectivamente 10, 40 e 58 vezes maior do que em diabticos
sem CAC em um perodo de 2 anos de seguimento. A CAC foi
superior aos escores de Framingham e do UKPDS para a predio de eventos.
Recentemente, dados do estudo Prospective Evaluation
of Coronary Artery Calcium in Predicting Cardiovascular Events in Asymptomatic Patients with Type 2 Diabetes
(PREDICT) confirmaram a importncia da deteco da CAC
em diabticos assintomticos para a identificao de indivduos de alto risco para desfechos cardiovasculares.10 Foram
acompanhados prospectivamente 589 diabticos por 4 anos. A
CAC foi marcadora independente do risco de eventos.
As razes de dano relativas para os escores de clcio no que
se refere aos intervalos 0 a 10 de unidades Agatston (AU) foram
de: 11 a 100, 5,4; 101 a 400, 10,5; 401 a 1.000, 11,9 e > 1.000,
19,8. As reas sob a receiver operator characteristic curve (ROC)
mostraram melhora da avaliao do risco clnico quando a CAC
foi acrescentada.
Raggi et al.11 avaliaram mais de 900 diabticos e encontraram que a CAC > 1.000 indicou mortalidade de 9% em 5 anos
em comparao com 1,1% naqueles sem CAC ou escore de
clcio < 10. Contudo, este estudo no avaliou desfechos como
infarto do miocrdio.
A metanlise de Kramer et al. com diabticos tipo 2 incluiu
8 estudos com 6.521 pacientes inicialmente assintomticos
nos quais ocorreram 802 eventos.12 Os autores demonstraram
que o risco relativo de mortalidade total ou eventos cardiovasculares, comparando-se o escore de clcio 10 com < 10 foi de
5,47 (intervalo de confiana [IC] 95% 2,59 a 11,53, p < 0,001).
A sensibilidade foi elevada (94%), porm com baixa especificidade (34%) do mtodo. Esse achado corrobora o conceito
de que mesmo os diabticos com escore de clcio baixo (< 10)
apresentam menor risco de eventos cardiovasculares.
Dessa maneira, no h dvida de que a CAC til tanto
para a deteco de IMi quanto para a estratificao do risco de
eventos coronarianos e morte em diabticos assintomticos.
Entretanto, uma proposta que necessita ainda ser validada em
estudos prospectivos a do uso da determinao da CAC pela
TC como exame de triagem para DCV em diabticos. A cintigrafia ou o ecocardiograma de estresse seriam realizados em
diabticos assintomticos que apresentassem escores de clcio
> 400 ou de 100 a 400 em SM, durao de DM > 10 anos ou
microangiopatia.5 O escore de clcio poderia ser repetido aps
5 anos caso seja zero, do contrrio no dever ser repetido.
O quanto novos exames como a angiotomografia coronariana acrescentaro simples determinao da CAC objeto de
estudos. Hadamitzky et al. avaliaram a eficcia da angiotomografia coronariana em predizer eventos cardiovasculares em
140 diabticos e 1.782 no diabticos seguidos por 33 meses
em mdia.13 Os pacientes do estudo apresentavam sintomas
atpicos para DAC ou outros fatores de risco. Os diabticos

06/10/2015 09:53:17

Diagnstico da Doena Coronariana Silenciosa 127

que exibiam carga de placa elevada, caracterizada por alto


nmero de segmentos coronarianos com placas de ateroma
(calcificadas ou no), tiveram cerca de trs vezes mais eventos
dos que os no diabticos (1,8% vs. 0,5% ao ano). A carga de
placas foi o melhor marcador de eventos coronarianos, mesmo
ajustando-se para o escore de clcio. O estudo FACTOR 64
avaliou se a angiotomografia de coronrias em diabticos tipo
1 ou 2 assintomticos poderia ser benfica em reduzir eventos
clnicos.14 Incluram-se pacientes com durao do diabetes de
pelo mesmo 3 ou 5 anos. Os pacientes foram randomizados
para realizar angiotomografia de coronrias ou no, sendo que
o resultado da mesma era utilizado na conduo clnica do paciente. Todos os pacientes foram submetidos a tratamento padro dos fatores de risco, sendo que os mdicos eram estimulados a alcanar metas teraputicas segundo diretrizes vigentes
na poca (hemoglobina glicada < 7,0%, LDL-colesterol < 100
mg/dl e presso sistlica < 130 mmHg). Os pacientes do grupo angiotomografia com coronrias normais eram mantidos
no tratamento padro. Os pacientes que apresentavam doena
coronria leve proximal ou grave proximal ou distal ou escore
de clcio acima de 10 eram recomendados a serem tratados
de maneira agressiva (LDL-colesterol < 70 mg/dl, HDL-colesterol > 50 mg/dl, triglicerdios < 150 mg/dl, hemoglobina
glicada < 6,0% e presso sistlica < 120 mmHg). Os pacientes
com estenose grave eram submetidos angiografia coronria
invasiva, e a deciso sobre revascularizao ficava a critrio do
mdico assistente. Os pacientes com obstruo coronria moderada eram submetidos pesquisa de isquemia miocrdica.
No total, foram randomizados 900 pacientes, sendo 452 para o
grupo angiotomografia, e o tempo mdio de seguimento foi de
4 anos. A durao mdia do diabetes no grupo sem angiotomografia chegou a 13,5 anos e no grupo que realizou o exame,
12,3 anos. A taxa de eventos do desfecho primrio (mortalidade total, infarto no fatal ou angina instvel) no foi diferente
entre os dois grupos, sendo de 6,2% (28 eventos) no grupo
angiotomografia versus 7,6% (34 eventos) no grupo controle,
hazard ratio (HR): 0,80 (IC 95% 0,49 a 1,32), p = 0,38. No
houve tambm diferena quanto ao desfecho secundrio
(eventos isqumicos cardacos maiores). De fato, a taxa de
eventos observada foi abaixo do previsto para clculo do tamanho amostral, o que pode ter interferido no resultado negativo do estudo. De todo modo, podemos concluir que pacientes diabticos com seus fatores de risco bem controlados no
tiveram benefcio do screening com angiotomografia de coronrias como medida para reduzir eventos cardiovasculares.
No final de 2010, a Associao Americana do Corao e o
Colgio Americano de Cardiologia manifestaram-se sobre o
nvel de evidncias e o grau de recomendao para a pesquisa de isquemia miocrdica por mtodos de imagem, pesquisa
da CAC e uso da angiotomografia coronariana em indivduos assintomticos, inclusive nos portadores de diabetes.15 A
cintigrafia miocrdica pode ser considerada em diabticos assintomticos considerados de alto risco ou por associao de
fatores de risco, por histria familiar de DAC precoce ou por
escore de clcio > 400 (recomendao IIB nvel de evidncia
C). Para indivduos diabticos assintomticos com mais de 40
anos de idade, a determinao da CAC um mtodo razovel
para avaliao do risco (recomendao IIa, nvel de evidncia B). A angiotomografia de coronria no recomendada

Diretrizes SBD 2015-2016 - CAP 19 - PARTE 2.indd 127

na anlise do risco em diabticos (recomendao III nvel de


evidncia C). Essa recomendao vlida mesmo aps a publicao de estudos mais recentes.1214
Calcificao da artria coronria maior que 100 implicaria
reduzir o colesterol da lipoprotena de baixa densidade (LDL-c)
< 70 mg/dl, em vez de < 100 mg/dl, a presso arterial < 130/80
mmHg, alm do uso de cido acetilsaliclico (AAS). Se houver
IMi, o paciente dever ser encaminhado ao cardiologista. Por
fim, importante que, caso haja sintomas de isquemia, dor torcica e/ou dispneia, o paciente seja encaminhado para prova de
isquemia ou cateterismo cardaco, e no para TC.

Risco cardiovascular no diabetes tipo 1


Diabticos tipo 1, com o passar dos anos, apresentam maior
risco de complicaes cardiovasculares,16 principalmente aps
os 40 anos de idade. Contudo, esse intervalo pode variar e depender do tempo de durao da doena, do aparecimento de
nefropatia, da hipertenso arterial e do descontrole da glicemia. Mais recentemente, a obesidade e a SM associam-se a esse
risco aumentado de DCV. Zgibor et al.17 analisaram a importncia dos escores clnicos na avaliao do risco de DAC em
diabticos tipo 1. Esses autores mostraram claramente que escores como UKPDS e o de Framingham subestimaram o risco
de DAC no diabetes tipo 1. O algoritmo proposto por Bax et
al.,5 combinando a deteco da CAC com os testes, poderia ser
tambm utilizado nessa populao.

Declarao
importante enfatizar que as condutas propostas aqui so de
opinio do autor e os nveis de evidncia e recomendao so
no mximo IIB. Ainda so necessrios estudos prospectivos
para testar o custo/efetividade das estratgias de screening sugeridas neste captulo.

Referncias bibliogrficas
1. American Diabetes A. Standards of medical care in diabetes-2014.
Diabetes Care. 2014; 37(suppl 1):S14-S80.
2. Fox CS, Sullivan L, DAgostino RB et al. The significant effect of
diabetes duration on coronary heart disease mortality: the Framingham Heart Study. Diabetes Care. 2004; 27(3):704-8.
3. DAgostino RB, Vasan RS, Pencina MJ et al. General cardiovascular risk profile for use in primary care: the Framingham Heart
Study. Circulation. 2008; 117(6):743-53.
4. Stevens RJ, Kothari V, Adler AI et al. The UKPDS risk engine: a
model for the risk of coronary heart disease in Type II diabetes
(UKPDS 56). Clinical Science. 2001; 101(6):671-9.
5. Bax JJ, Young LH, Frye RL et al. Screening for coronary artery
disease in patients with diabetes. Diabetes Care. 2007; 30(10):
2729-36.
6. Bax JJ, Inzucchi SE, Bonow RO et al. Cardiac imaging for risk
stratification in diabetes. Diabetes Care. 2007; 30(5):1295-304.
7. Young LH, Wackers FJ, Chyun DA et al. Cardiac outcomes after
screening for asymptomatic coronary artery disease in patients
with type 2 diabetes: the DIAD study: a randomized controlled
trial. JAMA. 2009; 301(15):1547-55.
8. Wong ND, Rozanski A, Gransar H et al. Metabolic syndrome
and diabetes are associated with an increased likelihood of inducible myocardial ischemia among patients with subclinical
atherosclerosis. Diabetes Care. 2005; 28(6):1445-50.

06/10/2015 09:53:18

128 Diretrizes SBD | 2015-2016


9. Anand DV, Lim E, Hopkins D et al. Risk stratification in uncomplicated type 2 diabetes: prospective evaluation of the combined use
of coronary artery calcium imaging and selective myocardial perfusion scintigraphy. European Heart Journal. 2006; 27(6):713-21.
10. Elkeles RS, Godsland IF, Feher MD et al. Coronary calcium
measurement improves prediction of cardiovascular events in
asymptomatic patients with type 2 diabetes: the PREDICT study.
European Heart Journal. 2008; 29(18):2244-51.
11. Raggi P, Shaw LJ, Berman DS et al. Prognostic value of coronary artery calcium screening in subjects with and without
diabetes. Journal of the American College of Cardiology. 2004;
43(9):1663-9.
12. Kramer CK, Zinman B, Gross JL et al. Coronary artery calcium
score prediction of all cause mortality and cardiovascular events
in people with type 2 diabetes: systematic review and meta-analysis. BMJ. 2013; 346:f1654.
13. Hadamitzky M, Hein F, Meyer T et al. Prognostic value of coronary computed tomographic angiography in diabetic patients

Diretrizes SBD 2015-2016 - CAP 19 - PARTE 2.indd 128

14.

15.

16.
17.

without known coronary artery disease. Diabetes Care. 2010;


33(6):1358-63.
Muhlestein JB, Lappe DL, Lima JA et al. Effect of screening for
coronary artery disease using CT angiography on mortality and
cardiac events in high-risk patients with diabetes: the FACTOR-64
randomized clinical trial. JAMA. 2014; 312(21):2234-43.
Greenland P, Alpert JS, Beller GA et al. 2010 ACCF/AHA guideline for assessment of cardiovascular risk in asymptomatic
adults: a report of the American College of Cardiology Foundation/American Heart Association Task Force on Practice Guidelines. Journal of the American College of Cardiology. 2010;
56(25):e50-103.
Wajchenberg BL, Rassi N, Feitosa AC et al. Cardiovascular disease in type 1 diabetes mellitus. Arquivos Brasileiros de Endocrinologia e Metabologia. 2008; 52(2):387-97.
Zgibor JC, Piatt GA, Ruppert K et al. Deficiencies of cardiovascular risk prediction models for type 1 diabetes. Diabetes Care.
2006; 29(8):1860-5.

06/10/2015 09:53:18

Retinopatia Diabtica
Introduo
A retinopatia diabtica (RD) umas das principais complicaes relacionadas ao diabetes mellitus (DM) e a principal causa
de cegueira em pessoas com idade entre 20 e 74 anos.1 Aproximadamente 12% dos novos casos de cegueira legal, isto , a diminuio da acuidade visual a um grau que impea o exerccio
de atividades laborais, so causados pela RD. Aps 20 anos de
doena, mais de 90% dos diabticos com o tipo 1 e 60% daqueles com o tipo 2 apresentaro algum grau de retinopatia. Na RD,
a principal causa de perda visual o edema macular, podendo
estar presente desde as fases iniciais da retinopatia at em casos
nos quais h doena proliferativa grave, acometendo 30% dos
pacientes com mais de 20 anos de diabetes.2 A forma proliferativa aquela que se relaciona mais frequentemente com a perda
visual grave, devido a eventos oculares potencialmente causadores de cegueira irreversvel, como a isquemia retiniana difusa, incluindo a macular e o descolamento tracional de retina.
Estima-se que em pacientes com RD proliferativa no tratada
a taxa de evoluo para a cegueira seja de 50%, em 5 anos.35
No Brasil, ainda no h pesquisas que demonstrem, com
exatido, a prevalncia da RD. Porm, estudos realizados em
diferentes regies do pas referem uma incidncia de 24 a 39%
de casos, sendo sua maior frequncia em indivduos residentes
em regies no metropolitanas.610 Avaliando-se as estatsticas disponveis, com percentuais adaptados de outros pases,
estima-se que aproximadamente 2 milhes de brasileiros tenham algum grau de RD, podendo-se presumir que uma parte
importante desses indivduos apresentar perda visual relacionada com a doena. O risco de cegueira pela RD pode ser
reduzido a menos de 5% quando o diagnstico realizado em
tempo adequado e o tratamento feito de modo correto, antes
que alteraes irreversveis possam se instalar.11

Importncia do controle sistmico


O tempo de durao do diabetes e o controle glicmico so,
respectivamente, os dois fatores mais importantes relacionados
com o desenvolvimento e a gravidade da RD. fundamental
que seja feito o controle glicmico adequado para a preveno
e diminuio das complicaes relacionadas com a doena. O
estudo norte-americano Diabetes Control and Complications
Trial (DCCT) comparou a terapia insulnica intensiva insulinoterapia convencional em pacientes com DM tipo 1 (DM1).
Os pacientes submetidos ao controle intensivo apresentaram
reduo de 76% no risco de desenvolvimento de retinopatia.
Em pacientes com algum grau de retinopatia observou-se a

Diretrizes SBD 2015-2016 - CAP 20.indd 129

reduo de 54% no risco de progresso da RD.12 De maneira


geral, a cada 1% de reduo da hemoglobina glicada ocorre
uma diminuio no risco de aparecimento da retinopatia de
35%, e de progresso de 39%.13 Em pacientes com diabetes
mellitus tipo 2 (DM2), o estudo United Kingdom Prospective
Diabetes Study (UKPDS) demonstrou a importncia do controle intensivo da presso arterial. Aps 9 anos de acompanhamento e controle pressrico, diminuiu-se o risco de progresso da retinopatia em 47%. A anlise do UKPDS demonstrou
que, para cada decrscimo de 10 mmHg da presso arterial
sistlica, havia uma diminuio de 13% do risco de evoluo
para qualquer complicao microvascular.14

Classificao
Os critrios para diagnstico e caracterizao da RD, assim
como para a definio de tratamento com fotocoagulao a laser,
baseiam-se nas definies e achados de duas importantes sries
de estudos. O Diabetic Retinopathy Study (DRS 1976 a 1979)
estudou o papel da panfotocoagulao e definiu critrios diagnsticos para a RD proliferativa, enquanto o Early Treatment
Diabetic Retinopathy (ETDRS 1985 a 1997) determinou critrios atualmente utilizados referentes RD no proliferativa e
ao edema macular, assim como a utilizao da fotocoagulao
a laser nesses pacientes. Buscando menor fragmentao e maior
padronizao na classificao da RD, um grupo multidisciplinar,
formado por oftalmologistas, endocrinologistas e epidemiologistas props, durante o International Congress of Ophthalmology
(Sydney, 2002), uma classificao baseada na gravidade para a
RD e para o edema macular, abrangendo os principais critrios
definidos no DRS e no ETDRS.15 A classificao internacional
proposta encontra-se exposta nos Quadros 1 e 2.

Diagnstico, acompanhamento
e tratamento
Em 2010, a Sociedade Brasileira de Retina e Vtreo (SBRV) emitiu o Parecer Oficial sobre a Retinopatia Diabtica, com orientaes sobre o diagnstico, acompanhamento e tratamento da
doena.16
As recomendaes sobre o diagnstico da RD, segundo o
parecer da SBRV, classificadas de acordo com o grau de recomendao proposto pelas Diretrizes, encontram-se dispostas
no Quadro 3.
Em pacientes diabticos, o acompanhamento oftalmolgico
deve ser programado e rigorosamente cumprido, a fim de que
a retinopatia seja tratada de maneira correta e antes que surjam

05/10/2015 06:53:02

130 Diretrizes SBD | 2015-2016


Quadro 1 Classificao da retinopatia diabtica (A).15
Gravidade da
retinopatia

Achados oftalmoscopia sob


dilatao pupilar

Sem retinopatia aparente Sem alteraes


Retinopatia diabtica
no proliferativa leve

Microaneurismas apenas

Retinopatia diabtica
no proliferativa
moderada

Achados mais abundantes


que na retinopatia no proliferativa
leve, e menos abundantes que na
retinopatia no proliferativa grave

Retinopatia diabtica
no proliferativa grave

Presena de um dos seguintes


achados: mais de 20 hemorragias
retinianas em cada um dos quatro
quadrantes retinianos,
ensalsichamento venoso em dois
quadrantes ou microanormalidades
vasculares intrarretinianas em um
quadrante

Retinopatia diabtica
proliferativa

Presena de neovasos e/ou


hemorragia vtrea ou pr-retiniana

Quadro 2 Classificao do edema macular (A).15


Gravidade do edema
macular diabtico

Achados oftalmoscopia sob


dilatao pupilar

Edema macular
aparentemente ausente

Ausncia de espessamento
retiniano ou exsudatos duros no
polo posterior

Edema macular
aparentemente
presente

Presena de espessamento
retiniano ou exsudatos duros no
polo posterior

Classificao do edema macular presente


Edema macular leve

Algum grau de espessamento de


retina ou exsudatos duros no polo
posterior, porm distantes do centro
foveal

Edema macular
moderado

Espessamento de retina prximo ao


centro da mcula, mas que ainda no
atingiu seu centro

Edema macular grave

Espessamento de retina ou exsudatos


duros atingindo o centro da mcula

Quadro 3 Testes de deteco de retinopatia.

sequelas irreversveis. Frequentemente, mesmo pacientes com


RD proliferativa grave podem ser assintomticos, sendo fundamental que sejam feitas avaliaes oftalmolgicas peridicas.
Nos portadores de DM1, a RD geralmente inicia-se aps
3,5 anos ps-puberdade. No caso do DM2, em locais com bom
acesso assistncia sade, que proporcionem uma boa sobrevida ao portador de diabetes, estima-se que 38% dos diabticos j apresentem algum grau de RD poca do diagnstico
da doena sistmica.
O consenso de que se realize o acompanhamento de
modo que os pacientes no alcancem as formas proliferativas
graves da doena e, para tanto, o intervalo no deve ser superior a 1 ano, reduzindo-se esse tempo conforme a gravidade
do caso (Quadro 4). Nas grvidas com retinopatia presente,
descrito que em 77,5% dos casos h progresso da retinopatia,
chegando a 22,5% a indicao de fotocoagulao antes do parto, da a necessidade de acompanhamento trimestral.
O tratamento da RD com a fotocoagulao permanece, em
2015, como o padro-ouro para o tratamento da retinopatia proliferativa e possibilidade teraputica no edema macular. A fotocoagulao impede a perda de viso em 90% dos casos, quando
iniciada nas fases no proliferativa avanada ou proliferativa inicial. Para pacientes com retinopatia proliferativa de alto risco, a
perda de viso grave (20/800 ou pior) reduzida em 50% dos casos (Quadro 5). O estudo ETDRS demonstrou que o tratamento
do edema macular clinicamente significativo (EMCS) com laser
em grid ou focal/direto reduz o risco de baixa de viso em 50%
comparado ao grupo-controle (24% para 12%).
Diversos tratamentos farmacolgicos foram propostos para
o EMCS, em destaque o uso de frmacos antiangiognicos (bevacizumabe, ranibizumabe e aflibercepte) e corticosteroides (trianQuadro 4 Recomendaes para o incio do acompanhamento.
Recomendaes para o incio do
acompanhamento

Grau de
recomendao

Diabtico tipo 1 deve iniciar o


acompanhamento aps a puberdade ou
com 5 anos de doena

Diabtico tipo 2 deve iniciar o exame


oftalmolgico junto com o diagnstico do
diabetes

O intervalo entre os exames anual,


podendo ser menor dependendo do grau
de retinopatia ou maculopatia encontrada
importante que nunca ultrapasse esse
intervalo

Recomendaes para a deteco de


retinopatia

Grau de
recomendao

A fotografia do fundo de olho um bom


mtodo para diagnstico da retinopatia

Durante a gravidez, os exames devem ser


trimestrais

Oftalmoscopia indireta e biomicroscopia


da retina, realizadas por pessoa treinada,
so mtodos aceitveis

Pacientes com queixa de perda de viso


devem ser encaminhados para um
oftalmologista com urgncia

Dilatar as pupilas com tropicamida

No h evidncias que apontem o melhor


mtodo diagnstico para a retinopatia
diabtica

Fonte: Adaptado de Morales PH, Lavinsky D, Vianello S et al. Parecer da


Sociedade Brasileira de Retina e Vtreo. Retinopatia Diabtica, 2010.16

Diretrizes SBD 2015-2016 - CAP 20.indd 130

Tratamento com cido acetilsaliclico (Early


Treatment of Diabetic Retinopathy Study),
650 mg/dia: no h evidncias de que o uso B
de cido acetilsaliclico interfira na
progresso da retinopatia
Fonte: Adaptado de Morales PH, Lavinsky D, Vianello S et al. Parecer da
Sociedade Brasileira de Retina e Vtreo. Retinopatia Diabtica, 2010.

05/10/2015 06:53:03

Retinopatia Diabtica 131


Quadro 5 Recomendaes clnicas para intervenes primrias e secundrias na retinopatia diabtica.
Interveno

Grau de
recomendao

Controle glicmico

Qualquer reduo da HbA1c vantajosa para o desenvolvimento ou progresso da RD.


Em pacientes com RD, HbA1c < 7% a ideal

Controle pressrico

Qualquer reduo da presso sistlica e/ou diastlica vantajosa para inibir o


desenvolvimento ou progresso da RD. Em pacientes com RD, a presso sistlica < 130
mmHg a ideal

Controle lipdico

Diminuio dos nveis de LDL-c reduz o risco de complicaes macrovasculares e pode


ser vantajosa para o edema macular diabtico

Panfotocoagulao

Panfotocoagulao imediata recomendada em pacientes com RD proliferativa,


especialmente aqueles de alto risco

RD proliferativa inicial menos grave (neovasos planos na retina sem sinais de alto risco) e
RD no proliferativa grave podem ser observadas de perto, porm a panfotocoagulao
recomendada se houver dificuldade ou atraso no acompanhamento, sinais de
progresso ou fatores de risco, especialmente em pacientes com DM2

Fotocoagulao
macular focal/grid

Tratamento com laser focal/grid recomendado em pacientes com edema de mcula


clinicamente significativo. Tratamento deve ser guiado pela angiofluoresceinografia, e
dificilmente ser efetivo se houver isquemia macular importante

Vitrectomia

Vitrectomia precoce (trs meses) recomendada em pacientes com DM1 com


hemorragia vtrea grave e RD proliferativa. Vitrectomia pode ser considerada em
pacientes com RD proliferativa no responsiva panfotocoagulao ou associada a
trao envolvendo a mcula

Vitrectomia pode ser vantajosa em casos selecionados de edema macular difuso no


responsivo a outras terapias, especialmente na presena de trao vitreomacular

Corticosteroides
intravtreos

Triancinolona intravtrea tem ao no tratamento do edema macular difuso. Estudo


randomizado demonstrou inferioridade ao laser em 3 anos com o risco maior de catarata
e aumento de presso intraocular

Frmacos
antiangiognicos

Reduzem a neovascularizao da retina e o edema de mcula. Estudos recentes


demonstraram o benefcio de sua utilizao isoladamente e/ou associada
fotocoagulao, apresentando maior ganho visual que a fotocoagulao isolada no
tratamento do edema macular

Recomendaes clnicas

(A) Estudos experimentais e observacionais de melhor consistncia; (B) Estudos experimentais e observacionais de menor consistncia; (C) Relatos de
casos estudos no controlados; (D) Opinio desprovida de avaliao crtica, baseada em consenso, estudos fisiolgicos ou modelos animais.
Fonte: Adaptado de Morales PH, Lavinsky D, Vianello S et al. Parecer da Sociedade Brasileira de Retina e Vtreo. Retinopatia Diabtica, 2010.

cinolona acetonida, implante biodegradvel de dexametasona e implante no biodegradvel de fluocinolona), injetados


diretamente na cavidade vtrea. O maior estudo clnico randomizado utilizando a triancinolona e comparando-a ao tratamento com fotocoagulao, utilizando o protocolo ETDRS
modificado, no demonstrou maior eficcia dessa substncia
em relao ao laser ao final de 3 anos de acompanhamento,
alm de aumentar o risco de catarata e glaucoma nos pacientes
submetidos a esse tratamento.17 Por outro lado, estudos controlados utilizando o ranibizumabe evidenciaram, ao longo de
2 anos, melhores resultados visuais, tanto isoladamente quanto em associao fotocoagulao a laser, quando comparado
fotocoagulao a laser isolada. Recentemente, o aflibercepte
foi avaliado no tratamento do edema macular diabtico. Estudo acompanhado durante 1 ano mostrou a superioridade de
sua utilizao em comparao fotocoagulao a laser isolada.17-20 Os antiangiognicos constituem o padro-ouro atual
no tratamento do edema macular diabtico. O ranibizumabe
foi aprovado pela Food and Drug Administration (FDA), em

Diretrizes SBD 2015-2016 - CAP 20.indd 131

2012, e pela Agncia Nacional de Vigilncia Sanitria (Anvisa), em 2013, para o tratamento do edema macular diabtico.
O aflibercepte encontra-se aprovado pela FDA norte-americana desde 2014, para o edema diabtico, e encontra-se em
tramitao no Brasil. Em 2015, estudo multicntrico do grupo DRCRNet mostrou semelhana entre os antiangiognicos
(bevacizumabe, ranibizumabe e aflibercepte) no tratamento
do edema macular diabtico, com leve vantagem na utilizao
do aflibercepte em pacientes com acuidade visual inferior a
20/50.21 Nos EUA, foram aprovados, em 2014, os implantes
intravtreos de dexametasona e fluocinolona acetonida para o
tratamento do edema macular.22-23 Atualmente, os antiangiognicos so utilizados, alm do edema macular, na preparao
pr-cirrgica para a vitrectomia, diminuindo a atividade neovascular nos casos de RD proliferativa.
Casos em que a fotocoagulao no eficaz, como nas
traes vitreomaculares, hemorragias vtreas persistentes e
descolamentos tracionais de retina acometendo a regio macular, devem ser tratados cirurgicamente pela vitrectomia.

05/10/2015 06:53:03

132 Diretrizes SBD | 2015-2016

Considerando todos os casos cirrgicos, a vitrectomia proporciona acuidade visual melhor que 20/100 em cerca de 80%
dos casos. Os resultados funcionais dependem fundamentalmente da integridade pr-operatria da vasculatura retiniana
e da complexidade anatmica do olho no pr-operatrio. Um
efeito importante da cirurgia vtrea que mais de 90% dos casos se mantm estveis em longo prazo, se a cirurgia for bem-sucedida e no houver complicaes nas primeiras semanas
de ps-operatrio.24

Referncias bibliogrficas
1. Klein R, Klein BEK. Epidemiology of eye disease in diabetes.
In: Flynn Jr HW, Smiddy WE, editors. Diabetes and ocular
Disease: past, present, and future therapies. The Foundation of
the American Academy of Ophthalmology. 2000; 19-61.
2. Klein R, Klein BE, Moss SE. Visual impairment in diabetes. Ophthalmology. 1984; 91:1-9.
3. Beetham WP. Visual prognosis of proliferating diabetic retinopathy. Br J Ophthalmol. 1963; 47:611-19.
4. Caird FI, Burditt AF, Draper GJ. Diabetic retinopathy: a further
study of prognosis for vision. Diabetes. 1968; 17:121-3.
5. Deckert T, Simonsen SE, Poulson JE. Prognosis of proliferative
retinopathy in juvenile diabetics. Diabetes. 1967; 16:728-33.
6. Taleb AC, vila M, Almeida R, Bicas H. As condies de sade
ocular no Brasil. 1a ed. So Paulo: Conselho Brasileiro de Oftalmologia; 2007. p. 20-1.
7. Taleb AC, vila M, Moreira H. As condies de sade ocular no
Brasil. 1a ed. So Paulo: Conselho Brasileiro de Oftalmologia;
2009.
8. Ramos SR, Sabbag FP, Busato D et al. Retinopatia diabtica: estudo de uma associao de diabticos. Arq Bras Oftalmol. 1999;
62:735-7.
9. Foss MC, Paccola GMGF, Souza NV, Iazigi N. Estudo analtico de
uma amostra populacional de diabticos tipo II da regio de Ribeiro Preto (SP). AMB Rev Assoc Med Bras. 1989; 35(5):179-83.
10. Escario PH, Arantes TE, Figueiroa Filho NC, Urtiga RD, Florncio TL, Arcoverde AL. Epidemiology and regional differences
of diabetic retinopathy in Pernambuco, Brazil. Arq Bras Oftalmol. 2008; 71(2):172-5.
11. Ferris FL III. How effective are treatments for diabetic retinopathy? J Am Med Assoc. 1993; 269:1290-1.
12. Diabetes Control and Complications Trial Research Group. The
effect of intensive treatment of diabetes on the development and
progression of long-term complications in insulin-dependent
diabetes mellitus. N Engl J Med. 1993; 329:977-86.

Diretrizes SBD 2015-2016 - CAP 20.indd 132

13. Diabetes Control and Complication Trial. The absence of a glycemic threshold for the development of long-term complications:
the perspective of the Diabetes Control and Complications Trial.
Diabetes. 1996; 45:1289-98.
14. United Kingdom Prospective Diabetes Study Group. Intensive
blood-glucose control with sulphonylureas or insulin compared
with conventional treatment and risk of complications in patients
with type 2 diabetes. UKPDS 33. Lancet. 1998; 352: 837-53.
15. Wilkinson CP, Ferris FL 3rd, Klein RE, Lee PP, Agardh CD, Davis
M et al. Proposed international clinical diabetic retinopathy and
diabetic macular edema disease severity scales. Ophthalmology.
2003; 110:1677-82.
16. Morales PH, Lavinsky D, Vianello S et al. Parecer da Sociedade
Brasileira de Retina e Vtreo Retinopatia Diabtica, 2010.
17. Elman MJ, Bressler NM, Qin H, B4eck RW, Ferris FL 3rd, Friedman SM et al. Diabetic Retinopathy Clinical Research Network.
Expanded 2-year follow-up of ranibizumab plus prompt or deferred laser or triamcinolone plus prompt laser for diabetic macular edema. Ophthalmology. 2011; 118(4):609-14.
18. Nguyen QD, Brown DM, Marcus DM, Boyer DS, Patel S, Feiner
L, et al. Ranibizumab for diabetic macular edema: results from
2 phase III randomized trials: RISE and RIDE. Ophthalmology.
2012; 119(4):789-801.
19. Mitchell P, Bandello F, Schmidt-Erfurth U, Lang GE, Massin P,
Schlingemann RO et al. RESTORE study group. The RESTORE
study: ranibizumab monotherapy or combined with laser versus
laser monotherapy for diabetic macular edema. Ophthalmology.
2011; 118(4):615-25.
20. Do DV, Nguyen QD, Boyer D, Schmidt-Erfurth U, Brown DM,
Vitti R et al. One-year outcome of the Da Vinci study of VEGF
Trap Eye in eyes with diabetic macular edema. Ophthalmology.
2012 Aug; 119(8):1658-65.
21. Wells JA, Glassman AR, Ayala AR et al. Diabetic Retinopathy Clinical Research Network. Aflibercept, bevacizumab, or ranibizumab
for diabetic macular edema. N Engl J Med. 2015; 372(13):1193-203.
22. Haller JA, Kuppermann BD, Blumenkranz MS et al. Dexamethasone DDS Phase II Study Group. Randomized controlled trial
of an intravitreous dexamethasone drug delivery system in patients with diabetic macular edema. Arch Ophthalmol. 2010;
128(3):289-96.
23. Cunha-Vaz J, Ashton P, Iezzi R et al. FAME Study Group. Sustained delivery fluocinolone acetonide vitreous implants: longterm benefit in patients with chronic diabetic macular edema.
Ophthalmology. 2014; 121(10):1892-903.
24. Almeida R, Isaac DLC, vila M. Retinopatia diabtica proliferativa. In: Avila M, Isaac D (Org.). Vitrectomia 20, 23 e 25G. 1a ed.
Rio de Janeiro: Cultura Mdica; 2010. 1. p. 203-22.

05/10/2015 06:53:03

Neuropatia Diabtica
Introduo
Neuropatia diabtica o distrbio neurolgico demonstrvel
clinicamente ou por mtodos laboratoriais em pacientes diabticos, quando excludas outras causas de neuropatia (A).15 Em geral, o acometimento patolgico do sistema nervoso muito amplo e, inmeras vezes, bastante grave no diabetes mellitus (DM).
A prevalncia da neuropatia diabtica alcana nveis elevados
com a evoluo temporal da doena, chegando geralmente a
frequncias de 50% de leso neuroptica em diferentes grupos
de pacientes analisados nos mbitos nacional e internacional.
Entretanto, essa prevalncia pode aumentar significativamente
e atingir valores prximos a 100% de acometimento quando se
utilizam mtodos diagnsticos de maior sensibilidade, como os
eletrofisiolgicos (A).610 Pode-se detectar distrbio neurolgico
precocemente na evoluo de DM do tipo 2 (DM2), muitas vezes
desde o momento do diagnstico, enquanto nos pacientes diabticos do tipo 1 normalmente surge cinco ou mais anos aps o
diagnstico, devendo-se realizar avaliao para tal complicao
nestes momentos e depois anualmente por meio de testes que
sero descritos posteriormente. notrio, ento, que o acometimento neuroptico dos pacientes seja geralmente precoce e de alta
prevalncia, a maioria constituindo-se em triopatia diabtica
oftalmo, nefro e neuropatia e sendo um importante problema
de sade, que ocasiona morbidade e mortalidade e piora significativamente a qualidade de vida por incapacitao e diminuio
de sobrevida. Atualmente, no h dvida de que o bom controle
metablico do diabetes reduz a frequncia e a intensidade da leso neurolgica, conforme se demonstrou em importantes estudos prospectivos, os quais envolveram indivduos diabticos dos
tipos 1 (Diabetes Control and Complications Trial [DCCT]) e 2
(UK Prospective Diabetes Study [UKPDS]) (A).1114
Nessa situao patolgica, a leso neurolgica extensa no
organismo humano diabtico, envolvendo amplamente todo o
sistema nervoso perifrico em seus componentes sensorimotor
e autnomo, com clnica caracterstica e concordante com as
hipteses patognicas de natureza metablica e/ou microvascular. Nos estudos que se tm realizado com grupos de pacientes
diabticos usando-se metodologia clnica rotineira, verifica-se
predominncia ntida da neuropatia sensorimotora. Entretanto,
essa situao pode ocorrer em razo da metodologia empregada, j que os testes de funo autonmica so de uso rotineiro
mais difcil, envolvendo mtodos e equipamentos mais sofisticados. Desse modo, o quadro clnico da neuropatia pode variar amplamente, desde formas assintomticas at a presena de
manifestaes pouco especficas, somticas e/ou autonmicas.

Diretrizes SBD 2015-2016 - CAP 21.indd 133

Como se mencionou anteriormente, o acometimento patolgico na neuropatia diabtica geralmente amplo no organismo,
apresentando-se de duas formas principais (A):1525

Polineuropatia sensorimotora simtrica


Neuropatia autonmica (cardiovascular, respiratria, digestiva e geniturinria).

Menos frequentemente, a leso neuroptica mais localizada, apresentando-se nas formas de:



Mononeuropatia focal (tibiais, medianos e pares cranianos


III, IV, VI e VII)
Neuropatia multifocal radicular (geralmente, intercostal,
toracoabdominal e lombar)
Neuropatia multifocal multiplexos (localizao variada)
Plexopatia ou amiotrofia.

O diagnstico das formas mais frequentes de neuropatia


diabtica baseia-se na caracterizao do quadro clnico com os
sintomas e sinais clnicos mais tpicos e na realizao de testes
neurolgicos. As principais manifestaes clnicas de comprometimento somtico so de dormncia ou queimao em membros inferiores, formigamento, pontadas, choques, agulhadas
em pernas e ps, desconforto ou dor ao toque de lenis e cobertores e queixas de diminuio ou perda de sensibilidade ttil,
trmica ou dolorosa. Ainda que a predominncia de sintomas e
sinais se localize nos membros inferiores, os membros superiores (mos e braos) podem tambm ser afetados. importante
destacar que a ausncia de sintomas e sinais de parestesia anteriormente mencionada no exclui a neuropatia, pois alguns
pacientes evoluem direto para a perda total de sensibilidade. Os
testes neurolgicos bsicos envolvem a avaliao de sensibilidade, pesquisa de reflexos tendinosos e medidas de presso arterial (deitado e em p) e de frequncia cardaca (A):2646

Avaliao de sensibilidades dolorosa (palito ou agulha), ttil (algodo ou monofilamento de Semmes-Weinstein 5,07
a 10 g), trmica (quente/frio) e vibratria (diapaso de 128
Hz ou bioestesimetro)
Pesquisa de reflexos tendinosos (aquileu, patelar e tricipital)
Medida de presso arterial sistmica em posies deitada e
ortosttica (hipotenso postural: queda da presso arterial
sistlica > 20 mmHg 1 min aps assumir posio ortosttica)
Frequncia cardaca de repouso: sugestiva de disautonomia
cardiovascular quando o valor estiver acima de 100 bpm.

05/10/2015 06:53:25

134 Diretrizes SBD | 2015-2016

Outros testes neurolgicos mais complexos e de difcil realizao rotineira confirmam leso neurolgica, como:

Tratamento dos sintomas e sinais da neuropatia


sensorimotora

Especialmente em relao dor neuroptica, as principais


opes teraputicas para as parestesias e dores da neuropatia
diabtica (D) so:48,53,54

Avaliao de neuroconduo, especialmente em membros


inferiores, ou testes sensoriais quantitativos
Testes da regulao autonmica cardiovascular: medidas
do intervalo entre duas ondas R, manobra de Valsalva, teste postural passivo, arritmia sinusal respiratria e esforo
isomtrico
Cintigrafia com metaiodobenzilguanidina e tomografia por
emisso de psitrons (PET) com 11-c-hidroxiefedrina: medidas diretas da integridade simptica cardaca.

Tratamento da neuropatia diabtica


Controle metablico
Sem dvida, o bom controle metablico (A) do diabetes
o principal fator preventivo da neuropatia,1114,47,48 tanto
inibindo o aparecimento de leses, quanto sua intensidade e extenso no diabetes tipo 1 e reduzindo a progresso
no diabetes tipo 2. Alguns estudos tambm sugerem que
o bom controle metablico pode melhorar a neuropatia j
estabelecida.
Alm disso, tm sido indicadas outras medidas teraputicas, como o uso de inibidores de enzima conversora de angiotensina (IECAs) ou agentes antioxidantes tais como o cido alfa-lipoico, a benfotiamina e o cido tictico. O estudo
SYDNEY 2, randomizado, duplo-cego controlado com 181
pacientes diabticos, demonstrou benefcios nos sintomas
neuropticos positivos com o uso de cido tictico nas doses
de 600 e 1.200 mg/dia.49
Tratamentos propostos com embasamento patogentico
incluem o cido a-lipoico (age sobre a formao de espcies
reativas de oxignio), benfotiamina (previne o dano vascular
no diabetes) e inibidores da aldose-redutase (reduz fluxo por
meio da via do poliol). Uma vez que a base patolgica geral
das alteraes no metabolismo, causadas pela hiperglicemia,
a produo de superxidos pela cadeia de transporte mitocondrial de eltrons, que podem ser revertidos pela ativao da
transcetolase, uma enzima dependente dos nveis de tiamina, a
benfotiamina pode representar uma opo de teraputica.50,51
A ao da benfotiamina na polineuropatia diabtica foi avaliada por diversos estudos. O estudo randomizado, duplo-cego,
controlado por placebo, prospectivo e de fase III BENDIP foi
o que apresentou a maior amostra inicial, 181 pacientes, o que
permitiu a avaliao por inteno de tratamento, ao final, de
133 deles, utilizando escores de neuropatia e analisando a melhora da dor neuroptica e de funes sensoriais.52 A dosagem
inicial da benfotiamina pode ser de at 600 mg ao dia, ao longo de 6 semanas e, ento ser reduzida conforme a evoluo
do paciente.
Entretanto, para as medicaes atualmente disponveis ou
em pesquisa, h a necessidade crescente de novos estudos
com maiores amostras de pacientes para avaliar as medicaes
mais potentes ou combinaes para a gesto da neuropatia
diabtica no intuito de maximizar o alvio da dor e melhorar a
qualidade de vida dos pacientes.

Diretrizes SBD 2015-2016 - CAP 21.indd 134

Acupuntura
Medicamentos antidepressivos tricclicos: amitriptilina (25 a
150 mg), imipramina (25 a 150 mg) e nortriptilina (10 a 150
mg) por via oral (VO)/dia
Medicamento antidepressivo dual: duloxetina (60 a 120
mg) e venlafaxina (150 a 225 mg) VO/dia
Medicamentos anticonvulsivantes: pregabalina (150 a 600
mg) e gabapentina (900 a 1.800 mg) VO/dia
Capsaicina (0,075%) em creme: uso tpico
Clonidina (0,1 a 0,3 mg/dia).

Veja, no Quadro 1, os medicamentos utilizados no tratamento da neuropatia sensorimotora.

Tratamento dos sintomas e sinais da neuropatia


autonmica (D)53,5559

Disautonomia cardiovascular:
Hipotenso postural: devem-se evitar mudanas posturais bruscas, uso de meias ou calas compressivas,
elevao da cabeceira do leito (30 cm) e, quando necessrio, uso de fludrocortisona (Florinefe) 0,1 a 0,4 mg/
dia VO
Disautonomia gastrintestinal:
Gastresofgica: metoclopramida, cisaprida e domperidona
Intestinal (diarreia ou constipao intestinal): antibitico de amplo espectro e loperamida e difenoxilato; aumento da ingesto de fibra alimentar.

Observe, no Quadro 2, os medicamentos para o tratamento


da disautonomia gastrintestinal.

Disautonomia geniturinria:
Bexiga neurognica: treinamento para esvaziamento
vesical programado (completo com manobras de compresso abdominal e autossondagem); antibioticoterapia

Quadro 1 Medicamentos para o tratamento da neuropatia


sensorimotora.
Medicamentos
antidepressivos

Dose/dia

Amitriptilina

25 a 150 mg

Duloxetina

60 a 120 mg

Imipramina

25 a 150 mg

Nortriptilina

10 a 150 mg

Venlafaxina

150 a 225 mg

Medicamentos
anticonvulsivantes

Dose/dia

Gabapentina

900 a 1.800 mg

Pregabalina

150 a 600 mg

05/10/2015 06:53:25

Neuropatia Diabtica 135

nas infeces urinrias e na preveno delas, cloridrato


de betanecol em caso de volume residual ps-miccional
significativo (mais de 100 ml)
Disfuno ertil: atualmente, a primeira escolha inclui
os medicamentos do grupo dos inibidores da fosfodiesterase (sildenafila, vardenafila e tadalafila). Utilizam-se
tambm frmacos de uso intracavernoso ou intrauretral
(papaverina, fentolamina e prostaglandinas), prtese peniana e dispositivos a vcuo.
Quadro 2 Medicamentos para o tratamento da disautonomia
gastrintestinal.
Medicamentos

Dose

Modo de utilizao

Metoclopramida 5 a 20 mg

30 min antes das refeies e


noite, ao deitar

Cisaprida

10 a 20 mg

30 min antes das refeies

Domperidona

10 a 20 mg

30 min antes das refeies e


noite, ao deitar

Loperamida

2 mg

Duas vezes/dia

Difenoxilato

2,5 mg

Duas vezes/dia

Quadro 3 Recomendaes e concluses.


Recomendaes e concluses

Grau de
recomendao

Neuropatia diabtica o distrbio


neurolgico demonstrvel
clinicamente ou por mtodos
laboratoriais em pacientes diabticos,
quando excludas outras
causas de neuropatia

O bom controle metablico do


diabetes reduz a frequncia e a
intensidade da leso neurolgica

O acometimento patolgico na
neuropatia diabtica geralmente
amplo no organismo, apresentando-se
de duas formas principais:
polineuropatia sensorimotora
simtrica e neuropatia autonmica
(cardiovascular, respiratria, digestiva e
geniturinria)

Os testes neurolgicos bsicos envolvem a


avaliao de sensibilidade, pesquisa de
reflexos tendinosos e medidas de presso
arterial (deitado e em p) e frequncia
cardaca

O tratamento da neuropatia sensorimotora


e autonmica geralmente
medicamentoso e dirigido aos sintomas e
sinais da doena

A presena de neuropatia autonmica est


associada a aumento significativo de
mortalidade na populao diabtica
acometida

(A) Estudos experimentais e observacionais de melhor consistncia; (B)


Estudos experimentais e observacionais de menor consistncia; (C) Relatos
de casos estudos no controlados; (D) Opinio desprovida de avaliao
crtica, baseada em consenso, estudos fisiolgicos ou modelos animais.

Diretrizes SBD 2015-2016 - CAP 21.indd 135

Referncias bibliogrficas
1. Boulton AJ, Vinik AI, Arezzo JC et al. Diabetic neuropathies: a
statement by the American Diabetes Association. Diabetes Care.
2005; 28:956.
2. American Diabetes Association/American Academy of Neurology. Consensus statement: report and recommendations of the
San Antonio conference on diabetic neuropathy. Diabetes Care.
1988; 11:592.
3. England JD, Gronseth GS, Franklin G et al. Distal symmetric
polyneuropathy: a definition for clinical research: report of
the American Academy of Neurology, the American Association of Electrodiagnostic Medicine, and the American Academy of Physical Medicine and Rehabilitation. Neurology. 2005;
64:199.
4. Greene DA, Feldman EL, Stevens MJ et al. Diabetic neuropathy.
In: Porte D, Sherwin R, Rifkin H, eds. Diabetes mellitus. East
Norwalk: Appleton & Lange, 1995.
5. Greene DA, Sima A, Pfeifer MA et al. Diabetic neuropathy. Annu
Rev Med. 1990; 41:303.
6. Dyck PJ, Kratz KM, Karnes JL et al. The prevalence by staged
severity of various types of diabetic neuropathy, retinopathy, and
nephropathy in a population-based cohort: the Rochester Diabetic Neuropathy Study. Neurology. 1993; 43:2345.
7. Mulder DW, Lambert EH, Bastron JA et al. The neuropathies associated with diabetes mellitus. A clinical and electromyographic study of 103 unselected diabetic patients. Neurology. 1961;
11(4Pt1):275.
8. Partanen J, Niskanen L, Lehtinen J et al. Natural history of peripheral neuropathy in patients with noninsulin-dependent diabetes mellitus. N Engl J Med. 1995; 333:89.
9. Sands ML, Shetterly SM, Franklin GM et al. Incidence of distal symmetric (sensory) neuropathy in NIDDM. Diabetes Care.
1997; 20:322.
10. Young MJ, Boulton AJ, Macleod AF et al. A multicentre study of
the prevalence of diabetic peripheral neuropathy in the United
Kingdom hospital clinic population. Diabetologia. 1993; 36:150.
11. Martin CL, Albers JW, Pop-Busui R et al. Neuropathy and related
findings in the Diabetes Control and Complications Trial/Epidemiology of Diabetes Interventions and Complications study.
Diabetes Care. 2014; 37:31-8.
12. Diabetes Control and Complications Trial. Effect of intensive
diabetes treatment on nerve conduction in the Diabetes Control
and Complications Trial. Ann Neurol. 1995; 38:869.
13. Ang L, Jaiswal M, Martin C et al. Glucose control and diabetic
neuropathy: lessons from recent large clinical trials. Curr Diab
Rep. 2014; 14:528.
14. The Diabetes Control and Complications Research Group. The
effect of intensive diabetes therapy on the development and progression of neuropathy. Ann Intern Med. 1995; 122:561.
15. Brownlee M. Glycation and diabetic complications. Diabetes.
1994; 43:836.
16. Cameron NE, Eaton SE, Cotter MA et al. Vascular factors and
metabolic interactions in the pathogenesis of diabetic neuropathy. Diabetologia. 2001; 44:1973.
17. Dyck PJ, Hansen S, Karnes J et al. Capillary number and percentage closed in human diabetic sural nerve. Proc Natl Acad Sci
EUA. 1985; 82:2513.
18. Feldman EL, Stevens MJ, Thomas PK et al. A practical two-step
quantitative clinical and electrophysiological assessment for the
diagnosis and staging of diabetic neuropathy. Diabetes Care.
1994; 17:1281.
19. Forrest KY-Z, Maser RE, Pambianco G et al. Hypertension as a
risk factor for diabetic neuropathy. A prospective study. Diabetes. 1997; 46:665.

05/10/2015 06:53:25

136 Diretrizes SBD | 2015-2016


20. Johnson PC, Doll SC, Cromey DW. Pathogenesis of diabetic neuropathy. Ann Neurol. 1986; 19:450.
21. Kelkar P, Masood M, Parry GJ. Distinctive pathologic findings
in proximal diabetic neuropathy (diabetic amyotrophy). Neurology. 2000; 55:83.
22. Kilo S, Berghoff M, Hilz M et al. Neural and endothelial control
of the microcirculation in diabetic peripheral neuropathy. Neurology. 2000; 54:1246.
23. King RH. The role of glycation in the pathogenesis of diabetic
polyneuropathy. Mol Pathol. 2001; 54:400.
24. Malik RA. The pathology of human diabetic neuropathy. Diabetes. 1997; 46(suppl 2):S50.
25. Pfutzner A, Forst T, Engelbach M et al. The influence of isolated
small nerve fibre dysfunction on microvascular control in patients with diabetes mellitus. Diabet Med. 2001; 18:489.
26. Aronson D, Weinrauch LA, DElia JA et al. Circadian patterns of
heart rate variability, fibrinolytic activity, and hemostatic factors
in type I diabetes mellitus with cardiac autonomic neuropathy.
Am J Cardiol. 1999; 84:449.
27. Bannister R, Mathias CJ. Management of postural hypotension.
In: Bannister R, ed. Autonomic failure. A textbook of clinical disorders of the autonomic nervous system. 2nd ed. Oxford: Oxford
University Press, 1988. pp. 569.
28. Brown JS, Wessells H, Chancellor MB et al. Urologic complications of diabetes. Diabetes Care. 2005; 28:177.
29. Cohen JA, Estacio RO, Lundgren RA et al. Diabetic autonomic
neuropathy is associated with an increased incidence of strokes.
Auton Neurosci. 2003; 108:73.
30. Deanfield JE, Daggett PR, Harrison MJG. The role of autonomic
neuropathy in diabetic foot ulceration. J Neurol Sci. 1980; 47:203.
31. Dyck PJ, Kratz KM, Lehman KA. The Rochester Diabetic Neuropathy Study: design, criteria for types of neuropathy, selection bias,
and reproducibility of neuropathic tests. Neurology. 1991; 41:799.
32. Feldman M, Schiller LR. Disorders of gastrintestinal motility associated with diabetes mellitus. Ann Intern Med. 1983; 98:378.
33. Forsen A, Kangro M, Sterner G et al. A 14-year prospective study
of autonomic nerve function in type 1 diabetic patients: association with nephropathy. Diabet Med. 2004; 21:852.
34. Franse LV, Valk GD, Dekker JH et al. Numbness of the feet is
a poor indicator for polyneuropathy in type 2 diabetic patients.
Diabet Med. 2000; 17:105.
35. Jones KL, Russo A, Berry MK et al. A longitudinal study of gastric emptying and upper gastrintestinal symptoms in patients
with diabetes mellitus. Am J Med. 2002; 113:449.
36. Langer A, Freeman MR, Josse RG et al. Metaiodobenzylguanidine imaging in diabetes mellitus: assessment of cardiac sympathetic denervation and its relation to autonomic dysfunction and
silent myocardial ischemia. J Am Coll Cardiol. 1995; 25:610.
37. Malik RA, Veves A, Walker D et al. Sural nerve fibre pathology
in diabetic patients with mild neuropathy: relationship to pain,
quantitative sensory testing and peripheral nerve electrophysiology. Acta Neuropathol (Berl). 2001; 101:367.
38. Maser RE, Mitchell BD, Vinik AI et al. The association between
cardiovascular autonomic neuropathy and mortality in individuals with diabetes: a meta-analysis. Diabetes Care. 2003; 26:1895.
39. Meyer C, Grossmann R, Mitrakou A et al. Effects of autonomic
neuropathy on counterregulation and awareness of hypoglycemia in type 1 diabetic patients. Diabetes Care. 1998; 21:1960.

Diretrizes SBD 2015-2016 - CAP 21.indd 136

40. Suarez GA, Clark VM, Norell JE et al. Sudden cardiac death in
diabetes mellitus: risk factors in the Rochester diabetic neuropathy study. J Neurol Neurosurg Psychiatry. 2005; 76:240.
41. Tesfaye S, Chaturvedi N, Eaton SE et al. EURODIAB Prospective
Complications Study Group. Vascular risk factors and diabetic
neuropathy. N Engl J Med. 2005; 352:341.
42. Valensi P, Sachs RN, Harfouche B et al. Predictive value of cardiac autonomic neuropathy in diabetic patients with or without
silent myocardial ischemia. Diabetes Care. 2001; 24:339.
43. Veglio M, Borra M, Stevens LK et al. The relation between QTc interval prolongation and diabetic complications. The EURODIAB
IDDM Complication Study Group. Diabetologia. 1999; 42:68.
44. Wieling W, Borst C, van Dongen Torman MA et al. Relationship
between impaired parasympathetic and sympathetic cardiovascular control in diabetes mellitus. Diabetologia. 1983; 24:422.
45. Ziegler D, Laux G, Dannehl K et al. Assessment of cardiovascular
autonomic function: age-related normal ranges and reproducibility
of spectral analysis, vector analysis, and standard tests of heart rate
variation and blood pressure responses. Diabet Med. 1992; 9:166.
46. Ziegler D. Cardiovascular autonomic neuropathy: clinical manifestations and measurement. Diabetes Reviews. 1999; 7:342.
47. Vincent AM, Russell JW, Low P et al. Oxidative stress in the
pathogenesis of diabetic neuropathy. Endocr Rev. 2004; 25:612.
48. Javed S, Petropoulos IN, Alam U et al. Treatment of painful diabetic neuropathy. Ther Adv Chronic Dis. 2015; 6(1):15-28.
49. Ziegler D, Ametov A, Barinov A et al. Oral treatment with alphalipoic acid improves symptomatic diabetic polyneuropathy: the
SIDNEY 2 trial. Diab Care. 2006; 29:2365-70.
50. Thornalley PJ, et al. High prevalence of low plasma thiamine
concentration in diabetes linked to a marker of vascular disease.
Diabetologia. 2007; 50(10):2164-70.
51. Brownlee M. The pathobiology of diabetic complications: a unifying mechanism. Diabetes. 2005; 54(6):1615-25.
52. Stracke H, et al. Benfotiamine in diabetic polyneuropathy (BENDIP): results of a randomised, double blind, placebo-controlled
clinical study. Exp Clin Endocrinol Diabetes. 2008; 116:600-5.
53. Feldman EL, Stevens MJ, Greene DA. Treatment of diabetic
neuropathy. In: Mazzaferri EL, Bar RS, Kreisberg RA, eds. Advances in endocrinology and metabolism. Chicago: Mosby Year
Book; 1994. p. 393.
54. Max MB, Lynch SA, Muir J et al. Effects of desipramine, amitriptyline, and fluoxetine on pain in diabetic neuropathy. N Engl J
Med., 1992; 326:1250.
55. Greene DA, Feldman EL, Stevens MJ. Neuropathy in the diabetic foot: new concepts in etiology and treatment. In: Levin
M, ONeal L, eds. The diabetic foot. Chicago: Mosby Year Book,
1993; p. 135.
56. Horowitz M, Harding PE, Chatterton BE et al. Acute and chronic
effects of domperidone on gastric emptying in diabetic autonomic neuropathy. Dig Dis Sci. 1985; 30:1.
57. Horowitz M, Maddox A, Harding PE et al. Effect of cisapride on
gastric and esophageal emptying in insulin-dependent diabetes
mellitus. Gastroenterology. 1987; 92:1899.
58. Mason L, Moore A, Derry S et al. Systematic review of topical capsaicina for the treatment of chronic pain. BMJ. 2004; 328:1991.
59. Valdovinos MA, Camilleri M, Zimmermann BR. Chronic diarrhea in diabetes mellitus: mechanisms and an approach to diagnosis and treatment. Mayo Clin Proc. 1993; 68:691.

05/10/2015 06:53:25

Diagnstico Precoce do
P Diabtico
Introduo
O p diabtico conceituado no glossrio do Guidance
(Recomendaes) 2015, do IWGDF (International Working
Group on the Diabetic Foot ou Grupo de Trabalho Internacional sobre P Diabtico), como infeco, ulcerao e/ou
destruio de tecidos moles associadas a alteraes neurolgicas e vrios graus de doena arterial perifrica (DAP)
nos membros inferiores.1 Os dados epidemiolgicos so
variados e denotam a diversidade regional dos desfechos
dessa complicao: em pases desenvolvidos, a DAP o fator
complicador mais frequente, enquanto nos pases em desenvolvimento, a infeco , ainda, uma complicao comum
das lceras dos ps em pacientes diabticos (UPD), resultando em amputaes.1,2 A frequncia e gravidade tambm
deve-se a diferenas socioeconmicas, tipo de calados usados e cuidados, que no so padronizados em escala nacional
nesses pases.1,2
A incidncia anual de lceras em pacientes com diabetes mellitus (DM) situa-se entre 2 e 4% e a prevalncia, 4 a
10%; estimando-se serem mais altas em pases com baixa
situao socioeconmica.3 A incidncia cumulativa ao longo da vida de UPD de 25%, e essas leses precedem 85%
das amputaes.4,5 Apenas das UPD cicatrizaro6,7 e at
28% resultaro em algum tipo de amputao.8 Anualmente,
um milho de pessoas com DM perde uma parte da perna
em todo o mundo, traduzindo-se em trs amputaes por
minuto.3
O p diabtico a causa mais comum de internaes prolongadas, compreende 25% das admisses hospitalares nos
Estados Unidos e implica custos elevados: 28 mil dlares por
admisso por ulcerao, enquanto na Sucia 18 mil dlares
(sem amputao) e 34 mil dlares (com amputao).9,10
Sabe-se que uma grande proporo dos leitos hospitalares em emergncias e enfermarias nos pases em desenvolvimento ocupada por UPD.1,2 Alm disso, dados so escassos
ou inexistem, sistemas de sade no so organizados, conhecimento dos profissionais de sade com relao a p diabtico crtico e resoluo muito baixa, sobretudo quanto
revascularizao.2,11 No Brasil, so estimadas, em um modelo hipottico para uma populao de 7,12 milhes de pessoas
com DM2, 484.500 lceras, 169.600 admisses hospitalares e
80.900 amputaes, das quais para 21.700 o desfecho seria a
morte.12

Diretrizes SBD 2015-2016 - CAP 22.indd 137

Fisiopatognese e vias da ulcerao


Neuropatia, limitao da mobilidade articular
e presso plantar
Embora os dados variem nas diferentes regies do mundo, as
vias para a ulcerao so semelhantes: a UPD resulta de dois ou
mais fatores de risco, atuando em concerto com a polineuropatia diabtica (PND) no papel permissivo principal.1 A PND est
presente em 50% dos pacientes com DM2 acima de 60 anos13 e
afeta 30% dos pacientes em atendimento clnico hospitalar e de
20 a 25% entre os pacientes na ateno primria.14
A insensibilidade resulta do agravo s fibras nervosas finas
(tipos C e delta) pela exposio prolongada hiperglicemia associada a fatores cardiovasculares. H comprometimento das
fibras grossas (beta, A alfa), com perda da propriocepo, do
movimento articular e do feedback da percepo de posio
pelos receptores nas pernas e nos ps e, em estgios avanados, fraqueza muscular e alteraes estruturais dos ps pelo
comprometimento motor.15 Clinicamente, observam-se as
deformidades neuropticas: dedos em garra ou em martelo,
proeminncias de metatarsos e acentuao do arco.
Traumas (p. ex., calados inapropriados, caminhar descalo, objetos dentro dos sapatos) precipitam a UPD e a insensibilidade associada limitao de mobilidade articular (LMA)
resultam em alteraes biomecnicas com aumento da presso
em reas plantares (metatarsos) e dorsais (dedos). A presso
plantar (PP) anormal um fator importante para ulcerao
somente se houver insensibilidade. A PP est relacionada com
a LMA, sobretudo nas articulaes do tornozelo, subtalar e
metatarsofalangianas, por comprometimento do colgeno
tipo IV e deposio de produtos finais de glicao avanada
(AGE), resultando em hiperqueratose e calosidades, que so
leses pr-ulcerativas.16,17 A anidrose (pele seca), resultante
da disautonomia perifrica, e os calos favorecem o aumento
da carga, e ocorre hemorragia subcutnea e ulcerao pelo
trauma repetitivo.1 A Figura 1 mostra reas de PP anormal no
calcneo, acentuao do arco, proeminncia de metatarsos,
arco desabado (Charcot), regio dorsal dos dedos, valgismo
(que no especfico do DM) e, por fim, as regies plantares
mais vulnerveis ulcerao, no antep.1,18 Verifique, nas Figuras 1 e 2, as deformidades e reas de maior presso (dorsal
e plantar).1,18

05/10/2015 07:06:27

138 Diretrizes SBD | 2015-2016

Figura 1 Ilustrao do IWGDF (1999), com as reas de presso anormal, que favorecem UPD.1,18

No recente estudo prospectivo, observacional, Eurodiale


(The European Study Group on Diabetes and Lower Extremity Project ou Grupo de Estudo Europeu em Diabetes e
Projeto de Membros Inferiores),21 com 14 centros europeus
(10 pases) e 1.232 pacientes diabticos consecutivos (20032004), cujo manejo seguiu as Diretrizes Prticas do IWGDF,1
observou-se que as UPD cicatrizaram em 77% (com ou sem
amputao), 5% sofreram amputao maior (acima do tornozelo) e 18% amputao menor (55% nos dedos, 34% em
raio e 11% no mdio p), com bito em 6%. As caractersticas dos participantes eram: sexo masculino (65%), DM de
longa durao (70% > 10 anos), condio de sade comprometida (insuficincia renal), mau controle glicmico (49%
com HbA1c > 8,4%) e idade mdia de 65 anos. Com relao
s UPD, o estudo constatou novos padres na causa: 79%
apresentavam PND, 50% tinham DAP, isquemia crtica em
12% (definida como o ITB [ndice tornozelo-brao] < 0,5) e
apenas 22% apresentaram a UPD clssica da regio plantar
no antep ou mediop. A infeco estava presente em 58% e
31% tinham DAP nas UPD maiores e mais profundas e comorbidades, o que provavelmente contribuiu para que 40%
evolussem para amputao, enquanto 85% das UPD sem
DAP ou infeco cicatrizaram.21 A Figura 3 contm o algoritmo das vias para a ulcerao.22

Leso tecidual da ulcerao e p de


Charcot | Papel da neuropatia no controle
neurovascular e inflamao
B

Figura 2 Casos reais com deformidades neuropticas (dedos em


garra) e pele seca em calcneo e hiperqueratose; hipotrofia grave
de msculos intersseos, hiperextenso de tendes e dedos em
garra. A. Cortesia: Pedrosa HC. Centro de P Diabtico, Unidade de
Endocrinologia, Polo de Pesquisa SES-DF. B. PND motora hipotrofia de pequenos msculos. Cortesia: IWGDF.

Doena arterial perifrica


A doena arterial perifrica predominantemente infrainguinal e afeta 50% dos pacientes com DM, cinco a dez vezes mais
frequente do que em no diabticos; 25 a 50% podem ser assintomticos ou apresentar sintomas atpicos, 30% tm claudicao intermitente e apenas 20% manifestam formas mais graves,
evoluindo para doena arterial obstrutiva perifrica (DAOP) e
isquemia crtica.19,20

Diretrizes SBD 2015-2016 - CAP 22.indd 138

Estudos apontam para uma resposta orquestrada pela denervao com implicao no controle neurovascular, resultando em
alterao do fluxo capilar, oxigenao, filtrao de fluidos e resposta inflamatria, o que torna os pacientes diabticos mais suscetveis a leso tecidual, infeco, inclusive desenvolvimento de
neurosteoartropatia de Charcot. Essa cadeia de resposta denota
a ao da PND em microvasos com liberao de neuropeptdios
vasodilatadores (substncia P, calcitonin gene-related peptide
CGRP, peptdio relacionado com o gene da calcitonina e fator
de necrose tumoral alfa [TNF-a]).23
O significado fisiopatolgico dos produtos finais de glicao avanada, advanced glycation and productos (AGE) emergiu em decorrncia das complicaes crnicas do DM na dcada de 1980 e evidncias acumulam-se sobre a sua funo
quanto a inflamao, aterosclerose e distrbios neurais degenerativos, com vrios mecanismos propostos: (1) acmulo de
AGE na matriz extracelular, causando cruzamentos anormais
e diminuio na elasticidade dos vasos; (2) ligao a receptores

05/10/2015 07:06:27

Diagnstico Precoce do P Diabtico 139


Diabetes mellitus

Depresso
Instabilidade
postural

Perda da
sensibilidade
protetora

Doena arterial
perifrica

Neuropatia
autonmica

Polineuropatia sensitivo-motora

Deformidades
Atrofia
muscular

Pele seca,
diminuio da
sudorese,
veias dilatadas

Aumento dos
pontos de
presso no p

Calosidades

P em risco

Ulcerao

Fatores externos
(caminhar
descalo, sapatos
inadequados)

Figura 3 Vias para a ulcerao. O p em risco resulta de um concerto entre a PND sensitivo-motora (deformidades, presso plantar) e ND
autonmica (pele seca), e complica-se pela DAP.22 Adaptado de Pedrosa HC, Vilar L, Boulton AJM. Neuropatias e p diabtico. 1a ed. Rio
de Janeiro: AC Farmacutica; 2014.

(RAGE) em diferentes tipos celulares e ativao de vias como a


do fator nuclear kappa-beta (NF-kb) e modulao da expresso gnica em clulas endoteliais, msculo liso, macrfagos,
assim como (3) a formao de AGE intracelulares, que comprometem o xido ntrico e fatores de crescimento.24,25
Postula-se que uma subpopulao de pacientes com DM
teria maior expresso de mecanismos inflamatrios e hormonais envolvendo os sistemas (receptor activator for nuclear
factor kappa ligand/osteoprotegerin [RANK/OPG], ativador
do receptor do ligante do fator nuclear kappa/osteoprotegerina), que implicam calcificao da mdia (um dos atributos
resultantes da PND e existentes no p de Charcot), aumento
da atividade osteoclstica e maior fragilidade ssea, os quais
so precedidos por traumas leves, UPD prvia, infeco ou cirurgia, cuja base comum a todos a inflamao. A interveno
teraputica via AGE e RAGE abre amplas possibilidades de
preveno contra complicaes diabticas em extremidades
por meio de antioxidantes e antiagregantes plaquetrios, como
tambm na via RANKL/OPG, notadamente para p de Charcot,
com o uso de anticorpos monoclonais (denosumabe).26,27

Avaliao clnica
Rastreamento | Identificao do p em risco de
ulcerao
A avaliao requer duas medidas extremamente simples: histria clnica e exame dos ps, que se inicia pela remoo dos cal-

Diretrizes SBD 2015-2016 - CAP 22.indd 139

ados e das meias, que tambm devem ser avaliados, mas ainda
no constitui uma rotina em vrios locais de trabalho em todo
o mundo.1
Dados de estudo multicntrico do Brasil verificaram apenas
58% (1.300) dos pacientes com diabetes tipo 2 atendidos em
centros especializados e no especializados, que tiveram registro do exame dos ps efetuado no ano anterior, com taxas tambm crticas de registro referentes a fundoscopia (46,9%; 1.047),
microalbuminria (38,9%; 869) e tabagismo (54,5%; 1.216).28
Uma pesquisa on-line no site da Sociedade Brasileira de Diabetes (SBD), em 2005, constatou que 65% entre 311 internautas nunca haviam tido os ps examinados (Dissat C e Pedrosa
HC, pelo Departamento de P Diabtico da SBD, Conferncia
Global para o Dia Mundial, Congresso da SBD, Salvador, 2005;
comunicao pessoal).
Os principais fatores de risco, com dados comprovados por
meio de estudos prospectivos, so mostrados no Quadro 1.29
Alm disso, ressaltam-se a durao do DM (> 10 anos) e o
mau controle glicmico,1 fatores psicossociais correlacionados
com a depresso que favorece instabilidade postural e quedas, desmotivao e baixa aderncia ao autocuidado diante de
UPD e, consequentemente, poder de evit-la.30
Ao exame fsico, outras condies dermatolgicas, como
pele seca, rachaduras, unhas hipotrficas ou encravadas, macerao interdigital por micose, calosidades e ausncia de pelos e alterao da colorao e temperatura (indicando isquemia), constituem condies pr-ulcerativas decorrentes de
PND e DAP.1,29

05/10/2015 07:06:28

140 Diretrizes SBD | 2015-2016


Quadro 1 Fatores de risco para ulcerao dos ps.*
Principais

Polineuropatia perifrica (PND)


Deformidades (PND motora, biodinmica,
limitao da mobilidade articular)
Trauma
Doena arterial perifrica (DAP)
Histrico de lcera; histrico de amputao

Outros

Nefropatia, retinopatia
Condio socioeconmica
Morar sozinho, inacessibilidade ao sistema de
sade

Bus S et al. On behalf of IWGDF Guidance on the prevention of foot ulcers in


at-risk patients with diabetes, 2015. Disponvel em: <http://www.iwgdf.org>.
*Os fatores de risco principais foram identificados a partir de estudos
prospectivos. A trade de ulcerao constituda por PND, deformidades e trauma
(63%), e isquemia (35%) o fator associado amputao, segundo Reiber et al.31

Ferramentas para avaliao neurolgica e


presso plantar
Estesimetro ou monofilamento de nilon
O monofilamento de nilon (Semmes-Weinstein), cor laranja,
como kit SORRI de 10 g, detecta alterao de fibra grossa (beta
e A alfa) relacionada com a sensibilidade protetora plantar.32 Em
vrios relatos, incluindo estudos prospectivos, observaram-se
sensibilidade de 66 a 91%, especificidade de 34 a 86% e valor
preditivo negativo de 94 a 95%, o que coloca o monofilamento
como o instrumento recomendado para rastrear PND e risco de
ulcerao neuroptica.3335
A SBD adota a recomendao de Boulton et al., pela Fora
de Trabalho ADA (American Diabetes Association ou Associao Americana de Diabetes) e AACE (American Association
of Clinical Endocrinologists ou Associao Americana de Endocrinologistas Clnicos), para testar quatro reas plantares:
hlux (regio plantar da falange distal), 1a, 3a e 5a cabeas de
metatarsos,32,35 embora o IWGDF mantenha apenas trs locais
recomendados (hlux, 1a e 5a cabeas de metatarsos).1 H uma
grande diversidade de modelos disponveis, confeccionados
sem preciso na calibrao, implicando teste no acurado.36 O
uso do monofilamento no deve ultrapassar 10 pacientes ao dia
e um repouso de 24 h requerido para alcanar as 500 h de
meia-vida do instrumento em boas condies.36
A Figura 4 exemplifica os locais de teste (A) e a aplicao
do monofilamento (B e C); a Figura 5 mostra o monofilamento brasileiro, na cor laranja 10 g, da SORRI-Bauru, SP (a
instituio confecciona o instrumento sem fins lucrativos).

Diapaso 128 Hz, martelo, pino ou palito


O diapaso 128 Hz e o martelo testam fibras grossas sensitivas
(beta) e motoras (A alfa), para avaliao de sensibilidade vibratria e reflexos aquileus, respectivamente; enquanto o pino
(neurotip) ou palito descartvel avalia fibras finas sensitivas
(tipo C), para testar a sensibilidade dolorosa, ou o pinprick,
que a percepo da distino de uma ponta romba e outra
pontiaguda.13,34 Todos esses testes foram validados em estudos
prospectivos e podem ser usados para o diagnstico de PND,
em formato de escores,13,31,37 ou para o diagnstico da perda
de sensibilidade protetora (PSP).31,34

Diretrizes SBD 2015-2016 - CAP 22.indd 140

Figura 4 A. reas de testes. B e C. Aplicao do monofilamento de


10 g. Deve-se solicitar ao paciente para dizer sim durante o toque
na rea de teste, com fora apenas suficiente para curvar o monofilamento em 2 s; uma simulao de aplicao e outra aplicao
concreta nas mesmas reas confirmam a identificao pelo paciente do local testado se duas respostas esto corretas; qualquer rea
insensvel indica sensibilidade protetora alterada.1,35 Detalhamento
do uso do monofilamento est disponvel na referncia 1.

Figura 5 Monofilamento brasileiro. O kit SORRI, com dois monofilamentos exclusivos para o exame de indivduos com DM, tem
baixo custo e boa acurcia (<http://www.sorribauru.com.br>).

Bioestesimetro e neuroestesimetro
Ambos so instrumentos que quantificam o limiar da sensibilidade vibratria (LSV) mediante aplicao de uma haste de
borracha dura na face dorsal do hlux, registrando-se em volts
(V) a leitura da percepo do estmulo vibratrio (0 a 50, no

05/10/2015 07:06:28

Diagnstico Precoce do P Diabtico 141

biostesimetro; 0 a 100, no neuroestesimetro). A mdia de trs


leituras indica o LSV, cujo ponto de corte de risco de ulcerao
25 V (sensibilidade 83%, especificidade 63%; relao de probabilidade positiva [likelihood ratio] 2,2; intervalo de confiana
IC 95%, 1,8 a 2,5; e negativa 0,27; IC 95%, 0,14 a 0,48]).13,38
As recomendaes da Associao Americana de Diabetes
(ADA) e da Associao Americana de Endocrinologistas Clnicos (AACE),35 que so endossadas pela SBD31 e pela Associao Latino-Americana de Diabetes (ALAD, Guias do Grupo
Latino-Americano de Estudos sobre P Diabtico GLEPED),
para o rastreamento de PND e risco neuroptico de ulcerao39
so mostradas no Quadro 2. O biostestimetro ou neuroestesimetro que avalia as fibras grossas beta, tambm pode ser usado,
se disponvel, como outro teste associado ao monofilamento.35

Presso plantar
A presso plantar (PP) pode anteceder os achados clnicos de
PND, e a sua valorizao como fator de risco para ulcerao tem
sido demonstrada em estudos prospectivos e transversais.16,17
H uma variedade de mtodos que avaliam a PP, desde simples
plantgrafos sem escala de fora (Harris Mat)40,41 ou com escala de fora (Podotrack/PressureStat), validado com relao ao
pedobargrafo,42 que, como as plataformas e palmilhas dotadas
de sensores, captam, por meio da pisada, a presso anormal. O
ponto de corte, indicativo de PP elevada, varia segundo os sistemas empregados.4 A PP torna-se mais relevante como risco
de ulcerao quando associada PND, inclusive para nortear a
confeco e a distribuio de palmilhas.4,42,43

Ferramentas para avaliar a doena arterial


perifrica
A palpao dos pulsos deve ser sempre efetuada, porm h
grande variao intra e interobservadores, mesmo em mos
experientes; portanto, recomenda-se um teste mais objetivo.44
A avaliao com um Doppler manual (transdutor 8 a 10 MHz)
e o achado de um ndice tornozelo-brao (ITB) < 0,9 til
para detectar DAP em pacientes assintomticos, sobretudo
sem PND, uma vez que a insensibilidade mascara os sintomas
de isquemia. A calcificao da artria mdia (Mockenberg),
edema, PND e infeco associam-se frequentemente DAP e
podem, tambm, comprometer a performance da palpao e
at de testes diagnsticos.
Quadro 2 Diagnstico de perda da sensibilidade protetora plantar.*
Monofilamento 10 g e um ou mais testes alterados:
Vibrao (diapaso 128 Hz)
Dor (pino ou palito)
Reflexos (martelo)
Diagnstico: perda da sensibilidade protetora (PSP)/loss of
protective sensation (LOPS)
ADA-AACE Task Force. Diabetes Care. 2008; 31:1679-85.
Diretrizes SBD 2011-2014, 2015. Disponvel em: <http://www.diabetes.
org.br>. *Diagnstico da perda de sensibilidade protetora: com o teste de
monofilamento 10 g e um ou mais testes neurolgicos alterados (diapaso
128 Hz, pino ou palito, martelo, que avaliam as sensibilidades vibratria e
dolorosa e reflexos aquileus, respectivamente), faz-se simultaneamente
um rastreamento de PND e identificao de risco neuroptico de ulcerao
neuroptica.31,35,38

Diretrizes SBD 2015-2016 - CAP 22.indd 141

O ITB constitui um mtodo fcil, objetivo e reproduzvel


para o rastreamento da DAP. Considerando-se que 50% dos
pacientes com DM tm DAP,1,20 o custo do instrumento irrisrio perante o impacto de uma UPD com isquemia isolada
ou associada PND (entre R$ 900,00 e 2.000, preo de 2015).
O ITB a relao da maior presso sistlica das artrias distais
de ambos os ps (artrias tibiais posteriores e anteriores ou pediosa) pelo maior valor das artrias braquiais, aferidas bilateralmente.19,20 Os pontos de corte de ITB normal so 0,9 a 1,30,
segundo o IWGDF, cuja recente reviso sistemtica verificou
sensibilidade e especificidade mdias para o ponto de corte
< 0,9 de 63% (29 a 100) e 93% (58 a 97), respectivamente. Esse
nvel reduz em 45% a probabilidade de DAP, porm, diante de
PND (que eleva o ITB pela calcificao da mdia), o ITB < 0,9
aponta para maior probabilidade de DAP do que um resultado
dentro da variao normal.20 O relatrio do American College
of Cardiology Foundation/American Heart Association Task
Force on Practice Guidelines adota valores de ITB > 1,40 como
no compressvel; 1,0 a 1,40 como normal; limtrofe entre 0,91
e 0,99 e anormal at 0,90.45 A Figura 6 mostra a tomada do
ITB, como apresentada no Guia do Exame do P, lanado pela
ADA e divulgado no Brasil pela SBD, com permisso.46
Outros mtodos diagnsticos no invasivos incluem o ndice digital-brao (IDB), que a relao da presso sistlica do
hlux com a da artria braquial: o ponto de corte 0,75 tem
menor limitao referente calcificao da mdia para descartar DAP associada PND, assim como o registro trifsico de
onda de pulso pedal descarta DAP; a medida da presso parcial transcutnea de oxignio (TcPO2) > 30 mmHg indica bom
prognstico de cicatrizao, e o mtodo acurado, no entanto,
o elevado custo e a necessidade de pessoal tcnico especializado para o seu manuseio constituem o maior impedimento; a
oximetria de pulso surge como uma ferramenta de fcil aplicao e superior ao ITB, porm ainda requer consolidao para
recomendao formal.
O IWGDF, no entanto, diante da insuficiente evidncia
com as novas metodologias empregadas (ver reviso sistemtica da ref. 20), no recomenda um nico teste para a deteco
de DAP em pessoas com DM, apontando para a necessidade
premente de padronizao da investigao.20 Assim, as recomendaes do Guidance 2015 do IWGDF, sobre diagnstico
e prognstico de DAP, so mostradas no Quadro 3 (para o
tratamento, o leitor pode referir-se referncia 20, disponvel
em <http://www.iwgdf.org>). O sistema GRADE (Grading of
Recommendations Assessment, Development and Evaluation;
Graduao para Manuseio, Desenvolvimento e Avaliao de
Recomendaes) determina a intensidade da recomendao
como forte ou fraca, com base na qualidade, equilbrio entre benefcios e danos, valores e preferncias dos pacientes e
custos (utilizao de recursos); e a qualidade da evidncia em
alta, moderada ou baixa a partir do risco de vis nos estudos,
dimenso do efeito, opinio de experts. As explicaes detalhadas para o racional de cada avaliao e graduao esto
contempladas nas referncias 1 e 20.

Organizao de servios
Os itens indispensveis para o alcance da preveno das
UPD so: (1) educao para pessoas com DM e seus cuidadores, equipes dos hospitais e centros especializados (nveis

05/10/2015 07:06:28

142 Diretrizes SBD | 2015-2016

Figura 6 Determinao do ndice tornozelo-brao (ITB): com um


manguito de presso, aferem-se as presses sistlicas bilateralmente das artrias braquias e das artrias do tornozelo (pediosas
ou tibiais anteriores e posteriores). A presso sistlica mxima do
tornozelo dividida pela presso sistlica do brao. O resultado do
ITB de 0,9 a 1,30 normal e afasta DAP.1,19,20,46

tercirio e secundrio) e na ateno bsica (nvel primrio);


(2) sistema para deteco dos indivduos em risco de ulcerao, com exame anual; (3) intervenes para reduzir o
risco de UPD, como cuidados poditricos e uso de calados
apropriados; (4) tratamento efetivo e imediato para qualquer
complicao nos ps; (5) auditoria de todos os aspectos do
servio para identificar e assegurar que as prticas de cuidados locais sejam efetuadas segundo padres aceitveis (de
evidncias), e (6) estruturao do servio com o objetivo de
alcanar as necessidades do paciente para um cuidado crnico, em vez de buscar apenas a interveno de problemas
agudos (de urgncia).1
O treinamento das categorias de profissionais de sade, inclusive de mdicos, crucial para a aplicao dessas tcnicas
de rastreamento e diagnstico de PND e DAP, visando identificao de risco de ulcerao que deve ser aplicada aos 60%
dos pacientes estimados ainda sem complicaes.1,11,47 Anlises da Sucia mostram que a preveno intensiva (educao
do paciente, uso de calados adequados e acesso a cuidados
regulares pela equipe multiprofissional) destinada a pacientes
com risco elevado de ulcerao efetiva se a incidncia de lcera e amputao for reduzida em 25%.10
O IWGDF recomenda a implantao de equipes na comunidade, de ambulatrios ligados a hospitais ou centros especializados, de modo a estabelecer-se, gradualmente, uma rede
integrada para atendimento aos portadores de DM com graus
variados de problemas nos ps, preferencialmente conduzida
por clnicos gerais e endocrinologistas ou diabetologistas e enfermeiros com insero de outros profissionais e especialistas
segundo o nvel de complexidade do atendimento proposto
(Quadro 4).1,18,48

Quadro 3 Doena arterial perifrica | Recomendaes para diagnstico e prognstico sistema GRADE.1,20
Diagnstico
Examine o paciente anualmente para verificar DAP, o que envolve histria clnica e palpao dos
pulsos distais

Grau de recomendao e
qualidade de evidncia
Forte | Baixa

Avalie DAP na presena de lcera nas extremidades. Determine as ondas do fluxo arterial com
Doppler manual; afira as presses sistlicas do tornozelo (tibiais anteriores e posteriores) e brao
para determinar o ITB

Forte | Baixa

Realize testes no invasivos para excluir DAP. Nenhum deles considerado timo, porm o ITB < 0,9
til para a sua deteco. ITB 0,9 a 1,3, ndice digital-brao (IDB) 0,75; e 0,9 a 1,3 e fluxo trifsico das
artrias pedais ao Doppler excluem DAP

Forte | Baixa

Prognstico
Sintomas ou sinais de DAP predizem cicatrizao. O potencial de cicatrizao pode ser verificado com
um dos seguintes testes: com 25% de possibilidade; presso de perfuso da pele > 40 mmHg; IDB
30 mmHg ou presso transcutnea de O2 (TcPO2, PtCO2) 30 mmHg

Forte | Moderada

Considerar exames de imagem (angiotomografia e arteriografia) e revascularizao diante de presso


digital < 30 mmHg ou TcPO2 (PtCO2) < 25 mmHg

Forte | Baixa

Considerar exames de imagem (angiotomografia e arteriografia) em todos os pacientes que no


apresentem evoluo positiva da ulcerao aps 6 semanas de manuseio adequado

Forte | Baixa

Microangioapatia diabtica no deveria ser considerada a causa de m cicatrizao diante de


ulcerao

Forte | Baixa

lcera sem cicatrizao e presso do tornozelo < 50 mmHg ou ITB < 0,5 requer exame de imagem e
revascularizao urgentes

Forte | Moderada

Diretrizes SBD 2015-2016 - CAP 22.indd 142

05/10/2015 07:06:28

Diagnstico Precoce do P Diabtico 143


Quadro 4 Nveis de abordagem ao p diabtico, para a organizao de servios de acordo com o nvel de ateno sade em
todos os pases.1
Ateno bsica (nvel 1, primrio)

Mdico generalista e enfermeiro, podiatra* (se disponvel)

Mdia complexidade (nvel 2, secundrio)

Mdico generalista/endocrinologista, enfermeiro, podiatra,* cirurgio (geral,


ortopedista), cirurgio vascular, intervencionista endovascular, em colaborao com
ortesista e protesista, especialista em calados

Alta complexidade (nvel 3, tercirio)

Como em 2; centro clnico especializado em p diabtico, os vrios especialistas


atuando em equipe interdisciplinar e desempenhando papel de centro de referncia

*Em pases onde no h disponibilidade de podiatras, especialistas em ps com formao superior, a enfermagem quem conduz os cuidados bsicos
aps capacitao. Na Amrica Latina, apenas pases como Cuba, Uruguai e Argentina dispem de curso de podologia em nvel superior.1,18,39

O xito dos esforos para preveno e tratamento das complicaes das UPD advm de uma organizao bem estruturada sob a perspectiva holstica com integrao das vrias disciplinas profissionais, com a aplicao de recomendaes com
base em evidncias, como o Guidance 2015 do IWGDF.1,29
A experincia do Distrito Federal, iniciada em 1992 e intitulada Projeto Salvando o P Diabtico, disseminou-se para
vrias regies do pas, com treinamentos formais, at 2001,
mediante workshops patrocinados pelo Ministrio da Sade
(MS) e apoiados pela SBD. O modelo ratifica a atuao em
equipe multiprofissional, o que rendeu uma reduo nas amputaes em torno de 77% no perodo de 2000 a 2004, no hospital de referncia.11
No entanto, embora vrios ambulatrios de p diabtico
tenham sido implementados no Brasil aps a capacitao sob
a chancela do MS e apoio da SBD,7,11,49 desde 2003 o apoio
oficial do MS foi descontinuado, desarticulando a formao de
uma rede, e, at os dias atuais, no foi, ainda, implantada uma
linha de cuidado para aplicao em todo o pas.12 Por meio do
programa Step by Step, do IWGDF-IDF (SbS, Passo a Passo),
que se inspirou no Projeto Salvando o P Diabtico do Brasil,
a SBD engajou-se em conjunto com a ALAD e o IWGDF-IDF
ao SbS, para capacitar lderes nacionais e multiplicar estratgias a fim de reduzir lceras e amputaes pela implantao e
padronizao de cuidados e preveno com base nas Diretrizes Prticas do IWGDF.48,50,51 Uma ferramenta importante
efetuar, aps o rastreamento, a classificao do risco detectado. A classificao norteia as linhas bsicas de cuidados a se-

rem seguidos e auxilia a organizar em que nvel de assistncia


o paciente deve ser registrado e acompanhado. A classificao
do risco do IWGDF foi validada em 2001,29,51,52 e alteraes
foram efetuadas para o seguimento com base na pesquisa de
PSP e DAP (Quadro 5).35,46 A classificao foi adotada pela
SBD e ALAD e consta das fichas clnicas do Programa SbS no
Brasil.32,39,46,51
O IWGDF elaborou cinco documentos com base em
evidncias cientficas,1 envolvendo os seguintes tpicos: (1)
Prevention of foot ulcers in at-risk patients with diabetes (Preveno de lceras em ps de pacientes diabticos em risco);
(2) Footwear and offloading to prevent and heal foot ulcers in
diabetes (Calados e descarga para prevenir e cicatrizar lceras
em ps no diabetes); (3) Diagnosis, prognosis and management
of peripheral artery disease in patients with foot ulcers in diabetes (Diagnstico, prognstico e manuseio de doena arterial
perifrica em pacientes com diabetes e lceras em ps); (4)
Diagnosis and management of foot infections in persons with
diabetes (Diagnstico e manuseio de infeces em pessoas
com diabetes); (5) Interventions to enhance healing of chronic
ulcers of the foot in diabetes (Intervenes para promover cicatrizao de lceras crnicas em pessoas com diabetes). O
acesso a todo o Guidance 2015 pelo site http://www.iwgdf.or.
Alm das revises sistemticas, h um sumrio de recomendaes com base no sistema GRADE, com a intensidade
classificada em forte e fraca, e qualidade da evidncia em alta
e baixa,1 que inclui opinio de especialistas nas reas em que
no foi possvel obter evidncias para a recomendao.

Quadro 5 Classificao do risco, recomendaes e acompanhamento peridico, segundo o nvel de ateno de sade (ADA-AACE-SBD).35,49
Nvel de risco

Definio clnica

Recomendaes de tratamento

Recomendaes de seguimento

PSP e DAP
ausentes

Educao do paciente, incluindo aconselhamento


sobre o sapato adequado

Anual, por uma equipe generalista


(previamente treinada) ou especialista

PSP deformidade

Considerar uso de sapatos especiais


Considerar cirurgia profiltica se a deformidade
no puder ser acomodada nos sapatos
Continuar a educao do paciente

A cada 3 a 6 meses, por equipe


especialista

DAP PSP

Considerar o uso de sapatos especiais


Consulta com um cirurgio vascular para
seguimento conjunto

A cada 2 a 3 meses
(por equipe especialista)

Histrico de lcera
ou amputao

Considerar o uso de sapatos especiais


Consulta com cirurgio vascular para seguimento
conjunto (se houver DAP)

A cada 1 a 2 meses
(por equipe especialista)

PSP: perda da sensibilidade protetora; DAP: doena arterial perifrica. Quando se aplicar escores de comprometimento neuroptico e DAP, a sigla PSP ,
ento, substituda por PND, como delineado nas fichas clnicas do BrasPEDI_SBD.50

Diretrizes SBD 2015-2016 - CAP 22.indd 143

05/10/2015 07:06:28

144 Diretrizes SBD | 2015-2016

Certamente, o contedo dever ser ajustado realidade


local, levando-se em conta as diferenas regionais em todos
os seus aspectos e, claro, a situao socioeconmica. Seguindo a proposta dessa Diretriz, o Quadro 6 contm as recomendaes para a preveno de pessoas diabticas em risco
de ulcerao.29
Por fim, as recomendaes referentes ao diagnstico precoce, preveno de complicaes e posterior implantao de
linhas para organizar o cuidado esto contidas no Quadro 7,
com base em evidncias classificadas em A, B, C e D.1,20,29,5358
As intervenes para tratamento da UPD no fazem parte
do escopo dessa Diretriz. O leitor pode se referir aos documentos do Canadian Diabetes Association Clinical Practice
Guidelines Expert Committee,53 NICE (National Institute of
Clinical Excellence),54,55 Guidance 2015 do IWGDF e Diretrizes Brasileiras para o Tratamento das Infeces em lceras
Neuropticas dos Membros Inferiores.5759

Anexo 1 | Guia de Bolso para Exame


dos Ps
A ADA lanou, em 2009, o Foot Examination Pocket Chart
(Guia de Bolso para Exame dos Ps). Aps entendimentos
com os autores, David Armstrong e Lawrence Lavery, a coordenadora do Departamento de P Diabtico da SBD
poca, Hermelinda C. Pedrosa, e a gerente administrativa,
Anna Maria Ferreira, conduziram o processo burocrtico
para a cesso dos direitos autorais visando impresso e
divulgao no site da SBD. Guia de Bolso para Exame dos
Ps (Figura 7)46 contm sumrio da avaliao clnica dos ps
dos pacientes diabticos com nfase na PSP, alm de orientao para prescrio de calados, antibioticoterapia, verso
simplificada da classificao do Texas,52 resumo das indicaes de dispositivos (curativos) e classificao do IWGDF.
Ilustraes do uso do monofilamento de 10 g e os pontos de
teste (hlux, 1a, 3a e 5a cabeas de metatarsos), alm de como
calcular o ITB para o rastreamento da DAP, tambm esto
contemplados.
O contedo do Guia contribui, por meio de um formato
simples, para o seguimento das orientaes cardinais do p
diabtico, desde o exame clnico at o cuidado com as leses e
orientao sobre calados.

Anexo 2 | Calados
Recomendaes sobre calados para pacientes
diabticos
O Departamento de P Diabtico coordenou, em 2006, com
vrios especialistas na rea de PND e p diabtico (Ana
Ravazzani, Cndida Parisi, Domingos Malerbi, Gesa Macedo,
Helena Schmid, Hermelinda C. Pedrosa, Karla Rezende e
Maria Regina Calsolari), a elaborao das recomendaes para
um calado confeccionado para uso pelos pacientes diabticos. Este anexo contempla os pontos considerados essenciais
do tema.
Inexiste um consenso sobre calados adequados, embora
vrias recomendaes j estejam contempladas em documentos

Diretrizes SBD 2015-2016 - CAP 22.indd 144

Quadro 6 Recomendaes para a preveno de diabticos com


risco de ulcerao.*
Item

Grau e qualidade

Exame anual

Forte | Baixa

Se h PND: histrico de UPD/amputao,


DAP, deformidades, leses pr-ulcerativas,
m higiene, calados inadequados

Forte | Baixa

Tratar leses pr-ulcerativas: calos, bolhas


(drenar se necessrio), unhas encravadas e
espessadas, tratar hemorragias, prescrever
antimicticos

Forte | Baixa

Orientar para no caminhar descalos ou


com meias, usar chinelos, dentro ou fora
de casa

Forte | Baixa

Instruir para inspecionar os ps e os


calados, lavar os ps diariamente e secar
entre os dedos, no usar substncias ou
emplastros para remover calos ou cravos,
usar emolientes para hidratar os ps,
cortar as unhas em linha reta

Fraca | Baixa

Instruir para utilizar calados


apropriados para prevenir uma lcera
inicial, plantar ou no plantar, ou uma
lcera recorrente no plantar; se houver
deformidade ou leso pr-ulcerativa,
prescrever calados ou palmilhas
customizadas ou rteses

Forte | Baixa

Para prevenir recorrncia de lcera,


prescrever calados teraputicos
que reduzam a carga durante a
caminhada (p. ex., reduzir 30% de
carga em relao a um calado padro)
e encorajar o uso

Forte | Moderada

Para prevenir a primeira UPD em um


paciente de risco, a educao deve ser
direcionada a melhorar o conhecimento e
comportamento e motivar a aderncia ao
autocuidado

Fraca | Baixa

Para prevenir a recorrncia de UPD em um


paciente de risco, a promoo do cuidado
integrado inclui tratamento profissional,
proviso de calado adequado e
educao. O processo deve ser repetido
ou reavaliado uma vez a cada ms ou
trimestralmente, se necessrio

Forte | Baixa

Instruir o paciente a monitorar a


temperatura da pele em casa, para
prevenir uma primeira UPD ou a sua
recorrncia.** O objetivo identificar
sinais precoces de inflamao,
seguindo-se a ao tomada pelo prprio
paciente e profissional de sade para
resolver a causa da inflamao

Fraca | Moderada

*Grade System (Sistema GRADE, Grading of Recommendations Assessment,


Development and Evaluation; Graduao para Manuseio, Desenvolvimento
e Avaliao de Recomendaes): intensidade da recomendao como forte
ou fraca; e a qualidade da evidncia em alta, moderada ou baixa.1,29
**Quando disponvel, uso de termmetro a laser em domiclio. Esse item se
baseia em uma experincia nos Estados Unidos e tem potencial limitado para
implementao em nosso meio, diante do custo e do acesso ao termmetro
mesmo para uso em servios.

05/10/2015 07:06:28

Diagnstico Precoce do P Diabtico 145


Quadro 7 Recomendaes e concluses.
Recomendaes e concluses

Grau de
recomendao

PND: rastreamento deve ser efetuado


poca do diagnstico de DM2 e
anualmente

PND: rastreamento deve ser realizado aps


5 anos do diagnstico para o DM1

Rastreamento de PND: identificar sintomas


e sinais (deformidades neuropticas
dedos em garra, proeminncia de
metatarsos, calosidades, limitao da
mobilidade articular; pesquisar a perda de
sensibilidade protetora plantar (PSP)
insensibilidade ao monofilamento 10 g e
um dos testes sensorimotores alterados
(sensibilidade vibratria, sensibilidade
dolorosa, reflexo aquileu)

A
DM1: os pacientes devem ser tratados
intensivamente para atingir bom controle da
glicose (HbA1c < 7,0%), com o propsito de
prevenir e evitar a progresso da PND
DM2: os indivduos devem ser tratados
intensivamente para atingir o bom
controle da glicose (HbA1c < 7,0%), com o
intuito de tambm prevenir e evitar a
progresso da PND

B
Os pacientes diabticos com alto risco de
ulcerao (histria prvia de lcera e
amputao) devem receber, por profissionais
treinados a lidar com leses em ps,
educao (inclusive orientaes para evitar
traumas), aconselhamento sobre calados,
cessao de tabagismo e referncia precoce
quanto aos cuidados a serem tomados
Pacientes com lceras devem ser seguidos
por uma equipe multiprofissional com
expertise evidente no manuseio para prevenir
recorrncia de lceras e amputaes

A classificao de Texas, validada, mostrou


ser mais eficaz em refletir o risco de
amputao e predizer a possibilidade de
cicatrizao do que a de Wagner

Todo paciente diabtico com leso no p


deve receber atendimento em at 24 h

Qualquer infeco relacionada com leses em D


ps de pacientes diabticos tem de ser
tratada de maneira adequadamente agressiva
(A) Estudos experimentais e observacionais de melhor consistncia; (B)
Estudos experimentais e observacionais de menor consistncia; (C) Relatos
de casos estudos no controlados; (D) Opinio desprovida de avaliao
crtica, baseada em consenso, estudos fisiolgicos ou modelos animais.

Diretrizes SBD 2015-2016 - CAP 22.indd 145

Critrios globais mnimos

O exame clnico dos ps deve integrar uma D


abordagem do DM pelos profissionais e dos
gestores de sade para diminuir o risco de
leses e amputaes nos ps (PND, DAP e
evidncia de infeco)
A recomendao para realizao do ITB
envolve qualquer paciente diabtico com
sintomas e idade acima de 50 anos

cientficos, inclusive na verso de 2007 do Consenso Internacional (<http://www.idf.org/bookshop>). A seleo de


calados para pacientes diabticos considerada uma prescrio e deve envolver critrios clnicos e confeco dentro
de normas padronizadas. No nosso pas, a Associao Brasileira de Normas Tcnicas (ABNT) e o Instituto Nacional de
Metrologia, Normalizao e Qualidade Industrial (Inmetro)
dispem de dados tcnicos para a aprovao de calados. O
Departamento de P Diabtico da SBD elaborou um conjunto de normas tcnicas, com base em conceitos globais mnimos para a emisso do Selo SBD de Calado Adequado. O
selo da SBD um avano para difundir entre os mdicos e
demais profissionais da sade, bem como entre os usurios,
a necessidade do uso de critrios tcnicos para indicar calados adequados, com base na atividade e no risco de ulcerao (ver Figura 5).

Peso: < 400 g (mximo: 480 g)


Parte anterior (frente): ampla, com largura e altura suficientes para acomodar os dedos. Modelos com at trs
larguras
Parte externa: couro macio e flexvel
Forrao interna: em couro de carneiro, microfibra antialrgica e antibacteriana, passvel de absorver o suor
Entressola: palmilhado com fibras de densidade varivel
Solado: no flexvel, do tipo mata-borro, com reduo de
impacto e antiderrapante, de couro ou borracha densa, colado ou costurado, espessura mnima de 20 mm
Contraforte rgido e prolongado: para acomodar e ajustar o
retrop, prevenindo atrito no calcneo e/ou malolo
Ausncia de costuras e/ou dobras internas
Colarinho almofadado
Lingueta prolongada
Gspea complacente, com altura para o dorso do p
Palmilha removvel
Abertura e fechamento: com calce regulvel (velcro ou cadaro no encerado e mnimo de ilhoses: tipo blucher)
Cabedal de material no sinttico
Numerao: um ponto ou meio ponto e ao menos duas larguras
Salto 2 cm
Rigidez no mediop
Fixao no calcanhar.

Para facilitar a aquisio para dispensao aos pacientes


com PSP e/ou DAP e/ou deformidades e passado de lceras (riscos 1-2-3), sugerem-se as seguintes descries, com
base no Medicare (Estados Unidos) e no Selo SBD: calados ortopdicos, anatmicos, com numerao em ponto e
meio ponto, formas hiperprofundas, com no mnimo trs
larguras de base diferentes, confeccionados com forrao
e solados especiais, para reduzir pontos de atrito ou compresso, dotados de palmilhas removveis e especiais, para
ps neuropticos de criana ou adulto, com a base tipo rocker (mata-borro), contraforte reforado, colar e pala com
acolchoado.

05/10/2015 07:06:29

Figura 7 A. Guia de bolso para exame dos ps.

146 Diretrizes SBD | 2015-2016

Diretrizes SBD 2015-2016 - CAP 22.indd 146

05/10/2015 07:06:29

Figura 7 B. Guia de bolso para exame dos ps.

Diagnstico Precoce do P Diabtico 147

Diretrizes SBD 2015-2016 - CAP 22.indd 147

05/10/2015 07:06:30

148 Diretrizes SBD | 2015-2016

Leitura sugerida
Recomendao de realizao de procedimentos extracardacos para
diagnstico de DAP: Portaria no 272, de 15 de junho de 2011.

Referncias bibliogrficas
1. Bakker K, Apelqvist J, Lipsky BA et al. The 2015 Guidance on
prevention and management of foot problems in diabetes: development of an evidence-based global consensus. International
Working Group on the Diabetic Foot (IWGDF). Disponvel em:
<http://www.iwgdf.org>. Acesso em: 20/07/2015.
2. Unwin N. The diabetic foot in the developing world. Diabetes
Metab Res Rev. 2008; 24(Suppl 1):S31-S3.
3. Boulton AJM, Vileikyte L, Ragnarson-Tennvall G et al. The global burden of diabetic foot disease. Lancet. 2005; 366:1719-24.
4. Singh N, Armstrong DG, Lipsky BA. Preventing foot ulcers in
patients with Diabetes. JAMA. 2005; 293:217-28.
5. Pecoraro RE, Reiber GE, Burgess EM. Pathways to diabetic
limb amputations. Basis for prevention. Diabetes Care. 1990;
13:513-21.
6. Jeffcoate WJ, Chipchase SY, Ince P et al. Assessing the outcome
of the management of diabetic foot ulcers using ulcer-related and
person-related measures. Diabetes Care. 2006 aug; 29(8):1784-7.
7. Prompers L, Schaper N, Apelqvist J et al. Prediction of outcome
in individuals with diabetic foot ulcers: focus on the differences
between individuals with and without peripheral arterial disease.
The Eurodiale Study. Diabetologia 2008 may; 51(5):747-55.
8. Armstrong DG, Lavery LA, Harkless LB. Validation of a diabetic
wound classification system. The contribution of depth, infection, and ischemia to risk of amputation. Diabetes Care. 1998
may;21(5):855-9.
9. Reiber GE, LeMaster JW. Epidemiology and economic impact of
foot ulcers. In: Boulton AJM, Cavanagh P, Rayman G, eds. The Foot
in diabetes. 4th ed. Chichester: John Wiley & Sons. 2006; 1:1-16.
10. Ragnarson T, Apelqvist J. Health economic consequences of diabetic foot lesions. Clin Infect Dis. 2004; 39(Suppl 2):S132-S9.
11. Pedrosa HC, Leme LAP, Novaes C et al. The diabetic foot in
South America: progress with the Brazilian Save the Diabetic
Foot Project. Int Diabetes Monitor. 2004; 16(4):17-24.
12. Rezende KF, Ferraz MB, Malerbi DA et al. Predicted annual costs
for inpatients with diabetes and foot ulcers in a developing country a simulation of the current situation in Brazil. Diabetes UK.
Diabetic Medicine. 2010; 27:109-12.
13. Boulton AJM, Vinik AI, Arezzo JC et al. American Diabetes Association. Diabetic neuropathies: a position statement by the
American Diabetes Association. Diabetes Care. 2005; 28:956-62.
14. Tapp R, Shaw J. Epidemiology of diabetic neuropathy. In: Diabetic Neuropathy. Tesfaye S, Boulton AJM, eds. Oxford: Oxford
Diabetes Library. 2009; 1:1-8.
15. van Schie CHM. Neuropathy: mobility and quality of life. Diabetes Metab Res Rev. 2008; 24(Suppl 1):S45-S51.
16. Fernando DJ, Masson EA, Veves A et al. Relationship of limited
joint mobility to abnormal foot pressures and diabetic foot ulceration. Diabetes Care. 1991; 14:8-11.
17. Veves A, Murray HJ, Young MJ et al. The risk of foot ulceration
in diabetic patients with high foot pressure: a prospective study.
Diabetologia. 1992; 35:660-3.
18. International Consensus on the Diabetic Foot. In: Pedrosa HC e
Andrade, trads. SES-DF, MS, 2001.
19. Jude ED, Eleftheriadou I, Tentolouris N. Peripheral arterial disease in diabetes review. Diabet Med. 2010; 27:4-14.
20. Hinchliffe RJ, Brownrigg JR, Apelqvist J et al. IWGDF Guidance on the diagnosis, prognosis and management of peripheral
artery disease in patients with foot ulcers in diabetes. Diabetes
Metab Res Rev, 2015 [in press].

Diretrizes SBD 2015-2016 - CAP 22.indd 148

21. Schaper NC. Lessons from Eurodiale. Diabetes Metab Res Rev.
2012; 28(Suppl 1):21-6.
22. Pedrosa HC, Tavares FS. As vias para a ulcerao. In: Pedrosa
HC, Vilar L, Boulton AJM, eds. Neuropatias e p diabtico. Rio
de Janeiro: AC Farmacutica. 2014; 21:144-59.
23. Schaper NC, Huijberts M, Pickwell K. Neurovascular control
and neurogenic inflammation in diabetes. Diabetes Metab Res
Rev. 2008; 24(Suppl 1):S40-S4.
24. Monier VM, Stevens VJ, Cerami A. Maillard reactions involving
proteins and carbohydrates in vivo: relevance to diabetes mellitus and aging. Prog Food Nutr Sci. 1981; 5:315-27.
25. Meerwaldt R, Links TP, Graaf R et al. Increased accumulation of
skin AGES precedes and correlates with clinical manifestation of
diabetic neuropathy. Diabetologia. 2005; 48:1644-73.
26. Lapolla A, Piarulli F, Sartore G et al. AGES and antioxidant status
in type 2 diabetic patients with and without peripheral arterial
disease. Diabetes Care. 2007; 30:670-8.
27. Jeffcoate WJ, Game F, Cavanagh PR. The role of proinflammatory cytokines in the cause of neuropathic osteoarthropathy (acute
Charcot foot) in diabetes. Lancet. 2005; 366:2058-61.
28. Gomes MB, Gianella D, Faria M et al. Prevalence of the type 2
diabetic patients within the targets of care guidelines in daily
practice: a multicenter study in Brazil. Rev Diabetic Stud. 2006;
3:73-8.
29. Bus SA, Van Netten JJ, Lavery LA et al. IWGDF Guidance on the
prevention of foot ulcers in at-risk patients with diabetes. Diabetes Metab Res Rev, 2015 [in press].
30. Vileikyte L, Gonzalez J. Reconhecimento e manuseio das
questes psicossociais na neuropatia diabtica. In: Pedrosa HC,
Vilar L, Boulton AJM, eds. Neuropatias e p diabtico. Rio de
Janeiro: AC Farmacutica. 2014; 22:120-43.
31. Reiber GE, Vileikyte L, Boyko EJ et al. Causal pathways for incident lower-extremity ulcers in patients with diabetes from two
settings. Diabetes Care. 1999; 22:157-162.
32. Pedrosa HC. Neuropatia diabtica. [E-Book, SBD 2014]. Disponvel em: <http://www.diabetes.org.br>.
33. Pham H, Armstrong DG, Harvey C et al. Screening techniques to
identify the at risk patients for developing diabetic foot ulcers in
a prospective multicenter trial. Diabetes Care. 2000; 23:606-11.
34. Mayfiled JE, Sugarman JR. The use of Semmes-Weinstein monofilament and other threshold tests for preventing foot ulceration
and amputation in people with diabetes. J Fam Practice. 2000;
49:S17-S29.
35. Boulton AJM, Armstrong D, Albert S et al. ADA-AACE Task
Force. Diabetes Care. 2008; 31:1679-85.
36. Booth J, Young MJ. Differences in the performance of commercially available 10 g-monofilaments. Diabetes Care. 2000; 23:984-8.
37. Abbot CA, Carrington AL, Ashe H et al. The North-West Diabetes Foot Care Study: incidence of, and risk factors for, new
diabetic foot ulceration in a community based patient cohort.
Diabet Med. 2002; 20:377-84.
38. Young MJ, Breddy JL, Veves A et al. The prediction of diabetic
neuropathic foot ulceration using vibration perception thresholds: a prospective study. Diabetes Care. 1994; 17:557-60.
39. Prez JAM, Vitarella G, Guzmn JR et al. Guas ALAD de pie
diabtico. Rev da ALAD. 2010 jun; 17(2):73-84.
40. Patasky Z, Assal JP, Conne P et al. Plantar pressure distribution
in type 2 diabetic patients without peripheral neuropathy and
peripheral vascular disease. Diabet Med. 2005; 22:762-7.
41. Silvino N, Evanski PM, Waugh TR. The Harris and Beath footprinting mat: diagnostic validity and clinical use. Clin Orthop
1980; 151:265-9.
42. Van Schie CHM, Abbot CA, Vileikyte L et al. A comparative
study of Podotrack, a simple semiquantitative plantar pressure
measuring device and the optical pedobarograph in the assess-

05/10/2015 07:06:30

Diagnstico Precoce do P Diabtico 149

43.
44.
45.

46.
47.
48.
49.
50.

51.

ment of pressures under the diabetic foot. Diabetic Med. 1999;


16:154-9.
Boulton AJM. The pathway to ulceration. In: Boulton AJM, Cavanagh O, Rayman G, eds. The foot in diabetes. 4th ed. Chichester, UK: John Wiley & Sons; 2006; (5):51-67.
Andros G, Harris RW, Dulawa LB et al. The need for arteriography in diabetic patients with gangrene and palpable foot pulses.
Arch Surg. 1984; 119:1260-3.
Rooke TW, Hirsch AT, Misra S et al. 2011 ACCF/AHA Focused
update of the guideline for the management of patients with peripheral artery disease (updating the 2005 guideline): a report
of the American College of Cardiology Foundation/American
Heart Association Task Force on Practice Guidelines. J Am Coll
Cardiol. 2011; 58(19):2020-45.
Pedrosa HC, Pimazoni A, trads. Guia de bolso para exame dos
ps. 2010. Disponvel em: <http://www.diabetes.org.br>.
Bowering K, Eko JM, Kalla TP. Canadian Diabetes Association
Clinical Practice Guidelines Expert Committee. Foot Care. 2008;
S143-S53.
Bakker K, Apelqvist J, Schaper NC. Practical guidelines on the
management and prevention of the diabetic foot 2011. Diabetes
Metab Res Rev. 2012; 28(Suppl 1):225-31.
Boulton AJ. The diabetic foot: grand overview, epidemiology and
pathogenesis. Diabetes Metab Res Rev. 2008; 24(Suppl 1): S3-S6.
Pedrosa HC, Tavares SF, Saigg MAC et al. Programa Passo a
Passo (Step by Step) Fichas clnicas. In: Pedrosa HC, Vilar L,
Boulton AJM, eds. Neuropatias e p diabtico. Rio de Janeiro:
AC Farmacutica. 2014; 22:144-59.
Bakker K, Abbas ZG, Pendsey S. Step by Step, improving diabetic
foot care in the developing world. A pilot study for India, Bangla-

Diretrizes SBD 2015-2016 - CAP 22.indd 149

52.
53.

54.

55.

56.
57.
58.
59.

desh, Sri Lanka and Tanzania. Practical Diabetes International.


2006; 23(8):365-9.
Peters EJ, Lavery LA. Effectiveness of the diabetic foot risk classification system of the International Working Group on the Diabetic Foot. Diabetes Care. 2001; 24(8):1442-7.
Young RJ. The organization of diabetic foot care: evidence-based
recommendations. In: Boulton AJM, Cavanagh PR, Rayman G,
eds. The foot in diabetes. 4th ed. Chichester, UK: John Wiley &
Sons, 2006. pp. 398-403.
National Institute of Clinical Excellence (NICE). Clinical Guidelines CG10. Type 2 Diabetes: prevention and management of foot
problems. CG10. London: NICE, 2004 jan [review 2011 mar].
Disponvel em: <http://www.nice.org.uk/guidance/CG10>. [Update publication planned for August 2015].
National Institute of Clinical Excellence (NICE). Clinical Guidelines CG119. Type 2 Diabetes: in-patient management of diabetic foot. London: NICE, 2004 jan [review 2011 mar]. Disponvel
em: <http://www.nice.org.uk/guidance/CG119>. [Update publication planned for August 2015].
Game FL, Apelqvist J, Attinger C et al. IWGDF guidance on use
of interventions to enhance the healing of chronic ulcers of the
foot in diabetes. Diabetes Metab Res Rev. 2015 [in press].
Bus SA, Armstrong DG, Van Deursen RW et al. IWGDF Guidance
on footwear and offloading interventions to prevent and heal foot ulcers in patients with diabetes. Diabetes Metab Res Rev. 2015 [in press].
Lipsky BA, Aragn-Snchez J, Diggle M et al. IWGDF Guidance
on the diagnosis and management of foot infections in persons
with diabetes. Diabetes Metab Res Rev. 2015 [in press].
Diretrizes Brasileiras para o Tratamento das Infeces em lceras Neuropticas dos Membros Inferiores. 2010; 14(1):1413.

05/10/2015 07:06:31

Doena Renal do Diabetes


Introduo
A classificao atual da doena renal crnica, independentemente da etiologia, baseada na taxa de filtrao glomerular
(TFG) e na excreo urinria de albumina (EUA),1 pois tem
sido extensamente reconhecida a relao desses dois parmetros com desfechos adversos renais e mortalidade. Dessa
maneira, tem havido uma ampliao do espectro das apresentaes clnicas da doena renal do diabetes (DRD), sendo o
fentipo da doena renal no albuminrica, caracterizada por
reduo isolada da TFG, cada vez mais reconhecido. O termo
nefropatia diabtica deve ser atualmente, portanto, reservado
somente para pacientes com proteinria detectvel persistente, em geral associada elevao da presso arterial. A DRD,
na forma de elevao da EUA, pode acometer de 30 a 50% dos
pacientes com diabetes.2 Em aproximadamente 1/5 dos casos,
observa-se a reduo isolada da TFG.3,4 Em estudos realizados
no sul do Brasil, verificou-se que 37% dos pacientes com DM
tipo 2 (DM2) e 34% dos pacientes com DM tipo 1 (DM1) apresentam aumento da EUA.5,6
Embora a taxa de complicaes crnicas relacionadas com
o DM venha diminuindo nas ltimas duas dcadas, tendo
ocorrido uma reduo aproximada de 30% na DRD em suas
fases mais avanadas, ainda muito grande o nmero de pacientes afetados, pois a incidncia de DM continua aumentando.7 Por este motivo, a DRD permanece sendo a principal
causa de doena renal crnica em pacientes ao ingressarem
em programas de dilise,8 inclusive no Brasil.9,10
A DRD est associada ao aumento de mortalidade,1115
principalmente relacionada com a doena cardiovascular.11,14
O aumento da EUA importante fator de risco para eventos
coronarianos,16,17 e para o desenvolvimento e progresso da
DRD.14,15 Esse risco foi originalmente demonstrado na dcada
de 1980.1820
Com base nos valores crescentes de EUA, a DRD tem sido
historicamente classificada em trs fases: normoalbuminria,
microalbuminria e macroalbuminria.21 Entretanto, a progresso destes estgios no inexorvel, podendo ocorrer regresso da microalbuminria em cerca de 30% dos pacientes,14
em geral associada a intervenes teraputicas.22 Os pontos de
corte para classificao dos valores de EUA (macro e microalbuminria) so relativamente arbitrrios, j que foram originalmente determinados a partir de coortes com nmero limitado
de pacientes com DM1.1820 mais provvel que exista um contnuo risco para os desfechos relacionados com o aumento da
EUA. De fato, pacientes com DM2 e valores normais elevados

Diretrizes SBD 2015-2016 - CAP 23.indd 150

de EUA tm maior risco de eventos cardiovasculares, renais e


de mortalidade.23 Na DRD, alm da possibilidade da ocorrncia de TFG reduzida com EUA normal,4,2426 recentemente, foi
demonstrado que, em at 60% dos pacientes com DM1, pode
ocorrer a perda precoce e acentuada da TFG (> 3,5 ml/min/
ano) antes do aparecimento da microalbuminria. So esses os
pacientes que progrediro para a fase final da DRD.27
Apesar dos questionamentos acerca da importncia do
valor do aumento da EUA como um marcador da DRD, em
recente reviso de ensaios clnicos randomizados (ECR), de
metanlises e de grandes estudos observacionais, o papel da
microalbuminria como fator risco para eventos cardiovasculares e progresso de DRD foi reforado.28 Neste contexto,
importante salientar que a tanto a EUA como a TFG so preditores independentes de doena cardiovascular e de mortalidade no paciente com DM2.29,30
A Associao Americana de Diabetes (ADA, do ingls
American Diabetes Association) recomenda para avaliao
da DRD a estimativa da TFG e a medida da EUA.12 Recentemente, a albuminria passou a ser classificada apenas como
EUA normal ou EUA aumentada, esta ltima em substituio
aos termos microalbuminria e macroalbuminria. No entanto, esses termos ainda so amplamente utilizados. A Kidney
Disease Improving Global Outcomes (KDIGO) confirma a
modificao da nomenclatura, mas divide a EUA em trs extratos: normal, aumentada e muito aumentada.

Diagnstico da doena renal do diabetes


O rastreamento da DRD deve ser iniciado logo ao diagnstico do DM nos pacientes com DM2 e aps 5 anos do incio
no DM1. No entanto, pacientes com DM1 que se encontrem
na puberdade ou com DM persistentemente descompensado
tm de ser rastreados independentemente dessas indicaes.
O rastreamento precisa ser anual e basear-se na medida da albuminria e na estimativa da TFG.12
O rastreamento deve ser iniciado preferencialmente pela
medida de albumina em amostra isolada de urina (primeira
da manh ou casual),12,21,31 devido acurcia diagnstica e
facilidade desse tipo de coleta.12,3135 Pode ser medido o ndice albumina-creatinina ou apenas a concentrao de albumina.12,15,31,33,34 A vantagem da utilizao da concentrao da
albumina um menor custo sem perda de acurcia diagnstica quando comparada com o ndice.33 Alm disso, foi demonstrado em um estudo de coorte com 6 anos de seguimento
que a concentrao de albumina em amostra casual preditiva

08/10/2015 16:34:38

Doena Renal do Diabetes 151

de eventos cardiovasculares, DRD e mortalidade em geral.15


Recente metanlise (14 estudos, 2.708 pacientes) comprovou
a acurcia diagnstica da medida da concentrao isolada de
albumina em amostra de urina, no havendo diferena em relao ao ndice albumina-creatinina.36 Apenas em pacientes
com EUA marcadamente elevada (macroalbuminria, EUA
> 300 mg/g) e diminuio da TFG, o ndice albumina-creatinina parece ser mais acurado do que a medida isolada de
concentrao urinria de albumina.37
Todo teste de albuminria anormal deve ser confirmado
em duas de trs amostras coletadas em um intervalo de 3 a
6 meses, devido variabilidade diria da EUA.12,31,35 Fatores
como exerccio durante o perodo de coleta de urina, febre,
insuficincia cardaca, hiperglicemia grave e hipertenso arterial no controlada podem elevar os valores de EUA.38 Embora seja sugerido que infeco urinria possa interferir nos
valores de EUA, recentemente foi constatado que a existncia
de bacteriria no interfere de maneira aprecivel nas medidas
de albuminria, no sendo necessria, como rotina, a realizao de urocultura concomitante EUA,39 achado confirmado
em recente metanlise que incluiu 305 estudos observacionais
conduzidos em 1.552 pacientes com DM.40
A medida de albuminria deve ser realizada por um mtodo acurado e padronizado.41 O Quadro 1 descreve os pontos
de corte diagnsticos atualmente adotados para o diagnstico
de DRD com base em valores de albuminria. Conforme j
mencionado, a ADA recomenda o uso dos termos albuminria normal e elevada para valores acima do normal (englobando as categorias anteriormente denominadas de micro e
macroalbuminria). J a KDIGO, que representa as diretrizes
de nefrologia, sugere o uso de trs faixas: albuminria normal
(< 30 mg/g = mg albumina/g de creatinina), albuminria elevada (30 a 300 mg/g) e albuminria muito elevada (> 300 mg/g),
que fariam a correspondncia com as faixas de micro- e macroalbuminria respectivamente, mas reforando o abandono
do uso desses termos.
Na impossibilidade de realizar-se a medida da EUA, o clculo de protenas totais pode ser tambm utilizado. Os pontos
de corte adotados, proteinria em amostra 430 mg/l ou em
urina de 24 h > 500 mg correspondem a valores muito elevados de EUA (macroalbuminria).21 Tambm a verificao de
protenas no exame qualitativo de urina sugere EUA elevada,
pois, em geral, sua ocorrncia refere-se a um valor de protenas totais na urina > 500 mg/24 h.21
A estimativa da TFG com equaes deve ser realizada rotineiramente com a medida da albuminria.12 A concentrao
srica da creatinina no pode ser usada como ndice isolado de
avaliao de funo renal, j que sofre influncia de vrios fatores extrarrenais, como a variao da massa muscular e de alguns
medicamentos.42 A equao de Cockcroft-Gault [(140 idade)

peso/(72 creatinina) 0,85 (se mulher)], apesar de amplamente utilizada para estimar a TFG, pouco acurada.43,44 Na
prtica clnica atual, a TFG deve ser estimada por meio de
equaes que empreguem a creatinina srica e sejam ajustadas
para idade, gnero e etnia. Precisa ser empregado preferencialmente um mtodo de medida de creatinina srica calibrado,
isto , equiparado pelo fabricante do ensaio a um mtodo de
referncia internacional reconhecido pelo NIST (National Institute of Standards and Technology). O laboratrio de anlises
clnicas que realiza o exame dispe dessa informao. Uma das
equaes mais utilizadas para estimar a TFG a do estudo Modification of Diet in Renal Disease (MDRD),45 sendo que esta
frmula foi posteriormente adaptada ao uso com valores de
creatinina srica calibrados. A equao Chronic Kidney Disease
Epidemiology Collaboration (CKD-EPI) foi desenvolvida posteriormente,46 no ano de 2009, e tem melhor acurcia do que as
anteriores, especialmente na faixa de normalidade. Entretanto,
sua acurcia parece ser menor em pacientes com DM quando
comparada com seu uso em indivduos sem DM, com tendncia
a subestimar a TFG dentro da faixa da normalidade.47,48 Calculadoras facilmente utilizveis e que empregam essas equaes para
determinar a TFG esto disponveis online: <www.kidney.org>.
Os laboratrios devero calcular a TFG estimada com a equao
CKD-EPI ou MDRD e report-la sempre no laudo toda a vez que
for solicitada dosagem de creatinina srica.49 No entanto, um levantamento regional no sul do Brasil demonstrou que esta orientao seguida por apenas 10% dos laboratrios comerciais.50
O Quadro 2 descreve os estgios da DRD com base nos nveis de TFG e EUA. Essas informaes possibilitam diferentes
combinaes considerando a TFG e o valor da albuminria,
o que pode ter implicaes clnicas relevantes no manejo dos
pacientes. Por fim, lembrar que frequentemente pacientes com
DM apresentam a DRD com aumento de EUA e TFG normal.
A cistatina C srica , assim como a creatinina srica, um
marcador endgeno da TFG. Alguns estudos tm demonstrado que, em pacientes com DM, a cistatina seria um melhor
preditor de doena renal avanada e de mortalidade quando
comparada creatinina srica.52 Segundo as ltimas diretrizes
de nefrologia, a cistatina C deve ser solicitada quando a TFG
estimada com a equao CKD-EPI estiver entre 45 e 60 ml/
min, especialmente se no houver outras evidncias de doena
renal, para dirimir dvidas quanto aos achados com a TFG
Quadro 2 Doena renal do diabetes | Estgios de classificao
da doena renal crnica de acordo com a taxa de filtrao
glomerular e excreo urinria de albumina.

Estgios

Descrio

Taxa de filtrao
glomerular
(ml/min/1,73 m2)

TFG normal ou elevada*

90

TFG levemente reduzida*

60 a 89

3A

Moderada reduo da TFG

45 a 59

Valores

3B

Reduo marcada da TFG

30 a 44

Concentrao de albumina15

14 mg/l

Reduo grave da TFG

15 a 29

ndice albumina:creatinina12

30 mg/g

Insuficincia renal

< 15

Quadro 1 Valores de albuminria utilizados para o diagnstico de


doena renal do diabetes.
Amostra casual de urina

Amostra de urina de 24 h21

Diretrizes SBD 2015-2016 - CAP 23.indd 151

30 mg/24 h

*EUA elevada (adaptado de Levey et al.);51 TFG: taxa de filtrao glomerular;


EUA: excreo urinria de albumina.

08/10/2015 16:34:39

152 Diretrizes SBD | 2015-2016

baseada em equaes da creatinina.49 Calculadoras online j


disponibilizam o clculo da TFG a partir da cistatina C (www.
kidney.org). Ainda mais recentemente, tem sido sugerido o
uso de equaes combinadas que incluam a cistatina e a creatinina sricas para avaliar a TFG.53
Alm da EUA elevada como expresso de leso glomerular na DRD, outros marcadores glomerulares tm sido avaliados, como a excreo urinria de transferrina, ceruloplasmina,
adiponectina, laminina e protenas podocitrias. No entanto,
nenhum desses marcadores mostrou-se superior em relao
albuminria at o momento.54 Alm disso, os tbulos e o interstcio renal tambm parecem apresentar uma funo na patognese da DRD. O acometimento tubular poderia inclusive
preceder o envolvimento glomerular, pois vrias protenas e enzimas tubulares so detectveis antes da elevao da EUA e da
queda da TFG: NGAL (neutrophil gelatinase-associated lipocalin), NAG (N-acetyl glucosaminidase), KIM-1 (kidney injury molecule 1), a1- e b2-microglobulinas, L-FABP (fatty acid binding
protein) e RBP4 (retinol binding protein 4). Estudos mais robustos so ainda necessrios para definir o verdadeiro papel desses
biomarcadores na deteco precoce da DRD.52

progressivo da mesma e desacelerar o declnio da TFG, alm


de prevenir a ocorrncia de eventos cardiovasculares. A medida da EUA vem sendo usada como um desfecho substituto
para desfechos mais duros, como a insuficincia renal e/ou
morte, embora existam controvrsias sobre essa utilizao da
EUA.58,59 As principais estratgias de tratamento da DRD, no
incluindo tratamento de substituio renal (dilise e transplante), esto descritas no Quadro 3.

Diagnstico diferencial da doena


renal do diabetes

Quadro 3 Estratgias do tratamento em pacientes com doena


renal do diabetes.12,13,21,60

O aumento da EUA ou a reduo da TFG em pacientes com DM


podem ser causados por outra doena renal no relacionada
com o DM. O paciente deve ser submetido avaliao adicional
nas seguintes situaes: incio da proteinria em pacientes com
durao do DM inferior a 5 anos, em especial no DM1;55 incio
da proteinria abrupto e rapidamente progressivo, no compatvel com o curso clnico da DRD;21 alteraes no sedimento urinrio, como cilindros hemticos, leucocitrios e acantcitos;56
manifestaes clnicas de outra doena sistmica e ausncia de
retinopatia e neuropatia em pacientes com DM1,34 visto que
nestes a retinopatia diabtica precede o surgimento de DRD.56
Nos pacientes com DM2, a ausncia de retinopatia e neuropatia
no excluem DRD, pois apenas 57% dos pacientes com DM2
proteinricos, com diagnstico de ND confirmado por biopsia,
apresentam retinopatia diabtica.56 Entretanto, uma recente
metanlise que incluiu mais de 2.000 pacientes com DM2, todos
com comprovao de DRD por biopsia e a maioria com indicao de biopsia por suspeita de outra possvel causa de nefropatia, comprovou que a retinopatia diabtica til no diagnstico
da DRD. Os valores preditivos positivo e negativo da retinopatia
foram de 72 e 69%, respectivamente, tendo a forma proliferativa
de retinopatia diabtica 98% de especificidade para o diagnstico da DRD.57 A diminuio rpida e acentuada da TFG (> 30%)
aps o incio de terapia com inibidores da enzima conversora
da angiotensina (IECA) ou bloqueadores do receptor AT1 da
angiotensina (BRA) sugere estenose da artria renal,34 devendo
esta possibilidade ser avaliada, especialmente em pacientes com
vasculopatia.

Tratamento da doena renal do diabetes


Tradicionalmente, os objetivos do tratamento da DRD incluem reduzir a EUA, tendo como alvo a obteno de valores normais de EUA (normoalbuminria), evitar o aumento

Diretrizes SBD 2015-2016 - CAP 23.indd 152

Controle glicmico intensificado


O papel do controle glicmico intensificado sobre a progresso da DRD, de microalbuminria para macroalbuminria e
sobre o declnio da TFG nos pacientes com valores de EUA
marcadamente elevados (macroalbuminrios) no est completamente esclarecido.6164
Em pacientes com DM2 recm-diagnosticado, o estudo
United Kingdom Prospective Diabetes Study (UKPDS) no observou benefcio em desfechos renais quando o tratamento intensivo da hiperglicemia foi comparado ao tratamento convencional (HbA1c 7,0% vs. 7,9%).65 Entretanto, quando os desfechos

Interveno

Descrio

Frmacos que atuam


no SRAA

Inibidores da enzima conversora da


angiotensina
Bloqueadores do receptor AT1 da
angiotensina II
Antagonistas dos receptores da
aldosterona
Inibidores diretos da renina

Restrio proteica

Restrio moderada de protenas:


0,8 g/kg peso/dia em casos de
progresso da DRD e reduo da TFG

Controle pressrico

Uso de diurticos tiazdicos (furosemida


se TFG < 30 ml/min), antagonistas do
clcio e/ou betabloqueadores e/ou
vasodilatadores
Alvo: presso arterial 140/80 mmHg
ou 130/80 mmHg situaes
especiais: jovem, risco elevado de AVC

Controle glicmico

Alvo: HbA1c < 7%


Individualizar de acordo com a
presena de comorbidades

Controle de lipdios

Paciente no dialtico:
50 anos de idade: uso de estatina
< 50 anos de idade e presena de
DCV estabelecida ou risco
cardiovascular em 10 anos > 10%: uso
de estatina
Paciente dialtico:
Manter hipolipemiante se introduzido
antes da dilise
Indicar incio de estatina apenas em
situaes especiais (p. ex., infarto do
miocrdio etc.)

AVC: acidente vascular cerebral; DCV: doena cardiovascular; HbA1c:


hemoglobina glicada; SRAA: sistema renina-angiotensina-aldosterona; TFG:
taxa de filtrao glomerular.

08/10/2015 16:34:39

Doena Renal do Diabetes 153

microvasculares foram analisados em conjunto, houve reduo


de risco em 25% com o tratamento intensificado. Outros estudos
clnicos randomizados (ECR) (ACCORD, ADVANCE, VADT)
no demonstraram haver um benefcio inequvoco do controle
intensivo na DRD durante o perodo de interveno. Diferentemente do UKPDS, esses estudos incluram pacientes com doena
cardiovascular prvia ou presena de fatores de risco cardiovasculares. No estudo Action to Control Cardiovascular Risk in Diabetes (ACCORD),66 a incidncia de macroalbuminria foi reduzida em 29% no grupo sob tratamento intensivo em relao ao
tratamento convencional (HbA1c 7,2% vs. 7,6%), embora no
tenha havido proteo no tocante queda da TFG ou incidncia
de doena renal terminal. O mesmo foi observado no estudo
Action in Diabetes and Vascular Disease: Preterax and Diamicron Modified Release Controlled Evaluation (ADVANCE),67
no qual o grupo tratado intensivamente (HbA1c 6,5% vs. 7,3%)
teve reduo na incidncia de macroalbuminria (2,9% vs. 4,1%
no grupo-controle), tambm sem efeito na TFG. Entretanto, no
acompanhamento mdio de 5,9 anos ps-estudo, os pacientes
submetidos ao tratamento intensivo apresentaram uma reduo
de 46% no risco de progresso para doena renal terminal.68 No
entanto, o nmero de eventos absolutos foi pequeno, no se observou efeito do tratamento intensivo nas complicaes microvasculares maiores como um grupo nem efeito na mortalidade
geral ou relacionada com a doena renal. No Veterans Affair
Diabetes Trial (VADT),69 a teraputica intensificada (HbA1c
6,9% vs. 8,4%) no preveniu a progresso de microalbuminria
para macroalbuminria, embora os valores de albuminria tenham sido menores ao final do estudo no grupo sob tratamento
intensificado. Analisados em conjunto, os resultados desses estudos sugerem que a obteno de valores de HbA1c < 7% tem
um pequeno efeito no retardo da progresso da albuminria em
pacientes com DM2, e que a ao protetora de progresso para
insuficincia renal, se existente, s observada aps perodos
longos de melhora do controle glicmico. Embora os resultados
desses estudos sejam aparentemente contraditrios em relao
aos do UKPDS,61,6264 deve-se levar em conta que os pacientes includos apresentavam uma durao mdia conhecida do
DM de 8 a 11 anos, evidncias de doena cardiovascular e/ou
associao com fatores de risco cardiovascular, indicando, portanto, estgios j avanados da evoluo do DM. Ainda, nesse
contexto, vale lembrar que, em uma metanlise de ECR, foi demonstrado que um controle glicmico estrito em pacientes com
DM2 no reduz a mortalidade geral ou complicaes microvasculares, inclusive a DRD. Contudo, um controle glicmico
intensificado aumenta em 30% o risco de hipoglicemia grave.70
Um nico ECR conduzido em 160 pacientes com DM2 microalbuminricos e seguimento de 7,8 anos revelou um efeito
benfico do controle glicmico intensificado (HbA1c 7,9% vs.
9%) sobre a perda de funo renal avaliada pela TFG, alm da
reduo da albuminria. Entretanto, nesse estudo, um efeito
independente de melhor controle glicmico no foi verificado, pois os pacientes do grupo em tratamento intensificado
estavam sob interveno mltipla: controle glicmico intensificado, uso de IECA, cido acetilsaliclico e hipolipemiantes.64
Em pacientes com DM1, o estudo Diabetes Control and
Complications Trial (DCCT) no observou reduo na progresso para macroalbuminria nos pacientes que eram microalbuminricos no incio do estudo.62 Todavia, esse trabalho

Diretrizes SBD 2015-2016 - CAP 23.indd 153

no tinha poder suficiente para demonstrar esse benefcio, j


que somente 73 pacientes eram inicialmente microalbuminricos. Portanto, no existia at ento evidncia em pacientes
com DM1 de que o controle glicmico intensificado tivesse
vantagem na progresso da DRD. Entretanto, um estudo observacional prospectivo acompanhou 349 pacientes com DM1
e proteinria (DRD estgios 1 a 3) por at 15 anos. O grupo que
melhorou o controle glicmico durante o perodo de observao apresentou menor queda da TGF e menor prevalncia de
doena renal terminal (29%) em comparao com os pacientes
que mantiveram um mau controle glicmico (42%). A diminuio da HbA1c em 1 ponto foi associada a uma proteo de 24%
para evoluo de doena renal terminal (hazard ratio [HR]
0,76; intervalo de confiana [IC] 95% 0,63 a 0,91; p=0,003).71
ainda possvel que os valores extremos de HbA1c estejam
associados a desfechos negativos na DRD. Em estudo que avaliou 23.296 pacientes com DM e TFG < 60 ml/min, valores de
HbA1c > 9 e < 6,5% foram relacionados com maior mortalidade.72 Essa curva em U da mortalidade ligada HbA1c foi recentemente tambm demonstrada em 9.000 pacientes com DM
em hemodilise para valores de HbA1c < 7,0 e > 7,9%.73
Com relao aos frmacos orais utilizados para tratamento
da hiperglicemia, o grau de funo renal deve ser considerado
na escolha do agente. Pacientes com TFG < 30 ml/min tm
absoluta contraindicao para o uso da metformina. Valores de
TFG de 30 a 59 ml/min precisam alertar sobre outros fatores
de risco para acidose lctica antes da prescrio ou da continuidade do uso da metformina.74 Entretanto, essa contraindicao
tem sido bastante discutida devido escassa evidncia de que o
uso da metformina realmente esteja relacionado com risco aumentado de acidose lctica em pacientes com doena renal.75
J as sulfonilureias e seus metablitos, com exceo da gliclazida e glipizida, no devem ser utilizadas, ou utilizadas com
muita cautela, em pacientes com perda significativa de funo
renal.76 A acarbose, um inibidor da a-glicosidase intestinal,
pode ser utilizada at valores de TFG > 30 ml/min (creatinina srica at 2 mg/dl),77 pois, em estgios mais avanados,
existe a preocupao de que seus metablitos acumulem-se,
levando ao dano heptico. As glitazonas, sendo atualmente a
pioglitazona o representante disponvel desta classe no mercado, podem ser alternativas no tratamento desses pacientes,
pelo baixo risco de hipoglicemia e por no necessitar de ajuste
de dose na doena renal e serem seguras do ponto de vista cardiovascular.78 Entretanto, potenciais efeitos colaterais devem
ser levados em conta, como anemia, reteno hdrica, ganho
de peso, aumento de risco de fraturas e insuficincia cardaca.
Entre os inibidores da dipeptidil peptidase-4 (DPP-4) vildagliptina, sitagliptina, linagliptina e saxagliptina, apenas a linagliptina no requer ajuste no caso de perda de funo renal.
Para os demais representantes, so recomendados ajustes de
acordo com os estgios de DRC.79,80 A exenatida, a liraglutida e a lixisenatida, frmacos anti-hiperglicmicos de uso subcutneo, representam os anlogos do peptdio semelhante ao
glucagon 1 (GLP-1). Estes medicamentos esto indicados para
uso em pacientes com valores de TFG de > 30 ml/min.81 J
os anlogos do GLP-1 de longa durao (uso semanal) como
a albiglutida, poderiam ser utilizados nos diferentes estgios
da DRD.82 Um grupo de pesquisadores independentes sugeriu um risco aumentado de pancreatite e tumor de pncreas

08/10/2015 16:34:39

154 Diretrizes SBD | 2015-2016

neuroendcrino maligno em pacientes com DM2 tratados


com agonistas GLP-1, anlogos do GLP-1 e inibidores da DPP4.83 Recentemente, entretanto, as agncias de sade europeia
(EMA; do ingls, European Medicines Agency) e americana
(FDA) realizaram uma avaliao dos dados de ps-comercializao e concluram que no existem evidncias que confirmem possvel associao causal destes frmacos com pancreatite e neoplasia pancretica.84
Outra classe de medicamentos anti-hiperglicmicos de uso
oral so os inibidores do cotransporte tubular renal de sdio-glicose (inibidores do SGLT2), como dapagliflozina, canagliflozina e empagliflozina. Atuam inibindo a reabsoro tubular
proximal de glicose e sdio, por mecanismo independente de
insulina, promovendo um aumento de glicosria com melhora do controle glicmico, perda de peso e reduo da presso
arterial. No entanto, ocorre um aumento de infeces urogenitais por fungos. Esses medicamentos dependem da habilidade
renal de filtrar glicose e no devem, portanto, ser utilizados em
pacientes com TFG < 45 ml/min.85
Em fases mais avanadas da DRD, a produo de insulina
endgena reduzida e, em geral, os pacientes com DM2 necessitam usar insulina para melhorar o controle glicmico. Com a
progresso da DRD, as necessidades de insulina podem variar.
Um estudo em pacientes com DM1 demonstrou que aqueles
com TFG < 60 ml/min, quando comparados aos com TFG >
90 ml/min, tiveram em mdia uma reduo da necessidade do
anlogo de insulina de longa durao (insulina basal) de 30 e
27% para as insulinas glargina e determir, respectivamente.86
Da mesma maneira, os pacientes com TFG < 60 ml/min necessitaram uma dose de insulina ultrarrpida lispro 33% menor
que os pacientes com TFG > 90 ml/min. Diminuio similar da
dose foi observada para a insulina regular humana. Entretanto,
esse efeito no foi observado para a insulina aspart.
No avaliado nesse estudo, o anlogo de longa durao
recentemente comercializado no Brasil, a insulina degludeca,
no necessita ajuste de dose de acordo com a funo renal, podendo ser utilizado at em estgios terminais da doena renal.

Controle intensificado da presso


arterial e bloqueio do sistema
renina-angiotensina-aldosterona
O tratamento da hipertenso arterial sistmica (HAS), independentemente do agente utilizado, apresenta efeito benfico
sobre a progresso da DRD (aumento da EUA).87 Metanlise
recente confirmou que uma reduo de 10 mmHg na presso
arterial sistlica diminui o risco de desenvolvimento de albuminria anormal, alm de diminuir a mortalidade total, eventos cardiovasculares, acidente vascular cerebral (AVC) e piora
da retinopatia do DM.88 No entanto, essa reduo no teve
efeito sobre a progresso para insuficincia renal terminal.
Os frmacos que bloqueiam o sistema renina-angiotensina (SRAA), por meio de seu efeito renoprotetor especfico,
independentemente da reduo da presso arterial (PA), diminuem a EUA e a progresso para estgios mais avanados
da DRD.89,9093 Em pacientes com DM2, dois grandes ECR
avaliaram o efeito protetor do tratamento intensificado da
HAS em pacientes com macroalbuminria. Ambos incluram

Diretrizes SBD 2015-2016 - CAP 23.indd 154

pacientes com aumento de creatinina ou reduo de TFG e


avaliaram os efeitos dos BRA. No estudo Reduction of Endpoints in NIDDM with the Angiotensin II Antagonist Losartan (RENAAL),94 1.513 pacientes foram randomizados para
50 mg ou 100 mg de losartana ou placebo. Os pacientes do
grupo losartana apresentaram uma reduo de 35% na EUA,
de 25% no risco de duplicao da creatinina srica e de 28%
na incidncia de insuficincia renal terminal. Apesar de a PA
ter sido menor no grupo interveno no primeiro ano de seguimento (146/78 vs. 150/80 mmHg), no houve diferena no
segundo ano e ao final do estudo. Com base neste ltimo achado, os autores sugerem que o benefcio na reduo de eventos
ocorreu devido ao uso especfico da losartana mais do que
reduo da PA. O estudo Irbesartan in Diabetic Nephropathy Trial (IDNT) confirmou alguns desses achados e avaliou
o efeito especfico da classe de medicamentos em uso.95 Este
ECR com 1.715 pacientes foi composto por trs braos: placebo, anlodipino 10 mg e irbesartana 300 mg. A PA foi menor
nos grupos anlodipino (141/77 mmHg) e irbesartana (140/77
mmHg) em comparao ao grupo-controle (144/80 mmHg), e
sem diferena de PA entre os dois frmacos anti-hipertensivos.
Entretanto, somente no grupo irbesartana foi demonstrada reduo de 33% no risco de duplicao da creatinina srica. Em
ambos os estudos no se observou reduo no risco de morte.
Em pacientes com DM1, o efeito protetor do tratamento
intensificado da HAS em pacientes com DRD e macroalbuminria foi inicialmente sugerido em ensaios clnicos no randomizados e que incluram um nmero pequeno de pacientes
(11 a 18 pacientes) h mais de 20 anos.89,96 Nesses estudos, a
reduo da PA foi efetiva em reduzir a EUA e a queda da TFG.
O efeito benfico da reduo da PA sobre EUA foi confirmado em um ECR com 129 pacientes com DM1 e macroalbuminria, todos em uso de IECA, no qual o grupo com tratamento intensificado da PA (alvo de PA mdia < 92 mmHg)
apresentou menor EUA (535 vs. 1.723 mg/24 h) em relao
ao grupo com tratamento convencional (alvo de PA mdia de
100 mmHg a 107 mmHg).89 No entanto, a queda da TFG foi
semelhante nos dois grupos. Recentemente, uma metanlise
demonstrou que o bloqueio do SRAA,97 com IECA ou BRA,
reduziu a albuminria em pacientes microalbuminricos, mas
no naqueles normoalbuminricos DM1 nem modificou a
mortalidade e a TFG.
O efeito da reduo da PA tambm foi estudado em estgios mais precoces de DRD em pacientes com DM2. ECR
demonstraram que os IECA e BRA reduzem em cerca de trs
vezes a incidncia de macroalbuminria.92,93 O estudo Microalbuminuria, Cardiovascular, and Renal Outcomes-Heart
Outcomes Prevention Evaluation (MICRO-HOPE), envolvendo pacientes com DM2,92 cerca de 55% deles portadores de
HAS, demonstrou benefcio na preveno da macroalbuminria e de eventos cardiovasculares. No estudo Irbesartan in Microalbuminuria, Type 2 Diabetic Nephropathy trial (IRMA2),93 590 pacientes com DM2, HAS e microalbuminria foram
randomizados para placebo ou irbesartana (150 mg e 300
mg). Os valores de PA mostraram-se menores nos grupos de
irbesartana combinados (irbesartana 150 mg: 143/83 mmHg
e irbesartana 300 mg: 141/83 mmHg) do que no grupo placebo (144/83 mmHg). Aps ajuste para valores de EUA basal
e de PA durante o estudo, no grupo irbesartana 300 mg, foi

08/10/2015 16:34:39

Doena Renal do Diabetes 155

demonstrada uma reduo de 44% no risco de progresso para


macroalbuminria, sem efeito na queda da TFG. Uma metanlise confirmou os efeitos benficos dos BRA e IECA em pacientes com DM2, em fases precoces da DRD.98 Foi demonstrado
um menor risco de duplicar a creatinina srica e de desenvolver
macroalbuminria. Outra metanlise revelou que o bloqueio do
SRAA,97 independentemente do medicamento utilizado, reduziu
a albuminria de pacientes com DM2 normo e microalbuminricos, porm no modificou a mortalidade e a TFG.
A ao benfica dos frmacos bloqueadores do SRAA sobre
a DRD independe da reduo da PA. De fato, uma metanlise
que incluiu 12 ECR com 698 pacientes com DM1 microalbuminricos, porm normotensos, demonstrou uma reduo de
62% na incidncia de macroalbuminria em comparao com
placebo.91 Outra metanlise publicada posteriormente, cujo
objetivo foi avaliar os efeitos de IECA e BRA sobre a DRD, e
que incluiu 10.598 pacientes com DM1 e DM2, confirmou que
estes medicamentos reduzem o risco de insuficincia renal terminal e de duplicao da creatinina srica tanto em pacientes
com microalbuminria como com macroalbuminria, embora esses agentes no tenham sido capazes de reduzir a mortalidade.58,97 O efeito de diferentes classes de anti-hipertensivos
(IECA, BRA, bloqueadores de canal de clcio, betabloqueadores e a combinao de IECA + diurtico tiazdico) foi avaliado
em uma metanlise em rede (network meta-analysis),99 cuja
tcnica estatstica permite que todas as classes sejam comparadas entre si, mesmo quando no existem ECR com determinada comparao. No foram encontradas diferenas de
mortalidade total ou de evoluo para doena renal terminal.
Somente o IECA usado isoladamente foi associado ao menor
risco de duplicao da creatinina srica (ICR 95%: 0,58; 0,32 a
0,90). Mais recentemente, outra metanlise em rede avaliou o
efeito de diferentes classes de anti-hipertensivos e o desenvolvimento de insuficincia renal terminal em pacientes com DM
e DRC.100 Nenhuma classe foi capaz de reduzir a mortalidade,
mas a associao entre IECA e BRA ou os BRA isoladamente
reduziram o risco de insuficincia renal terminal.
Em concluso, os frmacos que atuam no SRAA tm mais
efeitos benficos sobre a funo renal de pacientes com DM
do que outros anti-hipertensivos, em especial sobre a progresso para a macroalbuminria e insuficincia renal terminal. Quanto comparao do efeito renoprotetor dos BRA
com os IECA, o estudo Diabetics Exposed to Telmisartan
and Enalapril (DETAIL) mostrou resultados equivalentes das duas classes de frmacos em pacientes com DM2 e
DRD micro ou macroalbuminricos.101 Atualmente, o uso de
IECA ou BRA recomendado para todos os pacientes com
aumento da EUA (micro ou macroalbuminricos), independentemente de valores de PA.12 possvel que os efeitos dos
BRA sejam diferentes entre si. Um estudo observacional canadense com quase 55.000 pacientes com DM demonstrou
que telmisartana e valsartana foram associadas a menor risco
de internao hospitalar por eventos cardiovasculares quando comparados a outros frmacos dessa classe (candesartana, ibesartana, losartana).102 Um ECR conduzido em 4.447
pacientes com DM2 e EUA normal demonstrou que a olmesartana utilizada por 3,2 anos,103 apesar de retardar o aparecimento da microalbuminria, foi associada a maior incidncia de eventos cardiovasculares fatais, talvez relacionados

Diretrizes SBD 2015-2016 - CAP 23.indd 155

com a maior prevalncia de doena coronariana no grupo


interveno. De fato, o efeito cardiovascular dos BRA no
est completamente esclarecido.
Alguns aspectos devem ser observados com relao ao uso
de bloqueadores do SRAA. O efeito antiproteinrico dos BRA
ocorre precocemente, j 7 dias aps o incio do tratamento,
persistindo estvel posteriormente.104 Esse efeito independente da reduo na PA e dose-dependente. Aps o incio
dos bloqueadores do SRAA, pode ocorrer uma elevao da
creatinina srica de at 30% em relao aos valores iniciais.105
Nessa situao, os IECA no devem ser suspensos, pois esse
aumento associado a uma preservao a longo prazo da funo renal, incluindo pacientes com valores iniciais de creatinina srica > 1,4 mg/dl.105 Entretanto, elevaes de creatinina
srica superiores a 30% devem levantar a suspeita de estenose de artria renal. Ainda, a inibio do SRAA, especialmente com os IECA, pode aumentar os nveis de potssio srico,
principalmente quando houver insuficincia renal.106 Por essa
razo, creatinina e potssio sricos devem ser avaliados 1 ms
aps o incio do uso de IECA ou BRA.
Finalmente, o uso combinado de IECA e BRA (duplo
bloqueio do SRAA) poderia ser mais efetivo do que o uso
isolado de cada medicamento. O resultado do efeito dessa
associao sobre a albuminria controverso. O estudo The
Ongoing Telmisartan Alone and in Combination with Ramipril Global Endpoint Trial (ONTARGET),59 que incluiu
25.620 indivduos, 6.982 destes com DM, todos com risco
cardiovascular elevado, concluiu que o uso simultneo de
BRA e IECA (telmisartana e ramipril) associou-se piora de
desfecho renal composto (dilise, transplante, duplicao da
creatinina srica e morte), embora tenha ocorrido reduo
da proteinria. Esses dados pem em dvida a utilizao da
proteinria como um desfecho substituto reduo da funo renal na DRD. No subgrupo com DM, no se observou
aumento dos desfechos renais deletrios, entretanto, tambm, no se observou benefcio do duplo bloqueio. A piora da
funo renal ocorreu principalmente por necessidade aguda
de dilise, portanto, refletindo hipoperfuso renal prvia por
doena vascular. Essa observao sugere que aqueles pacientes
com doena vascular grave pioram da funo renal sob o duplo
bloqueio do SRAA. Alm disso, deve ser lembrado que o uso
combinado de BRA e IECA associou-se tambm a uma maior
frequncia de paraefeitos, como hipotenso postural, sncope
e diarreia.59 Um estudo avaliou a combinao de losartana e
lisinopril em comparao com losartana e placebo em pacientes com DM2 e EUA 300 mg/g creatinina.107 O duplo bloqueio no diminuiu o risco de DRC terminal, mas foi associado a maior risco de hiperpotassemia e insuficincia renal
aguda. Essa questo foi novamente avaliada na metanlise
em rede citada anteriormente, na qual o duplo bloqueio reduziu o risco de insuficincia renal terminal.100 A associao
com insuficincia renal aguda (odds ratio [OR] 2,69, IC 95%
0,98 a 7,38) e hiperpotassemia (OR 2,69, IC 95% 0,97 a 7,47)
no foi significativa, mas houve uma tendncia para aumento
de risco, uma vez que os intervalos de confiana inferiores
incluram o 1,00 de forma limtrofe. Assim, a segurana do
duplo bloqueio ainda controversa e, no presente momento,
no se recomenda o uso de IECA em associao com BRA no
tratamento da DRC do diabetes.

08/10/2015 16:34:39

156 Diretrizes SBD | 2015-2016

Entre os frmacos que atuam no SRAA, existem ainda os


antagonistas dos receptores da aldosterona (espironolactona)
e inibidores diretos da renina (alisquireno),108 cujo uso associado a BRA109 pode levar a maior reduo da albuminria
do que o uso isolado desses medicamentos em pacientes com
DM. A associao de alisquireno com losartana aparentemente tem um efeito antiproteinrico benfico semelhante nos
diversos estgios de doena renal, porm com mais hiperpotassemia quando a TFG < 60 ml/min.8,110 Uma reviso
sistemtica com metanlise de ECR, envolvendo 4.814 participantes, avaliou a segurana do uso associado do alisquireno
com bloqueadores do SRAA.111 Demonstrou-se que o risco de
hiperpotassemia foi maior com a associao com o alisquireno
do que com monoterapia, seja com o prprio alisquireno, com
IECA ou BRA. Recentemente, aps 33 meses, foi interrompido
um ECR que tinha por objetivo avaliar os efeitos cardiovasculares e renais resultantes da associao do alisquireno com
BRA ou IECA em pacientes com DM2 e DRD e/ou doena
cardiovascular. Embora a reduo na EUA tenha sido maior
no grupo do alisquireno, o estudo foi interrompido em razo
de maior incidncia de hiperpotassemia e hipotenso, alm de
maior risco de parada cardaca nesses pacientes.112 Em resumo, no existe at o momento qualquer indicao para o uso
combinado de frmacos inibidores do SRAA visando a maior
renoproteo em pacientes com DM e DRD.
Os alvos da PA nos pacientes com DM foram recentemente modificados. O Joint 8 (Eighth Joint National Committee)
para tratamento da HAS em adultos foi publicado em 2014 e
recomenda um alvo de PA para pacientes com DM ou com
DRC de < 140/90 mmHg.113 O consenso de DRD da ADA
de 2014 endossou o alvo mais alto,114 assim como a diretriz
da ADA de 2015, mas esta ltima admite um alvo mais baixo ( 130/80) em pacientes jovens e quando este puder ser
atingido sem a necessidade de um grande nmero de frmacos.12,113,115,116 No entanto, a adoo desses alvos discutvel
tendo em vista os resultados do estudo Hypertension Optimal
Treatment (HOT),115 no qual o alvo de PA diastlica, cerca
de 80 mmHg, foi relacionado com menor risco de desfechos
cardiovasculares do que o alvo de aproximadamente de 90
mmHg; e do estudo Action to Control Cardiovascular Risk
in Diabetes (ACCORD),116 no qual valores de PA sistlica de
cerca de 120 mmHg foram associados ao menor risco de AVC
do que valores > 130 mmHg. Assim, recomendamos um alvo
de PA 140/80 mmHg para a maioria dos pacientes, mas uma
PA sistlica 130 deve ser considerada em pacientes jovens ou
com risco aumentado de AVC.
As recomendaes gerais para os pacientes diabticos hipertensos so aplicveis queles com DRD. Para atingir os alvos recomendados,117 so geralmente necessrios trs a quatro
agentes anti-hipertensivos. O tratamento deve ser iniciado com
um inibidor do SRAA, devido ao conhecido efeito renoprotetor desses frmacos. Alguns estudos favorecem o uso dos IECA
como escolha inicial, uma vez que existe ainda dvida se algumas classes de BRA poderiam aumentar a mortalidade.103,104
Alm disso, na escolha do medicamento, deve ser lembrado
que a reduo da albuminria, empregada como um desfecho
substituto, nem sempre acompanhada de reduo de mortalidade ou perda de funo renal avaliada pela TFG (desfechos
duros).58,59,97,104 Os pacientes com PA sistlica 20 mmHg e PA

Diretrizes SBD 2015-2016 - CAP 23.indd 156

diastlica 10 mmHg acima do alvo devem iniciar o tratamento com dois agentes anti-hipertensivos. Nesses casos, um IECA
ou um BRA associado a diurtico tiazdico em baixa dose (12,5
a 25 mg/dia) pode ser utilizado. Para aqueles pacientes com a
TFG < 30 ml/min (creatinina srica de 2,5 a 3 mg/dl) indicado o uso de diurtico de ala (furosemida).117 Na presena de
efeitos colaterais dos IECA, como tosse, os BRA so uma excelente alternativa, sendo os agentes preferidos para os pacientes
com DM2 com hipertrofia ventricular esquerda e/ou micro ou
macroalbuminria.9294,118 Outros agentes anti-hipertensivos
adicionais devem ser utilizados conforme a necessidade. Os
betabloqueadores so especialmente indicados para pacientes
com cardiopatia isqumica por reduzirem eventos cardiovasculares e mortalidade nos pacientes com frequncia cardaca >
84 bpm.106 A combinao de betabloqueadores e bloqueadores
do canal de clcio do tipo no di-hidropiridnicos (verapamil,
diltiazem) no deve ser utilizada, pois ambos os agentes apresentam efeito cronotrpico negativo. Quanto ao horrio de
administrao dos frmacos, um ECR demonstrou que a administrao de pelo menos um medicamento anti-hipertensivo
noite reduziu a PA noturna e os desfechos de morte cardiovascular, infarto agudo do miocrdio e AVC.119 Os desfechos
renais no foram avaliados neste estudo, mas, tendo em vista o
benefcio encontrado, h a recomendao de que pelo menos
um dos frmacos anti-hipertensivos seja utilizado noite.

Interveno diettica
As publicaes mais recentes da ADA recomendam que pacientes com aumento de EUA no sejam submetidos a dietas
com restrio proteica por estas no terem efeitos sobre o declnio da TFG ou na melhora de fatores de risco cardiovascular e controle glicmico.12,120122 Entretanto, sugerem que
restrio de protenas da dieta (0,8 g/kg de peso ideal/dia) seja
adotada nos pacientes que apresentam progresso da DRD
(EUA elevada e reduo de TFG) apesar de controle glicmico
e pressrico adequados e do uso de medicamentos inibidores
do sistema renina-angiotensina-aldosterona.12 Essas publicaes no incluram uma metanlise recentemente publicada
com 779 pacientes de 13 ECR que demonstrou haver benefcio
de uma dieta pobre em protenas, tanto em relao melhora
da TFG quanto reduo da proteinria em pacientes com
DRD.123 Importante citar que esses efeitos benficos ocorreram especialmente nos pacientes que aderiram dieta. Alm
da dificuldade de adeso dieta,124 outro possvel fator de confuso capaz de explicar em alguns estudos a ausncia de efeitos
benficos o uso sistemtico de IECA e BRA associado a um
controle intensificado da PA.125 De fato, em estudo no qual o
uso de inibidores do SRAA ocorreu em menor proporo e
o controle da PA foi menos estrito,126 os efeitos benficos da
interveno diettica sobre a funo renal foram significativos.
Alm da reduo de protenas da dieta, possvel que o
tipo ou origem da protena seja importante no tratamento da
DRD. Em estudos de curta durao que compararam o efeito sobre a funo renal do consumo de protena de origem
vegetal ou animal no foi observada qualquer diferena entre as dietas avaliadas.127,128 Entretanto, um ECR com 4 anos
de durao que envolveu 41 pacientes com DM2 demonstrou
que uma dieta normoproteica com adio de soja texturizada

08/10/2015 16:34:39

Doena Renal do Diabetes 157

(contedo proteico: 35% animal, 35% soja e 30% vegetal) foi


capaz de reduzir a proteinria quando comparada com uma
dieta-controle (contedo proteico: 70% animal e 30% vegetal).129
A interveno dietoterpica sobre o contedo lipdico da
dieta mediante substituio da carne vermelha pela de galinha,
esta ltima rica em cidos graxos poli-insaturados, mostrou-se
capaz de diminuir, em curto prazo, a EUA em pacientes com
DM2 microalbuminricos e macroalbuminricos.130,131 De
fato, os cidos graxos poli-insaturados, incluindo os de origem
vegetal, parecem ter um efeito protetor sobre a albuminria,
conforme sugerido em um estudo transversal realizado em pacientes com DM2.132 Uma observao importante que o efeito
de reduo da EUA resultante da dieta base de carne de galinha no foi diferente do efeito do enalapril em um ECR com 12
meses de durao em pacientes DM2 microalbuminricos.133
Ainda, no tocante aos lipdios da dieta, existe a sugesto de que
o uso de leo de cozinha rico em diacilglicerol, quando comparado com leo rico em triacilglicerol, poderia, em pacientes
com DM2, reduzir a progresso da DRD avaliada pelo aumento da creatinina srica em curto prazo.134 tambm possvel
que os cidos graxos w-3 da dieta estejam relacionados com a
EUA. A histria diettica de 1.436 participantes do DCCT foi
revista e demonstrou-se que a maior ingesto de cido eicosapentaenoico (EPA) e cido docosaexaenoico (DHA) foi inversamente associada a valores de EUA.135 De fato, reviso extensa
sugere que os cidos graxos de cadeia longa, especialmente do
tipo w-3 (encontrado no leo de peixe), so capazes de reduzir
a albuminria.136
Ao serem feitas recomendaes dietoterpicas para o paciente com DRD, deve-se levar em considerao que, em sua
maioria, esses pacientes so portadores de HAS e a reduo da
ingesto de sal deve ser um objetivo nutricional dos pacientes
com DRD.122 Uma reduo de ingesto de sdio (< 1.500 mg/
dia de sdio ou 3,75 g/dia de sal) faz parte das recomendaes dietoterpicas feitas pela ADA para pacientes com DM e
HAS. 12 A diminuio de sal na dieta especialmente importante, pois potencializa os efeitos anti-hipertensivos dos frmacos.137 Alm disso, j foi demonstrado em pacientes com
DRD um maior benefcio de efeitos renais e cardiovasculares
dos BRA quando associados a maior reduo na ingesto de
sal.138 A restrio de sal deve estar includa dentro de um padro de dieta tipo DASH (elevado consumo de frutas, vegetais
e produtos lteos magros).12 Em pacientes com DM2, esse padro de dieta foi vinculado a menores valores de PA.139 Tal
efeito benfico foi recentemente comprovado em ECR no qual
a dieta DASH associada recomendao de caminhadas reduziu a PA sistlica de 24 h em 12 mmHg.140 Entretanto, essa
dieta no recomendada para pacientes em dilise.141,142
Um padro de dieta com mais do que uma interveno
possivelmente protetora da funo renal foi testado em um
ECR com 4 anos de durao, realizado em 191 pacientes com
DM2 proteinricos.143 Neste ECR, foram comparadas uma
dieta pobre em carboidratos (40% do valor calrico total), pobre em ferro (sem carne vermelha, apenas frango e peixe) e
rica em polifenis (vinho tinto e leo de oliva extravirgem)
com uma dieta hipoproteica (0,8 g/kg/dia). A dieta teste foi
mais efetiva em reduzir a progresso de perda de funo renal
(duplicao de creatinina srica e insuficincia renal terminal)
e a mortalidade em geral.143

Diretrizes SBD 2015-2016 - CAP 23.indd 157

Suplementos nutricionais poderiam tambm ser teis no


tratamento da DRD. A suplementao na dieta com cidos
graxos poli-insaturados tem resultados controversos sobre a
EUA: ao neutra (cidos graxos w-3 leo de peixe),144 efeito
de reduo (cido etil-eicosapentanoico) ou de aumento (cido linoleico).145,146 J a suplementao com vitaminas C e E
diminuiu a EUA em pacientes com DM2 microalbuminricos
em um ECR de curta durao.147 A adio de zinco e magnsio vitamina C e E parece ter um efeito sinrgico sobre a
reduo da EUA em pacientes com DM2 normoalbuminricos e microalbuminricos.148 Tambm a suplementao com
tiamina (vitamina B1) em doses elevadas foi capaz de reduzir
a EUA.149 No entanto, o uso de doses elevadas de vitamina
B6 e B12, associadas ao cido flico, piorou a funo renal e
aumentou eventos cardiovasculares e mortalidade por todas
as causas analisadas como evento combinado, conforme demonstrado em recente ECR realizado em pacientes com EUA
> 300 mg/24 h ou proteinria 500 mg/24 h.150
Em concluso, dietas base de carne de galinha ou base
de soja, ou ainda dietas com intervenes alimentares mltiplas, podem representar uma alternativa no manejo da DRD,
porm so ainda necessrios estudos com um maior nmero
de pacientes e em mais longo prazo. Quanto utilizao de
suplementos, devido ao nmero limitado de pacientes estudados, segurana a longo prazo e, em geral, curto tempo de
durao dos estudos, no existem evidncias suficientes que
justifiquem a recomendao do seu uso no tratamento da
ND. A recomendao atual de dieta para a DRD ainda a
restrio de protenas apenas nos pacientes com EUA elevada
(> 300 mg/24 h) e com reduo progressiva da TFG (< 60 ml/
min/1,73 m). Alm disso, a restrio de sal com a adoo de
uma dieta tipo DASH recomendada.

Dislipidemia
A avaliao do efeito da reduo dos lipdios sricos com
medicamentos hipolipemiantes sobre a mortalidade e a progresso da DRD em pacientes com qualquer grau de DRC foi
descrita em uma reviso sistemtica com metanlise realizada pela NKF (National Kidney Foundation).151 As estatinas
no diminuram a mortalidade geral ou cardiovascular nessa
populao e este resultado no dependeu da dose utilizada.152 J quando avaliado o risco de eventos cardiovasculares combinados nos pacientes com DM e DRC, as estatinas
mostraram-se benficas, com reduo desse desfecho.34 No
que diz respeito aos desfechos renais, tais medicamentos no
apresentaram efeito sobre a albuminria, embora em subanlises de dois importantes ECR o uso de estatinas tenha
sido associado a menor queda de TFG.152,153 Portanto, a NKF
recomenda o uso das estatinas com o objetivo de reduzir
eventos cardiovasculares,34 e no mortalidade, em pacientes
diabticos pr-dialticos. Esta recomendao foi reforada
em publicao recente.154
Em pacientes em hemodilise, a atorvastatina no reduziu
mortalidade cardiovascular, infarto e acidente vascular cerebral
(desfecho composto) em um perodo de 4 anos.155 Tambm
a rosuvastatina no reduziu desfechos cardiovasculares e/ou
mortalidade como demonstrado em um ECR com 2.776 pacientes em hemodilise.156 No entanto, em anlise post-hoc dos

08/10/2015 16:34:39

158 Diretrizes SBD | 2015-2016

731 pacientes com DM tipo 2, observou-se uma reduo do risco de eventos cardacos fatais e no fatais com o uso da rosuvastatina.157 Mais recentemente, no estudo SHARP, a combinao
de estatina com ezetimibe tambm no reduziu o risco de desfechos primrios nos pacientes em dilise.158 Esses dados indicam que, apesar de reduo significativa observada nos valores
do LDL, o uso de estatina deve ser anterior perda importante
da funo renal,159 e no se recomenda iniciar o medicamento
em pacientes em dilise com o objetivo de preveno primria
de eventos cardiovasculares. Entretanto, no existem dados que
recomendem a suspenso de estatinas quando j estiverem em
uso antes do incio da dilise,151 sendo sugerida, nesta situao,
a manuteno da estatina.160
O benefcio dos fibratos sobre preveno secundria de
eventos cardiovasculares combinados foi demonstrado somente em um estudo no qual os valores de triglicerdios no
fizeram parte dos critrios de incluso.161 J em relao a
desfechos renais na DRD, os fibratos parecem no ter efeito
sobre a progresso da EUA,162,163 embora ocorra nestes pacientes maior regresso de EUA elevada para normoalbuminria.151,163 Portanto, os fibratos somente devem ser usados
no caso de triglicerdios muito elevados (> 1.000 mg/dl) para
reduzir o risco de pancreatite aguda. Nos pacientes com DRC
estgios 4 e 5, est indicado apenas o uso do clofibrato e genfibrozila, ambos com doses ajustadas de acordo com TFG.34
Recentemente, foi publicada a diretriz da KDIGO sobre o
manejo dos lipdios nos pacientes com DRC em geral.164 Nesta
diretriz, recomenda-se que os valores de LDL sejam utilizados apenas para clculo do risco cardiovascular, porm no
mais para deciso de indicar o uso de hipolipemiantes. Esta
recomendao baseia-se no fato de que a reduo do risco cardiovascular resultante do uso de estatinas constante nos diferentes nveis de LDL, sugerindo que esse benefcio seja mais
proporcional ao risco cardiovascular basal do que aos nveis
de LDL. A diretriz recomenda o uso de estatina nos pacientes
com 50 anos de idade e DRC, mas no em dilise ou com
transplante renal prvio. Para os pacientes com < 50 anos e
DRC, recomenda-se o uso de estatina se estiver presente um
dos seguintes fatores: doena coronariana estabelecida, DM,
doena cerebrovascular prvia ou risco de evento coronariano
em 10 anos > 10%.
No mesmo ano, foi publicada a diretriz do ACC/AHA
(American College of Cardiology/American Heart Association) sobre o tratamento da dislipidemia.60 Na mesma linha
de pensamento, a diretriz contraindicou o uso do LDL como
alvo de tratamento, baseando-se no fato de que, nos ECR existentes, a interveno foi baseada no uso ou no de estatina e
no nos alvos de LDL. Entretanto, essas recomendaes geraram muitos debates e controvrsia, em especial pela indicao
de uso de estatinas em todo paciente com risco cardiovascular
calculado igual ou superior a 7,5% em 10 anos (calculado por
meio de uma nova calculadora).165,166 Sobretudo, o uso desta
calculadora nos pacientes com DM questionvel, j que o
DM por si s confere risco cardiovascular aumentado. Portanto, apoiando-se em ensaios clnicos que focam pacientes com
DM, a ADA recomenda que o uso de estatina seja baseado
na idade (< 40 anos, 40 a 75 anos e > 75 anos) e na presena de fatores de risco cardiovascular (colesterol LDL 100
mg/dl, hipertenso, tabagismo e sobrepeso ou ob