Chapter 11 DNA Replication

11/04/2013

Nucleic Acids: information storage and transmission

Genes are the units of heredity and are made of nucleic acid (DNA)
Nucleic acids are polymers of nucleotides linked together by
dehydration synthesis reactions
Nucleotides are the building block of molecules of a nucleic acid and
are composed of a sugar, a phosphate group, and a nitrogenous base

The sugar and phosphate groups form the nucleic acid backbone
Nucleic acid backbone has directionality (3 vs. 5) antiparallel
(think of a highway)
Antiparallel: parallel, but going in opposite directions

If DNA were compared to a book, the sugar and phosphate groups

would only be the binding of the book. The actual words, or genetic
information would be contained in the nitrogenous bases
4 bases in DNA:
o Purines
Guanine
Adenine
o Pyrimidines
Cytosine
Thymine
G forms bonds with C
A forms bonds with T
There are two families of nitrogenous bases:
o Pyrimidines and Purines

o Pyrimidines are nitrogenous bases characterized by a sixmembered ring made up of carbon and nitrogen atoms

o Purines are nitrogenous bases characterized by a fivemembered ring fused to a six-membered ring where both
rings are made up of carbon and nitrogen atoms

Evidence that DNA is the genetic material

In a eukaryotic cell, the DNA content double prior to cell division
During cell division the doubled DNA is divided equally between the
two daughter cells
In 1947, Erwin Chargaff from Columbia University used paper
chromatography to separate the bases of the DNA from different species
(fish, humans, bacteria, etc.)
Found that the base composition (number of As, Ts, Gs, Cs) varied
between species
Adenine (A) = Thymine (T)
Guanine (G) = Cytosine (C)
There was a relationship between the bases
Chargaffs rules
o A=T
o G=C
Watson and Crick (and others) discovered the double helix
Remember the structure of the monomer (nucleotide)


and the polymer (single strand DNA)

Understanding the structure of DNA

Physical structure evidence
Rosalind Franklin (1920 1958)
Gifted x-ray crystallographer
Lead to the double helix model

2 strands are antiparallel


Specific-base pairing complementary base pairs the key to solving
puzzle
A-T and G-C pairs, explained Chargaffs Rules

DNA Length
DNA in a typical human cell is about 2 meters long
Must be contained within a cell about 10 m in diameter
So in American units if the average cell were an inch in diameter,
the DNA contained inside of it would be about 3 miles long
Genes

The Human Genome Project revealed that most of the DNA of

humans does not encode mRNAs or any other RNAs. Appear to
serve no purpose whatsoever in our life cycle
Craig Ventor
Accounts for an astonishing ~98.5% of human chromosomal DNA
These non-coding regions are similar in humans, but not identical.
Accounts for your DNA fingerprint. Called mini-satellite sequences

Mini-satellite sequences:

DNA evidence is used to Fingerprint people with different minisatellites

Forensic DNA Analysis

Became commercially available in 1987
Since then, there have been thousands of people who have avoided
wrongful accusation of crimes. Over 200 rulings have been
overturned due to DNA analysis
Called the DNA 200. Group of unjustly imprisoned people who
served, on average, 12 years in prison
Recombinant DNA
The combination of DNA from 2 or more organism into a single DNA
molecule
This is how many important proteins such as insulin, HGH, and EPO
are commercially produced today
Insulin
The gene that encodes for insulin production in humans is snipped
out of human DNA and inserted into the DNA of an E. Coli
bacterium
These bacteria reproduce extremely quickly, and the new
generations of bacteria all produce insulin in enormous quantities
This is the insulin that diabetics inject on a daily basis. First
genetically engineered drug approved by the FDA in 1982

Human Growth Hormone (HGH)

Produced by the human pituitary gland. Insufficient production of
HGH leads to dwarfism
HGH increases protein synthesis, burning of body fat, and growth in
nearly every part of the body. Used to combat weight loss in AIDS
patients
Before 1994, treatment was extremely expensive because HGH had
to be extracted and purified from the pituitary gland of human
cadavers
Through recombinant DNA discoveries, it is now available for the
low low price of only $7500 for a months supply
Erythropoietin (EPO)
Hormone produced by the kidney that stimulates red blood cell
production
It is used to treat anemia resulting from chemotherapy, eating
disorders, and lung disease
Increases the bodys ability to transport oxygen to cells and tissues
Since 1985, EPO has been produced through recombinant DNA
technology in hamster ovaries
Been implicated in blood-doping scandals in professional sports.
Can be very dangerous because it thickens the blood, increasing the
changes of heart attack
Sales of EPO exceeded $10 billion in 2004
DNA Technology in Agriculture
One of the biggest problems farmers face is destruction of crops by
insects, leading to the use of dangerous pesticides
In 1961, a bacteria was discovered that produced a crystal spore
that was harmless to plants and humans, but deadly to insects
For years, this discovery led to the inclusion of these bacterial
spores in pesticides
In 1995, recombinant DNA technology was used to actually insert
the bacterial gene for the production of this spore into the actual
plants DNA. Now the plant produces the crystal spore that kills the
insects. Pesticides no longer used.
Featherless Chickens
Recently, featherless chickens were developed through recombinant
technology
Believed to be easier and less expensive to prepare for market,
lowering costs for farmers, and lowering prices for consumers

Found to be vulnerable to mosquito attacks, parasites, disease, and

sunburn. Also, they had difficulty mating because the males are
unable to flap their wings

DNA replication

The process of DNA replication is conceptually easy, but reality of the

process is very complex
Requires 20+ enzymes and accessory proteins
Extremely rapid
o Prokaryote 500 nucleotides added per second
o Humans 50 nucleotides added per second
Accurate about 1 in a billion chance of a mistake
Three fundamental steps:
Double helix unwinds and strands separate
Each strand can act as a template
A new strand winds up with an old strand

Semiconservative replication

In this model, each new DNA double helix would be made of a strand
of old DNA and a strand of new DNA
2 copies old-new paired

Where it starts

The DNA strands are separated by an enzyme called helicase to

form a replication bubble

At each end of that replication bubble is a replication fork where

the new strands are being synthesized
Replication forks are the Y-shaped regions of replicating DNA
molecules where new strands are growing

Synthesis of the new strands

DNA polymerase
Synthesis occurs in 5 3 direction
Therefore synthesis is bidirectional

The fragments of the lagging strand are joined by another enzyme

called DNA ligase

Because of the bidirectional nature of the replication, one strand is

synthesized in a continuous manner (leading strand) then opposing
strand (lagging strand) is synthesized in pieces

Leading Strand Synthesis

DNA Polymerase is moving in the same direction as the helicase.

Adds complimentary nucleotides in the 5 to 3 direction

Lagging Strand Synthesis

DNA Polymerase is moving in the opposite direction as the helicase

1.

2.

Transcription
nucleus
DNA gets transcribed into mRNA (messenger RNA on transcript)
DNA RNA
Translation
Outside the nucleus
On a ribosome
mRNA transcript gets translated into a protein
mRNA (nucleotides) protein (amino acids)
tRNA (transfer RNA): reads the nucleotide language and converts it
to amino acid language
rRNA (ribosomal RNA): physically makes up the ribosome

3 consecutive nucleotides in a transcript is one codon

every codon codes for one particular amino acid to be added to the
protein

Bases in

DNA: GATC
RNA: GAUC

DNA is the instructions (program) that tells the cell what to do

Proteins are the results of these instructions

DNA RNA Proteins

Step one DNA to RNA
This process is called transcription
Transcription is the synthesis of RNA using DNA as a template
The RNA is complementary to the DNA
RNA that is synthesized from a gene coding for a protein is called
messenger RNA (mRNA) or a transcript
Differences between DNA and RNA
1. Sugar deoxyribose (DNA) vs. ribose (RNA)

a.
2. Base thymine (DNA) is replaced by uracil (RNA)

During transcription of a gene, only one strand (template strand) of

the DNAs two strands is read
Different genes use different strands as the template strand

Step two RNA to protein

This process is called translation
Translation: the synthesis of a polypeptide (protein) directed by
mRNA

Why is this process referred to as translation?

Converting the language of nucleic acids into the language of
proteins
o 4 bases in nucleic acids
o 20 amino acids in proteins
Transfer RNA (tRNA) and ribosomal RNA (rRNA) act as the
interpreter between the nucleotide language of mRNA and the amino acid
language of proteins
In the genetic code, a triplet of nucleotides specifies an amino acid

There are 4 nucleotides in RNA and 20 amino acids

4 different nucleotides, combining as codons, which are 3nucleotide sequences
Math would dictate that there could potentially be as many as 64
amino acids (4^3)
But there are only 20 amino acids, since each amino acid is usually
encoded by more than one codon
60 of the 64 possible codons code for amino acids
The remaining four codons signal translation to start (start codon)
and translation to stop (stop codon)
Since there are only 20 amino acids, more than one codon can code
for the same amino acid
This relationship makes the code redundant, or degenerate

Question: Why are only 20 amino acids formed from the 64 possible
combinations of the bases?
An amino acid can be encoded by more than one nucleotide
triplet
Transcription Initiation

RNA polymerase binds to the promoter region of DNA near the

beginning of a gene, separating the double helix near the promoter

Transcription - Elongation

RNA polymerase travels along the DNA template strand, catalyzing

the addition of ribose nucleotides into an RNA molecule
The nucleotides in the RNA are complementary to the template
strand of the DNA

Transcription Termination

At the end of a gene, RNA polymerase encounters a sequence of

DNA called a termination signal
RNA polymerase detaches from the DNA and releases the RNA
molecule

Conclusion of transcription

After termination, the DNA completely rewinds into a double helix

The RNA molecule is free to move from the nucleus to the
cytoplasm for translation, and RNA polymerase may move to
another gene and begin transcription once again, or it can even rebind the same promoter and transcribe the same gene again

Question: What is the order of steps in the transcription process?

Initiation, elongation, termination
Question: How does initiation begin?
RNA polymerase finds a promoter region and binds, causing
the DNA double helix to unwind

If the mRNA transcript AUGCGCUGCAAU were to leave the nucleus and

undergo translation at a ribosome, what would be the sequence of
anticodons translating this nucleotide into a protein
UACGCGACGUUA
Translation is the RNA-directed synthesis of proteins
During translation, proteins are synthesized according to the
genetic message of sequential codons in the mRNA
Messenger RNA (mRNA)

The sequence of nucleotides present in the DNA is reflected by the

sequence in the mRNA
And
The sequence of nucleotides in a mRNA determines the sequence of
amino acids
And
The sequence of amino acids determines the protein

The ribosome is where proteins are built

The ribosome coordinates the pairing of tRNA anticodons with
mRNA codons

Composed of ribosomal RNA (rRNA) and protein

The subunits combine as a ribosome only when they are translating
a protein

The P site holds the tRNA with the polypeptide chain attached
o Where the protein that has been made so far will be found
The A site hold the tRNA with the next amino acid to be added
o Where the next tRNA containing the next amino acid will be
found
The ribosome holds all the components together as enzymes
transfer the next amino acid to the growing polypeptide chain
Catalytic site: contains the enzyme needed to form peptide bonds
between amino acids

Question: Where does protein synthesis occur?

On the ribosomes outside the nucleus
Transfer RNA (tRNA)

tRNA acts as the interpreter between the nucleotide language of

mRNA and the amino acid language of proteins
In part of this role as interpreter, the tRNA must read the mRNA
This is accomplished by the anticodon portion of the tRNA
The other portion of the tRNAs role as interpreter is to transfer
the correct amino acid from the cytoplasmic pool of amino acids to
the ribosome for protein synthesis

Using this
One Codon One Anticodon One Amino Acid
Method the gene is decoded to synthesize a protein

As in transcription, translation (protein synthesis) occurs in three

stages:
1. Initiation
2. Elongation
3. Termination
The initiation complex binds to an mRNA molecule
The methionine (met) tRNA anticodon (UAC) base pairs with the
start codon (AUG) of the mRNA

Elongation: the methionine from the initiator tRNA forms a peptide

bond with the amino acid on the tRNA at the A site
o This leaves the tRNA at the P site with no amino acid, and the
tRNA at the A site with a dipeptide attached

The ribosome moves one codon down the mRNA

This translocates the tRNA (with the growing peptide) from the A
site to the P site

The mRNA reaches a stop codon: UAA, UAG, or UGA

Stop codon is a triplet codon that signals the end of translation

Mutations are permanent changes in the DNA that can involve large
chromosomal regions or a single nucleotide pair
Point mutations are mutations limited to one or two nucleotides in a
single gene, and can affect the function of a protein

Substitutions are the replacement of one base with another


Insertion is the insertion of one or more nucleotide pairs into a gene

Deletion is the deletion of one or more nucleotide pairs from a gene


Translation happens on the ribosome
5 = the beginning
EXAM QUESTION:
DNA: 3 GAC 5
RNA: 5 CUG 3
Or
DNA: 5 GGA 3
RNA: 3 CCU 5
5 must always be first so answer is written as 5 UCC 3
Transcription:
DNA mRNA (nucleus)
mRNA protein (ribosome)
Start Codon: Almost always AUG which codes for the amino acid
Methionine (Met)
This amino acid is almost always the first amino acid in proteins
Know the 3 Stop codons:

UGA
UAA
UAG

How many amino acids long will the protein coded by this mRNA be?
5 GCCAGCAUGCCCAAUGCCAGCUGACCG 3
START
STOP
It would be 5 amino acids long (you DO NOT count the stop codon)

Evolution is a change in the genetic makeup of a population over time

as a result of natural selection
The main ideas of evolution were not widely accepted until after
Charles Darwin published On the Origin of Species in 1859
Pre-Darwinian thought held that all organisms were created
simultaneously by God, and that each distinct life-form was
permanently fixed and did not change over time
So how did the concept of Evolution come about?
Exploration of new lands revealed a staggering diversity of life
o Early explorers often took naturalists along to catalogue the
plant and animal life they found
o The number of species was far greater than expected
o The vast numbers of species observed allowed naturalists to
see patterns that had not emerged before
Each area had its own distinctive set of species
Some species closely resembled one another yet
differed in some characteristics
These patters seemed inconsistent with the idea that
species were fixed and unchanging
Fossils revealed that life has changed over time
Fossils the preserved remains or traces of organisms that died
long ago
Discovered in many forms:
o Petrified remains of bones, wood, shells, or their impressions
left in mud
o Most are found in sedimentary rock
William Smith, a British surveyor, recognized that certain fossils
were always found in the same layers of rock

o Many rocks occur in layers, with newer layers positioned over

older layers
Also, the organization of fossils and rock layers was consistent with
the fossils of a given type always in the same layers
Most fossils found in the oldest, deepest layers were very different
from modern organisms
The resemblance to modern organisms gradually increased in
progressively younger, more shallow rocks
Many of the fossilized species were extinct

The fossil evidence led to a revolutionary conclusion:

Different types of organisms had lived at different times in the past
This countered the view that species were created at one time and
did not change afterwards
Fossils of Extinct Organisms

Some scientists devised non-evolutionary explanations for fossils:

To account for the existence of extinct species while preserving the
notion of a single creation by God, Georges Cuvier (1769 1832)
proposed the theory of catastrophism
o High numbers of species were created originally
o A series of catastrophes produced rock layers and destroyed
many species, preserving some as fossils
o Modern day species are the survivors of these catastrophes
Geological evidence led to several conclusions:
Earth is far older than the 6,000 years proposed by theologians
There was enough time for evolution to occur
Modern geologists estimate that the Earth is about 4.5 billion years
old
Charles Darwin and Alfred Russel Wallace proposed a mechanism of
evolution
By the mid-1880s, a growing number of biologists had concluded
that present-day species had evolved from earlier ones
o But how?
o 1858, Charles Darwin and Alfred Russel Wallace
independently provided evidence of the occurrence of
evolution and proposed the mechanism for how it occurs
Darwin and Wallace both had traveled extensively and studied
plants and animals in detail
o Both had observed that some species differ in only a few
traits
o Both knew that fossils showed a trend of increasing
complexity
o Both were aware that the Earth is extremely old
Darwins Finches, Residents of the Galapagos Islands


Darwin and Wallace independently proposed that organisms evolved by
natural selection
Both presented papers to a biological journal in London in 1858
Darwin published On the Origin of Species by Means of Natural
Selection in 1859
o Proposed that individuals evolved through a process of
descent with modification
Individuals in each generation differ slightly from the
members of the preceding generation
Over long time periods, small genetic differences
accumulate to produce major transformations
Darwin and Wallaces theory was based on 4 principles:
Principle 1: Individual members of a population are different from
one another
o We now know that variations arise purely by chance resulting
from random mutations in DNA
o The difference are obvious in many physical characteristics
and extend to the genetic level
o Variation in a Population of Snails:

Principle 2: At least some of the differences between members of

a population are characteristics that may be passed from parent to
offspring (inheritable)
o However, the mechanism of inheritance was not understood
at this point in time (Mendel 1890s)
Principle 3: In each generation, some individuals in a population
survive and reproduce successfully. Others do not.
o Darwin observed that many more individuals are born than
survive to reproduce
o Some individuals have more offspring than others
Principle 4: Individuals with advantageous traits survive longest
and produce the most offspring, a process known as natural
selection
o In the competition to survive and reproduce, winners are
determined not by chance, but by the traits they possess

TEST QUESTION: What actually changes over time?

The genes in a population
Natural selection modified populations over time
Natural selection acts on individuals within a population; however, it
is the population that changes over time
o Over generation, the population changes, as the percentage
of individuals inheriting favorable traits increases
o An individual cannot evolve, but a population can
How Do We Know That Evolution Has Occurred?
An overwhelming body of evidence in multiple areas of science
supports the theory of evolution
1. Fossils provide evidence of evolutionary change over time
2. Comparative anatomy gives evidence of descent with modification
3. Embryological similarity suggests common ancestry

4. Modern genetic analyses reveal similarities in genes among diverse

organisms
1. Fossils provide evidence of evolutionary change over time
a. Several series of fossils have been found that exhibit the evolution
of body structures over time
i. One series reveals that modern whales evolved from landdwelling ancestors
ii. The Evolution of the Whale
iii.

2. Comparative anatomy gives evidence of descent with modification

a. Comparing the bodies of organisms of different species has
revealed differences that could result only from evolutionary change
during descent from a common ancestor
i. Homologous structures are structures that have the same
evolutionary origin despite their current appearance or function
ii. Bird and mammalian forelimbs are homologous structures
iii. The forelimbs are used for flying, swimming, running, and
grasping
iv. Despite their different uses, they have strong anatomical
similarities
v. Such similarity is exactly what we would expect if bird and
mammal forelimbs were derived from a common ancestor
vi. Homologous Structures

vii.
a. Vestigial structures are remnants of structures that are inherited
from ancestors
i. Molar teeth in vampire bats (which live on a diet of blood and,
therefore, dont chew their food) are vestigial structures.
Tonsils, a tailbone, and the appendix in humans.
3. Embryological similarity suggests common ancestry
a. All vertebrate embryos resemble one another in their early
development
b. All vertebrate embryos possess genes that direct development of
gill slits and a tail
c. Adult fish retain gills and tail because the genes are active
throughout their embryonic development
d. Humans are born without gills and a tail because the genes are
active only during early embryonic development
e. Embryological Stages Reveal Evolutionary Relationships

i.

4. Modern genetic analyses reveal similarities among diverse

organisms
a. All organisms share related biochemical processes
i. All cells use DNA as a genetic blueprint
ii. All use RNA, ribosomes, and approximately the same genetic
code for translation
iii. All use roughly the same set of 20 amino acids to build proteins
iv. All use ATP to transfer energy
Controlled breeding modifies organisms
Artificial selection is selective breeding to produce plants and
animals that possess desirable traits
o Modern dogs are descended from wolves
o In only a few thousand years, humans are artificially selected
for all breed of modern dogs
o Dog Diversity Illustrates Artificial Selection
o

Humans have created tremendous variation in several species over

relatively short periods of time through artificial selection
o Isnt it logical to assume that much larger changes could
result from hundreds of millions of years of natural
selection?

Evolution by natural selection occurs today

Female guppies prefer to mate with brightly colored males;
however, brightly colored males are more likely to be eaten by
predators
o Males found in areas without predators were brightly colored
o Males found in areas with predators were duller by
comparison (predators eliminated brightly colored males
before they could reproduce)

o The conclusion was that when fewer predators are present,

brighter coloration can evolve
o An experiment confirmed the conclusion
Predators were introduced to previously predator-free
areas (where males were brightly colored)
Within a few generations, male guppies in those areas
evolved to become less colorful
o Guppies Evolve to Become More Colorful in Predator-Free
Environments

The insecticide bait Combat is used to kill roaches

o However, a few roaches possessed a rare mutation that
caused them to dislike glucose, the main ingredient in
Combat
o Because the roaches that did not eat the Combat bred
successfully, soon the mutation spread throughout the
population, making the insecticide ineffective
o Combat had acted as an agent of natural selection
o Every pesticide in existence has become harmless to at least
one of the insect species it is designed to kill