Académique Documents
Professionnel Documents
Culture Documents
DOI 10.1007/s11259-008-9071-9
ORIGINAL ARTICLE
50
Introduction
Melatonin (N-acetyl-5-methoxytryptamine), an indole hormone is synthesized from
serotonin in the pineal gland and other extra-pineal tissues (Tamarkin et al. 1985; Masana
and Dubocovich 2001). In birds, melatonin regulates circadian rhythm, hibernation,
feeding pattern, thermoregulation, and neuroendocrine function (Reiter 1980; Tamarkin et
al. 1985; Malpaux et al. 2001; Adachi et al. 2002). In mammals, melatonin also influences
the reproductive function via activation of receptor sites within the hypothalamicpituitary-gonadal axis (Reiter 1980; Malpaux et al. 2001). Melatonin regulates ovarian
function through activation of multiple receptors and signaling pathways on different
target cell types especially theca and granulosa cells (Soares et al. 2003).
In birds, melatonin binding sites were identified in the ovaries, suggesting a possible role
of melatonin in various ovarian functions (Ayre et al. 1992; 1994; Ayre and Pang 1994).
However, the distribution of mRNA expression of melatonin receptors in ovarian structures
has not been reported. In chicken, three subtypes of melatonin receptors (Mel-1a, Mel-1b,
and Mel-1c) with nearly identical pharmacological profiles have been described in neural
tissues (Natesan and Cassone 2002). These receptor subtypes were found to be expressed
differentially in chicken ocular tissues and asterocytes (Natesan and Cassone 2002; Adachi
et al. 2002; Rada and Wiechmann 2006).
In the present investigation, the partial sequences of ovarian melatonin receptor subtypes
(Mel-1a, Mel-1b, and Mel-1c) were cloned and sequenced. Furthermore, the expression
profile of melatonin receptor subtypes was examined in the granulosa and theca layers of
various stage follicles and postovulatory follicles by semi-quantitative RT-PCR.
51
were separated in all preovulatory follicles except small white follicles as per standard
procedures (Gilbert et al. 1977). However, the postovulatory follicles were collected
without separating granulosa and theca layers.
RNA isolation and reverse transcription
Total RNA was extracted from individual samples by RNAgents- Total RNA isolation
system (Promega, Madison, WI, USA) according to the manufacturers instructions.
Approximately, 25 mg of tissue samples were used for RNA isolation. The concentrations
and purities of RNA preparations were determined spectrophotometrically at OD260 versus
OD280. The possible traces of genomic DNA were removed by treating 5 g of each RNA
samples with 5 U of RNase-free DNase (Biogene, CA, USA) at 37C for 1 h. The DNase
was subsequently inactivated by incubation at 65C for10 min. Each DNase treated total
RNA sample (2 g) was reverse transcribed with suitable negative and positive controls
using the RevertAid First strand cDNA synthesis kit (MBI Fermentas, Hanover, MD,
USA) according to the manufacturers instructions. The resultant cDNA was stored frozen at 20C till used. Negative controls were performed using all components except reverse
transcriptase. Total RNA from chicken spleen was used in positive control and for
standardizing reaction conditions.
PCR, cloning and sequencing of the Mel-1a, Mel-1b, and Mel-1c cDNA
Primers for the amplification of the partial sequence of melatonin receptor subtypes i.e
Mel-1a, Mel-1b, and Mel-1c from chicken ovarian tissue were designed using DNAStar
Lasergene software (DNASTAR, Inc. Madison, WI, USA) (Table 1) based on the published
brain sequence for the chicken melatonin receptors (Rappert 1995; Liu et al. 1995). PCR
reactions were performed in 25 l volume containing 10 pmoles of each primer, 0.1 mM
dNTPs mix, 1 unit of Taq DNA polymerase (Invitrogen), 2 l cDNA in 1 Taq polymerase
buffer (10 mM Tris-HCl pH 8.8, 50 mM KCl, 2.5 mM MgCl2). PCR amplification was
carried out for 37 cycles with denaturing at 94C for 45 sec, annealing (Table 1) for 45 sec,
and extension at 72C for 1 min, followed by a final extension at 72C for 20 min. The
PCR products were fractionated by agarose gel electrophoresis and visualized with
ethidium bromide staining and UV light. The PCR products of Mel-1a, Mel-1b, and Mel-1c
cDNAs were cloned into pTZ Vector (InsT/Aclone, MBI fermentas) and sequenced for both
strands by M 13 forward and reverse primers using an automated ABI PRISM 310 Genetic
Genes
Primer Sequences
Accession
No.
Product Annealing
Size (bp) Temperature (C)
Mel-1a
NM_205362 447
59
Mel-1b
U30609
462
52
Mel-1c
U31821
407
58
-Actin
5CACGCTAGCCACCATCCTCATCTT 3
5GCACGAATAAATCCTGGGGTCATA 3
5CTGGTGGTGGCCTTGTATCC 3 5
TTGGCTTTGTTTCTGACTTGACTC 3
5GCTGGGCAACGCGCTGGTCAT 3 5
TGCAAGAGTAAATCCGGGGGTCAT 3
5CATCACCATTGGCAATGAGAGG 3 5
GCAAGCAGGAGTACGATGAATC 3
L08165
353
60
52
Analyzer (Applied Biosystem, Foster City, CA). General nucleotide sequence analysis was
performed using the Lasergene program (DNASTAR, Madison, WI). Nucleotide sequences
were compared with sequences in the NCBI database using the BLAST algorithm (http://
www.ncbi.nlm.nih.gov/BLAST/).
Semi-quantitative RT-PCR
PCR reactions were performed with equal amount of cDNA samples from all birds, in
duplicate in separate tubes for the amplification of Mel-1a, Mel-1b, and Mel-1c mRNA with
specific primers in a thermalcycler (iCycler Bio-Rad, Hercules, CA, USA). The
amplification was carried out in 25 l volume containing 10 pmoles each primer,
0.1 mM dNTPs mix, 1 unit of Taq DNA polymerase (Invitrogen), 2 l cDNA in 1 Taq
polymerase buffer (10 mM Tris-HCl pH 8.8, 50 mM KCl, 2.5 mM MgCl2). Different
negative controls were employed at different stages, in which some components were
selectively omitted in the reaction mixture, i.e. either cDNA or Taq polymerase. PCR
reaction conditions were defined for each primer pair, to obtain a linear relationship of RNA
and final PCR product. The number of cycles used to amplify each cDNA was chosen to
enable the PCR to proceed in a linear range in the preliminary experiments. PCR cycling
conditions were similar to that described in previous section, except for -actin (29 cycles).
Amplicons were analyzed on ethidium bromide stained 1.5% agarose gel (Gel
documentation system, Syngene, USA). The sizes and quantity of PCR products were
verified by comparison with a quantitative DNA ladder (E-Gel; Invitrogen, Carlsbad,
California, USA). Densitometry analysis was performed to estimate the expression of
melatonin receptor subtypes in ovarian follicles (Sundaresan et al. 2005)
Statistical analysis
Analysis of normalized melatonin receptor subtype values were carried out using one-way
analysis of variance with Duncuns post test with Bonferroni correction using SPSS
software version 15 for Windows, Chicago, Illinois, USA.
Results
Ovarian melatonin receptor subtypes
To investigate the expression of the multiple forms of the melatonin receptor mRNA in
reproductive tissues, primers were designed from reported chicken brain mel-1a, mel-1b
and mel-1c sequences. Sequences were submitted to the Genbank database with the
accession numbers: EF197907 (Mel-1a), EF197909 (Mel-1b) and DQ990818 (Mel-1c). A
BLAST search with each of three melatonin receptor sequences revealed they were similar
to chicken brain receptors (99%).
Melatonin receptors mRNA expression in ovary
The expression of Mel-1a receptor was absent in small white follicles (Fig. 1). Theca cells
of all yellow follicles revealed the Mel-1a receptor expression. Further, the expression of
Mel-1a was significantly higher in F68, F5 and F3 follicles when compared to F2 and F1
follicles. The highest level of Mel-1a receptor expression was observed in F5 follicle
53
Fig. 1 RT-PCR analysis of Mel1a mRNA expression in preovulatory follicles of domestic hen.
(A). Figures show representative
examples of the PCR product of
Mel-1a and -actin in preovulatory follicles. (B). Graphics represent the mean of the normalized
O.D. for each mRNA band
obtained by densitometric analysis (meanS.E; n=10). Normalization was done dividing each O.
D. value by the value of -actin
band in the same sample. Values
with different alphabets represent
significantly different (p<0.05)
mRNA expression between different follicles. SW-small white
follicle; SY-small yellow follicles; F1-F8-different stage of
preovulatory follicles
(Fig. 1A and B). The Mel-1b receptor was expressed in both granulosa and theca layers of
all types of follicles. There was no significant difference in the level of expression among
follicles (Fig. 2A and B). The expression of Mel-1c receptor was also observed in both
granulosa and theca layers. However, the expression was not noticed in small white and
Fig. 2 RT-PCR analysis of Mel1b mRNA expression in preovulatory follicles of domestic hen.
(A). Figures show representative
examples of the PCR product of
Mel-1b and -actin in preovulatory follicles. (B). Graphics represent the mean of the normalized
O.D. for each mRNA band
obtained by densitometric analysis (meanS.E; n=10). Normalization was done dividing each O.
D. value by the value of -actin
band in the same sample. Values
with different alphabets represent
significantly different (p<0.05)
mRNA expression between different follicles. SW-small white
follicle; SY-small yellow follicles; F1-F8-different stage of
preovulatory follicles
54
small yellow follicles. Further, the expression levels were significantly higher in F5 and F3
follicles (Fig. 3A and B). The expression levels of Mel-1c receptor were downregulated in
F2 and F1 follicles. In the POF, the expression of Mel-1a receptor was up regulated significantly
up to POF3 which was down regulated in POF45. The Mel-1b receptors expression was not
altered during the regression of POF. However, Mel-1c receptor mRNA expression was
upregulated up to POF2 which was subsequently downregulated (Fig. 4A and B).
Discussion
Most studies investigating the mechanism(s) by which melatonin regulates reproduction
have focused in the hypothalamus and pituitary as target tissues (Malpaux et al. 2001), with
little attention directed to the role this hormone may play in the ovary itself. The present
investigation findings are in line with the hypothesis of a direct melatonin action on the
gonads (Ayre and Pang 1994).
In the current study, we observed an expression of all three subtypes of melatonin
receptors in ovary of domestic chicken. As there were no published references for the
expression of melatonin receptors in ovary of birds, we cloned and characterized these
receptors. The partial sequence analysis of ovarian receptors revealed that the melatonin
subtypes were identical to the brain receptors. Earlier studies found the iodomelatonin
binding sites in granulosa cells of the ovary (Ayre et al. 1994). Our findings confirm the
presence of melatonin receptors in the ovary.
In small white follicles of ovary, the expression of mel-1a and mel-1c receptors were not
noticed. However, in yellow follicles, all the three subtypes of receptors were expressed. In
chicken, at an early stage of follicular development the small yellow ovarian follicles
produce estrogens and androgens. As follicles begin to sequester yolk, their production of
Fig. 3 RT-PCR analysis of Mel1c mRNA expression in preovulatory follicles of domestic hen.
(A). Figures show representative
examples of the PCR product of
Mel-1c and -actin in preovulatory follicles. (B). Graphics represent the mean of the normalized
O.D. for each mRNA band
obtained by densitometric analysis (meanS.E; n=10). Normalization was done dividing each O.
D. value by the value of -actin
band in the same sample. Values
with different alphabets represent
significantly different (p<0.05)
mRNA expression between different follicles. SW-small white
follicle; SY-small yellow follicles; F1- F8: different stage of
preovulatory follicles
55
estrogens from theca cells decreases, to become very low at ovulation (Cassy et al. 2004).
In mammals, estradiol differentially affects melatonin receptors expression (Masana et al.
2005). Therefore, the expression of melatonin receptor subtypes might have been
influenced by the ovarian steroids.
Interestingly, the expression of mel-1a receptor was not found in the granulosa layer of
any of the ovarian follicles. However, mel-1b and -1c receptors were expressed at significantly
higher levels in granulosa layer. The differential distribution of melatonin receptor subtypes
in ovarian tissues suggests that these receptors mediate distinct downstream cellular functions
of melatonin in these tissues.
In the current study, we observed upregulation of melatonin receptors (mel-1a and 1c)
during the regression of postovulatory follicles. In the later stages of postovulatory follicle
regression the melatonin receptors were downregulated. In chicken ovarian follicles, the
regression of granulosa layer starts immediately and completes within 3 days postovulation. However, regression of the theca layer was slow and was completed only after
5 days post-ovulation (Johnson and Bridgham 2002; Sundaresan et al. 2008a, b). Therefore,
we assume that the expression of melatonin receptors might have been influenced by atresia
or apoptosis of different follicular layers in the POF.
56
In summary, we have characterized the ovarian mel-1a, mel-1b and mel-1c transcripts
that are equivalent to the brain receptors. In addition, the expression of melatonin receptor
subtypes suggests the direct action of melatonin in female reproductive processes of
domestic chicken.
References
Adachi, A., Natesan, A.K., Whitfield-Rucker, M.G. and Weigum, S.E., Cassone, V.M., 2002. Functional
melatonin receptors and metabolic coupling in cultured chick astrocytes. Glia, 39, 268278 doi:10.1002/
glia.10109
Ayre, E.A. and Pang, S.F., 1994. 2-[125I]iodomelatonin binding sites in the testis and ovary: putative
melatonin receptors in the gonads. Biological Signals, 3, 7184 doi:10.1159/000109528
Ayre, E.A., Yuan, H. and Pang, S.F., 1992. The identification of 125I-labelled iodomelatonin-binding sites in
the testes and ovaries of the chicken (Gallus domesticus). Journal of Endocrinology, 133, 511
Ayre, E.A., Wang, Z.P., Brown, G.M. and Pang, S.F., 1994. Localization and characterization of [125I]
iodomelatonin binding sites in duck gonads. Journal of Pineal Research, 17, 3947 doi:10.1111/j.1600
079X.1994.tb00112.x
Cassy, S., Metayer, S., Crochet, S., Rideau, N., Collin, A. and Tesseraud, S., 2004. Leptin receptor in the
chicken ovary: potential involvement in ovarian dysfunction of ad libitum-fed broiler breeder hens.
Reproductive Biology and Endocrinology, 2, 72 doi:10.1186/14777827272
Gilbert, A.B., Evans, A.J., Perry, M.M. and Davidson, M.H., 1977. A method for separating the granulosa
cells, the basal lamina and the theca of the preovulatory ovarian follicle of the domestic fowl (Gallus
domesticus). Journal of Reproduction and Fertility, 50, 179181 doi:10.1530/jrf.0.0500179
Johnson, A.L. and Bridgham, J.T., 2002. Caspase-mediated apoptosis in the vertebrate ovary. Reproduction,
124, 1927 doi:10.1530/rep.0.1240019
Malpaux, B., Migaud, M., Tricoire, H. and Chemineau, P., 2001. Biology of mammalian photoperiodism and
the critical role of the pineal gland and melatonin. Journal of Biological Rhythms, 16, 336347
doi:10.1177/074873001129002051
Masana, M.I. and Dubocovich, M.L., 2001. Melatonin receptor signaling: finding the path through the dark.
Science STKE, 107, PE39.
Masana, M.I., Soares, J.M. Jr. and Dubocovich, M.L., 2005. 17Beta-estradiol modulates hMT1 melatonin
receptor function. Neuroendocrinology, 81, 8795 doi:10.1159/000084897
Natesan, A.K. and Cassone, V.M., 2002. Melatonin receptor mRNA localization and rhythmicity in the
retina of the domestic chick, Gallus domesticus. Visual Neuroscience, 19, 265274 doi:10.1017/
S0952523802192042
Rada, J.A. and Wiechmann, A.F., 2006. Melatonin receptors in chick ocular tissues: implications for a role of
melatonin in ocular growth regulation. Investigative Ophthalmology and Visual Science, 47, 2533
doi:10.1167/iovs.050195
Reiter, R.J., 1980. Photoperiod: its importance as an impeller of pineal and seasonal reproductive rhythms.
International Journal of Biometeorology, 24, 5763 doi:10.1007/BF02245542
Soares, J.M. Jr., Masana, M.I., Ersahin, C. and Dubocovich, M.L., 2003. Functional melatonin receptors in
rat ovaries at various stages of the estrous cycle. Journal of Pharmacology and Experimental
Therapeutics, 306, 694702 doi:10.1124/jpet.103.049916
Sundaresan, N.R., Ahmed, K.A., Saxena, V.K., Sastry, K.V.H., Saxena, M., Pramod, A.B., Nath, M., Singh,
K.B., Rasool, T.J., DevRoy, A.K. and Singh, R.V., 2005. Differential expression of inducible nitric oxide
synthase and cytokine mRNA in chicken lines divergent for cutaneous hypersensitivity response.
Veterinary Immunology and Immunopathology, 108, 373385 doi:10.1016/j.vetimm.2005.06.011
Sundaresan, N.R., Saxena, V.K., Sastry, K.V.H., Anish, D., Marcus Leo, M.D., Kantaraja, C., Saxena, M. and
Ahmed, K.A., 2008a. Caspase-mediated apoptosis in chicken postovulatory follicle regression.
Veterinary Research Communications, 32, 1319 doi:10.1007/s11259-007-9005-y.
Sundaresan, N.R., Saxena, V.K., Sastry, K.V.H., Nagarajan, K., Jain, P., Singh, R., Anish, D., Ravindra, P.V.,
Saxena, M. and Ahmed, K.A., 2008b. Cytokines and chemokines in postovulatory follicle regression of
domestic chicken (Gallus gallus domesticus). Developmental and Comparative Immunology, 32, 253
264 doi:10.1016/j.dci.2007.05.011.
Tamarkin, L., Baird, C.J. and Almeida, O.F., 1985. Melatonin: a coordinating signal for mammalian
reproduction? Science, 227, 714720 doi:10.1126/science.3881822