10/9/2014

Protein Synthesis:
Translation of
the Genetic Message

Translating the Genetic Message

Protein biosynthesis is a
complex process
requiring ribosomes,
mRNA, tRNA, and
protein factors
Several steps are
involved
Before being
incorporated into
growing protein chain,
a.a. must be activated
by tRNA and
aminoacyl-tRNA
synthetases

10/9/2014

The Genetic Code

Salient features of the genetic code
triplet: a sequence of three bases (a codon) is
needed to specify one amino acid
nonoverlapping: no bases are shared between
consecutive codons
commaless: no intervening bases between codons
degenerate: more than one triplet can code for the
same amino acid; Leu, Ser, and Arg, for example, are
each coded for by six triplets
universal: the same in viruses, prokaryotes, and
eukaryotes; the only exceptions are some codons in
mitochondria

The Genetic Code (Contd)

The ribosome moves
along the mRNA three
bases at a time rather
than one or two at a
time
Theoretically possible
genetic codes are
shown in figure 12.2

10/9/2014

The Genetic Code (Contd)

All 64 codons have assigned meanings

61 code for amino acids

3 (UAA, UAG, and UGA) serve as termination signals
only Trp and Met have one codon each
the third base is irrelevant for Leu, Val, Ser, Pro, Thr,
Ala, Gly, and Arg
the second base is important for the type of amino
acid; for example, if the second base is U, the amino
acids coded for are hydrophobic
for the 15 amino acids coded for by 2, 3, or 4 triplets,
it is only the third letter of the codon that varies. Gly,
for example, is coded for by GGA, GGG, GGC, and
GGU

The Genetic Code (Contd)

10/9/2014

Wobble Base Pairing

Some tRNAs bond to one
codon exclusively, but
many tRNAs can recognize
more than one codon
because of variations in
allowed patterns of
hydrogen bonding
the variation is called
wobble
wobble is in the first base
of the anticodon

Amino Acid Activation

Amino acid activation
and formation of the
aminoacyl-tRNA take
place in two separate
steps
Both catalyzed by
amionacyl-tRNA
synthetase
Free energy of
hydrolysis of ATP
provides energy for
bond formation

10/9/2014

Loading Proteins onto tRNA charging the tRNA

1. adenylation

2. Formation of the aminoacyl-tRNA

H
H

-O-

Aminoacyl-tRNA synthase

AMP

Glycyl- tRNA

Charging is highly specific - amino acids recognize the correct tRNA through
distinguishing features on the tRNA, such as the
acceptor stem, D stem, and anti-codon stem
Since there are 20 amino acids, there are 20 aminoacyl-tRNA synthetases

Amino Acid Activation (Contd)

This two-stage reaction allows selectivity at two
levels
the amino acid: the aminoacyl-AMP remains bound
to the enzyme and binding of the correct amino acid is
verified by an editing site in the tRNA synthetase
tRNA: there are specific binding sites on tRNAs that
are recognized by aminoacyl-tRNA synthetases.

10/9/2014

Chain Initiation
In all organisms, synthesis of polypeptide chain
starts at the N-terminal end, and grows from Nterminus to C-terminus
Initiation requires:

tRNAfmet
initiation codon (AUG) of mRNA
30S ribosomal subunit
50S ribosomal subunit
initiation factors IF-1, IF-2, and IF-3
GTP, Mg2+

Forms the initiation complex

Shine-Dalgarno Sequence Recognized by

E. Coli Ribosomes

10/9/2014

Translation involves three steps: Initiation, Elongation, Termination

Initiation formation of the initiation complex

1. Ribosomal small sub-unit binds with the ribosomal binsing site (RBS)
RBS - a sequence of about 5-10 nucleotides (ex. AGGAGG) on the mRNA located 5 10
nucleotides from the initiating codon, AUG.
5AGAAACAGGAGGAAAGAAAUGCCCAAGAUGCCGAGGGGGCCCGCGGAGUAGAAA
AGGAGG
AUG
3
2. fmet-tRNA binds at the AUG site
3. Ribosomal large sub-unit completes the initiation complex, translation starts

Elongation
4. The next complementary tRNA bind at the attachment binding site (A) of the ribosome
5. A peptide bond forms between the 2 amino acid at the P site, the growing protein
transfers at the A site

Ribosome - contains a binding site for mRNA, and two binding sites for tRNA: the
acceptor site and the the peptidyl site.
Exit site

P site (peptidyl site) - binds to the tRNA holding the growing polypeptide chain of
amino acids
A site (acceptor site) - binds to the aminoacyl tRNA, which holds the new amino
acid to be added to the polypeptide chain
E site (exit site) - serves as a threshold, the final transitory step before a tRNA
now bereft of its amino acid is let go by the ribosome

10/9/2014

Chain Elongation
Uses three binding sites for tRNA present on the
50S subunit of the 70S ribosome: P (peptidyl) site, A
(aminoacyl) site, E (exit) site.
Requires

70S ribosome
codons of mRNA
aminoacyl-tRNAs
elongation factors EF-Tu (Elongation factor
temperature-unstable), EF-Ts (Elongation factor
temperature-stable), and EF-G (Elongation factorGTP)
GTP, and Mg2+

Elongation Steps

Step 1
an aminoacyl-tRNA is bound to the A site
the P site is already occupied
2nd amino acid bound to 70S initiation complex. Defined by the
mRNA
Step 2
EF-Tu is released in a reaction requiring EF-Ts
Step 3
the peptide bond is formed, the P site is uncharged
Step 4
the uncharged tRNA is released
the peptidyl-tRNA is translocated to the P site
EF-G and GTP are required
the next aminoacyl-tRNA occupies the empty A site

10/9/2014

6. The ribosome then moves 1 codon down

the mRNA in a 5' to 3' direction (translocation).

Translocase an enzyme used for translocation

7. The tRNA without the amino acid is released
from the E site while thenext complementary
tRNA binds at the new A site.
Termination
8. The process continues along the mRNA
until a stop codon is reached
9. The enzyme release factor terminates
the translocation. The small and large
sub-units of the ribosome separates and
the protein is released

Chain Termination
Chain termination requires
stop codons (UAA, UAG, or UGA) of mRNA
RF-1 (Release factor-1) which binds to UAA and
UAG or RF-2 (Release factor-2) which binds to UAA
and UGA
RF-3 which does not bind to any termination codon,
but facilitates the binding of RF-1 and RF-2
GTP which is bound to RF-3

The entire complex dissociates setting free the

completed polypeptide, the release factors, tRNA,
mRNA, and the 30S and 50S ribosomal subunits

10/9/2014

Components of Protein Synthesis

Protein Synthesis
In prokaryotes, translation begins very soon after
mRNA transcription
It is possible to have several molecules of RNA
polymerase bound to a single DNA gene, each in a
different stage of transcription
It is also possible to have several ribosomes bound to
a single mRNA, each in a different stage of translation
Polysome: mRNA bound to several ribosomes
Coupled translation: the process in which a
prokaryotic gene is being simultaneously transcribed
and translated

10

10/9/2014

Simultaneous Protein Synthesis on

Polysomes
A single mRNA molecule is translated by several
ribosomes simultaneously

Each ribosome produces a copy of the polypeptide

chain specified by the mRNA
When protein has been completed, the ribosome
dissociates into subunits that are used again in
protein synthesis

Simultaneous Protein Synthesis on

Polysomes (Contd)

11

10/9/2014

Eukaryotic Translation
Chain Initiation:
the most different from process in prokaryotes
13 more initiation factors are given the designation eIF
(eukaryotic initiation factor) (Table 12.4)

Eukaryotic Translation (Contd)

Chain elongation
uses the same mechanism of peptidyl transferase and
ribosome translocation as prokaryotes
there is no E site on eukaryotic ribosomes, only A and
P sites
there are two elongation factors, eEF-1 and eEF-2
eEF2 is the counterpart to EF-G, which causes
translocation

Chain termination
stop codons are the same: UAG, UAA, and UGA
only one release factor that binds to all three stop
codons

12

10/9/2014

Posttranslational Modification
Newly synthesized polypeptides are frequently modified
before they reach their final form where they exhibit biological
activity
N-formylmethionine in prokaryotes is cleaved
specific bonds in precursors are cleaved, as for example,
preproinsulin to proinsulin to insulin
leader sequences are removed by specific proteases of the
endoplasmic reticulum; the Golgi apparatus then directs the
finished protein to its final destination
factors such as heme groups may be attached
disulfide bonds may be formed
amino acids may be modified, as for example, conversion of
proline to hydroxyproline
other covalent modifications; e.g., addition of carbohydrates

Examples of Posttranslational Modification

13

10/9/2014

Protein Degradation
Proteins are in a dynamic state and are often turned
over
Degradative pathways are restricted to
subcellular organelles such as lysosomes
macromolecular structures called proteosomes

In eukaryotes, ubiquitinylation (becoming bonded

to ubiquitin) targets a protein for destruction
protein must have an N-terminus
those with an N-terminus of Met, Ser, Ala, Thr, Val,
Gly, and Cys are resistant
those with an N-terminus of Arg, Lys, His, Phe, Tyr,
Trp, Leu, Asn, Gln, Asp, Glu have short half-lives

Ubiquitin-Proteosome Degradation

14

10/9/2014

Acidic N-termini Induced Protein

Degradation

15