Académique Documents
Professionnel Documents
Culture Documents
NRC on Plant Biotechnology, I.A.R.I., New Delhi 110012, India, and 2Department of Biotechnology, Jamia Hamdard, New
Delhi 110062, India
(Received 2 March 2006)
Abstract
A cDNA library was constructed in l TriplEx2 vector using poly (A) RNA from immature seeds of Cicer arietinum. The
lectin gene was isolated from seeds of chickpea through library screening and RACE-PCR. The full-length cDNA of
Chichpea seed lectin(CpGL)is 972 bp and contains a 807 bp open reading frame encoding a 268 amino acid protein.
Analysis shows that CpSL gene has strong homology with other legume lectin genes. Phylogenetic analysis showed the
existence of two main clusters and clearly indicated that CpSL belonged to mannose-specific family of lectins. RT-PCR
revealed that CAA gene expressed constitutively in various plant tissues including flower, leaf, root and stem. When chickpea
lectin mRNA level was checked in developing seeds, it was higher in 10 DAF seeds and decreased throughout seed
development.
Keywords: Cicer arietinum, expression analysis, leguminosae, lectin gene, nucleotide sequencing
Introduction
Lectins are a large and heterogenous group of proteins
that have the ability to bind reversibly to a specific
mono-or-oligosaccharide (Van Damme et al. 1998).
They are ubiquitously distributed in nature and are
most abundant in plants, where they can be found in
seeds, leaves, barks, bulbs, rhizomes, roots and tubes
depending on the plant tissues (Lis and Sharon 1986;
Gupta et al. 2004). However, majority of studies on
lectins have been carried out on legumes, particularly,
seeds where they comprise up to 15% of total protein.
Based on evolutionary and structural relatedness,
seven lectin families have been distinguished, of which
legume lectins are best characterized (Peumans and
Van Damme 1998). Although lectins have been
extensively studied with respect to carbohydrate
binding specificity and potential utility for the
isolation and characterization of glycoconjugates, the
Correspondence: K. R. Koundal, NRC on Plant Biotechnology, I.A.R.I., New Delhi 110012, India. Tel: 91 11 25848783. Fax: 91 11
25843984. E-mail: kirparam@rediffmail.com
*The nucleotide sequence reported in this paper have been submitted to the GenBank and is available under the accession no. AY221982.
ISSN 1042-5179 print/ISSN 1029-2365 online q 2007 Informa UK Ltd.
DOI: 10.1080/10425170601060608
Mitochondrial DNA Downloaded from informahealthcare.com by University of S.A Lib 119257 on 11/14/12
For personal use only.
197
Figure 1. A D. A, B. Agarose gel electrophoresis and Southern hybridization of restricted chickpea genomic DNA, Lane M. Marker l/ Hind
III, 1. Chickpea genomic DNA digested with Bam HI, 2. Chickpea genomic DNA digested with Eco RI; C, D. Agarose gel electrophoresis and
Southern hybridization of restricted cDNA clones, Lane M. Marker l/ Eco RI Hind III, Lanes 1-3. Chickpea lectin clone digested with Sfi I.
Mitochondrial DNA Downloaded from informahealthcare.com by University of S.A Lib 119257 on 11/14/12
For personal use only.
Figure 2. The cDNA sequence and deduced amino acid sequence of chickpea seed lectin (CpSL). The start codon is underlined and
stop codon is italicized and underlined.
Mitochondrial DNA Downloaded from informahealthcare.com by University of S.A Lib 119257 on 11/14/12
For personal use only.
199
Figure 3. Alignment of deduced amino acid sequence of CpSL (chickpea seed lectin) with other legume lectins: CAA47011 from Pisum
sativum; CAC42124 from Lens culinaris; CAF18558 from Lathyrus sativus and CAD27484 from Vicia faba. Identical amino acid residues are
indicated with yellow. The amino acid residues identical among any two of the five lectins are indicated with gray. The amino acid residues
different from other lectins are indicated with black.
primer Cpl 2 and 50 RACE inner primer (50 CGCGGATCCGAACACTGCGTTTGCTGGCTTTGATG -30 ). The PCR product (750 bp) was
purified and cloned into pGEM-T easy vector
(Promega) followed by sequencing.
Sequence analysis
Multiple sequence alignment was performed by the
ClustalW (clustalw.genome.jp) programme. The phylogenetic tree was constructed on the basis of deduced
amino acid sequences of CpSL and other legume
lectins using ClustalX and Treeview version 1.6.5.
Expression analysis of chickpea lectin
Total RNA was isolated from various plant tissues
including leaf, root, stem and inflorescence of
chickpea according to the method of Salzman et al.
(1999). PCR was employed after reverse transcription
to study the levels of expression in different tissues. To
ensure that the samples were free of DNA, the RNA
CAA470
41
CAF185
99
CAC421
100
CAD274
100
Mitochondrial DNA Downloaded from informahealthcare.com by University of S.A Lib 119257 on 11/14/12
For personal use only.
CAA429
100
CAA763
CAD288
100
CAF185
49
P050
60
54
BAA364
CAA369
cDNA library
Of 5 mg of total RNA obtained from 5 g of immature
chickpea seeds, 2 mg was purified using oligo (dT)
cellulose column that yielded 50 mg of poly (A) RNA.
The synthesized cDNA was in the range of 0.5-5 kb.
The restricted cDNA was size fractioned by
CHROMA SPIN-400 column, 500 ng of fractioned
cDNA was ligated with 500 ng of Sfi I restricted
lTriplEx2 vector. The ligated mixture was packaged
in vitro in packaging extract. The cDNA library of
Mitochondrial DNA Downloaded from informahealthcare.com by University of S.A Lib 119257 on 11/14/12
For personal use only.
201
Figure 5. A. Expression analysis of lectin in different tissues of chickpea, Lane M. Marker l/ Eco RI Hind III, Lanes 15. Total RNA
from: 1, flower; 2, leaf; 3, root; 4, stem; 5, seed; Lane 6, Negative control; B. Expression analysis of lectin in developing seeds of chickpea, Lane
M. Marker l/ Hind III, Lanes 1-6. Seeds from: 1, 10 DAF; 2, 15 DAF; 3, 20 DAF; 4, 25 DAF; 5, 30 DAF; 6, 35 DAF; Lane 7, Negative
control.
Acknowledgements
Expression pattern of chickpea lectin
To investigate the expression in tissues of Cicer
arietinum, total RNA was isolated from various tissues
and reverse transcribed followed by PCR. An
amplicon of 550 bp detected in flower, leaf, root
and stem (Figure 5A) indicates that perhaps CpSL is
indeed constitutively expressed. Constitutive
expression of lectin gene has been observed in all
tissues of other plants. Zhu et al. (1996) showed
similar lectin expression at the protein level by using
immunoblot in Griffonia simplifolia. Constitutive
expression of lectin in various tissues has also been
recorded in Crinum asiaticum (Chai et al. 2003),
Pinellia ternata (Yao et al. 2003) and Arisaema
heterophyllum (Zhao et al. 2003).
The expression of chickpea lectin was growth
related. The relative quantity of CpSL mRNA in the
seeds seemed clearly dependent on the developmental
stage. The amplicon intensity was higher in 10th DAF
seeds, decreasing throughout seed development; the
lowest being on 25th DAF (Figure 5B). Our findings
are consistent with the study on expression pattern of
soybean lectin (Goldberg et al. 1983). Hybridization
experiments demonstrated that lectin mRNA levels
were maximized at mid-maturation stage but not
detectable at later stages. It implicitly implies that
stage-specific activation and repression of lectin gene
occurs during development and that the transcriptional
process plays an important role in this regulation.
Earlier studies have shown that many seed lectins of
leguminous family possess insecticidal activities
(Gatehouse et al. 1999; Powell 2001). The chickpea
lectin gene can also be introduced into crops and
resistance to a wide range of insects can be tested.
References
Carlini CR, Grossi-de-Sa MF. 2002. Plant toxic proteins with
insecticidal properties. A review on their potentialities as
bioinsecticides. Toxicon 40:1515 1539.
Chai Y, Pang Y, Liao Z, Zhang L, Sun X, Lu Y, Wang S, Tang K.
2003. Molecular cloning and characterization of a mannosebinding lectin gene from Crinum asiaticum. J Plant Physiol
160:913920.
Datta S, Kansal R, Koundal KR. 2000. Construction of cowpea
(Vigna unguiculata L) cDNA library and characterization of an
isolated lectin gene. J Plant Biochem Biotech 9:6771.
Dellaporta SL, Wood J, Hicks JB. 1983. A plant DNA
minipreparation: Version II. Plant Mol Biol Rep 1:1921.
Diaz C, Melchers LS, Hooykaas PJJ, Lugtenberg BJJ, Kijne JW.
1989. Root lectins as determinant of host plant specificity in the
Rhizobium-legume symbiosis. Nature 338:579581.
Galasso I, Lioi L, Lanave C, Bollini R, Sparvoli F. 2004.
Identification and isolation of lectin nucleotide sequences and
species relationships in the genus Lens (Miller). Theor Appl
Genet 108:10981102.
Gatehouse AMR, Davison GM, Stewart JN, Gatehouse LN, Kumar
A, Geoghegan IE, Birch ANE, Gatehouse JA. 1999. Concanavalin A inhibits development of tomato moth (Lacanobia
oleracea) and peach-potato aphid (Myzus persicae) when
expressed in transgenic potato plants. Mol Breed 5:153165.
Gatehouse JA, Bown D, Evans IM, Gatehouse LN, Jobes D, Preston
LP, Croy RR. 1987. Sequence of the seed lectin gene from pea
(Pisum sativum L.). Nucleic Acids Res 15:7642.
Goldberg RB, Hoschek G, Vodkin LO. 1983. An insertion sequence
blocks the expression of a soybean lectin gene. Cell 33:465475.
Gupta N, Narula A, Srivastava PS. 2004. Purification and
characterization of lectin from seeds of Delonix regia. J Plant
Biochem Biotech 13:141144.
Mitochondrial DNA Downloaded from informahealthcare.com by University of S.A Lib 119257 on 11/14/12
For personal use only.