Molecular Plant Breeding 2015, Vol.6, No.

6, 1-11
http://mpb.biopublisher.ca

Research Article

Open Access

Genome-wide identification and characterization of heat shock factor genes

from pigeonpea (Cajanus cajan)
Maibam A1, Tyagi A2, Satheesh V1, Mahato AK1, Jain N1, Raje RS2, Rao AR3, Gaikwad K1 , Singh NK1
1. National Research Center on Plant Biotechnology, New Delhi, India
2. Div. of Genetics, Indian Agricultural Research Institute, New Delhi, India
3. Indian Agricultural Statistics Research Institute, New Delhi, India
Corresponding authors email: kish2012@gmail.com
Molecular Plant Breeding, 2015, Vol.6, No.6
doi: 10.5376/mpb.2015.06.0006
Received: 10 Dec., 2014
Accepted: 28 Feb., 2015
Published: 19 Mar., 2015
Copyright 2015 Maibam et al., This is an open access article published under the terms of the Creative Commons Attribution License, which permits
unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Preferred citation for this article:
Maibam et al., Genome-wide identification and characterization of heat shock factor genes from pigeonpea (Cajanus cajan), Molecular Plant Breeding, 2015,
Vol.6, No. 6 1-11 (doi: 10.5376/mpb.2015.06.0006)

Abstract Genome wide analysis of heat shock factor (Hsf) genes was carried out in pigeonpea (Cajanus cajan) in order to
understand their structure and function. A total of 23 Hsfs were predicted using FGENESH and labeled as CcHsf. Out of the 23 genes,
14 unique sequences were selected and characterized for their presumed structures such as protein domain and motif organization.
The phylogenetic relationships and expression profiling of CcHsf genes under heat-stress was studied. Phylogenetic analysis
showed that CcHsf genes were distributed into e i g h t groups. In this study, classes A, B and C were further subdivided into
subclasses such as A1, A2, A3, A4, A5, A6, A8, A9, B 1 , B2, B3, B4 and C1. Expression profiling of all 14 genes was carried out by
semi-quantitative PCR, among which CcHsfA-1d and CcHsfA-2 were observed to be highly upregulated during h ea t -st re ss .
Relative quantification with qRT-PCR s h o w e d that CcHsfA-1d is upregulated 2-6 hrs after heat-stress indicating its significant role
as an early response factor. Our study provides a glimpse of the Hsf gene family in pigeonpea and this information can be utilized to
gain more insight into the heat-response mechanism in pigeonpea.
Keywords Domain; Glycine max; Heat shock factor; Motif; Pigeonpea; Phylogenetics
Abbreviations: AHA - Aromatic/ Hydrophobic /Acidic; Hsf - Heat Shock Factors; IRRK- Isoleucine, Arginine, Arginine,
Lysine; NLS - Nuclear Localization Signal; NES - Nuclear Export Signal

Introduction

cannot escape heat and are forced to adapt by

modifying their metabolism to prevent damage caused
by high temperatures. Various responses are exhibited
by a plant during heat stress such as morphological
damage, anatomical changes, physiological and
expression of stress related proteins. These stress
proteins are mainly responsible for the stability of
other cellular proteins and membranes. During heat
stress, protein denaturation starts and key regulators
known as heat shock factors (Hsf), which regulate
heat shock proteins (Hsp) are activated (Wu et al.,
1995; Yamada et al., 2007; Fujimoto et al., 2010). The
Hsfs recognize and bind to the conserved palindromic
heat shock element (HSE- 5-AGAAnnTTCT-3)
present in the promoters of most of the heat
stress-inducible genes (Wu et al., 1995). The heat
stress transcription factor (Hsf) therefore, is the main
component of the signal transduction chain mediating
the activation of genes responsive to heat stress and
other abiotic as well as biotic stresses (Wu et al.,
1995). Heat shock transcription factors belong to

Pigeonpea [Cajanus cajan (L.)Millspaugh] is one of

the important tropical legume crops providing food
and nutritional security largely to Asia and Africa. It is
also known as tropical green pea, congopea,
gungopea or no-eye pea. It is a diploid (2n=22),
perennial woody shrub, often cross-pollinated crop
belonging to the family Fabaceae. The pigeonpea
genome was sequenced by two groups (Singh et al.,
2011; Varshney et al., 2011), and its size was
estimated to be between 833- 858Mb. Apart from
being drought-tolerant, pigeonpea is also known to be
heat-tolerant and grows well in the south Asian
peninsula in the rainy season when the day
temperatures are quite high. Under the current
climatic regime which tends to be erratic, global
warming will adversely impact almost all aspects of
plant development, growth, reproduction and yield
(Treshow, 1970). Organisms tend to maintain
homeostasis during stress period (Boron, 2003). As
compared to animals, plants are sessile organisms that
1

Molecular Plant Breeding 2015, Vol.6, No.6, 1-11

http://mpb.biopublisher.ca
winged helix-turn-helix (Harrison et al., 1994), and
each Hsf monomer contains one C-terminal and three
N-terminal leucine zipper domain required for
oligomerization (Schuetz et al., 1991). They contain
various domains such as DNA binding domain,
oligomerization domain, nuclear export signal (NES),
activation domain (CTAD) and nuclear localization
signal (NLS) domain. Among these domains, the DNA
binding domain located at the N-terminal is highly
conserved in nature (Treuter et al., 1993) and the
domain structure consists of three helical bundles (H1,
H2, H3) and a four-stranded (1, 2, 3, 4)
beta-sheet. Conserved HSE motifs recognized by
DNA binding domain that contains three helix bundles
capped by a four-stranded antiparallel beta sheet
(Harrison et. al., 1994). Hydrophobic heptad repeats is
the main feature of an oligomerization domain that is
responsible for the trimerization for activation of Hsfs.
The oligomerization and DNA binding domains are
separated by a flexible linker. The NLS nuclear
localization domain required for nuclear import,
located at the C-terminal is characterized by arginine
and lysine rich residues (Mattaj et al., 1998). In
addition, some Hsf proteins may contain a NES
domain and a C-terminal activation domain
characterized by AHA motif rich in aromatic/
hydrophobic/ acidic residues (Weis, 1998).
Intracellular distributions of Hsfs proteins are mainly
governed by NLS and NES domains. There are three
main classes of Hsfs, namely Hsf A, Hsf B and Hsf C
(Nover et al., 2001). Among these different classes,
class A has a peculiar feature i.e, an aromatic/
hydrophobic /acidic AHA type of activation domain at
the C-terminal (Mittal et al., 2009), which is not found
in the other classes. Some of the class A proteins that
do not have the activation domain, in order to perform
their functions, may form hetero-oligomers with other
class A proteins with the activation domain, and it is
possible that class B and class C proteins may work in
a similar fashion (Guo et al., 2008). Very few hsfs are
found in mammalian genome whereas plants show a
much higher complexity of Hsf genes both in terms of
distribution and classes. Distribution and abundance
of Hsf genes varies depending upon plant, e.g. tomato,
Arabidopsis, Soybean, Rice, Poplar, and Medicago
have 18, 21, 34, 25, 28 and 16, respectively, which are
divided into three classes A, B and C (Nover L. et al.,
1996, 2001). In tomato, HsfA-1a is constitutively

expressed during heat-stress and acts as the main

regulator of the heat response. If HsfA-1 is suppressed,
the plant cannot withstand even moderate heat stress
(Mishra et al., 2002; Nover et al., 1996, 2001; Kotak
et al., 2004, 2007). In contrast to tomato where HsfA-1
acts as the master regulator of the heat response no
such master regulator could be identified in
Arabidopsis. However, HsfA-2 is a dominant Hsf in
Arabidopsis and its activity is repressed in the
presence of AtHsp17.7-CII (Port et al., 2004). Though
Hsf genes are recognized to play a vital role in heat
stress regulation, they also have important roles in
growth and development process. The expression of
Hsf genes particularly HsfB-1 and HsfB-2 depends
upon developmental stage (Bharti et al., 2004). As
HsfB-1 is down-regulated, HsfB-2 is up-regulated in
mature root. However, in immature seed in the
globular embryo stage, HsfB-1 is up-regulated while
HsfB-2 is down-regulated (Soares-Cavalcanti et al.,
2012). HsfA-2 plays an important part during heat
stress and recovery. HsfA-4 and HsfA-8 are prominent
against reactive oxygen species, and HsfA-5 acts as a
repressor of HsfA-4 (Mochida et al., 2009;
Soares-Cavalcanti et al., 2012; Benko-Iseppon et al.,
2012). The nature of expression of Hsf genes is indeed
spatial and temporal. A few degrees elevation in
temperature during flowering time can result in the
loss of entire grain crop cycles (Zinn et al., 2010). As
earths atmosphere average temperature continuously
keep on increasing it will have a significant impact on
crop production. There is an increase not only in day
but also in night temperatures. These high
temperatures can reduce crop yield significantly
especially if it occurs during flowering. Pigeonpea is a
moderately temperature and drought tolerant crop and
not much information is available on its genomic
components involved in heat stress. So, identifying
and characterization of key components involved in
heat stress tolerance mechanism are a high priority
and could provides a first glimpse of Hsf gene family
in pigeonpea.

1 Materials and methods

1.1 Plant materials
Pigeonpea varieties Asha (ICPL87119) and Pusa
Dwarf were used for all wet lab assays. The plant
material was collected from field as well as net house
facility of the Division of Genetics, Indian
Agricultural Research Institute, New Delhi.
2

Molecular Plant Breeding 2015, Vol.6, No.6, 1-11

http://mpb.biopublisher.ca
1.2 Prediction of Hsf genes from pigeonpea genome
The pigeonpea genome was retrieved from the
NRCPB database and NCBI GenBank under the
accession AFSP00000000 (http://www.ncbi.nlm.nih.
gov/nuccore/AFSP00000000). The retrieved sequences
were used for prediction of Hsf genes using
FGENESH with Hidden Markov Model (HMM)
based gene prediction program. Gene prediction was
carried out with reference to Medicago and Soybean
as gene model. For similarity search, TBLASTN
(http://blast.ncbi.nlm.nih.gov/) was performed.
Soybean Hsf genes sequence were downloaded from
legume TFDB hosted by the RIKEN Plant Science
Center (legumetfdb.psc.riken.jp).

1.6 Isolation of total RNA from the plant sample

and synthesis of cDNA
Total RNA was prepared using SpectrumTM Plant
Total RNA Kit (Sigma-Aldrich) followed by DNase I
treatment to remove any genomic DNA contamination.
The integrity of the RNA was assessed on a 1% (w/v)
formaldehyde agarose gel. IscriptTM Select cDNA
synthesis kit (Bio-rad) was used to synthesis cDNA
from RNA sample. The following steps were
performed for synthesis of cDNA from total RNA. All
the components were prepared as follows: iScript
reverse transcriptase (1l), 5x iScript buffer (4l),
Oligo (dT) primer (2l), nuclease free water (12 l),
RNA Sample (1l), Total 20l mixed thoroughly and
briefly centrifuged. The components were added to a
0.2 ml PCR tube plate on ice and were mixed gently
and incubated for 60-90 min at 400C, followed by
incubation at 85 0C for 5 min to heat inactivate the
reverse transcriptase and stored at -200C.

1.3 Domain prediction and verification

Protein sequences were analyzed with Pfam
(pfam.sanger.ac.uk). Analysis and identification of
different functional modules like DNA binding
domain, oligomerization domain, nuclear localization
signal (NLS), nuclear export signal (NES) and
activation domain of Cajanus cajan Hsfs by sequence
comparison with well characterized Arabidopsis and
tomato Hsfs. MEME was performed to analyze the
motif distribution and verification of predicted
domain.

1.7 Semi-quantitative reverse transcription PCR

and quantitative real time PCR
The following proportion of (Vivantis) AGILE
LIFESCIENCE TECHNOLOGIES INDIA PVT LTD
reagents were used in semi-quantitative PCR reactions,
nuclease free water (12.8 l), 10X Buffer (without
MgCl2) 2 l, dNTP (10mM) 1 l, 50 mM MgCl2 (1
l), 5 U Taq polymerase (0.2 l), cDNA (100 ng/l) 2
l, gene specific primers (1 l). Pre-initiation step was
carried at 940C for 5 min and 40 steps of the cycle
(denaturation at 94 0C for 20 sec, annealing at 550C
for 20 sec, and extension at 720 C for 1 min), followed
by incubation at 72 0C for another 10 min. Then the
reaction was held at 40C. For analyzing PCR
amplification the reaction content was mixed with 2 l
of 6x DNA loading dye and loaded in a 1.5% agarose
gel and electrophoresed in 1x TAE. For RT-PCR,
primers were designed from the 3 end of sequence,
keeping annealing temperature at around 600C and GC
content about 50 % (Table 1). The cDNA was
synthesized from 1 g of total RNA using IscriptTM
Select cDNA synthesis kit (Bio-rad). Quantitative
RT-PCR was carried out using LightCycler 480
SYBR Green 1 Master (Roche) real-time PCR system.
Each reaction contained 10 L LightCycler 480
SYBR Green 1 Master 5.0 l (100 ng/l) cDNA
sample, and 1l of gene-specific primer in a final
volume of 20 l. A pair of primers was designed from
CcHsfA-1d gene sequence using Primer 3 targeting an

1.4 Multiple sequence alignment and phylogenetic

analysis
MUSCLE (Version 3.2) was used to align amino acid
sequences of Hsf proteins. Phylogenetic analysis of 14
CcHsf, 15 GmHsf (Glycine max), 13 MtHsf (Medicago
trunculata) and 18AtHsf (Arabidopsis thaliana) genes
were done with MEGA 5. Phylogenetic trees were
constructed using the neighbor-joining (NJ) method
with pairwise deletion option and p-distance.
Bootstrapping was set at 1500 replicates to test for
statistical reliability of the phylogeny.
1.5Treatment of plant material
Pigeonpea (Cajanus cajan) var. Asha and Pusa
Dwarf plants were grown in field condition. Various
plant parts like bud and leaf were collected at young
developmental stages for DNA or RNA isolation with
standard protocol. The samples were kept in media
plate (Agar media 0.7%) and incubated in Thermo
Scientific MaxQ 6000 incubator for heat stress at
450C (Wahid et al. 2007) for 2 hr, 6 hr and 24 hr
using detach leaf/bud method.
3

Molecular Plant Breeding 2015, Vol.6, No.6, 1-11

http://mpb.biopublisher.ca

2 Results

amplicon size of 172 bp (Table 2). The thermal

cycling conditions used were as follows: pre-initiation
step 94 0C for 5 min, 40 cycles of 940C for 15 sec,
570C for 15 sec and 720C for 20 sec. The specificity of
the reactions was verified by melting curve analysis.
The relative mRNA level for CcHsfA-1d gene was
calculated as CT values (Livak and Schmittgen,
2001) in comparison to unstressed bud. Tubulin A
gene (C.cajan_07743) was used as internal control for
normalization. Three biological replicates of each
cDNA sample were used for quantitative RT-PCR
analysis.

2.1 Sequence retrieval and analysis of hsf domains

Pigeonpea genome sequences showing similarity with
heat stress-responsive genes were downloaded from
NCBI. Prediction of Hsf genes was carried out using
FGENESH with reference to Glycine max and 23
genes were predicted. Similarity search of CcHsf
genes was performed using tBLASTN (NCBI) to
isolate all possible homologues and eliminate the
hypothetical ones. Out of 23, 14 CcHsf genes heat
shock factors were selected and characterized from the
current available pigeonpea genome database (Table
3). (For domain prediction, protein sequences were
analyzed with Pfam to obtained conserved Hsf-type
DBD domain sequence based on the Hidden Markov
Model (HMM). All the predicted CcHsf genes show
presence of a consistent DBD domain. Multiple
sequence alignment of Hsf-type DBD domain of
selected CcHsf genes was performed using MUSCLE
in MEGA.5. Almost all the heat shock factors taken in
the study have a conserved DNA binding domain
(Figure 1a) with the exception of 1-d family.
Identification of different modules of Cajanus cajan
Hsfs was carried out by sequence comparison with the
well characterized Arabidopsis and Tomato Hsfs. The
N-terminal region consisting of DNA binding domain
displays the most conserved part of Hsfs as compared
to the C-terminal region. Almost all identified Hsfs
display similar conserved protein sequence with
regard to each modules present in CcHsf. A schematic
diagram of CcHsf (Figure 1b ) showing their conserved

Table 1 List of primers used in Semi-quantitative PCR analysis

SL.No Primers
CcHsfA-6b
CcHsfA-2
GmHsf30
GmHsfA-2

Sequence
Tm
R AACCCCACTATGCCCTTGC
53
F GCAGGTGAAAGAAGAGGTGGA 54
R TCAGGAACGGTGGTGGAC
53
F TTCAAACCTCTCTCCGCAAC
52
R GTCGGTGGATGGGTCTTCA
53
F ACAGCCTATGGAAGGGTTGC
54
R CAGCAGAAAACTTGTGAGAATCC53
F TGGAGCCAAACTTGCGATAG
52
R GCGAACGAAGCTTGAGAAATTG 53

Table 2 Primers used in Real Time PCR

Sl.No

Gene

CcHsfA-1d F TCATTGGGGGTTATTGGATCA 62

Sequence

Tm

Tubulin-A F TGCCACCATCAAGACTAAGAGG 60

R GCTGGACCTCATTCCCTTTG 62
R ACCACCAGGAACAACAGAAGG60
Table 3 Predicted gene analysis
SL.No

Gene

No. of amino acids

Molecular weight(Da)

pI

CcHsf B-3

231

26740.1

9.08

CcHsf A-1b

436

48602.2

5.03

CcHsf A-4a

402

46005.0

5.05

CcHsf A-9

426

48470.6

5.87

CcHsf A-6b

276

32123.3

5.64

CcHsf B-2a

381

41740.2

5.27

CcHsfA-8-like

175

19277.7

5.31

CcHsf A-1d

561

62434.3

5.17

CcHsf A-2

366

41361.0

4.91

10

CcHsf A-6b-like

353

41087.1

5.25

11

CcHsf A-8

438

50363.0

5.17

12

CcHsf A-1d-like

416

45821.1

4.81

13

CcHsf A-4a-like

388

44374.5

5.12

14

CcHsf B-2a-like

257

28819.5

9.24

Molecular Plant Breeding 2015, Vol.6, No.6, 1-11

http://mpb.biopublisher.ca

Figure 1a Multiple sequence alignment of CcHsf DNA-binding domain

Figure 1 b A schematic diagram of CcHsf with different functional modules

5

Molecular Plant Breeding 2015, Vol.6, No.6, 1-11

http://mpb.biopublisher.ca
functional domain say DNA binding domain,
oligomerization domain, nuclear localization signal
(NLS) (Table 4) (Kosugi et al., 2009), nuclear export
signal (NES) and activation domain... The DBD was
found to be remarkably conserved in terms of its
length and start position and AHA motifs were clearly
absent in HsfA-8, A-8 like, A-9 and all the B type hsfs.
Similarly NES domain was not detected in A-6b, A-8,
A-9 and all B types of hsfs. NLS domain was detected
for each of these sequences indicating the high degree
of conservation across categories of hsfs. Some
additional genes were labeled as A-1d like, A-4a like
and so on and had a different domain signature as
compared to the full genes respectively.
Table 4 Potential nuclear localization signal (NLS) motif w.r.t
their Hsf genes
SL.No
1
2
3
4
5
6
7

Gene
CcHsfB-3
CcHsfA-1b
CcHsfA-4a
CcHsfA-6b
CcHsfA-6b-like
CcHsfA-2
CcHsfA-4a

Potential NLS motif

GGREMKRNRTE
IPGVNKKRRLH
MERKRRLPKS
MSKKRRRPIE
FSKKRRRPIE
ARRKRRLTNS
MDRKRRLPRS

2.2 Phylogenetic analysis

Protein sequences were taken for phylogenetic
reconstruction of the Hsf family including 14 CcHsf,
15 GmHsf, 13 MtHsf, and 18AtHsf. All Hsfs fell
broadly into three major classes: classes A, B and C

(Koskull-Doring et al., 2007), with well-supported

bootstrap values (1500) indicating high reliability
(Figure 2a). 13 groups were identified based on
phylogenetic analysis and the Cchsfs were distributed
into different groups. However, four genes namely
CcHsfA-8-like, ATHsfA-6a, MtHsfA-4d and
MtHsfA-2c remained isolated from others Hsf genes.
In this study, class A, class B and class C were further
subdivided into subclasses according to their bootstrap
values and phylogenetic relationship, designated as A1,
A2, A3, A4, A6, A8, A9, B1, B2, B3, B4 and C1. The
genes HsfB-3, HsfA-2, HsfA-1d clustered in separate
internal node representing only the legume group. For
sequence homology searches, MEME analysis
(Timothy et al., 1998) was performed and it shows
that the CcHsf motif distribution and arrangement
resembled those of Soybean, Medicago and
Arabidopsis (Figure 2a). Three major motifs were
predicted and all three were part of the DNA binding
domain (Figure 2b).
2.3 Expression analysis
To study the expression of CcHsf genes
semi-quantitative PCR was performed for all 14
pigeonpea hsfs (data not shown) and 2 from Glycine
max. Among the CcHsf genes, CcHsfA-1d, CcHsfA-9
and CcHsfA-2 were upregulated after 2 hr post heat
treatment. The expression pattern of Hsf genes in bud
and leaf tissue was seen to be uniform (Figure 3a).
The Soybean genome harbors about 65 Hsfs genes or
hsf like genes and although only 26 have been reported,

Figure 2a Phylogenetic relationships among pigeonpea, soybean, medicago and Arabidopsis using MEGA 5., iTOL (Interactive
Tree Of Life)
6

Molecular Plant Breeding 2015, Vol.6, No.6, 1-11

http://mpb.biopublisher.ca

Figure 2b Conserved motifs in the Hsf Family members

we used the database to expand our scope for finding

any hsf like sequences. These genes were then tested
for expression in pigeonpea using semi quantitative
RT-PCR. Out of 42 GmHsf genes, 25 amplified under
heat stress (data not shown). However, GmHsf A-2
and GmHsf 30 were upregulated and stand out among
the other GmHsfs (Figure 3b). For relative
quantification of the expression of CcHsf genes, real
time-PCR was performed. CcHsfA-1d gene was
selected for the purpose of expression profiling during
heat stress in bud (Asha) because it showed maximum
induction in semi-quantitative RT-PCR assays.
CcHsfA-1d was found to be upregulated 3.87 folds as
compared with the reference gene at 2hr heat stress
treatment and reduced to 2.74 folds at 6 hr treatment
and remained completely down-regulated at 24 hr heat
stress treatment (Figure 4).

Figure 3b RT-PCR analysis for GmHsf in pigeonpea under

different periods of heat stress
Note: (cv. Asha) Lanes: M- Ladder ; 1- Control; 2- 2 hours; 36 hours; 4-24 hours; (cv. Pusa Dwarf) Lanes: 5- Control; 6- 2
hours; 7- 6 hours; 8-24 hours respectively

3 Discussion
In this study, 14 CcHsf genes were identified and
characterized from the draft pigeonpea genome. All
predicted CcHsf genes displayed conserved Hsf-type
DNA binding domain (DBD) indicating that it is the
most conserved among the different domains in Hsf.
This is in agreement with Arabidopsis Hsfs where the
DNA Binding Domain is highly conserved (IRRK--),
(Nover et al., 2001; Scharf et al., 1993, 2012). Both
NLS and NES, which are important for maintaining
the intracellular distribution of the Hsfs between the
nucleus and cytoplasm (Lyck et al., 1997, Baniwal et
al., 2004) were also found in pigeonpea proteins. The
multiple alignment and distribution of signature
domains indicated the presence of atleast 14 genes in
pigeonpea. Peculiar alignment was seen for A-d and
A-1d like indicating low level of homology among
other genes. This is strange since the prediction was
based on legume database hsf genes. The A-1d like

Figure 3a RT-PCR analysis for CcHsf in pigeonpea under

different periods of heat stress
Note: (cv. Asha) Lanes: 1- Control; 2- 2 hours; 3- 6 hours; 4-24
hours; M- Ladder; (cv. Pusa Dwarf) Lanes: 5- Control; 6- 2
hours; 7- 6 hours; 8-24 hours respectively
7

Molecular Plant Breeding 2015, Vol.6, No.6, 1-11

http://mpb.biopublisher.ca

Figure 4 QRT-PCR of CcHsf A-1d gene expression (Bud from Asha cv.) during heat stress under 2-24 hr interval

protein could be a terminated version or that the low

level of alignment could be due to partial sequence
information. The distribution of domains is as
expected for the A type family for most of the motifs.
Still, the entire genome wide analysis did not yield the
desired number of hsfs, considering that Soybean has
close to 65 known genes. The phylogenetic analysis of
Hsfs in pigeonpea, Soybean, Medicago and
Arabidopsis indicated that CcHsfs are closely related
to GmHsfs than to MtHsfs and AtHsfs. A similar study
(Soares-Cavalcanti et al. 2012) also reported
structural similarity between Hsfs of Soybean, Lotus
and Medicago, grouping them into the legume
family. They reported the evolutionary consistency
between the Hsf groups indicating the high degree of
similarity in this family of proteins. Interestingly,
MEME analysis of HsfA-1d showed that CcHsfA-1d
motif distribution is distinct from Soybean, Medicago,
and Arabidopsis. Therefore, CcHsfA-1d might interact
with other proteins in a manner not similar to its
homologues in Soybean, Medicago or Arabidopsis as
differences in the distribution of protein motifs in
homologues may lead to changes in protein-protein
interactions (Cornman, 2010), resulting in the
regulation of the heat shock factor genes at the
transcriptional level (Du et al., 2013). Such
differences in the motif sequence or motif distribution
is expected in crops that are not closely related. Their
genome may display a high level of synteny at the
sequence level, but may still have a distinct species
specific identity. A similar group of Hsfs were found

to be specific to dicots when the Rice and Arabidopsis

Hsfs were compared (Guo et al., 2008). It is possible
that certain species may harbor sequences arising out
of speciation and may impart advantage to that species
(Harrison, 1991). CcHsfA-1d needs to be investigated
further for its role in pigeonpea and whether these
motifs are of any importance. Semi-quantitative PCR
analysis revealed that CcHsfA-1d, CcHsfA-9 and
CcHsfA-2 were the most upregulated in both young
leaves and flower buds under heat stress indicating
that subfamily A may act as activators during heat
stress as other workers have also shown that HsfA2 is
upregulated under heat stress (Baniwal et al.,
2004;Charng et al., 2007). They showed that Hsf A
family members play an important role in early heat
stress induction profile and activating signaling
pathway regulating others Hsf genes and heat induced
genes. Hsf genes in young tissue, apart from
conferring thermotolerance, play a vital role in
regulation of normal plant growth and development
under heat stress (Hsu and Jinn, 2010; Hsu et al.,
2010). Semi quantitative expression profiling of
GmHsfs in pigeonpea indicate that 25 of these turned
out be positive. This indicates that pigeonpea genome
has more hsfs waiting to be discovered other than the
14 predicted in our preliminary analysis. This number
is expected to increase as only 511 Mb of the 852 Mb
sized genome was analyzed. Further finishing of the
pigeonpea genome will definitely enrich the initial
number found in this study. Recently, the
identification of a heat-induced splice variant of
8

Molecular Plant Breeding 2015, Vol.6, No.6, 1-11

http://mpb.biopublisher.ca
HsfA-2 has led (Ogawa et al., 2007) to suggest an
auto-regulatory nature for HsfA-2 as over
accumulation of hsf regulators is not preferable for
normal growth and development. Quantitative real
time-PCR analysis of CcHsfA-1d showed that
CcHsfA-1d is upregulated when subjected to heat
stress for 2hr. It has been reported in Arabidopsis that
HsfA-1d enhances the activity of the HsfA-2 which is
known to be a key Hsf. When hsfA-1d is knocked out
in Arabidopsis, the ability to withstand high
temperature is lost and in these mutants, other Hsfs
belonging to class A and B were also down regulated
(Yokoi et al., 2011). Thus it is evident that HsfA-1d is
very important and it will be interesting to know
whether in pigeonpea it also has a similar role as far as
inducing other Hsps/Hsfs is concerned. Due to high
redundancy among Hsf genes functional identification
may be a difficult task. Analysis of such pathways
through transient and over expression can provide
some clues (Mishra et al., 2002, Li et al., 2005, Liu et
al., 2009 and Yokotani et al., 2008) but is error prone
due to attenuators competition (Voellmy, 2004; Fu et
al., 2006; Yamada et al., 2007; Hsu et al., 2010; Hahn
et al., 2011). Recently the role of HsfA1-d was shown
to be as a key regulator, when TsHsfA-1d was over
expressed in Arabidopsis. The transgenic plant
displayed a better heat tolerance capability and
interacted negatively with Hsp90. The transgene was
also found to be localized in the nucleus and hence
more likely to control the downstream genes and
avoiding Hsp90. This clearly indicates the role of
HsfA-1d in Arabidopsis heat tolerance pathways and
assumes greater significance since till date no single
hsf apart from hsfA-2 is shown to be the key
transcription factor (Yokotani et al., 2008).

composition of hsf in this plant. This study, however,

forms a preliminary basis for further investigations of
hsfs in pigeonpea and the differential expression of
CcHsfA-2 needs further characterization as it offers
a lead towards deciphering the pigeonpea
thermotolerance pathways.
Authors contribution
KG and NKS devised the experiment as principle investigators
and wrote the paper. AM designed all experiments and
contributed significantly to all wet lab experiments. AT and NJ
assisted in all the wet lab experiments. AKM, VS and ARR
provided the bioinformatics support. RSR provided the material
and contributed to improvement of manuscript. All authors
have seen and approved the final manuscript. The authors
declare that they have no conflict of interest
Acknowledgements
Authors are grateful to Project Director, National Research
Centre on Plant Biotechnology, New Delhi, for providing the
required facilities. The financial support (Fellowship to Albert
Maibam) from ICAR is duly acknowledged.
References
Baniwal SK, Bharti K, Chan KY, Fauth M, Ganguli A, Kotak S, Mishra SK,
Nover L, Port M, Scharf KD, Tripp J, Weber C, Zielinski D, von
Koskull-Doring P, 2004, Heat stress response in plants: a complex
game with chaperones and more than twenty heat stress transcription
factors, J.Biosci, 29: 471-487
http://dx.doi.org/10.1007/BF02712120
Benko-Iseppon AM, Nepomuceno AL Abdelnoor RV, 2012, GENOSOJA
The Brazilian Soybean Genome Consortium: High throughput omics
and beyond, Genet Mol Biol, 35: pp. i-iv
Bharti K, von Koskull-Doring P, Bharti S, Kumar P, Tintschl-Korbitzer A,
Treuter E, Nover L, 2004, Tomato heat stress transcription factor
HsfB1 represents a novel type of general transcription coactivator with
a histone-like motif interacting with the plant CREB binding protein
ortholog HAC1, Plant Cell, 16: 1521-1535
http://dx.doi.org/10.1105/tpc.019927
Boron W.F, 2003. Medical Physiology: A Cellular And Molecular
Approaoch, Elsevier/Saunders, pp. 125-126
Charng YY, Liu HC, Liu NY, Chi WT, Wang CN, Chang SH, Wang TT,
2007, A heat-inducible transcription factor, HsfA2, is required for
extension of acquired thermotolerance in Arabidopsis, Plant Physiol,
143:251-262
http://dx.doi.org/10.1104/pp.106.091322
Cornman RS, 2010, The distribution of GYR- and YLP-like motifs in
Drosophila suggests a general role in cuticle assembly and other
protein-protein interactions, PLoS One, 5(9).pii: e12536. doi:
10.1371/journal.pone.0012536
http://dx.doi.org/10.1371/journal.pone.0012536
Du X, Wojtowicz D, Bowers AA, Levens D, Benham CJ, Przytycka TM,
2013, The genome-wide distribution of non-B DNA motifs is shaped
by operon structure and suggests the transcriptional importance of
non-B DNA structures in Escherichia coli, Nucleic Acids Res, 41:
5965-77
http://dx.doi.org/10.1093/nar/gkt308
Fujimoto M, Nakai A, 2010, The heat shock factor family and adaptation to
proteotoxic stress; FEBS J, 227: 4112-4125
http://dx.doi.org/10.1111/j.1742-4658.2010.07827.x
Fu S, Rogowsky P, Nover L, Scanlon M, 2006, The maize heat shock

Pigeonpea hsfs are currently not fully sequenced.

Completion of these sequences will help in better
elucidation of the structure as compared to other
legumes. As per this study pigeonpea harbors about 14
hsfs. This is a small number considering that soybean
has about 65 hsfs, making it one of the largest yet
discovered among the plants. Whether these many are
required for imparting thermotolerance, needs to be
understood. Going by the closeness between
pigeonpea and soybean, it is also expected that more
hsfs are waiting to be identified. Since pigeonpea is
moderately tolerant to high temperatures as compared
to other legumes, it will be interesting to note the
9

Molecular Plant Breeding 2015, Vol.6, No.6, 1-11

http://mpb.biopublisher.ca
KD, 2002, In the complex family of heat stress transcription factors,
HsfA1 has a unique role as master regulator of thermotolerance in
tomato, Genes Dev, 16:1555-1567
http://dx.doi.org/10.1101/gad.228802
Mittal D, Chakrabarti S, Sarkar A, Singh A, Grover A, 2009, Heat shock
factor gene family in rice: Genomic organization and transcript
expression profiling in response to high temperature, low temperature
and oxidative stresses, Plant Physiol. Biochem, 47:785-95
http://dx.doi.org/10.1016/j.plaphy.2009.05.003
Mochida K, Yoshida T, Sakurai T, Yamaguchi-Shinozaki K, Shinozaki K,
Tran L-SP, 2009, In silico analysis of transcription factor repertoire and
prediction of stress-responsive transcription factors in soybean, DNA
Res,16:353-369
http://dx.doi.org/10.1093/dnares/dsp023
Nishizawa-Yokoi A, Nosaka R, Hayashi H, Tainaka H, Maruta T, Tamoi M,
Ikeda M, Ohme-Takagi M, Yoshimura K, Yabuta Y, Shigeoka S, 2011,
HsfA1d and HsfA1e involved in the transcriptional regulation of
HsfA2 function as key regulators for the Hsf signaling network in
response to environmental stress, Plant Cell Physiol, 52: 933-45
http://dx.doi.org/10.1093/pcp/pcr045
Nover L, Scharf KD, Gagliardi D, Vergne P, Czarnecka-Verner E, Gurley
WB, 1996, The Hsf world: classification and properties of plant heat
stress transcription factors, Cell Stress Chaperones, 1: 215-223
http://dx.doi.org/10.1379/1466-1268(1996)001<0215:THWCAP>2.3.C
O;2
Nover L, Bharti K, Doring P, Mishra SK, Ganguli A, Scharf KD, 2001,
Arabidopsis and the heat stress transcription factor world: how many
heat stress transcription factors do we need? Cell Stress Chaperones, 6:
177-189
http://dx.doi.org/10.1379/1466-1268(2001)006<0177:AATHST>2.0.C
O;2
Ogawa D, Yamaguchi K, Nishiuchi T, 2007, High-level overexpression of
the Arabidopsis HsfA2 gene confers not only increased themotolerance
but also salt/osmotic stress tolerance and enhanced callus growth, J.
Exp. Bot, 58: 3373-3383
http://dx.doi.org/10.1093/jxb/erm184
Port M, Tripp J, Zielinski D, Weber C, Heerklotz D, Winkelhaus S, Bublak
D, Scharf KD, 2004, Role of Hsp17.4-CII as co-regulator and
cytoplasmic retention factor of tomato heat stress transcription factor
HsfA2, Plant Physiol, 135: 1457-1470
http://dx.doi.org/10.1104/pp.104.042820
Scharf KD, Rose S, Thierfelder J, Nover L, 1993, Two cDNAs for tomato
heat stress transcription factors. Plant Physiol. 102: 1355-1356
http://dx.doi.org/10.1104/pp.102.4.1355
Scharf KD, Berberich T, Ebersberger I, Nover L, 2012, The plant heat stress
transcription factor (Hsf) family: structure, function and evolution,
BiochimBiophysActa, 1819:104-19
http://dx.doi.org/10.1016/j.bbagrm.2011.10.002
Schuetz TJ, Gallo GJ, Sheldon L, Tempst P, Kingston RE, 1991, Isolation of
a cDNA for HSF2: evidence for two heat shock factor genes in humans,
Proc. Natl. Acad. Sci. U.S.A., 88 (16): 6911-5
http://dx.doi.org/10.1073/pnas.88.16.6911
Singh NK, Jain PK, Bhattacharya R, Gaikwad K, Mohapatra T, Srinivasan R,
and Sharma TR et al., 2011, The first draft of the pigeonpea genome
sequence, Journal of plant Biochemistry and biotechnology,20.15pp
Soares-Cavalcanti NM, Belarmino LC, Kido EA, Pandolfi V,
Marcelino-Guimares FC, Rodrigues FA, Pereira GAG, Benko-Iseppon
AM, 2012, Overall picture of expressed heat shock factors in Glycine
max, Lotus japonicus and Medicago truncatula, Genet. and Mol. Biol,
35: 247-259
http://dx.doi.org/10.1590/S1415-47572012000200006
Bailey TL, Gribskov M, 1998, "Combining evidence using p-values:
application to sequence homology searches", Bioinformatics,
14(1):48-54
http://dx.doi.org/10.1093/bioinformatics/14.1.48
Treshow M, 1970, Environment and plant response, McGraw-Hill,
Company; NewYork:.p. 421
Treuter E, Nover L, Ohme K, Scharf KD, 1993, Promoter specificity and

factor-binding protein paralogs EMP2 and HSBP2 interact

non-redundantly with specific heat shock factors, Planta, 224: 42-52
http://dx.doi.org/10.1007/s00425-005-0191-y
Guo J, Wu J, Ji Q, Wang C, Luo L, Yuan Y, Wang Y, Wang J, 2008,
Genome-wide analysis of heat shock transcription factor families in
rice and Arabidopsis, J Genet Genomics, 35:105-18
http://dx.doi.org/10.1016/S1673-8527(08)60016-8
Hahn A, Bublak D, Schleiff E, Scharf K-D, 2011, Crosstalk between Hsp90
and Hsp70 chaperones and heat stress transcription factors in tomato,
Plant Cell, 23:741-755
http://dx.doi.org/10.1105/tpc.110.076018
Harrison RG,1991, Molecular changes at speciation, Annual Review of
Ecology and Systematics, 22: 281-308
http://dx.doi.org/10.1146/annurev.es.22.110191.001433
Harrison CJ. Bohm AA, Nelson HC, 1994, Crystal structure of the DNA
binding domain of the heat shock transcription factor, Science, 263:
224-227
http://dx.doi.org/10.1126/science.8284672
Higashi Y, Ohama N, Ishikawa T, Katori T, Shimura A, Kusakabe K,
Yamaguchi-Shinozaki K, Ishida J, Tanaka M, Seki M, Shinozaki K,
Sakata Y, Hayashi T, Taji T, 2013, HsfA1d, a protein identified via
FOX hunting using Thellungiella salsuginea cDNAs improves heat
tolerance by regulating heat-stress-responsive gene expression, Mol
Plant, Mar;6(2):411-22
Hsu S-F, Jinn T-L, 2010, AtHSBP functions in seed development and the
motif is required for subcellular localization and interaction with
AtHSFs, Plant Signal Behav, 5:1042-1044
http://dx.doi.org/10.4161/psb.5.8.12404
Hsu S-F, Lai H-C, Jinn T-L, 2010, Cytosolic-localized heat shock factor
binding protein, AtHSBP, functions as a negative regulator of heat
shock response by translocation to the nucleus and is required for seed
development in Arabidopsis, Plant Physiol, 153: 773-748
http://dx.doi.org/10.1104/pp.109.151225
Kosugi S, Hasebe M, Matsumura N, Takashima H, Miyamoto-Sato E,
Tomita M, Yanagawa H, 2009, Six classes of nuclear localization
signals specific to different binding grooves of importin , J. Biol.
Chem, 284: 478-485
http://dx.doi.org/10.1074/jbc.M807017200
Kotak S, Port M, Ganguli A, Bicker F, von Koskull-Doring P, 2004,
Characterization of C-terminal domains of Arabidopsis heat stress
transcription factors (Hsfs) and identification of a new signature
combination of plant class A Hsfs with AHA and NES motifs essential
for activator function and intracellular localization, Plant J, 39: 98-112
http://dx.doi.org/10.1111/j.1365-313X.2004.02111.x
Kotak S, Vierling E, Baumlein H, von Koskull-Doring P, 2007, A novel
transcriptional cascade regulating expression of heat stress proteins
during seed development of Arabidopsis, Plant Cell, 19:182-195
http://dx.doi.org/10.1105/tpc.106.048165
Li C, Chen Q, Gao X, Qi B, Chen N, Xu S, Chen J, Wang X, 2005, AtHsfA2
modulates expression of stress responsive genes and enhances
tolerance to heat and oxidative stress in Arabidopsis, Sci China Ser C
Life Sci, 48: 540-550
http://dx.doi.org/10.1360/062005-119
Livak KJ and Schmittgen TD, 2001, Analysis of relative gene expression
data using real-time quantitative PCR and the 2(-Delta Delta C(T))
Method. Methods. 2001 Dec;25(4):402-8.Liu H-C, Charng Y-Y, 2013,
Common and Distinct functions of Arabidopsis class A1 and A2 heat
shock factors in diverse abiotic stress responses and development,
Plant Physiol, Preview DOI:10.1104/pp.113.221168
http://dx.doi.org/10.1104/pp.113.221168
Lyck R, Harmening U, Hohfeld I, Scharf K-D, Nover L, 1997, Intracellular
distribution and identification of the nuclear localization signals of two
tomato heat stress transcription factors, Planta, 202:117-125
http://dx.doi.org/10.1007/s004250050110
Mattaj IW and Englmeier L, 1998, Nucleocytoplasmic transport: the soluble
phase, Annu. Rev. Biochem, 167:256-306
http://dx.doi.org/10.1146/annurev.biochem.67.1.265
Mishra SK, Tripp J, Winkelhaus S, Tschiersch B, Theres K, Nover L, Scharf

10

Molecular Plant Breeding 2015, Vol.6, No.6, 1-11

http://mpb.biopublisher.ca
deletion analysis of three tomato heat stress transcription factors, Mo1.
Gen. Genet, 1993 Jul;240(1):113-25
Varshney RK, Chen W, Li Y, Bharti AK, Saxena RK, Schlueter JA,
Donoghue MT, Azam S, Fan G, Whaley AM, Farmer AD et al., 2011,
Draft genome sequence of Pigeonpea (Cajanus cajan) an orphan
legume crop of resource-poor farmers, Nature Biotechnology,Vol30 (1):
83-89
http://dx.doi.org/10.1038/nbt.2022
Voellmy R, 2004, On mechanisms that control heat shock transcription
factor activity in metazoan cells, Cell Stress Chaperones, 9: 122-133
http://dx.doi.org/10.1379/CSC-14R.1
Von Koskull-Dring P, Scharf KD, Nover L, 2007, The diversity of plant
heat stress transcription factors, Trends Plant Sci, (10): 452-457
http://dx.doi.org/10.1016/j.tplants.2007.08.014
Wahid A., Gelani S., Ashraf M., Foolad M, 2007, Heat tolerance in plants:
an overview. Environ. Exp. Bot. 61 199-223 10.1016/j.envexpbot.
2007.05.011
http://dx.doi.org/10.1016/j.envexpbot.2007.05.011
Weis K, 1998, Importins and exportins: how to get in and out of the nucleus,

TrendsBiochem. Sci, 23:185-189

http://dx.doi.org/10.1016/S0968-0004(98)01204-3
Wu C, 1995, Heat shock transcription factors: structure and regulation,
Annu. Rev. Cell Dev. Biol, 11: 441-469
http://dx.doi.org/10.1146/annurev.cb.11.110195.002301
Yamada K, Fukao Y, Hayashi M, Fukazawa M, Suzuki I, Nishimura M,
2007, Cytosolic HSP90 regulates the heat shock response that is
responsible for heat acclimation in Arabidopsis thaliana, J. Biol. Chem,
282: 37794-37804
http://dx.doi.org/10.1074/jbc.M707168200
Yokotani N, Ichikawa T, Kondou Y, Matsui M, Hirochika H, Iwabuchi M,
Oda K, 2008, Expression of rice heat stress transcription factor
OsHsfA2e enhances tolerance to environmental stresses in trans- genic
Arabidopsis, Planta, 227, 957-967
http://dx.doi.org/10.1007/s00425-007-0670-4
Zinn KE, Tunc-Ozdemir M, Harper JF, 2010, Temperature stress and plant
sexual reproduction: uncovering the weakest links, J. Exp. Bot, 61:
1959-1968
http://dx.doi.org/10.1093/jxb/erq053

11