Acta Botanica Sinica

2004, 46 (12): 14161423

http://www.chineseplantscience.com

Cre/lox-mediated Marker Gene Excision in Elite Indica Rice Plants Transformed with Genes Conferring Resistance to Lepidopteran Insects
CHEN Song-Biao1, LIU Xiang1, PENG Hai-Ying2, GONG Wang-Kui1, WANG Rui1, WANG Feng2, ZHU Zhen1*
(1. Institute of Genetics and Developmental Biology, The Chinese Academy of Sciences, Beijing 100101, China;
2. Fujian Provincial Key Laboratory of Agricultural Genetic Engineering, Fujian Academy of Agriculture Sciences,
Fuzhou 350003, China)

Abstract: Cre/lox -mediated gene excision in commercial rice (Oryza sativa L.) plants was studied with
a recombination-reporter gene system, in which the selectable marker hygromycin phosphotransferase
gene (hpt) flanking by two directly oriented lox sites was located between the rice actin1 promoter and a
promoterless gusA gene. This system allows visualization of GUS expression by activating promoterless
gusA after site-specific recombination. The crossing strategy was used to introduce the cre gene into the
lox plants. In 30 hybrid plants from four crosses made from T0 actin1 promoter-lox -hpt -lox -gusA plant with
T0 cre plant, 12 expressed GUS and 9 showed hygromycin-sensitive. We furthermore demonstrated the
utility of the Cre/lox in excision of hpt marker gene in an elite indica rice restorer Minghui 86 transformed
with both insecticidal modified cowpea trypsin inhibitor gene sck and Bacillus thuringiensis endotoxin gene
cryIAc. In 77 hybrid plants from nine crosses made from T2 homozygous lox -hpt -lox -sck -cryIAc plant with
T2 homozygous cre plant, 56 showed hygromycin-sensitive. Molecular analyses confirmed the excision of
hpt in all hygromycin-sensitive plants.
Key words: Cre/lox ; gene excision; transgenic rice; insect resistance; sck ; cryIAc; marker-free
Selectable marker genes are commonly used in transformation systems for the recovery of transgenic plants.
However, the maintenance of marker genes in transgenic
plants has caused environmental and consumer concerns
in recent years. Although no scientific basis has been determined for these concerns, the absence of selectable
marker genes would certainly contribute to the public acceptance of transgenic crops (Zuo et al., 2001). Moreover,
the removal of marker genes is also a reasonable strategy
for gene stacking through re-transformation using the same
marker gene (Yoder and Goldsbrough, 1994). To this end,
several strategies have been proposed to generate markerfree transgenic plants, including co-transformation,
transposon-mediated repositioning, intrachromosomal recombination and site-specific recombination (Ebinuma
et al., 2001).
Site-specific recombination systems, such as Cre/lox
(Austin et al., 1981), R/RS (Araki et al., 1987) and FLP/FRT
(Broach et al., 1982), consist of a recombination enzyme
and two small DNA recognition sites. These recombination enzymes can interact with its specific recognition sites
and result in excision of the intervening DNA, when two

recognition sites present in a direct repeat orientation. Use

of site-specific recombination systems has been reported
to successfully excise selectable marker genes from genome
in model plants such as Arabidopsis and tobacco (Dale
and Ow, 1991; Russell et al., 1992; Gleave et al., 1999; Sugita
et al., 1999; Sugita et al., 2000; Zuo et al., 2001) and in
economically important crops rice and maize (Endo et al.,
2002; Hoa et al., 2002; Zhang et al., 2003).
Rice (Oryza sativa) is one of the worlds most important
food crops, but is susceptible to attack by wide range of
herbivorous insects. Since there is no known rice cultivar
with natural sufficient level of resistance to the major rice
pests (Maqbool et al., 1998), transgenic breeding technology has been considered to be a new environmentally sustainable approach to control insect predation of rice. Since
1993 (Fujimoto et al., 1993), transgenic rice plants with insecticidal genes enhanced pest resistance have been reported in many experiments (Duan et al., 1996; Xu et al.,
1996; Nayak et al., 1997; Cheng et al., 1998; Maqbool et al.,
1998; Tu et al., 2000; Khanna and Raina, 2002). In our previous research, we have also successfully developed
transgenic elite indica rice lines expressing a modified cpti

Received 2 Apr. 2004 Accepted 1 Aug. 2004

Supported by the State Key Basic Research and Development Plan of China (2001CB10901), the Hi-Tech Research and Development (863)
Program of China (2001AA212041, 2002AA212031) and the National Special Program for Research and Industrialization of Transgenic
Plants (JY03-B-18-03).
* Author for correspondence. Tel(Fax): +86 (0)10 64852890; E-mail: <zzhu@genetics.ac.cn>.

CHEN Song-Biao et al.: Cre/lox-mediated Marker Gene Excision in Elite Indica Rice Plants Transformed with Genes Conferring
Resistance to Lepidopteran Insects

gene, named sck (Deng et al., 2003) or both sck and cryIAc
genes with highly resistance to lepidopteran insects
(unpublished data). In this study, we investigated the function of the Cre/lox, one of the most widely studied sitespecific recombination systems, in rice by a recombination-reporter gene system. The results showed that the Cre/
lox system could control gene excision efficiently in rice.
Based on this, we furthermore demonstrated the utility of
Cre/lox in excision of selectable marker gene in commercial
rice plants transformed with insecticidal genes sck and
cryIAc.

1 Materials and Methods

1.1 Vector construction
Three binary vectors, pCACreBar, pCALHGUS and
pCUBACloxHpt (Fig.1a, b, c) were designed and constructed
to test the function of the Cre/lox controlling gene excision
in rice. To construct plasmid pCACreBar, a cre gene digested by Hind from pUC19-cre (Mozo and Hooykaas,
1992) was inserted into the corresponding sites between
the rice actin1 promoter (McElroy et al., 1990) and the terminator of nopaline synthase gene (Tnos) in the intermediate plasmid pAPTN. The actin1 promoter-cre-Tnos fragment digested by Xho / Pst from the resultant recombinant plasmid pBlueACre was then inserted into the Xho/
Pst site of pCMasbarm (Zhou et al., 2003) to generate
plasmid pCACrebar.
A 112-bp double strand oligonucleotide, 5'CTCGAGATAACTTCGTATAATGTATGCTATACGAAGTTATAGTTAACTACGTAAGGCCTAATAACTTCGTATAATGTATGCTATACGAAGTTATCCACCATGTTGGATCGAT3', was synthesized (TaKaRa company, Dalian, China) and
then cloned into the Xho/ Cla site of pBlueScriptKS+
(Stratagene) to obtain plasmid pBluelox. This oligonucleotide contains a Hpa site flanked by two direct repeat
lox sites. An expression cassette of hygromycin
phosphotransferase (hpt) gene, which driven by the promoter of mannopine synthase gene (Pmas), digested by
Xho / EcoR from intermediate plasmid pMPHpt was
inserted into the Hpa site of pBluelox to obtain plasmid
pBlueloxHpt. The lox-Pmas-hpt-Tnos-lox fragment was
digested by Xho/BstX from pBlueloxHpt and inserted
into the Xho/BstX site of pCAMBIA2300 (http://www.
cambia.org.au/main/r-et-camvec.htm) to form plasmid
pCloxHpt. The plasmid pCALHGUS was then derived by
inserting the rice actin1 promoter into the Xho site and
inserting a promoterless -glucuronidase gene (gusA) followed by the Tnos into the BstX /Hind of the
pCloxHpt.

Plasmid pCUBACloxHpt was derived by inserting a fragment containing both a sck gene (Deng et al., 2003) controlled by the rice actin1 promoter and a cryIAc gene (Cheng
et al., 1998) controlled by the maize ubiquitin promoter
(Christensen and Quail, 1996) into the Hind site of
pCloxHpt.
1.2 Transformation of rice plants and crossing of
transgenic plants
Plant expression vectors pCACreBar, pCALHGUS and
pCUBACloxHpt were transferred into Agrobacterium
tumefaciens LBA4404 by electroporation according to the
instruction of Escherichia coli pulser apparatus (BIORAD). The elite indica rice restorer line, Minghui 86, was
used for transformation. Rice plants were grown under field
conditions, and immature embryos 1215 d after pollination were isolated for tissue culture and transformation
experiments. One-month-old calli induced on N6-based
(Chu, 1978) medium were then used as explants for
Agrobacterium-mediated transformation by following essentially the protocol of Hiei et al. (1994). Stably
pCACreBar-transformed plants were selected for
phosphinothricin (ppt) resistance and pCALHGUS- and
pCUBACloxHpt-transformed plants were selected for
hygromycin resistance. To excise hpt from transgenic rice
plants, the crossing strategy was used to introduce the cre
gene into the lox plants. For pCALHGUS-transformed
plants, primary T0 transformants were crossed with primary
T0 pCACreBar-transformed plants and for pCUBACloxHpttransformed plants, homozygous T2 generation plants were
produced to cross with homozygous T2 pCACreBar-transformed plants.
1.3 Plant assays
GUS activity in leaves or in whole plants of rice seedlings was performed according to Jefferson et al. (1987).
Hygromycin resistance of rice seedlings was assayed by
leaf culture method as essentially described by Wang and
Waterhouse (1997). Seeds were germinated and grown in
the greenhouse for about 1 month. Leaf tip of the first expanding leaf was cut and cultured on MS media containing
0.5 mg/L 6-BA and 100 mg/L hygromycin for about 68 d to
assay hygromycin resistance.
1.4 Molecular analysis
Total genomic DNA was extracted from leaves, as described by Murray and Thompson (1988). PCR was carried
out under standard conditions with oligonucleotide primers for hpt, gusA, cre, sck and cryIAc genes, resulting in
fragments of 0.85 kb, 0.99 kb, 1.0 kb, 0.42 kb and 0.74 kb
respectively. Primer sequences were 5 'TA C A C A G C C AT C G G T C C A G A - 3 ' a n d 5 ' -

TAGG AG GG CGT GG ATAT GT C-3 ' fo r h p t , 5 'C G AA C T G A A C T G G C A G A C TAT C - 3 ' a n d 5 ' GGTTCAGGCACAGCACATCAAAG-3' for gusA, 5'AT G T C C A AT T T A C T G A C C G T- 3 ' a n d 5 ' C TA AT C G C C AT C T T C C AG C A - 3 ' f o r c re , 5 'A A A AT G A A G A G C A C C AT C T T C - 3 ' a n d 5 ' TCTAGAGTTCATCTTTCTCATC-3' for sck, 5'T GCAGAGAGCT TCAGAGAGTG-3' and 5'ACACCCTGACCTAGTTGAGC-3' for cryIAc. For Southern blotting analysis, about 20 g of genomic DNA digested
with restriction endonuclease (NEB) was separated through
electrophoresis in 1.0% agarose gel and blotted onto
Hybond-N+ nylon membranes (Amersham Pharmacia). Blots
were hybridized with sck, cryIAc, hpt and cre, using the
PCR-generated fragments of sck, cryIAc, hpt and cre
(primers and conditions as described above) labeled with
[-32P] dCTP as probes.

after site-specific excision was designed and constructed

to test the function of Cre/lox system in rice. The construct,
pCALHGUS (Fig.1b), contained a selectable marker hpt gene
expression cassette flanking by two directly oriented lox
sites. This hpt cassette was located between the rice actin1 promoter and the gusA structural gene and as a result,
gusA expression from the actin1 promoter was blocked.
After the excision of the hpt cassette catalyzed by Cre
recombinase, the promoterless gusA gene will be adjacent
to the actin1 promoter (Fig.1b) and consequently, the gusA
gene will be activated and its expression could be detected.
Calli of elite indica rice restorer Minghui 86 were transformed with plant expression vectors pCACreBar,
pCALHGUS and pCUBACloxHpt. For vector pCACreBar,
transformed calli were selected and regenerated on pptcontaining medium and for vectors pCALHGUS and
pCUBACloxHpt, transformed calli were selected and regenerated on hygromycin-containing medium. Totally 5, 8, and
26 plants were derived from independent calli transformed
with pCACreBar, pCALHGUS and pCUBACloxHpt and
designated as cre-, Pactin-lox-hpt-lox-gusA- and lox-hptlox-sck-cryIAc-plants respectively.

Results

2.1 Experimental design and transformation of rice plants

A recombination-reporter gene system allowing visualization of GUS expression by activating promoterless gusA

Fig.1. Maps of plant expression vectors. a. pCACreBar. b. pCALHGUS. c. pCUBACloxHpt. cre, recombinase gene of Cre/lox system;
bar, phosphinothricin-N-acetyltaensferase gene; gusA, -glucuronidase gene; hpt, hygromycin phosphotransferase gene; sck, modified
cpti gene with a signal peptide and a KDEL coding sequences at 5' and 3' ends (Deng et al., 2003); cryIAc, Bacillus thuringiensis endotoxin
gene; Pactin, promoter of rice actin1 gene; Pmas, promoter of mannopine synthase gene; Pubi, promoter of maize ubiquitin gene; Tnos,
terminator of nos gene; Tocs, terminator of ocs gene; lox, specific recognition site of Cre/lox system; LB, RB, left and right borders of TDNA.

CHEN Song-Biao et al.: Cre/lox-mediated Marker Gene Excision in Elite Indica Rice Plants Transformed with Genes Conferring
Resistance to Lepidopteran Insects

2.2 GUS expression in hybrid plants of Pactin-lox-hptlox-gusA-plants cre-plants

PCR analyses were carried out to confirm the presence
of gusA or cre gene in selected primary Pactin-lox-hpt-loxgusA-plants and cre-plants. An expected 989-bp internal
fragment from gusA or an expected 1 000-bp internal fragment from cre could be detected in all Pactin-lox-hpt-loxgusA- or cre-plants (data not shown). The eight Pactinlox-hpt-lox-gusA-plants and five cre-plants were then
grown in the greenhouse and the plants were crossed for
producing hybrid seeds.
Four crosses of Pactin-lox-hpt-lox-gusA-plant creplant with 30 hybrid plants (F1) in total were made. All these
four crosses yielded GUS expressing hybrid plants (12 out
of 30) (Table 1). The GUS expression in individual crosses
varied from 2/7 (28.6%) to 6/12 (50%). GUS activity in whole
plants of a few rice seedlings was performed by histochemical assay and the GUS expression could be visualized in
leaf, stem and root (Fig.2). To confirm the excision of hpt
gene mediated by the Cre recombinase, the seedlings were
assayed for hygromycin resistance. Of 12 hybrid seedlings
with GUS expression, nine were hygromycin-sensitive (Table
1; example in Fig.3). PCR analysis showed that while the
parental Pactin-lox-hpt-lox-gusA-plants yielded the expected 845-bp fragment for hpt, the GUS-positive/
hygromycin-sensitive hybrid plants yielded no PCR fragment for hpt (example in Fig.4). However, the GUS-positive/hygromycin-resistant hybrid plants also yielded the
specific PCR fragment for hpt (example in Fig.4, lane 6),
suggesting the excision of hpt gene in these hybrid plants
was chimeric.
Table 1

2.3 Excision of hpt in hybrid plants of lox-hpt-lox-sckcryIAc-plantscre-plants

The lox-hpt-lox-sck-cryIAc-plants were also verified the
presence of sck and cryIAc genes by PCR and 22 out of 26
T0 plants yielded both expected 419-bp specific fragment
for sck and 744-bp specific fragment for cryIAc. These 22
plants and 2 T0 cre-plants, cre-1 and cre-3 (Table 1) were
planted in the greenhouse to produce selfed seeds. The
inheritance of transgenes was then tested by analyzing
segregation of hygromycin- or ppt-resistant phenotype in
selfed progeny and confirmed by PCR. Sixteen out of 22 T1
lines derived from T0 lox-hpt-lox-sck-cryIAc-plants and all
2 T1 cre-plant lines from cre-1 and cre-3 showed segregation of hygromycin-resistant : hygromycin-sensitive or pptresistant : ppt-sensitive in a nearly 3 : 1 ration (data not
shown). Homozygous T2 transgenic lines from these T1
lines were obtained by selection of seedlings on
hygromycin- or ppt-containing medium and confirmed by
PCR and then used for crossing.
Nine crosses of lox-hpt-lox-sck-cryIAc-plant creplant with 77 hybrid plants in total were made. The hybrid
seedlings were assayed of hygromycin resistance by culturing leaf tip on selective medium. Of 77 hybrid seedlings,
56 were hygromycin sensitive (Table 1). To corroborate the
excision of hpt gene, molecular analysis was performed on
hygromycin-sensitive hybrid plants. While expected 845bp fragment for hpt could be detected in parental lox-hptlox-sck-cryIAc-plants, the hygromycin-sensitive hybrid
plants yielded no PCR fragment for hpt (data not shown).
Genomic DNA isolated from hybrid plants of cross lox-hptlox-sck-cryIAc-8cre-1 (Table 1) and their parental plants

GUS expression and hygromycin sensitivity in the hybrid of lox-plant cre-plant

Cross
No. of tested F1 hybrid plants
No. of GUS+ plants
No. of hyg S plants
Pactin-lox-hpt-lox-gusA-2 cre-1
3
1
1(1)
Pactin-lox-hpt-lox-gusA-3 cre-1
8
3
2
Pactin-lox-hpt-lox-gusA-7 cre-3
12
6
5
Pactin-lox-hpt-lox-gusA-10 cre-3
7
2
1
Total
30
12
9
lox-hpt-lox-sck-cryIAc-2 cre-3
18
18 (2)
lox-hpt-lox-sck-cryIAc-8 cre-1
8
8
lox-hpt-lox-sck-cryIAc-11 cre-1
11
8
lox-hpt-lox-sck-cryIAc-11 cre-3
9
9
lox-hpt-lox-sck-cryIAc-12 cre-1
2
2
lox-hpt-lox-sck-cryIAc-12 cre-3
5
3
lox-hpt-lox-sck-cryIAc-20 cre-3
12
6
lox-hpt-lox-sck-cryIAc-29 cre-1
7
4
lox-hpt-lox-sck-cryIAc-29 cre-3
5
4
Total
77
56
Pactin-lox-hpt-lox-gusA, plants transformed with vector pCALHGUS; cre, plants transformed with vector pCACreBar; lox-hpt-lox-sckcryIAc, plants transformed with vector pCUBACloxHpt; GUS+, GUS-positive; hygS, hygromycin-sensitive. (1), only GUS+ plants were tested;
(2), all F1 hybrid plants were tested.

Fig.4. PCR analysis of hybrids of Pactin-lox-hpt-lox-gusAplant cre-plant for the gusA, hpt and cre genes. a. Samples of
amplification fragment for gusA. b. Samples of amplification fragment for hpt. c. Samples of amplification fragment for cre. M,
molecular marker; N, non-transgenic control plant; P, positive
control; 1, parental Pactin-lox-hpt-lox-gusA-plant; 27, hybrid
rice plants of Pactin-lox-hpt-lox-gusA-7cre-3 (Table 1); 8, parental cre-plant.

Figs.23. GUS expression and hygromycin sensitivity assay of

hybrid plants of Pactin-lox-hpt-lox-gusA-plant cre-plant. 2.
GUS expression in hybrid plant. left, non-transgenic control plant;
center, hybrid plant of Pactin-lox-hpt-lox-gusA-7cre-3 (Table
1); right, parental Pactin-lox-hpt-lox-gusA-plant. 3. Hygromycin
sensitivity assay of rice seedling leaves. 12, non-transgenic control plants; 35, parental Pactin-lox-hpt-lox-gusA-plants; 69,
hybrid plants of Pactin-lox-hpt-lox-gusA-7cre-3 (Table 1); 10
12, parental cre-plants.

was subjected to Southern blot hybridization with sck,

cryIAc, hpt and cre probes respectively (example in Fig.5).
For hybridization with sck, cryIAc and hpt probes, genomic
DNA was digested with BamH and for hybridization
with cre probe, genomic DNA was digested with Hind .
The hygromycin-sensitive hybrid plants yielded sck, cryIAc
and cre but hpt hybridization signals (Fig.5, lanes 25),
while the parental lox-hpt-lox-sck-cryIAc-plant yielded sck,
cryIAc and hpt hybridization signals (Fig.5, lane 1) and the
parental cre-plant yielded cre hybridization signal (Fig.5,

Fig.5. Southern analysis of hybrids of lox-hpt-lox-sck-cryIAcplant cre-plant. ac. Genomic DNA was digested with the
restriction enzyme BamH and hybridizations were done with
sck, cryIAc or hpt probe respectively. d. Genomic DNA was
digested with the restriction enzyme Hind and hybridizations
were done with cre probe. P, the 0.56-kp sck-Tnos fragment, 2.1kp cryIAc-Tnos fragment and 1.05-kp hpt fragment digested by
BamH from plasmid pCUBACloxHpt (Fig.1c) and the 1.0-kb
cre fragment digested by Hind from plasmid pCACreBar (Fig.
1a) were analyzed as positive control for ac and d respectively;
N, non-transgenic control plant; 1, parental lox-hpt-lox-sck-cryIAcplant; 2-5 hybrid rice plants of lox-hpt-lox-sck-cryIAc-8cre-1
(Table 1); 6, parental cre-plant.

CHEN Song-Biao et al.: Cre/lox-mediated Marker Gene Excision in Elite Indica Rice Plants Transformed with Genes Conferring
Resistance to Lepidopteran Insects

lane 6).

3 Discussion
The Cre/lox site-specific recombination system from E.
coli phage P1 has been well characterized. Cre is a 38.5-kD
protein that recognizes and interacts with two 34-bp lox
recognition sequences resulting in excision, integration or
inversion of the intervening DNA sequences depending
on the orientation of lox sites. The Cre/lox system has
been used successfully to manipulate transgenes or chromosomes in the nuclear genomes of a wide variety of organisms including animals (Gorman and Bullock, 2000) and
plants (Ow, 2002). In plants, the Cre/lox-mediated manipulation included chromosome recombination, translocation
or deletion (Koshinsky et al., 2000; Vergunst et al., 2000),
site-specific integration of the transgenes (Albert et al.,
1995; Vergunst and Hooykaas, 1998; Vergunst et al., 1998;
Day et al., 2000), reducing the copy number of DNA inserts
in the host genome (Srivastava et al., 1999) and deletion of
selectable marker genes from the host genomes (Dale and
Ow, 1991; Russell et al., 1992; Gleave et al., 1999; Zuo et
al., 2001; Endo et al., 2002; Zhang et al., 2003).
In the present study, we demonstrated the Cre/lox-mediated excision of selectable marker hpt gene in the rice
plants using a recombination-reporter gene system. The
excision of lox-hpt-lox led to the fusion of the gusA gene to
the rice actin1 promoter and consequently activated the
expression of gusA gene. The crossing strategy was used
to introduce the cre gene into the lox plants and four
crosses were made from T0 Pactin-lox-hpt-lox-gusA-plant
with T0 cre-plant. The recombination was found in all four
crosses although the efficiency of the recombination
(expressed as the percentage of GUS expression plants)
varied among individual crosses. Leaf assay on
hygromycin-containing medium and PCR amplification confirmed the excision of hpt from the hybrid plants genome.
Chimeric excision of transgenes in host genomes mediated by site-specific recombination system was reported to
be a common phenomenon in many experiments (Dale and
Ow, 1991; Russell et al., 1992; Onouchi et al., 1995; Bar et
al., 1996; Hoa et al., 2002). In this study, we also found that
in a few cases of the tested hybrid plants, the GUS expression phenotype was inconsistent with the hygromycin-resistant phenotype (Table 1) and these plants also yielded
the expected 845-bp fragment when PCR analysis was carried out using the specific primers for hpt gene. These results suggested that the recombination in these plants was
induced at early germinal stage, or is random during the
somatic development stage (Hoa et al., 2002) and the

excision of hpt was incomplete. To improve the recombination efficiency, it might need to select transformants with
high expression of Cre to produce hybrid plants (Bayley et
al., 1992).
Site-specific recombination systems have been used to
successfully excise marker genes in plants, including economically important crops rice and maize (Endo et al., 2002;
Hoa et al., 2002; Zhang et al., 2003). However, most of
these experiments were carried out based on reporter genes
such as gusA or gfp to detect the gene excision. Here we
demonstrated the utility of Cre/lox in excision of selectable
marker gene in commercial rice plants transformed with insecticidal genes. Instead of using reporter genes to detect
the recombination, we monitored the hpt excision by a
simple leaf assay method. In 77 hybrid plants made from T2
homozygous plants carrying sck and cryIAc with T2 homozygous plants carrying cre, 56 were found with
hygromycin-sensitive phenotype and confirmed of the excision of hpt by molecular analysis. Therefore, after removal
of the cre and bar gene constructs in hybrid plants by
genetic segregation, plants might be obtained that contained only the sck and cryIAc genes and used to develop
commercial insect-resistant lines. The absence of selectable marker genes would contribute to the public acceptance of transgenic rice.
Acknowledgements: The authors wish to thank Dr. P J J
Hooykaas and Dr. A C Vergunst, Institute of Molecular
Plant Sciences, Leiden University, for kindly providing plasmid pUC19-cre.
References:
Albert H, Dale E C, Lee E, Ow D W. 1995. Site-specific integration of DNA into wild-type and mutant lox sites in the plant
genome. Plant J, 7: 649659.
Araki H, Jearnpipatkul A, Tatsumi H, Sakurai T, Ushino K, Muta
T, Oshima Y. 1987. Molecular and functional organization of
yeast plasmid pSR1. J Mol Biol, 182: 191203.
Austin S, Ziese M, Sternberg N. 1981. A novel role of site-specific recombination in maintenance of bacterial replicons. Cell,
25: 729736.
Bar M, Leshem B, Gilboa N, Gidoni D. 1996. Visual characterization of recombination at FRT-gusA loci in transgenic tobacco
mediated by constitutive expression of the native FLP
recombinase. Theor Appl Genet, 93: 407413.
Bayley C, Morgan M, Dale E C, Ow D W. 1992. Exchange of
gene activity in transgenic plants catalyzed by the Cre-lox
site-specific recombination system. Plant Mol Biol, 18: 353
281.
Broach J R, Guarascio V R, Jayaram M. 1982. Recombination


within the yeast plasmid 2 micron circle is site specific. Cell,
29: 227234.
Cheng X, Sardana R, Kaplan H, Altosaar I. 1998. Agrobacteriumtransformed rice plants expressing synthetic cryIA(b) and cryIA

Hoa T T C, Bong B B, Huq E, Hodge T K. 2002. Cre/lox sitespecific recombination controls the excision of a transgene
from the rice genome. Theor Appl Genet, 104: 518525.
Jefferson R A, Kavanagh T A, Bevan M W. 1987. GUS fusions:

(c) genes are highly toxic to striped stem borer and yellow

-glucuronidase as a sensitive and versatile gene fusion marker

stem borer. Proc Natl Acad Sci USA, 95: 27672772.

in higher plants. EMBO J, 6: 39013907.

Chu C-C . 1978. The N6 medium and its applications to anther

Khanna H, Raina S. 2002. Elite indica transgenic rice plants ex-

culture of cereal crops. Proceedings of Symposium in Plant

pressing modified CryIAc endotoxin of Bacillus thuringiensis

Tissue Culture. Peking: Science Press. 4350.

Christensen A H, Quail P H. 1996. Ubiquitin promoter-based

show enhanced resistance to yellow stem borer (Scirpophaga

incertulas). Transgenic Res, 11: 411423.

vectors for high-level expression of selectable and/or screenable

Koshinsky H A, Lee E, Ow D W. 2000. Cre/lox site-specific

marker genes in monocotyledonous plants. Transgenic Res, 5:

recombination between Arabidopsis and tobacco chromosomes.

213218.
Dale E C, Ow D W. 1991. Gene transfer with subsequent removal

Plant J, 23: 715722.

Maqbool S B, Husnain T, Riazuddin S, Masson L, Christou P.

of the selection gene from the host genome. Proc Natl Acad Sci

1998. Effective control of yellow stem borer and rice leaf

USA, 88: 1055810562.

folder in transgenic rice indica varieties Basmati 370 and m 7

Day C D, Lee E, Kobayashi J, Holappa L D, Albert H, Ow D W.

2000. Transgene integration into the same chromosome loca-

using the novel -endotoxin cry2A Bacillus thuringiensis gene.

Mol Breeding, 4: 501507.

tion can produce alleles that express at a predictable level, or

McElroy D, Zhang W, Cao J, Wu R. 1990. Isolation of an effi-

alleles that are differentially silenced. Genes Dev, 14: 2869

cient actin promoter for use in rice transformation. Plant Cell,

2880.
Deng C-Y, Song G-S, Xu J-W , Zhu Z. 2003. Increasing accumu-

2: 163171.
Mozo T, Hooykaas P J J. 1992. Design of a novel system for the

lation level of foreign protein in transgenic plant through protein

construction of vectors for Agrobacterium-mediated plant

targeting. Acta Bot Sin , 45: 10841089.

transformation. Mol Gen Genet, 236: 17.

Duan X, Li X, Xue Q, Abo-EI-Saad M, Xu D, Wu R. 1996.

Murray H G, Thompson W P. 1988. Rapid isolation of high

Transgenic rice plants harboring an introduced potato pro-

molecular weight DNA. Nucleic Acids Res, 8: 43214325.

teinase inhibitor gene are insect resistant. Nat Biotechnol,

Nayak P, Basu D, Das S, Basu A, Ghosh D, Ramakrishnan N A,

14: 494498.

Ghosh M, Sen S K. 1997. Transgenic elite indica rice plants

Ebinuma H, Sugita K, Matsunaga E, Endo S, Yamada K, Komamine

expressing CryIAc -endotoxin of Bacillus thuringiensis are

A. 2001. Systems for the removal of a selection marker and

resistant against yellow stem borer (Scirpophaga incertulas).

their combination with a positive marker. Plant Cell Rep, 20:

383392.

Proc Natl Acad Sci USA, 94: 21112116.

Onouchi H, Nishihama R, Kudo M, Machida Y, Machida C.

Endo S, Sugita K, Sakai M, Tanaka H, Ebinuma H. 2002. Single-

1995. Visualization of site-specific recombination catalyzed

step transformation for generating marker-free transgenic rice

by a recombinase from Zygosaccharomyces rouxii in

using the ipt-type MAT vector system. Plant J, 30: 115122.

Fujimoto H, Itoh K, Yamamoto M, Kyozuk J, Shimamoto K.
1993. Insect resistant rice generated by introduction of a modified -endotoxin gene by Bacillus thuringiensis. Bio/Technology,
11: 11511155.
Gleave A P, Mitra D S, Mudge S R, Morris B A M. 1999. Select-

Arabidopsis thaliana. Mol Gen Genet, 247: 653660.

Ow D W. 2002. Recombinase-directed plant transformation for
the post-genomic era. Plant Mol Biol, 48: 183200.
Russell S H, Hoopes J L, Odell J T. 1992. Directed excision of a
transgene from the plant genome. Mol Gen Genet, 234: 49
59.

able marker-free transgenic plants without sexual crossing:

Srivastava V, Anderson O D, Ow D W. 1999. Single-copy

transient expression of cre recombinase and use of a condi-

transgenic wheat generated through the resolution of comolex

tional lethal dominant gene. Plant Mol Biol, 40: 223235.

Gorman C, Bullock C. 2000. Site-specific gene targeting for gene
expression in eukaryotes. Curr Opin Biotech, 11: 455460.
Hiei Y, Shozo O, Komari T, Takashi K. 1994. Efficient transformation of rice (Oryza sativa L): mediated by Agrobacterium
and sequence analysis of the boundaries of the T-DNA. Plant
J, 6: 271282.

integration patterns. Proc Natl Acad Sci USA, 96: 11117

11121.
Sugita K, Matsunaga E, Ebinuma H. 1999. Effective selection
system for generating marker-free transgenic plants independent of sexual crossing. Plant Cell Rep, 18: 941947.
Sugita K, Kasahara T, Matsunaga E, Ebinuma H. 2000. A transformation vector for the production of marker-free transgenic

CHEN Song-Biao et al.: Cre/lox-mediated Marker Gene Excision in Elite Indica Rice Plants Transformed with Genes Conferring
Resistance to Lepidopteran Insects

plants containing a single copy transgene at high frequency.

Plant J, 22: 461469.
Tu J, Zhang G, Datta K, Xu C, He Y, Zhang Q, Khush G S, Datta
S K. 2000. Field performance of transgenic elite commercial
hybrid rice expressing Bacillus thuringiensis -endotoxin. Nat
Biotechnol, 18: 11011104.
Vergunst A C, Hooykaas P J J. 1998. Cre/lox-mediated site-specific integration of Agrobacterium T-DNA in Arabidopsis

Xu D, Xue Q, Mcelroy D, Mawal Y, Hilder V A, Wu R. 1996.

Constitutive expression of a cowpea trypsin inhibitor gene,
CpTi, in transgenic rice plants confers resistance to two major
rice insect pests. Mol Breeding, 2: 167173.
Yoder J I, Goldsbrough A P. 1994. Transformation system for
generating marker-free transgenic plants. Bio/Technology, 12:
263267.
Zhang W, Subbarao S, Addae P, Shen A, Armstrong C, Peschke V,

thaliana by transient expression of Cre. Plant Mol Biol, 38:

Gilbertson L. 2003. Cre/lox-mediated marker gene excision in

393406.

transgenic maize (Zea mays L.) plants. Theor Appl Genet,

Vergunst A C, Jansen L E T, Fransz P F, Hans de Jong J, Hooykaas

P J J. 2000. Cre/lox-mediated recombination in Arabidopsis:

107: 11571168.
Zhou H-Y , Chen S-B, Li X-G , Xiao G-F , Wei X-L , Zhu Z ().

evidence for transmission of a translocation of a translocation

2003. Generating marker-free transgenic tobacco plants by

and a deletion event. Chromosoma, 109: 287297.

Agrobacterium-mediated transformation with double T-DNA

Vergunst A C, Jansen L E T, Hooykaas P J J. 1998. Site-specific

integration of Agrobacterium T-DNA in Arabidopsis thaliana

binary vector. Acta Bot Sin , 45: 11031108.

Zuo J R, Nui Q W, Geir M S, Chua N H. 2001. Chemical regulated,

mediated by Cre recombinase. Nucleic Acids Res, 26: 2729

site-specific DNA excision in transgenic plants. Nat Biotechnol,

2734.

19: 157161.

Wang M B, Waterhouse P M. 1997. A rapid and simple method of

assaying plants transformated with hygromycin or PPT resistance genes. Plant Mol Biol Rep, 15: 209215.

(Managing editor: ZHAO Li-Hui)