Proc. Nadl. Acad. Sci.

USA
Vol. 84, pp. 6340-6344, September 1987
Biochemistry

Isolation and sequence of complementary DNA encoding human
extracellular superoxide dismutase
(placental cDNA expression library/nucleotide sequence/amino acid sequence/molecular evolution/oxygen radicals)

KARIN HJALMARSSON*, STEFAN L. MARKLUNDtt, AKE ENGSTROM§, AND THOMAS EDLUND¶
*Department of Molecular Genetics and Cell Biology, SYN-TEK AB, Box 1451, S-901 24 UmeA, Sweden; tDepartment of Clinical Chemistry,
Umea University Hospital, S-901 85 Umea, Sweden; §Department of Immunology, Biomedical Center, Box 582, S-751 23 Uppsala, Sweden;
and 1Department of Microbiology, Ume& University, S-901 87 UmeA, Sweden
Communicated by Irwin Fridovich, May 8, 1987

ABSTRACT
A complementary DNA (cDNA) clone from a
human placenta cDNA library encoding extracellular superoxide dismutase (EC-SOD; superoxide:superoxide oxidoreductase, EC 1.15.1.1) has been isolated and the nucleotide sequence determined. The cDNA has a very high G+C content.
EC-SOD is synthesized with a putative 18-amino acid signal
peptide, preceding the 222 amino acids in the mature enzyme,
indicating that the enzyme is a secretory protein. The first 95
amino acids of the mature enzyme show no sequence homology
with other sequenced proteins and there is one possible
N-glycosylation site (Asn-89). The amino acid sequence from
residues 96-193 shows strong homology (:50%) with the rinal
two-thirds of the sequences of all known eukaryotic CuZn
SODs, whereas the homology with the P. leiognathi CuZn SOD
is clearly lower. The ligands to Cu and Zn, the cysteines
forming the intrasubunit disulfide bridge in the CuZn SODs,
and the arginine found in all CuZn SODs in the entrance to the
active site can all be identified in EC-SOD. A comparison with
bovine CuZn SOD, the three-dimensional structure of which is
known, reveals that the homologies occur in the active site and
the divergencies are in the part constituting the subunit contact
area in CuZn SOD. Amino acid sequence 194-222 in the
carboxyl-terminal end of EC-SOD is strongly hydrophilic and
contains nine amino acids with a positive charge. This sequence
probably confers the affnity of EC-SOD for heparin and
heparan sulfate. An analysis of the amino acid sequence
homologies with CuZn SODs from various species indicates
that the EC-SODs may have evolved from the CuZn SODs
before the evolution of fungi and plants.

reactions between rabbit polyclonal antibodies directed
toward the enzymes have been observed (8). The present
paper presents the isolation and characterization of a complementary DNA (cDNA) clone from human placenta encoding EC-SOD. The deduced amino acid sequence is
compared with those of sequenced CuZn SODs. 1

MATERIALS AND METHODS
Chemicals. Restriction endonucleases were obtained from
Boehringer Mannheim. 35S- and 32P-labeled nucleotides and
nitrocellulose filters were purchased from Amersham.
DuPont Cronex 4 x-ray film was obtained from E. I. DuPont
de Nemours.
Strains, Phages, and Plasmids. Escherichia coli Y 1090 (10)
was used for plating of the Xgtll placenta cDNA library, E.
coli HB101 (11) was used for propagation of plasmids, and E.
coli strain JM 103 (12) was for propagation of M13 vector mp9
derivatives. The human placenta cDNA library prepared in
the vector Xgtll was obtained from Clontech Laboratories
(Palo Alto, CA) (catalogue no. HL 1008 lot 1205). For
determination of the nucleotide sequence of cDNA clones,
the M13 vector mp9 (13) was used. Subcloning of cDNA
fragments was carried out in plasmid pUC18 (14).
Amino Acid Sequence Analysis. EC-SOD type C, isolated
from human umbilical cords (7), was desalted by gel filtration
in 50 mM NH4HCO3. It was then reduced with dithiothreitol
(2 mM) in 6 M guanidinium hydrochloride/0.5 M Tris HCl,
pH 8.0, for 1 hr at 37°C and alkylated with iodo[3H]acetic acid
(2.2 mM) for 1 hr at room temperature in the dark. Digestion
of the reduced and alkylated EC-SOD with trypsin 1:50
(wt/wt) was done in 0.1 M NH4HCO3 containing 0.1 mM
CaCl2 at 37°C for 1.5 hr. Separation of tryptic peptides was
done by reversed-phase chromatography on a ,uBondapak
C18 column (Waters Associates) eluted with a linear gradient
of acetonitrile in 0.1% trifluoroacetic acid. The eluate was
monitored at 220 nm and liquid scintillation counting identified cysteine-containing fractions. The intact protein and
isolated tryptic peptides were sequenced by automated
Edman degradation (15) on a Beckman 890 C sequencer as
described (16). In the intact protein, the sequence of the first
33 amino-terminal amino acids was determined (cf. Fig. 1).
Cloning and Sequencing of Human EC-SOD. Preparation of
a DNA probe. On the basis of the amino-terminal amino acid
sequence of human EC-SOD (see Fig. 1) and the postulated
codon usage for eukaryotic proteins (17), a synthetic 48-mer
deoxyoligonucleotide (5' CAGGGACATGTATGCCAAG-

Extracellular superoxide dismutase (EC-SOD; superoxide:
superoxide oxidoreductase, EC 1.15.1.1) is the major SOD
isoenzyme in extracellular fluids such as plasma, lymph (1),
and synovial fluid (2) but occurs also in tissues (3, 4).
EC-SOD is heterogenous with regard to binding to heparinSepharose and can be separated into three fractions: A,
without affinity; B, with weak affinity; and C, with relatively
high affinity (5). Most EC-SOD in the vascular system is
apparently bound to endothelial cell surfaces (6). Membranebound heparan sulfate is the likely receptor for the enzyme
(K. Karlsson and S.L.M., unpublished data) and EC-SOD
fraction C is the form that binds (6).
EC-SOD is a tetrameric glycoprotein with an apparent
subunit molecular weight of -30,000 (5). Like the CuZn
SODs, EC-SOD contains one Cu and one Zn atom per
subunit (5, 7) and is inhibited by cyanide, azide, diethyldithiocarbamate, and H202 (8). As for the CuZn SODs, H202 is
the product of the catalyzed reaction (9). Still, despite the
similarities, the amino acid compositions of human CuZn
SOD and EC-SOD are clearly different (5) and no cross-

Abbreviations: SOD, superoxide dismutase; EC-SOD, extracellular SOD.
tTo whom reprint requests should be addressed.
lThe sequence reported in this paper is being deposited in the
EMBL/GenBank data base (Bolt, Beranek, and Newman Laboratories, Cambridge, MA, and Eur. Mol. Biol. Lab., Heidelberg)
(accession no. J02947).

The publication costs of this article were defrayed in part by page charge
payment. This article must therefore be hereby marked "advertisement"
in accordance with 18 U.S.C. §1734 solely to indicate this fact.
6340

to which 20. respectively. 1. Homologies with other proteins were searched for using the Protein Identification Resource. The filters were exposed to DuPont Cronex 4 x-ray film overnight. Underlined amino acid sequences have been confirmed by amino acid sequence analysis of intact EC-SOD and of tryptic peptides. 21-23) after subcloning into the EcoRI site of the M13 vector mp9 and generating a sequential series of overlapping clones by the method of Dale et al. The insert was found to be 1396 base pairs (bp) long and contained an open reading frame of 240 amino acids surrounded by 69-bp and 607-bp untranslated regions of the 5' and 3' ends.1% NaDodSO4 at 37°C and allowed to air dry. Each filter contained about six positive plaques..homologous to the postulated consen- **Protein Identification Resource (1986) Protein Sequence Database (Natl. this sequence of amino acids is rich in hydrophobic amino acids and the last residue is alanine. Materials and Methods) corresponds to amino acid 19 of the deduced amino acid sequence.g of denatured sonicated calf thymus DNA per ml. phenol and chloroform extraction. Acad. pH 6. were presoaked in 0. Phages from plaques showing a positive hybridization reaction were isolated and purified and DNA was extracted (20). Washington. Sci.ug of Asp3 was cleaved with EcoRI and the cDNA insert was separated from X DNA by electrophoresis in a 6% polyacrylamide gel. coli HB101. All nucleotide sequencing data were compiled and analyzed using the GENEUS computer system (25). and then prehybridized for 1 hr at 41'C in 40 ml of 20% formamide/750 mM NaCI/75 mM Na3 citrate/0.05 . Underlined amino acid sequences have been confirmed by amino acid sequence analysis of intact EC-SOD and of tryptic peptides. the filters were washed once in 30 mM NaCI/3 mM Na3 citrate at 37°C followed by four washes in the same solution containing 0. Eight nitrocellulose filters. Subcloning and sequencing of cDNA encoding human EC-SOD. Then. Found.8/50 . for 18 hr at 41°C. Like known signal peptides. Biomed. cDNA sequence and deduced amino acid sequence of EC-SOD. Natl. and ethanol precipitation (19). DC). The preceding 18 amino acids apparently represent a signal peptide. Release 8. The DNA sequence found at the translation initiating codon. containing 3557 sequences. The length of the cDNA inserts was determined by agarose gel electrophoresis after cleavage of the phage DNA with EcoRI. Transfer of plaques to and treatment of nitrocellulose filters were done essentially as described by Maniatis et al.ug of EcoRI-digested alkaline phosphatase-treated pUC18 DNA and then transformed into strain E. coli Y 1090. Plasmid pLS3 DNA was subjected to restriction endonuclease analysis. -CAGCCAUGC-.75 M NaCl/75 mM Na3 citrate.Biochemistry: Hjalmarsson et al. The cDNA fragment was isolated from the gel by electroelution. Transform- ants were selected on plates containing ampicillin.1% (wt/vol) Ficoll/0. The hybridization was performed in the prehybridization solution supplemented with 100 /LM ATP (final concentration) and 7 x 105 cpm of the [y-32P]ATP end-labeled 48-mer probe per ml. 0. Computer Programs and Analysis. Screening of a human placenta cDNA library. which is one of the amino acids found in this position in known signal peptides (26). Proc.(27). GTGACTGAGATCTGGCAGGAGGTGATGCA 3') com- plementary to the coding strand of the EC-SOD gene was synthesized (18). 1. About 30 .000 plaques had been transferred per filter.** RESULTS Nucleotide Sequence of Human EC-SOD cDNA. The complete nucleotide sequence of both DNA strands of the cDNA insert of phage Xsp3 was determined (12.1% (wt/vol) bovine serum albumin/0. . The recombinant phage carrying the largest cDNA insert was designated Xsp3 and was chosen for further studies. The recombinant phages of the Xgtll human placenta cDNA library were screened for human EC-SOD cDNA sequences by plating the phages on the indicator strain E. is homologous to the postulated consensus sequence for eukaryotic initiation sites.g of the isolated cDNA fragment was ligated to 1 . -CCGCCAUG(G). described above. The nucleotide sequence and deduced amino acid sequence of the cDNA insert of Xsp3 are shown in Fig. Res. (24). A possible polyadenylylation signal with the sequence -ATTAAA.0.1% (wt/vol) polyvinylpyrrolidone/50 mM sodium phosphate. A recombinant plasmid carrying the cDNA insert was identified and designated pLS3. USA 84 (1987) -18 6341 -10 MetLeuAlaLeuLeuCysSerCysLeuLeuLeuAlaAlaGlyAlaSerAsp CTGGGTGCAGCTCTCTTTTCAGGAGAGAAAGCTCTCTTGGAGGAGCTGGAAAGGTGCCCGACTCCAGCCATGCTGGCGCTACTGTGTTCCTGCCTGCTCCTGGCAGCCGGTGCCTCGGAC 1 120 -1 +1 10 20 30 AlaTrpThrGlyGluAspSerAlaGluProAsnSerAspSerAlaGluTrpIleArgAspMetTyrAlaLysValThrGluIleTrpGlnGluValMetGlnArgArgAspAspAspGly GCCTGGACGGGCGAGGACTCGGCGGAGCCCAACTCTGACTCGGCGGAGTGGATCCGAGACATGTACGCCAAGGTCACGGAGATCTGGCAGGAGGTCATGCAGCGGCGGGACGACGACGGC 40 240 50 60 70 ThrLeu~isAlaAlaCysGlnValGlnProSerAlaThrLeuAspAlaAlaGlnProArgValThrGlyValValLeuPheArgGlnLeuAlaProArgAlaLysLeuAspAlaPhePhe ACG CT CCACGCCGC 80 CTGCCAGGTGCAG CCGT CGGC CACG CTGGACGCCGCGCAG C CCCGGGTGACCGGCGTCGTC CTCTT CCGG CAGCTTGCGCC CCG CGC CAAG CT CGACGCCTTCTTC 360 90 100 110 AlaLeuGluGlyPheProThrGluProAsnSerSerSerArgAlaIleHisValHisGlnPheGlyAspLeuSerGlaGlyCysGluSerThrGlyProHisTyrAsnProLeuAlaVa1 GCCCTGGAGGGCTTCCCGACCGAGCCGAACAGCTCCAGCCGCGCCATCCACGTGCACCAGTTCGGGGACCTGAGCCAGGGCTGCGAGTCCACCGGGCCCCACTACAACCCGCTGGCCGTG 480 120 130 140 150 ProHisProGlnHisProGlyAspPheGlyAsnPheAlavalArgAspGlySerLeuTrpArgTyrArgAlaGlyLeuAlaAlaSerLeuAlaGlyProHisSerIleValGlyArgAla CCGCACCCGCAGCACCCGGGCGACTTCGGCAACTTCGCGGTCCGCGACGGCAGCCTCTGGAGGTACCGCGCCGGCCTGGCCGCCTCGCTCGCGGGCCCGCACTCCATCGTGGGCCGGGCC 600 160 170 180 190 ValValValHisAlaGlyGluAspAspLeuGlyArgGlyGlyAsnGlnAlaSerM'alGiuAsnGlyAsnAlaGlyArgArgLeuAlaCysCysValValGlyValCysGlyProGlyLeu GTGGTCGTCCACGCTGGCGAGGACGACCTGGGCCGCGGCGGCAACCAGGCCAGCGTGGAGAACGGGAACGCGGGCCGGCGGCTGGCCTGCTGCGTGGTGGGCGTGTGCGGGCCCGGGCTC 720 200 210 220 TrpGluArgGlnAlaArgGluHisSerGluArgLysLysArgArgArgGluSerGluCysLysAlaAla*** TGGGAGCGCCAGGCGCGGGAGCACTCAGAGCGCAAGAAGCGGCGGCGCGAGAGCGAGTGCAAGGCCGCCTGAGCGCGGCCCCCACCCGGCGGCGGCCAGGGACCCCCGAGGCCCCCCTCT 840 GCCTTTGAGCTTCTCCTCTGCTCCAACAGACACCTTCCACTCTGAGGTCTCACCTTCGCCTCTGCTGAAGTCTCCCCGCAGCCCTCTCCACCCAGAGGTCTCCCTATACCGAGACCCACC 960 ATC CTT CCAT CCTGAGGAC CGC C CCAAC CCT CGGAGCC CCCCACTCAGTAGGTCTGAAGGC CTCCATTTGTACCGAAACAkCC CCG CTCACGCTGACAGC CTCCTAGG CT CCCTGAGGTAC 1080 CTTTCCACCCAGACCCTCCTTCCCCACCCCATAAGCCCTGAGACTCCCGCCTTTGACCTGACGATCTTCCCCCTTCCCGCCTTCAGGTTCCTCCTAGGCGCTCAGAGGCCGCTCTGGGGG 1200 GTTGC CTCGAGTCCCCCCAC CCCT C CCCAC CCAC CACCG CTC CCGCGGCAAGCCAGCCCGTGCAACGGAAGCCAGGCCAACTG C CCCGCGTCTTCAG CTGTTTCG CATC CACCGCCACCC 1320 CACTGAGAGCTGCTCCTTTGGGGGAATGTTTGGCAACCTTTGTGTTACAGATTAAAAATTCAGCAATTCAAAAAAA 1396 FIG. After incubation. (19). The start of mature EC-SOD (cf.

cow. this corresponds to a part of the loop in the "zinc ligand region" (40). diethyldithiocarbamate. There is a strong preference for codons containing a maximal number of G+C. horse. Codon usage for the gene encoding human EC-SOD including signal peptide Amino acid Leu Ser Arg Val Pro Thr No. leiognathi CuZn SODs are aligned along the EC-SOD sequence. The cysteines forming the intrasubunit disulfide bridge in the CuZn SODs also have their counterparts in EC-SOD. show no sequence homologies with the CuZn SOD family (Fig. unpublished data). All ligands to the Cu and Zn atoms can be identified in EC-SOD. The last significant difference is seen at residues 175-180. yeast. Cys107 and Cys-189. Acad. For comparison. His-121. DISCUSSION The amino acid sequence of human EC-SOD. 2. 52. the EC-SOD sequence shows strong homologies with the CuZn SOD family. contains a signal peptide. P. and Asp-127) can be identified in EC-SOD. Of the 76 positions in this region. Karlsson and S." These parts of bovine CuZn SOD are positioned in the outer surface of the "B-barrel. 54. 48. in which at least six of the nine CuZn SODs share amino acids (enclosed in Fig. a reasonable order . which correspond to B-strand "4f. The codon usage of the gene encoding EC-SOD is shown in Table 1. It is possible that the deviant sequences in the homologous region and parts of the first 95 amino acids of EC-SOD are responsible for the tetramer subunit contact. The arginine in the active site entrance of the CuZn SODs (40).M. His-124. The sequence starts with an 18-amino acid signal peptide preceding the amino terminus of mature EC-SOD as discussed above. spinach. fruit fly. The carboxyl-terminal end of EC-SOD (residues 194-222) is very hydrophilic and the most distinctive feature is the high content (nine) of positively charged amino acids. 2). horse. fruit fly. The carboxyl-terminal end of EC-SOD is very hydrophilic and contains many positively charged amino acid residues. 56. 3c. This part is also less conserved among the CuZn SODs. residues 96-193. The homology is lower from residues 117-123. It is therefore likely to extend out into the solvent. 1 and 2. We propose that this part of the protein confers the affinity of EC-SOD for heparin (5) and analogues such as heparan sulfate leading in vivo to binding to cellular surfaces (ref. corresponding to a part of the "active site lid loop" in bovine CuZn SOD (40). Deduced Amino Acid Sequence. of codons 1 21 1 9 1 17 Phe 0 8 Codon GCU GCC GCA GCG GGU GGC GGA GGG AUU AUC AUA 7 3 0 9 0 11 0 7 0 5 0 14 0 15 1 7 (1987) SODs contain identical amino acids in the region. and 1202 (8). 2b." EC-SOD was also deviant from residues 137-147 (92-102 in bovine CuZn SOD). USA 84 sus sequence AATAAA is found 14 bp upstream of the polyadenylylation tail (28). 52. Arg-186. the following numbers of identical amino acids are found: human. among which the only N-glycosylation site is found (Asn-89). Comparison of EC-SOD with sequences of CuZn SODs from different species allows some speculations on the evolutionary history of the EC-SODs (Fig. The conformation of EC-SOD around the active site is therefore expected to be very similar to that of the CuZn SODs. which indicates that EC-SOD is a secretory protein as postulated (1. The region of the EC-SOD sequence. the three-dimensional structure of which is known (40). The parts of bovine CuZn SOD that are homologous to EC-SOD form the environment of the Cu and Zn atoms. This would explain the similarities of EC-SOD and CuZn SODs with respect to specific activity (5) and sensitivity to inhibitors like cyanide. The amino acid composition of the deduced sequence is very similar to the amino acid compositions of human native EC-SOD isolated from lung (5) and umbilical cord (7) and recombinant EC-SOD produced by expression of the cDNA in Chinese hamster ovary cells (7). swordfish. cow. the sequences of the human. If the 98 amino acids of EC-SOD in sequence positions 96-193 are compared with homologous positions in the CuZn SODs. it is found that all ligands to Cu (His-96. where some amino acids are deleted in EC-SOD. Another less homologous sequence is in the region 137-147. In bovine CuZn SOD. The first 43 residues of bovine CuZn SOD constitute B-strands "la. is also found in EC-SOD. pig. as deduced from the cDNA. 2). the chemical modification of which leads to inactivation of the enzyme (41). of Codon UUA UUG CUU CUC CUA CUG UCU UCC UCA UCG AGU AGC CGU CGC CGA CGG AGA AGG GUU GUC GUA GUG CCU CCC CCA CCG ACU ACC ACA ACG codons 0 Amino acid Ala 0 1 7 1 Gly 11 1 4 1 Ile 5 0 6 0 His Gln Asn Lys 0 5 Asp 0 8 3 4 CAU CAC CAA CAG AAU AAC AAA AAG GAU GAC Glu GAA Cys GAG UGU UGC 0 0 0 UUC UAU UAC 0 10 4 Tyr 0 7 5 0 0 0 1 0 UUU 1 10 No. 6. EC-SOD has an identical amino acid in 49 positions. the identities with the CuZn SODs from various species cannot be judged to differ significantly and follow any order of evolution. His-113. 49. Except for P." which constitutes the main part of the subunit contact area in the enzyme. and P. Since EC-SOD is a tetramer. 53. The first 95 amino acids of EC-SOD. its subunit contact area should be different and larger. K. In the region His-96 to Gly-193. leiognathi. 30.174. If EC-SOD is compared with bovine CuZn SOD. Nor was it possible to find any significant homologies with other proteins in the Protein Identification Resource. Proc. azide. homologous to the CuZn SOD family corresponds to residues 44-148 in bovine CuZn SOD. spinach." and the first half of "6d. In Fig. The deduced amino acid sequence of EC-SOD is presented in Figs. Natl. Sci. 3-5). 55. the three-dimensional structure of which is known in detail (40).L. pig. leiognathi. bakers' yeast. swordfish. His-98. 2). The sequence of the central portion of the mature EC-SOD is highly homologous with the final two-thirds of the sequences of the CuZn SODs.6342 Biochemistry: Hjalmarsson et al. and His-163) and Zn (His-113. EC-SOD shares amino acids in 22 of the 23 positions in which all the CuZn Table 1. Arg-186 in EC-SOD corresponds to Arg-141 in the entrance to the active site of bovine CuZn SOD. The usage of G+C at the third position of codons is one of the highest (96%) found in vertebrate genes (29).. as can the cysteines forming the intramolecular disulfide bond. The mature protein contains 222 amino acids and the calculated molecular weight is 24.

The need for an extracellular and cell-surface-associated SOD must have occurred early in evolutionary history. Marklund. leiognathi" 80 F A L K [W L VIT V WT V L K G L.. (1986) Ann. 847-851. 7. K. 77. 1398-1403. USA 84 (1987) Biochemistry: Hjalmarsson et al.T V P QGTIHFEAK-. Natl. Acad. & Hellner.L. A. S. after the bacteriocupreins but before the occurrence of fungi and plants.. 6. birds. Marklund. spinach. 222. and Swedish National Board for Technical Development Grant 85-3412. leiognathi not presented. L. 84. & Marklund. Acad. L. Dis. S. USA 79. J. 1. Bjelle. 64. the ECSODs have so far only been looked for and found in mammals (4). 63. Homologous amino acids are enclosed in boxes in positions where six or more are shared by the nine CuZn SODs. USA 84. fruit fly (36). in press. Comparison of the deduced amino acid sequence (designated by the single-letter code) of mature human EC-SOD with those of CuZn SODs from human (30. 649-655. Invest. 3. 83. 1. leiognathi. 7634-7638. 62. the homologous sequence is highly conserved and must be important for the function of the enzymes. Holme.G T PUV N V E G V V T L T Q E D . L. leiognathi (39). 4. Acad. spinach (37). Engstrom.M. Skogman. cow.. leiognathi FIG. G. (1982) Chim. bakers' yeast (38). (1987) Proc. cow (33). J. & Marklund. and 03556. 45. . L. *. L.Proc.K A T . L. Marklund.. Natl. Natl. E.G D T V P H GV I H F E Q Q Q E G G P V E T T GJ T V Y LF E Q E G N A N A V KG TV F F EQ ES S . Sci. A. In accordance with this view is the fact that only 12 of the 53 amino acids identical in EC-SOD and human CuZn SOD are identical on the nucleotide level (Fig. (1982) Proc. S. The study was supported by Swedish Medical Research Council Grants 04761. Swedish Natural Science Council Grant 4875-103. L. refs. This analysis indicates that the EC-SODs have evolved from the CuZn SODs.K A T . Gunnar Skogman are thanked for valuable discussions. unpublished data). Almost nothing is known about this distribution. Marklund. 31).. S. Dr. P. 86. Stina Olofsson and assistance with computer analysis of Dr. (1984) J. bakers' yeast. Karlsson. Tibell.G K IVS T IV N TWS 60 50 P S A T A T . Hjalmarsson. The skillful technical assistance of Ms. horse (34). 242.0 G P T G VS GV V K 7 QASESEPT T G K P V G T I ffjL S Q N K Y GWV 100 90 G F P T E P N L T S T K L A T II K G L T S II T G L T F WE G L T I L K G L A E V C G L A R S G P E A GN E T G G G G G A S A 0 P K K K K R v 220 210 200 C G P G L W E R Q A R E H S E R K K R R R E S E C K A A Human SOD A Q CuZn Is Pig T Cow A K Horse A P Sword fish E A K Fruit fly T P V Spinach Bakers yeast T N P.K A L . K. The EC-SODs might be widely distributed among higher phyla. S. Rheum. Marklund. swordfish (35).. 07149. Lena Tibell and Dr.. emerges if the same 98 amino acid positions are compared among the CuZn SODs with the human enzyme as the basis: pig. 74. Robert Harr is gratefully acknowledged. L. L. swordfish. and P. 55-59. pig (32). 2. (1984) Biochem. Sci. 30 and 31). L. Edlund. 30. & Elmqvist. S.K V L .K V V-K A T K K V 0 D D AAA V C V L V C V L V C V L V C V L V C V L A V CV A V A V L AVA V L L T V K M L A A A A A R V G D GO G D G D G A GD K G T K GD T D L S S R A I HV H G LIHG F H V H G G DIH G F H V H G G DH G F H V H G G IDH G F H V H G G EIH G F H V H I G LIH G F H V H G G K H G F HLH V N A E ]G F HIIH Y PEAIMI HGFHIH VTFTPELAD-LJT S E E E K P K P L SRK H G GIPI K DJ E R H V G D E S KK H G GPI K IDL E R H V G D E R H V G D L S K K H G GIP K D H H G G P K D E E G[P K D E D H G A P V D E N H G A P E I ElV H G AIP TID EIV H G F P w T D D IHA N K T 110 G C [ENP E F G D N T A G C T S A G P H F N P Q O Q E G E E E Q F G D N T Q G C T S A G P H F N P G D N TQ G C T S A G P H F N P G D N T Q G C T T|A G IH F N P G D N T N G C I S A G P H F N P F F F F F m G P H F N P G D N T N G C M S Grp H F N P G D T T N G C M S FG DA NGCVSAGPHFNPHDL R H V G D R H V G D G D R H R H A G D gH V G D W R Y R A G L A A S S Vr S V Al D V sT E LGN K DG V A T V YII EDI S V III A LGN V TAI K N G V A I V D LI V D P L I S L G N V T IA D V D M K D S V IIS E N L G N V T A TD-K I S A NIG V AK I L G N V T[A G D C P T K V N IT D S K I T E A L G N V T D N Q I P I E A V AIN T D G V A L G N G N K T D E NIG V AlK G S F KD S L I K NT N P V L A P -R FVSA L TAI LISIGIDPHH C I I G R ILl S Gl D H IS I I G R Y S I LISIGHE LISIGIK HSI P IS G I LITI L|FIGIA DSI I G R I G R V R D D G D D D T K D|G GE3A 1 70 160 150 L A G E ID VV L G R [GGN 180 VAENGAG T G N A G TIL V V H K AID LGKIGGIN E Tl M IV V H El K P ID D L Gl R IG Gl N IE E Sl T IK T G N A G T|M|V V H E K P D DL GRIG GIN E E SIT K T G NN AA GG T M V V H E K QID D L GRKIG GIN E E S T K T G E IV mHE ADDLGI GGN EES L |K T G N A I GRR TM TIYIV V H QD AID D L GKQIG GIHEESTK SIT G N AA I G N G K GSHESPU H3 GEIQID nD LL GGKGD N|SV VIG R S LV V V HIA |L|T|G|P T EESLK T G NA LIG P TS V V G - 190 ACCV A A A A A H EL KHAI M IAGGN GV C G V I G I C G V IG I C G V I C G V I C G V I GIC G V I A C G VWS A C G V I A C G V I G G G G G G 0 I I T I L L G G G S RL RL RL S RL R S S RL S RL A RI G R G P RP GG G A V LT L K E 140 130 120 L A VP L S K K A SIKK Y G K E D K K T F KKT 70 G V V L F R Q L A P R A K L D A F G I I N F E Q K E S N G P V P V P V Q G T I Y F E L K G E K . T. 2. 5. Acta 126. S. Sci. 6343 30 20 10 1 W T E G n S A E P N S D S A E W I R D M Y A K V T E I W Q E V M Q R R D D D G 40 T L H A A C Q V Human CuZn so0 " Pig Cow " Horse " Sword fish " Fruit fly " Spinach " Bakers yeast P. horse. (1987) Biochem.. and fish (S. 41-51. fruit fly. G. Sequence (SEKDGKVVLGGA) in P. Clin. In spite of the proposed long evolutionary separation between the EC-SODs and the eukaryotic CuZn SODs.

36. P. Hering. V. K. R. Biochem. Gouy.. J. Hoppe-Seyler 366. T. A. I. Blech. 2017-2034. Sanger. J. Engstrom. 17. H. J. (1978) FEBS Lett. 273-284. A. M.... A. & Otting. J. Tsunasawa.. T. R. Sci. P. Bannister. R. 39.. H. & Gustafsson. & Coulson. J. 1. 184. Lieman-Hurwitz. 1289-1298. A.. & Flohd. r43-r74. Messing. T. L. 824-828. 857-872. 30. Rocha.. Marklund. W. Fritsch. 16. & Roulland-Dussoix. H. Saunders. Randolph. M. 2065-2070. A.. A. Sanger. S. H.. Steiner. 99... Huynh. Chem. 9. 27. H. T. Flohe. Kempe. 133. M. M.. Biol. S. Otting. 9. H. 269-272. 181-217. & Ayala. L. K.. Tainer. 13. Acad. & Messing. 6758-6765. F. E.. McClure. 230. Biol. (1984) EMBO J. ed. N. 21. M. D... & Asada. M. 256. G. F. N. J. 101-106.. (1977) Proc. & Cortese.. 22. H. V. J. J. P. Tanaka. Gunzler. Norrander. (1985) Proc. J. 129. Quiroga. 801-805.. F. J.. R. H.. & Ammer. (1984) EMBO J. (1982) J.. Kim. M. 20. D. & Seeburg. L. & Mullenbach. Bannister. L. & Richardson. Y. Y. R. V. Steinman. 87.. 31-40.. R. L. (1986) Nucleic Acids Res. (1985) Nucleic Acids Res. 12. & Hill. Maniatis. (1984) in DNA Cloning Techniques: A Practical Approach. Bannister. Katsube. & Bannister. Sci. Chem. 5465-5469. E. & Brownlee. Boyer. 145. Chem. (1982) Gene 19. M. Z. Fallman. R. & Roth. Biol. Naik. D. Von Heijne. Michelson. 269-276. (IRL. J. Wahlstrom. 35. Friedman. Engstrom. 169-172. Y.. Schreier. B.. Oxford). Sakiyama. Nicklen. J. S.. Acad. R. G. M. (1983) HoppeSeylers Z. W. 237-239. Matthes. Getzoff. Messing.. P. 23. 11545-11551.. 477-484. 7326-7338.. 14. Gautier. USA 84 (1987) 26. Proudfoot.-I. (1974) J. & Bennich. E. D. R. Natl. 107-110. D. Chem. (1985) Biol. 5463-5467. T. (1976) Nature (London) 263. J. 18. Beem. (1967) Eur. Abernethy.. & Coulson. 249. Jacobzone. Proc. 459-472.. Natl. P.-M. 364. Edman. (1985) FEBS Lett. 6345-6355. J. A.. T. (1969) J. 435-455. D.6344 Biochemistry: Hjalmarsson et al. 31. S. J. L. Biochem. J. (1985) Biochem. Scandella.. A. & Mercier. Glover. S. USA 80. Steffens. A. C. 38.. Dale.-J. Botstein. Young. S. Carlsson. 19. A. & Groner. Puma. 9. 220. J. (1983) Gene 26. K. Biol. Wintzerith. Richardson.. R. B. F. Davis. F. 211-214. Biol. 3. R. (1985) Plasmid 13. L. J. W. C.. Sci. (1981) J. 255. G. 28. & Sambrook. R. 8. Biol. Grantham. Acad. 34... M. & Begg. W. 15.. Borders. Y. & Vieira. Biochem. W.. 13. H. F. 14. 675-690. Masiarz. (1980) Advanced Bacterial Genetics (Cold Spring Harbor Laboratory. (1983) Eur. Chem. P. D.. 80-91. P. J. Sherman.. W. Cold Spring Harbor.. Tao. 10. (1980) J. K. (1986) Nucleic Acids Res. & Houchins. Sanchez-Pescador. NY). A. C. 3. 32. J. (1979) J. (1984) Eur. M. Acad. M.. . Mol. Kozak. A. D. W. G. R. Dafni. Steinman. S. Mol. R. J. 24. P. G. (1986) J. &c Chambon. USA 74. Haggstrom. Kitagawa. Aota. Lee. Mol. 41. K. R. 17-21. J. Lerch. Puget. Crea. pp. 160. Natl. 25. F. M. (1981) Nucleic Acids Res.. (1981) Nucleic Acids Res. 14. W. 40. Grundstrom. K. K. 29. Kim. V.. F. R.. 12. 49-78. J. S. 309-321. Cold Spring Harbor. (1984) Biochem.. G. Hallewell. Smith. Steffens. C. (1982) Molecular Cloning: A Laboratory Manual (Cold Spring Harbor Laboratory. 41. Najarian. M. 33. J. L. H. N. Harr. J. A.. Zenke... D. Sci. J. L. A. Oiochem. 771-776. C. J.. S. Staub. & Davis. NY). (1983) Proc. USA 82. 37. Marklund. Physiol. R. & Ikemura. A. Natl. (1984) Nucleic Acids Res. P. 11. G. R. R. & Fridovich.-M.

Sign up to vote on this title
UsefulNot useful