Se realizara PCR convencional utilizando los siguientes primers para la
detección sensible de tuberculosis
38 Kda

65 Kda

Par de Primers 5’ 3’

Tamaño fragmento
123 pb
541 pb
419 pb
322 pb
383 pb

además detecta la resistencia a etambutol e izoniaziza relacionadas con 2 mutaciones en los genes emb y kat PCR Tiempo Real Primers Blanco rpoB embB katG TB control rpo520/524 rpo510/514 rpo514/520 rpo529/533 rpo524/529 emb306 Sondas TaqMan kat315 Secuencia 5' -> 3' Forward: ACACCGCAGACGTTGATCA Reverse: CTAGTGATGGCGGTCAGGTAC Forward: CGTGGTGATATTCGGCTTCCT Reverse: GCCGAACCAGCGGAAATAG Forward: TGGGCTGGAAGAGCTCGTAT Reverse: GGAAACTGTTGTCCCATTTCG FAM-TCTTCGGCACCAGC-MGB VIC-TCAACCCCGACAGC-MGB FAM-CCATGAATTGGCTCAGC-MGB VIC-TTCATGGACCAGAACAA-MGB FAM-CAGCGCCGACAGT-MGB VIC-TGACCCACAAGCGC-MGB FAM-CTCGGGCCATGCC-MGB VIC-CACCAGCGGCATC-MGB Antibiótico asociado -------------------------------- Rifampicina Etambutol Isoniazida METODO 2 Utilizando el kit GenoType® MTBDRplussl V2.MPB64 Forward: CCA TCG ATC CGA GAC CCT GCT CAA GGG Reverse: TGC TCT AGA CTC CTC GAC GGT GAT GAC Forward: TCC GCT GCC AGT CGT CTT CC Reverse: GTC CTC GCG AGT CTA GGC CA 155 pb 240 pb DETECCION DE MDR-TB METODO 1 Ensayo in-house de PCR en tiempo real obtenido y modificado de Wada et al. 2004 Detecta la presencia de 5 mutaciones asociadas a la resistencia rifampicina a través de 5 sondas dirigidas a distintos sitios del gen rpo. (PCR convencional seguido de Hibridación con sondas de DNA en tira)  Detecta la presencia de 11 mutaciones a través de las siguientes sondas de estas 5 dirigidas a rifampicina y 6 a isoniazida           SONDA (Mutacion) Rpo MUT1 (D516V) rpoB MUT2A (H526Y) rpoB MUT2B (H526D) rpoB MUT3 (S531L) rpoB MUT2A KatG MUT1 (S315T1) KatG MUT1 (S315T2) inhA MUT1 (C15T) inhA MUT2 (A15G) inhA MUT3A (T8C) Antibiótico asociado rifampicina isoniazida .

guantes.6 Extracción DNA con kit 4. inhA MUT3B (T8A) COTIZACIONES METODO 1 “In-house” PCR tiempo real Detección de TB Detección de MDR-TB Otros Extracción DNA con kit Set de primers PCR master Mix Electroforesis Set de Primers Set de Sondas Fluorogenicas Inactivacion de muestra con NALC Extraccion de DNA TaqMan Master Mix Otros insumos (tubos.8 15 10 20 9 9 119 119 15 15 228. guantes.8 15 10 2.4 9 4.4 26.) OJO: La implementación adecuada de este protocolo requería para su implementación más adecuada de equipo para incubar las tiras de hibridación Twincubator que costaría aproximadamente más de 18.4 26. tips etc.4 9 56 30 15 20 30 15 168.6 132. tips etc.8 15 10 56 extracción con Ultrasonido 4.875 Bolivianos .) TOTAL= Extracción DNA con Ultrasonido 4.8 15 10 2.8 METODO 2 Genotype MTBDR plus (Hain) Detección de TB Detección de MDR-TB Otros TOTAL= Set de primers PCR master Mix electroforesis Extracción con kit de extracción Inactivacion de muestra con NALC Determinación por kit (según estudio costos OMS en África) Otros insumos (tubos. calibración equipos.8 192. calibración equipos.

Mas compra de Twincubator 168. GenoType® MTBDRplussl V2. 247.675 bs. 211.800 bs. Utilizando extracción con sonicador Método Utilizando extracción con KIT Cuadro comparativo de costos para análisis de 1000 muestras según distintos ensayos 132.600 bs.675 bs.800 bs. 192. .in-house de PCR en tiempo real GenoType® MTBDRplussl V2.600 bs. 228.