Vous êtes sur la page 1sur 28

BIOLOGIE

MOLCULAIRE
EXERCICES ET MTHODES
Licence PACES CAPES

Sous la direction de Marc Thiry


Professeur luniversit de Lige (Belgique)
Nicolas Bourmeyster
MCU-PH en biologie cellulaire luniversit de Poitiers
Jacques Dommes
Professeur luniversit de Lige (Belgique)
Marielle Lebrun
Assistante luniversit de Lige (Belgique)
Pierre Rigo
Assistant pdagogique et acteur de la communication
scientifique luniversit de Lige (Belgique)
Marie-France Versali
Assistante luniversit de Lige (Belgique)

Illustration de couverture:
Fibroblastes humains de prpuce infects par une souche recombinante
du virus de la varicelle et du zona (VZV) exprimant la petite protine
de capside fusionne une protine fluorescente verte. Les cellules
ont t fixes et les microtubules (en rouge) ainsi que les lysosomes (en bleu)
ont t mis en vidence par immunofluorescence.
Clich: Dr. Marielle Lebrun.

Dunod, 2014

Dunod,
Dunod, 2016
2014
rue Laromiguire,
ParisCedex
11, rue5Paul
Bert, 92247 75005
Malakoff
5 rue www.dunod.com
Laromiguire,
75005 Paris
www.dunod.com
ISBNwww.dunod.com
978-2-10-074326-1
ISBN 978-2-10-070528-9
ISBN 978-2-10-070528-9

Table des matires


Avant-propos 5
Comment utiliser cet ouvrage? 6
Remerciements 8

Le matriel gntique

QCM 22
Vrai ou faux? 25
Exercices 28
Schma de synthse......................................................................................... 32

Rplication de lADN

33

QCM 56
Vrai ou faux? 62
Exercices 65
Schma de synthse......................................................................................... 69

La transcription

70

QCM 80
Vrai ou faux? 83
Exercices 85
Schma de synthse......................................................................................... 87

Maturation de lARN

88

Dunod. Toute reproduction non autorise est un dlit.

QCM 101
Vrai ou faux? 106
Exercices 110
Schma de synthse....................................................................................... 112

Traduction et synthse des protines

113

QCM 126
Vrai ou faux? 129
Exercices 132
Schma de synthse....................................................................................... 137

Modifications post-traductionnelles des protines

138

QCM 152
Vrai ou faux? 157
Exercice 160
Schma de synthse....................................................................................... 162

Le transport intracellulaire des protines

163

QCM 181
Vrai ou faux? 185
Exercices 188
Schma de synthse....................................................................................... 190

Rgulation de la transcription

191

QCM 213
Vrai ou faux? 219
Schma de synthse....................................................................................... 224

pissage alternatif et stabilit des ARNm

225

QCM 248
Vrai ou faux? 251
Exercices 254
Schma de synthse....................................................................................... 256

10

Rgulation de la traduction

257

QCM 276
Vrai ou faux? 280
Schma de synthse....................................................................................... 284

11

Dgradation des protines intracellulaires

285

QCM 296
Vrai ou faux? 301
Exercices 304
Schma de synthse....................................................................................... 307

12

Techniques de base de biologie molculaire

308

QCM 331
Vrai ou faux? 335
Exercices 337
Schma de synthse....................................................................................... 349

Annexe

350

Index 351

Dunod. Toute reproduction non autorise est un dlit.

Avant-propos

Ce livre a t conu comme un outil pdagogique


destin aider les tudiants en tudes suprieures
apprhender les concepts fondamentaux de la
biologie molculaire. Par divers types dexercices, ltudiant est incit se poser des questions
sur la matire et complter ainsi petit petit ses
connaissances.
Louvrage prsente en douze chapitres les bases
de la biologie molculaire, aussi bien chez les
eubactries et les arches que chez les eucaryotes.
Aprs une prsentation du matriel gntique sont
exposes sa capacit se rpliquer et ses autres
variations au cours de la vie cellulaire. Les diffrentes tapes du passage de lADN la protine
sont ensuite abordes successivement, de la transcription en passant par la maturation, la traduction
et les modifications post-traductionnelles des protines. La rgulation de ces diffrentes tapes fait
lobjet de la seconde partie du livre. Louvrage se
termine enfin par un chapitre consacr aux principales techniques de biologie molculaire.
Cette division est ncessairement arbitraire,
cest pourquoi dans chaque chapitre prsentant
une notion prcise, de multiples renvois permettent au lecteur de se rfrer rapidement aux
donnes associes la question traite.
Chaque chapitre dbute par un rappel thorique
synthtique, sous forme de fiches, accompagn de
schmas didactiques destins faciliter la comprhension des donnes et leur mmorisation. Ce

rappel thorique est suivi par de nombreux exercices de diffrents types (QCM, questions Vrai/
Faux et exercices de synthse) et de difficult
croissante. Ils permettent ltudiant de svaluer
et de rviser ses connaissances ainsi que dappliquer les concepts fondamentaux de la biologie
molculaire. Tous les exercices sont corrigs et
comments. Les questions Vrai/Faux jouissent
galement dune rponse plus dtaille et les exercices de synthse bnficient de conseils mthodologiques pour aider ltudiant construire une
rponse. Un ou deux schmas de synthse la fin
de chaque chapitre relient les diffrentes notions
abordes pour aider une rflexion globale.
Ce livre est galement complt par des
bonus web avec des exercices dentranement
supplmentaires.
Cet ouvrage de biologie molculaire est destin
aux tudiants de licence de Sciences de la vie et
de la PACES et aux candidats au CAPES de SVT
(en France) ainsi quaux tudiants du Bachelier
des Facults de Sciences, de Mdecine et de
Mdecine vtrinaire (en Belgique). Il pourra
aussi tre consult par tous ceux qui ressentent
le besoin de mettre jour leurs connaissances
dans un domaine en perptuelle volution, et qui
est devenu indispensable la comprhension des
grandes fonctions biologiques et celle de leurs
dsordres.

Comment utiliser
Le matriel gntique

1
12 chapitres
et leurs mots-cls

MOTS-CLS
nuclotides nuclosides bases azotes ribose dsoxyribose pyrimidine
purine acide ribonuclique (ARN) acide dsoxyribonuclique (ADN) gnome
chromatine nuclosome fibre chromatinienne nuclode plasmide

Retrouvez des complments


de cours et des exercices
supplmentaires sur la page
associe louvrage
sur dunod.com

Aspect de la chromatine sous la forme dun collier de perles aprs talement molculaire
de cellules eucaryotes et observation sous le microscope lectronique transmission.
Clich: Prof. Marc Thiry.

Lobservation au microscope lectronique de la chromatine a permis de mettre en vidence une structure en collier de perles (Photo de couverture). Chaque perle,
dnomme nuclosome, a une forme de disque denviron 11nm de diamtre pour environ
6nm dpaisseur. Il est constitu de huit histones (deux exemplaires dhistones H2A,
deux dH2B, deux dH3 et deux dH4) entoures dun segment dADN de 146paires de
bases (environ un tour trois quarts).
Les histones sont des protines comprenant beaucoup dacides amins basiques (comme
la lysine et larginine) qui prsentent des charges positives. Ces charges vont pouvoir
tablir des liaisons ioniques avec les charges ngatives portes par les groupements
phosphate de lADN. De cette manire, ADN et histones peuvent tre lis.
LADN compris entre deux nuclosomes contient environ 60paires de bases et est
associ une histone de liaison H1. Cette portion dADN est parfois appele ADN
internuclosomique. Lensemble forme donc une structure en collier de perles,
aussi appel nuclofilament ou fibre chromatinienne de 11nm (figure1.14).

11

Solnode

30 nm

Structure en boucles
du chromosome

300 nm

H1

Les fibres compactes de 30nm vont ensuite former des boucles denviron 300nm de
long, qui sancrent dans une matrice protique (sorte de squelette interne du chromosome, constitu de protines acides). Enfin, cette structure en boucles successives va
former une hlice denviron 700nm de diamtre, dont chaque tour est constitu denviron 60 boucles. Ce niveau reprsente le taux de compaction maximal de lADN dans un
chromosome (figure1.15).

Dunod. Toute reproduction non autorise est un dlit.

Niveaux suprieurs dorganisation de la chromatine

Chromosome
en mtaphase

1400 nm

Taux de condensation de la chromatine

ADN internuclosomique

Figure1.14 Structure du nuclofilament

Le nuclofilament peut senrouler sur lui-mme en hlice (forme de solnode), dont


chaque tour est form de sixnuclosomes. Cette hlice a un diamtre plus pais, denviron 30nm. Les histones H1 jouent ici un rle important de stabilisation de la structure,
en interagissant avec les nuclosomes voisins.

700 nm

Figure1.15 Les diffrents niveaux dorganisation de la chromatine

ADN

Solnode ou fibre chromatinienne de 30 nm

Section condense
dun chromosome

Exercices

mm

11 nm

histones nuclosomiques

6m

18

Fibre chomatinienne
collier de perles

Lors de linterphase, la chromatine apparat dans le noyau sous deux formes correspondant un taux de condensation diffrent: la chromatine condense (ou htrochromatine) en mottes irrgulires et la chromatine dcondense (ou euchromatine) prsentant
un aspect plus diffus. Ces deux types de chromatine correspondent deux tats fonctionnels de la mme substance. La chromatine condense est gntiquement rprime,
cest--dire inactive du point de vue transcriptionnel. Elle se situe principalement la
priphrie du noyau, contre lenveloppe nuclaire, ainsi quautour des nucloles, mais
peut galement se rpartir dans tout le noyau sous forme de mottes de taille variable. La
chromatine dcondense est quant elle potentiellement active, capable dtre transcrite.
Elle est essentiellement localise la priphrie des mottes de chromatine condense,
une rgion du nucloplasme dnomme les espaces prichromatiniens. Le contrle de
la condensation de la chromatine est orchestr par une srie denzymes particulires qui
vont interagir sur les nuclosomes et les histones qui les composent (chapitres 6 et8).

1. Le matriel gntique

Nuclosome

2 nm

QCM

Nuclofilament ou fibre chromatinienne de 11 nm

ADN en double hlice

Vrai ou faux ?

possdent donc deux extrmits, appeles tlomres (chapitre2). Les chromosomes sont
constitus de chromatine, nom donn lassociation dADN et de protines (histones
et protines non-histoniques).

Fiches

Des rappels de cours


sous forme de fiches

19

De nombreux
schmas

cet ouvrage ?

Des questions
Vrai/Faux
Fiches

Entranement
Vrai ou faux ?

H
CH2
HO

Fiche 1 : Les nuclotides

2.

La cyclisation du pentose des nuclotides se fait par raction de la


fonction OH du C4 sur le C1 impliqu dans la fonction aldhyde.

3.

Les bases azotes pyrimidines sont constitues dun htrocycle et


les bases purines de deux cycles accols.

4.
5.

Ladnosine est une base azote purine.

Les bases purines sont au nombre de deux dans les acides nucliques,
contenant chacune cinq atomes dazote.

6.

Toutes les bases azotes des acides nucliques contiennent au moins


un atome doxygne.

7.

La dnaturation de lADN par la chaleur est dautant plus difficile quil


est riche en appariements C-G.

8.

Dans lADN, les bases azotes sont lies aux riboses par des liaisons
N-glycosidique.

9.

Les bases purines et pyrimidines sont lies au C1 du pentose par leur


atome dazote numrot 1.

10.
11.

Les acides nucliques sont riches en charges ngatives.

Dans lADN, adnine et thymine interagissent entre elles par deux


a. Le ribose est un pentose.
liaisons hydrogne, une entre lamine en C6 de l'adnine et loxygne
b. Le ribose
est prsent
dans les
ribonuclotides.
en C4 de lathymine,
et lautre
entre lazote
1 de
ladnine et lhydrogne de lazote
3 de
la thymine.
c. Le
ribose
fait partie du groupe des aldoses.

12.

Lextrmit3
des
nucliques
est constitue
dun groupement
d.
Le acides
ribose possde
quatre
fonctions hydroxyle.
o
o
OH libre, prt
avec
un nouveau
nuclotide. mais le C3 du dsoxyribose est rduit.
e.Leragir
ribose
ressemble
au dsoxyribose,
Cest au niveau du grand sillon de la double hlice que les histones
o
o
interagissent
avec les
lADN.
2. Parmi
affirmations suivantes sur le pentose des nuclotides, laquelle est

14.
15.
16.
17.
18.

QCM

1.

Vrai ou faux ?
Exercices

Entranement

QCM

Parmi les affirmations suivantes sur le ribose, laquelle est fausse ?

fausse
?
La compaction
de lADN
laide des nuclosomes est stabilise par

les histonesH1,
qui
interagissent
avec les nuclosomes
voisins.
a. Le
pentose
des nuclotides
est sous forme
cyclique.
Chez certains
les nuclotides
plasmides sont
desaldopentose,
molcules dADN
o une fonction
o
b.procaryotes,
Le pentose des
est un
car il porte
aldhyde.
nuclaire surnumraire pouvant contenir des gnes de rsistance.
c. Le cycle du pentose est compos de cinq atomes de carbone.
Chez les eucaryotes, les gnomes non-nuclaires codent pour des
o
o
d. Le pentose sous sa forme cyclique est appel -furanose.
protines indispensables la survie de la cellule.
e. La forme cyclique est , car la fonction OH du C1 est situe du mme ct du
Une cellule humaine contient une seule molcule dADN.
o
o
cycle que le C5.
Contrairement lADN des eucaryotes, lADN des procaryotes nest
o
o
pas associ
des protines.
3. Parmi
les affirmations suivantes sur les bases azotes, laquelle est exacte ?

1. Le matriel gntique

Dunod. Toute reproduction non autorise est un dlit.

Chez les procaryotes

Fiche 4 : Organisation du gnome

Variable (taille, nombre, forme, localisation,


squence)
Les gnes
Squence transcrite + Squences rgulatrices
Les squences intergniques
Squences rptitives non-codantes disperses ou mobiles

Faux

Linformation gntique est stocke dans un polymre de dsoxyribonuclosides.

13.

Nuclode :
Un chromosome unique circulaire
Associ des protines
Plasmides
Molcules dADN surnumraires
Pas ncessaires la survie, mais
peuvent tre avantageux (rsistance)

Fiche 3 : Structure et organisation des chromosomes eucaryotes

N
N

N
Pyrimidine

Purine

N
OH

OH
O

Ribose

Pentose
H
Ribose (ARN)
HO
NH2
Dsoxyribose (ADN)
Adnine
Aldopentose
N
Forme cyclique: -furanose N
Bases azotes:
N
N
Purines
H
. Adnine (A)
O
Guanine
. Guanine (G)
NH
Pyrimidines:
N
NH2
. Cytosine (C)
N
. Thymie (T)
N
H
. Uracile (U)
Li au C1 du pentose par liaison N-Glycosidique
Groupement(s) Phosphate:
Dun trois groupements
Li au C5 du pentose par liaison ester

Des QCM pour


sauto-valuer

Vrai

1.

a. Luracile possde un groupement CH3 supplmentaire par rapport la thymine.


b. Ladnine contient une fonction amine sur le C6 et une fonction ctone sur le C2.
c. Toutes les pyrimidines ont une fonction ctone sur leur C4.

25
d. Les bases purines se lient au pentose au niveau de leur atome dazote numrot
9.
e. Adnine et guanine ne diffrent entre elles que par la prsence dune fonction
ctone supplmentaire dans la guanine.

Nuclofilament (fibre chromatinienne de 11 nm)


Nuclosome : octamre dhistones (2 copies de chacun
des histones H2A, H2B, H3 et H4) + 146 pb ADN
ADN de liaison + Histone H1
Solnode (fibre chromatinienne de 30 nm)
Niveaux suprieurs : boucles de 300 nm de long, hlice
de 700 nm de diamtre

Uracile

N
H

NH

Cytosine

OH

H 3C

O
H

HO
H

CH2
HO

Dsoxyribose

Pentose

O
O

N
H

NH

NH2

N
H

Thymine

Fiche 2 : Les acides nucliques

Polynuclotides :
Polymres de nuclotides
Liaisons phosphodiester entre les nuclotides
Extrmit 3 OH
Extrmit 5 Phosphate
Appariements entre bases azotes :
C-G : 3 liaisons hydrogne
A-T : 2 liaisons hydrogne (ADN)
A-U : 2 liaisons hydrogne (ARN)
ADN :
Polymre de dsoxyribonuclotides
Bicatnaire : chanes antiparallles, complmentaires et hlicodales
ARN :
Polymre de ribonuclotides
Monocatnaire
. ARNm
. ARNr
. ARNt

N
N
N

Purine

Pyrimidine
N

Base

O
CH2
O
P

Phosphate

Schma de synthse: Le matriel gntique

Des schmas de synthse


en fin de chapitre

4.

Parmi les affirmations suivantes sur la nomenclature des nuclotides, laquelle


est exacte ?
a. La cytidine diphosphate est un nucloside form de lassociation dune base azote,
la cytosine, dun sucre, le ribose, et de deux groupements phosphate.
b. La dsoxyadnine diphosphate est un nuclotide form dune base azote purine
lie un pentose, lui-mme associ deux groupements phosphate.
c. La dsoxyuridine monophosphate est un nuclotide prsent dans lARN.
d. La dsoxyguanosine diphosphate est un nuclotide form dune base azote
purine, la guanine, lie un pentose, le dsoxyribose, lui-mme associ deux
groupements phosphate.
e. La thymidine diphosphate est un nuclotide form de lassociation dune base
azote purine, dun sucre et de deux groupements phosphate.

22
32

Toutes les rponses


commentes

Des exercices pour sentraner avec


des conseils mthodologiques
Entranement

Le gnome dun eucaryote est constitu de 6,6 109 nuclotides. Il y a une origine de
rplication toutes les 6000pb et la taille des fragments dOkazaki est de 300nuclotides.
a) Sachant quune ADN ligase est capable deffectuer 20 ligatures par minute et que
la dure de la phase S est de 8h20, combien faut-il dADN ligase en moyenne dans le
noyau?

Une biopsie a t ralise chez trois patients prsentant une masse de cellules
potentiellement cancreuses au niveau du colon. Avec une coloration adquate de lADN,
le nombre de cellules en mitose et le nombre de cellules totales ont t comptabilises
au moyen dun microscope, sur trois champs de cellules diffrents. Un morceau de
colon dans une partie adjacente la masse cellulaire suspecte a t prlev et trait de
la mme manire afin de servir de contrle. Voici les rsultats bruts:

Dunod. Toute reproduction non autorise est un dlit.

Tissu
contrle

Patient 1

Patient 2

Patient 3

Nombre de cellules total

Nombre de cellules en mitose

200

200

125

200

15

200

16

200

14

200

12

400

26

400

25

260

13

275

11

200

12

3.

2. Rplication de lADN

4.

65

c. La primase est une ARN polymrase qui


gnre de courts segments dARN de polarit 5-3, ncessaires car les ADN polymrases ont besoin dun substrat amorcematrice pour exercer leur activit. Elle est
essentielle pour initier la synthse la fois
du brin prcoce et du brin retard. Chez les
eucaryotes, elle est associe lADN pol
dans un complexe ttramrique (contenant
deux primases et deux ADN pol ). Chez
les eucaryotes, lamorce ARN est dabord
allonge sur une courte distance par lADN
pol du complexe primase/ADN pol puis
cette ADN polymrase de faible processivit
et de faible fidlit est remplace par les
ADN pol et pol par un mcanisme appel
changement de polymrase.

c. Chez les eucaryotes, lamorce dARN synthtise par la primase est dabord allonge par lADN pol . Cette ADN polymrase
introduit des erreurs car elle ne possde pas
dactivit exonuclasique 3-5 et a une faible
processivit. Elle est rapidement remplace
par les ADN pol et pol qui possdent une
grande fidlit et une grande processivit.
Elle na pas dquivalent chez les procaryotes
o lamorce ARN est directement utilise par
lADN polIII. En plus de ses fonctions au sein
du rplisome, elle intervient dans la synthse du brin C des tlomres. LADN polI
des procaryotes comble les brches laisses
par le passage de la RNase H qui dgrade les
amorces dARN.

6.

a et d. Grce la prsence de rptitions


et dun brin 3 plus long que le brin 5, le
tlomre adopte une configuration particulire en forme de boucle. Ce systme
permet dviter que les extrmits des
chromosomes soient reconnues comme
des cassures double brin et nactivent la
cascade de signalisation de ATM ou de
DNA-PK. Cela conduirait principalement
lactivation du NHEJ, au rattachement bout

Fiches

5.

QCM

d. Linitiation de la rplication chez les


eubactries se fait au niveau dune squence
appele oriC.oriC contient des rgions rptes et des squences GATC dans lesquelles
ladnine est mthyle par les mthylases
dam. Plusieurs monomres de DnaA se
fixent sur les rgions rptes lorsque les
sites GATC sont mthyls sur les deux
brins. Ce nest pas la mthylation des
brins qui stimule linitiation mais labsence
de mthylation dun des deux brins qui
empche linitiation par un phnomne qui
nest pas encore entirement lucid. Cest
lADN hlicase DnaB qui est recrute par
DnaA pour sparer les deux brins dADN.
Enfin, les conditions du milieu extrieur
vont influencer lintervalle de temps entre
deux initiations successives, conduisant,
dans des conditions trs favorables, lapparition de chromosomes multi-fourchs.

Exercices

b) Le taux derreur moyen introduit par les ADN pol et est de 106 et de lADN pol de
104, la taille de la partie ADN des amorces est de 10 nuclotides. Sachant que la dure de
la phase G2 est de 4h10 et quil faut que toutes les erreurs dappariement soient rpares
avant la mitose, combien de cassures le MMR doit-il tre capable de rparer par minute?

Dunod. Toute reproduction non autorise est un dlit.

3.

2.

d. Chez les eucaryotes, les complexes de


reconnaissance des origines de rplication
(ORC) sont en permanence lis sur lADN.
En G1, ORC recrute les poseurs dADN hlicase, Cdc6 et Cdt1 qui sont ncessaires
pour recruter lADN hlicase MCM. la transition G1/S, ces complexes pr-rplicatifs
sont activs par une Ddk et une Cdk via
une phophorylation de certaines sous-units du complexe. Chez les eucaryotes pluricellulaires, bien que linitiation se droule
sur des squences prcises et localises des
chromosomes, il ny a pas dquivalent des
squences ARS dcrites chez la levure. Les
origines de rplication sont actives de faon
squentielle, les premires tant celles qui
sont situes dans des rgions transcrites et
donc o la chromatine est la plus accessible.
Chez les eucaryotes pluricellulaires, cest le
niveau dexpression de Cdc6 et de Cdt1aux
diffrentes phases du cycle cellulaire qui
dtermine le moment de linitiation.

Vrai ou faux ?

La masse molculaire du gnome dune eubactrie est de 2,856 109 Da. Sachant que
la vitesse dincorporation des nuclotides de lADN pol III est de 1 750 nuclotides
par seconde, et quil faut cinq minutes aprs larrt de rplication pour la maturation
des fragments dOkazaki, quel est le temps minimal pour la rplication? (NB: masse
molculaire moyenne dun nuclotide: 340Da)

4.

Exercices

2.

QCM

Un brin dADN contenant 15% dadnine, 25% de cytosine, 20% de thymine et 40% de
guanine est rpliqu par une ADN polymrase, quelle sera la composition en base du
brin complmentaire issu de la rplication et quelle sera la composition en base de la
molcule dADNdb?

b. La processivit dune ADN polymrase


dsigne la longueur de la chane polynuclotidique quelle est capable de synthtiser avant de se dcrocher et dpend donc
de sa liaison plus ou moins forte sur le brin
matrice. Lanneau coulissant permet daugmenter considrablement la processivit.
LADN pol a une faible processivit, elle
est rapidement remplace par les ADN pol
et par le phnomne appel changement
de polymrase

Vrai ou faux ?

1.

1.

2. Rplication de lADN

Fiches

Rponses

Exercices

59

Remerciements
Je remercie trs vivement tous ceux qui depuis
plusieurs annes contribuent au bon fonctionnement de mes cours dispenss aux tudiants du
bachelier en Sciences. Il sagit en particulier du
collectif enseignant de la Facult des Sciences et
des assistants qui encadrent les sances daide
ltude et les travaux pratiques : Pierre Balthasart,
Sbastien Brouwers, Philippe Compre,
Nadine Coosemans, Vronique Goosse, Alain
Hambuckers, Marine Joris, Sandrine Malchair,
Dorothe Pete et Ludovic Sottiaux.
Je remercie bien sr tous mes collaborateurs
grce auxquels jai pu enrichir et diversifier mes
connaissances en biologie cellulaire et molculaire. Je pense en particulier aux membres de
mon unit de recherche du GIGA-Neurosciences:
Marie Cloes, Nicolas Johnen, Patricia Piscicelli,
Justine Renauld et Nicolas Thelen.

Un tout aussi grand merci au Prof. Ulrich Scheer


pour la microphotographie du chapitre 3 et au
Dr. Isabelle Otte pour les figures dun exercice
dans le chapitre 12.
Je termine en exprimant toute ma gratitude
Jacques, Marie-France, Nicolas, Marielle et Pierre
avec lesquels jai partag cette belle exprience.
La mise en commun de nos connaissances, chacun
dans sa spcialit, ainsi que lexprience pdagogique et lesprit critique de chacun ont t des
apports considrables dans la construction pas
pas de notre livre.
Je les remercie chaleureusement.
Marc Thiry

Le matriel gntique
Mots-cls
nuclotides nuclosides bases azotes ribose dsoxyribose pyrimidine
purine acide ribonuclique (ARN) acide dsoxyribonuclique (ADN) gnome
chromatine nuclosome fibre chromatinienne nuclode plasmide

Aspect de la chromatine sous la forme dun collier de perles aprs talement molculaire
de cellules eucaryotes et observation sous le microscope lectronique transmission.
Clich: Prof. Marc Thiry.

Fiche1

Constitution chimique: les nuclotides


Un des aspects les plus importants de la biologie molculaire est ltude du matriel
gntique. Linformation gntique de tout tre vivant est stocke dans des macromolcules, polymres de nuclotides (fiche2). Les nuclotides sont chacun forms dun
pentose, dune base azote et dun ou plusieurs groupements phosphate (figure1.1). Les
nuclotides se distinguent entre eux par la nature du pentose, de la base et par le nombre
de groupements phosphate.
Phosphate
O

Figure1.1 Schma gnral


dun nuclotide

CH2

Base
N

Pentose

Pentose
Le pentose peut tre un ribose (dans le cas des ribonuclotides de lARN) ou un dsoxyribose (dans le cas des dsoxyribonuclotides de lADN). Ces deux sucres cinq atomes
carbones portent une fonction aldhyde, on parle alors daldopentose. La numrotation des atomes de carbone du pentose porte en plus une apostrophe (), afin de
pouvoir les distinguer des atomes des bases azotes (figure1.4). Dans les nuclotides,
ces pentoses sont sous forme cyclique, par raction de la fonction hydroxyle (OH) du
carbone4 sur le carbone1 impliqu dans la fonction aldhyde (figure1.2). Le cycle
ainsi form est un htrocycle compos de cinq atomes: quatre atomes de carbone et
un atome doxygne. Les molcules possdant un tel cycle sont appeles furanose.
Latome doxygne impliqu dans le cycle est celui de la fonction OH du carbone4,
tandis que latome doxygne de la fonction aldhyde forme une fonction OH avec un
proton. Cette fonction OH tant situe du mme ct du cycle que le carbone5 du
pentose, la forme cyclique du furanose est donc .
H
1

C
5

HO
2
3
4

OH

OH

OH

CH2

OH

CH2OH

HO

OH

Ribose

-ribofuranose

Projection de Fisher

Projection de Haworth

Figure1.2 Cyclisation du ribose

Ainsi dans les nuclotides, le nom complet du ribose est -ribofuranose, et celui
du dsoxyribose est -dsoxyribofuranose. La diffrence entre les deux se situe au
niveau du carbone2portant dans le dsoxyribose un hydrogne, alors quil porte une
10

CH2

OH

HO

CH2

HO

OH

OH

O
H

HO

Ribose
-ribofuranose

Dsoxyribose
-dsoxyribofuranose

QCM

HO

Fiches

fonction OH dans le ribose (figure1.3). En fait, le dsoxyribose drive du ribose, par


rduction de cette fonction OH du carbone2.

Figure1.3 Diffrence entre ribose et dsoxyribose (projection de Haworth)

Base azote

Vrai ou faux ?

Chaque nuclotide contient galement une base azote, qui peut tre de deux types:
une pyrimidine ou une purine. Toutes deux sont des molcules azotes htrocycliques
(figure1.4). Les pyrimidines sont constitues dun seul cycle six atomes, quatre atomes
de carbone et deux atomes dazote. Les purines sont constitues de deux cycles accols:
un cycle pyrimidique et un cycle imidazole (cycle cinq atomes, trois atomes de carbone et deux atomes dazote). La numrotation des atomes dans ces bases est galement
prsente dans la figure1.4.
N3

N1

Exercices

4
5

2
8

N
3

Pyrimidine

Purine

Dans les nuclotides, il existe trois pyrimidines diffrentes: la cytosine, la thymine et


luracile (figure1.5). La cytosine contient une fonction ctone (sur le carbone2) et une
fonction amine (sur le carbone4), tandis que la thymine et luracile contiennent deux
fonctions ctone (la fonction amine de la cytosine est remplace par une fonction ctone
sur le carbone4). Enfin, la thymine contient un groupement CH3 supplmentaire (sur
le carbone5), par rapport luracile.
NH2

H 3C

N
H

1. Le matriel gntique

Dunod. Toute reproduction non autorise est un dlit.

Figure1.4 Diffrences entre pyrimidine et purine et numrotation des atomes

NH

NH

Cytosine (C)

N
H

Thymine (T)

N
H

Uracile (U)

Figure1.5 Structure des pyrimidines

11

Dans les nuclotides, il existe deux purines diffrentes: ladnine et la guanine


(figure1.6). Les diffrences entre les deux se marquent au niveau du cycle pyrimidique.
Ladnine contient uniquement une fonction amine (sur le carbone6), tandis que la
guanine contient une fonction ctone (sur le carbone6, lemplacement de la fonction
amine de ladnine) et une fonction amine supplmentaire (sur le carbone2).
NH2

O
N

NH
N

N
N

N
H

NH2

N
H

Adnine (A)

Guanine (G)

Figure1.6 Structure des purines

Ces bases azotes reprsentent lencodage du matriel gntique: cest lenchanement


particulier de ces bases qui constitue linformation gntique. Dans lADN, le codage
est ralis laide de quatre bases parmi les cinq cites ci-dessus: ladnine, la cytosine,
la guanine et la thymine. Dans lARN, le codage est aussi ralis par quatre bases, mais
cette fois la thymine est remplace par luracile.

Nuclosides
Un pentose et une base azote peuvent se lier pour former un nucloside. La liaison ainsi
forme est appele liaison N-glycosidique, car elle se forme entre le carbone1 du
pentose et un atome dazote (N) de la base (figure1.7). Avec une pyrimidine, la liaison
se fait avec latome dazote numrot 1 (figure1.8a), tandis quavec une purine, la liaison
se fait avec latome dazote numrot 9 (un du cycle imidazole, figure1.8b).
5

Figure 1.7 Schma gnral


dun nucloside et liaison
N-glycosidique

HO

CH2

Base
N
O
Liaison N-glycosidique
1

4
3

Pentose

(a)

(b)
4

HO

CH

4
3

N3

Pentose

HO

CH2

N1

9N

N
3

4
3

Pentose

Figure1.8 Nucloside avec une pyrimidine (a) et avec une purine (b)

En fonction de la nature du pentose, on parlera de ribonucloside (si le pentose est


un ribose) ou de dsoxynucloside (si le pentose est un dsoxyribose). Afin de bien
diffrencier les bases azotes et les nuclosides, il existe une nomenclature particulire
(tableau1.1). Pour les pyrimidines, le suffixe idine est ajout tandis que pour les purines
cest le suffixe osine.

12

Purines

Nucloside

Abrviation

Cytosine

Cytidine

Thymine

Thymidine

Uracile

Uridine

Adnine

Adnosine

Guanine

Guanosine

QCM

Pyrimidines

Base

Fiches

Tableau1.1 Nomenclature des nuclosides

Nuclotides

Figure 1.9 Schma gnral


dun nuclotide monophosphate
et liaison ester

O
Phosphate

Base
N

Exercices

Liaison
ester 5
CH2
O

Vrai ou faux ?

Le carbone5 du pentose peut se lier un groupement phosphate par une liaison ester.
Lensemble dun nucloside (pentose +base azote) et dun groupement phosphate est
alors appel nuclotide monophosphate (figure1.9).
Un deuxime groupement phosphate peut se lier au premier par une liaison anhydride
dacide, on parlera alors de nuclotide diphosphate. De la mme faon, un troisime
groupement phosphate peut se lier sur le deuxime pour former un nuclotide triphosphate
(figure1.10). Cest sous cette forme que les nuclosides sont utiliss dans la synthse
des acides nucliques.

4
3

Pentose
Liaisons anhydride d'acide
O

Figure 1.10 Schma gnral


dun nuclotide triphosphate
et liaisons anhydride dacide

P
O

O
O

O
O

Phosphates

P
O

Base

5
CH2

O
4

1
3

Le nom de chaque nuclotide commence par celui du nucloside correspondant (en


fonction de la base azote), suivi du nombre de groupements phosphate (mono-, di- ou
tri-phosphate). Labrviation des nuclotides suit les mmes rgles: la premire lettre
correspond labrviation du nucloside, la deuxime lettre correspond au nombre de
groupements phosphate (M pour mono-, D pour di- et T pour tri-) et la troisime lettre est un P (pour phosphate). Par exemple, le ribonuclotide portant une
adnine et trois groupements phosphate est appel adnosine triphosphate, abrvi
ATP.

1. Le matriel gntique

Dunod. Toute reproduction non autorise est un dlit.

Pentose

13

Fiche2

Les acides nucliques


Polynuclotides
Les acides nucliques sont des polymres de nuclotides. Il en existe deux types: lacide
dsoxyribonuclique (ou ADN), polymre de dsoxyribonuclotides (le pentose est
un dsoxyribose), et lacide ribonuclique (ou ARN), polymre de ribonuclotides (le
pentose est un ribose).
Les acides nucliques jouent un rle essentiel dans lorganisation et la vie de la cellule.
Ainsi, linformation gntique est stocke dans un acide nuclique particulier (lADN),
puis est transcrite en un autre type dacide nuclique (lARN messager, chapitre3) et enfin
cette information est utilise par dautres ARN (ARN de transfert et ARN ribosomiques)
pour tre traduite en protines (chapitre5). Ces diffrents types dacides nucliques
feront lobjet de cette fiche.
Ces acides nucliques sont forms par polymrisation de nuclotides triphosphate:
ribonuclotides dans le cas des ARN et dsoxyribonuclotides dans le cas de lADN.
Cette polymrisation se fait par raction entre le groupement hydroxyle (OH) port
par le carbone3 du pentose du nuclotide1 avec le premier groupement phosphate du
nuclotide2 (figure1.10). Ceci entrane la libration dune molcule de pyrophosphate
inorganique (deux groupements phosphate). Cette raction destrification aboutit la
formation dune liaison phosphodiester entre les nuclotides1 et 2 (figure1.11). En effet,
le groupement phosphate du nuclotide2 est impliqu dans deux liaisons ester: une avec
le pentose de son nuclotide et lautre avec le pentose du nuclotide1.
Au final, le carbone5 du nuclotide1 porte un groupement phosphate libre, on nommera cette extrmit 5 (aussi appele extrmit5 Phosphate). lautre extrmit, cest le groupement OH port par le carbone3 du nuclotide2 qui est libre,
et prt ragir avec un autre nuclotide. On nommera donc cette extrmit 3 (ou
extrmit3 OH). Par convention, les acides nucliques seront toujours orients et
lus dans le sens5 3.
Nuclotide 1
O
O

CH2

Base 1

1
3

P
O

O
O

Nuclotide 2

P
O

1
3

O
O

OH
O

Base 1

CH2

Base 2

CH2

O
4

1
3

OH

Liaison phosphodiester
O

P
O

Base 2

CH2

O
4

1
3

OH

Figure1.11 Polymrisation de deux nuclotides et liaison phosphodiester

14

Appariements entre bases azotes

NH2

HN

QCM

CH3

Vrai ou faux ?

Fiches

Comme nous le verrons plus loin, les acides nucliques peuvent adopter des structures tridimensionnelles, parfois complexes. Ces structures sont rendues possibles par
linteraction quil peut exister entre certaines bases azotes. Ces interactions, appeles
appariements, sont effectues laide de liaisons hydrogne entre une pyrimidine et une
purine, deux deux. Ainsi, une adnine pourra se lier une thymine (dans lADN) ou
un uracile (dans lARN) par lintermdiaire de deux liaisons hydrogne, et une guanine
pourra se lier une cytosine (aussi bien dans lADN que dans lARN) par lintermdiaire
de trois liaisons hydrogne (figure1.12). Ces appariements sont dits canoniques ou
de Watson/Crick, et ce sont ceux quon trouve dans la grande majorit des cas, tablissant les rgles de complmentarit entre les bases azotes. Parfois, il arrive cependant
que certains appariements soient non-canoniques, comme nous le verrons plus tard
(chapitres3 et 5). Lensemble de deux bases apparies est appel une paire de bases.
Adnine
N
N

Thymine
N

N
Guanine

H2N

Cytosine

NH
N

Exercices

Figure1.12
Appariements entre
bases azotes et
liaisons hydrogne

N
O

NH2
Liaisons hydrogne

Pour rappel, lADN est un polymre de dsoxyribonuclotides. Lenchanement et lordre


des diffrents dsoxyribonuclotides reprsentent la structure primaire de lADN.
Le plus souvent, lADN est bicatnaire, cest--dire quil est constitu de deux chanes
(ou brins) dacides nucliques. Ces deux chanes dADN sont antiparallles, complmentaires et hlicodales, reprsentant la structure secondaire de lADN.
Lorientation antiparallle signifie que les deux chanes sont parallles lune par rapport lautre, mais de sens oppos (en tte bche). Lune est dans le sens5 3 et
lautre dans le sens3 5.
Les chanes sont complmentaires, cest--dire qu une adnine sur une chane correspond une thymine sur lautre chane (de la mme faon, une guanine correspond une
cytosine), en respectant ainsi les rgles de complmentarit. La complmentarit des deux
chanes permet de les relier par des liaisons hydrogne et ainsi dapporter une cohsion
la structure. Ainsi, le brin5 3 a une squence de nuclotides complmentaire
celle du brin3 5.

1. Le matriel gntique

Dunod. Toute reproduction non autorise est un dlit.

ADN

15

ce niveau, on comprend donc pourquoi les rgles de complmentarit impliquent systmatiquement une pyrimidine (forme dun cycle) avec une purine (forme de deux
cycles accols). Si deux pyrimidines sappariaient, lespace sparant les deux chaines
cet endroit serait infrieur lespace quoccupent une pyrimidine et une purine. De la
mme faon, lespace occup par deux purines serait suprieur lespace occup par
une pyrimidine et une purine. Ainsi, la distance sparant les deux chanes serait variable
le long de la chane, diminuant la stabilit de la structure. En conclusion, lappariement
dune pyrimidine et dune purine permet de maintenir constante la distance sparant les
deux chanes.

Enfin, les deux chanes adoptent une structure tridimensionnelle hlicodale. Les deux brins
de lADN forment en fait une double hlice dont la structure fait apparatre deux sillons
de taille ingale: un petit et un grand (figure1.13). Des protines peuvent se lier lADN
dans les sillons, principalement laide de liaisons hydrogne et ioniques. En fonction de
ces protines, le site dinteraction pourra tre diffrent. Ainsi, les bases azotes tant plus
accessibles dans le grand sillon, cest par exemple ce niveau que les facteurs de transcription vont venir se lier une squence spcifique (chapitres 3 et 8). Dautres protines,
comme les histones (fiche 3), interagiront avec le petit sillon de la double hlice dADN.
En fonction de la squence en bases azotes et des conditions denroulement et dhydratation de lADN, la double hlice peut se trouver sous diffrentes formes. La forme la
plus commune est lADN-B: hlice oriente droite, possdant un diamtre de 2nm
et dont la longueur dun tour (10paires de bases) correspond environ 3,4nm. Dans
cette configuration, les paires de bases sont perpendiculaires laxe de la double hlice.
La forme A correspond aussi une hlice droite, mais plus large (environ 2,3nm de
diamtre) et plus serre (longueur dun tour denviron 2,8nm). Les paires de bases sont
ici en biais par rapport laxe de la double hlice. Cette forme est rgulirement trouve
en condition de dshydratation.
Enfin, la formeZ correspond une hlice gauche, plus troite (environ 1,8nm de
diamtre) et plus allonge (longueur dun tour denviron 4,5nm) que la forme B. Cette
forme sobserve surtout dans les rgions riches en appariements cytosine-guanine.
extrmit 5
P

Liaison hydrogne
T

C
extrmit 3

G
G

G
A

P
P

Petit sillon

G
C

extrmit 3

C
T

G
G
Grand sillon

T
P

G
P

A
P

T
A

A
C

G
A

T
A

P
extrmit 5

G
A

C
T

Figure1.13 Structures primaire et secondaire de lADN

16

ARN

Fiches
QCM
Vrai ou faux ?
Exercices
1. Le matriel gntique

Dunod. Toute reproduction non autorise est un dlit.

LARN est un polymre constitu de ribonuclotides. Contrairement lADN bicatnaire, la molcule dARN est gnralement monocatnaire, cest--dire constitue
dune seule chane nuclotidique. Cette chane peut toutefois tre replie sur elle-mme
sur de courtes distances, en raison de ltablissement de liaisons hydrogne entre bases
complmentaires.
Les ARN sont issus de la transcription de gnes spcifiques se trouvant dans lADN
(chapitres3 et 4). Ils constituent une copie parfaite de la squence en bases azotes des
gnes, dans laquelle les thymines sont remplaces par des uraciles. La squence des bases
le long des molcules dARN est spcifique et va notamment permettre la synthse de
protines prcises (chapitre5).
Diffrentes molcules sont constitues dARN, quon peut classer en deux grandes
catgories:
ARN codants: ce sont les ARN messagers (ARNm), qui seront traduits en protines
par les ribosomes (chapitre5).
ARN non-codants: ce sont tous les autres ARN, autrement dit les ARN qui ne seront
pas traduits en protines. Parmi leur norme diversit, on citera par exemple:
ARN ribosomiques (ARNr): ARN qui sassocient avec les protines ribosomiques
pour former les ribosomes (rle structural). Ils y ont galement un rle catalytique notamment dans la formation des liaisons peptidiques entre les acides amins
(chapitre5).
ARN de transfert (ARNt): adaptateurs molculaires jouant un rle essentiel dans la
traduction des ARNm en protines, en association avec les ribosomes (chapitre5).
Petits ARN nuclaires (ARNsn): uniquement chez les eucaryotes, les ARNsn permettent lpissage des pr-ARNm dans le noyau (chapitre4), en association avec
des protines.
Petits ARN nuclolaires (ARNsno): uniquement chez les eucaryotes, les ARNsno
prsents dans le nuclole participent la maturation des ARNr (chapitre4).
Des ARN intervenant dans la rgulation de lexpression gnique diffrents niveaux
(chapitres 8, 9 et 10), comme les ARNs (qui rgulent la traduction et la stabilit
des ARNm chez les eubactries), les ARNlnc (qui rgulent la transcription chez
les eucaryotes) et les miARN (qui rgulent la transcription, la stabilit des ARNm
et la traduction chez les eucaryotes).
La sous-unit ARN de la tlomrase (uniquement chez les eucaryotes, chapitre2).

Fiche3

Structure et organisation
des chromosomes eucaryotes
Chromosomes et chromatine
Chez les eucaryotes, lensemble du matriel gntique, appel gnome, peut donc tre
reprsent comme une succession de nuclotides. Ceux-ci vont cependant sorganiser
en structures linaires distinctes dans le noyau: les chromosomes. Ces chromosomes
17

possdent donc deux extrmits, appeles tlomres (chapitre2). Les chromosomes sont
constitus de chromatine, nom donn lassociation dADN et de protines (histones
et protines non-histoniques).

Nuclofilament ou fibre chromatinienne de 11nm


Lobservation au microscope lectronique de la chromatine a permis de mettre en vidence une structure en collier de perles (Photo de couverture). Chaque perle,
dnomme nuclosome, a une forme de disque denviron 11nm de diamtre pour environ
6nm dpaisseur. Il est constitu de huit histones (deux exemplaires dhistones H2A,
deux dH2B, deux dH3 et deux dH4) entoures dun segment dADN de 146paires de
bases (environ un tour trois quarts).
Les histones sont des protines comprenant beaucoup dacides amins basiques (comme
la lysine et larginine) qui prsentent des charges positives. Ces charges vont pouvoir
tablir des liaisons ioniques avec les charges ngatives portes par les groupements
phosphate de lADN. De cette manire, ADN et histones peuvent tre lis.
LADN compris entre deux nuclosomes contient environ 60paires de bases et est
associ une histone de liaison H1. Cette portion dADN est parfois appele ADN
internuclosomique. Lensemble forme donc une structure en collier de perles,
aussi appel nuclofilament ou fibre chromatinienne de 11nm (figure1.14).
Nuclosome

histones nuclosomiques
6m

11
m

H1

ADN
ADN internuclosomique

Figure1.14 Structure du nuclofilament

Solnode ou fibre chromatinienne de 30nm


Le nuclofilament peut senrouler sur lui-mme en hlice (forme de solnode), dont
chaque tour est form de sixnuclosomes. Cette hlice a un diamtre plus pais, denviron 30nm. Les histones H1 jouent ici un rle important de stabilisation de la structure,
en interagissant avec les nuclosomes voisins.

Niveaux suprieurs dorganisation de la chromatine


Les fibres compactes de 30nm vont ensuite former des boucles denviron 300nm de
long, qui sancrent dans une matrice protique (sorte de squelette interne du chromosome, constitu de protines acides). Enfin, cette structure en boucles successives va
former une hlice denviron 700nm de diamtre, dont chaque tour est constitu denviron 60 boucles. Ce niveau reprsente le taux de compaction maximal de lADN dans un
chromosome (figure1.15).
18

11 nm

Solnode

30 nm

Structure en boucles
du chromosome

300 nm

700 nm

Chromosome
en mtaphase

1400 nm

Exercices

Section condense
dun chromosome

Fiches

Fibre chomatinienne
collier de perles

QCM

2 nm

Vrai ou faux ?

ADN en double hlice

Figure1.15 Les diffrents niveaux dorganisation de la chromatine

Lors de linterphase, la chromatine apparat dans le noyau sous deux formes correspondant un taux de condensation diffrent: la chromatine condense (ou htrochromatine) en mottes irrgulires et la chromatine dcondense (ou euchromatine) prsentant
un aspect plus diffus. Ces deux types de chromatine correspondent deux tats fonctionnels de la mme substance. La chromatine condense est gntiquement rprime,
cest--dire inactive du point de vue transcriptionnel. Elle se situe principalement la
priphrie du noyau, contre lenveloppe nuclaire, ainsi quautour des nucloles, mais
peut galement se rpartir dans tout le noyau sous forme de mottes de taille variable. La
chromatine dcondense est quant elle potentiellement active, capable dtre transcrite.
Elle est essentiellement localise la priphrie des mottes de chromatine condense,
une rgion du nucloplasme dnomme les espaces prichromatiniens. Le contrle de
la condensation de la chromatine est orchestr par une srie denzymes particulires qui
vont interagir sur les nuclosomes et les histones qui les composent (chapitres 6 et8).

1. Le matriel gntique

Dunod. Toute reproduction non autorise est un dlit.

Taux de condensation de la chromatine

19

Territoires chromosomiques
Dans presque toutes les cellules eucaryotes, les chromosomes ne peuvent pas tre individualiss pendant linterphase. Cependant, leur mise en vidence par hybridation in
situ a rvl quils prsentent une organisation non alatoire au sein du noyau. Chaque
chromosome occupe un volume bien dfini lintrieur du noyau, appel territoire chromosomique. En revanche, en division cellulaire, les chromosomes sont clairement distincts au sein des cellules. En effet, la chromatine dont ils sont constitus atteint un tat
de condensation maximal en division, permettant la rpartition du matriel gntique
dans les deux cellules filles.

Chez les procaryotes: nuclode et plasmides


Chez les procaryotes, les gnes se trouvent gnralement dans un chromosome unique,
la plupart du temps circulaire. Ce chromosome procaryote est constitu dune seule molcule dADN, associe des ARN et des protines (surtout des facteurs de transcription).
Lensemble de cette structure est appel nuclode et nest pas dlimit par une membrane nuclaire. Chez certaines archobactries, la molcule dADN est aussi associe
des protines semblables aux histones, qui participent la condensation de lADN. Chez
les eubactries par contre, lADN nest jamais associ des histones: la condensation de
lADN se fait principalement par un mcanisme appel surenroulement, ralis notamment
par des enzymes appeles ADN topoisomrases. Certaines cellules procaryotes peuvent
aussi contenir une ou plusieurs molcules dADN surnumraires, gnralement circulaires,
appeles plasmides. Ces molcules sont distinctes de lADN chromosomique et ne sont
pas ncessaires la survie de la cellule procaryote. Par contre, les gnes qui sy trouvent
peuvent tre avantageux pour cette cellule, par exemple en lui confrant des caractristiques de rsistance diffrents facteurs (antibiotiques, mtaux lourds).

Fiche4

Organisation du gnome
Variabilits des gnomes
Comme nous lavons vu dans la fiche3, le gnome est lensemble du matriel gntique
contenu dans lADN dune cellule. Dans le monde du vivant, les espces ont des gnomes
parfois trs diffrents. En effet, les molcules dADN des espces peuvent varier par:
leur taille: de quelques milliers de paires de bases plusieurs milliards;
leur nombre: une molcule dADN chez les procaryotes, plusieurs chez les eucaryotes
(par exemple 46 chez lHomme);
leur forme: circulaire (chez la plupart des procaryotes) ou linaire (chez la majorit
des eucaryotes);
leur localisation: spare ou non du reste de la cellule par deux membranes. Chez
les eucaryotes, lADN est par exemple contenu dans un noyau, alors que lADN des
procaryotes est dans le cytoplasme;
leurs squences: certaines caractristiques de chaque espce, dautres caractristiques
de chaque individu dans une mme espce.

20

Gnome procaryote

Fiches

Chez les procaryotes, le gnome est gnralement plus petit et contient souvent moins
de gnes que chez les eucaryotes. La plupart du temps, il ny a quune molcule dADN
circulaire, qui nest pas spare du reste de la cellule. En plus de cette molcule dADN,
certains procaryotes ont galement des plasmides.

Gnomes eucaryotes

Vrai ou faux ?

QCM

Chez les eucaryotes, on distingue deux types principaux de gnomes:


le gnome nuclaire: constitu de plusieurs molcules dADN linaires contenues dans
un noyau. Quand on parle du gnome des eucaryotes, cest gnralement celui-l
que lon fait rfrence.
les gnomes non-nuclaires: contenus dans des organites comme les mitochondries
(prsents chez la quasi-totalit des eucaryotes) et les chloroplastes (prsents chez les
eucaryotes photosynthtiques), ces gnomes sont donc prsents en plusieurs copies
dans une cellule. Il semblerait quils soient des drivs de gnomes procaryotes, car
ils prsentent beaucoup de caractristiques communes (comme la prsence dune seule
molcule dADN circulaire).
Chez certains eucaryotes, on retrouve galement des plasmides dans le cytosol (comme
chez certains Saccharomyces et Kluyveromyces).

Organisation des gnomes

Exercices

Les gnomes sont constitus de rgions particulires appeles gnes, spares par
des rgions appeles squences intergniques.

Les squences intergniques


Les squences intergniques sont des rgions non-codantes de lADN, situes entre les
gnes. Chez les procaryotes, il y a trs peu de ces rgions, la majorit du gnome correspondant des gnes. linverse chez les eucaryotes, les rgions intergniques peuvent
reprsenter une grande partie de la taille du gnome. Ces rgions correspondent des
squences rptitives non-codantes disperses (ADN satellite, minisatellite et microsatellite) ou mobiles (transposons et retrotransposons, chapitre2).

1. Le matriel gntique

Dunod. Toute reproduction non autorise est un dlit.

Les gnes
Un gne est la squence complte dADN ncessaire la synthse dune chane polypeptidique (obtenu partir de la traduction dun ARNm; chapitre5) ou dun ARN
fonctionnel (comme les ARNt et ARNr). Le concept de gne ne se rsume donc pas
aux nuclotides codant la squence dacides amins dune protine (qui forment la rgion
codante, chapitre5), il englobe aussi toutes les squences dADN non-codantes requises
la formation dun ARN mature. Parmi celles-ci, citons notamment les squences de
contrle de la transcription (chapitres3 et 8) ou les squences rgulatrices de la maturation
des ARNm (chapitres4, 9 et 10).

21

Entranement
QCM

1.

Parmi les affirmations suivantes sur le ribose, laquelle est fausse?


a. Le ribose est un pentose.
b. Le ribose est prsent dans les ribonuclotides.
c. Le ribose fait partie du groupe des aldoses.
d. Le ribose possde quatre fonctions hydroxyle.
e. Le ribose ressemble au dsoxyribose, mais le C3 du dsoxyribose est rduit.

2.

Parmi les affirmations suivantes sur le pentose des nuclotides, laquelle est
fausse?
a. Le pentose des nuclotides est sous forme cyclique.
b. Le pentose des nuclotides est un aldopentose, car il porte une fonction aldhyde.
c. Le cycle du pentose est compos de cinq atomes de carbone.
d. Le pentose sous sa forme cyclique est appel -furanose.
e. La forme cyclique est , car la fonction OH du C1 est situe du mme ct du
cycle que le C5.

3.

Parmi les affirmations suivantes sur les bases azotes, laquelle est exacte?
a. Luracile possde un groupement CH3 supplmentaire par rapport la thymine.
b. Ladnine contient une fonction amine sur le C6 et une fonction ctone sur le C2.
c. Toutes les pyrimidines ont une fonction ctone sur leur C4.
d. Les bases purines se lient au pentose au niveau de leur atome dazote numrot
9.
e. Adnine et guanine ne diffrent entre elles que par la prsence dune fonction
ctone supplmentaire dans la guanine.

4.

Parmi les affirmations suivantes sur la nomenclature des nuclotides, laquelle


est exacte?
a. La cytidine diphosphate est un nucloside form de lassociation dune base azote,
la cytosine, dun sucre, le ribose, et de deux groupements phosphate.
b. La dsoxyadnine diphosphate est un nuclotide form dune base azote purine
lie un pentose, lui-mme associ deux groupements phosphate.
c. La dsoxyuridine monophosphate est un nuclotide prsent dans lARN.
d.
La dsoxyguanosine diphosphate est un nuclotide form dune base azote
purine, la guanine, lie un pentose, le dsoxyribose, lui-mme associ deux
groupements phosphate.
e. La thymidine diphosphate est un nuclotide form de lassociation dune base
azote purine, dun sucre et de deux groupements phosphate.

22

5.

Parmi les affirmations suivantes sur les acides nucliques, laquelle est exacte?

Fiches

a. De linformation gntique la traduction en protines, la cellule a besoin de


seulement trois acides nucliques diffrents.
b. Les acides nucliques sont forms par polymrisation de nuclotides monophosphate.
c. La polymrisation des nuclotides se fait par raction entre le groupement OH
port par le C3 du pentose du nuclotide 1 avec un groupement phosphate du
nuclotide2.
d. Dans les acides nucliques, la liaison entre deux nuclotides est appele liaison
phosphodiether.

7.

Si on comptait le nombre de bases de chaque type contenues dans un chantillon


dADN, quel serait le rsultat, en accord avec les rgles dappariement entre
bases azotes?
a. A +C =G +T

c. G +C =A +C

b. G +C =A +T

d. G +C =2T

Vrai ou faux ?

6.

QCM

e. Les deux extrmits des acides nucliques sont appeles 3 et 5: 3 pour


lextrmit portant un groupement phosphate libre et 5 pour lextrmit portant
un groupement OH libre.

e. T =G

Parmi les affirmations suivantes sur les acides nucliques, laquelle est fausse?
a.
LADN est le plus souvent bicatnaire, tandis que lARN est gnralement
monocatnaire.

Exercices

b. LADN-B forme une double hlice dont la structure fait apparatre deux sillons de
mme taille.
c. Les deux chanes dADN sont antiparallles, complmentaires et hlicodales.
d. Les deux chanes dADN interagissent entre elles par des liaisons hydrogne.
e. Les ARNt prsentent des rgions bicatnaires, suite au repliement de lARN sur
lui-mme.

8. Parmi les affirmations suivantes sur la fibre chromatinienne, laquelle est


fausse?
a. Un nuclosome a un diamtre denviron 11nm, pour environ 6nm dpaisseur.
b. LADN interagit avec les histones par lintermdiaire de liaisons covalentes.
c. LADN senroule sur un tour trois quarts autour dun octamre dhistones.
e. Entre deux nuclosomes, il existe une portion dADN denviron 60paires de bases
associe une histone H1.

9.

1. Le matriel gntique

Dunod. Toute reproduction non autorise est un dlit.

d. Un nuclosome contient deux copies dhistone H3.

Parmi les affirmations suivantes sur les gnomes, laquelle est exacte?
a. Le gnome procaryote est constitu dune seule molcule dADN monocatnaire
circulaire.
b. Chez les eucaryotes, la majorit du gnome est constitue de rgions codant pour
des gnes.
c. Chez les eucaryotes, les exons sont des parties de la squence transcrite qui seront
limines avant la traduction.
d. Tous les ARN transcrits partir de gnes sont traduits en protines.
e. Il existe des procaryotes ayant un gnome plus grand que certains eucaryotes.

23

Rponses
1.

2.

c. Le pentose des nuclotides est un


aldopentose sous forme cyclique, appele
-furanose. Le cycle form est constitu de
quatre atomes de carbone et un atome doxygne, et non cinq atomes de carbone. Ce type
de cycle est appel htrocycle, car il est
constitu de plusieurs types datomes.

3.

d. Cest bien au niveau de latome dazote


numrot 9 des purines que la liaison se
fait avec le pentose. Cest la thymine qui possde un groupement CH3 supplmentaire par
rapport luracile. Ladnine ne possde pas
de fonction ctone. Cest sur le C2 que toutes
les pyrimidines ont une fonction ctone.
Enfin, adnine et guanine diffrent entre elles
non seulement par la prsence dune fonction
ctone supplmentaire sur la guanine, mais
aussi par la position de la fonction amine (C6
pour adnine et C2 pour la guanine).

4. d. Un nuclotide est une base azote lie un


pentose, lui-mme associ un ou plusieurs
groupements phosphate. Les cinq bases azotes sont: ladnine, la guanine, la cytosine, la
thymine et luracile. Les cinq nuclosides associs sont, respectivement: ladnosine, la guanosine, la cytidine, la thymidine et luridine. La
cytidine diphosphate est donc un nuclotide et
non un nucloside et ladnine une base azote et non un nuclotide. Dans lARN, cest de
luridine et non de la dsoxyuridine (le pentose
est un ribose et non un dsoxyribose). Enfin,
la thymidine est forme dune base azote
pyrimidine (thymine) et non purine. La seule
proposition correcte est donc la d.

5.

24

phosphate. De linformation gntique la


traduction en protines, la cellule a besoin
dau moins quatre acides nucliques diffrents (ADN, ARNm, ARNt et ARNr), plus tous
les autres ARN rgulateurs (chapitres 4, 8, 9
et 10). Les acides nucliques sont forms par
polymrisation de nuclotides triphosphate,
formant des liaisons phosphodiester (et non
phosphodiether) entre les nuclotides. Enfin,
les deux extrmits des acides nucliques
sont bien appeles 3 et 5, mais les
groupements libres ports par chacune sont
linverse de la proposition e. (OH en 3 et
phosphate en 5).

e. Le ribose est un sucre cinq carbones (donc


un pentose) portant une fonction aldhyde
(aldose), quatre fonctions hydroxyle (OH sur
les carbones1, 2, 3 et 5) et prsent dans
les ribonuclotides. Ribose et dsoxyribose se
ressemblent bien, mais cest le C2 du dsoxyribose qui est rduit, pas le C3.

c. La polymrisation des nuclotides se fait


effectivement par raction entre le groupement OH port par le C3 du pentose du
nuclotide1 avec un groupement phosphate
du nuclotide 2 (le premier), accompagn
dune libration des deux autres groupements

6.

a. LADN renferme quatre types de bases azotes qui sapparient deux deux: adnine (A)
avec thymine (T) et cytosine (C) avec guanine
(G). Dans une molcule dADN, les bases complmentaires sont donc en proportion gale
(A =T et C =G), et cest tout (A G, T G).
Laffirmation A +C =G +T est donc correcte.
En revanche, le nombre de chacun des deux
types dappariements varie dans cette molcule dADN (G +C A+T).

7.

b. LADN-B forme une double hlice dont la


structure fait apparatre deux sillons de taille
ingale: un petit et un grand.

8.

b. LADN interagit avec les histones par lintermdiaire de liaisons ioniques. En effet, les histones sont des protines portant des charges
positives (acides amins basiques) pouvant
tablir des liaisons ioniques avec les charges
ngatives portes par lADN (groupements
phosphate).

9.

e. En effet, certains eucaryotes ont un gnome


trs petit (plus petit que certains gnomes
procaryotes). Par exemple, le gnome de
leucaryote parasite Encephalitozoon cuniculi
(2,9106 paires de bases) est plus petit que
le gnome du procaryote Escherichia coli
(4,6 106 paires de bases). Le gnome procaryote est constitu dune molcule dADN
(bicatnaire) circulaire. Chez les eucaryotes, la
majorit du gnome est constitu de rgions
non-codantes et ce sont les introns qui sont
limins avant la traduction. Enfin, certains
ARN ne sont pas traduits, comme les ARNt et
les ARNr.

Fiches

Entranement

Linformation gntique est stocke dans un polymre de dsoxyribonuclosides.

2.

La cyclisation du pentose des nuclotides se fait par raction de la


fonction OH du C4 sur le C1 impliqu dans la fonction aldhyde.

3.

Les bases azotes pyrimidines sont constitues dun htrocycle et


les bases purines de deux cycles accols.

4.
5.

Ladnosine est une base azote purine.

Les bases purines sont au nombre de deux dans les acides nucliques,
contenant chacune cinq atomes dazote.

6.

Toutes les bases azotes des acides nucliques contiennent au moins


un atome doxygne.

7.

La dnaturation de lADN par la chaleur est dautant plus difficile quil


est riche en appariements C-G.

8.

Dans lADN, les bases azotes sont lies aux riboses par des liaisons
N-glycosidique.

9.

Les bases purines et pyrimidines sont lies au C1 du pentose par leur


atome dazote numrot 1.

10.
11.

Les acides nucliques sont riches en charges ngatives.

Dans lADN, adnine et thymine interagissent entre elles par deux


liaisons hydrogne, une entre lamine en C6 de l'adnine et loxygne
en C4 de la thymine, et lautre entre lazote 1 de ladnine et lhydrogne de lazote 3 de la thymine.

12.

Lextrmit3 des acides nucliques est constitue dun groupement


OH libre, prt ragir avec un nouveau nuclotide.

13.

Cest au niveau du grand sillon de la double hlice que les histones


interagissent avec lADN.

14.

La compaction de lADN laide des nuclosomes est stabilise par


les histones H1, qui interagissent avec les nuclosomes voisins.

15.

Chez certains procaryotes, les plasmides sont des molcules dADN


nuclaire surnumraire pouvant contenir des gnes de rsistance.

16.

Chez les eucaryotes, les gnomes non-nuclaires codent pour des


protines indispensables la survie de la cellule.

17.
18.

Une cellule humaine contient une seule molcule dADN.

Contrairement lADN des eucaryotes, lADN des procaryotes nest


pas associ des protines.

QCM

1.

Vrai ou faux ?

Faux

Exercices

Vrai

1. Le matriel gntique

Dunod. Toute reproduction non autorise est un dlit.

Vrai ou faux ?

25

Rponses
1. Faux.

A-T nen implique que deux. De ce fait, plus


lADN sera riche en appariement C-G, plus il
sera difficile de le dnaturer (par exemple
la chaleur), cause du nombre de liaisons
hydrogne plus important.

Linformation gntique est stocke


dans un polymre de dsoxyribonuclotides
(ADN), les groupements phosphate sont
indispensables pour les liaisons phosphodiester entre les diffrents nuclotides.

Vrai. Effectivement, cest bien le C1 du pentose des nuclotides qui est impliqu dans la
fonction aldhyde. Cest ce niveau que la
fonction OH du C4 va ragir pour former le
cycle. La raction ne serait pas possible avec
la fonction OH du C3, car lencombrement
strique des diffrents groupements ne permet pas la cyclisation du pentose. Lors de la
cyclisation, il faut que la fonction carbonyle
(ici laldhyde) et la fonction OH soient distantes dau moins troisatomes.

8. Faux.

3. Vrai. Pour reconnatre les bases purines des

10. Vrai.

2.

pyrimidines, souvenez-vous que celles qui


ont le nom le plus long (pyrimidines) ont le
moins de cycle (un seul). Inversement, celles
qui ont le nom le plus court (purines) ont
le plus de cycle (deux). Htrocycle signifie que les atomes impliqus dans le cycle
ne sont pas tous les mmes (ici il y a des
atomes de carbone et dazote).

4. Faux. Ladnosine est un nucloside constitu dun pentose (ici le ribose) et de la


base azote adnine (qui est une purine).
Cest donc ladnine et non ladnosine qui
est la base azote. Faites bien attention
la nomenclature des bases azotes et des
nuclosides.

5.

Vrai. Il existe deux bases purines dans


les acides nucliques, et elles contiennent
toutes les deux cinq atomes dazote : en
position 1, 3, 7 et 9 des cycles, plus un
atome dazote dans la fonction amine (position 6 pour ladnine et position 2 pour la
guanine).

6. Faux. La cytosine et la guanine contiennent


un atome doxygne, la thymine et luracile en contiennent deux, mais ladnine ne
contient aucun atome doxygne.

7. Vrai.

Lappariement C-G implique trois liaisons hydrogne tandis que lappariement

26

Dans lADN, les bases azotes sont


bien lies aux pentoses par des liaisons
N-glycosidique, mais ces pentoses sont des
dsoxyriboses et non des riboses.

9.

Faux. Les bases purines et pyrimidines


sont bien lies au C1 du pentose, mais en
fonction du type de base, latome dazote
impliqu est diffrent. Avec les pyrimidines,
cest latome dazote1 qui se lie au pentose,
tandis quavec les purines, cest latome
dazote9.
Les groupements phosphate, qui forment le montant de la chane des acides
nucliques avec les pentoses, sont porteurs de charges lectriques ngatives. Ces
charges ngatives permettent ltablissement de liaisons ioniques, par exemple avec
des protines basiques (riches en charges
positives), comme les histones.

11. Vrai.

Dans lADN, adnine et thymine interagissent bien par deux liaisons hydrogne,
entre les diffrents groupements cits dans
lnonc.

12. Vrai.

Lextrmit 3 des acides nucliques


est bien constitue dun groupement OH
libre, tandis que lextrmit5 est constitue
dun groupement phosphate libre. Cest au
niveau de lextrmit3 que la chane dADN
peut sagrandir, quun nouveau nuclotide
peut sajouter.

13. Faux.

linverse, cest au niveau du petit


sillon de la double hlice que les histones
interagissent avec lADN. Les bases azotes
tant plus accessibles dans le grand sillon,
cest ce niveau que les facteurs de transcription vont venir se lier une squence
spcifique.

14. Vrai.

La compaction de lADN laide des


nuclosomes est effectivement stabilise par les histones H1, qui interagissent

peut pas parler dADN nuclaire, puisquil


ny a pas de noyau. Les plasmides sont
des molcules dADN surnumraires quon
peut trouver dans le cytoplasme de certains
procaryotes.

16. Vrai.

Fiches

Les cellules humaines contiennent


46 chromosomes, chacun de ces chromosomes constitue une molcule dADN. Ainsi,
les cellules humaines contiennent au moins
46 molcules dADN (excepts les cellules
germinales), et mme le double lorsque ces
molcules ont t rpliques (chapitre 2).
Chez lHomme, linformation gntique
est donc morcele en plusieurs molcules
dADN.

18. Faux. LADN des procaryotes est aussi associ des protines, surtout des facteurs de
transcription. Chez certaines archobactries, certaines de ces protines sont semblables aux histones des eucaryotes, tandis
que chez les eubactries, lADN nest jamais
associ des histones (mais bien dautres
types de protines).

1. Le matriel gntique

Dunod. Toute reproduction non autorise est un dlit.

Exercices

Ces gnomes non-nuclaires codent


par exemple pour des protines de la chane
respiratoire des mitochondries, indispensables pour la respiration cellulaire (processus vital de la cellule pour transformer
les diffrents nutriments en nergie exploitable pour la cellule, lATP). Le gnome
chloroplastique code lui pour une partie

17. Faux.

QCM

15. Faux. Attention chez les procaryotes, on ne

des sous-units de la RubisCO, une enzyme


extrmement importante qui permet de fixer
le CO2 atmosphrique dans la matire organique des organismes photosynthtiques.

Vrai ou faux ?

notamment avec les nuclosomes voisins.


Ainsi, le nuclofilament (ou fibre chromatinienne de 11 nm) peut senrouler sur luimme en hlice (chaque tour est constitu
de six nuclosomes), pour former un solnode de diamtre plus pais (30nm). Cest
ce niveau que les histones H1 stabilisent
la structure en maintenant les diffrents
nuclosomes entre eux.

27

Entranement
Exercices
1. Sur le brin monocatnaire dARN suivant, mettez en vidence les zones susceptibles de
sapparier entre-elles:
5 UAACGUAGCCAGUACUACGU 3

Sur le brin repli sur lui-mme, comptabilisez:

a) Le nombre de liaisons phosphodiester.

b) Le nombre de liaisons N-glycosidique.

c) Le nombre de liaisons hydrogne.

Conseil mthodologique
Souvenez-vous des appariements entre les bases azotes de lARN. Pour quun brin dARN
puisse se replier sur lui-mme, il faut que deux zones spares par quelques nuclotides
interagissent entre elles grce lappariement de bases complmentaires.

2.

Sur le brin dADN bicatnaire suivant, comptabilisez:


5 ATTCAGCATCGAATGCGCTGGCTC 3
5 TAAGTCGTAGCTTACGCGACCGAG 3

a) Le nombre de liaisons phosphodiester.


b) Le nombre de liaisons N-glycosidique.

c) Le nombre de liaisons hydrogne.

Conseil mthodologique
tablissez une rgle gnrale pour connatre le nombre de liaisons qui stablissent entre
n lments.

3.

Aprs avoir squenc un brin dADN bicatnaire, un chercheur trouve quil est compos
de 40% de guanine.
AT
a) En sachant cela, calculez le rapport:
GC
b) Le mme chercheur squence un autre brin dADN bicatnaire et trouve que le
AT
rapport
de ce brin vaut 2,25. Quel brin dADN sera plus facilement dnaturable, ce
GC
dernier brin ou celui de la question prcdente? Justifiez votre rponse.

Conseil mthodologique
Souvenez-vous des appariements entre les bases azotes de lARN et du nombre de
liaisons impliques dans ces appariements.

28

Vous aimerez peut-être aussi