Vous êtes sur la page 1sur 201

COMMUNAUT FRANAISE DE BELGIQUE

ACADMIE UNIVERSITAIRE WALLONIE-EUROPE


FACULT UNIVERSITAIRE DES SCIENCES AGRONOMIQUES DE GEMBLOUX

CARACTRISATION DU CONSORTIUM MICROBIEN


D'UN GRAIN DE KFIR

Vronique Louise NINANE

Dissertation originale prsente en vue de l'obtention du grade de docteur en sciences


agronomiques et ingnierie biologique

Promoteur : Pr. Ph. THONART


Co-promoteurs : Dr. P. DARDENNE, Dr. G. BERBEN
2008

Ninane Vronique Louise (2008). Caractrisation du consortium microbien d'un grain de kfir. Gembloux, Facult
Universitaire des Sciences Agronomiques, 197 p., 16 tabl., 16 fig.
Rsum: Les grains de kfir sont des ferments lactiques constitus d'une microflore complexe et diversifie. Celle d'un grain
de kfir (KJ) a t caractrise par une approche mthodologique classique d'isolements microbiens sur des milieux de
culture slectifs et, pour les bactries lactiques, par une approche indpendante d'isolements bactriens par culture. Cette
dernire consistait en l'analyse de la squence des rgions V1 et V2 de l'ADNr 16S, amplifies partir de l'ADN extrait du
grain. La sensibilit de la mthode a t augmente cette occasion en dissociant les amplifications gniques des populations
lactiques minoritaires et majoritaires du grain. La flore identifie dans le grain KJ comprenait Acetobacter sp., Kazachstania
exigua, Lactobacillus kefiranofaciens subsp. kefirgranum, Lb. kefiri, Lb. parakefiri, Lactococcus lactis subsp. lactis et
Leuconostoc mesenteroides, et tait dpourvue de microcoques, de pdiocoques, de Weissella viridescens, de bactries
indicatrices de dfauts d'hygine, de Salmonella sp. et de Listeria monocytogenes. Dans le but de vrifier le caractre complet
des espces mises jour, une reconstitution du grain partir des micro-organismes qui en ont t isols a t envisage. Des
conditions exprimentales favorables la formation de grains dans un substrat lact ont t recherches partir d'extraits du
grain KJ renfermant un consortium microbien a priori complet. Ces essais de reconstitution n'ont pas conduit la formation
de grains de kfir mais l'un d'eux a conduit la formation de biofilms. Cet vnement a t reproduit dans du lait de faon
rptable avec des consortiums reconstitus partir des micro-organismes individuels isols du grain KJ.
Ninane Vronique Louise (2008). Characterisation of the microbial consortium of a kefir grain (Thse de doctorat in French).
Gembloux, Belgium Gembloux Agricultural University, 197 p., 16 tabl., 16 fig.
Summary: Kefir grains are dairy starters composed of a complex and diversified microflora. The one of a kefir grain (KJ)
was characterised by a classical methodological approach of microbial isolation on selective culture media and, for the lactic
acid bacteria, by a culture-independent approach. This latter was the sequence analysis of the 16S rDNA V1 and V2 regions
amplified from a grain DNA extract. At this occasion, the sensitivity of the method was increased by splitting up the genetic
amplification of the less abundant lactic acid population from that of more abundant ones. The microflora identified in the
kefir grain KJ included Acetobacter sp., Kazachstania exigua, Lactobacillus kefiranofaciens subsp. kefirgranum, Lb. kefiri,
Lb. parakefiri, Lactococcus lactis subsp. lactis and Leuconostoc mesenteroides, and was free of micrococci, pediococci,
Weissella viridescens, indicator bacteria of sanitary defaults, Salmonella sp. and Listeria monocytogenes. With the aim to
verify the completeness of the identified species, a reconstitution of the grain from the isolated micro-organisms was
envisaged. Experimental conditions favourable to a grain formation in a milky substrate were searched with extracts of the
KJ grain that contained a theoretical complete consortium. These trials of grain reconstitution didn't lead to the formation of
kefir grains but one of them led to the formation of biofilms. This event was repeatably reproduced in milk with consortiums
that were reconstituted from the individual micro-organisms isolated from the KJ grain.
Copyright. Aux termes de la loi belge du 22 mars 1886, sur le droit d'auteur, seul l'auteur a le droit de reproduire cet ouvrage
ou d'en autoriser la reproduction de quelque manire et sous quelque forme que ce soit. Toute photocopie ou reproduction
sous autre forme est donc faite en violation avec la loi.

Ce travail fut une exprience intense,


passionnante et enrichissante,
Qui, sans vous,
Chers parents, chers amis,
chers collgues,
N'aurait pas vu le jour.

Pour votre patience, vos encouragements


et vos judicieux conseils,
Je tiens vous dire
MERCI.

SOMMAIRE
RSUM

SUMMARY

INTRODUCTION

11

1.1

Grains de kfir

13

1.2

Prparation et qualit du kfir

24

1.3

Perspectives de dveloppement

35

1.4

Mthodes didentification des bactries lactiques

46

1.5

Objectifs du travail

55

MATRIEL ET MTHODES

59

2.1

Matriel biologique

59

2.2

Qualit hyginique du grain de kfir KJ

60

2.3

Identification et quantification des groupes microbiens du grain de kfir KJ

61

2.4

Identification molculaire des bactries lactiques du grain de kfir KJ

64

2.5

Isolement des micro-organismes du grain de kfir KJ et identification des isolats

69

2.6

Formation du grain de kfir KJ

73

RSULTATS

77

3.1

Qualit hyginique du grain de kfir KJ

77

3.2

Identification et quantification des groupes microbiens du grain de kfir KJ

79

3.3

Identification molculaire des bactries lactiques du grain de kfir KJ

85

3.4

Identification des isolats microbiens

100

3.5

Formation du grain de kfir KJ

111

DISCUSSION

129

4.1

Qualit hyginique du grain de kfir KJ

129

4.2

Identification et quantification des groupes microbiens du grain de kfir KJ

133

4.3

Identification molculaire des bactries lactiques du grain de kfir KJ

139

4.4

Composition microbienne du grain de kfir KJ

146

4.5

Formation du grain de kfir KJ

149

CONCLUSIONS ET PERSPECTIVES

157

5.1

Caractristiques microbiennes du grain de kfir KJ

157

5.2

Atouts, contraintes et performances de la mthode molculaire d'identification des bactries


lactiques
160

5.3

Avances en matire de reconstitution d'un grain de kfir

162

ANNEXE I : ANCIENNES DNOMINATIONS DES MICRO-ORGANISMES DU KFIR

167

ANNEXE II : CODE DES ACIDES


BOWDEN, 1985).

NUCLIQUES DE L'UNION INTERNATIONALE DE BIOCHIMIE

(CORNISH169

BIBLIOGRAPHIE

171

LISTE DES DOCUMENTS PUBLIS DANS LE CONTEXTE DE CE TRAVAIL

187

LISTE DES FIGURES

189

LISTE DES TABLEAUX

191

TABLE DES MATIRES

193

RSUM

RSUM
Les grains de kfir sont des ferments lactiques constitus d'une microflore complexe et
diversifie. Celle dun grain de kfir slectionn pour ses qualits organoleptiques et
technologiques, le grain KJ, a t caractrise du point de vue de sa composition microbienne
tant qualitative que quantitative.
Les groupes microbiens participant au consortium ont t identifis par la mthode
classique d'isolements sur des milieux de culture slectifs. Elle a rvl la prsence dans le
grain KJ de lactobacilles, de coques lactiques, de leuconostocs, de bactries actiques et de
levures. Paralllement, elle a montr que le grain KJ tait dpourvu de microcoques, de
pdiocoques, de Weissella viridescens, de bactries indicatrices de dfauts d'hygine ainsi que
des germes de la flore pathogne prvalant dans nos rgions et susceptible de se dvelopper
dans cette matrice (Listeria monocytogenes et Salmonella sp.).
L'identification de Acetobacter sp. et de Kazachstania exigua, la bactrie actique et la
levure du grain KJ, a t dtermine par des mthodes phnotypiques et/ou molculaires
appliques des souches isoles du grain. L'identification de la flore lactique du grain KJ,
plus diversifie dans les grains que la flore actique et plus dlicate mettre en vidence par
culture que les levures, a t effectue par une approche indpendante d'isolements bactriens
par culture. Elle consistait en l'analyse de squences du gne codant pour l'ARNr 16S
amplifies partir de l'ADN directement extrait d'un grain. L'identification des bactries
l'origine des squences a t dtermine par comparaison avec des squences d'origine
connue. La comparaison portait sur de courtes rgions cibles de l'ADNr 16S, d'une centaine
de nuclotides. Le pouvoir discriminant des rgions cibles de l'ADNr 16S tait suffisant pour
garantir une identification fiable des lactobacilles et des coques lactiques de grains de kfir au
niveau taxonomique de l'espce mais n'autorisait une identification fiable des leuconostocs
qu'au niveau du genre. Dans lapproche applique, le nombre de squences examines
dtermine la sensibilit de la mthode. Il a t rationalis en dissociant l'ADNr 16S des
populations lactiques minoritaires et majoritaires du grain l'occasion de l'amplification
gnique. Le nombre de squences examines dans chacun des pools d'amplification a t fix
de faon dtecter les espces dominantes de tous les groupes lactiques identifis dans le
grain de kfir KJ et de ceux dont la prsence tait pressentie sur base des donnes de la
littrature : lactobacilles homofermentaires, lactobacilles htrofermentaires, coques lactiques
3

RSUM

et leuconostocs. Cette stratgie a rvl la prsence dans le grain KJ de cinq espces


lactiques : Lactobacillus kefiranofaciens, Lb. kefiri, Lb. parakefiri, Lactococcus lactis et
Leuconostoc sp. La diversit des bactries lactiques qu'elle a permise de mettre en vidence
dans le grain KJ tait reprsentative de celle de grains de kfir.
L'identification molculaire des bactries lactiques a t confirme par une analyse des
caractristiques phnotypiques de souches isoles du grain KJ. Elle a, paralllement, t
prcise des niveaux taxonomiques plus fins pour les taxons le requrant. L'identification de
Lactobacillus kefiranofaciens subsp. kefirgranum et de Lactococcus lactis subsp. lactis a t
prcise partir de leur profil fermentaire et celle de Leuconostoc mesenteroides, partir du
profil de migration de ses protines cellulaires.
La composition quantitative moyenne de la flore banale identifie dans le grain KJ
tait, en terme d'units viables (ufc.g-1), de : 1,4 . 108 lactobacilles, 3,9 . 104 coques lactiques,
1,5 . 105 leuconostocs, 4.0 . 107 bactries actiques et 1,1 . 107 levures. Dans les conditions de
culture appliques au laboratoire, qui relevaient de pratiques usuelles de culture de grains de
kfir, la composition quantitative du grain KJ variait non seulement au cours du temps mais
aussi entre les cultures individuelles entretenues et incubes en parallle. La variabilit de
l'abondance du grain KJ en lactobacilles, en coques lactiques et en levures, exprime par
l'cart type relatif gomtrique des dnombrements, atteignait ainsi respectivement 41 %,
420 % et 43 %. Les sources potentielles de variabilit ont t identifies ; elles concernaient la
temprature initiale du lait de renouvellement des cultures, lintensit du rinage des grains et
lhtrognit de lenvironnement immdiat des grains lie notamment la pratique d'une
culture statique de grain. Lhtrognit de lenvironnement immdiat des grains tait la
principale source potentielle de variabilit pour les lactobacilles et les levures.
Les grains de kfir sont des associations symbiotiques qui se forment spontanment
dans une rgion gographique dtermine (Caucase). Nulle part ailleurs un grain de kfir n'a,
ce jour, t constitu. Des paramtres potentiellement dterminants une formation de grain
in vitro ont t recherchs par lobservation du comportement dextraits microbiens du grain
KJ soumis des conditions de culture favorables un tel processus. La simulation
exprimentale des vnements et conditions de formation in situ, dduits de descriptions
bibliographiques, ne conduisaient pas la reconstitution du grain KJ.

RSUM

Une constitution du grain dans ces conditions supposait un processus de formation


incluant une phase de croissance des petites structures de grain formes par le consortium
dans un environnement de caill. Lventualit dun processus impliquant une phase de
croissance des petites structures de grain KJ dans du lait a t considre. Des petites
structures de grain KJ, reprsentes exprimentalement par des fragments de grains, ont t
incubes dans du lait nature et dans du lait modifi de faon , notamment, promouvoir la
constitution de la matrice des grains. Le lait, nature ou modifi, s'est rvl inappropri leur
croissance, et mme dans certains cas leur prservation, et rendait improbable un processus
de formation du grain par croissance de petites structures de ce grain dans ce substrat.
Paralllement, le consortium du grain KJ formait des structures microbiennes qui se
prsentaient sous la forme de biofilms souples flottant dans le lait. Ces structures
microbiennes diffraient de grains de kfir notamment par leur consistance plus molle.
L'anomalie au niveau de la cohsion de leur matrice et l'incapacit des petites structures de
grain KJ crotre dans du lait, qui est le substrat naturel de ce consortium, pourrait traduire
l'absence dans le grain KJ d'un intervenant microbien permettant d'amorcer la constitution du
grain.
La formation de biofilms par le consortium du grain KJ tait par ailleurs un vnement
alatoire, probablement en raison de la variabilit de la composition microbienne quantitative
du grain KJ. A partir dun consortium reconstitu avec des cultures standardises de souches
isoles du grain KJ, la formation de biofilms tait reproductible. La littrature laisse
indirectement penser que l'occurrence occasionnelle d'un tel vnement in situ est possible.
Un processus de formation faisant intervenir une telle structure intermdiaire, en tant que
milieu de croissance de petites structures de grain KJ ou en tant que structure primaire
voluant vers une structure mature de grain, est ds lors une hypothse plausible.

SUMMARY

SUMMARY
Kefir grains are dairy starters composed of a complex and diversified microflora. The
one of a particular kefir grain selected for its organoleptic and technological qualities, the KJ
grain, was characterised with respect to its microbial composition, as well qualitatively as
quantitatively.
The microbial clusters participating in the consortium were identified by the classical
method of microbial isolation on selective culture media. This method revealed the presence
in the KJ grain of lactobacilli, lactic acid streptococci, leuconostocs, acetic acid bacteria and
yeasts. In parallel, it showed that the KJ grain was free of micrococci, pediococci, Weissella
viridescens, indicator organisms of hygienic defects as well as the microbes of the pathogenic
microflora occurring in our countries and that is able to grow in the grain matrix (Listeria
monocytogenes and Salmonella sp.).
The identification of Acetobacter sp. and of Kazachstania exigua, the acetic acid
bacteria and the yeast of the kefir grain KJ, was determined by phenotypic and/or molecular
methods applied on strains isolated from the grain. Due to the larger diversity of the lactic
acid microflora of the grain compared to that of the acetic acid one and to its more delicate
cultivation compared to that of the yeasts, the lactic acid bacteria identification was achieved
by a culture-independent approach focussing on the 16S rDNA sequences directly amplified
from a grain DNA extract. The identification of the bacteria to which the sequences belonged
was determined by comparison with sequences of known origins. This comparison concerned
short targeted regions of the 16S rDNA of about a hundred nucleotides. The discriminating
power of the targeted regions of the 16S rDNA was sufficient to guarantee an accurate
identification of the lactobacilli and the lactic acid streptococci of kefir grains at the species
taxonomic level but barely agreed an accurate identification of the leuconostocs at the genus
level. In the considered approach, the number of sequences analysed determines the
sensitivity of the method. This was rationalized by splitting up the 16S rDNA from the less
and the more abundant lactic populations of the grain when genomic DNA was amplified. The
number of sequences analysed within each pool of amplified 16S rDNA was set in such a way
that the major species of all the lactic acid groups of the kefir grain KJ that were identified
and suspected to contribute to the microflora on the basis of published data could be detected.
Those concerned the homofermentative lactobacilli, the heterofermentative lactobacilli, the
7

SUMMARY

lactic acid streptococci and the leuconostocs. This strategy revealed the presence in the KJ
grain of five lactic acid bacterial species: Lactobacillus kefiranofaciens, Lb. kefiri,
Lb. parakefiri, Lactococcus lactis and Leuconostoc sp. The diversity of the lactic acid bacteria
that were highlighted by this way was in accordance with this of kefir grains.
The molecular identification of the lactic acid bacteria was confirmed by an analysis
of the phenotypic traits of strains isolated from the KJ grain. In parallel, it was specified at a
lower taxonomic level for the taxa that required it. Sub-species identification was specified by
their fermentative profiles for Lactobacillus kefiranofaciens subsp. kefirgranum and for
Lactococcus lactis subsp. lactis, and by the fingerprint of its cellular proteins for species
identification of Leuconostoc mesenteroides.
The mean quantitative composition of the non-pathogenic microflora identified in the
KJ grain was, in terms of viable counts (cfu.g-1), of: 1,4 . 108 lactobacilli, 3,9 . 104 lactic acid
streptococci, 1,5 . 105 leuconostocs, 4,0 . 107 acetic bacteria and 1,1 . 107 yeasts. In the culture
conditions applied at the laboratory, which correspond to custom cultivation practices, the
quantitative composition of the KJ grain varied not only in the course of time but also
between the individual cultures handled and incubated in parallel. The variability of the KJ
grain abundance in lactobacilli, lactic acid streptococci and yeasts, expressed by the geometric
relative standard deviation of the enumerations, reached 41 %, 420 % and 43 % respectively.
The potential sources of variability were identified: they concerned the initial temperature of
the milk for culture renewal, the grain rinsing intensity and the heterogeneity of the
environment close to the grains that was linked among others to the practice of a static grain
culture. The heterogeneity of the environment close to the grains was the major potential
source of variation for the lactobacilli and the yeasts.
Kefir grains are symbiotic associations that set up spontaneously in a particular
geographic region (Caucasus). Nowhere else a kefir grain was ever constituted up to now.
Potential parameters that might determine a grain setting up in vitro were searched through
the observation of the behaviour of KJ grain microbial extracts maintained under culture
conditions that favoured this process. The experimental simulation of the in situ setting up
events and conditions, deduced from the bibliographic descriptions, didn't lead to the
reconstitution of the KJ grain.

SUMMARY

A grain constitution in those conditions presupposed a setting up process that includes


the growth of the small grain structures formed by the consortium in an environment of curds.
The possibility of a process implying a growth of the small KJ grain structures in milk was
considered. Small grain structures, that were fragments of grains, were incubated in regular
milk and in modified milk that might promote the constitution of the grain matrix. Both,
regular and modified milk, appeared inappropriate for their growth and made unlikely a grain
setting up process by growth of small structures of this grain in this substrate.
In parallel, the consortium of the grain was able to set up microbial structures that
looked like supple biofilms floating in the milk. Those microbial structures differed from
grains by, among others, their softer consistency. The anomaly in the cohesion of their matrix
and the inability of the small KJ grain structures to grow in milk, that is the natural substrate
of this consortium, might suggest that a microbial participant needed to initiate the grain
setting up could lack in the consortium of the mature KJ grain.
The setting up of biofilms by the KJ consortium was moreover a random event,
probably due to the variability of the quantitative microbial composition of the KJ grain.
Starting with a reconstituted consortium made of standardised cultures issued from strains
isolated from the KJ grain, led to a reproducible setting up of a biofilm. Published
descriptions about kefir grains indirectly suggest that such an event might occasionally take
place in situ. A process of grain setting up involving such an intermediate structure, as the
environment in which small KJ grain structures can grow or as a primary structure that
evolves to a mature grain, is therefore a plausible hypothesis.

INTRODUCTION

INTRODUCTION
Le kfir est un lait ferment dont l'existence est antrieure aux premiers textes le

dcrivant. La description de sa gense repose ds lors sur une transmission orale des lments
de son histoire qui reste, aujourd'hui encore, dpourvue d'appuis scientifiques formels. Voici
ce que Beijerinck (1889)1, un microbiologiste du XIXme sicle qui s'intressait aux
fermentations spontanes, en dit :
"Par kfir on entend le ferment du lait des tribus montagnardes du Caucase, et aussi
la boisson rsultant de son action sur le lait. Le vrai nom de cette boisson, toutefois, est
"sakwaska". Pour la clart du discours on dsignera le ferment sous le nom de "grains de
kfir".
Selon toute probabilit, le kfir drive du koumis et en est une forme amliore.
Comment cette drivation s'est faite, c'est ce qu'on ne sait pas d'une manire certaine, mais la
tradition de fabrication d'un tel produit parat digne de foi.
Les anciens peuples du Caucase apportrent un premier perfectionnement la
prparation du koumis en n'employant plus, comme le font encore aujourd'hui les nomades de
l'Asie centrale, du lait de jument mais du lait de vache ou de chvre.
Cette prparation se faisait d'abord dans des vaisseaux de bois en chne qui n'taient
jamais nettoys : aprs la fin de la fermentation, tablie spontanment, on ne les vidait qu'en
partie, puis on ajoutait de nouveau du lait frais. Bien qu'il doive y avoir de grandes chances
pour que, dans le liquide ainsi dilu, la fermentation primitive recommence et se continue de
la mme manire, il parat pourtant s'tre produit frquemment des altrations du produit qui
firent rechercher un procd meilleur et plus sr. Celui-ci fut trouv dans l'emploi de
caillettes de veau ou de mouton, dposes sur le fond des rcipients en chne et restant dans
un tat de repos aussi parfait que possible.
On vit alors se former et l, sur le bois des parois, des grains de kfir qui ensuite
furent reconnus capables de provoquer seuls la fermentation voulue (...). Les grumeaux de

Beijerinck M.W., 1889. Sur le kfir. Arch. Nerl. Sci. Exactes Nat. 23, 428-444. Cit par : Pidoux, 1984.

11

INTRODUCTION

ferment eux-mmes s'accroissent, quoique lentement, et au bout de quelques temps, ils se


sparent en fragments plus petits."
La prparation et la consommation courante de kfir se sont depuis lors tendues une
rgion plus vaste que les montagnes du Caucase et le kfir est aujourd'hui plus largement
considr comme un lait ferment traditionnel des pays de l'Est.
Le kfir serait dans ces pays la boisson la plus populaire... aprs la vodka. Chiffre, la
consommation annuelle moyenne de kfir en Union Sovitique tait estime quelque 5 litres
par personne dans les annes 80 (Kosikowski, 1982). En 1997, les seuls Moscovites en
auraient consomm quotidiennement 400 tonnes (Reynaud, 1997), ce qui quivaut environ
16 litres par personne et par an. Dans ces pays, la demande en kfir en justifiait une
production lchelle industrielle : en 1981, Lacrosse rapporte que des laiteries roumaines
produisaient jusqu' 100.000 litres de kfir par jour, tandis qu'une centaine de laiteries
polonaises en produisaient respectivement 22 et 32 millions de litres en 1982 et en 1988
(Libudzisz & Piatkiewicz, 1990). Aujourdhui, de grands groupes laitiers comme Danone ou
Valio investissent dans des lignes locales de production de kfir (Anonyme Groupe Danone,
2006 ; Anonyme Valio, 2007). Le groupe Danone, qui occupe une place prpondrante dans
le march des produits laitiers frais, a bien compris l'attachement des populations de l'Est au
kfir. Pour tenir compte des habitudes alimentaires locales, Activia, un de ses produits phares,
a t rinterprt : le yaourt au bifidus actif que l'on connat chez nous est ainsi devenu un lait
ferment de type kfir pour le march russe (Anonyme Groupe Danone, 2007).
Le kfir est connu bien au-del des frontires sovitiques, comme en tmoigne la
provenance des grains utiliss dans les tudes publies. Ces grains ont en effet t collects
auprs de particuliers habitant des pays aussi divers que l'Afrique du Sud (Witthuhn et al.,
2004), Taiwan (Kuo & Lin, 1999), l'Argentine (Garrote et al., 1998), le Portugal (Pintado et
al., 1996), l'Espagne (Angulo et al., 1993), la France (Vayssier, 1978), l'Irlande (Rea et al.,
1996), l'Allemagne (Neve, 1992) ou la Belgique (Ninane et al., 2005a). En Belgique, la
Station laitire de l'Etat, aujourd'hui intgre au Dpartement Qualit des productions
agricoles du Centre wallon de Recherches agronomiques (CRA-W, Gembloux, Belgique), en
distribue depuis 1950 (Jamotte, 1974).
Le kfir est connu en d'autres rgions encore, notamment aux Etats-Unis : un
immigrant russe, Mike Smolyansky, y cra en 1986 une manufacture d'aliments "sant",
12

INTRODUCTION

Lifeway Foods, dont la production principale est du kfir (Anonyme Lifeway, 2005). La
perce de ce produit sur le march amricain n'est toutefois pas prcise et il semblerait que,
hors des frontires de l'ex Union Sovitique, la production du kfir soit le plus souvent limite
une chelle domestique ou artisanale. En Belgique, le personnel du Service des ferments du
CRA-W, qui examine systmatiquement la varit des laits ferments proposs par les centres
de distribution, n'a jusqu' prsent que rarement constat la prsence de kfir dans le rayon
"frais" des supermarchs.
1.1

Grains de kfir

1.1.1 Structure des grains de kfir


Les grains de kfir sont dcrits comme tant de "petites masses rides, consistance
glatineuse, de grosseur variable" (Jamotte, 1974), des "granules irrguliers glatineux,
blanchtres ou jauntres, de la taille d'une noix" (Kosikowski, 1982) ou encore de "petites
masses blanches lastiques, en forme de chou-fleur" (Pidoux, 1984). Si lapparence dun
chou-fleur est souvent voque pour dcrire des grains de kfir (Duitschaever et al., 1988 ;
Arihara et al., 1990 ; Neve, 1992 ; Abraham & De Antoni, 1999 ; Kuo & Lin, 1999), elle nen
est pas pour autant exclusive : Marshall & Cole (1984) illustrent des formes varies de grains
(Figure 1.1.1) et en dcrivent comme "pouvant tre drouls en une sorte de feuille".

Figure 1.1.1 : Illustration de grains de kfir (Marshall & Cole, 1984) ; a : grain en forme de
"feuille" ; b : grain en forme de "feuille enroule" ; c & d : grain de forme non dfinie ; e & f :
grain en forme de "chou-fleur". Reproduit avec l'aimable autorisation de la Fdration
internationale de laiterie (FIL-IDF, Building Diamant, 80 Bd A. Reyers, 1030 Bruxelles,
Belgique).

13

INTRODUCTION

La dimension des grains de kfir est variable et homogne ou htrogne au sein dun
lot selon quils sont petits ou plus gros. Les grains de Bottazzi & Bianchi (1980) ont 2 3 mm
de diamtre tandis que ceux de Abraham & De Antoni (1999) ont un diamtre compris entre 1
et 40 mm.
Observs en microscopie lectronique (Bottazzi & Bianchi, 1980 ; Molska et al.,
1980 ; Marshall & Cole, 1984 ; Duitschaever et al., 1988 ; Neve, 1992 ; Rea et al., 1996 ;
Guzel-Seydim et al., 2005), les grains de kfir rvlent la prsence de bactries et de levures
troitement associes une matrice spongieuse (Figure 1.1.2). Tous les grains examins par
ces auteurs reclent des bactries en forme de bacille ; des bactries en forme de coque y sont
par contre sporadiquement observables.

Bactrie (coque)

Levure

Bactrie (bacille)

Matrice

Figure 1.1.2 : Illustration d'un grain de kfir en grossissement de 7000 X (Guzel-Seydim et


al., 2005). Reproduit avec l'aimable autorisation de Wiley-Blackwell Publishing (Oxford,

UK).
Molska et al. (1980) relvent de ces observations microscopiques une absence
d'agencement structur entre les bactries et les levures. Tous s'accordent dire que les
bactries et les levures sont ingalement rparties dans le grain. Toutefois, tandis que certains
observent une plus grande concentration de levures la surface du grain et une plus grande
concentration de bactries l'intrieur du grain (Molska et al., 1980 ; Marshall & Cole, 1984 ;
Guzel-Seydim et al., 2005), d'autres observent le contraire (Bottazzi & Bianchi, 1980 ;
Duitschaever et al., 1988). Rea et al. (1996) confirment cette diffrence de rpartition entre
grains et prcisent qu'elle existe aussi au sein d'un mme grain : qu'elle soit effectue la
surface ou au cur du grain, la rpartition de ces micro-organismes varie en fonction de la

14

INTRODUCTION

coupe examine. Lorsquelles sont observables, les bactries en forme de coque ont toutefois
toujours t localises la surface du grain (Rea et al., 1996 ; Guzel-Seydim et al., 2005).
1.1.2 Microflore des grains de kfir
Composition microbienne qualitative des grains de kfir

Les tudes publies sur la composition microbienne de grains de kfir mettent en


lumire une microflore complexe, souvent compose de plusieurs espces de bactries
lactiques et de levures, parfois associes dautres micro-organismes (Tableau 1.1.1).
La microflore identifie partir de grains de kfir comprend de nombreuses espces,
associes dans les grains de kfir en diverses combinaisons (Tableau 1.1.1). A celles
recenses dans le Tableau 1.1.1, viennent sajouter Lactobacillus crispatus et Lb. gallinarum
identifies partir de grains de kfir dont les compositions microbiennes ne sont pas
clairement prcises (Garbers et al., 2004).
Parmi les bactries lactiques recenses, la majorit des espces appartient au genre
Lactobacillus. Elle inclut des espces homofermentaires : Lb. acidophilus, Lb. crispatus,
Lb. delbrueckii, Lb. gallinarum, Lb. gasseri, Lb. helveticus, Lb. kefiranofaciens ; et des

espces

htrofermentaires

facultatives

ou

obligatoires :

Lb. brevis,

Lb. curvatus,

Lb. fermentum, Lb. kefiri, Lb. paracasei, Lb. parakefiri, Lb. plantarum et Lb. rhamnosus. Les

autres bactries lactiques, reprsentes dans une moindre diversit despces que les
lactobacilles,

appartiennent

aux

genres

homofermentaires

Lactococcus

(L. lactis),

Pediococcus et Streptococcus (St. thermophilus) ainsi qu'aux genres htrofermentaires


Leuconostoc (Ln. mesenteroides et Ln. lactis) et Weissella (W. viridescens).

Les levures isoles partir des grains comprennent de nombreuses espces incapables
de fermenter le lactose : Candida friedrichii, Candida inconspicua, Candida maris, Candida
tenuis, Kazachstania exigua, Pichia fermentans, Saccharomyces cerevisiae, Saccharomyces
unisporus, Torasporula delbrueckii, Yarrowia lipolytica, Zygosaccharomyces sp., et

seulement deux espces capables de fermenter le lactose : Kluyveromyces lactis et


Kluyveromyces marxianus.

15

INTRODUCTION

Tableau 1.1.1, 1re partie : Composition microbienne de grains de kfir. Les diffrentes

espces sont mentionnes sous leur appellation actuelle ; un tableau reprenant les anciennes
dnominations utilises par les diffrents auteurs est donn en Annexe I.
Rfrences

Grain Bactries lactiques


(*)

Levures

Autres groupes
microbiens

Ottogalli et al., 1973

Lactobacillus acidophilus
Lactobacillus brevis
Lactococcus lactis subsp. lactis
"Leuconostoc kephir"

Kluyveromyces lactis

Pas de bactries
actiques

Ottogalli et al., 1973

II

Lactobacillus acidophilus
Lactobacillus brevis
Lactococcus lactis subsp. lactis

Candida tenuis

Acetobacter
pasteurianus

Ottogalli et al., 1973

III

Lactobacillus acidophilus
Lactobacillus brevis
Lactococcus lactis subsp. lactis
"Leuconostoc kephir"

Kluyveromyces lactis
Pas de bactries
Saccharomyces cerevisiae actiques

Ottogalli et al., 1973

IV

Lactobacillus acidophilus
Lactobacillus brevis
Lactococcus lactis subsp. lactis

Kluyveromyces marxianus Bacillus subtilis

Angulo et al., 1993

Lactobacillus fermentum
Lactobacillus kefiri
Lactobacillus paracasei
subsp. tolerans
subsp. paracasei
Lactococcus lactis subsp. lactis

Kluyveromyces lactis
Torulaspora delbrueckii

Angulo et al., 1993

II

Lactobacillus brevis
Lactobacillus rhamnosus
Lactococcus lactis subsp. lactis

Candida friedrichii
Acetobacter sp.
Saccharomyces cerevisiae Micrococcus sp.
Saccharomyces unisporus
Torulaspora delbrueckii

Angulo et al., 1993

III

Lactobacillus brevis
Lactobacillus rhamnosus
Lactococcus lactis subsp. lactis
Leuconostoc sp.
Weissella viridescens

Candida friedrichii
Bacillus sp.
Kazachstania exigua
Micrococcus sp.
Kluyveromyces marxianus
Kluyveromyces lactis
Pichia fermentans
Saccharomyces cerevisiae
Torulaspora delbrueckii

Angulo et al., 1993

IV

Lactobacillus acidophilus
Lactobacillus gasseri
Lactobacillus paracasei
subsp. paracasei
Lactococcus lactis subsp. lactis
Weissella viridescens

Saccharomyces unisporus Acetobacter sp.


Torulaspora delbrueckii
Bacillus sp.

Angulo et al., 1993

Lactobacillus acidophilus
Lactobacillus brevis
Lactococcus lactis subsp. lactis
Streptococcus thermophilus
Weissella viridescens

Kluyveromyces marxianus Micrococcus sp.


Torulaspora delbrueckii

Angulo et al., 1993

VI

Lactobacillus brevis
Lactococcus lactis subsp. lactis

Saccharomyces cerevisiae Bacillus sp.

(*) Dnomination, donne par les auteurs, du grain sous objet.

16

Acetobacter sp.
Escherichia coli

INTRODUCTION

Tableau 1.1.1, 2me partie : Composition microbienne de grains de kfir. Les diffrentes

espces sont mentionnes sous leur appellation actuelle ; un tableau reprenant les anciennes
dnominations utilises par les diffrents auteurs est donn en Annexe I.
Rfrences

Grain Bactries lactiques


(*)

Levures

Autres groupes
microbiens

Angulo et al., 1993

VII

Lactobacillus brevis
Leuconostoc sp.
Streptococcus thermophilus
Weissella viridescens

Saccharomyces cerevisiae Bacillus sp.


Torulaspora delbrueckii
Micrococcus sp.

Angulo et al., 1993

VIII

Lactobacillus brevis
Lactobacillus paracasei
subsp. tolerans
Lactococcus lactis subsp. lactis
Pediococcus sp.

Kluyveromyces marxianus Bacillus sp.


Kluyveromyces lactis
Saccharomyces cerevisiae
Torulaspora delbrueckii

Pintado et al., 1996

Lactobacillus kefiri
Lactococcus lactis subsp. lactis

Saccharomyces unisporus Pas de bactries


actiques

Takizawa et al., 1998

Lactobacillus kefiranofaciens
subsp. kefiranofaciens
subsp. kefirgranum
Lactobacillus kefiri
Lactobacillus parakefiri
(**)

Pas recherches

Lin et al., 1999a

Lactobacillus helveticus
Leuconostoc mesenteroides

Kluyveromyces marxianus Pas recherchs


Pichia fermentans

Pas recherchs

Garrote et al., 2001

Lactobacillus kefiri
Lactobacillus plantarum
Lactococcus lactis subsp. lactis
Leuconostoc mesenteroides

Saccharomyces sp.

Garrote et al., 2001

II

Lactobacillus kefiri
Lactobacillus parakefiri
Lactobacillus plantarum
Lactococcus lactis subsp. lactis

Kluyveromyces marxianus Acetobacter sp.


Saccharomyces sp.

Garrote et al., 2001

III

Lactobacillus kefiri
Lactobacillus plantarum
Lactococcus lactis subsp. lactis

Saccharomyces sp.

Acetobacter sp.

Garrote et al., 2001

IV

Lactobacillus kefiri
Lactobacillus plantarum
Lactococcus lactis subsp. lactis

Saccharomyces sp.

Acetobacter sp.

Lactobacillus brevis
Lactobacillus helveticus
Lactobacillus paracasei
subsp. paracasei
Lactobacillus delbrueckii
subsp. bulgaricus
Lactococcus lactis subsp. lactis
Streptococcus thermophilus

Candida inconspicua
Pas recherchs
Candida maris
Kluyveromyces marxianus
Saccharomyces cerevisiae

Simova et al., 2002

Acetobacter sp.

(*) Dnomination, donne par les auteurs, du grain sous objet.


(**) Les bactries lactiques appartenant d'autres genres n'ont pas t recherches.

17

INTRODUCTION

Tableau 1.1.1, 3me partie : Composition microbienne de grains de kfir. Les diffrentes

espces sont mentionnes sous leur appellation actuelle ; un tableau reprenant les anciennes
dnominations utilises par les diffrents auteurs est donn en Annexe I.
Rfrences

Grain Bactries lactiques


(*)

Levures

Autres groupes
microbiens

Lactobacillus delbrueckii
subsp. delbrueckii

Zygosaccharomyces sp.

Pas de bactries
actiques ou
propioniques

Witthuhn et al., 2004 II

Lactobacillus delbrueckii
subsp. delbrueckii

Nant

Pas de bactries
actiques ou
propioniques

Witthuhn et al., 2004 III

Lactobacillus curvatus
Leuconostoc lactis

Kluyveromyces marxianus Pas de bactries


Yarrowia lipolytica
actiques ou
propioniques

Witthuhn et al., 2004 IV

Lactobacillus delbrueckii
subsp. lactis

Kluyveromyces marxianus Pas de bactries


actiques ou
propioniques

Witthuhn et al., 2004 V

Lactobacillus delbrueckii
subsp. delbrueckii
Lactococcus lactis subsp. lactis

Yarrowia lipolytica

Witthuhn et al., 2004 VI

Lactobacillus delbrueckii
subsp. lactis

Kluyveromyces marxianus Pas de bactries


Saccharomyces cerevisiae actiques ou
Yarrowia lipolytica
propioniques

Witthuhn et al., 2004 VII

Leuconostoc mesenteroides

Kazachstania exigua

Pas de bactries
actiques ou
propioniques

Witthuhn et al., 2004 VIII

Lactobacillus fermentum
Leuconostoc lactis

Kazachstania exigua
Zygosaccharomyces sp.

Pas de bactries
actiques ou
propioniques

Mainville et al., 2006

Lactobacillus kefiranofaciens
Lactobacillus kefiri
Lactococcus lactis
subsp. lactis
subsp. cremoris
Leuconostoc mesenteroides
subsp. cremoris

Pas recherches

Pas recherchs

Wang et al., 2006

Lactobacillus sp.

Pas recherches

Acinetobacter sp.
Enterobacter sp.
Sphingobacterium sp.

Chen et al., 2008

Lactobacillus kefiranofaciens
Lactobacillus kefiri
Lactococcus lactis
Leuconostoc mesenteroides

Pas recherches

Pseudomonas sp.

Hsinchu

Witthuhn et al., 2004 I

(*) Dnomination, donne par les auteurs, du grain sous objet.

18

Pas de bactries
actiques ou
propioniques

INTRODUCTION

Tableau 1.1.1, 4me partie : Composition microbienne de grains de kfir. Les diffrentes

espces sont mentionnes sous leur appellation actuelle ; un tableau reprenant les anciennes

Chen et al., 2008

Chen et al., 2008

Levures

Autres groupes
microbiens

Mongolia

Rfrences

Lactobacillus kefiranofaciens
Lactobacillus kefiri
Lactococcus lactis
Leuconostoc mesenteroides

Pas recherches

Escherichia coli
Pseudomonas sp.

Ilan

dnominations utilises par les diffrents auteurs est donn en Annexe I.


Grain Bactries lactiques
(*)

Lactobacillus kefiranofaciens
Lactobacillus kefiri
Lactococcus lactis
Leuconostoc mesenteroides

Pas recherches

Escherichia coli
Pseudomonas sp.

(*) Dnomination, donne par les auteurs, du grain sous objet.

Les autres micro-organismes, identifis occasionnellement dans des grains de kfir,


comprennent des bactries d'intrt alimentaire : Acetobacter sp. et Micrococcus sp., et des
bactries contaminantes : Acinetobacter sp., Bacillus sp., Enterobacter sp., Escherichia coli,
Pseudomonas sp. et Sphingobacterium sp.
Composition microbienne quantitative des grains de kfir

Du point de vue quantitatif, les grains de kfir renferment un nombre variable de


bactries lactiques et de levures. Les valeurs extrmes dabondance de ces deux groupes
microbiens sont publies par Garrote et al. (2001) et Guzel-Seydim et al. (2005) ; elles sont
de 1,5 . 108 ufc.g-1 et 109 ufc.g-1 pour les bactries lactiques et de 106 ufc.g-1 et 2,8 . 108 ufc.g-1
pour les levures. Lorsque les diffrentes composantes des bactries lactiques sont dnombres
individuellement, les quantits chiffres de lactobacilles sont comprises entre 1,2 . 107 ufc.g-1
et 1,4 . 108 ufc.g-1 et celles de coques lactiques entre 1,0 . 106 ufc.g-1 et 1,3 . 107 ufc.g-1
(Abraham & De Antoni, 1999).
La flore bactrienne lactique des grains de kfir est prsente comme dominante par
rapport celle des levures (Kosikowski, 1982). La comparaison des donnes publies
relatives aux dnombrements des diffrents groupes microbiens montre queffectivement la
population de bactries lactiques domine, ou est tout le moins prsente en quantit
quivalente celle des levures, dans la plupart des grains de kfir tudis (Vayssier, 1978 ;
Molska et al., 1980 ; Angulo et al., 1993 ; Pintado et al., 1996, Garrote et al., 2001 ; Witthuhn
19

INTRODUCTION

et al., 2004 ; Guzel-Seydim et al., 2005). Chiffre, la reprsentativit de cette population est

alors variable : comprise entre 83 % et 90 % de la flore totale de grains bulgares (Simova et


al., 2002), la population de bactries lactiques est 1000 fois plus leve que celle des levures

dans des grains turques (Guzel-Seydim et al., 2005). Dans certains grains toutefois, la
population des levures est plus abondante que celle des bactries lactiques. Cest le cas pour
trois des huit grains dorigines diffrentes tudis par Angulo et al. (1993) et pour quatre des
huit grains tudis par Witthuhn et al. (2004).
La flore bactrienne des grains de kfir est le plus souvent domine par des
lactobacilles (Molska et al., 1980 ; Pintado et al., 1996 ; Garrote et al., 1997 ; Abraham & De
Antoni, 1999) mais peut tre domine par des coques lactiques. Dans ce cas, les coques
lactiques reprsentent jusqu' 65 % de la flore totale du grain (Simova et al., 2002).
La composition microbienne de grains de kfir ninclut pas ncessairement des
espces appartenant chacun des types fermentaires de lactobacilles : certaines comprennent
exclusivement des lactobacilles htrofermentaires et dautres, un unique lactobacille
homofermentaire (Tableau 1.1.1). Toutefois, lorsque des spcimens appartenant chacun des
types fermentaires de lactobacilles sont quantifis dans des grains, les homofermentaires sont
plus abondants que les htrofermentaires. Kandler & Kunath (1983) dnombrent ainsi 90 %
de lactobacilles homofermentaires dans une population de lactobacilles isole de grains de
diverses origines, Takizawa et al. (1998) en dnombrent autant dans une population de
lactobacilles isole de grains dune unique origine, tandis que Simova et al. (2002) en
dnombrent entre 70 et 87 % dans des populations de lactobacilles isoles individuellement de
diffrents grains bulgares.
La flore bactrienne non lactique des grains de kfir, considre comme contaminante,
a rarement fait l'objet d'une approche quantitative... publie ! Dans celle de Angulo et al.
(1993), les bactries non lactiques, toutes espces confondues, reprsentent de 6,6 %
33,3 % de la flore des grains. Parmi la flore bactrienne non lactique identifie dans des
grains de kfir, figurent des bactries actiques que Garrote et al. (2001) ont caractrises
distinctement : leur nombre slve 2,5 . 105 - 3,6 . 105 ufc.g-1 de grains.

20

INTRODUCTION

1.1.3 Matrice des grains de kfir

Les micro-organismes contribuent, selon Abraham & De Antoni (1999), concurrence


de 0,9 % la masse (humide) des grains de kfir. Autrement dit, la matrice des grains en
constitue la majeure partie.
Les donnes relatives la composition chimique des grains de kfir traduisent une
substance essentiellement constitue deau, dont la fraction non aqueuse contient
principalement des sucres et des protines. La teneur en eau des grains de kfir varie en effet
entre 80 % et 90 % de leur poids tandis que les fractions polysaccharidique et protique
varient respectivement entre 36 % et 54 % et entre 28 % et 35 % de leur matire sche
(Ottogalli et al., 1973 ; Garrote et al., 2001).
La matrice des grains de kfir contient un polysaccharide spcifique, jamais isol dun
autre substrat, et nomm pour cette raison kfirane. Les auteurs lorigine de son
identification, la Rivire et al. (1967), estiment que le kfirane constitue prs de la moiti de
la substance cohsive des grains.
Le kfirane est un polysaccharide soluble dans leau qui a la particularit de glifier en
prsence dalcool (Mukai et al., 1991). Il se caractrise par une rpartition binaire ou
uniforme en chromatographie, correspondant des composants de poids molculaire
d'environ 1.106 et 4.106 ou 107 daltons selon la source, Yokoi et al. (1990) ou Piermaria et al.
(2008) respectivement. D'aprs Kooiman (1968), le kfirane est compos de quantits
quimolaires de D-glucose et de D-galactose agencs en un rseau d'units de six sucres
(Figure 1.1.3).

--D-Gp-(16(2))-

6)--D-Gp-(12(6))--D-Galp-(14) --D-Galp-(13) --D-Galp-(14) --D-Gp-(1

Figure 1.1.3 : Illustration de l'unit de six sucres, du D-glucose (D-G) ou du D-galactose (D-

Gal), rpte dans la structure du kfirane telle que propose par Kooiman (1968).

21

INTRODUCTION

Le kfirane ne serait pas le seul constituant de la matrice des grains de kfir dont la
production a une origine microbienne. Abraham & De Antoni (1999) en mettent lhypothse
pour des protines. Dans leurs travaux de caractrisation des protines de grains de kfir, ces
auteurs mettent en vidence la prsence, dans les grains, de protines qui par leur masse
molculaire leve ne peuvent provenir des protines du lait ou de leur dgradation.
1.1.4 Formation du grain de kfir

Jamais un grain na pu tre constitu in vitro partir de cultures microbiennes. Les


grains sont jusqu prsent reproduits par fragmentation (Koroleva, 1988). Naturellement ou
mcaniquement, des morceaux se dtachent dun grain existant et grossissent pour fournir
leur tour de petits grains.
Le mcanisme de formation des grains de kfir reste ce jour mconnu. Celui dautres
structures microbiennes, les biofilms, a t, par leur profusion et la pathognie de certains,
plus tudi et est document.
Dans la nature, le dveloppement de bactries en film flottant sur une surface liquide
ou coll une interface solide est frquent ; la matire visqueuse qui couvre les vases et la
plaque dentaire en sont des exemples courants. Dans ces structures, les bactries sont
assembles dans une matrice de polymres quelles synthtisent. Les matrices des biofilms se
composent dlments communs dont notamment des exopolysaccharides (Lasa, 2006). Ces
exopolysaccharides bactriens ne sont gnralement pas utiliss comme source nergtique
par les micro-organismes qui les produisent ; la plupart d'entre-eux sont incapables de
cataboliser le polymre qu'ils synthtisent. Les exopolysaccharides auraient plutt une
fonction cologique de protection vis--vis de facteurs de stress environnementaux et
dadhsion cellulaire (Ruas-Madiedo et al., 2002). Dans le processus de formation des
biofilms, ils jouent un rle prpondrant au niveau de l'adhsion des bactries aux surfaces
qu'elles colonisent (Cerning, 1990 ; Cammarota & Sant'Anna, 1998 ; Lasa, 2006).
Dans le domaine alimentaire, les proprits agglutinantes des bactries actiques sont
empiriquement bien connues au travers de la mre de vinaigre, ce ferment daspect glatineux
qui se forme spontanment dans le vinaigre. Elles s'expriment galement dans le kombucha,
le th sucr ferment par des bactries actiques et des levures. L'association microbienne du
22

INTRODUCTION

kombucha est fixe dans le gel cellulosique form la surface de la boisson et produit par les
bactries actiques (Chen & Liu, 2000 ; Teoh et al., 2004).
Un rle similaire a t tabli dans un contexte d'agrgation microbienne plus proche de
celle des grains de kfir que les biofilms : celui des grains de kfir dit sucr ou Gingebeer
plant. Ces petites masses lastiques translucides, composes de bactries lactiques et de
levures, sont connues pour fermenter de l'eau sucre. Lactobacillus hilgardii, un membre du
consortium microbien de ces grains, produit un exopolysaccharide dont les proprits
agglutinantes ont t tablies. Les bactries sont dans ce cas immobilises dans le gel de
dextrane qu'elles produisent et forment des grains (Pidoux, 1989 ; Pidoux et al., 1992).
Les micro-organismes lorigine de la synthse de kfirane, lexopolysaccharide
bactrien identifi dans les grains de kfir, sont des lactobacilles. Observs en microscopie
dans des extraits de grains de kfir, les micro-organismes enrobs dune gangue mucodale en
ont la morphologie caractristique (la Rivire et al., 1967). Paralllement, les isolats de grains
de kfir capables de produire du kfirane en culture pure sont tous des lactobacilles (la Rivire
et al., 1967 ; Toba et al., 1986 ; Toba et al., 1987 ; Yokoi et al., 1990). Ceux isols par les

quipes de la Rivire et de Toba ont fait lobjet dune identification plus prcise et ont t
assigns deux taxons : Lactobacillus brevis (la Rivire et al., 1967) et Lb. kefiranofaciens
subsp. kefiranofaciens (Fujisawa et al., 1988 ; Vancanneyt et al., 2004) respectivement.
Ottogalli et al. (1973) attribuent cette proprit Lb. acidophilus par dduction, aprs examen
de la morphologie des cellules microbiennes identifies dans le grain de kfir tudi, mais une
production de kfirane par ces bactries isoles en culture pure na jamais t tablie.
Si les lactobacilles sont lorigine de la synthse du kfirane, les levures en stimulent
la production. En 1932 dj, des chercheurs russes avaient soulign l'influence favorable
qu'exercent les levures sur l'activit mtabolique des bactries lactiques du kfir et sur leur
croissance (Koroleva, 1988). En 1967, la Rivire et son quipe observent que la prsence de
levure conditionne le dveloppement de la souche de Lactobacillus brevis qu'ils ont isole de
grains de kfir et qui produit du kfirane. Incapable de se dvelopper dans du lait non
supplment, cette souche y pousse bien lorsque le lait est inocul avec une levure isole de
grains de kfir. Ils prcisent que ces conditions conduisent une bonne formation de gangue
de kfirane autour des cellules bactriennes, proprit qui n'est pas observable dans dautres
milieux de culture. En 2003, Schoevers & Britz confirment que l'ajout d'extrait de levure au
23

INTRODUCTION

milieu de culture conduit une meilleure croissance des grains et une plus grande
production de polymres extracellulaires. Indpendamment, l'quipe de Cheirsilp (2003a et
2003b) montre que Lactobacillus kefiranofaciens produit plus de kfirane en co-culture avec
Saccharomyces cerevisiae qu'en culture pure, mme lorsque la levure est inactive. Elle en

dduit que l'interaction l'origine de cette stimulation de la production de kfirane est lie
un contact physique. Aujourd'hui, c'est en prsence de S. cerevisiae que l'optimisation des
conditions de production de kfirane par Lb. kefiranofaciens est envisage (Tada et al., 2007).
Un autre lment commun aux biofilms est la prsence, la surface des bactries, de
protines de haut poids molculaire qui leur confrent la capacit former un biofilm. Ces
protines associes aux biofilms (Bap) promeuvent ladhsion primaire des cellules aux
surfaces abiotiques et ladhsion des cellules bactriennes entre-elles. Elles sont capables de
provoquer un mcanisme de formation indpendant de celui de lexopolysaccharide et
confrent aux biofilms une plus grande fermet (Lasa, 2006). Les protines de haut poids
molculaire mises en vidence dans des grains de kfir par Abraham & De Antoni (1999)
pourraient avoir une origine microbienne. La confirmation de cette hypothse et leur rle dans
la formation du grain de kfir restent toutefois en suspens.
1.2

Prparation et qualit du kfir

1.2.1 Contribution des diffrents groupes microbiens aux transformations du lait


Acidification du lait

L'activit des bactries lactiques conduit principalement l'acidification du lait. Les


bactries lactiques se caractrisent en effet par la proprit de produire de l'acide lactique
partir de sucre, disponible sous la forme de lactose dans le lait.
Les espces homofermentaires ont un plus grand pouvoir acidifiant que les espces
htrofermentaires. Elles fermentent les sucres presque exclusivement en acide lactique tandis
que les espces htrofermentaires les fermentent en deux produits terminaux : l'acide lactique
et l'acide actique ou l'thanol. Pour tre complet, signalons que cette fermentation
"htrolactique" s'accompagne d'un dgagement de CO2.
La contribution de chacune d'elles l'acidification du lait dpend de leur aptitude se
dvelopper dans cet environnement qui volue en cours de fermentation.
24

INTRODUCTION

Dans le lait et temprature ambiante, les lactocoques se dveloppent rapidement et


produisent rapidement de l'acide lactique. Ainsi, dans ces conditions, ils en produisent environ
8 g.l-1 et abaissent le pH environ 4,6 en 15 20 heures (Teuber, 1995). Leur croissance est
ensuite inhibe par l'acidit ambiante.
Dans les mmes conditions, Lactobacillus casei, un lactobacille homofermentaire, en
produit 6 g.l-1 seulement en 24 heures (Assadi et al., 2000). Toutefois, lors de la fermentation
du kfir, son dveloppement est stimul par l'acidification rsultant de l'activit des
lactocoques. Les lactobacilles sont en effet acidophiles ; le pH auquel ils se dveloppent le
mieux se situe entre 4,0 et 4,5 (Rozier et al., 1985). Par ailleurs, leur croissance peut aussi tre
stimule par la prsence de levures (Gueguen & Schmidt, 1992).
C'est malgr tout aux lactocoques que Koroleva (1988) attribue le rle d'acidifiant
dans la fermentation du kfir.
Synthse de composs aromatisants

Les bactries lactiques produisent galement des molcules participant l'arme du


kfir : actaldhyde, actone, diactyle et butanediol.
L'actaldhyde est un mtabolite intermdiaire de la fermentation "htrolactique" du
lactose. Il est normalement rduit en thanol chez les bactries lactiques msophiles mais peut
tre excrt comme produit final par certaines bactries thermophiles dpourvues d'alcooldhydrognase. C'est le cas pour Streptococcus thermophilus que l'on retrouve parfois dans
les grains de kfir.
L'actone, le diactyle et le butanediol sont parfois produits la place de l'acide
lactique dans le mtabolisme des sucres mais leur principal prcurseur est l'acide citrique.
De nombreuses bactries lactiques sont capables de dgrader l'acide citrique du lait en
acide actique, en CO2 et, pour certaines d'entre-elles, en acide formique ou en composs
aromatisants : actone, diactyle et butanediol. La plupart des leuconostocs "laitiers" et un
biovar de Lactococcus lactis fermentent l'acide citrique par cette dernire voie. Dans le kfir,
les composs aromatisants qui en sont issus sont attribus l'activit des leuconostocs
(Koroleva, 1988 ; Rea et al., 1996).

25

INTRODUCTION

Les leuconostocs "laitiers" se dveloppent le mieux un pH proche de celui du lait et


sont inhibs en milieu acide. Leur croissance s'arrte lorsque le pH interne de la cellule atteint
5,4-5,7 (Mc Donald et al., 1990). Le pH externe d'inhibition dpend de la nature de l'acide
organique prsent (Hemme & Foucaud-Scheunemann, 2004). En prsence d'acide lactique,
des souches sauvages de Leuconostoc sp., isoles de fromage au lait cru, ne se dveloppent
quasiment plus un pH de 4,6 (Snchez et al., 2005). L'activit des leuconostocs "laitiers"
aura ds lors lieu en dbut de fermentation et sera d'autant plus importante que l'acidification
du lait est lente.
Synthse dagents texturants

Les agents texturants dorigine microbienne sont des polysaccharides de poids


molculaire lev appels exopolysaccharides en rfrence au fait quils sont exocellulaires,
c'est--dire scrts dans le milieu. La synthse d'exopolysaccharide est un mtabolisme
rpandu chez les bactries et rare chez les levures (De Vuyst et al., 2001).
Les lactobacilles Lactobacillus kefiranofaciens subsp. kefiranofaciens et Lb. brevis
sont l'origine de la synthse de kfirane, lexopolysaccharide typique du kfir (paragraphe
1.1.4). Dautres micro-organismes du kfir sont toutefois susceptibles de produire des
exopolysaccharides et de contribuer sa texture. Les souches laitires productrices
dexopolysaccharides concernent plusieurs espces qui peuvent figurer parmi le consortium
microbien de grains de kfir : Leuconostoc mesenteroides, Streptococcus thermophilus,
Lactococcus lactis subsp. cremoris, Lactobacillus acidophilus, Lb. delbrueckii subsp.
bulgaricus, Lb. helveticus, Lb. paracasei et Lb. rhamnosus (De Vuyst et al., 2001 ; Monsan et
al., 2001). Koroleva (1988) attribue par ailleurs un rle texturant aux bactries actiques du

kfir.
Les bactries lactiques msophiles, comme la plupart de celles rencontres dans le
kfir, produisent gnralement un maximum d'exopolysaccharides en conditions sub-ltales ;
le taux de production dexopolysaccharide est alors indpendant de la croissance bactrienne
(De Vuyst et al., 2001). Toutefois, dans le cas de Lactobacillus kefiranofaciens subsp.
kefiranofaciens et de Lb. rhamnosus la production dexopolysaccharide en milieu de synthse

est corrle la croissance bactrienne de la souche tudie (Cheirsilp et al., 2001a ;


Bergmaier, 2002). Dans l'hypothse o cette corrlation se vrifie dans le milieu naturel, le

26

INTRODUCTION

lait, le taux de production dexoploysaccharide est li aux facteurs influenant la croissance


bactrienne.
Les exopolysaccharides produits par les diffrents micro-organismes ont des pouvoirs
texturant variables qui dpendent notamment de leur composition, de leur masse molculaire,
de leur conformation spatiale et de leur habilit interagir avec les protines du lait (Duboc &
Mollet, 2001). Par ailleurs, dans le lait, l'incorporation de quantits croissantes de polymre
ne conduit pas ncessairement une amlioration de la texture c'est--dire une augmentation
de la viscosit du lait ferment (Laws & Marshall, 2001).
Lipolyse

Les micro-organismes du kfir ont une activit lipolytique qui se traduit par la
libration d'acides gras volatils participants l'arme de la boisson (Koroleva, 1988). La
plupart des micro-organismes sont capables de scrter des lipases et de participer
l'hydrolyse de la matire grasse. Toutefois, les levures ont en gnral une activit lipolytique
suprieure celle des bactries lactiques (Talon & Montel, 1994).
Synthse d'acide linolique conjugu

L'acide linolique conjugu (CLA) est un constituant de la matire grasse laitire


susceptible de prsenter un intrt particulier pour la sant humaine (Khanal, 2004 ; Rainer &
Heiss, 2004 ; Pariza, 2004).
La synthse du CLA prsent naturellement dans le lait est essentiellement le fruit de
l'activit des bactries du rumen. Une synthse de CLA peut avoir lieu lors de la fermentation
du lait et de la maturation des fromages. Une contribution microbienne la synthse de CLA
dans ces produits laitiers est alors pressentie. Diverses bactries lactiques, dont certaines
souches provenant de ferments lactiques, sont effectivement capables de synthtiser du CLA
in vitro (Jiang et al., 1998 ; Lin et al., 1999b ; Alonso et al., 2003).

Les espces bactriennes de grains de kfir dont des reprsentants sont capables de
synthtiser du CLA in vitro sont Lactobacillus acidophilus, Lb. delbrueckii, Lactococcus
lactis et Streptococcus thermophilus (Lin et al. 1999b).

27

INTRODUCTION

Fermentation alcoolique

Enfin, les levures sont rputes pour leur aptitude produire de l'alcool et du CO2 par
fermentation des sucres en absence d'oxygne. Cette caractristique, exploite dans la
prparation du kfir, contribue fortement la spcificit de ce lait ferment.
Les levures sont plutt acidophiles - leur optimum de croissance avoisine en gnral
un pH de 5,5-6,0 (Gueguen & Schmidt, 1992) - et se dveloppent lentement. Les
transformations rsultant de leur activit auront ds lors cours en fin de fermentation.
Celles-ci sont surtout dveloppes par une prolongation de la fermentation une temprature
d'incubation plus basse. Les levures sont en effet moins thermophiles que les bactries
lactiques.
1.2.2 Procds de fabrication
Qualit du lait

Originellement, le kfir tait prpar partir de lait de vache, de chvre ou de brebis


(Kosikowski, 1982). Il est aujourd'hui gnralement prpar partir de lait de vache.
Les grains de kfir sont galement capables de fermenter des matrices vgtales dont
du jus de soya (Abraham & De Antoni, 1999) mais le produit obtenu nest alors plus du kfir
au sens premier du terme.
Le lait est utilis entier ou crm selon le got ou la ncessit dittique. Un lait
entier donnera un kfir plus pais et onctueux qu'un lait crm (Lacrosse, 1981). Son odeur
et sa flaveur seront plus crmeuses et plus douces, moins acides (Muir et al., 1999).
Le traitement thermique du lait joue un rle important dans la qualit du kfir. Il a une
double fonction : hyginique et texturante. La chaleur, en dnaturant les protines du lait et en
dispersant les micelles de casine, amliore en effet la stabilit et la viscosit du caill et
rduit la synrse (Zourari & Anifantakis, 1988). Le lait est, selon Libudzisz & Piatkiewicz
(1990), de prfrence pasteuris temprature leve pendant une priode prolonge, par
exemple 85-87 C pendant 10 minutes.
L'homognisation du lait amliore galement la texture du produit et permet d'viter
une monte de la crme (Zourari & Anifantakis, 1988).
28

INTRODUCTION

Prparation traditionnelle

Traditionnellement, le lait est ferment partir de grains de kfir. En production


domestique, le lait est incub temprature ambiante. La quantit de grains ajouts au lait et
la dure d'incubation sont ajustes en fonction de la temprature de la pice et du produit final
souhait : plus ou moins acide, mousseux, visqueux... Chiffre, cette pratique se traduit par
un taux d'ensemencement variant de 2 % 10 % et une incubation de 18 24 heures une
temprature comprise entre 20 C et 25 C (Wszolek et al., 2001). Les grains de kfir sont
alors spars du lait ferment l'aide d'un tamis. Rincs l'eau, ils peuvent tre rutiliss pour
d'autres ensemencements.
Le lait ferment peut ensuite subir une maturation destine favoriser le
dveloppement et l'activit des levures. Le produit final sera alors plus alcoolis et ptillant et
aura un got de levure plus prononc. Dans cette optique, le lait est transvas dans un
rcipient hermtique et incub en cave (8 C 10 C). La dure d'incubation dpend du degr
de maturation souhait. Elle est de minimum 8 10 heures et peut durer jusqu' 24, 36 voire
48 heures (Lacrosse, 1981 ; Wszolek et al., 2001). La maturation est ensuite arrte par
refroidissement.
Ce procd simple est matriellement peu pratique mettre en uvre pour une
production industrielle de kfir. D'autant plus que, pour la prservation des grains, le matriel
ne peut contenir d'alliage mtallique (Libudzisz & Piatkiewicz, 1990).
Procds industriels

En production industrielle, le lait est le plus souvent inocul avec un levain. La


difficult majeure dans ce type de production est d'obtenir un levain de composition
microbienne quivalente celle du grain ou, tout du moins, conduisant un produit similaire
au kfir traditionnel.
Prparation du levain

Le levain utilis dans la mthode russe, dcrite par Koroleva (1988), est prpar par
fermentation du lait partir de grains. Cette mthode permet de prserver au mieux la
complexit microbienne du ferment original. Toutefois, la balance microbienne du ferment
original semble difficile reproduire. Les conditions de culture sont pour ce point
dterminantes. Un ensemencement plus lev conduit en effet une balance microbienne plus
29

INTRODUCTION

pauvre en coques et en levures qu'un ensemencement plus faible. Paralllement, une


temprature d'incubation leve (25 C) favorise le dveloppement des lactobacilles et des
bactries actiques tandis qu'une temprature plus basse (18 C 20 C) favorise celui des
coques lactiques. Enfin, l'homognisation du lait pendant la fermentation a pour effet
d'accrotre la population des lactocoques et des levures tandis quun rinage hebdomadaire
des grains a pour effet de diminuer celle de tous les groupes bactriens.
Les conditions de culture conduisant, selon Koroleva (1988), au dveloppement
optimal de tous les groupes microbiens prsents dans le grain sont : un ensemencement
compris entre 2 % et 3 %, une incubation de 24 heures 18-20 C et 2 3 agitations pendant
la fermentation.
Elles ne sont cependant pas ncessairement le garant d'une balance microbienne
quivalente celle du grain. Dans ces conditions d'ensemencement et d'incubation, du lait
ferment partir de grains bulgares prsente en effet un appauvrissement en lactobacilles et
en levures (Simova et al., 2002). Au cours de cette exprimentation, l'agitation pendant la
fermentation semble faire dfaut. Si l'absence d'agitation peut expliquer l'appauvrissement en
levures, ce n'est pas le cas pour les lactobacilles. Cette manipulation n'a en effet pas
d'influence sur le dveloppement de ce groupe microbien (Koroleva, 1988).
Dans la pratique, les conditions d'ensemencement et d'incubation pour la prparation
du levain sont trs variables (Pidoux, 1984). Dans une manufacture roumaine par exemple, le
lait est ensemenc avec 1 % de grains et incub pendant 24 heures 18-20 C (Lacrosse,
1981).
Pour obtenir de grandes quantits d'inoculant, le levain est parfois multipli dans du
lait. Les conditions d'incubation du lait prconises par Koroleva (1988) sont les mmes que
prcdemment. Cependant, si ces conditions conduisent un dfaut de balance, il sera
amplifi dans le levain "de seconde gnration". Ainsi, l'appauvrissement en lactobacilles
observ dans le lait ferment partir de grains bulgares est accentu aprs une seconde culture
(Simova et al., 2002).
Dans la pratique, les conditions appliques peuvent tre trs diffrentes. En Pologne
par exemple, le levain "de seconde gnration" est obtenu par incubation 20 C pendant 20

30

INTRODUCTION

heures d'un lait ensemenc avec 3 % dune culture-mre, elle-mme issue de la fermentation
d'un lait ensemenc avec 10 % de grains et incub 20 C pendant 24 heures.
Dans les annes 80, l'industrie polonaise a commenc remplacer, dans ce procd,
les grains de kfir par une culture lyophilise. Celle-ci est prpare partir de lait ferment
par des grains de kfir puis standardis 10 % de la flore totale par addition de levures isoles
de grains (Libudzisz & Piatkiewicz, 1990).
Enfin, Vayssier (1978) rapporte avoir analys un levain polonais uniquement constitu
de Streptococcus lactis et Streptococcus diacetylactis (il s'agit probablement de Lactococcus
lactis et de son biovar diacetylactis). Au vu de la pauvret microbienne de ce levain, on peut

supposer qu'il a t reconstitu partir de cultures pures. Cependant, les kfirs prpars
partir de ce type de levain prsentent des caractristiques sensorielles diffrentes du kfir
traditionnel (Muir et al., 1999). Une tude rcente portant sur la formulation d'un ferment
partir de cultures isoles de grains de kfir a montr que, malgr un nombre lev d'espces
mises en uvre (7 bactries et 4 levures) et le soin apport leur balance dans le produit fini,
le got du kfir obtenu de cette faon s'carte trop de la boisson originelle pour tre
acceptable (Assadi et al., 2000).
Prparation du kfir

L'utilisation d'un levain pour la production de kfir impose une adaptation des
conditions de fermentation par rapport celles utilises traditionnellement. Les levains
provoquent en effet une acidification du lait plus rapide que les grains (Bourounoff, 1933)2.
Ainsi, dans une manufacture roumaine, le lait ensemenc avec 5 % de levain est incub
pendant 24 heures une temprature de 10 C-12 C seulement (Lacrosse, 1981). En Pologne,
la temprature d'incubation est plus proche de la tradition : elle varie selon les saisons de
19 C-20 C en hiver 21 C-23 C en t (Libudzisz & Piatkiewicz, 1990). Le taux
d'ensemencement est ajust pour compenser les variations saisonnires de la temprature
d'incubation : 5 % 7 % en hiver et 2 % 3 % en t. L'adaptation porte ici essentiellement
sur la dure d'incubation qui est plus courte. Elle est de 6-8 heures ou de 14 heures selon
qu'elle est ralise en tank ou en bouteilles. La fermentation du lait est en effet ralise en
tank ou directement dans les conteneurs destins la distribution du produit.

Bourounoff, 1933. Recherches sur le kfir. Thse de l'Ecole vtrinaire de Lyon. Cit par : Pidoux, 1984.

31

INTRODUCTION

La maturation du lait acidifi, lorsquelle est pratique, se fait en bouteille, dans les
mmes conditions d'incubation qu'en production traditionnelle.
1.2.3 Composition du lait ferment

La qualit du kfir, tant au niveau du got que de sa valeur nutritionnelle ou


dittique, dpend de celle du lait et des transformations rsultant de l'activit des diffrents
micro-organismes prsents dans le ferment. La diversit de la composition microbienne des
ferments et des pratiques dterminant leur dveloppement engendre une grande diversit de
kfirs. Les traits communs ces kfirs, mais dvelopps avec des intensits variables, sont
l'acidification, la prsence d'alcool et d'un fond levur, ainsi qu'une texture onctueuse et
mousseuse. Au niveau sensoriel, le kfir traditionnel est dcrit comme tant plus onctueux et
plus crmeux mais aussi plus acide et plus amer qu'un yaourt, lait ferment mieux connu chez
nous (Muir et al., 1999).
La qualit du kfir dpend avant tout de sa composition chimique et c'est ds lors au
travers de celle-ci que nous tenterons de la caractriser.
Acides organiques

L'acide lactique du kfir est presque exclusivement sous la forme de son isomre L(+),
forme la plus assimilable par l'organisme humain. Les teneurs en acide lactique
communment cites pour le kfir, et confirmes par les mesures de Lacrosse (1970), sont
comprises entre 6 et 10 g.l-1 (Pidoux, 1984 ; Hall et al., 1994 ; Libudzisz & Piatkiewicz,
1990). Il semblerait cependant qu'elles puissent tre beaucoup plus leves : une teneur de 15
g.l-1 a en effet t mesure dans un lait ferment partir de grains argentins (Assadi et al.,
2000). Ces teneurs sont, dans l'ensemble, comparables celles d'un yaourt. Ce dernier doit en
effet avoir une teneur minimale en acide lactique de 7 g.kg-1 (Norme FIL 163, 1992) et si
possible comprise entre 10 g.kg-1 et 13 g.kg-1 (Loones, 1994), mais elle peut s'lever jusqu'
17 g.kg-1 (Muir et al., 1999).
Le kfir peut contenir des quantits relativement leves d'acide actique : 0,9 g.l-1
alors que celle d'un yaourt est de 0,2 g.l-1 (Muir et al., 1999). Ce compos contribue
probablement la perception "acide" du kfir.

32

INTRODUCTION

Lactose

La quantit de lactose restant aprs fermentation varie selon Hall et al. (1994) de
20 g.l-1 et 35 g.l-1. Assadi et al. (2000) en mesurent toutefois une quantit moindre dans un
kfir traditionnel : 14 g.l-1.
Malgr la prsence de lactose rsiduel, le kfir peut, selon Zourari & Anifantakis
(1988), tre consomm sans problme par les personnes intolrantes au lactose. A quantits
gales, le lactose ingr par lintermdiaire de kfir est effectivement mieux digr et mieux
tolr par lhomme adulte que celui ingr par la consommation de lait (Hertzler & Clancy,
2003). Cette amlioration de la digestion et de la tolrance au lactose proviendrait de la
libration, dans le tube digestif, de -galactosidase microbienne.
Composs aromatisants

Selon Kosikowski (1982) la flaveur typique du kfir serait due la prsence de


diactyle et d'actaldhyde dans un rapport 3:1. Cependant, la valeur mesure par Wszolek et
al. (2001) dans des kfirs traditionnels prpars partir de laits d'origines diffrentes (brebis,

chvre et vache) est en moyenne de 5:4. Elle est, dans ce cas, proche du rapport dfini par
Lindsay & Day (1965) comme confrant au beurre un dfaut de got dit "de yaourt" : 5:6.
Par ailleurs, il semblerait que les teneurs en diactyle du kfir soient parfois trop
faibles pour contribuer sa flaveur. Variant entre 1 mg.l-1 et 2,6 mg.l-1 (Libudzisz &
Piatkiewicz, 1990 ; Wszolek et al., 2001 ; Liu et al., 2002a) les concentrations en diactyle
mesures dans des kfirs traditionnels, sont parfois infrieures aux teneurs minimales
ncessaires pour dvelopper la flaveur des produits laitiers ferments : de 2 4 mg.l-1
(Desmazeaud,1992).
Protines, matire grasse et acide linolique conjugu

Les teneurs en protines, en matire grasse et en acide linolique conjugu (CLA) du


kfir sont essentiellement dtermines par celles du lait utilis.
La teneur en protine du lait reste inchange aprs la fermentation lactique (Kuo &
Lin, 1999). Du point de vue digestibilit, les protines du kfir seraient quivalentes celles
des laits caills (Pidoux, 1984).

33

INTRODUCTION

La teneur en matire grasse du kfir dpend du choix du lait utilis : entier, demicrm ou crm. Elle diminue toutefois aprs la fermentation lactique. Du kfir prpar
partir d'un lait 3,5 % de matire grasse affiche un taux compris entre 3,0 % et 3,1 % (Kuo &
Lin, 1999) ; taux qui s'inscrit dans les valeurs cites par Pidoux (1984) : de 3,0 % 3,2 %.
La teneur du lait en l'isomre t9, t11 du CLA est augmente aprs fermentation par des
grains de kfir (Guzel-Seydim et al., 2006). Cette composante isomrique du CLA ne
reprsente toutefois qu'une petite fraction de l'ensemble des isomres du CLA (Khanal, 2004)
et ne semble pas modifier la teneur en CLA total du lait qui reste inchange aprs
fermentation par des grains de kfir (Ninane et al., 2005b).
Alcool et CO2

La teneur en thanol du kfir dpend du procd de fabrication appliqu. Elle est plus
leve dans le kfir traditionnel que dans le kfir industriel. Un lait acidifi partir de grains a
une teneur en thanol comprise entre 0,1 % et 0,3 % (Kuo & Lin, 1999). Aprs maturation, la
teneur en thanol de ce lait acidifi peut atteindre 1 % (Kosikowski, 1982), 2 % (Libudzisz &
Piatkiewicz, 1990) ou plus (Koroleva, 1988). La teneur en alcool dans les kfirs industriels
atteint par contre au maximum 0,04 % (Glaeser, 1981)3.
De mme que pour la teneur en thanol, l'enrichissement en CO2 du kfir dpend du
procd appliqu. Pour un lait acidifi partir de grains de kfir, le taux de CO2 est, selon
Libudzsiz & Piatkiewicz (1990), compris entre 0,08 % et 0,2 %. Il peut toutefois tre
beaucoup plus lev : 3 % de CO2 ont t mesurs dans un lait acidifi partir de grains
argentins (Assadi et al., 2000). On peut s'attendre des taux encore plus levs aprs la
maturation du lait ferment : selon Bourounoff (1933)4, les bouteilles clatent parfois aprs
trois jours de maturation. Toujours selon cet auteur, l'utilisation d'un levain fait chuter la
teneur en CO2 au cours des repiquages.

Glaeser H., 1981. [Kefir : cultures, production, chemical composition and nutritive value.] Ernhr. Umsc., 28,
156-158 (DSA 1982, n 6920). Cit par : Zourari & Anifantakis, 1988.

Bourounoff, 1933. Recherches sur le kfir. Thse de l'Ecole vtrinaire de Lyon. Cit par : Pidoux, 1984.

34

INTRODUCTION

1.3

Perspectives de dveloppement

Les perspectives de dveloppement envisages par les quipes de chercheurs


intresss par le kfir couvrent les domaines de la cosmtologie (Chen et al., 2006), de la
bioprotection alimentaire (Powell et al., 2006 ; Dimitrellou et al., 2007), du recyclage du petit
lait, un sous-produit de l'industrie laitire (Athanasiadis et al., 2001 ; Athanasiadis et al.,
2002 ; Koutinas et al., 2007), de la boulangerie (Plessas et al., 2005 ; Esteller et al., 2006 ;
Plessas et al., 2007a ; Plessas et al., 2007b ; Filipcev et al., 2007 ; Plessas et al., 2008) et de
l'alimentation humaine et animale caractre "sant". Cette dernire, qui mane de la
rputation du kfir, est de loin la plus documente.
1.3.1 Rputation du kfir

Le kfir vhicule la rputation d'tre bnfique la sant. Dans les rgions de l'Est,
cette rputation forge partir d'expriences personnelles, bnficie de l'aval du corps
mdical. Selon Farnworth (1999), le kfir est quotidiennement servi titre "d'activateur de la
sant" dans des hpitaux russes et y est utilis comme agent thrapeutique pour certaines
infections. D'aprs cet auteur, les textes russes de Batinkov (1971)5, Besednova et al. (1977)6,
Bukhgalter (1974)7, et Sukhov et al. (1986)8, font tat de l'utilisation curative du kfir dans le
traitement de maladies digestives, de bronchites et de pneumonies.
Les vertus bienfaisantes du kfir trouvent aussi un cho auprs du corps mdical
japonais : Ota (1999), un membre du corps acadmique de l'Ecole de mdecine de l'Universit
d'Osaka (Japon), en prconise la consommation comme mesure prventive d'infection par les

Batinkov E.L., 1971. [Use of milk and kefir in peptic ulcer of the stomach and duodenum.] Vopr. Pitan. 30 (4),
98-91. Cit par : Farnworth, 1999.

Besednova N.N., Epshtein L.M., Gazha A.K., Borovskaia G.A., Besednov A.L., Rhozhznov I.V. & Smolina
T.P., 1997. [Therapeutic-prophylactic milk products with a new immunocorrector of natural origin.] Vopr.
Pitan. (3), 31-34. Cit par : Farnworth, 1999.

Bukhgalter F.L., 1974. [Use of kefir in complex treament of children with biliary tract diseases associated with
diseases of the pancreas.] Pediatr. Akush. Ginekol. (6), 15-17. Cit par : Farnworth, 1999.

Sukhov S., Kalamkarova L.I., Il'Chenko L.A. & Zhangabylov A.K., 1986. [Changes in the microflora of the
small and large intestine in patients with chronic enteritis after dietary treatment with cultured milk products.]
Vopr. Pitan. (4), 14-17. Cit par : Farnworth, 1999.

35

INTRODUCTION

souches entrohmorragiques de Escherichia coli O157. L'ingestion de kfir, en stimulant la


colonisation des intestins par des bifidobactries et des bactries lactiques, limiterait le
dveloppement de E. coli O157.
1.3.2 Notions de probiotique et d'aliment fonctionnel
Probiotiques

La notion de probiotique trouve son origine dans les travaux de Metchnikoff,


microbiologiste et prix Nobel de mdecine au dbut du XXme sicle. D'aprs la synthse de
ses travaux ralise par Tannock (2002), Metchnikoff associa la longvit des populations de
l'Europe de l'Est une importante consommation de lait ferment. Il attribua cette longvit
au remplacement des bactries intestinales qu'il qualifiait de "putrfiantes" par les bactries
"acidifiantes" des laits ferments. Selon Metchnikoff, les bactries intestinales produisaient en
effet des substances toxiques responsables du vieillissement. Ds lors, pour prvenir
l'autointoxication gnre par les bactries "putrfiantes" de l'intestin, et donc augmenter
lesprance de vie, Metchnikoff proposa d'ingrer des bactries lactiques vivantes.
L'argumentation scientifique de Metchnikoff est aujourd'hui mise en doute d'une part cause
de l'absence de registre d'tat civil permettant de vrifier la longvit relle de ces populations
et, d'autre part, par le rle avr positif, et non ngatif comme le supposait Metchnikoff, de la
plupart des micro-organismes de la flore intestinale sur l'hte (Rou, 1996). Entre-temps,
l'ide d'ingrer des micro-organismes pour amliorer la sant de l'hte t relaye par
d'autres scientifiques qui ont introduit puis prcis la notion de "probiotique".
Le terme probiotique a t introduit par Lilly et Stillwell (1965) pour dcrire les
substances produites par un micro-organisme qui stimulaient le dveloppement dautres
microorganismes. Depuis, la dfinition des probiotiques a volu au gr de l'tat des
connaissances de leurs mcanismes d'action sur la sant. En 1974, Parker largit la notion de
probiotiques aux microorganismes qui contribuent au maintien de lquilibre de la flore
intestinale, englobant ainsi les microorganismes et les mtabolites microbiens produits.
Quinze ans plus tard, Fuller (1989) redfinit les probiotiques comme tant : "des prparations
microbiennes vivantes utilises comme additif alimentaire qui ont une action bnfique sur
lanimal hte en amliorant sa balance microbienne intestinale". Plus rcemment, un groupe

d'experts europens a propos d'largir la dfinition pour y inclure les micro-organismes ayant
des mcanismes d'action indpendants d'une modification de la microflore intestinale
36

INTRODUCTION

(Salminen et al., 1998). Cette proposition a t adopte par le groupe de travail mandat
conjointement par lOrganisation des Nations Unies pour lAgriculture et lAlimentation
(ONUAA) et par lOrganisation Mondiale pour la Sant (OMS) pour faire le point sur la
question. Ce groupe d'experts internationaux dfinit en effet les probiotiques comme tant
"des microorganismes vivants qui, administrs en quantits adquates, sont bnfiques pour
la sant de lhte" (Anonyme FAO/WHO, 2001).
Aliments fonctionnels

Le concept d'aliment fonctionnel est n au Japon dans les annes 80. A cette poque,
l'accroissement des maladies lies l'alimentation, et en particulier celles de la population
vieillissante, conduit le gouvernement japonais subsidier un programme de recherches
visant identifier les fonctions physiologiques des aliments. La mise en vidence de fonctions
biomodulantes intervenant dans le contrle de l'homostasie de l'organisme, puis
l'identification de composs bioactifs et la dtermination des facteurs de sant qu'ils
amliorent ont dfini une nouvelle catgorie daliments identifie par le terme "aliment
fonctionnel". Pour les instances japonaises, laliment fonctionnel fait rfrence un aliment
de consommation courante qui, par la prsence de composs bioactifs, a un effet bnfique
sur un aspect spcifique de la sant suprieur la plupart des aliments conventionnels. Les
composs alimentaires, prsents naturellement dans laliment ou ajouts, considrs au pays
du soleil levant comme fonctionnels ou potentiellement fonctionnels comprennent, entre
autres, des fibres alimentaires (inuline), des oligosaccharides, des polyalcools (erythritol,
sorbitol, maltitol, lactitol), des acides gras poly-insaturs (EPA, DHA, CLA), des peptides,
des protines, des glycosides, des isoprnodes (carotnodes dont le lycopne), des vitamines,
des alcools (oryzanol, octacosanol), des phnols (polyphnols ou flavonodes du th), des
cholines (lcithines de soja et d'uf), des minraux et des bactries lactiques (Shinohara,
1995). Ds 1991, le lgislateur japonais autorise la distinction commerciale des aliments
fonctionnels par le label FOSHU pour "foods for specified health use" et en dtermine les
conditions doctroi (Shinohara, 1995).
Import en Europe dans les annes 90, le concept d'aliment fonctionnel s'y est
dvelopp en prenant, dans l'esprit du public, une signification plus large. Pour le
consommateur europen, les aliments fonctionnels reprsenteraient en effet simplement une
alternative "plus saine" l'alimentation classique (Renard, 2000). Pour les Services fdraux
des affaires scientifiques, techniques et culturelles (SSTC) toutefois, un aliment est considr
37

INTRODUCTION

comme fonctionnel "si l'on a pu dmontrer qu'il influence positivement, et au-del de son
effet nutritionnel classique, une ou plusieurs fonctions de l'organisme de manire
promouvoir le maintien d'un tat de bien-tre ou de sant, ou de rduction du risque d'une
maladie" (SSTC, 2002).
1.3.3 Contexte rglementaire

Les conditions de mise sur le march des probiotiques sont dfinies en fonction de leur
application : mdicamenteuse, alimentaire ou zootechnique.
Application mdicamenteuse

Pour une application mdicamenteuse, c'est--dire pour prvenir ou gurir des


maladies humaines ou animales, les lignes directrices de mise sur le march europen sont
fixes par la Directive 65/65/CEE9. Elles sont compltes, pour les mdicaments usage
humain, par celles de la Directive 2001/83/CE10. Ces textes de loi europens sont inscrits dans
le droit belge par l'intermdiaire de la Loi du 25 mars 1964 sur les mdicaments et par l'Arrt
royal du 14 dcembre 2006 relatif aux mdicaments usage humain et vtrinaire.
Un mdicament ne peut tre commercialis sans autorisation de mise sur le march
octroye par le Ministre de la Sant publique ou par son dlgu, ou par la Commission
europenne, aprs l'valuation de sa scurit, de son efficacit et de sa qualit. Ces paramtres
sont dtermins sur base, entre autres, des rsultats d'essais pharmaceutiques, prcliniques et
cliniques. Ce sont des essais coteux, qui doivent tre rgulirement reproduits pour maintenir
l'enregistrement du mdicament. Ceci explique probablement le petit nombre de probiotiques
enregistrs dans la liste des mdicaments autoriss en Belgique et publie au Moniteur Belge ;
seuls deux probiotiques y figurent actuellement (septembre 2008) : le Lacteol et l'Enterol.
Il s'agit de prparations base de souches de Lactobacillus acidophilus et Saccharomyces
boulardii respectivement (Anonyme Centre belge d'information pharmacothrapeutique,

2008).

Directive 65/65/CEE du Conseil du 26 janvier 1965, concernant le rapprochement des dispositions lgislatives,

rglementaires et administratives, relatives aux spcialits pharmaceutiques


10

Directive 2001/83/CE du Parlement europen et du Conseil du 6 novembre 2001 instituant un code

communautaire relatif aux mdicaments usage humain

38

INTRODUCTION

Application alimentaire

Par le fait qu'ils sont "destins tre ingrs par l'tre humain", les probiotiques
utiliss comme supplment alimentaire, de mme que les aliments fonctionnels, sont
considrs comme des denres alimentaires et sont rgis par la lgislation y attenant. Les
probiotiques et les aliments fonctionnels doivent ce titre rpondre aux exigences de scurit
alimentaire fixes par le Rglement (CE) n 178/200211. Les aliments et ingrdients
alimentaires, dont ceux composs de micro-organismes, pour lesquels la consommation
humaine est jusqu'ici reste ngligeable dans la Communaut, doivent pralablement
satisfaire aux exigences du Rglement (CE) n 258/9712. Dans la mesure o le kfir est un
aliment traditionnel consomm dans certains Etats membres, il rpond de facto aux exigences
scuritaires de ces rglements.
La prsentation commerciale des aliments et la publicit qui en est faite doivent
respecter certaines rgles. La Directive 2000/13/CE13 en dicte les principes gnraux, inscrits
dans la lgislation belge par l'Arrt royal du 17 avril 1980 concernant la publicit pour les
denres alimentaires, par la Loi du 14 juillet 1991 sur les pratiques du commerce et sur
l'information et la protection du consommateur, par l'Arrt royal du 8 janvier 1992
concernant l'tiquetage nutritionnel des denres alimentaires et par l'Arrt royal du 13
septembre 1999 relatif l'tiquetage des denres alimentaires premballes.
Concernant les rgles relatives l'utilisation d'une allgation de sant dans la publicit
pour les denres alimentaires, il ne peut tre fait "rfrence un effet de la denre alimentaire
sur la sant ou sur le mtabolisme si la preuve de cette allgation ne peut tre fournie" (AR

du 17 avril 1980). Les conditions d'utilisation d'une allgation de sant, ou relative la


rduction d'un risque de maladie, dans la Communaut europenne sont prcises dans le

11

Rglement (CE) n 178/2002 du Parlement europen et du Conseil du 28 janvier 2002 tablissant les principes

gnraux et les prescriptions gnrales de la lgislation alimentaire, instituant l'Autorit europenne de scurit
des aliments et fixant des procdures relatives la scurit des denres alimentaires
12

Rglement (CE) n 258/97 du Parlement europen et du Conseil du 27 janvier 1997 relatif aux nouveaux

aliments et aux nouveaux ingrdients alimentaires


13

Directive 2000/13/CE tablissant les rgles d'tiquetage, de prsentation et de publicit des denres

alimentaires

39

INTRODUCTION

Rglement (CE) n 1924/200614, modifi par les Rglements (CE) n 107/200815 et


109/200816. D'application depuis le 1er juillet 2007, toutes les dispositions rglementaires ne
sont pas encore effectives en date du 4 juillet 2008. Ce rglement prvoit ainsi la cration, au
plus tard pour le 31 janvier 2010, d'une liste positive d'allgations de sant autorises dans
laquelle seront dfinies leurs conditions d'utilisation. Les allgations reprises dans la liste
pourront tre faites sans autre procdure d'autorisation pour autant qu'elles soient fondes
("reposent sur des preuves scientifiques gnralement admises") et bien comprises par le
consommateur moyen.
Pour d'autres allgations de sant ou pour celles relatives la rduction d'un risque de
maladie, une demande d'autorisation doit tre introduite auprs de l'autorit nationale
comptente (le Ministre de la Sant publique). L'autorisation sera octroye aprs une
valuation scientifique de la pertinence de la demande par l'Autorit europenne de scurit
des aliments (EFSA). A charge du demandeur de fournir l'EFSA la preuve scientifique que
l'allgation rpond aux critres dfinis dans le rglement. Les exigences au niveau de contenu
et de la prsentation de la demande d'autorisation sont fixes dans le Rglement (CE)
n 353/200817. Elles incluent la ralisation d'tudes sur l'tre humain, auxquelles elles donnent
la prpondrance.
Application zootechnique

Utiliss pour avoir un effet positif sur la production, le rendement ou le bien-tre des
animaux, notamment en influenant leur flore gastro-intestinale, les probiotiques sont
considrs comme des additifs zootechniques. Leur mise sur le march europen, leur

14

Rglement (CE) n 1924/2006 du Parlement europen et du Conseil du 20 dcembre 2006 concernant les

allgations nutritionnelles et de sant portant sur les denres alimentaires


15

Rglement (CE) n 107/2008 du Parlement europen et du Conseil du 15 janvier 2008 modifiant le rglement

(CE) n 1924/2006 concernant les allgations nutritionnelles et de sant portant sur les denres alimentaires en
ce qui concerne les comptences d'excution confres la Commission
16

Rglement (CE) n 109/2008 du Parlement europen et du Conseil du 15 janvier 2008 modifiant le rglement

(CE) n 1924/2006 concernant les allgations nutritionnelles et de sant portant sur les denres alimentaires
17

Rglement 353/2008 de la Commission du 18 avril 2008 fixant les dispositions d'excution relatives aux

demandes d'autorisation d'allgations de sant prvues l'article 15 du rglement (CE) n 1924/2006 du


Parlement europen et du Conseil

40

INTRODUCTION

prsentation commerciale (tiquetage) et leur utilisation sont rglementes par le Rglement


(CE) n 1831/200318. Un additif ne peut tre mis sur le march, transform ou utilis pour
l'alimentation animale sans autorisation de la Commission, accorde sous la forme d'un
rglement publi au Journal officiel de l'Union europenne. La demande est effectue auprs
de la Commission, laquelle en informe les Etats membres et transmet cette demande l'EFSA
pour avis. L'EFSA value, entre autres, l'efficacit du probiotique sur base des rsultats des
tudes ralises cet effet. Le rglement prvoit que l'EFSA publie des lignes directrices
dtailles afin d'aider le demandeur tablir et prsenter sa demande. Elles ont t publies
le 28 aot 2007 pour les additifs composs ou issus de plantes (plantes, herbes et extraits de
plante). Deux documents additionnels pourraient concerner les micro-organismes : un des
deux documents, publi le 13 septembre 2007, concerne l'extrapolation des rsultats obtenus
sur des espces d'levage courantes des espces d'levage occasionnelles ou mineures, et
l'autre, publi le 12 mars 2008, concerne les tests conduire pour vrifier la compatibilit
entre deux additifs. Ces documents sont disponibles sur le site de l'EFSA :
http://www.efsa.europa.eu.
Une liste des additifs autoriss pour l'alimentation animale, intitule Registre
communautaire des additifs pour l'alimentation animale, est publie par la Direction Gnrale
sant et protection des consommateurs (DG SANCO) de la Commission europenne.
Plusieurs souches de Bacillus subtilis, de Enterococcus faecium, de Lactobacillus
acidophilus, de Saccharomyces cerevisiae et une souche de Bacillus cereus, de Bacillus
licheniformis, de Kluyveromyces marxianus, de Lactobacillus rhamnosus et de Pediococcus
acidilactici y taient inscrites au 28 novembre 2007 pour leurs fonctions probiotiques.
1.3.4 Avances scientifiques en matire d'valuation des effets sant du kfir

Pressentie comme source de souches probiotiques, la microflore des grains de kfir a


t utilise pour en isoler des candidats potentiels. Les potentialits probiotiques des souches
isoles de kfirs ont t values sous l'angle traditionnel de la prvention et du traitement de
dsordres gastro-intestinaux. Santos et al. (2003) ont valu leur potentiel primaire in vitro
par l'examen de paramtres impliqus dans deux modes d'action intervenant dans la

18

Rglement (CE) n 1831/2003 du Parlement europen et du Conseil du 22 septembre 2003 relatif aux additifs

destins l'alimentation des animaux

41

INTRODUCTION

rgularisation de troubles gastro-intestinaux : l'exclusion comptitive de l'adhrence de


pathognes la muqueuse intestinale et la production de substances antimicrobiennes. Deux
des souches isoles de kfir par ces auteurs montrent une capacit d'adhsion des cellules
coliques humaines et une activit antimicrobienne l'encontre de plusieurs souches
pathognes. Dans le mme ordre d'ides, Golowczyc et al. (2007) ont valu les potentialits
de souches de Lactobacillus kefiri isoles de grains de kfir prvenir l'adhsion et l'invasion
de cellules coliques humaines par une souche de Salmonella enterica et en ont tudi le mode
d'action. Contrairement l'effet attendu d'une action par exclusion comptitive, l'adhsion de
Lb. kefiri aux cellules pithliales ne prvient pas celle de S. enterica et ne rduit pas

l'invasion des cellules par le pathogne. Par contre, cultives avec S. enterica avant l'infection,
les souches de Lb. kefiri capables d'agrgation avec ce pathogne en rduisent la capacit
d'invasion. Ces auteurs rapportent aussi que les protines de surface des souches de Lb. kefiri
rduisent les capacits d'adhsion et d'invasion de cette souche de S. enterica,
indpendamment de leurs proprits d'agrgation avec le pathogne. Golowczyc et al. (2008)
ont par ailleurs isol de grains de kfir des souches de Lb. plantarum qui ont un pouvoir
inhibiteur l'encontre de diverses souches pathognes ou potentiellement pathognes. Les
souches isoles par Santos et al. (2003) ainsi que celles de Lb. plantarum isoles par
Golowczyc et al. (2008) prsentent une rsistance l'acidit et la bile qui laisse entrevoir la
possibilit d'une survivance lors du passage dans le tractus gastro-intestinal. Leur survivance
et l'efficacit de leur activit probiotique in vivo n'ont toutefois pas t prouves.
Cest pour une application zootechnique que les proprits probiotiques du kfir, au
sens dune modification de la microflore de lhte, ont t prouves in vivo. Dans cet usage,
lintrt rside surtout dans lamlioration de lhygine des carcasses des animaux. En
diminuant la charge fcale en bactries contaminantes et en pathognes alimentaires, on
diminue le risque de contamination de la carcasse labattage. Dans cette optique, des effets
positifs de ladministration de kfir de la volaille ont t observs. Ils concernent une
exclusion comptitive lencontre de Campylobacter jejuni chez des poulets (Zacconi et al.,
2003) et plus gnralement une modification de la microflore fcale doisons (Yaman et al.,
2006).
Concernant les proprits de sant finalit humaine, l'aspect le plus tudi est relatif
l'effet anticarcinogne du kfir ou de ses fractions (petit lait, matire grasse,
polysaccharide...). Shiomi et al. (1982) ont observ que l'administration orale d'un
42

INTRODUCTION

polysaccharide soluble isol de grains de kfir, vraisemblablement du kfirane, inhibe la


croissance de tumeurs induites chez des souris. L'effet observ l'encontre de ce type de
tumeur a t ritr sur des souris avec la prise orale de kfir ou de jus de soja ferment par
des grains de kfir (Liu et al., 2002b). Chen et al. (2007) ont par ailleurs observ que du petit
lait de kfir, ajout des cultures de cellules d'origine humaine, rduit la prolifration des
cellules mammaires cancreuses tout en ne modifiant pas la prolifration des cellules
pithliales saines. Dans cette exprimentation, le petit lait de kfir a un pouvoir
anticarcinogne sur les cellules mammaires suprieur celui du yaourt : il agit sur la
prolifration des cellules cancreuses plus faibles doses et de faon plus intense.
Paralllement l'effet inhibiteur sur les tumeurs des souris, Shiomi et al. (1982) ont
constat que le polysaccharide soluble extrait du kfir est dpourvu d'effet cytotoxique direct
sur les cellules cancreuses et en ont dduit que son action doit tre dirige par l'intermdiaire
de l'hte. La mme quipe a tabli une relation entre l'action antitumorale observe et une
stimulation de l'immunit mdiation cellulaire (Murofushi et al., 1983). Dans le deuxime
cas d'tude oncologique sur des souris, une lyse apoptotique des cellules tumorales et une
stimulation de l'immunit humorale dans les tissus intestinaux, induites par l'ingestion de kfir
ou de soja ferment, ont t rapportes (Liu et al., 2002b). Une stimulation de l'immunit
intestinale due lingestion de kfir traditionnel a t confirme dans dautres laboratoires sur
de jeunes rats et des souris (Thoreux & Schmucker, 2001 ; Vinderola et al., 2006).
Cest laspect prventif des effets anticarcinognes du kfir qui a t examin par
Nagira et al. (2002) sur diffrents types de cellules humaines. Ces auteurs ont montr quun
extrait aqueux de kfir limite les dommages cellulaires induits par exposition des rayons
ultra-violets. Ils ont mis en vidence un effet de lextrait de kfir sur plusieurs facteurs
intervenant soit dans la destruction des cellules soit dans leur rparation. Les plus rvlateurs
sont la diminution rapide des agents oxydants gnrs et laccroissement de lactivit dun
systme de rparation de lADN endommag. La proprit antioxydante du kfir a galement
t montre en modle animal. Chez des souris, lingestion de kfir diminue les dommages
oxydatifs induits par un agent toxique, le ttrachlorure de carbone (CCl4), dans les tissus
hpathiques et rnaux (Gven et al., 2003). Dans cette exprimentation, le kfir a un pouvoir
antioxydant suprieur celui, bien connu, de la vitamine E.

43

INTRODUCTION

Guzel-Seydim et al. (2006) ont estim le potentiel anticarcinogne de la fraction


lipidique du kfir l'aide d'un test biologique rapide couramment utilis pour valuer le
potentiel mutagne de composs chimiques (Ames). Dans cet essai, la matire grasse du kfir,
ainsi que celles du lait et du yaourt, diminuent l'effet de certains agents mutagnes sur le
rvlateur biologique. La matire grasse du kfir s'y rvle toutefois plus efficace pour
diminuer l'effet mutagne de ces agents que la matire grasse du lait et a une action plus large
que celle du yaourt : l'effet mutagne de l'azoture de sodium est rduit avec la matire grasse
du kfir mais pas avec celle du yaourt.
La modulation des dfenses immunitaires est la finalit vise par lquipe de
Kabayama (1997) dans leur recherche de composs alimentaires anti-stress. Dans cette
optique, la fraction lipidique du kfir et le kfirane ont des proprits intressantes : ils
inhibent ou rduisent laction ngative dhormones de stress sur la production dinterfron ,
un facteur humoral non spcifique du systme immunitaire, par une ligne de cellules
humaines.
Un autre aspect prometteur est celui li la rponse de type allergique du systme
immunitaire. Chez les souris, lingestion de kfir frais ou lyophilis diminue la rponse
immunitaire spcifique un allergne alimentaire, lovalbumine (Umeda et al., 2005 ; Liu et
al., 2006a). L'ingestion de kfir lyophilis rduit aussi la rponse inflammatoire de la

muqueuse bronchique provoque par raction allergique chez la souris. Dans cette exprience,
l'ingestion de kfir diminue le taux d'indicateurs de la rponse immunitaire (IgE et cytokines)
et, en parallle, les manifestations asthmatiques de broncho-constriction et de production de
mucus provoques par la rponse immunitaire l'allergne (Lee et al., 2007).
Une potentialit hypocholestrolmiante du kfir a galement t tudie mais les
rsultats sont controverss. Encourageants au niveau de la capacit dassimilation de
cholestrol par la microflore du kfir et de leffet hypocholestrolmiant du kfir sur des
animaux de laboratoire, les rsultats ne se vrifient pas en exprimentation humaine. Vujii
et al. (1992) ont ainsi mesur une diminution de la teneur en cholestrol ajout du lait aprs

fermentation par des grains de kfir et, en modle animal, Liu et al. (2006b) rapportent que
lingestion de kfir a tendance rduire le taux de cholestrol sanguin de hamsters nourris
avec une alimentation enrichie en cholestrol. Cependant, dans l'exprimentation de St-Onge
et al. (2002), conduite sur des hommes souffrants dhypercholestrolmie modre, le kfir ne

44

INTRODUCTION

gnre aucune diffrence du taux de cholestrol sanguin, total ou de ses composantes LDL ou
HDL, par rapport une consommation quivalente de lait.
Le kfir et le jus de soja ferment ont par ailleurs des proprits intressantes vis--vis
denzymes intervenant dans des mcanismes de rgulation physiologique. Certains peptides
issus de kfir prpar avec du lait de chvre ont ainsi une activit inhibitrice lencontre de
lenzyme de conversion de langiotensine implique dans laugmentation de la pression
artrielle (Quiros et al., 2005). La prservation de leur activit dans des essais de simulation
de la digestion gastrointestinale laisse entrevoir une fonctionnalit anti-hypertensive de ces
peptides de kfir. La fermentation de jus de soja par un ferment de kfir diminue par contre
l'activit inhibitrice naturelle du jus de soja l'encontre de lenzyme de conversion de
langiotensine (Kwon et al., 2006). Son action pourrait nanmoins avoir un intrt vis--vis
d'un autre aspect de la sant : celui du diabte pospandrial. La fermentation du jus de soja par
un ferment de kfir module en effet aussi les activits inhibitrices naturelles du jus de soja
l'encontre d'enzymes intervenant dans le processus l'origine de l'hyperglycmie
postpandriale : l'-amylase et les -glucosidases. En rduisant l'activit inhibitrice
l'encontre de l'-amylase et en augmentant celle l'encontre des -glucosidases, la
fermentation amliorerait, selon Kwon et al. (2006), les potentialits du jus de soja comme
alternative thrapeutique ce type de diabte : elle attnue l'inhibition enzymatique
responsable des effets secondaires lis aux thrapies enzymatiques. L'inhibition excessive de
l'-amylase serait en effet responsable de la fermentation intestinale anormale et dsagrable
des carbohydrates non digrs, associe la prise mdicamenteuse d'inhibiteurs
enzymatiques.
Certains aspects sant envisags relvent de consquences thrapeutiques ou
d'applications dittiques spcifiques : rduction des effets secondaires de traitements par
radiothrapie du cancer sur l'pithlium intestinal ou dveloppement d'un lait ferment
faible teneur en galactose pour les patients atteints de galactosmie. Ingr par des rats, le
kfir a un effet protecteur l'encontre de la destruction apoptotique des cellules intestinales
induite par irradiation aux rayons-X (Matsuu et al., 2003). Li la dose d'exposition des rats
aux rayons-X, l'effet protecteur du kfir est dans ce cas significatif pour une dose quivalente
la moiti de celle administre aux patients par sance de radiothrapie. Dans l'optique de
proposer aux patients galactosmiques un produit laitier de consommation quotidienne, Varga
et al. (2006) ont mesur la capacit d'un ferment de kfir compos de plusieurs cultures

45

INTRODUCTION

bactriennes et de levures diminuer la teneur en galactose de lait lactose hydrolys.


L'activit fermentaire de ce ferment de kfir diminue la teneur en galactose du lait lactose
hydrolys d'un facteur 8 mais le taux de galactose rsiduel reste lev en regard des
recommandations mdicales pour les jeunes patients galactosmiques.
1.4

Mthodes didentification des bactries lactiques

Les bactries sont classes en groupes taxonomiques, ou taxons, en fonction de


critres qui voluent selon les donnes disponibles. L'espce, qui est le groupe de base dans
les classements bactriens, est un concept volutif non encore arrt par une dfinition
universellement admise.
1.4.1 Notion despce bactrienne

La reproduction sexue, qui est la base de la dfinition de lespce dans les rgnes
animal et vgtal, est rare chez les bactries ; seuls quelques groupes, dont les coliformes,
sont capables de conjugaison. Par sa raret, le critre de reproduction sexue sest rapidement
rvl inadquat pour rendre compte de la diversit microbienne implique dans les
applications pratiques de la microbiologie. Cest en consquence en fonction de
caractristiques lies ces applications - phnotypiques (ractions biochimiques),
morphologiques et de pathognicit - et de la source d'isolement que les premiers classements
bactriens ont t effectus. Lespce se dfinit alors de facto comme un ensemble de microorganismes prsentant suffisamment de similarit entre-eux et se diffrenciant des autres
(Staley & Krieg, 1984).
Jusque dans les annes 1960, la classification bactrienne reposait sur un petit nombre
de critres dont le choix tait souvent orient par les connaissances et prsomptions du
microbiologiste qui dcrivait l'espce. La prise en compte d'un ensemble plus large de
caractristiques morphologiques et biochimiques pour caractriser les espces est introduite
dans ces annes-l. Dix ans plus tard, l'informatisation amliore la validit de cette
classification en autorisant le traitement d'un plus grand nombre de tests biochimiques (100200) et le calcul de coefficients de similarit entre les espces et leurs composantes
microbiennes. Elle ne permet toutefois pas d'objectiver la dfinition de l'espce par un seuil de
similarit phnotypique (Brenner et al., 2005).

46

INTRODUCTION

Paralllement, le dveloppement d'outils permettant de comparer le gnome des


bactries introduit un nouveau critre de classification : la similitude de leurs ADNs.
Techniquement, le gnome bactrien peut aujourd'hui tre compar au niveau de sa
composition nuclotidique (pourcentage en cytosine et en guanine), par le biais de sa capacit
d'hybridation, par l'intermdiaire de l'empreinte rvle par une mthode dtermine et au
niveau de la squence nuclotidique de gnes particuliers dont celui codant pour l'ARN
ribosomique 16S (Vandamme et al., 1996 ; Gillis et al., 2005).
Deux paramtres gnotypiques fournissent la classification bactrienne des critres
de spciation objectifs, considrs comme la rfrence en matire de dfinition de l'espce par
les comits d'experts internationaux en systmatique bactrienne (Wayne et al., 1987 ;
Stackebrandt et al., 2002) : le taux d'hybridation de l'ADN dnatur (simple brin) provenant
de deux bactries et la stabilit thermique de l'ADN hybride (double brin) form. Le taux
d'hybridation et la valeur du paramtre de stabilit thermique dterminant l'espce ont t
fixs en fonction de la classification existante ; ce sont, comme le prcise Stackebrandt
(2003), des "valeur(s) artificielle(s) utilise(s) pour structurer le monde bactrien de faon
cohrente".

La squence de l'ADNr 16S fournit une assise plus "naturelle" la classification


bactrienne dans le sens o elle intgre une composante relative la phylognie bactrienne.
LARN ribosomique 16S, parce qu'il a un rle cl dans la traduction des ARNs messagers en
protines, est prsent dans tous les micro-organismes et offre une structure mosaque incluant
des rgions conserves et des rgions variables, reflets d'vnements de mutation plus ou
moins lointains lis leur spciation (Woese, 1987). Cet outil taxonomique est reconnu et
utilis en systmatique bactrienne : la dernire dition (2005) du Bergey's manual of
systematic bacteriology, qui est un ouvrage de rfrence en matire de classification
bactrienne, est structure sur base des relations phylogntiques tablies partir du gne
codant pour l'ARNr 16S. Cependant, le taux d'homologie de l'ADNr 16S des bactries n'est
pas toujours corrl avec le taux d'hybridation de l'entiret de l'ADN gnomique
(Stackebrandt & Goebel, 1994 ; Stackebrandt & Ebers, 2006) et ne peut ds lors se substituer
ce critre dcisif dans la dfinition de l'espce propose par les comits d'experts prcits.
Si le taux d'hybridation de l'ADN dnatur provenant de deux bactries et la stabilit
thermique de l'ADN hybride form constituent la rfrence en matire de dfinition de
47

INTRODUCTION

l'espce, ils ne suffisent pas eux seuls pour la dterminer. Pour tre reconnue comme telle,
une espce doit aussi pouvoir se distinguer des autres par des caractres phnotypiques
(Wayne et al., 1987 ; Stackebrandt et al., 2002). Les critres phnotypiques utiliss en
taxonomie polyphasique pour distinguer les espces bactriennes entre-elles concernent,
notamment, des caractres visibles d'ordre morphologique, physiologique, enzymatique et/ou
srologique, des marqueurs chimiotaxonomiques (exopolysaccharides, peptidoglycane,
quinones, lipides polaires, acides mycoliques...) et le comportement lectrophortique des
protines cellulaires ou membranaires (Vandamme et al., 1996 ; Gillis et al., 2005). La
pertinence des critres varie selon le groupe microbien considr : la capacit fermenter
diffrents sucres est un critre pertinent pour diffrencier les espces lactiques mais n'a pas de
sens pour diffrencier des Campylobacter sp. (elles sont incapables d'utiliser les sucres) par
exemple.
La dfinition de l'espce propose par les comits d'experts prcits rend peu compte
du rle cologique des bactries ; si bien qu'elle reconnat des exceptions la rgle,
notamment dans le domaine sensible de la microbiologie mdicale (Stackebrandt et al., 2002).
Ainsi, Yersinia pestis (agent de la peste) et Y. pseudotuberculosis, appartiennent, par rapport
cette dfinition, la mme espce mais sont nommes distinctement pour viter une
confusion au niveau de la pathognicit (Brenner et al., 2005).
Pour pallier cette carence, Cohan & Perry (2007) proposent d'asseoir une dfinition de
l'espce bactrienne sur un concept de cohsion gnomique l'image de celui ordonnant les
rgnes animal et vgtal. Les niches cologiques spcifiques joueraient dans le monde
bactrien le rle slectif que l'impossibilit de se reproduire opre dans les rgnes animal et
vgtal. Partant de ce postulat, les membres d'une communaut bactrienne ayant des rles
cologiques distincts, ou "cotypes", sont identifis au travers de la fonctionnalit d'un groupe
de gnes (codant pour des protines). L'quipe de Cohan propose diffrents modles
d'volution bactrienne, dont un disponible sur Internet19 (Koeppel et al., 2008), permettant
d'identifier les cotypes d'une communaut bactrienne. Ces modles sont toutefois contests
par Achtman & Wagner (2008) qui prnent une dfinition plus large de l'espce, indpendante
d'une mthode d'analyse et d'un critre universel.

19

http://fcohan.web.wesleyan.edu/ecosim/

48

INTRODUCTION

1.4.2 Identification microbienne

L'identification est le procd par lequel l'appartenance d'un isolat l'un ou l'autre
taxon est dtermine. Elle repose sur un ensemble de caractristiques que tous les membres du
taxon possdent et que les autres taxons ne possdent pas (Krieg, 2005).
1.4.3 Mthodes phnotypiques

Par bactries lactiques on entend communment des bactries anarobies


arotolrantes dont le, ou un des, produit(s) du mtabolisme fermentaire est de l'acide
lactique. Elles sont Gram positives, catalase ngatives, gnralement non mobiles et non
sporules (Dellaglio et al., 1994 ; Wood, 1995).
Les caractristiques phnotypiques rpertories par Curk et al. (1994a) pour les
identifier comprennent la morphologie cellulaire, la production d'exopolysaccharide ou de
pigment, la temprature et le pH optimaux de croissance, la tolrance au NaCl, la bile ou
d'autres inhibiteurs, le type fermentaire (dtermin par la production de CO2 en milieu
glucos), l'isomre optique de l'acide lactique produit par fermentation du glucose, l'hydrolyse
de l'arginine, de l'hippurate, de l'esculine, de l'amidon et de l'ure, et le profil de fermentation
des sucres.
Biomrieux (Marcy-l'Etoile, France) commercialise depuis les annes 70 un ensemble
de tests biochimiques miniaturiss spcifiquement destin l'identification des bactries
lactiques (galerie API 50 CHL). L'interprtation de l'ensemble de ces rsultats est assiste par
une grille d'identification disponible sous forme de document papier ou informatis. Cet outil
d'identification n'est toutefois pas toujours fiable au niveau taxonomique de l'espce, ni mme
au niveau du genre : appliqu seul l'identification de souches bactriennes commerciales il a
conduit dans 8 cas sur 27 une spcification errone (Huys et al., 2006).
Les mthodes phnotypiques ne permettent par ailleurs pas de diffrencier toutes les
bactries lactiques : celles autrefois associes Lactobacillus acidophilus, ou encore
Lb. brevis et Lb. kefiri, sont indiscernables sur une base phnotypique (Kandler & Kunath,

1983 ; Hammes & Vogel, 1995).

49

INTRODUCTION

1.4.4 Mthodes physico-chimiques

Les mthodes physico-chimiques appliques, ou qui offrent des perspectives


d'application, aux bactries lactiques reposent sur l'analyse de composants cellulaires
particuliers, les protines, ou de l'ensemble des composants cellulaires.
Profils protiques

Une cellule bactrienne synthtise environ 2000 protines diffrentes qui fournissent
une source riche d'information pour sa caractrisation et son identification. La sparation du
mlange de protines cellulaires par lectrophorse en gel de polyacrylamide (PAGE), avec
ou sans dodcyl sulfate de sodium (SDS), produit un lectrophorgramme ou profil protique
complexe qui peut tre considr comme l'empreinte de la souche bactrienne examine
(Curk et al., 1994a). Les profils protiques peuvent tre digitaliss et ainsi compars sur une
base numrique objective. Avec une mthode SDS-PAGE strictement normalise, l'quipe de
l'Universit de Gand (Belgique) et ses collaborateurs discriminent fiablement les bactries
lactiques aux niveaux de l'espce et de la sous-espce (Vandamme et al., 1996).
La digitalisation des profils protiques permet de les conserver pour constituer des
banques de donnes de rfrence. L'identification de souches bactriennes par comparaison
avec les donnes conserves implique une normalisation des profils protiques qui,
apparemment, n'est pas universelle : les diffrents groupes de recherche travaillent avec leur
propre banque de donnes (Leisner et al., 1999 ; Snchez et al., 2003 ; Tae-Woon et al.,
2003).
Spectres infra-rouge transforme de Fourier (IRTF)

Les proprits d'absorption des cellules bactriennes entires dans le moyen infrarouge (500 4000 cm-1) fournissent des spectres IRTF spcifiques chaque souche et
reproductibles (Naumann et al., 1988). Il s'agit d'une mthode rapide qui requiert peu de
prparation : la prparation de l'chantillon se rsume l'talement et la dessiccation d'une
culture cellulaire sur un support adquat (Curk et al., 1994a).
Le spectre IRTF d'une bactrie est fonction de sa composition cellulaire et dpend ds
lors, notamment, des conditions de culture. Dans des conditions normalises de culture, de
prparation de l'chantillon et de prise spectrale, les spectres IRTF permettent de discriminer
les bactries lactiques testes au niveau du genre et de l'espce (Curk et al., 1994b ; Amiel et
50

INTRODUCTION

al., 2000 ; Dziuba et al., 2007). Ces performances taxonomiques ont t tablies partir de

souches de collection appartenant aux genres Lactobacillus, Lactococcus, Leuconostoc,


Streptococcus et Weisella.
1.4.5 Mthodes gnotypiques

Les mthodes gnotypiques d'identification reposent sur les similitudes de l'ADN, total
ou de gnes cibls, de deux souches. Un atout majeur de ces mthodes est l'indpendance du
rsultat vis--vis des conditions de culture.
Hybridation ADN-ADN et stabilit thermique des hybrides

Le taux d'hybridation de l'ADN total de deux souches et la stabilit thermique de


l'hybride form sont des paramtres de rfrence en matire de dfinition de l'espce.
Plusieurs mthodes permettent de les dterminer. Les plus communes selon
Vandamme et al. (1996) sont la mthode l'hydroxyapatite (Brenner et al., 1969), la mthode
spectrophotomtrique (De Ley et al., 1970) et la mthode base sur une digestion de l'ADN
la nuclase S1 dcrite par Crosa et al. (1973) puis amliore par Grimont et al. (1980). La
mthode spectrophotomtrique prsente l'avantage, par rapport aux deux autres, d'tre
affranchie de radio-isotope mais ne permet pas de dterminer le paramtre de stabilit
thermique de l'ADN hybride. Ces mthodes classiques requirent toutes de grandes quantits
d'ADN et sont fastidieuses mettre en oeuvre.
Des mthodes miniaturises, plus rapides, ont t dveloppes (Ezaki et al., 1989 ;
Christensen et al., 2000 ; Mehlen et al., 2004). Compares aux mthodes classiques, elles
conduisent une bonne corrlation des rsultats pour les souches testes. Celles-ci
comprennent toutefois peu de bactries lactiques : seuls ma connaissance les genres Bacillus
(Goris et al., 1998) et Pediococcus (Mehlen et al., 2004) ont t reprsents dans les tests de
validation.
Squenage de l'ADNr

La comparaison de la squence nuclotidique de gnes discriminants est une technique


d'identification bactrienne dont le succs a t promu par le dveloppement d'outils
analytiques performants.

51

INTRODUCTION

Le squenage de gnes est en effet aujourd'hui une technique partiellement


automatise, permettant de lire rapidement des squences relativement longues par rapport
celles autorises par la traditionnelle mthode de Sanger. Les instruments modernes de
squenage automatique de l'ADN sont capables de lire simultanment jusqu' 384
chantillons d'environ 700 bases en moins de 2 heures (Wiebe et al., 2003).
Paralllement cette volution technologique, diffrentes organisations ou universits
ont constitu des banques de squences, incluant celles de souches connues, qu'elles mettent
la disposition du public par le rseau Internet. Celle du Genbank20 ou de l'European Molecular
Biology Laboratory21 (EMBL), sont gnrales, c'est--dire comprennent des squences de
tous les gnes, tandis que celles manant du Ribosomal Database Project II22 (RDP) gr par
lUniversit du Michigan (USA) et de l'European Ribosomal RNA Database23 gr par
lUniversit de Gand (Belgique) compilent exclusivement les squences de l'ARN ou de
l'ADN ribosomique. La banque manant du RDP comprend actuellement 513.272 squences
(Anonyme RDP, 2008) tandis que celle de l'European Ribosomal RNA Database en
comprenait 20.000 en 2004 (Wuyts et al., 2004).
Elles mettent par ailleurs la disposition du public des outils informatiques facilitant
la comparaison des squences et permettant de rechercher les squences les plus similaires
celle de la souche identifier au sein d'une banque de donnes. Ces outils sont accessibles par
le rseau Internet et fournissent immdiatement le rsultat de la recherche. Le logiciel FASTA
par exemple de l'European Bioinformatics Institute24 (EMBL-EBI) recherche au sein de la
banque de l'EMBL les squences les plus proches de celle introduite et affiche l'alignement de
chacune de ces squences proches avec celle introduite ainsi que divers paramtres relatifs au
taux d'homologie entre les squences. Les logiciels Seqmatch et Classifier du Ribosomal
Database Project II (RDP) fonctionnent de faon similaire mais ne fournissent que le rsultat
final de la recherche comparative, c'est--dire l'attribution de la squence identifier un

20

Genbank : http : //www.ncbi.nlm.nih.gov/

21

European Molecular Biology Laboratory : http://www.ebi.ac.uk/embl/

22

Ribosomal Database Project II : http://rdp.cme.msu.edu

23

European Ribosomal RNA Database : http ://www.psb.ugent.be/rRNA/index.html

24

European Bioinformatics Institute : http://www.ebi.ac.uk/

52

INTRODUCTION

taxon, sans accs au dtail des alignements, amputant ainsi la possibilit d'effectuer une
analyse critique du rsultat.
Parmi les gnes utiliss des fins d'identification bactriennes, celui codant pour
l'ARN ribosomique 16S prsente l'avantage d'tre la base des relations phylogntiques qui
servent d'pine dorsale la taxonomie contemporaine. Il n'existe toutefois pas de seuil
universel d'homologie entre deux squences de l'ADNr 16S permettant d'affirmer
l'identification de la souche bactrienne. Au-del de ~ 99 % d'homologie, les squences
peuvent aussi bien provenir de souches appartenant la mme espce que de souches
appartenant des espces distinctes (Stackebrandt & Ebers, 2006).
Typage molculaire

De nombreuses mthodes permettant de typiser des bactries partir de leur


ADN ont t dcrites. Les bactries inconnues sont dans ces cas identifies par comparaison
de leur empreinte, ou profil produit par la mthode applique, avec celles de bactries
identifies.
Les mthodes de typage molculaire de premire gnration reposent sur l'analyse des
profils obtenus par migration en gel d'agarose de l'ADN digr (fragment) par des enzymes
dtermines (RFLP). Sous un champ lectrique (lectrophorse), les fragments d'ADN
migrent dans le gel des vitesses inversement proportionnelles leur longueur et se sparent
pour donner, aprs une dure dtermine, un profil de bandes typique du set de fragments.
Les profils RFLP peuvent tre tablis partir de l'entiret de l'ADN gnomique,
partir d'une partie cible de l'ADN gnomique, gnes codant pour des protines ou pour
l'ARN ribosomique (ARDRA) par exemple, ou, pour les souches dotes de plasmides stables,
partir d'ADN plasmidique. Dans tous les cas, la qualit de l'ADN soumis la restriction
enzymatique est un facteur dterminant et son acquisition peut se rvler fastidieuse quand il
s'agit de l'entiret de l'ADN gnomique.
Applique l'entiret de l'ADN gnomique, cette technique prsente l'inconvnient
additionnel de gnrer des profils complexes difficiles interprter. Le nombre de fragments
et la complexit des profils, peuvent tre limits par l'emploi d'enzymes de restriction agissant
en des sites rares. La longueur des fragments obtenus impose alors de les sparer par
lectrophorse en champ puls (PFGE). Une alternative applique aux bactries lactiques, par
53

INTRODUCTION

Chagnaud et al. (2001) notamment, est la mise en vidence des fragments provenant d'un
gne ou d'un ensemble de gnes particulier comme l'ADNr (Ribotyping) l'aide de sondes
marques. Cette option impose alors de transfrer le profil obtenu en gel sur une membrane
synthtique pour pouvoir hybrider la sonde avec l'ADN cible.
Les mthodes RFLP peuvent se rvler trs discriminantes : mises en oeuvre partir
de l'entiret de l'ADN gnomique en utilisant des enzymes de restriction en sites rares
(PFGE) ou partir de gnes codant pour des protines, elles permettent de diffrencier les
bactries lactiques auxquelles elles ont t appliques au niveau de la souche (Zhang &
Holley, 1999 ; Giraffa et al., 2003 ; Cai et al., 2007 ; Oguntoyinbo, 2007).
Les mthodes de typage molculaire plus rcentes reposent sur la technique
d'amplification gnique, ou Polymerase chain reaction (PCR). La PCR est une technique de
rplication de l'ADN compris entre deux squences dtermines par les amorces
(oligonuclotidiques) de la raction en chane.
Certaines mthodes consistent en l'amplification de fragments d'ADN gnomique
dtermins par des amorces non spcifiques, arbitraires (AP, RAPD ou DAF), ou par des
squences consensus rptitives (rep-PCR). Les fragments gnrs, de longueur variable, sont
spars par migration lectrophortique dans un gel (d'agarose ou de polyacrylamide) et
forment une empreinte typique du taxon ou de la bactrie. L'identification de bactries
lactiques au niveau de l'espce et de la sous-espce ainsi que la diffrenciation de souches
lactiques par ce type de mthodes ont t rapportes (Cusick & O'Sullivan, 2000 ; De Urraza
et al., 2000 ; Masco et al., 2003).

D'autres mthodes consistent en l'amplification d'une rgion dtermine de l'ADN


gnomique dont le polymorphisme nuclotidique est rvl en exploitant les proprits de
dissociation de l'ADN. La dissociation de l'ADN, provoque par une augmentation de la
temprature ou par un agent chimique, transforme le fragment en une structure partiellement
ouverte et cre une diminution brutale de sa mobilit lectrophortique dans le gel. Dans un
gel soumis un gradient de temprature (TTGE) ou incluant un gradient d'agent dnaturant
(DGGE), l'ADN se concentre en une position dtermine par la squence du fragment
amplifi. L'avantage de ces mthodes est leur applicabilit un consortium microbien : les
micro-organismes sont caractriss par une bande spcifique identifiable dans le profil gnr
par l'ensemble. Avec les rgions variables de l'ADNr 16S comme cibles d'amplification
54

INTRODUCTION

gnique, les mthodes TTGE et DGGE se sont rvles performantes pour identifier les
bactries lactiques de divers produits laitiers - fromages, laits ferments et kfirs - au niveau
taxonomique de l'espce (Ogier et al., 2002 ; Fasoli et al., 2003 ; Temmerman et al., 2003 ;
Ogier et al., 2004 ; Garbers et al., 2004 ; Theunissen et al., 2005).
Hybridation spcifique

D'autres mthodes reposent sur l'hybridation d'une courte squence nuclotidique de


synthse, spcifique au taxon identifier ou dtecter, avec la squence complmentaire de
l'ADN de la souche identifier. Le succs de l'hybridation est rvl par un marqueur li la
squence de synthse, alors appele sonde, ou par la technique de PCR. Dans ce deuxime
cas, deux amorces (squences nuclotidiques de synthse) sont ncessaires ; seule une des
deux amorces doit tre spcifique au taxon cibl.
Des sondes et des amorces spcifiques certaines bactries lactiques ont t dcrites et
rpertories respectivement par Coeuret et al. (2003) et par Temmerman et al. (2004).
1.5

Objectifs du travail

Le kfir est un lait ferment traditionnel des pays de l'Est qui se singularise notamment
par la forme de son ferment originel. Figs dans une matrice polysaccharidique, les microorganismes du ferment de kfir forment en effet de petites masses lastiques compactes,
appeles grains de kfir, qui se multiplient en conservant leurs proprits.
Les grains de kfir sont constitus d'une microflore complexe, compose de bactries
lactiques et de levures, souvent associes des bactries actiques, et peuvent tre contamins
par des micro-organismes indsirables tels que des bacilles, des microcoques ou des
coliformes. Leur composition microbienne varie selon l'origine du grain dans une diversit
qui inclut de nombreuses espces : la littrature mentionne pas moins de 18 espces
diffrentes pour les seules bactries lactiques.
L'objectif pratique de ce travail tait de caractriser la microflore dun grain de kfir
choisi parmi la collection du Dpartement (CRA-W, Gembloux, Belgique) pour ses qualits
organoleptiques et technologiques suprieures. Par qualits organoleptiques et technologiques
on entend les caractristiques organoleptiques et technologiques considres et ressenties
comme positives par un consommateur belge ordinaire peu familiaris ce produit. Le grain
55

INTRODUCTION

slectionn procurait ainsi le kfir le plus apprci du personnel et ne conduisait pas un


dveloppement gazeux lors de la conservation du produit. Ltude du consortium microbien
du grain avait pour finalit la connaissance de sa composition dans un but concret de
distribution publique. La caractrisation comprenait ds lors l'valuation de la qualit
hyginique du grain, l'identification et la quantification des groupes microbiens prsents dans
le grain, la description de la croissance des principaux groupes microbiens dans des
conditions de manutention dtermines, l'identification des espces microbiennes participant
au consortium et l'valuation de l'intgralit de la diversit microbienne identifie.
Parmi les groupes microbiens constituant la flore banale des grains de kfir, les
bactries lactiques sont impliques dans le plus large ventail de fonctionnalits tant au niveau
de la transformation du lait (acidifiante, texturante et probiotique notamment) qu'au niveau de
la constitution du grain et revtent ce titre une importance majeure. La comprhension
prcise de leurs rles au sein de ce ferment particulier qu'est le grain de kfir repose avant tout
sur la justesse de leur identification.
La microflore lactique des grains de kfir est traditionnellement identifie par l'analyse
des caractristiques morphologiques et biochimiques des micro-organismes pralablement
isols par culture. Outre l'aspect fastidieux du travail qu'elle demande, cette approche
compromet la qualit des rsultats deux niveaux : la fiabilit de l'identification et la diversit
des espces mises jour. Les bactries lactiques ne peuvent, dans les cas extrmes,
simplement pas tre diffrencies sur une seule base phnotypique - c'est le cas notamment
des espces autrefois associes Lactobacillus acidophilus (Hammes & Vogel, 1995) et
leur isolement se heurte l'incapacit de certaines se dvelopper sur les milieux de synthse
usuels ; la slection des milieux de culture est un exercice dlicat dont l'insuccs a t constat
dans le contexte du kfir (Witthuhn et al., 2004). L'objectif mthodologique du travail tait de
dvelopper, pour les bactries lactiques de grains de kfir, une stratgie d'identification
permettant de contourner ces difficults. Elle reposait sur la slection d'outils d'identification
pertinents, adapts la multiplicit des espces lactiques du kfir.
La reconstitution du grain de kfir KJ partir des cultures pures qui en ont t isoles
serait un moyen lgant de sassurer de lidentification de toutes les espces indispensables
la formation et la fonctionnalit du grain. Sil est clairement relat que la reconstitution dun
grain de kfir partir de cultures individuelles reste un dfi, il nest nulle part fait mention de
56

INTRODUCTION

la reconstitution dun grain partir de lensemble de son consortium microbien. A fortiori, les
conditions exprimentales de reconstitution in vitro dun grain ne sont pas dcrites et
constituent un obstacle majeur cet objectif.
La formation in situ des grains de kfir est un vnement local dont la situation
gographique cartait lopportunit dobserver le processus pour en identifier les paramtres
dterminants. La conception dessais exprimentaux de reconstitution de grains reposait ds
lors exclusivement sur les donnes bibliographiques disponibles. Innovant en matire de
reconstitution in vitro de grains de kfir, ce travail avait pour objectif dentamer une rflexion
exprimentale dans ce domaine. Laboutissement dune reconstitution sur base des
descriptions de formation in situ des grains de kfir constituait dans ce contexte un lment
fondamental vrifier.

57

MATRIEL ET MTHODES

MATRIEL ET MTHODES

2.1

Matriel biologique

2.1.1 Origine et maintenance du grain de kfir25 KJ

Le grain de kfir (KJ) provenait de la collection du Centre wallon de Recherches


agronomiques (CRA-W, Gembloux, Belgique). Le Centre acquit ce grain en 1998 auprs de
particuliers bruxellois. Selon leurs dires, ce grain tait transmis en Belgique, de particulier
particulier, depuis de nombreuses annes.
Ds son acquisition, le grain de kfir KJ a t cultiv dans du lait UHT 22 C avec
un taux d'ensemencement de 20 % rajust hebdomadairement, un jour fixe de la semaine. Le
lait a t renouvel quotidiennement except les samedis et dimanches. A l'occasion du
renouvellement du lait, les grains taient rincs l'eau strile et goutts. Ces manipulations
d'entretien des grains se faisaient temprature ambiante.
2.1.2 Origine des souches de rfrence

Les souches types de Lactobacillus acidophilus, Lb. casei, Lb. johnsonii, Lb. kefiri,
Lb. parakefiri, Lactococcus lactis subsp. lactis, L. lactis subsp. cremoris, Leuconostoc lactis,
Ln. mesenteroides subsp. mesenteroides, Ln. mesenteroides subsp. cremoris, Streptococcus
thermophilus et de Pediococcus acidilactici ont t acquises auprs du Belgian Co-ordinated

Collections of Micro-organisms (Gand, Belgique) tandis que celles de Lb. kefiranofaciens


subsp. kefiranofaciens et Lb. kefiranofaciens subsp. kefirgranum ont t acquises auprs de la
Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH (DSMZ ; Braunschweig,
Allemagne). La souche DSM 20248 de Weissella viridescens provenant de lait pasteuris a
t acquise auprs du DSMZ (Braunschweig, Allemagne).

25

Le terme grain de kfir au singulier a t assign un ensemble de grains de kfir provenant d'une mme

source.

59

MATRIEL ET MTHODES

2.2

Qualit hyginique du grain de kfir KJ

2.2.1 Mesure du pH du grain

Environ 100 g de grains de kfir ont t prlevs en cours de cycle de fermentation du


lait. Le pH des grains rincs leau strile et goutts a t mesur laide dune lectrode au
calomel dsinfecte lalcool. Pour mesurer le pH, llectrode tait place au centre de la
masse de grains. Les grains taient ensuite remis dans le lait pour poursuivre la fermentation.
2.2.2 Recherche des germes pathognes et indicateurs de dfauts d'hygine

Les diffrents germes ont t recherchs, dans le lait ferment par du grain de kfir KJ
dans les conditions dcrites au paragraphe 2.1.1, l'aide de mthodes normalises ou valides
par lOrganisation internationale de normalisation (ISO, Genve, Suisse), lAssociation
franaise de normalisation (AFNOR, La Plaine Saint-Denis, France) ou la Fdration
internationale de laiterie (FIL, Bruxelles, Belgique), ou par des mthodes qui en taient
drives (Tableau 2.2.1).
Tableau 2.2.1 : Mthodes appliques pour la recherche des germes pathognes et indicateurs

de dfaut d'hygine.
Germes ou groupes de germes recherchs

Mthodes

Listeria monocytogenes

AFNOR V 08-055 (1997), AFNOR BIO-12/2-06/94 Vidas,


AFNOR BIO-12/4-02/95 Accuprobe

Salmonella sp.

AFNOR V 08-052 (1993)

Staphylocoques coagulase positive

ISO 6888-1 (1999)

Coliformes

FIL 73B:1998, partie 2

Moisissures

Drive* FIL 94B:1991

Micro-organismes contaminants

FIL 153:1991

* Etalement en surface de prises d'essai de 0,1 ml et identification des moisissures par examen de la morphologie
des colonies.

La recherche des staphylocoques coagulase positive, de Listeria monocytogenes et


des Salmonella sp. a t effectue en sous-traitance par le laboratoire national de rfrence
Lait et Produits laitiers de l'Instituut voor Landbouw en Visserijonderzoek (Melle, Belgique).

60

MATRIEL ET MTHODES

2.3

Identification et quantification des groupes microbiens du grain de kfir KJ

2.3.1 Identification des groupes microbiens

Lidentification des groupes microbiens a t effectue partir du lait ferment par le


grain de kfir KJ, dans les conditions dcrites au paragraphe 2.1.1.
Les groupes microbiens prsums ont t isols par talement, en botes de Petri, de
prises d'essai de 0,1 ml de lait ferment, pur et dilu dans de leau de Ringer, sur les milieux
de culture gloss et dans les conditions dincubation dcrites au Tableau 2.3.1.
L'aspect des colonies bien individualises, c'est--dire dveloppes en nombre
infrieur 150 par bote de Petri, a t observ. Des colonies ont t prleves et tales sur
lame pour examiner la morphologie des cellules microbiennes sous un grossissement de 1000
X, et, pour les bactries, leur raction la coloration de Gram.
L'activit enzymatique de la catalase des bactries a t dtermin par le dpt dune
goutte de H2O2 27 % sur quelques unes des colonies restantes.
La raction des cellules microbiennes la coloration de Gram a t teste l'aide du
coffret Color Gram 2 (Biomrieux, France), mis en uvre selon les prescriptions du fabricant.
2.3.2 Dnombrements des groupes microbiens
Echantillonnage et prparation des dilutions en vue des dnombrements

Les dnombrements ont t effectus partir d'chantillons de 12 g 3 g de grains


frais rincs l'eau strile. La premire dilution a t ralise en dispersant les grains dans 9
fois leur volume de solution de Ringer dilue au quart, l'aide d'un Ultra-turrax T25 (IKALabortechnik, Allemagne). Pour les disperser, une vitesse de rotation vide de 8.000
tours.min-1 a t applique pendant 120 s. Les dilutions suivantes ont t ralises en suivant
les recommandations de la Fdration internationale de laiterie (FIL, Bruxelles) reprises dans
la norme FIL 122C: 1996.
Mthodes de dnombrement

Les mthodes appliques pour dnombrer les diffrents groupes microbiens drivaient
de la mthode de comptage des colonies dcrite dans la norme FIL 100B: 1991 (FIL,
61

MATRIEL ET MTHODES

Bruxelles). Elles s'en cartaient par rapport aux milieux et aux conditions d'incubation utiliss
(Tableau 2.3.1).
Tableau 2.3.1 : Conditions de culture appliques pour lisolement et lnumration des

groupes microbiens du grain.


Groupes microbiens
prsums

Milieux de culture

Conditions
dincubation

Lactobacilles

MRS-Agar 5,4* (Merck ; Darmstadt, Allemagne)

3 jours 37 C, en
anarobiose

Pdiocoques

MRS-Agar (Merck ; Darmstadt, Allemagne) + 0,05 % (p/v)


cystine hydrochloride, 10 mg.L-1 vancomycine, 0,1 mg.L-1
novobiocine (Sigma ; St. Louis, USA)

1 jour 37 C,
en anarobiose

Weissella viridescens

APT-Agar (Evans & Niven, 1951) + 5 % (p/v) NaCl (VWR BDH 3 jours 30 C, en
Prolabo ; Fontenay sous Bois, France)
anarobiose

Coques lactiques

M 17-Agar (Merck ; Darmstadt, Allemagne)

2 jours 37 C, en
arobiose

Leuconostocs

Milieu de Mayeux (AES ; Bruz, France)

10 jours 22 C,
en arobiose

Microcoques

Agar plate-count (PCA) au lait crm (Merck ; Darmstadt,


Allemagne) + 5 % (p/v) NaCl (VWR BDH Prolabo ; Fontenay
sous Bois, France)

3 jours 30 C, en
arobiose

Bactries actiques

Acetobacter Peroxydans Medium (Anonyme DSMZ, 2001)

3 jours 25 C, en
arobiose

Levures

YGC-Agar (Merck ; Darmstadt, Allemagne)

5 jours 22 C, en
arobiose

*pH ajust avec de l'acide actique glacial (ucb, Louvain, Belgique).

Estimation de la prcision des mthodes de dnombrement

La prcision des mthodes de dnombrement des lactobacilles, des coques lactiques et


des levures a t estime partir de 7 chantillons de grains de 11,2 0,6 g prlevs dans un
lot homogne de grains rincs et goutts.
Traitement des donnes

Les populations microbiennes n'observant pas une distribution normale, les paramtres
statistiques de moyenne et de dispersion des rsultats ont t calculs partir du logarithme en
base 10 des valeurs exprimes en units formant colonies par gramme (ufc.g-1).

62

MATRIEL ET MTHODES

Les paramtres statistiques ont ensuite t convertis dans une base dcimale en
appliquant les quations suivantes :
Moyenne gomtrique (ufc.g-1) = 10m, o m est la moyenne des valeurs logarithmiques (log ufc.g-1).
Ecart type relatif gomtrique (%) = (10(S) 1) x 100, o S est lcart type des valeurs logarithmiques.

2.3.3 Statistiques des essais rpts dans le temps

Les paramtres statistiques de moyenne et de dispersion de lensemble des mesures


effectues hebdomadairement sur les deux cultures individuelles du grain ont t calculs en
considrant les rsultats individuels comme des variables alatoires.
La variance associe chacune des composantes de la dispersion des rsultats, les
deux cultures individuelles et les semaines, a t dtermine l'aide de la procdure VCE du
logiciel SAS (SAS Institute, 1994).
2.3.4 Activit -galactosidase de la microflore du grain

Trois grains d'environ 4 g ont t cultivs individuellement dans du lait contenant


0,4 mg.ml-1 de 5-bromo-4-chloro-3-indolyl--D-galactopyranoside (X-gal, Biosolve b.v. ;
Valkenswaard, Pays-Bas). Les trois grains ont t mis en culture dans le lait additionn de Xgal avec un taux d'ensemencement de 20 % (p/v). Deux des grains ont t cultivs en parallle
22 C ; une des cultures tait maintenue au repos tandis que l'autre tait agite 140 tours
par minute. Le troisime grain a t cultiv indpendamment temprature ambiante et sans
agitation. Aprs 24 heures d'incubation les grains ont t rincs l'eau strile et
photographis.
Des prlvements locaux ont t effectus sur le grain cultiv indpendamment des
deux autres pour vrifier la prsence de bactries capables d'utiliser le X-gal dans les zones
restes inactives, non colores, du grain.
Les prlvements, effectus par frottis l'aide de cure-dents striles, ont t mis en
culture sur du milieu MRS-Agar (Merck ; Darmstadt, Allemagne). Aprs une incubation de
72 heures 37 C et en anarobiose, des gouttes de X-gal 40 mg.ml-1 ont t dposes sur les

63

MATRIEL ET MTHODES

colonies. La lecture des botes de Petri a t ralise aprs une seconde incubation de 24
heures 37 C et en anarobiose.
2.4

Identification molculaire des bactries lactiques du grain de kfir KJ

2.4.1 Comparaison des squences de l'European Molecular Biology Laboratory

Les squences de l'European Molecular Biology Laboratory (EMBL) ont t alignes


et compares l'aide du logiciel "Clustal W" (Thompson et al., 1994) de l'European
Bioinformatics Institute (EBI).
2.4.2 Squences bordant les rgions V1, V2 et V3 de l'ADNr 16S

Les rgions variables V1, V2 et V3 ont t localises dans l'ADNr 16S des bactries
lactiques laide de squences repres dduites des schmas de la structure secondaire de
lARN 16S de E. coli donns par Neefs et al. (1993). Les zones les plus conserves bordant
les rgions variables ont t localises sur le schma illustrant la variabilit des nuclotides et
leur squence nuclotidique a t dtermine partir du schma prcisant la squence des
diffrents nuclotides.
Les squences repres bordant la rgion variable V1 taient : 5'-CATGCAAGT-3' et
5'-GGTGAGTAA-3'. La squence repre 5'-GGTGAGTAA-3' tait commune V1 et V2
dont elle marquait le dbut, 5'-ATTAGCTAGTAGGTGGGGT-3' dlimitant l'autre extrmit
de V2. Les squences bordant V3 taient 5'-GTAAA-3' et, environ 65 nuclotides plus loin,
5'-AAG-3'.
La stabilit des nuclotides au sein de ces squences a t reprsente par un trait
d'autant plus fonc qu'ils sont plus conservs ; ceux parfaitement conservs dans toutes les
espces analyses par Neefs et al. (1993) ont t souligns par un double trait.
2.4.3 Taux de variabilit des nuclotides

Le taux de variabilit des nuclotides dans une squence de longueur donne (N) a t
dfini comme tant la variabilit moyenne des nuclotides de cette squence multiplie par
100.

64

MATRIEL ET MTHODES

n=N
n =1

Le taux de variabilit des nuclotides =

Xn
x 100

,o X est le nombre de nuclotides diffrents


aligns la position n, et N est le nombre de
nuclotides que comprend la squence.

2.4.4 Stratgie d'isolement et d'identification de l'ADN cibl

L'isolement de l'ADNr 16S cibl des micro-organismes du grain de kfir comprenait


plusieurs tapes (Ninane et al., 2006). Elles incluaient une extraction de l'ADN gnomique de
l'ensemble du consortium microbien d'un grain et l'amplification d'une rgion cible de
l'ADNr 16S. Cette tape damplification a t mise profit pour isoler lADNr 16S des
populations bactriennes minoritaires dans le grain de kfir KJ en terme dunits viables : leur
ADNr 16S t amplifi sparment de celui des populations bactriennes majoritaires.
Les fragments amplifis de l'ADNr 16S, issus d'un mlange bactrien, ont ensuite t
individualiss par clonage dans E. coli.
La squence des fragments individualiss a t dtermine et leur origine identifie par
comparaison avec les squences d'une banque de donnes.
2.4.5 Extraction de l'ADN gnomique
Mthode dextraction

L'ADN du kfir KJ a t extrait partir d'un grain de kfir frais et rinc l'eau strile
de 50 mg ; l'ADN des souches bactriennes types a t extrait partir du culot cellulaire
produit par 1,5 ml de culture "over-night" 30 C ou, pour Streptococcus thermophilus,
37 C ; l'ADN des isolats de lactobacilles a t extrait partir d'une colonie directement
prleve sur le milieu de culture glos. Le matriel biologique a t immerg, ou mis en
suspension pour les cellules bactriennes, dans une solution de lyse frachement prpare
compose de 100 l de NaOH 0,1 N et de 1 l de SDS 10 %. La lyse des cellules a t
complte par une alternance, rpte 3 fois, de chauffage au four micro-ondes pendant 60 s
et de refroidissement sur glace pendant 60 s. L'ADN a ensuite t prcipit par ajout de 10 l
de K-actate 3 M et de 200 l d'thanol 96 % froid (-20 C) au mlange maintenu sur glace.
Aprs 10 minutes, l'ADN a t spar de la phase liquide par centrifugation et le surnageant

65

MATRIEL ET MTHODES

limin. Le culot d'ADN, rinc l'thanol 70 % et sch temprature ambiante, a t


suspendu dans 50 l de Tris HCl 10 mM (pH 7,2).
Rendement de la mthode dextraction

Le rendement de la mthode dextraction de lADN a t estim sur les souches types


de Lactobacillus acidophilus, de Lb. casei, de Lb. kefiranofaciens subsp. kefirgranum et de
Lb. kefiri. LADN a t extrait partir de trois culots cellulaires de poids connu par souche.

Les extraits dADN ont ensuite t dposs en gel dagarose en quantits inversement
proportionnelles aux poids des culots cellulaires. La quantit dADN tait value par
lintensit du signal rvl sous UV, aprs migration pendant 36 minutes 70 V.
2.4.6 Amplification des fragments cibls d'ADN

L'ADN gnomique a t amplifi l'aide de l'amorce universelle 27F dcrite par


Rochelle et al. (1992), utilise en combinaison avec une amorce commune aux lactobacilles
(R350) ou avec une amorce spcifique aux coques lactiques (Lactococcus sp. et Streptococcus
thermophilus) et aux leuconostocs (R485), selon la population bactrienne cible. Les

amorces spcifiques l'un ou l'autre groupe microbien ont t dtermines l'occasion de


cette tude. Leurs squences ont t enregistres dans la banque de donnes de l'EMBL sous
les numros d'accession AM419049 et AM419050 respectivement pour R350 et R385. Les
squences des amorces taient les suivantes :
R350, 5'-TCCATTGTGGAAGATTCCC-3' (lactobacilles)
R485, 5'-TTAGCCGTCCCTTTCTGG-3' (coques lactiques plus leuconostocs).
Les indices (350 et 485) des amorces font rfrence aux positions du nuclotide
terminal de l'extrmit 3' de chacune d'elles sur le gne de l'ARNr 16S de la souche type de
Escherichia coli, enregistr sous le numro d'accession X80725 (Cilia et al., 1996).

Les ractions d'amplification ont t effectues partir de 2 l d'ADN auquel le


mlange ractionnel a t ajout de faon obtenir un volume total de 25 l. Le mlange
ractionnel tait compos de Tris-HCl (pH 8,0), de KCl, de MgCl2 et de chacun des dNTPs
des concentrations finales de 20 mM, 50 mM, 2,5 mM et 0,2 mM respectivement. Il contenait
en outre par raction : 20 pmol de chaque amorce et 1,25 U de Platinum Taq DNA
Polymerase (Invitrogen, Merelbeke, Belgique).
66

MATRIEL ET MTHODES

L'ADN a t dnatur, et l'enzyme active, une temprature de 95 C pendant 120 s.


Le fragment d'ADN a t amplifi durant 30 cycles comprenant une phase de dnaturation
94 C pendant 15 s, suivie par une phase d'hybridation pendant 60 s et une phase d'longation
72 C pendant 90 s. Pour augmenter la spcificit de l'hybridation, tout en conservant un
bon rendement d'amplification, les 10 premiers cycles ont t effectus une temprature
d'hybridation plus leve que les 20 cycles suivants. Les tempratures d'hybridation
appliques la paire d'amorces ciblant les lactobacilles (27F-R350) taient de 56 C et 49 C
respectivement pour les 10 premiers et les 20 cycles suivants. Celles appliques la paire
d'amorces ciblant les coques lactiques et les leuconostocs (27F-R485) taient respectivement
de 60 C et 53 C. Les ractions ont t compltes par une priode d'longation de 7 minutes
72 C et, ensuite, arrtes par refroidissement 4 C.
La qualit du produit a t vrifie par la migration d'un aliquote de 10 l dans un gel
d'agarose 2 %. Sa puret a t atteste par la prsence d'une seule bande d'ADN tandis que sa
taille a t estime par la migration simultane d'un marqueur de poids molculaire (100 pb
Ladder, Invitrogen, Merelbeke, Belgique).
2.4.7 Clonage des fragments d'ADN

Les fragments d'ADN ont t insrs dans le plasmide pCR2.1-TOPO et, ensuite,
transforms dans la souche TOP10 chimiquement comptente de E. coli l'aide du kit TOPO
TA Cloning (Invitrogen, Merelbeke, Belgique).
La taille des inserts a t vrifie par la migration en gel d'agarose du produit
d'amplifications gniques ralises avec les amorces M13-Forward et M13-Reverse propres
au plasmide. L'extraction de l'ADN des clones de E. coli, les ractions d'amplifications et
l'estimation de la taille des fragments amplifis ont t effectues de la mme faon que
prcdemment, except pour les cycles de temprature. Dans ce cas, l'ADN a t amplifi par
30 cycles identiques comprenant une phase de dnaturation 94 C pendant 30 s, suivie par
une phase d'hybridation 55 C pendant 30 s et une phase d'longation 72 C pendant 30 s.
2.4.8 Extraction de l'ADN plasmidique des clones de Escherichia coli

L'ADN plasmidique des clones de E. coli contenant l'insert squencer a t isol,


partir du culot cellulaire de 5 ml de culture over-night 37 C, l'aide du High Pure Plasmid
Isolation Kit distribu par Roche Diagnostics GmbH (Mannheim, Allemagne).
67

MATRIEL ET MTHODES

La qualit et la concentration des extraits d'ADN ont t estimes par


spectrophotomtrie UV partir d'aliquotes dilues 200 fois. La qualit de l'ADN a t atteste
par un rapport des absorbances 260 nm et 280 nm proche de 1,8. La concentration a t
calcule partir de l'absorbance 260 nm (A260), en considrant qu'une concentration en
ADN de 50 g.ml-1 livre une absorbance A260 = 1.
2.4.9 Squenage des inserts
Estimation du nombre de fragments squencer

Le nombre de fragments a t calcul partir de la loi binomiale : P = 1-(1-p)n o P est


la probabilit de dtecter dans "n" squences, au moins une squence particulire prsente en
proportion "p" dans la population totale.
Transforme, l'quation est la suivante :
Nombre de fragments squencer (n) = log (1-p) (0,05), si P = 95 %.

Mthode de squenage

Les ractions de squenage ont t effectues l'aide du DYEnamic Direct Cycle


Sequencing Kit with 7-deaza dGTP (Amersham Life Science Inc., USA). Pour chacune des 4
ractions de squenage, 0,3 g d'ADN plasmidique ont t mis en prsence du mlange
ractionnel prt l'emploi et de 0,5 pmol de l'une des amorces M13-Forward ou M13-Reverse
marques au colorant fluorescent IRD-800 (Biolegio, Malden, Pays-Bas).
Les fragments marqus ont t synthtiss au cours de 20 cycles comprenant
une phase de dnaturation 95 C pendant 30 s, suivie par une phase d'hybridation 45 C
pendant 15 s et une phase d'longation 70 C pendant 30 s.
Les produits de synthse ont t dnaturs 70 C pendant 180 s puis spars par
migration en gel d'acrylamide 5,5 % (KB+ Gel Matrix, Li-Cor Inc., Lincoln, USA).
La lecture des squences a t effectue l'aide du squenceur automatique Gene
ReadIRTM DNA Analysis System L4200S-1 (LI-Cor Inc., Lincoln, USA).

68

MATRIEL ET MTHODES

Traitement des squences

Les squences du brin dans lequel s'inscrit la squence de l'amorce d'amplification 27F
(Rochelle et al., 1992) ont t exploites telles quelles, tandis que les squences
correspondant au brin complmentaire ont t transcrites. Leur transcription a t ralise
l'aide des logiciels Microsoft Word 2000 et Microsoft Excel 2000 (Microsoft Corporation,
Washington, USA) selon la procdure suivante : le format de la police des squences a, si
ncessaire, t uniformis dans Word de faon inclure exclusivement des lettres capitales.
Les donnes, livres sous la forme d'une succession de lettres (symboles des nuclotides), ont
ensuite t copies dans Excel et mises en forme l'aide de la fonction Convertir de faon
avoir une lettre par cellule. L'ordre des lettres ainsi mises en forme a t invers l'aide de la
fonction Concatener du logiciel Excel. Pour terminer la transcription de la squence, le
symbole de chacun des nuclotides successifs a t remplac par celui du nuclotide
complmentaire l'aide de la fonction Rechercher-Remplacer de Excel en prenant soin de
remplacer un caractre majuscule par un caractre minuscule et de "respecter la casse".
La rgion V1 de chacune des squences, brutes ou transcrites selon le brin concern, a
t localise visuellement l'aide des squences repres donnes au paragraphe 2.4.2. Les
squences V1 ont t alignes dans Word et compares visuellement. Elles ont t regroupes
sur base de leurs similitudes et la squence consensus du groupe a, le cas chant, t
dtermine. Pour dterminer l'origine bactrienne des squences V1, la squence consensus
du groupe de similitude ou, en l'absence de squence consensus, toutes les squences du
groupe ont t compares avec celles de la banque de l'EMBL l'aide du moteur de recherche
FASTA (Pearson & Lipman, 1988) de l'EBI.
La mme dmarche a t effectue pour analyser la rgion V2 des leuconostocs.
2.5

Isolement des micro-organismes du grain de kfir KJ et identification des isolats

2.5.1 Isolement des micro-organismes du grain de kfir


Mise en culture

Les micro-organismes du grain KJ ont t isols partir dchantillons de grains


disperss dans une solution de dilution comme dcrit au paragraphe 2.3.2.

69

MATRIEL ET MTHODES

Des aliquotes de 0,1 ml de la suspension dilue ont t tales sur les milieux de
culture slectifs repris dans Tableau 2.3.1, except pour les lactobacilles. Les lactobacilles ont
t isols sur les milieux Rogosa-CW (Kojima et al., 1993) et KPL (Toba et al., 1986).
Amplifications gniques pour la slection des isolats de lactobacilles

Les lactobacilles identifis dans le grain de kfir KJ par la voie molculaire


comprenaient 3 espces. Des isolats de chacune des espces identifies ont t slectionns
sur le milieu Rogosa-CW par amplifications gniques (PCR) effectues laide d'amorces
spcifiques dtermines dans le cadre de ce travail.
Les squences des amorces utilises, en combinaison avec l'amorce R350, pour
slectionner les isolats de Lb. kefiranofaciens, de Lb. kefiri et de Lb. parakefiri taient
respectivement : 5'-ACTTCGGTGAGGACGCTG-3', 5'-GAACGCGTTTCCGTTATTG-3' et
5'-CGGCCAATGATTTCAGGTG-3'. Les positions, sur le gne de l'ARNr 16S de la souche
type de Escherichia coli, numro d'accession X80725 (Cilia et al., 1996), du nuclotide
terminal de l'extrmit 3' de chacune des amorces spcifiques taient 83, 22 et 73
respectivement.
L'ADN a t extrait partir des colonies par la mthode dcrite au paragraphe 2.4.4.
Les ractions d'amplification gniques ont t mises en oeuvre de la faon dcrite au
paragraphe 2.4.5, avec des tempratures d'hybridation communes aux trois couples d'amorces,
de respectivement 45 C et 38 C pour les 10 premiers et les 20 cycles suivants.
La spcificit des amorces avait t vrifie sur les souches types des trois espces
vises. Utilises avec lamorce R350, les amorces spcifiques chacune des espces
amplifiaient des fragments de la longueur attendue (environ 300 bp) lorsqu'ils taient
appliqus la souche type de l'espce cible, et pour Lactobacillus kefiranofaciens celles de
ses deux sous-espces, tandis qu'aucun fragment n'tait amplifi lorsqu'ils taient appliqus
aux deux autres espces du groupe (rsultats non prsents).
Purification des isolats

Les isolats ont t purifis par des isolements successifs sur leur milieu de culture
slectif respectif. La puret des isolats a t vrifie par lobservation microscopique
(grossissement de 1000 X) de lhomognit de la morphologie des cellules et, pour les

70

MATRIEL ET MTHODES

lactobacilles, par la rponse ngative de PCR effectues avec les amorces spcifiques aux
autres espces du groupe identifies dans le grain KJ.
2.5.2 Tests didentification
Bactries lactiques

Pralablement aux tests phnotypiques, les isolats purifis ont t cultivs 24 heures
30 C en bouillon MRS acidifi un pH de 5,4 avec de l'acide actique pour les lactobacilles,
en bouillon M17 pour les coques lactiques et en bouillon MRS pour les leuconostocs. Les
lactobacilles ont t incubs en anarobiose tandis que les coques lactiques et les leuconostocs
ont t cultivs en arobiose.
La raction des isolats bactriens la coloration de Gram a t teste l'aide du coffret
Color Gram 2 et leur profil de fermentation a t dtermin en galeries API 50 CH. Le coffret
Color Gram 2 et les galeries API 50 CH ont t mis en oeuvre selon les prescriptions du
fabricant (Biomrieux, France).
La voie de fermentation des isolats a t dtermine selon la mthode de Gibson &
Abdel-Malek (1945), dans le milieu au jus de tomate dcrit par les auteurs pour les
lactobacilles, dans du bouillon M17 pour les coques lactiques et dans du bouillon MRS pour
les leuconostocs.
Le bouillon MRS tait fourni par Oxoid (Basingstoke, Royaume-Uni) et le bouillon
M17, par Merck (Darmstadt, Allemagne).
Les protines dun isolat de Leuconostoc sp. ont t analyses en sous-traitance par le
Belgian Co-ordinated Collections of Micro-organisms (Gand, Belgique) par la mthode
d'lectrophorse en conditions dnaturantes (SDS-PAGE). D'aprs leur description
mthodologique, la prparation des extraits cellulaires et l'lectrophorse des protines en
conditions dnaturantes (SDS-PAGE) ont t excutes selon le protocole tabli par Pot et al.
(1994) tandis que le profil des protines a t digitalis et compar aux profils de souches de
rfrence de bactries lactiques l'aide du logiciel Bionumerics (Applied Maths, Belgique).

71

MATRIEL ET MTHODES

Bactrie actique

La bactrie actique a t identifie en sous-traitance par le Belgian Co-ordinated


Collections of Micro-organisms (Gand, Belgique) sur base de la squence de lADNr 16S de
lisolat. D'aprs leur description mthodologique, l'ADN gnomique a t prpar selon le
protocole tabli par Niemann et al. (1997). L'ADN a t amplifi avec les amorces 16F27 et
16R1522 de l'institut et purifi l'aide du NucleoFast 96 PCR Clean-up Kit (MachereyNagel, Dren, Allemagne).
Les ractions de squenage ont t effectues l'aide du BigDye Terminator Cycle
sequencing Kit (Applied Biosystems, Foster City, CA, USA) et purifies l'aide du
Montage SEQ96 Sequencing Reaction cleanup Kit (Millipore, Bedford, MA, USA). Le
squenage a t effectu l'aide d'un ABI Prism 3130XL Genetic Analyser (Applied
Biosystems, Foster City, CA, USA).
Les ractions de squenage ont t effectues avec 3 amorces de l'institut : 16F358,
16R339 et 16R519, de sorte que les morceaux de squence se chevauchent partiellement. Le
chevauchement partiel des morceaux de squence facilite leur assemblage effectu ici l'aide
du programme AutoAssembler (Applied Biosystems, Foster City, CA, USA).
L'analyse phylogntique des squences de l'isolat et des souches types a t effectue
l'aide du logiciel BioNumerics (Applied Maths, Belgique).
Levure

La levure a t identifie par lobservation de la morphologie des cellules et par


l'examen de caractristiques physiologiques (profil de fermentation de sucres et d'activit
enzymatique).
Le profil de fermentation et d'activit enzymatique a t dtermin l'aide d'une
galerie API Candida mise en oeuvre selon les prescriptions du fabricant (Biomrieux, France).

72

MATRIEL ET MTHODES

2.6

Formation du grain de kfir KJ

2.6.1 Prparation des extraits de grain

La microflore du grain KJ a t disperse dans du lait UHT par battage pendant 10


minutes l'aide d'un Stomacher Lab-Blender 400 (Seward Medical UAC House, Londres).
Une masse minimale de 100 g de grains a t disperse dans un volume quivalent de lait
(rapport poids:volume de 1:1).
Le lait ensemenc a t filtr au travers de 4 couches de gaze strilises l'autoclave
(121 C pendant 20 minutes) ou au travers dun tamis souple synthtique (filtre chicore)
strilis dans de leau de Javel et rinc leau strile.
2.6.2 Conditions de prculture des souches individuelles

Pralablement aux essais mis en oeuvre partir du consortium reconstitu, les isolats
purifis ont t cultivs dans les conditions prcises dans le Tableau 2.6.1.

Tableau 2.6.1 : Conditions de prculture des souches microbiennes utilises dans les essais

mis en uvre partir du consortium reconstitu.


Identification des souches

Bouillons de culture

Conditions dincubation

Lactobacillus kefiranofaciens subsp.


kefirgranum (KPL 4)

KPL (Toba et al., 1986)

3 jours 30 C, en
anarobiose

Lactobacillus kefiri (KPL 6)

KPL (Toba et al., 1986)

3 jours 30 C, en
anarobiose

Lactobacillus parakefiri (R-CW 110)

Rogosa-CW (Kojima et al., 1993)

3 jours 30 C, en
anarobiose

Lactococcus lactis (RM 31)

Lait UHT

3 jours 30 C en
arobiose

Leuconostoc mesenteroides (RM 2)

Lait UHT

3 jours 30 C, en
arobiose

Acetobacter sp. (LMG 24630)

Acetobacter Peroxydans Medium


(Anonyme DSMZ, 2001)

3 jours 25 C, en
arobiose

Kazachstania exigua (MUCL 49750)

YGC (FIL 94B:1991)

5 jours 22 C, en
arobiose

73

MATRIEL ET MTHODES

2.6.3 Bouillons de synthse utiliss pour vrifier les proprits d'agglutination du


consortium

La vrification de l'activit agglutinante du consortium extrait du grain a t effectue


dans du bouillon Rogosa-CW (Kojima et al., 1993), du bouillon KPL (Toba et al., 1986), du
bouillon MRS (Oxoid, Basinstoke, Royaume-Uni) acidifi un pH de 5,4 avec de l'acide
actique glacial (UCB-RPL, Louvain, Belgique) strilis par filtration et du bouillon M17
(Oxoid, Basinstoke, Royaume-Uni).
2.6.4 Bouillons base de lait utiliss dans les essais daptitude du lait la croissance et
dans les essais de formation de biofilms

Les bouillons consistaient en du lait nature (lait), du lait acidifi un pH de 5,5 avec
de l'acide actique glacial (UCB-RPL, Louvain, Belgique) strilis par filtration (lait5,5), du
lait additionn raison de 5 % (v/v) d'thanol absolu (VWR ; Fontenay sous Bois, France)
strilis par filtration (lait + thanol), du lait additionn dune solution strile de D-glucose
(Merck ; Darmstadt, Allemagne) 10 % (p/v) de faon avoir une concentration finale en
glucose de 5 g.l-1 (lait + glucose), du lait additionn dune solution strile d'extrait de levure
(Oxoid ; Basinstoke, Royaume-Uni) 10 % (p/v) de faon avoir une concentration finale en
extrait de levure de 5 g.l-1 (lait + extrait de levure) et du lait additionn de 0,25 ml.l-1 de
prsure (Berthelot ; Meursault, France) strilise par filtration (lait + prsure).
Le lait utilis tait du lait UHT demi-crm de la marque INEX (Bavegem, Belgique)
pour les premiers essais conduit partir du consortium extrait du grain et partir du
consortium reconstitu, et de la marque CANDIA (Lyon, France) pour les seconds essais
conduits partir des ces deux consortiums.
2.6.5 Taux densemencement des bouillons

Un volume de 20 ml de chacun des bouillons de culture a t ensemenc en bote de


Petri avec 2 ml dextrait de grain ou avec 0,2 ml de chacune des prcultures des souches
individuelles.

74

MATRIEL ET MTHODES

2.6.6 Conditions de culture des tmoins de croissance des souches individuelles

En parallle des essais de formation de biofilms partir du consortium reconstitu, les


souches individuelles ont t cultives dans les conditions reprises au Tableau 2.6.2.

Tableau 2.6.2 : Conditions de culture des tmoins de croissance des souches individuelles

utilises dans les essais de formation de biofilms partir du consortium reconstitu.


Identification des souches

Bouillons de culture

Conditions d'atmosphre

Lactobacillus kefiranofaciens subsp.


kefirgranum (KPL 4)

MRS 5,4 * (Oxoid, Basinstoke, Royaume-Uni)

Anarobiose

Lactobacillus kefiri (KPL 6)

MRS 5,4 * (Oxoid, Basinstoke, Royaume-Uni)

Anarobiose

Lactobacillus parakefiri (R-CW 110) MRS 5,4 * (Oxoid, Basinstoke, Royaume-Uni)

Anarobiose

Lactococcus lactis (RM 31)

M17 (Oxoid, Basinstoke, Royaume-Uni)

Arobiose

Leuconostoc mesenteroides (RM 2)

MRS (Oxoid, Basinstoke, Royaume-Uni)

Arobiose

Acetobacter sp. (LMG 24630)

Acetobacter Peroxydans Medium (Anonyme


DSMZ, 2001)

Arobiose

Kazachstania exigua (MUCL 49750) YGC (FIL 94B:1991)

Arobiose

*pH ajust avec de l'acide actique glacial (UCB-RPL, Louvain, Belgique) strilis par filtration.

75

RSULTATS

RSULTATS

3.1

Qualit hyginique du grain de kfir KJ

3.1.1 Evolution du pH du grain au cours des cycles hebdomadaires de culture

Lvolution de lacidit des grains au cours des cycles de culture appliqus au


laboratoire a t tablie pour valuer la sensibilit du grain de kfir KJ une contamination
par des germes pathognes.
La succession des cycles de culture appliqus au laboratoire se caractrisait par une
discontinuit hebdomadaire : une priode dattente de 48 heures succdait 5 cycles de 24
heures. Paralllement, le taux densemencement du lait tait rajust une fois par semaine et
non loccasion de chacun des cycles de culture. Cette discontinuit dans la succession des
cycles et le rajustement hebdomadaire du taux densemencement craient des conditions de
culture variables entre les cycles de culture. Cette variabilit a t prise en compte en
mesurant le pH de grains prlevs indiffremment au cours de chacun des cycles de culture
successifs.
Par ailleurs, le procd dchantillonnage des grains (paragraphe 2.2.1) modifiait
temporairement les conditions de culture. Pour minimiser linfluence de ces manipulations sur
lvolution de lacidit des grains, le nombre de prlvement effectus par cycle de culture a
t limit 1.
Les grains ont t prlevs et leur pH relev aprs des dures d'incubation variables de
faon couvrir les 24 heures d'un cycle de culture.
Dans les conditions du laboratoire, taux densemencement de 20 % et temprature de
22 C (paragraphe 2.1.1), le pH du grain de kfir KJ variait de 4,2 - 4,3 3,4 - 3,6 au cours
dun cycle moyen de culture de 24 heures (Figure 3.1.1). Le cycle de culture tait rpt 5 fois
puis prolong par une priode de 48 heures pendant laquelle le grain tait maintenu dans le
lait acidifi, c'est--dire un pH infrieur 3,6.

77

RSULTATS

5,0
4,8
4,6

pH du grain

4,4
4,2
4,0
3,8
3,6
3,4
3,2
3,0
0

10

12

14

16

18

20

22

24

Dure d'incubation (heure)

Figure 3.1.1 : Evolution de lacidit du grain de kfir KJ au cours dun cycle de culture de 24

heures.
3.1.2 Germes pathognes et indicateurs de dfauts d'hygine

Linnocuit du grain de kfir KJ a t vrifie par la recherche dune contamination


par des germes pathognes et indicateurs de dfauts d'hygine.
Les germes recherchs ont t slectionns sur base des prescriptions lgislatives et
sur base des recommandations de la Fdration internationale de laiterie (FIL, Bruxelles). Ils
comprenaient Listeria monocytogenes, les Salmonella sp., les staphylocoques coagulase
positive, les coliformes, les moisissures et les micro-organismes contaminants tels que dfinis
par la norme FIL 153:1991.
Aucune croissance des germes recherchs dans le lait ferment partir du grain de
kfir KJ na t observe aux seuils de dtection appliqus (Tableau 3.1.1.).
Les seuils de dtection appliqus pour la recherche des germes prescrits par des textes
de loi, cest--dire tous les germes excepts les micro-organismes contaminants,
correspondaient aux limites fixes par ceux-ci ou permettaient, dans le cas des coliformes, de
les respecter. Le seuil de dtection appliqu pour les coliformes respectait la recommandation,
plus restrictive, de la FIL : larrt royal prvoit labsence de coliformes dans 0,1 ml tandis
78

RSULTATS

que, pour les levains, la norme 149A:1997 de la FIL prescrit labsence de ce groupe
microbien dans 1 ml de produit.
Le seuil de dtection des micro-organismes contaminants, de 10 ufc.ml-1, permettait de
respecter la recommandation de la FIL relative ce groupe microbien. La FIL recommande,
dans sa norme de composition des levains lactiques de cultures de bactries lactiques
(149A:1997), un niveau de contamination infrieur 50 ufc.g-1.
Tableau 3.1.1 : Qualit hyginique du lait ferment partir du grain de kfir KJ (juin 2007).
Germes ou groupes de germes recherchs

Rsultats

Listeria monocytogenes

absence dans 25 ml

Salmonella sp.

absence dans 25 ml

Staphylocoques coagulase positive

< 10 ufc.ml-1

Coliformes

absence dans 1 ml

Moisissures

< 100 ufc.ml-1

Micro-organismes contaminants

< 10 ufc.ml-1

3.2

Identification et quantification des groupes microbiens du grain de kfir KJ

Les grains de kfir comprennent une microflore banale diversifie, compose de


bactries lactiques et de levures, parfois associes des bactries actiques et/ou des
microcoques. Les bactries lactiques recenses dans la littrature relative la composition
microbienne de grains de kfir incluent des lactobacilles, des pdiocoques, des coques
lactiques, des leuconostocs et Weissella viridescens (Tableau 1.1.1).
3.2.1 Identification des groupes microbiens du grain

Les groupes microbiens participant au consortium du grain KJ, parmi ceux recenss
dans la littrature, ont t identifis sur base de leur capacit crotre sur des milieux de
culture slectifs.
Les milieux de culture slectifs utiliss (Tableau 2.3.1) respectivement pour
lisolement des lactobacilles, des coques lactiques, des leuconostocs, des bactries actiques
et des levures ont conduit un dveloppement microbien.

79

RSULTATS

Aucun dveloppement microbien ntait par contre observ sur les milieux utiliss
pour l'isolement des pdiocoques, de Weissella viridescens et des microcoques. Dans les trois
cas, l'adquation des conditions de culture tait confirme par le dveloppement microbien
obtenu en parallle partir de tmoins positifs : la souche type de Pediococcus acidilactici
pour les pdiocoques, la souche DSM 20248 d'origine laitire de W. viridescens pour les
reprsentants de ce taxon et du lait cru pour les microcoques. Le dveloppement, partir du
lait cru, de micro-organismes sapparentant des microcoques tait confirm par leur
coloration de Gram et leur raction au test de catalase ainsi que par la morphologie et
lagencement des cellules. Tels que dcrits (Kocur, 1984), les microcoques prsums
dvelopps partir du lait cru taient Gram positifs, catalase positifs, de forme sphrique et
certains taient associs en ttrades.
Les colonies dveloppes partir du kfir KJ sur le milieu utilis pour l'isolement des
lactobacilles prsentaient deux types morphologiques : certaines taient blanches et opaques
tandis que d'autres taient translucides. Les colonies dveloppes sur chacun des autres
milieux de culture ne prsentaient pas, entre elles, de diffrences morphologiques
significatives.
Les caractristiques cellulaires de raction la coloration de Gram, de raction au test
de catalase et morphologiques taient uniformes entre les colonies bactriennes dveloppes
sur un mme milieu, y compris pour celles, diffrentes daspect, dveloppes sur le milieu
ddi aux lactobacilles. Elles correspondaient (Tableau 3.2.1) celles dcrites pour chacun
des groupes microbiens prsums : cellules Gram positives et catalase ngatives, en forme de
btonnets pour les lactobacilles (Kandler & Weiss, 1986) ou sphriques pour les coques
lactiques et les leuconostocs (Hardie, 1986 ; Garvie, 1984) ; cellules Gram ngatives, catalase
positives, ovodes et souvent en paires pour les bactries actiques (De Ley et al., 1984).
Les levures formaient des colonies glabres et prsentaient une morphologie cellulaire
typique de ce groupe par sa taille, suprieure celle des bactries, et par la formation, pour
certaines dentre-elles, de bourgeons.

80

RSULTATS

Tableau 3.2.1 : Coloration de Gram, raction au test de catalase et morphologie cellulaire des

bactries dveloppes sur les milieux de culture slectifs.


Groupes microbiens prsums

Coloration de Gram

Test de catalase Morphologie des cellules

Colonies blanches et opaques

Positif

Ngatif

Cellules allonges (btonnets)


de longueur variable

Colonies translucides

Positif

Ngatif

Cellules allonges (btonnets)


de longueur variable

Coques lactiques

Positif

Ngatif

Cellules sphriques

Leuconostocs

Positif

Ngatif

Cellules sphriques

Bactries actiques

Ngatif

Positif

Cellules ovodes par paires

Lactobacilles

Examens effectus sur 3 colonies.

3.2.2 Quantification des groupes microbiens du grain

Les cinq groupes microbiens identifis dans le grain de kfir KJ - les lactobacilles, les
coques lactiques, les leuconostocs, les bactries actiques et les levures - ont t dnombrs
par comptage des colonies dveloppes sur les milieux de culture slectifs (Tableau 2.3.1).
Leur abondance dans le grain a t estime partir de deux chantillons de grains
cultivs en parallle dans les conditions habituelles (paragraphe 2.1.1). La quantit de grains
mise en oeuvre au dbut des cycles hebdomadaires de culture, dans chacune des deux cultures
individuelles, tait de 50 10 g.
Les dnombrements microbiens effectus dans les deux cultures individuelles de
grains ont t rpts hebdomadairement pendant 2 ou 7 semaines selon le groupe microbien
examin. Les leuconostocs et les bactries actiques ont t dnombrs pendant 2 semaines
tandis que les lactobacilles, les coques lactiques et les levures ont t dnombrs pendant 7
semaines. Le lait UHT utilis pendant la dure de lessai provenait dun mme lot.
L'abondance moyenne des diffrents groupes microbiens participant au consortium
tait ingale (Tableau 3.2.2). En terme d'units formant colonies, les bactries lactiques
reprsentaient 73 % de la flore totale du grain tandis que les bactries actiques et les levures
en reprsentaient respectivement 21 % et 6 %. Parmi les bactries lactiques, les lactobacilles
taient plus nombreux dun facteur 1000 que les coques lactiques et les leuconostocs. Au sein

81

RSULTATS

de ce groupe lactique minoritaire, les leuconostocs taient, en moyenne, 4 fois plus abondants
que les coques lactiques.
Tableau 3.2.2 : Dnombrements des groupes microbiens participant au consortium du grain

de kfir KJ.
Groupes microbiens

Moyennes gomtriques (ufc.g-1)

Ecarts types relatifs gomtriques (%)


De l'ensemble (n)

Lactobacilles
Coques lactiques

1,4 10

28

28

440

29

35

24

41 (14)

420 (14)

3,9 10

Leuconostocs

1,5 . 10

12 (4)

Bactries actiques

4,0 . 107

18 (4) b

Levures

1,1 10

Entre semaines Entre doubles

43 (14)

n : nombre de mesures effectues intervalle d'une semaine dans 2 cultures de grains de kfir pendant : a) 7
semaines ; b) 2 semaines.

Les dnombrements de lactobacilles, de coques lactiques et de levures ont t


effectus en parallle, dans le mme contexte exprimental et statistique. Ces dnombrements
taient assortis dune variabilit ingale, 10 fois plus leve pour les coques lactiques que
pour les lactobacilles et les levures (Ecarts types relatifs gomtriques de lensemble des
rsultats, Tableau 3.2.2). Cette ingalit tait observe au cours du temps mais pas ou peu
entre les doubles (Ecarts types relatifs gomtriques entre semaines et entre doubles
respectivement, Tableau 3.2.2) ; dans ce cas la variabilit des coques lactiques tait moindre.
Cette diffrence de variabilit des dnombrements de coques lactiques entre les objets
(temps-doubles) indiquait qu'elle ne pouvait provenir exclusivement de la variabilit associe
la prcision de la mthode de dnombrement. Pour confirmer cette dduction et prciser
l'origine, mthodologique ou biologique, de la variabilit observe dans les dnombrements
des deux autres groupes microbiens, la prcision des mthodes de dnombrement appliques
aux lactobacilles, aux coques lactiques et aux levures a t estime partir d'chantillons de
grain provenant dun lot homogne de grains. Les prcisions de chacune de ces mthodes de
dnombrement taient, en terme d'cart type relatif gomtrique, de 9 %, 7 % et 4 %
respectivement.
Pour ces 3 groupes microbiens, la variabilit observe au cours du temps et celle
observe entre les cultures individuelles traites en parallle taient plus leves que la
variabilit lie la prcision de leur mthode de dnombrement (Ecarts types relatifs
82

RSULTATS

gomtriques entre semaines et entre doubles, Tableau 3.2.2). Dans les deux cas de figure, la
variabilit avait une signification biologique.
3.2.3 Identification des conditions de culture l'origine de la variabilit des abondances
microbiennes dans le grain de kfir

Les sources potentielles de cette variabilit ont t identifies par une analyse du
contexte environnemental des essais (paragraphe 4.2.3). Certaines ont t prcises en
analysant la rponse de la microflore du grain des modifications des conditions de culture.
La rponse de la microflore a t value par le dnombrement des micro-organismes du
grain ou par la visualisation de lactivit -galactosidase du consortium microbien du grain.
Influence de sjours rpts dans de leau et du rinage des grains sur labondance du grain
en lactobacilles, en coques lactiques et en levures

Le renouvellement du lait tait interrompu les samedis et dimanches et, pendant cette
priode dattente, le grain tait habituellement maintenu 22 C dans le lait ferment.
Lalternative qui a t teste tait de conserver le grain dans de leau 4 C. Rpts
hebdomadairement pendant 7 semaines, ces sjours dans de leau avaient une incidence sur
labondance des lactobacilles du grain mais pas sur celle des coques lactiques et des levures
(Tableau 3.2.3).
La maintenance habituelle des grains comprend leur rinage leau avant
lensemencement du lait frais. La suppression de cette tape de rinage pendant 7 semaines
na pas modifi labondance des groupes microbiens dans le grain (Tableau 3.2.3).
Tableau 3.2.3 : Dnombrements des groupes microbiens du grain de kfir KJ soumis des

conditions de culture diffrentes par rapport celles appliques habituellement.


Conditions de maintenances modifies par rapport
aux conditions habituelles

Dnombrements microbiens (ufc.g-1)


Lactobacilles
7

Conservation hebdomadaire dans de l'eau pendant


2 jours

1,3 . 10

Pas de rinage des grains entre deux cycles de


culture

2,1 . 108

Coques lactiques

Levures

7,4 . 106

1,1 . 105

2,1 . 107

1,1 . 10

Moyennes gomtriques de 2 mesures. La comparaison des valeurs avec celles obtenues dans les conditions de
maintenance habituelles (Tableau 3.2.2) a t effectue par le test t de Dunnett. La valeur en caractre gras est
diffrente de celle obtenue dans les conditions de maintenance habituelles au seuil = 0,05.

83

RSULTATS

Influence de lagitation des grains pendant la fermentation sur lactivit -galactosidase du


consortium

L'activit -galactosidase de la microflore du grain a t visualise l'aide d'un


substrat chromogne ajout au lait. La galactosidase est lenzyme qui catalyse lhydrolyse du
lactose, la principale source de carbone du lait. En se substituant au lactose, le substrat
chromogne, du X-gal, rvle lactivit fermentaire et indirectement la croissance des microorganismes capables de fermenter le lactose.
Les micro-organismes du grain capables d'une activit -galactosidase se
dveloppaient ingalement la surface de grains maintenus au repos pendant le cycle de
fermentation (Figure 3.2.2, a I et a II). Lorsque le milieu tait agit pendant la fermentation,
ces micro-organismes se dveloppaient uniformment la surface du grain (Figure 3.2.2, b).

aI

a II

Figure 3.2.2 : Visualisation du dveloppement microbien du grain l'aide d'un substrat

chromogne (X-gal). La rpartition des micro-organismes capables de mtaboliser le X-gal,


zones fonces, tait htrogne aprs un jour de culture sans agitation (a I et a II), tandis
qu'elle tait homogne lorsque la culture tait agite (b). Les prlvements microbiens
destins vrifier la prsence de micro-organismes capables de mtaboliser le X-gal dans les
zones restes inactives du grain ont t effectus aux endroits indiqus par les flches (a I).
La prsence, dans les zones restes inactives du grain, de bactries capables d'une
activit galactosidase a t vrifie partir disolats prlevs dans ces zones (Figure 3.2.2,
a I). Les colonies formes sur le milieu de synthse partir de ces prlvements taient

84

RSULTATS

capables de mtaboliser le X-gal : elles se coloraient (en bleu) aprs incubation en prsence
du substrat chromogne.
3.3

Identification molculaire des bactries lactiques du grain de kfir KJ

Les bactries lactiques du grain de kfir KJ ont t identifies par une approche
molculaire.
3.3.1 Identification des rgions variables de l'ADNr 16S

L'approche molculaire de l'identification bactrienne tait base sur l'analyse de


courtes squences de l'ADNr 16S. Les courtes squences les plus appropries l'identification
des lactobacilles, des coques lactiques et des leuconostocs de grains de kfir ont, dans ce but,
t dtermines en comparant des squences choisies de l'ADNr 16S.
Slection des squences

Les squences slectionnes cette fin (Tableau 3.3.1) provenaient de bactries


appartenant aux taxons identifis dans des grains de kfir (Tableau 1.1.1) et, pour renforcer la
reprsentativit des coques lactiques et des leuconostocs, de bactries appartenant des
taxons proches de ceux identifis dans des grains. Les squences slectionnes incluaient
ainsi une squence de la sous-espce hordnia de Lactococcus lactis et des squences de
Leuconostoc citreum et de Ln. pseudomesenteroides, deux espces dont les positions dans

larbre phylognique tabli partir de lADNr 16S sont proches des espces
Ln. mesenteroides et Ln. lactis identifies dans des grains de kfir (Collins et al., 1991).

Les squences slectionnes (Tableau 3.3.1) provenaient de la souche type des taxons
ou de souches dont la fiabilit de l'identification tait appuye par une publication.
Les gnomes des souches de Lactobacillus acidophilus, de Lb. brevis et de
Leuconostoc mesenteroides comprenaient respectivement 4, 5 et 4 oprons de lADNr 16S.

Les squences des 4 oprons de Ln. mesenteroides taient identiques, tandis que celles des
oprons des Lactobacillus sp. diffraient entre-elles par un nombre variable de nuclotides : la
squence d'un opron de Lb. acidophilus diffrait de 13 nuclotides par rapport aux autres,
tandis que les squences de 3 des 5 oprons de Lb. brevis diffraient, entre elles et par rapport
aux deux autres, de 2 ou 3 nuclotides selon la paire considre.
85

RSULTATS

Tableau 3.3.1 : Squences de l'European Molecular Biology Laboratory (Stoesser et al.,

2001) utilises pour identifier les rgions variables de l'ADNr 16S des bactries lactiques
cibles.
Numro
d'accession
EMBL

Longueur de
la squence,
en pb

Taxon

Rfrence

CP000033*

1572

Lactobacillus acidophilus

Altermann et al., 2005

CP000416*

1563

Lactobacillus brevis

Makarova et al., 2006

AM113777*

1559

Lactobacillus curvatus, souche type

non publi

AY773949*

1518

Lactobacillus delbrueckii subsp. delbrueckii,


souche type

Kao et al., 2007

AY773948

1494

Lactobacillus delbrueckii subsp. bulgaricus,


souche type

Kao et al., 2007

AY050173

1505

Lactobacillus delbrueckii subsp. lactis

Germond et al., 2003

M58819

1580

Lactobacillus fermentum, souche type

non publi

AF519171*

1747

Lactobacillus gasseri, souche type

non publi

AF429509

504

Lactobacillus helveticus, souche type

non publi

AJ621553*

1456

Lactobacillus kefiri, souche type

non publi

AJ575259*

1516

Lactobacillus kefiranofaciens subsp.


kefiranofaciens, souche type

Vancanneyt et al., 2004

D79212*

1522

Lactobacillus paracasei subsp. paracasei,


souche type

Mori et al., 1997

D16550

1520

Lactobacillus paracasei subsp. tolerans, souche


type

Mori et al., 1997

AY026750*

1396

Lactobacillus parakefiri, souche type

Krooneman et al., 2002

D79210*

1519

Lactobacillus plantarum subsp. plantarum,


souche type

non publi

AJ640078

1517

Lactobacillus plantarum subsp. argentoratensis,


souche type

Bringel et al., 2005

AF429476

507

Lactobacillus rhamnosus, souche type

Dobson et al., 2004

AB100803*

1499

Lactococcus lactis subsp. lactis, souche type

Mori et al., 2004

AB100802

1499

Lactococcus lactis subsp. cremoris, souche type

Mori et al., 2004

AB100804

1499

Lactococcus lactis subsp. hordnia, souche type

Mori et al., 2004

AF111948*

1505

Leuconostoc citreum, souche type

Choi et al., 2003

AB023968*

1451

Leuconostoc lactis, souche type

non publi

CP000414*

1549

Leuconostoc mesenteroides subsp.


mesenteroides, souche type

Makarova et al., 2006

AB023237*

1448

Leuconostoc pseudomesenteroides, souche type

non publi

AY188354*

1539

Streptococcus thermophilus, souche type

non publi

*Squences utilises pour localiser les rgions variables de l'ADNr 16S. Les squences enregistres sous un
numro d'accession commenant par CP comprennent toutes les copies ou oprons de l'ADNr 16S.

86

RSULTATS

Dans certains cas, les diffrentes sous-espces identifies dans des grains de kfir
taient reprsentes dans la slection des squences dADNr 16S par une squence unique
(Tableau 3.3.1). Dans ces cas, les squences de l'ADNr 16S des diffrentes sous-espces
taient identiques, ou quasiment, entre elles. Entre les sous-espces kefirgranum et
kefiranofaciens de Lb. kefiranofaciens, les squences des souches types, numros d'accession

respectifs AJ575259 et AJ575261, comportaient tout au plus un nuclotide diffrent. Cette


unique diffrence portait en fait sur la prsence dans une des deux squences dun nuclotide
variable qui pouvait tre identique celui de l'autre squence dans un cas sur deux. Entre les
diffrentes sous-espces de Ln.mesenteroides : mesenteroides, cremoris et dextranicum, les
squences des souches types, enregistres sous les numros d'accession respectifs CP000414,
AB023247 et AB023246 taient identiques.
Localisation des rgions variables de lADNr 16S

Dans cette tape de l'identification des rgions variables, le nombre de squences


examines a t limit une squence par espce. Seul un opron de Lb. acidophilus et un
opron de Lb. brevis, identifis par les numros de squence 155 et 169 respectivement, ont
t pris en compte. De mme, seule la squence de la sous-espce reprsentative de l'espce
au niveau de la souche type a t retenue. Les squences de Lb. helveticus, de Lb. rhamnosus
et de Lb. fermentum ont par ailleurs t cartes : d'une longueur d'environ 500 pb, les
squences de Lb. helveticus et de Lb. rhamnosus couvraient environ le tiers de la molcule et
auraient ds lors fauss l'analyse de rpartition des diffrences dans l'entiret de la molcule,
tandis que la prsence dun nombre lev de nuclotides indtermins dans la squence de
Lb. fermentum rendait difficile linterprtation de la comparaison de squences dune telle

longueur.
Lalignement des squences slectionnes (squences indiques par un astrisque,
Tableau 3.3.1) a t effectu l'aide de l'outil "Clustal W" de l'EBI (Thompson et al., 1994).
Les nuclotides des squences alignes ont ensuite t examins et leur variabilit dtermine
en chacune de leurs positions successives. La variabilit des nuclotides en chacune des
positions de l'alignement a t schmatise au fur et mesure de sa dtermination de faon
en visualiser le degr et la rpartition dans la molcule dADNr 16S (Figure 3.3.1).

87

RSULTATS

La reprsentation schmatique de l'ADNr 16S de bactries lactiques rvlait une


variabilit plus intense des nuclotides en certains endroits localiss prfrentiellement dans
la partie 5' de la molcule (Figure 3.3.1).
5'-oo..oo..oo.o........o.............o..................o..o..o
ooOOOoOOOoOo..ooooooooo..oooooooOooo..ooooooooOOOooooo..oo..
.o.oo..........o...o.oO..o.....oo.ooo.oOo....o.o.ooo........
V2
oooo..........O...oooooOOoOoo.o.oo.ooOoOOooo.o....oo.ooooOo.
.ooo.o.ooooo....oOo.o...oo.o.....o.o.oo...oo.....o...oo...oo
.o.ooo...o.o.......oo......oo.o..........o............o.....
..o...............o......o.........oo......oo.o..oo....oo...
...o........o....o.....oo..o..oo......o.o......oooooo.....OO
V3
OOOOoooo..oo..oo.OoooOOOOoo.......Ooooooo......oo........o..
..........................o..oo.o......o....................
......o....oo..ooOOo..o.....oo..o....o.oooo...o...ooOo.oooo.
.o.oo.....ooooooo........oo.o..o..oo...o...o................
o..................o...o...o........o....o.oo..o.o.ooo......
.oo.............oo....o...o............................o....
.........ooo...oo...oo.oooooo.o.ooooo.oo..ooo.o...o......o..
..ooo.................o........o........................o...
................................o..o........................
.....oooOOo.oooooooo......oooo.Oo.ooo......ooooOOoooo.......
........oo..................................................
....o.o.oooo........o....o..o..........oooo...........o.o...
...........o.....o.......oo.................................
...........Ooooo........Oo..o.oOoO.oo.Ooooo...oo......o...oo
ooo............o..o..o..........o..o..o....oo...............
..o.........o...o..................ooo......................
..o.o....o..o.ooo...o...oo...oooo.....oooo..o.oo.ooo..ooo...
...ooo.o.oo....-3'
V1

Figure 3.3.1 : Variabilit des nuclotides successifs de l'ADNr 16S de bactries lactiques,

schmatise partir de l'alignement des 16 squences indiques par un astrisque dans le


Tableau 3.3.1. Le nombre de nuclotides diffrents en une position donne de l'alignement est
reprsent par les symboles suivants : . pour 1 mme nuclotide dans toutes les squences de
bactries lactiques alignes ; o, o et O pour respectivement 2, 3 et 4 nuclotides diffrents.
Les rgions variables V1, V2 et V3 sont soulignes et identifies dans la marge de gauche.
Ces zones plus variables de la partie 5' de l'ADNr 16S de bactries lactiques ont t
dlimites sur base des rgions variables dcrites par Neefs et al. (1993). Les rgions
variables dcrites par ces auteurs dans l'ARNr 16S de E. coli ont t localises dans
l'ADNr 16S des bactries lactiques laide de squences repres relativement bien conserves
entre les espces (paragraphe 2.4.2). Ces dernires ont t dduites dans le cadre de ce travail,
partir de schmas de l'ARNr 16S de E. coli donns par Neefs et al. (1993).

88

RSULTATS

Entre les squences de bactries lactiques, les rgions V1, V2 et V3 ainsi dfinies
(Figure 3.3.1) prsentaient un taux de variabilit des nuclotides de respectivement 238 %,
187 % et 209 % (paragraphe 2.4.3).
Dtermination de l'applicabilit des rgions variables la diffrenciation des espces

Le domaine d'application des rgions V1, V2 et V3 en matire d'identification


bactrienne a t dtermin de faon inclure des squences de toutes les espces associes
des grains de kfir qui ont t recenses dans le Tableau 1.1.1. La comparaison des squences
a ds lors t largie aux squences imparfaites de Lb. helveticus, de Lb. rhamnosus et de
Lb. fermentum (Tableau 3.3.1). Elle incluait par ailleurs tous les oprons diffrents de
Lb. acidophilus et de Lb. brevis et, pour les espces comprenant plusieurs sous-espces, toutes

les squences de leurs sous-espces (Tableau 3.3.1).


Les rgions variables ont t examines par ordre dcroissant de variabilit et en
fonction de la pertinence de l'examen. La comparaison des squences a t effectue partir
de leur alignement.
L'alignement des rgions V1 sorganisait en quatre groupes, distincts la fois par la
longueur des fragments et par la squence des nuclotides (Figure 3.3.2).
Les squences de la rgion V1 des lactobacilles se rpartissaient dans deux groupes :
un des groupes (groupe 1, Figure 3.3.2) comprenait les squences des lactobacilles
htrofermentaires, facultatifs ou obligatoires, et dun lactobacille homofermentaire,
Lb. gasseri ; lautre groupe (groupe 2, Figure 3.3.2) comprenait exclusivement les squences

de lactobacilles homofermentaires. Les squences de la rgion V1 des coques lactiques et des


leuconostocs s'ordonnaient dans des groupes distincts, spcifiques chacun des groupes
microbiens (groupes 3 et 4 respectivement, Figure 3.3.2).
Les squences de la rgion V1 des lactobacilles se distinguaient de celles des coques
lactiques et des leuconostocs notamment par la longueur des fragments : comprise entre 59 et
72 nuclotides pour les lactobacilles, la longueur des fragments tait de 47 et 48 nuclotides
respectivement pour les coques lactiques et les leuconostocs. Entre les coques lactiques et les
leuconostocs, les squences de la rgion V1 se distinguaient par les diffrences
nuclotidiques. Entre ces deux groupes, les squences diffraient par au moins 17 nuclotides.

89

RSULTATS

Groupe 1
Lb. kefiri
Lb. brevis
Lb. rhamnosus
Lb. paracasei
Lb. gasseri
Lb. parakefiri
Lb. fermentum
Lb. curvatus
Lb. plantarum

CGAACGCGTTTCCGTTATTGATTTTAGGTGCTTGCATTTAGAATGATTTAACACGGAAACGAGTGGCGAACT
CGAACGAGCTTCCGTT---GAAT-GACGTGCTTGCACT---GAT--TTWAACAATGAAGCGAGTGGCGAACT
CGAACGAGTTCTGATTATTGAA-AGGTGCTTGCATCTTG-----ATTTAATTTTGAA-CGAGTGGCGGACG
CGAACGAGTTCTCGTTGATGA-T--CGGTGCTTGCACC-GAGA---TTCAACA-TGGAACGAGTGGCGGACG
CGAGCGAGCTTGCCTAGATGAATTT-GGTGCTTGCACCAGATGAAACTAGATA--CAAGCGAGCGGCGGACG
CGAACGCGTCTTGGCNAATGATTTTAGGTGCTTGCACTTGAAA-GATTTGACATTGAGACGAGTGGCGAACT
CGAACGCGTTGGCCCAATTGATTGATGGTGCTTGCACCTGATT-GATTTTGGTCGCNTACNAGTGGCGGACG
CGAACGCACTCTCGT--TAGATTGAAGAAGCTTGCTTCTGATT--GATAACATTTGAGT-GAGTGGCGGACG
CGAACGAACTCTGGTA-TTGATT---GGTGCTTGCATC--ATG--ATTTACATTTGAGT-GAGTGGCGAACT

72
63
64
64
69
71
71
67
63

CGAGCGAGCAGAACCAGCAGATTTA-----CTTCGGTAATGAC--GCTGGGG----ACGCGAGCGGCGGATG
CGAGCGAGCGGAACCAGCAGAATCA-----CTTCGGTGAGGAC--GCTGGGA----AAGCGAGCGGCGGATG
CGAGCGAGCTGAACCAACAGATTCA-----CTTCGGTGATGAC--GTTGGGA----ACGCGAGCGGCGGATG
CGAGCGAGCTGAATTCAAAGATYC------CTTCGG-GRTGATTTGTTGG------ACGCTAGCGGCGGATG

61
61
61
59

Groupe 2
Lb. helveticus
Lb. kefiranofaciens
Lb. acidophilus
Lb. delbrueckii
Groupe 3
L. lactis
St. thermophilus

TGAGC--GMTGAAGRTT---------GGTRCTTGYACC--------------RAYTKGAWGAGCAGCGAACG 47
AGAAC--GCTGAAGAGA---------GGAGCTTGCTCT--------------TCTTGGATGAGTTGCGAACG 47

Groupe 4
Ln. pseudomesenteroides
Ln. mesenteroides
Ln. lactis
Ln. citreum

CGAAC--GCACAGCGAAA--------GGTGCTTGCACC--------------TTTCAAGTGAGTGGCGAACG
CGAAC--GCACAGCGAAA--------GGTGCTTGCACC--------------TTTCAAGTGAGTGGCGAACG
CGAAC--GCGCAGCGAAA--------GGTGCTTGCACC--------------TTTCAAGCGAGTGGCGAACG
CGAAC--GCGCAGCGAGA--------GGTGCTTGCACC--------------TTTCAAGCGAGTGGCGAACG

48
48
48
48

Figure 3.3.2 : Alignement de la rgion V1 de l'ADNr 16S de bactries lactiques dont les

numros d'accession sont donns dans le Tableau 3.3.1. Les squences sont crites dans le
sens 5' 3', avec, en marges, le nom de l'espce dont elles sont issues et le nombre de
nuclotides qu'elles comportent. Les squences de certaines espces incluent les squences de
plusieurs oprons ou sous-espces pouvant comporter des diffrences nuclotidiques. Le cas
chant, les nuclotides diffrents sont identifis par la lettre symbolique, souligne, du code
de l'Union internationale de biochimie (Cornish-Bowden, 1985) donn en Annexe II. A
chaque position de la squence, les nuclotides identiques sont indiqus par un mme
contraste monochrome entre le fond et le caractre.
Compares deux deux, au sein de chacun des groupes, les squences de la rgion V1
prsentaient des diffrences variables. Ces diffrences taient plus frquentes entre les
squences des lactobacilles htrofermentaires et de Lb. gasseri (groupe 1, Figure 3.3.2) et
entre celles des coques lactiques (groupe 3, Figure 3.3.2) qu'entre les squences des
lactobacilles homofermentaires autres que Lb. gasseri (groupe 2, Figure 3.3.2) et entre celles
des leuconostocs (groupe 4, Figure 3.3.2).

90

RSULTATS

Parmi les squences des lactobacilles htrofermentaires et de Lb. gasseri, les couples
de squences les plus proches provenaient de Lb. kefiri et de Lb. brevis ou encore de
Lb. curvatus et de Lb. plantarum ; les paires de squences comportaient respectivement 17 et

18 nuclotides diffrents. Entre les squences de L. lactis et de St. thermophilus, les


diffrences concernaient au moins 11 nuclotides. Parmi les squences de la rgion V1 des
lactobacilles homofermentaires autres que Lb. gasseri, les couples de squences les plus
semblables provenaient de Lb. acidophilus et de Lb. helveticus ou Lb. kefiranofaciens ; ils
comportaient chacun 6 nuclotides diffrents. Parmi les squences des leuconostocs, celles de
Ln. mesenteroides et de Ln. pseudomesenteroides taient identiques.

La rgion V1 de l'ADNr 16S permettait de diffrencier entre elles les squences des
espces appartenant aux deux groupes de lactobacilles et aux coques lactiques mais tait
inadquate pour diffrencier celles appartenant aux leuconostocs. Des rgions V2 et V3 de
l'ADNr 16S, la plus approprie la diffrenciation des leuconostocs a t identifie partir de
l'alignement de leurs squences.
Alignement des rgions V2
Ln. pseudomesenteroides
Ln. mesenteroides
Ln. citreum
Ln. lactis

CACGTGGACAACCTGCCTCAAGGCTGGGGATAACATTTGGAAACAGATGCTAATACCGAATAAAACTCAGTGT
CACGTGGACAACCTGCCTCAAGGCTGGGGATAACATTTGGAAACAGATGCTAATACCGAATAAAACTTAGTGT
CACGTGGACAACCTGCCTCAAGGCTGGGGATAACATTTGGAAACAGATGCTAATACCGAATAAAACTTAGTAT
CACGTGGATAACCTGCCTCAAGGCTGGGGATAACATTTGGAAACAGATGCTAATACCGAATAAAACTTAGTAT

Ln. pseudomesenteroides
Ln. mesenteroides
Ln. citreum
Ln. lactis

CGCATGACACAAAGTTAAAAGGCGCTTTGGCGTCACCTAGAGATGGATCCGCGGTGC
CGCATGACACAAAGTTAAAAGGCGCTTCGGCGTCACCTAGAGATGGATCCGCGGTGC
CGCATGATATCAAGTTAAAAGGCGCTACGGCGTCACCTAGAGATGGATCCGCGGTGC
CGCATGATACAAAGTTGAAAGGCGCTACGGCGTCACCTAGAGATGGGTCCGCGGTGC

130
130
130
130

Alignement des rgions V3


Ln. pseudomesenteroides
Ln. mesenteroides
Ln. citreum
Ln. lactis

GCACTGTTGTATGGGAAGAACAGCTAGAATAGGGAATGATTTTAGTTTGACGGTACCATACCAGA
GCACTGTTGTATGGGAAGAACAGCTAGAATAGGAAATGATTTTAGTTTGACGGTACCATACCAGA
GCACTGTTGTATGGGAAGAAATGCTAAAATAGGGAATGATTTTAGTTTGACGGTACCATACCAGA
GCACTGTTGTATGGGAAGAAATGCTAGAATAGGGAATGATTCTAGTTCGACGGTACCATACCAGA

65
65
65
65

Figure 3.3.3 : Alignement des rgions V2 et V3 de l'ADNr 16S de leuconostocs dont les

numros d'accession sont donns dans le Tableau 3.3.1. Les squences sont crites dans le
sens 5' 3', avec, en marges, le nom de l'espce dont elles sont issues et le nombre de
nuclotides qu'elles comportent. A chaque position de la squence, les nuclotides identiques
sont indiqus par un mme contraste monochrome entre le fond et le caractre.
L'alignement des rgions V2 et V3 de squences de l'ADNr 16S de leuconostocs
montrait une plus grande variabilit des nuclotides au sein de la rgion V2 (Figure 3.3.3).
91

RSULTATS

Selon la paire de squences compares, les diffrences affectaient respectivement de 2 7


nuclotides et de 1 5 nuclotides dans les rgions V2 et V3.
3.3.2 Dtermination des amorces d'amplification gnique

Contrairement la dmarche classique d'identification microbienne qui consiste en


l'examen d'isolats bactriens, celle applique aux bactries lactiques du grain de kfir KJ se
voulait indpendante de cultures bactriennes. Elle visait l'ensemble de la population lactique
du grain sans isolement pralable des diffrentes espces sur des milieux de culture.
La prsence, dans le grain KJ, de populations de bactries lactiques de tailles trs
diffrentes en terme d'units viables (paragraphe 3.2.2) imposait ds lors le recours une
stratgie permettant d'isoler l'ADNr 16S des populations minoritaires. Cet isolement a t
ralis par le biais d'amplifications spares de leur ADNr 16S. Applique la population
dominante, les lactobacilles, la finalit de l'amplification gnique tait d'isoler l'ADNr 16S
cibl du plus large spectre possible d'espces. Dans le cas des populations minoritaires, les
coques lactiques et les leuconostocs, il s'agissait d'isoler l'ADNr 16S cibl du plus large
spectre possible d'espces appartenant exclusivement ces populations.
Deux amorces damplification gnique ont t dtermines dans ce but partir de
l'alignement des squences de bactries lactiques (Tableau 3.3.1). Ces amorces ont t
localises et transcrites pour tre utilises avec l'amorce universelle 27F de Rochelle et al.
(1992). Leur localisation a t dtermine de faon inclure les rgions variables V1 et V2 de
l'ADNr 16S dans le fragment quelles dlimitent avec lamorce universelle 27F.
L'amorce commune aux lactobacilles (R350) tait conserve dans toutes les squences
de lactobacilles, l'exception de celles de Lb. fermentum et de Lb. kefiri : elle diffrait d'un
nuclotide par rapport chacune de ces deux squences. La diffrence dans les squences
portait respectivement sur la thymine de l'extrmit 5' de lamorce et sur la cytosine de
l'extrmit 3' de l'amorce. Dans le cas de Lb. kefiri, la diffrence portait sur un nuclotide
dterminant pour la fonctionnalit de l'amorce. Toutefois, d'une part, l'amorce tait conserve
dans d'autres squences de la souche type de Lb. kefiri, celles enregistres sous les numros
d'accession AB024300 et AY579584, et, d'autre part, sa fonctionnalit a t vrifie sur la
souche type de Lb. kefiri.

92

RSULTATS

L'amorce spcifique aux coques et aux leuconostocs (R485) tait conserve dans les
squences des espces appartenant ces groupes microbiens et comportait au moins deux
nuclotides diffrents avec celles des lactobacilles.
La longueur des fragments cibls a t calcule par rapport l'ADNr 16S de
Escherichia coli (Cilia et al., 1996). Compte tenu de la position et de la longueur des amorces,

qui est de 29 nuclotides pour la 27F (Rochelle et al., 1992), la taille des fragments cibls
tait de 380 pb et de 514 pb respectivement avec l'amorce R350 et R485 (Figure 3.3.4).

54
-11

102

18

112
V1

233

350 369

485 503

V2

27F
27F

R350
R485

Figure 3.3.4 : Reprsentation schmatique des fragments amplifis avec l'amorce commune

aux lactobacilles (R350), ou spcifique aux coques lactiques plus leuconostocs (R485),
combine avec l'amorce bactrienne universelle 27F dcrite par Rochelle et al. (1992). Les
rgions variables V1 et V2 de l'ADNr 16S sont reprsentes par les zones hachures. Les
positions des nuclotides terminaux des rgions variables et des amorces, dans l'ADNr 16S de
Escherichia coli numro d'accession X80725 (Cilia et al., 1996), sont donnes par les

nombres surmontant les flches les pointant.


Appliques aux souches types de diverses bactries lactiques, les ractions
d'amplification gnique (PCR) ont donn les rsultats attendus avec chacune des paires
d'amorces. Avec la paire d'amorces prvue pour amplifier l'ADN des lactobacilles (27FR350), les ractions de PCR excutes sur Lb. fermentum, Lb. kefiri, Lb. johnsonii,
Lb. acidophilus, Lb. casei et sur les deux sous-espces de Lb. kefiranofaciens rsultaient en

fragments de la longueur attendue d'environ 380 pb. Avec la paire d'amorces prvue pour
amplifier l'ADN des coques lactiques et des leuconostocs (27F-R485), les ractions de PCR
excutes sur St. thermophilus, Ln. lactis, Ln. mesenteroides subsp. mesenteroides et sur les
sous-espces cremoris et lactis de L. lactis rsultaient en fragments de la longueur attendue de

93

RSULTATS

+/- 500 pb tandis qu'aucune amplification n'tait observe quand elles taient appliques aux
deux sous-espces de Lb. kefiranofaciens.
3.3.3 Nombre de fragments analyss

Dans chacun des deux sets d'amplification, les fragments d'ADNr 16S provenant des
diverses bactries ont t isols par clonage dans E. coli. Les fragments clons ont ensuite t
squencs et analyss en nombres dtermins sur base des donnes disponibles relatives la
composition attendue de chacun des deux groupes bactriens amplifis et la contribution de
leurs composantes au pool d'ADNr 16S. Le nombre de fragments squencer a ainsi t
estim en postulant l'hypothse d'gale intensit d'amplification pour chacun des fragments
prsents dans le pool d'ADN gnomique.
Chacun des groupes bactriens cibls par les amorces d'amplification gnique tait
potentiellement ou effectivement constitu de deux sous-groupes dabondances ingales dans
le grain en terme de bactries viables : lactobacilles homofermentaires et htrofermentaires
pour les uns, coques lactiques et leuconostocs pour les autres. Les espces homofermentaires
reprsentent en effet jusqu 90 % des lactobacilles dans les grains de kfir (Kandler &
Kunath, 1983 ; Takizawa et al., 1998) tandis que les leuconostocs taient en moyenne 4 fois
plus abondants dans le grain KJ que les coques lactiques.
L'quit de la contribution des units bactriennes du grain au pool de matriel
gnomique partir duquel elles taient dtectes supposait un rendement quivalent de
l'extraction de leur ADN. L'hypothse d'galit des rendements d'extraction a t prouve sur
les souches types de Lactobacillus acidophilus, de Lb. casei, de Lb. kefiranofaciens subsp.
kefirgranum et de Lb. kefiri. Applique ces bactries, la mthode d'extraction de l'ADN

fournissait des quantits d'ADN proportionnelles au poids de leur culot cellulaire (Figure
3.3.5). Partant de ce constat, l'hypothse d'galit des rendements d'extraction de l'ADN a t
tendue aux bactries du grain.
En terme d'ADNr 16S, la contribution des diffrentes espces du grain dpendait aussi
du nombre de copies de leur ADNr 16S. Les espces lactiques concernes par le sujet pour
lesquelles cette information est connue portent entre 4 et 9 copies de l'ADNr 16S (Makarova
et al., 2006).

94

RSULTATS

Dans les cas les plus dfavorables, c'est--dire les moins abondants et les moins
pourvus en copies d'ADNr 16S, les membres des lactobacilles et des coques plus leuconostocs
reprsenteraient 4 % et 11 % de leur groupe respectif. Estim en appliquant la loi binomiale,
le nombre de fragments thoriquement ncessaire pour les dtecter, avec une probabilit de
95 %, tait respectivement de 73 et 25.
Lb. acidophilus / Lb. casei /Lb. kefiranofaciens / Lb. kefiri
ADN

ARN

Figure 3.3.5 : Rendements de l'extraction de l'ADN gnomique de Lactobacillus acidophilus,


Lb. casei, Lb. kefiranofaciens subsp. kefirgranum et Lb. kefiri en trois rptitions chacun.

Migration en gel d'agarose de quantits d'extraits ajusts en fonction du poids des culots
cellulaires.
En pratique, le nombre de fragments squencs au sein des lactobacilles a t port
83 de faon avoir au moins une rptition de chacune des squences dtectes. Dans le
groupe des coques lactiques et des leuconostocs, trois exemplaires de la squence appartenant
au groupe le plus pauvre en terme de contribution au pool d'ADN et jamais reprsent par
plus d'un taxon au sein d'un grain, les leuconostocs (Tableau 1.1.1), conduit limiter
l'analyse 21 fragments.
3.3.4 Analyse des squences

Les squences de la microflore du grain de kfir KJ ont t identifies par


comparaison avec celles d'une banque de donnes. Leur identification a t rationalise en les
regroupant pralablement en fonction des similarits de leur rgion V1.
Par le fait que les diffrences entre l'ADNr 16S des micro-organismes ne se
rpartissent pas uniformment au sein de la molcule (Neefs et al., 1993), le seuil de
nuclotides dissemblables, d'environ 1 %, propos Stackebrandt & Ebers (2006) pour dpartir
l'origine des squences des espces diffrentes tait inadquat dans l'application prsente.
Paralllement, mme en envisageant la molcule entire de l'ADNr 16S, il n'y a pas de seuil
95

RSULTATS

dtermin dhomologie des squences partir duquel elles peuvent tre assignes la mme
espce (Stackebrandt & Goebel, 1994 ; Stackebrandt & Ebers, 2006). Le regroupement des
squences du grain de kfir KJ et lacceptabilit de leur identification molculaire ont en
consquence t envisags en fonction de la variabilit observe au sein de chacun des
groupes microbiens cibls.
Classement des squences de la rgion V1 de lADNr 16S

Les squences des 83 + 21 fragments ont t regroupes sur base des similarits de
leur rgion V1 en cinq groupes : A, B, C, D et E (Figure 3.3.6).
Au sein des groupes A, C, D et E (Figure 3.3.6) les squences taient identiques ou
diffraient entre-elles par un nuclotide. Dans ces cas, lassignation une origine commune,
mme pour les squences qui diffraient d'un nuclotide, tait supporte par le fait que, d'une
part, au sein dune mme souche les copies de l'ADNr 16S ne sont pas ncessairement
identiques (Vandamme et al., 1996). Parmi les squences de bactries lactiques examines,
les oprons de Lb. brevis diffraient dun nuclotide dans la rgion V1. Et d'autre part, par le
fait que la technique de PCR utilise pour amplifier les fragments d'ADN peut gnrer des
artfacts dans les squences (Clarke et al., 2001 ; Qiu et al., 2001).
Trois squences provenant du set d'amplification des lactobacilles prsentaient entre
elles des diffrences qui affectaient 2 ou 3 bases selon la paire considre (groupe B, Figure
3.3.6). Dans la rgion V1, l'amplitude des diffrences entre les squences de l'ADNr 16S des
lactobacilles variait selon leur groupe fermentaire : elles affectaient 6 nuclotides entre la
plupart des homofermentaires et plus de 17 nuclotides entre les htrofermentaires. La
squence consensus dtermine partir des trois squences tait assigne un lactobacille
htrofermentaire, Lactobacillus kefiri, cest--dire un membre du groupe des lactobacilles
prsentant le plus de variabilit dans la squence de la rgion V1. Lorigine commune des
trois squences tait ds lors plausible.
Identification molculaire des bactries du grain partir de la rgion V1

L'origine bactrienne des squences a t tablie en comparant les squences


consensus des groupes de similarit A, B, D et E (Figure 3.3.6), et les deux squences du
groupe C (Figure 3.3.6), celles de l'EMBL l'aide du moteur de recherche FASTA (Pearson
& Lipman, 1988).
96

RSULTATS

Amplicons gnrs par la paire d'amorces 27F-R350


Groupe A (78 fragments):
Consensus 5-CGAGCGAGCGGAACCAGCAGAATCACTTCGGTGAGGACGCTGGGAAAGCGAGCGGCGGATG-3
76x

5-.............................................................-3

1x

5-............................................G................-3

1x

5-.....................................................C.......-3

Groupe B (3 fragments):
Consensus 5-CGAACGCGTTTCCGTTATTGATTTTAGGTGCTTGCATTTAAATGATTTAACACGAAACGAGTGGCGAACT-3
1x

5-...........................A..........................................-3

1x

5-.....................................C................................-3

1x

5-.......................................G............T.................-3

Groupe C (2 fragments):
1x

5-CGAACGCGTCTTGGCCAATGATTTCAGGTGCTTGCATTTGAAAGATTTGACATTGAGACGAGTGGCGAACT-3

1x

5-CGAACGCGTCTCGGCCAATGATTTCAGGTGCTTGCATTTGAAAGATTTGACATTGAGACGAGTGGCGAACT-3

Amplicons gnrs par la paire d'amorces 27F-R485


Groupe D (18 fragments):
18x

5-TGAGCGCTGAAGGTTGGTACTTGTACCGACTGGATGAGCAGCGAACG-3

Groupe E (3 fragments):
3x

5-CGAACGCACAGCGAAAGGTGCTTGCACCTTTCAAGTGAGTGGCGAACG-3

Figure 3.3.6 : Squences de la rgion V1 de l'ADNr 16S de 83 + 21 fragments issus du grain

de kfir KJ, classes en groupes de similarit nots de A E. Les squences des groupes A, B
et C comportaient des diffrences entre-elles ; les nuclotides diffrents sont indiqus en
caractres gras tandis que les nuclotides identiques ceux de la squence consensus sont
reprsents par des points. La frquence de chaque squence est indique dans la marge de
gauche. Les squences ont t enregistres dans la banque de l'EMBL sous les numros
d'accession AM419051, AM419054, AM419055, AM419056 et AM419052 respectivement
pour les groupes A, B, C, D et E.
La squence consensus du groupe A tait identique celles des souches types de
Lactobacillus kefiranofaciens subsp. kefiranofaciens et de Lactobacillus kefiranofaciens

subsp. kefirgranum, enregistres respectivement dans la banque de l'EMBL sous les numros
d'accession AJ575259 et AJ575261 (Vancanneyt et al., 2004). Identique celles des souches
types de lespce, cest--dire garantes de lidentit du groupe taxonomique, la squence
consensus du groupe A pouvait tre attribue sans ambigut lespce Lb. kefiranofaciens.
La squence consensus du groupe B tait identique celle d'une souche de
Lactobacillus kefiri isole partir de fromage et enregistre sous le numro d'accession

97

RSULTATS

DQ313162 (Florez et al., 2006). Elle diffrait des squences de la souche type enregistres
sous les numros daccession AB024300 et AJ621553 par la longueur du fragment : celles de
la souche type comportaient respectivement 1 et 2 nuclotides additionnels, situs lintrieur
de la squence, par rapport la squence consensus du groupe B. Dtermine dans le cadre de
ce travail, la squence de la souche type de Lactobacillus kefiri, enregistre sous le numro
d'accession AM420309, concordait nanmoins en longueur et en squence nuclotidique avec
celle du groupe B et avec celle enregistre sous le numro daccession DQ313162.
A dfaut de squence consensus, les deux squences du groupe C ont t considres
individuellement. Elles s'alignaient toutes deux le mieux avec la squence de la souche type
de Lactobacillus parakefiri enregistre sous le numro d'accession AY026750 (Kroneman et
al., 2002). Les deux squences du groupe C en diffraient nanmoins par 2 et 3 nuclotides

respectivement. Toutefois, entre les membres du groupe des lactobacilles htrofermentaires


auquel appartient Lb. parakefiri, les diffrences concernaient au moins 17 nuclotides (groupe
1, Figure 3.3.2). Par rapport la variabilit de la rgion V1 observe entre les espces
htrofermentaires, l'homologie des squences du groupe C avec celle de la souche type
permettaient d'accepter l'identification molculaire de Lb. parakefiri.
La squence V1 du groupe D tait identique la squence de la souche type de
Lactococcus lactis subsp. lactis enregistre sous le numro daccession AB100803 (Mori et
al., 2004). Les diffrences entre les squences V1 des sous-espces laitires lactis et cremoris

de L. lactis, numros d'accession AB100803 et AB100802 respectivement (Mori et al., 2004),


affectaient 8 nuclotides et autorisaient leur diffrenciation. Cependant la squence V1 de la
sous-espce lactis ne diffrait de celle de la sous-espce hordniae, numro d'accession
AB100804 (Mori et al., 2004), que par 1 nuclotide et rendait incertaine lidentification de
lorigine bactrienne du groupe D au niveau de la sous-espce.
La squence V1 du groupe E tait identique celles provenant de plusieurs espces de
Leuconostoc :

notamment

Ln. mesenteroides,

Ln. gelidium,

Ln. inhae,

Ln. pseudomesenteroides et Ln. carnosum, numros daccession CP000414, AB004661,

AY675244, AM491818 et AB022925 respectivement. Son origine a t assigne ce genre


bactrien.

98

RSULTATS

Identification des leuconostocs partir de la rgion V2 de lADNr 16S

La squence de la rgion V1 ne permettant pas d'identifier les leuconostocs un


niveau plus prcis que celui du genre, les rgions V2 des trois fragments classs dans le
groupe E sur base de leur rgion V1 ont t examines.
Les trois fragments diffraient d'une base dans la squence de leur rgion V2 (Figure
3.3.7) et ont t considrs individuellement.
Alignes avec celles de la banque de donnes de l'EMBL, les squences V2 du groupe
E s'appariaient toutes les trois le mieux avec celle de la souche type de Leuconostoc
mesenteroides subsp. mesenteroides et avec celle d'une souche de Leuconostoc mesenteroides

subsp. cremoris, numros d'accession CP000414 (Makarova et al., 2006) et M23034 (Yang &
Woese, 1989) respectivement.
Une des trois squences issues du grain de kfir KJ (n 1 de la Figure 3.3.7) tait
identique aux deux squences de rfrence tandis que les deux autres en diffraient d'une
base.
1: 5-CACGTGGACAACCTGCCTCAAGGCTGGGGATAACATTTGGAAACAGATGCTAATACCGAATAAAACTTAGTGTCGCATGACA
2: 5-................................C.................................................
3: 5-................................G.................................................

1: CAAAGTTAAAAGGCGCTTCGGCGTCACCTAGAGATGGATCCGCGGTGC-3
2: ................................................-3
3: ................................................-3

Figure 3.3.7 : Squence de la rgion V2 de l'ADNr 16S des 3 fragments du groupe E. Les

squences des trois fragments diffraient d'un nuclotide indiqu en caractre gras avec, en
regard, le nuclotide de substitution. La squence du groupe a t enregistre dans la banque
de l'EMBL sous le numro d'accession AM419053.
Dans la rgion V2, les diffrences entre les squences de Ln. mesenteroides et de
Ln. pseudomesenteroides concernaient deux nuclotides (Figure 3.3.3), cest--dire peine

un nuclotide de plus quentre les trois fragments issus du grain de kfir KJ. Les diffrences
entre les espces taient toutefois localises en d'autres positions que celle du nuclotide qui
variait entre les fragments issus du grain. En outre, l'espce Ln. pseudomesenteroides n'a,
ma connaissance, jamais t isole de grains de kfir. Entre les squences publies des deux
99

RSULTATS

leuconostocs associs du kfir, Ln. mesenteroides et Ln. lactis, les diffrences concernaient
6 nuclotides (Figure 3.3.3). Les trois fragments du groupe E ont ds lors t assigns
Ln. mesenteroides mais leur identification tait incertaine.
3.4

Identification des isolats microbiens

L'approche indpendante d'isolements bactriens a permis d'identifier dans le grain KJ


trois lactobacilles, un coque lactique et un leuconostoc. L'identification molculaire tait
assure au niveau taxonomique de l'espce pour les lactobacilles et le coque lactique, et au
niveau du genre pour le leuconostoc.
Les bactries lactiques du grain ont t isoles en cultures pures pour confirmer et, le
cas chant, prciser leur identification molculaire par une mthode phnotypique classique.
Les autres groupes microbiens identifis dans le grain, les bactries actiques et les levures,
ont galement t isols du grain en cultures pures pour les identifier et ainsi complter la
caractrisation qualitative de la microflore du grain.
3.4.1 Isolement des souches microbiennes

Les lactobacilles ont t isols du grain de kfir KJ sur les milieux Rogosa-CW et
KPL dvelopps pour favoriser la croissance des lactobacilles spcifiques au kfir et, en ce
qui concerne le milieu KPL, plus particulirement ceux produisant du kfirane (Toba et al.,
1986 ; Kojima et al., 1993).
Les colonies dveloppes sur le milieu Rogosa-CW partir du grain KJ ne
prsentaient pas de diffrences morphologiques permettant de les discriminer. Les isolats ont
ds lors t slectionns par amplifications gniques effectues l'aide d'amorces spcifiques
chacune des espces cibles. Trois isolats ont t slectionns pour chacune des espces
cibles, l'exception de Lb. parakefiri pour lequel un unique isolat a t obtenu. La
reprsentativit de Lb. parakefiri par un unique isolat rsultait de la faible abondance des
colonies dveloppes sur le milieu Rogosa-CW rpondant aux amorces spcifiques cette
espce : une colonie sur les 54 testes donnait un signal positif l'amplification gnique
spcifique.
Trois types distincts de colonies s'taient dvelopps sur le milieu KPL partir du
grain de kfir KJ : des colonies bombes, blanches, et luisantes ; des colonies tales,
100

RSULTATS

translucides, lgrement blanchtres et luisantes ; et une colonie blanche, opaque et matte.


Trois colonies de chacun des types "luisants" et la colonie "matte" ont t examines.
Les cultures bactriennes de coques lactiques, de leuconostocs, de levures et de
bactries actiques ont t isoles du grain sur les milieux de culture slectifs repris au
Tableau 2.3.2. L'aspect uniforme de la morphologie des colonies dveloppes sur les milieux
slectifs, ainsi que, pour les bactries lactiques, les rsultats de leur identification molculaire,
laissaient supposer que les coques lactiques, les leuconostocs, les bactries actiques et les
levures taient chacun reprsents dans le grain de kfir KJ par une espce unique. Trois
isolats de coques lactiques et de leuconostocs et un unique isolat de la bactrie actique et de
la levure ont t prlevs alatoirement sur leur milieu de culture respectif.
3.4.2 Identification des isolats de lactobacilles

Les isolats prsums de lactobacilles, c'est--dire slectionns partir des milieux


Rogosa-CW et KPL, taient tous Gram positifs, catalase ngatifs et prsentaient, sous un
grossissement de 1000 X, une morphologie cellulaire en forme de btonnets.
Slectionns

partir

du

milieu

Rogosa-CW,

les

isolats

prsums

de

Lb. kefiranofaciens ne produisaient pas de CO2 par fermentation du glucose (R-CW 64,

R-CW 103 et R-CW 108, Tableau 3.4.1) tandis que les isolats prsums de Lb. kefiri
(R-CW 10, R-CW 22, R-CW 23, Tableau 3.4.2) et de Lb. parakefiri (R-CW 110, Tableau
3.4.2) en produisaient.
Slectionns partir du milieu KPL, les isolats formant des colonies bombes,
blanches, et luisantes (KPL 1, KPL 2 et KPL 4, Tableau 3.4.1) ainsi que l'isolat opaque et mat
(KPL 9, Tableau 3.4.1) ne produisaient pas de CO2 par fermentation du glucose tandis que
les isolats formant des colonies tales, translucides, lgrement blanchtres et luisantes (KPL
6, KPL 7 et KPL 8, Tableau 3.4.2) en produisaient.
Les profils fermentaires des trois isolats prsums de Lb. kefiranofaciens, des trois
isolats formant des colonies bombes, blanches et luisantes et de celui formant une colonie
opaque et matte sur le milieu KPL (R-CW 64, R-CW 103, R-CW 108, KPL 1, KPL 2, KPL 4
et KPL 9, Tableau 3.4.1), taient similaires. Un isolat formant des colonies bombes, blanches
et luisantes sur le milieu KPL (KPL 1, Tableau 3.4.1) diffrait des autres par son incapacit
fermenter le N-actyle-glucosamine tandis que lisolat formant une colonie opaque et matte
101

RSULTATS

sur le milieu KPL (KPL 9, Tableau 3.4.1) diffrait des autres par son incapacit fermenter le
D-raffinose. Le profil fermentaire des isolats, y compris la capacit variable de fermenter le
N-actyle-glucosamine, correspondait celui de Lb. kefiranofaciens subsp. kefirgranum dcrit
par Vancanneyt et al. (2004), l'exception de la capacit de produire de l'acide partir de
D-mannose et, pour lisolat "mat", de produire de lacide partir de D-raffinose. Ces auteurs
dcrivent Lb. kefiranofaciens, et sa sous-espce kefirgranum, comme ne produisant pas
d'acide partir de D-mannose alors que les isolats du kfir KJ en produisaient. Takizawa et al.
(1994), qui avaient isol, dcrit et class cette nouvelle bactrie au rang de l'espce
Lb. kefirgranum, lui attribuent par contre aussi la proprit d'utiliser le D-mannose. Dans nos

laboratoires, la souche type du groupe, produisait effectivement de l'acide partir de


D-mannose (T a1, Tableau 3.4.1). Au contraire de la description de Lb. kefiranofaciens subsp.
kefirgranum faite par Vancanneyt et al. (2004) et des autres isolats du kfir KJ, lisolat "mat"

et la souche type du groupe (KPL 9 et T a1, Tableau 3.4.1) ne produisaient pas dacide
partir de D-raffinose.
Les isolats du kfir KJ identifis comme appartenant lespce Lb. kefiranofaciens
subsp. kefirgranum formaient deux types de colonies diffrentes par leur aspect : luisantes et
matte. Laspect luisant traduisait vraisemblablement une production dexopolysaccharide qui
tait dficiente dans la colonie matte. Linstabilit gntique de la production de certains
exopolysaccharides est une caractristique connue et documente dans le domaine laitier
(Cerning, 1990). Au sein des lactobacilles, la coexistence de colonies dune mme origine
bactrienne prsentant des aspects lisse et rugueux est notamment rapporte par Suskovic et
al. (2000).

Les trois isolats prsums de Lb. kefiri (R-CW 10, R-CW 22 et R-CW 23, Tableau
3.4.2) et les trois isolats formant des colonies tales, translucides, lgrement blanchtres, et
luisantes sur le milieu KPL (KPL 6, KPL 7 et KPL 8, Tableau 3.4.2) exprimaient des
caractres fermentaires identiques ceux dcrits par Kandler & Kunath (1983) pour cette
espce, l'exception de la capacit de produire de l'acide partir de galactose et de raffinose.
Au contraire de leur description, tous les isolats fermentaient le galactose et deux isolats sur
six (R-CW 10 et R-CW 22, Tableau 3.4.2) fermentaient le raffinose. Dans les conditions
exprimentales du laboratoire, la souche type de Lb. kefiri fermentait aussi le galactose et le
raffinose (T b, Tableau 3.4.2).

102

RSULTATS

Lisolat prsum de Lb. parakefiri (R-CW 110, Tableau 3.4.2) exprimait des
caractres fermentaires qui concordaient ceux dcrit par Takizawa et al. (1994) pour
Lb. parakefiri et, pour les caractres faisant dfaut dans la description (Rf. c, Tableau 3.4.2),

ceux exprims par la souche type de Lb. parakefiri (T c, Tableau 3.4.2).


3.4.3 Identification des isolats de coques lactiques

Les isolats prsums de lactocoques taient Gram positifs et catalase ngatifs.


Observes sous un grossissement de 1000 X, les cellules bactriennes taient isoles ou
assembles par paires ou en chanes et prsentaient une morphologie cellulaire de forme
sphrique.
Les trois isolats prsums de lactocoques (RM 31, RM 38 et RM 41, Tableau 3.4.3) ne
produisaient pas de CO2 par fermentation du glucose. Leurs profils fermentaires taient
identiques et correspondaient la description de Lactococcus lactis subsp. lactis (Schleifer et
al., 1985) l'exception de la capacit de fermenter le trhalose. Selon sa description, et

comme cela s'tait vrifi pour la souche type, cette bactrie fermente le trhalose alors que
les isolats du kfir KJ en taient incapables. Toutefois, tels les isolats du kfir KJ, les 13
souches environnementales ou commerciales de Lactococcus lactis subsp. lactis, isoles et
identifies par Urbach et al. (1997) par une approche polyphasique incluant l'analyse des
gnes de l'ARNr 16S et ldh, ne produisent pas d'acide partir de trhalose.
3.4.4 Identification des isolats de leuconostoc

Les isolats prsums de leuconostoc taient Gram positifs et catalase ngatifs.


Observes sous un grossissement de 1000 X, les cellules bactriennes taient isoles ou
assembles, par paires ou en chanes, et prsentaient une morphologie cellulaire de forme
sphrique.
Les trois isolats prsums de leuconostocs (RM 1, RM 2 et RM 3, Tableau 3.4.3)
produisaient du CO2 par fermentation du glucose.
La morphologie des cellules et la voie fermentaire des isolats confirmaient leur
appartenance prsume au genre Leuconostoc. Les leuconostocs sont, avec certains
lactobacilles, dont les isolats se distinguaient ici clairement par la morphologie des cellules,
les seules bactries lactiques htrofermentaires (Garvie et al., 1984).
103

RSULTATS

Tableau 3.4.1 : Profils fermentaires des lactobacilles homofermentaires isols du grain de

kfir KJ (R-CW et KPL). Le profil fermentaire de la souche type (T a1) du taxon assign aux
isolats KJ ainsi que ceux dduits de la description bibliographique du taxon (Rf. a1) et du
taxon apparent (Rf. a2) sont juxtaposs aux profils des isolats KJ.
Isolat, souche type ou description bibliographique
Test fermentaire

Production d'acide partir de

Dgagement de CO2
Hydrolyse de l'esculine
Glycrol
Erythritol
D-Arabinose
L-Arabinose
Ribose
D-Xylose
L-Xylose
Adonitol
Mthyle-D-xyloside
Galactose
D-Glucose
D-Fructose
D-Mannose
L-Sorbose
Rhamnose
Dulcitol
Inositol
Mannitol
Sorbitol
Mthyle-D-mannoside
Mthyle-D-glucoside
N-Actyle-glucosamine
Amygdaline
Arbutine
Salicine
Cellobiose
Maltose
Lactose
Melibiose
Saccharose
Trhalose
Inuline
Mlzitose
D-Raffinose
Amidon
Glycogne
Xylitol
Gentiobiose
D-Turanose
D-Lyxose
D-Tagatose
D-Fucose
L-Fucose
D-Arabitol
L-Arabitol
Gluconate
2-cto-gluconate
5-cto-gluconate

R-CW R-CW R-CW


64
103
108
-

+
+
+
+
+
+
+
+
+
+
+
+
+
+
-

+
+
+
+
+
+
+
+
+
+
+
+
+
+
-

+
+
+
+
+
+
+
+
+
+
+
+
+
+
-

KPL
1

KPL
2

KPL
4

KPL
9

+
+
+
+
+
f
+
+
+
+
+
+
+
-

+
+
+
+
+
+
f
f
+
+
+
+
+
+
-

+
+
+
+
+
+
f
+
+
+
+
+
+
+
-

+
+
+
+
+
+
+
+
+
+
+
+
+
-

T a1

Rf.
a1

+
+
+
+
+
+
+
+
+
+
+
+
f
+
+
+
f
-

+
+
+
+
v
v
v
+
v
+
+
+
+
+
v
+
v
v
-

Rf.
a2
+
+
+
v
v
+
v
+
v
-

f : faible raction ; v : variable selon la souche ; a1 : Lactobacillus kefiranofaciens subsp. kefirgranum


(Vancanneyt et al., 2004) ; a2 : Lactobacillus kefiranofaciens subsp. kefiranofaciens (Vancanneyt et al., 2004).

104

RSULTATS

Tableau 3.4.2 : Profils fermentaires des lactobacilles htrofermentaires isols du grain de kfir KJ

(R-CW et KPL). Les profils fermentaires des souches types (T b et T c) des taxons assigns aux
isolats KJ ainsi que ceux dduits de leur description bibliographique (Rf. b et Rf. c) sont
juxtaposs aux profils des isolats KJ.
Isolat, souche type ou description bibliographique
Test fermentaire

Production d'acide partir de

Dgagement de CO2
Hydrolyse de l'esculine
Glycrol
Erythritol
D-Arabinose
L-Arabinose
Ribose
D-Xylose
L-Xylose
Adonitol
Mthyle-D-xyloside
Galactose
D-Glucose
D-Fructose
D-Mannose
L-Sorbose
Rhamnose
Dulcitol
Inositol
Mannitol
Sorbitol
Mthyle-D-mannoside
Mthyle-D-glucoside
N-Actyle-glucosamine
Amygdaline
Arbutine
Salicine
Cellobiose
Maltose
Lactose
Melibiose
Saccharose
Trhalose
Inuline
Mlzitose
D-Raffinose
Amidon
Glycogne
Xylitol
Gentiobiose
D-Turanose
D-Lyxose
D-Tagatose
D-Fucose
L-Fucose
D-Arabitol
L-Arabitol
Gluconate
2-cto-gluconate
5-cto-gluconate

R-CW

10
+
+
+
+
+
+
+
+
+
+
+
f
-

R-CW

22
+
+
+
+
+
+
+
+
+
+
+
f
f

R-CW

23
+
+
+
+
+
+
+
+
+
+
f
-

KPL 6 KPL 7 KPL 8


+
+
+
+
+
+
+
+
+
+
f
-

+
f
+
+
+
+
+
+
+
+
f
-

+
+
+
f
+
+
f
f
+
f
-

Tb

Rf. b

+
+
+
+
+
+
+
+
+
+
+
+
f
f
f

v
+
-

+
+
-

+
+
+
-

R-CW

110
+
+
+
+
+
+
+
-

Tc

Rf. c

+
+
+
+
+
+
+
+
+
-

+
-

+
+

+
+
-

+
+
v
v
-

f : faible raction ; v : variable selon la souche ; b : Lactobacillus kefiri (Kandler & Kunath, 1983) ; c : Lactobacillus
parakefiri (Takizawa et al., 1994).

105

RSULTATS

Tableau 3.4.3 : Profils fermentaires des coques lactiques et des leuconostocs isols du grain de

kfir KJ (RM). Le profil fermentaire de la souche type (T d) du taxon assign aux coques lactiques
isols du grain, celui dduit de sa description bibliographique (Rf. d) et ceux de divers
leuconostocs (Rf. e1, Rf. e2 et Rf. e3) sont juxtaposs aux profils des isolats KJ.
Isolat, souche type ou description bibliographique
Test fermentaire

Production d'acide partir de

Dgagement de CO2
Hydrolyse de l'esculine
Glycrol
Erythritol
D-Arabinose
L-Arabinose
Ribose
D-Xylose
L-Xylose
Adonitol
Mthyle-D-xyloside
Galactose
D-Glucose
D-Fructose
D-Mannose
L-Sorbose
Rhamnose
Dulcitol
Inositol
Mannitol
Sorbitol
Mthyle-D-mannoside
Mthyle-D-glucoside
N-Actyle-glucosamine
Amygdaline
Arbutine
Salicine
Cellobiose
Maltose
Lactose
Melibiose
Saccharose
Trhalose
Inuline
Mlzitose
D-Raffinose
Amidon
Glycogne
Xylitol
Gentiobiose
D-Turanose
D-Lyxose
D-Tagatose
D-Fucose
L-Fucose
D-Arabitol
L-Arabitol
Gluconate
2-cto-gluconate
5-cto-gluconate

RM
31
+
+
+
+
+
+
+
+
f
+
+
+
+
+
+
-

RM
38
+
+
+
+
+
+
+
+
f
+
+
+
+
+
+
-

RM
41
+
+
+
+
+
+
+
+
f
+
+
+
+
+
+
-

T
d
+
+
+
+
+
+
+
+
f
+
+
+
+
+
+
+
-

Rf. d
+
+
vr
+
+
+
+
vr
+
vr
v
v
v
+
+
vr
+
vr
vr
v
-

RM
1
+
+
+
+
+
+
+
+
-

RM
2
+
+
+
+
+
+
+
+
f
-

RM
3
+
+
+
+
+
+
+
+
vr
-

Rf.
e1
+
-

Rf.
e2
+
-

Rf.
e3
+
v

vr

+
+
v
v

+
+
-

v
+
v
+

vr

+
+
v
v
v

+
-

v
v
v
vr
vr
v
+

vr

f : faible raction ; v : variable selon la souche ; vr : raction variable ; d : Lactococcus lactis subsp. lactis (Schleifer et al., 1985) ;
e1, e2, e3 : Leuconostoc lactis, Ln. mesenteroides subsp. cremoris et Ln. mesenteroides subsp. dextranicum respectivement (Garvie,
1984).

106

RSULTATS

Les profils fermentaires des trois isolats de leuconostocs diffraient entre eux par la
capacit de fermenter le D-xylose : deux isolats (RM 2 et RM 3, Tableau 3.4.3) fermentaient
le D-xylose et un isolat (RM 1, Tableau 3.4.3) ne le fermentait pas. Paralllement,
l'acidification du milieu partir de saccharose tait variable : franche pour un des isolats
(RM 1, Tableau 3.4.3), elle tait faible pour les deux autres (RM 2 et RM 3, Tableau 3.4.3).
Lorsque le test a t rpt plus tard pour l'un d'eux (RM 3), la raction qui tait
antrieurement faible, devenait franchement ngative. D'aprs les rsultats de Garvie et al.
(1984), une variabilit de rponse un test fermentaire entre souches d'une mme espce et
une variabilit de raction un test fermentaire sont frquentes chez certains leuconostocs et
en particulier chez Leuconostoc mesenteroides subsp. dextranicum (Rf. e3, Tableau 3.4.3).
Par cette caractristique, les isolats du kfir KJ s'apparentaient Leuconostoc mesenteroides
subsp. dextranicum ; ils s'en cartaient cependant par leur incapacit fermenter le trhalose
et par le petit nombre de sucres ferments. Ces proprits l, les rapprochaient de
Ln. mesenteroides subsp. cremoris (Rf. e2, Tableau 3.4.3) ou plus encore de Ln. lactis (Rf.

e1, Tableau 3.4.3). Les trois isolats en diffraient nanmoins par leur capacit d'hydrolyser
l'esculine. Les profils fermentaires des trois isolats ne permettaient en consquence pas de
prciser l'identification du Leuconostoc sp. issu du grain KJ au niveau de lespce.
L'identification du Leuconostoc sp. issu du grain KJ a t prcise par l'analyse du
profil de migration des protines cellulaires d'un isolat. Le profil de migration des protines
par lectrophorse en conditions dnaturantes (SDS-PAGE) de l'isolat RM 3 tait le plus
similaire ceux de diverses souches de Leuconostoc mesenteroides, dont celui de la souche
type du groupe (Leuconostoc mesenteroides subsp. mesenteroides, Figure 3.4.1), et permettait
d'attribuer l'appartenance de l'isolat RM 3 Leuconostoc mesenteroides.

107

RSULTATS

% similarit

(I)
(I)
(I)
(II)
(III)
(III)
(III)
(III)
(II)

Figure 3.4.1 : Comparaison du profil de migration des protines, par lectrophorse en

conditions dnaturantes (SDS-PAGE), de la souche isole du kfir KJ avec les profils de


souches de leuconostocs provenant du Belgian Co-ordinated Collections of Micro-organisms
(Gand, Belgique). Les souches l'origine des profils sont identifies dans la marge de droite ;
la souche isole du kfir KJ est identifie sous le numro ID10403 tandis que celles provenant
de la collection sont identifies par leur numro de rfrence, complt par la lettre T pour les
souches types. Les sous-espces de Leuconostoc mesenteroides sont respectivement : (I)
cremoris, (II) mesenteroides et (III) dextranicum. Le degr de similarit entre les profils est

reprsent par le dendrogramme donn dans la marge de gauche.


3.4.5 Identification de lisolat actique

L'identification de l'isolat actique tait exclusivement base sur l'analyse d'une


squence partielle de l'ADNr 16S d'une longueur de 801 nuclotides. Les nuclotides
terminaux de la squence correspondaient aux 19ime et 874ime nuclotides de l'ADNr 16S de
E. coli numro d'accession X80725 (Cilia et al., 1996).

108

RSULTATS

% diffrences

Figure 3.4.2 : Arbre phylogntique tabli partir de la squence partielle de l'ADNr 16S de

l'isolat du kfir KJ et des souches types de diverses espces actiques. Les souches l'origine
des squences sont identifies dans la marge de droite ; celle isole du kfir KJ est identifie
sous le numro ID10595. Les numros d'accession des squences des souches types sont
donns l'extrme droite. La distance entre les squences, en terme de diffrences
nuclotidiques, est reprsente par la longueur des "branches" de l'arbre reprsent dans la
marge de gauche.
La squence partielle de l'isolat a t compare, par alignement, avec les squences
provenant de la banque de donnes de l'EMBL dont les numros d'accession sont indiqus
dans la Figure 3.4.2. Dtermine partir de ces comparaisons, la position phylogntique de
la squence partielle de l'ADNr 16S permettait d'attribuer sans ambigut l'appartenance de
l'isolat au genre Acetobacter (Figure 3.4.2).
La squence partielle de l'isolat prsentait le plus de similarit avec la squence de la
souche type de Acetobacter lovaniensis. La proportion de nuclotides identiques entre ces
109

RSULTATS

deux squences atteignait 99,9 % et indiquait que l'isolat appartenait trs probablement cette
espce. Toutefois, le manque de prcision quant la variabilit de cette rgion de l'ADNr 16S
entre les diffrentes espces constitutives de ce groupe bactrien, les Acetobacter, ne permet
pas de garantir l'identification au niveau de l'espce.
L'isolat actique a t dpos en collection publique (BCCM/LMG Bacteria
Collection, Gand, Belgique) sous la rfrence LMG 24630.
3.4.6 Identification de l'isolat de levure

Observ sous un grossissement de 1000 X, la levure isole du kfir KJ se prsentait


sous la forme de cellules allonges, non filamenteuses et bourgeonnantes.
L'isolat fermentait le glucose, le galactose, le saccharose, le trhalose et le raffinose. Il
tait dot d'une activit N-actyle--glucosamidase mais tait dpourvu d'activit
-maltosidase, -amylase, -xylosidase, -glucuronidase, urase et -galactosidase.
La table d'identification fournie par le fournisseur du test appliqu ne permettait pas
d'identifier la levure isole du kfir KJ. Le test est conu pour identifier des levures cliniques
et non alimentaires et, sans surprise, aucun des profils proposs ne correspondait celui de
l'isolat. Elle permettait toutefois d'orienter l'identification vers un membre du genre
Saccharomyces ou Candida. Compar la description des espces de Saccharomyces et de
Candida constitutives de grains de kfir (Tableau 1.1.1), le profil de l'isolat correspondait

celle de Saccharomyces exiguus (Barnett et al., 2000) aujourd'hui renomme Kazachstania


exigua sur une base molculaire (Kurtzman, 2003).

L'identification de l'isolat en tant que Kazachstania exigua a t confirme par la


Mycothque de l'universit catholique de Louvain (MUCL ; Louvain-la-Neuve, Belgique) sur
base de caractristiques morphologiques et physiologiques et sur base de la squence de
l'ADNr 26S de lisolat.
L'isolat de levure a t dpos en collection publique (BCCM/MUCL (Agro)Industrial
Fungi & Yeasts Collection, Louvain-le Neuve, Belgique) sous la rfrence MUCL 49750.

110

RSULTATS

3.5

Formation du grain de kfir KJ

La formation in vitro dun grain de kfir est un dfi clairement exprim (Koroleva,
1988 ; Zourari & Anifantakis, 1988 ; Libudzisz & Piatkiewicz, 1990). Aucune tentative de
reconstitution dun grain de kfir nest, ma connaissance, dcrite, laissant comme base de
rflexion exprimentale les descriptions de formation de grains in situ.
3.5.1 Concepts sous-tendant les essais de reconstitution du grain

Dans sa description, Beijerinck (188926) localise la formation des grains sur les parois
des conteneurs de fermentation du kfir. Il prcise par ailleurs que ces conteneurs n'taient
"jamais" nettoys. Indirectement cette absence de nettoyage laissait penser que du caill ait pu
s'accumuler sur les parois et tre le sige de la formation des grains. Cette hypothse
concordait avec la description plus prcise faite par Lacrosse (1981). Cet auteur dcrit
explicitement la formation d'une "crote caseuse comprenant un agglomrat de microorganismes vivants" sur les parois des conteneurs et y associe la naissance des grains. D'aprs

les observations rapportes par Lacrosse (1981), "cette crote spongieuse aurait, aprs
dessication et morcellement, donn naissance aux grains originaux de kfir"....

Par le biais de sa description de la gense de la crote spongieuse, dcrite comme


provenant des "caillages successifs", Lacrosse (1981) prcise la nature de la crote
spongieuse l'origine des grains, du caill, et exprime une notion d'vnements rpts. Cette
notion d'vnements rpts laissait penser que les grains se forment progressivement dans le
caill prserv au cours des fermentations successives.
3.5.2 Essais de reconstitution du grain partir du consortium microbien extrait du grain

Deux essais de reconstitution du grain ont t conus sur base de ces descriptions de
formation de grains in situ. Dans chacun des deux essais, du caill primaire, c'est--dire de
premire fermentation, a t prserv au cours des renouvellements de lait. Un des essais a t
mis en place avec du caill primaire frais, tandis que lautre a t mis en place avec du caill
primaire sch.

26

Beijerinck M.W., 1889. Sur le kfir. Arch. Nerl. Sci. Exactes Nat. 23, 428-444. Cit par : Pidoux, 1984.

111

RSULTATS

Le caill primaire a t form partir du consortium extrait du grain de kfir KJ en


prenant soin de ne pas le mettre en contact avec du mtal. Sans preuve scientifique formelle
de l'effet ngatif du mtal sur le dveloppement des grains, il a t tenu compte d'une
recommandation formule notamment par Libudzisz & Piatkiewicz (1990).
La fermentation du lait partir de ces extraits de grain conduisait la formation dun
gel ferme au terme de 2 semaines dincubation temprature ambiante. La consistance du gel
permettait de l'immerger dans du lait sans qu'il s'y disperse et ainsi de le prserver. Les
portions de caill primaire frais mises en oeuvre dans l'essai ont t prleves dans des gels
forms, en botes de Petri, autour de copeaux de bois. Les copeaux de bois avaient une double
fonction : dune part, simulant les parois des barriques de bois dcrits par Beijerinck (188927),
ils fournissaient un support daccroche permanent aux structures de grain en formation et,
dautre part, ils permettaient de localiser le caill primaire frais au cours des transferts
successifs dans du lait. Le caill primaire sch provenait de gels forms en bote de Petri,
sans copeaux de bois, et schs temprature ambiante pendant 20 jours. Transfrs dans du
lait, les fragments schs ramollissaient au cours du temps mais restaient reprables jusquau
terme de lessai.
Six portions de caill frais et 6 fragments de caill schs de 1 2 cm2, rpartis chacun
respectivement dans 3 et 2 botes de Petri, ont t conservs au cours de lessai.
Cycles de culture

Le schma exprimental adopt, fermentation en bote de Petri sans dispersion du


caill, conduisait une fermentation locale du lait : le lait prenait en masse excentriquement
partir des caills. Lorsque, la faveur de la prise en masse du lait, ladhrence des caills au
fond de la bote le permettait, les caills taient mouills avec le lait rest liquide en inclinant
la bote. Le lait tait renouvel lorsquil nen restait plus assez pour mouiller les caills, cest-dire aprs 1 2 semaines dincubation temprature ambiante et en arobiose.

27

Beijerinck M.W., 1889. Sur le kfir. Arch. Nerl. Sci. Exactes Nat. 23, 428-444. Cit par : Pidoux, 1984.

112

RSULTATS

Dure des essais

Dans l'hypothse o les grains se forment par croissance de petites structures initiales,
la dure des essais devait permettre ces petites structures d'atteindre une taille dtectable
dans les caills.
Considrant que la densit des grains est de 1 g.cm-3, une structure initiale minimale
de quelques dizaines de levures et de quelques centaines de lactobacilles aurait thoriquement,
daprs la composition microbienne du grain KJ (paragraphe 3.2.2), une taille de lordre de
10-2 - 10-3 mm3. La taille qu'elle devait atteindre pour tre dtectable dans les caills avait t
estime environ 5 . 10-1 mm3 (1 mm de diamtre). Elle s'avrera plus tard amplement
suffisante (Tableau 3.5.1).
Le rythme de croissance des petites structures de grain tait indtermin et a t
extrapol partir de celui du grain mre. Cette extrapolation n'avait toutefois de sens que pour
les petites structures dont l'environnement tait comparable celui du grain mre. C'tait
potentiellement le cas pour celles entranes avec les fragments de caill sch et situes la
surface de ceux-ci mais pas pour celles incluses dans les caills.
Le rythme de croissance du grain mre de kfir KJ variait en fonction du taux
d'ensemencement du lait dans des proportions non ngligeables du point de vue de
l'estimation de la dure de l'essai : le grain mre doublait en 1 ou 2 semaines selon qu'il tait
ensemenc dans le lait des taux de 5 % ou 20 % (p/v) respectivement (Ninane, 2002). A ces
rythmes de croissance, la dure ncessaire l'acquisition de la taille cible par les petites
structures initiales tait de 6 8 semaines ou de 12 16 semaines respectivement.
Pour prciser l'estimation, le taux d'ensemencement du lait par le caill sch a t
estim par pese d'chantillons indpendants de ceux mis en oeuvre pour l'essai. Le poids
moyen du caill sch tait de (0,027 0,002) g.cm2, ce qui, pour 3 fragments ensemencs
dans 20 ml de lait, quivalait un taux approximatif de 1 % (p/v). Dans l'hypothse o les
petites structures initiales croissent au mme rythme que le grain mre, une dure de 8
semaines tait suffisante pour les dtecter dans le caill.

113

RSULTATS

Structure des caills au terme des essais

Au terme des 8 semaines d'exprimentation, les caills primaires frais et schs se


dispersaient sous une pression mcanique et ne contenaient pas de structures fermes et
lastiques dtectables laide dune spatule.
3.5.3 Agglutination en milieux de synthse du consortium microbien extrait du grain

Devant l'absence de formation de structures ressemblant des grains, les proprits


agglutinantes du consortium microbien extrait du grain de kfir KJ ont t examines. Par sa
provenance, le consortium extrait du grain possdait a priori les proprits dagglutination
ncessaire la formation de structures initiales mais on ne pouvait exclure quelles aient t
affectes par laction mcanique de dispersion du grain. Il sagissait par ailleurs destimer la
vitesse de formation de structures microbiennes.
Les proprits dagglutination du consortium extrait du grain KJ ont t examines
dans des bouillons de synthse. Au contraire du lait ferment, les bouillons de synthse
permettaient, par leur translucidit, l'examen visuel direct des structures microbiennes
formes.
Aprs 2 semaines d'incubation, les cultures microbiennes dveloppes partir d'un
extrait du grain KJ prsentaient des aspects diffrents selon le bouillon utilis et les conditions
d'atmosphre appliques (Figure 3.5.1).
En arobiose, elles prenaient la forme d'un dpt poudreux, sans cohsion, dans les
bouillons M 17, Rogosa-CW et KPL (Figure 3.5.1, I). Dans le bouillon MRS5,4, le dpt
microbien formait dans le fond des botes un film libre cohrent aux contours indpendants du
bord de la bote et qui se maintenait, sans dispersion poudreuse, lorsqu'on le faisait glisser en
inclinant lgrement la bote (Figure 3.5.1, I). Des petites structures indpendantes flottaient
la surface des bouillons MRS5,4, Rogosa-CW et KPL ; elles prenaient la forme de peaux dans
les bouillons MRS5,4 et Rogosa-CW, et d'amas floconneux dans le bouillon KPL.
En anarobiose, le dpt cellulaire prenait la forme d'un film cohrent libre dans les
bouillons M 17, MRS5,4 et Rogosa-CW. Ces biofilms se brisaient sous agitation tout en
conservant une structure agglomre (Figure 3.5.1, II). Dans le bouillon KPL, le

114

RSULTATS

dveloppement microbien se prsentait sous la forme d'un amoncellement d'amas floconneux


(Figure 3.5.1, II).
I : arobiose
M 17

MRS5,4

Rogosa-CW

KPL

II : anarobiose
M 17

MRS5,4

Rogosa-CW

KPL

Figure 3.5.1 : Structure des cultures microbiennes dveloppes aprs 2 semaines d'incubation

en arobiose (I) et en anarobiose (II) dans les bouillons M 17, MRS5,4, Rogosa-CW et KPL
partir d'un extrait du grain KJ. Les biofilms forms dans le fond des botes de Petri ont t
briss par agitation.
3.5.4 Aptitude du lait nature et modifi la croissance de fragments de grain

Lobjectif des essais dcrits dans ce paragraphe tait de vrifier laptitude du lait de
vache, nature et modifi de faon favoriser le dveloppement de la matrice des grains, la
croissance de petites structures de grain.
Le lait de vache est un substrat de croissance et de propagation de grains de kfir
rpandu et convenait au grain mre de kfir KJ qui y tait entretenu et sy dveloppait
(Ninane, 2002). Certaines observations releves lors dessais prliminaires dorientation
laissaient penser que, nature, il ne convenait peut-tre pas la prservation et ds lors la
croissance de trs petites structures de grains. Lors des tests de filtration dextraits de grain
visant identifier la ou les techniques les plus appropries, des fragments de grain visibles
dans le lait dextraction en grossissement de 2 X ny taient plus visibles aprs 2 jours.
Paralllement, des petites structures de grain denviron 3 ~ 6 mm3, rcupres dans des gels
115

RSULTATS

forms partir d'extraits "tests" pour dterminer le procd exprimental de prservation des
caills (paragraphe 3.5.2), disparaissaient parfois aprs leur transfert dans du lait.
Lobservation attentive de lune delle rvla quau terme de 5 jours la structure avait perdu
son lasticit et se dispersait dans le lait. Par ailleurs, certains lments de la littrature
laissaient penser que des conditions particulires taient susceptibles d'interagir positivement
avec le dveloppement de la matrice des grains. Elles ont t releves et simules en
modifiant le lait.
Les donnes de la littrature mettent en vidence une interaction positive des levures
sur la production de kfirane, lexopolysaccharide constitutif de la matrice des grains, quelles
stimulent (la Rivire, 1967 ; Schoevers & Britz, 2003 ; Cheirsilp et al., 2003a et 2003b). Un
accroissement de la population de levures des extraits de grain a t simul par lajout
dextrait de levure au lait. Paralllement, la croissance de la levure Kazachstania exigua
identifie dans le consortium a t favorise par lajout de glucose au lait. K. exigua est une
levure incapable dutiliser le lactose comme source dnergie et dpend ce titre des autres
micro-organismes dont elle utilise les sous-produits.
Un autre aspect relatif au kfirane a t envisag ; il relve des proprits physicochimiques de lexopolysaccharide. Soluble dans leau, le kfirane glifie en prsence dalcool
(Mukai et al, 1991). La production dalcool a t simule par lajout dalcool au lait et incite,
paralllement, par les conditions d'atmosphre appliques.
Beijerinck (188928) et Lacrosse (1981) notent par ailleurs la prsence de caillettes de
veau dans le fond des conteneurs de prparation du kfir. Les caillettes de veau contiennent
une enzyme de coagulation du lait, la chymosine, connue et utilise en fromagerie pour cette
proprit. Elles sont par ailleurs trs acides (pH ~ 1) et ont pu modifier le pH du lait. Ces deux
aspects de l'apport de caillettes de veau ont t simuls par l'ajout de prsure au lait et,
paralllement, par l'acidification du lait un pH de 5,5.
Les essais daptitude de ces diffrents laits la croissance de petites structures de grain
taient envisags sur une dure dincubation de 2 semaines. La limitation de la dure des
essais imposait la prsence dans les extraits de fragments de taille particulire mais

28

Beijerinck M.W., 1889. Sur le kfir. Arch. Nerl. Sci. Exactes Nat. 23, 428-444. Cit par : Pidoux, 1984.

116

RSULTATS

imprcise : ils devaient tre petits pour reprsenter des petites structures et suffisamment
grands pour tre dcels dans les laits ferments au terme de l'exprimentation. Pour satisfaire
ces conditions, deux extraits du grain KJ de granulomtries diffrentes, dtermines par le
procd de prparation, ont t mis en oeuvre.
Caractrisation des extraits de grain

Pour viter un contact avec du mtal, le consortium des grains a t dispers dans du
lait par battage dans un Stomacher. Ce mode de dispersion gnrait un mlange de fragments
de grains de dimensions variables dont les plus gros taient carts des extraits par filtration.
Les deux extraits mis en oeuvre dans l'essai d'aptitude des laits se distinguaient par le degr de
filtration appliqu : grossier au travers de couches de gaze ou plus fin au travers d'un filtre
chicore.
La taille des fragments de grain que ces deux modes de filtration laissaient dans les
extraits a t value par l'examen des plus gros fragments isols des extraits par tamisage.
L'immersion des fragments ainsi isols dans de l'eau permettait de les examiner en 3
dimensions. De formes varies, le volume des fragments a t calcul en les assimilant des
formes sphriques ou ellipsodales parfaites selon leur configuration. Les dimensions des
formes parfaites dans lesquelles s'inscrivaient les fragments ont t mesures au
grossissement de 50 X l'aide d'une chelle gradue en dixime de mm.
Les mesures ont t rptes 3 fois dans le temps, sur des extraits frachement prpars
indpendants de ceux utiliss pour mettre en place l'essai d'aptitude des laits. La taille des 3
plus gros fragments prsents dans chacun des extraits a, chaque fois, t retenue pour
estimer la taille maximale moyenne des fragments laisss dans les extraits par les deux modes
de filtration. Les fragments de l'extrait filtr au travers de la gaze et ceux de l'extrait filtr au
travers du filtre chicore atteignaient en moyenne (3 1) mm3 et (0,3 0,1) mm3
respectivement.
Taux d'ensemencement des laits avec les extraits

Les extraits taient prpars en dispersant des grains dans un volume de lait quivalent
leur poids. Les fragments grossiers taient ensuite carts de l'extrait brut par filtration. La
fraction carte lors de la prparation des 3 extraits grossirement filtrs reprsentait

117

RSULTATS

(85 1) % de la quantit de grains mise en oeuvre dans l'extrait brut. Calcul par diffrence,
~1 ml d'extrait comprenait 15 % de la masse de grain (p/v).
Les laits ont t inoculs raison de 1 ml d'extrait pour 10 ml de lait, ce qui quivaut
un taux d'ensemencement de 1,5 % (p/v) en terme de masse de grains.
Structures apparentes des grains rcoltes dans les laits ferments

Aprs 2 semaines d'incubation 22 C, les laits ferments ont t tamiss au travers du


filtre chicore. Fabriqu dans une matire synthtique souple, le filtre chicore permettait
d'craser son contenu (les gels) entre les doigts pour en rvler les particules solides. La
consistance des particules rcoltes a ensuite t value par pression sur un fond dur laide
dune spatule.
Quelques particules solides rvlaient, lors de ce test, une consistance lastique
comparable celle des grains de kfir. Observes au binoculaire sous un grossissement de
10 X, certaines dentre elles prsentaient une forme boursoufle (chou-fleur) typique de grains
de kfir qui permettait dapparenter sans ambigut ces particules "lastiques" des grains de
kfir.
Ces particules apparentes de petites structures de grains de kfir ont exclusivement
t rvles dans l'essai amorc avec l'extrait de grains plus grossirement filtr ; aucune
particule de ce type n'a t mise en vidence dans les laits ferments de l'essai amorc avec
l'extrait de grains plus finement filtr. Labsence de particule dans les laits ferments de l'essai
amorc avec l'extrait de grains plus finement filtr laissait empiriquement prsager un dfaut
de croissance des fragments. Tamiss avec le filtre qui avait servi prparer lextrait, les laits
ferments auraient d livrer des petites structures de grain si les fragments y avaient grossi,
mme faiblement. Par ailleurs, la taille des particules rcoltes dans les laits ferments de
lessai amorc avec lextrait de grains plus grossirement filtr ne permettait pas de
dterminer si elles manaient dun processus de croissance ou simplement de la prservation
des fragments : les plus grosses dentre elles avaient une taille (Tableau 3.5.1) quivalente
celle des plus gros fragments de lextrait. Dans lhypothse o une croissance de ces
fragments de grain a eu lieu, elle ntait pas probante.

118

RSULTATS

Conditions favorables la croissance et/ou la prservation de petites structures de grain

Les laits ferments de lessai amorc avec lextrait plus grossirement filtr ne
livraient pas tous des particules apparentes des structures de grain ; la plupart dentre eux
en taient dpourvus (Tableau 3.5.1). Seuls deux laits ferments ont livr un nombre
consquent de particules de faon rptable : les laits incubs en anarobiose qui avaient t
additionns de glucose ou dthanol (Tableau 3.5.1).

Tableau 3.5.1 : Nombre et taille des structures de grain rcoltes dans les laits ferments

partir dun extrait de grain grossirement filtr.


Lait

Conditions d'atmosphre

Nombre de structures de
grain rcoltes par rptition

Taille des structures de


grain rcoltes (mm3)

Lait nature
Arobiose

Anarobiose

Arobiose

Anarobiose

Arobiose

0,2 et 0,3

Anarobiose

Arobiose

0,4

Anarobiose

Arobiose

Anarobiose

de 0,1 0,5

Arobiose

Anarobiose

Lait5,5

Lait + prsure

Lait + extrait de levure

Lait + glucose

Lait + thanol
de 0,2 3,4

Incubs en anarobiose, le lait additionn dthanol et le lait additionn de glucose


sont thoriquement des conditions qui stimulent la croissance des lactobacilles, parmi lesquels
figurent les micro-organismes producteurs de lexopolysaccharide constitutif des grains, et qui
renforcent, directement ou indirectement, la prsence dalcool dans le milieu.

119

RSULTATS

En milieu de synthse, les conditions d'anarobiose sont en gnral plus favorables la


croissance des lactobacilles que les conditions d'arobiose (Kandler & Weiss, 1984). Une
stimulation de la croissance bactrienne ne conduit pas ncessairement une augmentation de
la production d'exopolysaccharide : c'est gnralement dans des conditions sub-ltales que les
bactries lactiques msophiles produisent un maximum d'exopolysaccharides (De Vuyst et al.,
2001). Dans le cas des lactobacilles impliqus dans la production de kfirane,
lexopolysaccharide constitutif de la matrice des grains, le taux de production semble
toutefois lie leur croissance : en milieu de synthse, la production de kfirane est corrle
la croissance de la souche de Lactobacillus kefiranofaciens subsp. kefiranofaciens tudie par
Cheirsilp et al. (2001a).
Des conditions d'anarobiose dterminent par ailleurs la production dthanol par les
levures. En prsence dune levure incapable de fermenter le lactose, comme cest le cas de
Kazachstania exigua, la levure du grain KJ, lajout de glucose au lait stimule en principe la

croissance du micro-organisme et, dans des conditions d'anarobiose, la production d'alcool.


Dans l'hypothse o ces conditions particulires stimulent la production de kfirane,
lexopolysaccharide constitutif de la matrice du grain de kfir produit par des lactobacilles, et
augmentent simultanment le taux d'alcool, la rpartition des grains rcuprs au travers de
cet essai pourrait rsulter de l'expression d'une proprit physique du kfirane. Le kfirane est
en effet un exopolysaccharide soluble dans l'eau qui glifie en prsence d'alcool (Mukai et al.,
2001).
3.5.5 Activits de biosynthse du consortium microbien extrait du grain
Expression des activits de biosynthse

Laspect des gels forms partir de ces deux extraits de grains, prpars
indpendamment, cest--dire des moments diffrents (Essai 1 et Essai 2, Tableau 3.5.2),
variait selon le type de lait et les conditions d'atmosphre appliques. Les gels des laits
acidifis un pH de 5,5 et des laits additionns de prsure n'ont pas t pris en compte en
raison d'une contamination de ces laits dans le second essai.

120

RSULTATS

Tableau 3.5.2 : Aspect des laits ensemencs avec des extraits du grain KJ, aprs 2 semaines

dincubation 22 C. Les donnes concernent la structure (Structure) ainsi que la texture et le


pH des gels aprs homognisation (Texture/pH) ou le pH des liquides (pHliquide).
Objet(n)

Essai 1
Structure

Essai 2

Texture/pH ou pHliquide

Structure

Texture/pH ou pHliquide

Lait nature - arobiose


T(1)

Liquide blanc non gluant

pHliquide : ND

E(2)

Gel homogne de couleur


Fine, visqueuse /
crme, exsudat jaune gluant pH : ND

Liquide blanc non gluant

pHliquide : 6,5

Gel homogne de couleur


crme

Fine, visqueuse /
pH : 4,5 - 4,5

Lait nature - anarobiose


T(1)

Liquide blanc non gluant

pHliquide : ND

Liquide blanc non gluant

pHliquide : 6,7

E(2)

Gel blanc homogne

Fine, visqueuse /
pH : ND

Gel blanc homogne

Fine, visqueuse /
pH : 3,5 - 3,5

Liquide non gluant de


couleur crme

pHliquide : 6,4

Lait + extrait de levure - arobiose


T(1)

Liquide non gluant de


couleur crme

pHliquide : ND

E(2)

Gel craquel de couleur


crme fonc, exsudat jaune
trs gluant

Floconneuse,
Liquide non gluant de
visqueuse / pH : ND couleur crme dans lequel
flottent des peaux de
couleur crme

pHliquide :
8,2 - 8,3

Lait + extrait de levure - anarobiose


T(1)

Liquide non gluant de


couleur crme

pHliquide : ND

Liquide non gluant de


couleur crme

pHliquide : 6,4

E(2)

Gel homogne de couleur


crme

Fine, visqueuse /
pH : ND

Gel homogne de couleur


crme

Fine, visqueuse /
pH : 3,4 - 3,4

pHliquide : ND

Liquide blanc non gluant

pHliquide : 6,4

Gel homogne de couleur


crme

Fine, visqueuse /
pH : 4,4 - 4,5

Lait + glucose - arobiose


T(1)

Liquide blanc non gluant

E(2)

Gel homogne de couleur


Fine, visqueuse /
crme, exsudat jaune gluant pH : ND

Lait + glucose - anarobiose


T(1)

Liquide blanc non gluant

pHliquide : ND

Liquide blanc non gluant

pHliquide : 6,8

E(2)

Gel blanc homogne

Fine, visqueuse /
pH : ND

Gel blanc homogne

Fine, visqueuse /
pH : 3,6 - 3,6

Lait + thanol - arobiose


T(1)

Liquide blanc non gluant

pHliquide : ND

Liquide blanc non gluant

pHliquide : 6,3

E(2)

Gel homogne de couleur


crme clair

Fine, visqueuse /
pH : ND

Gel homogne de couleur


crme clair

Fine, non visqueuse


/ pH : 4,2 - 4,1

Lait + thanol - anarobiose


T(1)

Liquide blanc non gluant

pHliquide : ND

Liquide blanc non gluant

pHliquide : 6,6

E(2)

Gel blanc homogne

Fine, visqueuse /
pH : ND

Gel blanc homogne

Fine, visqueuse /
pH : 3,6 - 3,6

E : lait ensemenc ; T : lait non ensemenc ; n : nombre d'chantillons ; ND : non dtermin

121

RSULTATS

L'aspect des gels obtenus en condition d'anarobiose tait reproductible, c'est--dire


identique entre les deux essais rpts dans le temps (Essai 1 et Essai 2, Tableau 3.5.2). En
condition d'arobiose par contre, l'aspect des gels ou des laits ferments diffrait entre les
deux essais rpts dans le temps par les caractristiques suivantes :

la prsence dans le premier essai (Essai 1, Structure, Tableau 3.5.2) de zones d'exsudat
jaune gluant sur les gels obtenus partir de lait nature, de lait additionn d'extrait de
levure et de lait additionn de glucose. Ces zones d'exsudat jaune gluant la surface
des gels faisaient dfaut dans le second essai (Essai 2, Structure, Tableau 3.5.2) mais
les mouvements circulaires excuts l'aide d'une spatule pour homogniser les gels
faisaient apparatre, lors des premiers mouvements, des filaments d'exsudat jaune.

L'absence de formation de gel et de production de substance gluante ainsi que la


prsence de peaux dans le lait additionn d'extrait de levure du second essai (Essai 2,
Structure, Tableau 3.5.2).

L'absence de viscosit dans le gel form partir de lait additionn d'thanol du second
essai (Essai 2, Texture/pH, Tableau 3.5.2).

Identification des activits de biosynthse variables et de leurs acteurs

L'exsudat jaune gluant et la viscosit des gels tmoignaient d'une activit lie la
production d'exopolysaccharides. La variabilit de cette activit tait conditionne par les
conditions d'atmosphre : elle tait observe en conditions d'arobiose mais pas en conditions
d'anarobiose.
Le consortium identifi dans le grain de kfir KJ comprend deux taxons susceptibles
de produire significativement des exopolysaccharides en arobiose :

Acetobacter sp. et

Leuconostoc mesenteroides.

Les Acetobacter sp. sont dcrits comme des producteurs d'exopolysaccharide arobies
strictes (De Ley et al., 1984). La souche isole du grain KJ produisait apparemment de
l'exopolysaccharide en bouillon de synthse : une substance dense surmontant le culot
cellulaire y tait visible par la turbidit qu'elle provoquait dans le bouillon. Il est probable
qu'elle ait contribu la variabilit de la production d'exopolysaccharide observe entre les
deux essais.
122

RSULTATS

Leuconostoc

mesenteroides

comprend

des

souches

laitires

productrices

d'exopolysaccharide et produit un maximum d'exopolysaccharide en arobiose (Cerning,


1990). Celles du kfir KJ ne semblaient pas produire dexopolysaccharide : les colonies
dveloppes sur le milieu de Mayeux l'occasion de leur isolement du grain ne paraissaient
pas luisantes. Toutefois, la capacit des Ln. mesenteroides du grain produire de
lexopolysaccharide na pas fait lobjet dune recherche particulire et on ne peut
formellement exclure cette ventualit.
Les peaux formes dans le second essai semblaient provenir d'une activit
microbienne et non d'une modification physique du substrat (schage du lait en surface par
exemple) : elles taient absentes dans le lait strile incub en parallle. Par ailleurs, le pH du
lait inocul tait modifi par rapport celui du tmoin strile et tmoignait, lui aussi, d'une
activit microbienne.
La formation de peaux tait lie une augmentation du pH du lait. Dans le domaine
laitier, une lvation du pH est une modification qui intervient dans la maturation des
fromages. Deux mcanismes microbiens peuvent en tre l'origine : la consommation de
l'acide lactique produit dans le caill et la protolyse des casines. Les micro-organismes
protolytiques impliqus dans la maturation des fromages comprennent, notamment, des
levures (Alais, 1974 ; Anonyme INRA, 2008). Les bactries lactiques ont galement une
activit protolytique l'encontre de la casine et semblent contribuer la maturation de
certains fromages, de type Emmental (Gagnaire et al., 2001), mais elles sont peu
protolytiques comparativement aux levures (Monnet & Gripon, 1994). Par ailleurs, tandis
que les bactries lactiques produisent de l'acide lactique, certaines levures d'affinage en
consomment. La levure du consortium du grain de kfir KJ, Kazachstania exigua, comprend
des souches capables d'assimiler de l'acide lactique (Barnett et al., 2000). La capacit de la
souche de K. exigua du grain KJ consommer de l'acide lactique n'a pas t vrifie mais cela
n'hypothque pas sa contribution probable la protolyse de la casine du lait et
l'augmentation de pH observe dans le second essai.
Origine de la variabilit des activits de biosynthse

L'activit microbienne du consortium extrait du grain de kfir KJ a vari d'un essai


l'autre notamment au niveau de la production d'exopolysaccharides, exprime directement par
la prsence d'exsudat gluant ou indirectement au travers de la viscosit des gels.
123

RSULTATS

Le lait utilis tait dorigine diffrente et a pu, par la constance incertaine de sa


qualit, avoir un effet sur lactivit microbienne du consortium. L'activit des ferments
lactiques est en effet connue pour varier en fonction de variations, notamment saisonnires, de
la composition du lait (Desmazeaud, 1994).
L'inconstance de la composition microbienne quantitative du grain de kfir KJ
constituait galement une source potentielle de variabilit. Elle pouvait gnrer, malgr
l'application de procdures identiques d'extraction du consortium et d'ensemencement du lait
par l'extrait, une variabilit des taux rels d'ensemencement des micro-organismes individuels.
L'influence du taux d'ensemencement sur la teneur en certains exopolysaccharides et sur la
viscosit de kfirs prpars partir de grains a t tudie par Garrote et al. (1998) et par
Rimada & Abraham (2001). Dans ces exprimentations, une diffrence d'ensemencement d'un
facteur 10 conduit une modification des paramtres examins. La variabilit de l'abondance
dans le grain KJ de tous les groupes microbiens pour lesquels elle a t estime (paragraphe
3.2.2) pouvait conduire une diffrence d'ensemencement d'un facteur 10.
3.5.6 Activits de biosynthse du consortium reconstitu partir des souches individuelles

Dans le but de confirmer lactivit microbienne de formation de peaux avec un


consortium plus facilement matrisable, deux essais ont t mis en place partir des souches
individuelles isoles du grain de kfir KJ. Le consortium reconstitu utilis dans chacun des
deux essais a t standardis par la mise en oeuvre de quantits identiques de prcultures
standardises des souches (Tableau 2.6.1).
Conception des essais

Dans ces essais, la production de kfirane a t stimule par le conditionnement des


souches qui en taient potentiellement productrices. Deux lactobacilles isols du grain de kfir
KJ produisaient, sur un milieu KPL, de l'exopolysaccharide susceptible d'tre du kfirane :
Lactobacillus kefiranofaciens subsp. kefirgranum et Lb. kefiri (paragraphe 3.4.1). Les souches

de Lb. kefiranofaciens subsp. kefirgranum et Lb. kefiri utilises dans les essais avaient t
isoles sur ce milieu KPL et ont t cultives, avant la mise en place des essais, dans ce
substrat (non glos) qui induisait chez elles la production d'exopolysaccharide.
Le consortium reconstitu partir des souches ainsi conditionnes a t incub dans
du lait nature et non dans du lait additionn d'extrait de levure. Partant de l'hypothse que la
124

RSULTATS

production de kfirane par les souches conditionnes tait accrue par rapport celle du
consortium extrait du grain, il ne semblait pas ncessaire de la stimuler davantage en ajoutant
de l'extrait de levure.
Paralllement, le consortium reconstitu et conditionn a t incub dans les
conditions favorisant thoriquement la glification du kfirane : en anarobiose dans du lait
additionn de glucose ou d'thanol.
Aspect des gels

L'incubation des laits inoculs 22 C pendant 2 semaines donnait lieu des


modifications variables du substrat selon les conditions de culture appliques (Tableau 3.5.3).
Les modifications observes taient reproductibles, c'est--dire similaires entre les
deux essais rpts dans le temps (Essai 1 et Essai 2, Tableau 3.5.3).
Le lait utilis dans ces deux essais tait, comme prcdemment, d'origines diffrentes.
Cette diffrence d'origine constituait une source potentielle de la variabilit observe dans
l'expression des activits microbiennes des consortiums extraits du grain (paraphe 3.5.3). La
reproductibilit observe ici cartait cette ventualit vis--vis des activits microbiennes
exprimes par les consortiums reconstitus.
Lexpression de ces activits microbiennes diffrait de celle obtenue avec les
consortiums extraits du grain, par l'absence de viscosit dans les gels forms en anarobiose.
Structures microbiennes

Sans surprise, au vu des rsultats antrieurs (paragraphe 3.5.3), aucune structure


apparente des grains de kfir n'a t dtecte dans les laits ferments.
Les deux consortiums reconstitus formaient par contre des peaux comparables
celles observes dans le lait additionn dextrait de levure ferment en arobiose par un des
consortiums extrait du grain KJ (Essai 2, Tableau 3.5.1). Ces peaux se formaient dans le lait
ferment en arobiose (Essai 1 et Essai 2, Tableau 3.5.2). Formes exclusivement en prsence
dun consortium microbien, elles ont t assimiles des biofilms.

125

RSULTATS

Tableau 3.5.3 : Aspect des laits ensemencs avec le consortium reconstitu partir des micro-

organismes isols du grain KJ, aprs 2 semaines dincubation 22 C. Les donnes concernent la
structure (Structure) ainsi que la texture et le pH des gels aprs homognisation (Texture/pH) ou le
pH des liquides (pHliquide).
Objet(n)

Essai 1
Structure

Texture/pH ou pHliquide

Essai 2
Structure

Texture/pH ou pHliquide

Lait nature - arobiose


T(1)

Liquide blanc non gluant

pHliquide : 6,6

E(2)

Liquide blanc non gluant pHliquide : 6,4 - ND


sur lequel flotte une peau
de couleur crme

Liquide blanc non gluant

pHliquide : 6,6

Liquide blanc non gluant


dans lequel flottent des
peaux de couleur crme

pHliquide : 6,5 - ND

Liquide blanc non gluant

pHliquide : 6,4

Lait nature - anarobiose


T(1)

Liquide blanc non gluant

pHliquide : 6,4

E(2)

Gel blanc homogne,


surnageant liquide
translucide non gluant

Floconneuse
Gel blanc homogne,
pelliculaire, non
surnageant liquide
visqueuse / pH : 4,0 - ND translucide non gluant

Floconneuse
pelliculaire, non
visqueuse / pH : 4,8 - ND
pHliquide : 6,3

Lait + glucose - anarobiose


T(1)

Liquide blanc non gluant

pHliquide : 6,4

E(2)

Gel blanc homogne,


surnageant liquide
translucide non gluant

Floconneuse
Gel blanc homogne,
pelliculaire, non
surnageant liquide
visqueuse ; pH : 4,0 - ND translucide non gluant

Floconneuse
pelliculaire, non
visqueuse ; pH : 4,9 - ND
pHliquide : 6,3

Liquide blanc non gluant

Lait + thanol - anarobiose


T(1)

Liquide blanc non gluant

pHliquide : 6,4

E(2)

Gel blanc homogne,


surnageant liquide
translucide non gluant

Floconneuse
Gel blanc homogne,
pelliculaire, non
surnageant liquide
visqueuse ; pH : 4,2 - ND translucide non gluant

Liquide blanc non gluant

Floconneuse
pelliculaire, non
visqueuse ; pH : 4,9 - ND

E : lait ensemenc ; T : lait non ensemenc ; n : nombre d'chantillons ; ND : non dtermin

3.5.7 Comportement des souches individuelles


Croissance des souches individuelles

Dans chacun des essais, les tmoins de croissance des souches individuelles attestaient
d'un dveloppement de tous les micro-organismes mis en prsence l'exception de
Lactobacillus kefiranofaciens subsp. kefirgranum. La souche de Lb. kefiranofaciens subsp.
kefirgranum ne produisait pas de trouble dans les bouillons MRS5,4 incubs en parallle des

essais.

126

RSULTATS

L'absence de croissance de Lb. kefiranofaciens subsp. kefirgranum dans le bouillon


MRS5,4 ne signifie pas ncessairement que la souche ne s'tait pas dveloppe dans le lait en
prsence du consortium microbien ; de nombreux micro-organismes croissent difficilement
hors de leur environnement (Verstraete, 2008). Le cas est explicitement exprim par Witthuhn
et al. (2004) pour les bactries du kfir. Cependant, cette souche de Lb. kefiranofaciens subsp.
kefirgranum tait initialement capable de crotre dans le bouillon MRS5,4 : elle avait t

cultive dans ce bouillon l'occasion de son identification phnotypique. L'absence de


croissance dans le bouillon MRS5,4 incub en parallle des essais tmoignait ds lors d'une
modification de la capacit de croissance de la souche, probablement due aux repiquages
successifs en bouillon KPL.
Le dfaut de viscosit dans les gels forms en anarobiose appuyait lventualit dune
absence de croissance de cette souche dans le lait. La souche Lb. kefiranofaciens subsp.
kefirgranum tait un producteur dexopolysaccharide anarobie susceptible ds lors de

participer la viscosit des gels forms en anarobiose. De surcrot, la souche utilise dans
ces essais produisait sur le milieu KPL glos une colonie luisante dont la forme bombe
suggrait quelle soit visqueuse.
Paralllement, labsence de viscosit dans les gels tmoignait dune absence de
participation de lautre producteur anarobie avr dexopolysaccharide : Lb. kefiri. La souche
de Lb. kefiri utilise dans ces essais provenait dune colonie luisante qui, par son manque de
tenue, stalait sur le milieu glos et tait apparemment peu visqueuse. Il est probable que cet
exopolysaccharide contribue peu la viscosit des gels.
Agglutination des souches individuelles

Les souches de Acetobacter sp. et de Lb. kefiri formaient des agglomrats ressemblant
des peaux, lisses et boursoufles respectivement, dans les bouillons de synthse incubs en
parallle des essais comme tmoin de croissance.
Les souches de Leuconostoc mesenteroides et de Lactococcus lactis subsp. lactis
formaient par contre, dans les tmoins de croissance, des dpts poudreux et semblaient
dpourvues de proprits d'agglutination.

127

RSULTATS

Contre toute attente, Lb. parakefiri et Kazachstania exigua ne se dveloppaient pas,


dans leurs bouillons de synthse respectifs, en un dpt poudreux mais formaient des petits
granules sphriques.
3.5.8 Aspect des biofilms

Les biofilms (Figure 3.5.2) s'assemblaient, lors du tamisage des laits, en un amas
plastique. L'amas tait relativement rsistant l'crasement, c'est--dire qu'il tait difficile
disperser en particules suffisamment petites pour passer au travers des mailles du filtre
chicore. La cohsion de l'amas ne s'apparentait toutefois pas celle des grains.

Figure 3.5.2 : Biofilm form la surface du lait ensemenc par le consortium reconstitu

partir des micro-organismes individuels isols du grain KJ. Le biofilm est prsent dans de
leau et a t froiss loccasion de la manipulation. Constitu de matire collante, il na pas
t possible de le redployer.

128

DISCUSSION

DISCUSSION

4.1

Qualit hyginique du grain de kfir KJ

Le grain de kfir KJ tait d'origine domestique, ce qui implique qu'avant son


acquisition par le CRA-W, il tait cultiv dans des conditions d'hygine incertaines. Devant
l'incertitude quant sa qualit hyginique, la condition pralable sa distribution publique
tait de vrifier son innocuit.
4.1.1 Sensibilit du grain des germes contaminants

La sensibilit du grain de kfir KJ une colonisation par des germes pathognes a t


value au travers de l'volution de son acidit au cours des cycles hebdomadaires de culture.
Lacidit du milieu est en effet un facteur limitant pour la croissance de la plupart des
pathognes.
Le seuil de pH en dessous duquel les germes pathognes ne se dveloppent pas varie
selon la souche mais aussi en fonction de lenvironnement. Pour Listeria monocytogenes, par
exemple, le pH minimal pour crotre varie selon la souche examine de 5,0 5,7 4 C et de
4,3 5,2 30 C (Farber et al., 1989). Le comportement des micro-organismes dpend en
outre de la matrice alimentaire considre : regardant un composant unique, l'acide utilis
pour abaisser le pH du milieu de culture, Farber et al. (1989) rapportent que les acides
actique, lactique, citrique et hydrochlorique nont pas le mme pouvoir inhibiteur sur la
croissance des souches de Listeria monocytogenes tudies. A pH gal, la composition en
acides organiques du kfir a un pouvoir inhibiteur suprieur celle du yaourt lencontre
dune souche pathogne de Escherichia coli (Garrote et al., 2000). Toutefois, dfaut de
donnes tablies dans les conditions particulires au grain de kfir, les valeurs seuil de pH
diffuses par la Food and drug administration des USA (Anonyme FDA, 1999), qui revtent
un caractre gnral, ont t utilises comme base de discussion pour lvaluation globale de
la sensibilit du grain KJ.
Parmi les germes pathognes prvalant dans nos rgions (Imberechts et al., 2004 ;
Anonyme European Food Safety Authority, 2005 ; Vaillant et al., 2005), les plus tolrants
lacidit - Staphylococcus aureus, Listeria monocytogenes, Salmonella sp., Escherichia coli et
Bacillus cereus - ne se dveloppent gnralement pas des pH infrieurs 4,2 ; 4,4 ; 4,5 ; 4,6

129

DISCUSSION

et 4,9 respectivement. Campylobacter jejuni qui est, aprs Salmonella sp., responsable du plus
grand nombre de cas dclars de maladie infectieuse d'origine alimentaire ne crot
normalement pas un pH infrieur 5,5 (Anonyme FDA, 1999).
En dessous de ces valeurs limites de pH, le milieu devient ltal pour ces germes et
leurs populations dcroissent au cours du temps. Dans un kfir dont lacidit est de pH 4,0,
des populations de 8 . 104 et 6 . 104 ufc.ml-1, de Listeria monocytogenes et de Escherichia
coli O157:H7 respectivement, ne sont plus dtectes au terme de 10 jours de conservation

4 C (Gulmez & Guven, 2003). Dans les mmes conditions, une autre souche de
E . coli O157:H7, la souche "932", inocule dans le kfir raison de 107 ufc.ml-1, nest plus

dtecte aprs 8 jours de conservation (Tosun et al., 2007). Une plus grande tolrance
lacidit peut toutefois tre induite par adaptation des germes dans des conditions de pH subltales : le cas est notamment dcrit pour des souches de L. monocytogenes, Salmonella sp.,
E. coli et Bacillus cereus (Lee et al., 1994 ; Gahan et al., 1996 ; ODriscoll et al., 1996 ;

Wilmes-Riesenberg et al., 1996 ; Browne & Dowds, 2002 ; Tosun et al., 2007). Dans le kfir,
la survie de la souche "932" de E . coli O157:H7 est alors prolonge de 4 jours (Tosun et al.,
2007).
Par rapport aux valeurs indicatrices de pH seuil, lacidit du grain de kfir KJ
atteignait, le plus souvent, des valeurs de pH ltales pour les bactries pathognes
proccupantes dans nos rgions. Les valeurs de pH du grain taient nanmoins parfois
suprieures au pH minimal compatible avec un dveloppement de Staphylococcus aureus en
dbut de cycle de fermentation. De plus, pendant les 2 3 premires heures du cycle
quotidien de fermentation, lacidit du grain sinscrivait dans des valeurs de pH proches de
celle permettant d'induire, par adaptation, une plus grande rsistance lacidit chez une
souche de Salmonella typhimurium. Un sjour de 2 heures dans un milieu de pH 4,3 conduit
ce type de rsistance chez cette souche lorsqu'elle est en phase de croissance stationnaire (Lee
et al, 1994). Dans les autres cas de rsistance induite, les pH dadaptation appliqus sont

nettement suprieurs aux pH mesurs dans le grain de kfir KJ tous les stades du cycle de
culture (Gahan et al., 1996 ; ODristoll et al., 1996 ; Wilmes-Riesenberg et al., 1996 ; Browne
& Dowds, 2002 ; Tosun et al., 2007). Cependant, un sjour prolong dans un milieu trs acide
tel que celui mesur dans le grain KJ en fin de cycle de fermentation peut conduire la
slection de mutants plus rsistants ce facteur de stress ; le cas est rapport pour Listeria
monocytogenes aprs une exposition de 18 heures un pH de 3,5 (ODristoll et al., 1996).

130

DISCUSSION

4.1.2 Germes pathognes et indicateurs de dfauts d'hygine

Tenant compte de la sensibilit du grain de kfir KJ, son innocuit a t vrifie par la
recherche de germes pathognes ou indicateurs d'un dfaut d'hygine. Les critres
microbiologiques examins dans ce but ont t slectionns sur base des textes lgislatifs en
vigueur et sur base des recommandations de la Fdration internationale de laiterie (FIL,
Bruxelles).
Les levains ne font pas, ma connaissance, lobjet de textes de loi spcifiques relatifs
leur qualit hyginique. Par contre, pour tre commercialiss, les laits ferments qui en sont
issus doivent rpondre aux exigences microbiologiques fixes par le rglement (CE)
n 2073/2005 de la Commission du 15 novembre 2005 concernant les critres
microbiologiques applicables aux denres alimentaires et par l'arrt royal du 18 mars 1980
relatif au yaourt et autres laits ferments. Ces exigences portent sur des critres de scurit des
denres alimentaires, c'est--dire sur les germes pathognes et leurs toxines, sur des germes
indicateurs de dfaut d'hygine dans le procd de fabrication ainsi que sur l'efficacit de la
pasteurisation du lait. Les exigences lies l'innocuit de l'inoculation ont t appliques au
produit de fermentation obtenu partir du grain de kfir KJ.
Parmi les critres de scurit des denres alimentaires fixs par le rglement europen
(CE), Listeria monocytogenes et Salmonella sp. concernent respectivement toutes les denres
alimentaires prtes tre consommes et des produits laitiers fabriqus partir de lait cru.
Dans l'approche scuritaire dveloppe ici, on a considr que le lait utilis antrieurement
l'acquisition du grain par le CRA-W aurait pu ne pas tre trait thermiquement et l'absence de
contamination par Salmonella sp. a t vrifie. Parmi les catgories de denres alimentaires
inventories pour fixer les critres lis l'hygine de leur procd de fabrication, celles
comprenant les fromages taient les plus proches du kfir. Les germes indicateurs sont dans
ces cas les staphylocoques coagulase positive. Comprenant Staphylococcus aureus, un
germe notamment prsent dans les blessures infectes, ce critre semblait particulirement
adapt une fabrication domestique gnralement effectue "mains nues". La lgislation
belge prvoit, en outre, des limites d'acceptabilit de contamination des produits par des
coliformes et par des moisissures dont il a t tenu compte.
La FIL (1997) prconise, pour l'valuation de la qualit hyginique des levains
lactiques, deux critres supplmentaires : les micro-organismes contaminants et les
131

DISCUSSION

entrocoques. Lnumration des entrocoques est recommande pour valuer le niveau


d'hygine qui a prsid lors de la fabrication des laits ferments (Vanos, 1991 ; Jouve, 1996).
Selon Vanos (1991), les entrocoques constituent dans ce cas un indicateur plus appropri que
les coliformes parce qu'ils sont plus tolrants l'acidit que certains membres de ces derniers :
ils peuvent normalement se dvelopper jusqu des pH de 4,9-4,5 tandis que certaines souches
de Escherichia coli ne se dveloppent pas en dessous dun pH de 5,0. Cependant, en regard de
l'acidit du grain de kfir, la tolrance des entrocoques tait insuffisante pour fournir un
indicateur fiable. Ce critre additionnel n'apportait en consquence pas d'information
complmentaire celle fournie par les coliformes dont l'examen est impos par la loi belge.
Les publications relatives la composition microbienne des grains de kfir rvlent
une prsence rpte, au sein du consortium microbien, de bactries potentiellement
pathognes par voie alimentaire : Escherichia coli et des bactries appartenant au genre
Bacillus (Ottogali et al., 1973 ; Angulo et al., 1993 ; Chen et al., 2008). L'acidit du grain de

kfir KJ tait toutefois incompatible avec un dveloppement de E. coli et de B. cereus, le


Bacillus sp. pathogne par voie alimentaire qui prvaut dans nos rgions (Imberechts et al.,

2004 ; Vaillant et al., 2005).


Elles rvlent par ailleurs, une contamination isole des grains de kfir par des
bactries appartenant aux genres Sphingobacterium, Acinetobacter, Enterobacter et
Pseudomonas (Wang et al., 2006 ; Chen et al., 2008). Ce sont des bacilles Gram ngatifs

rpandus dans la nature, non fermentaires et comptabiliss avec les bactries qualifies de
contaminants par la FIL pour Sphingobacterium, Acinetobacter et Pseudomonas (Yabuuchi et
al., 1983 ; Elliot, 1984 ; Anonyme Centre for Infections, 2007) ou, fermentaires et

comptabiliss avec les coliformes pour Enterobacter (Richard, 1984). Parmi ces derniers
figure E. sakazakii, un germe pathogne l'origine d'infections dont la relation avec une
consommation d'aliments pour nourrissons a t tablie (Anonyme AFSCA, 2004) et qui doit
ce titre tre contrl dans les lait pour nourrissons de moins de 6 mois (Rglement CE
n 2073/2005). Le kfir n'est cependant pas un aliment pour nourrissons de moins de 6 mois.

132

DISCUSSION

4.2

Identification et quantification des groupes microbiens du grain de kfir KJ

4.2.1 Identification des groupes microbiens

Les donnes bibliographiques relatives la composition microbienne de grains de


kfir, prsentes au Tableau 1.1.1, montrent qu'ils comprennent une microflore banale
diversifie, compose de bactries lactiques et de levures, parfois associes des bactries
actiques et/ou des microcoques (Ottogalli et al., 1973 ; Angulo et al., 1993 ; Pintado et al.,
1996 ; Takizawa et al., 1998 ; Lin et al., 1999a ; Garrote et al., 2001 ; Simova et al., 2002 ;
Witthuhn et al., 2004 ; Mainville et al., 2006 ; Wang et al., 2006 ; Chen et al., 2008). Les
bactries lactiques incluent des lactobacilles, des pdiocoques, des coques lactiques, des
leuconostocs et Weissella viridescens. Parmi les groupes microbiens recenss, ceux
participant au consortium du grain de kfir KJ ont t identifis sur base de leur isolement par
croissance sur des milieux de culture slectifs.
Le choix des milieux de culture a t orient par lexprience de la Fdration
internationale de laiterie (FIL, Bruxelles) en matire de dnombrement slectif de groupes
microbiens dans les produits laitiers et en particulier dans les levains lactiques composs de
plusieurs espces de bactries lactiques. Les milieux proposs par la FIL et appliqus au kfir
KJ ciblent les coques lactiques, les leuconostocs, les levures et conjointement les lactobacilles
et les pdiocoques (norme 94B:1991 et annexe de la norme 149A:1997).
La croissance exclusive des pdiocoques a t cible par l'ajout d'hydrochlorure de
cystine, de novobiocine et de vancomycine au milieu propos par la FIL. Ainsi supplment,
le milieu MRS, conduit au recouvrement de diverses souches de Pediococcus acidilactici et
P. pentosaceus, les espces de pdiocoques associes des produits laitiers (Garvie, 1986),

tout en inhibant la croissance de nombreux lactobacilles et coques lactiques (Simpson et al.,


2006).
Weissella viridescens, une bactrie lactique autrefois classe parmi les lactobacilles

(Collins et al, 1993), n'est pas mentionne dans la norme de composition des laits ferments
de la FIL (149A:1997). La liste des bactries cites n'est ni exhaustive ni exclusive mais il est
peu probable que W. viridescens ait t intgre dans le domaine d'application des mthodes
de dnombrements spcifiques proposes en annexe de la norme sus-mentionne car il s'agit
d'une bactrie peu courante dans le domaine laitier. Elle n'est pas utilise en industrie laitire
133

DISCUSSION

et est rarement signale dans des laits ferments traditionnels ; hormis dans le kfir, sa
prsence a t rapporte dans du zabady, un lait ferment gyptien (Loones, 1994) et dans du
maziwa lala, un lait ferment kenyan (Miyamoto et al., 2005). Weissella viridescens est
nanmoins dcrite comme se dveloppant volontiers sur le milieu MRS propos par la FIL
pour le dnombrement conjoint des lactobacilles et des pdiocoques (Euzby, 2004).
La croissance slective de Weissella viridescens a t prouve en parallle par l'ajout
de chlorure de sodium au milieu APT propos par Evans & Niven (1951) pour l'isolement des
Weissella sp. D'aprs les auteurs l'origine de la description de l'espce, W. viridescens

supporte en effet jusqu' 6,5 % de NaCl dans ce milieu de culture (Niven & Evans, 1957). La
description de l'espce repose cependant sur des souches d'origine carne, isoles de
prparations sales (saucisses) et l'halotolrance de souches d'origine laitire provenant de
substrats non sals, comme c'est le cas du kfir, n'est pas documente. L'halotolrance d'une
souche laitire provenant de lait pasteuris a toutefois t confirme dans le cadre de cette
tude.
L'absence de dveloppement microbien, partir du kfir KJ, sur les milieux MRS et
APT supplments pour les slections exclusives de pdiocoques et de Weissella viridescens
permettait d'exclure une croissance de ces bactries sur le milieu MRS. Ainsi, dans le contexte
du kfir KJ, le milieu MRS ciblait la croissance slective des seuls lactobacilles.
Les microcoques sont des bactries apparentes aux fromages dont ils contribuent la
maturation (Bhowmik & Marth, 1990). Ils partagent avec Weissella viridescens la proprit
d'halotolrance mais s'en distinguent par une moindre exigence en lments nutritifs et par le
besoin en oxygne (Kocur, 1986). Ces caractristiques ont t mises profit pour les
slectionner dans le contexte du kfir. Dans leur introduction, Denis et al. (2001) recensent
divers milieux de culture utiliss pour isoler les microcoques partir de matrices alimentaires.
Le choix a t dict par l'application laitire du milieu de base, le PCA au lait crm, et par
le succs des isolements de microcoques partir de fromages effectus par Mounier et al.
(2005) sur ce milieu additionn de NaCl.
La slectivit du milieu utilis pour mettre en vidence les bactries actiques reposait
sur leur capacit utiliser de l'alcool comme source de carbone (De Ley et al., 1984).

134

DISCUSSION

Appliqus au kfir KJ les diffrents milieux ont conduit l'isolement de lactobacilles,


de coques lactiques, de leuconostocs, de bactries actiques et de levures. Aucun
dveloppement de pdiocoques, de Weissella viridescens ou de microcoques n'a par contre t
observ. Les lactobacilles, les coques lactiques et les levures sont des micro-organismes
ordinaires de grains de kfir ; ils figurent parmi le consortium de tous les grains dont la
caractrisation microbienne est tendue (Ottogalli et al., 1973 ; Angulo et al., 1993 ; Garrote
et al., 2001 ; Simova et al., 2002). Les leuconostocs et les bactries actiques n'y sont pas

toujours reprsents mais ont t isols de grains de kfir par quelques auteurs (Ottogali et al.,
1973 ; Angulo et al., 1993 ; Garrote et al., 2001). Les pdiocoques, W. viridescens et les
microcoques ont par contre, ma connaissance, exclusivement t isols de grains de kfir
par Angulo et al. (1993). L'identification de pdiocoques, de W. viridescens et de
microcoques dans des grains de kfir n'mane, dans ce cas, pas d'une recherche oriente vers
leur mise en vidence spcifique. Autrement dit, d'autres auteurs auraient d les dtecter s'ils
avaient t des constituants habituels de grains de kfir.
4.2.2 Quantification des groupes microbiens

Labondance dans le grain de kfir KJ des cinq groupes microbiens identifis - les
lactobacilles, les coques lactiques, les leuconostocs, les bactries actiques et les levures - a
t dtermine en terme dunits viables (ufc.g-1).
Labondance moyenne des diffrents groupes microbiens du grain KJ tait ingale. Le
grain KJ se caractrisait, linstar dautres grains (Vayssier, 1978 ; Molska et al., 1980 ;
Angulo et al., 1993 ; Pintado et al., 1996, Garrote et al., 2001 ; Witthuhn et al., 2004 ; GuzelSeydim et al., 2005), par une dominance de la population de lactobacilles. La proportion de
lactobacilles y tait du mme ordre de grandeur que dans les grains tudis par Simova et al.
(2002) qui la chiffrent entre 83 % et 90 % de la flore totale. Le grain de kfir KJ tait par
ailleurs similaire au grain cultiv par Pintado et al. (1996) du point de vue de son abondance
moyenne en lactobacilles, en coques lactiques et en levures. Estimes partir du graphique
fourni par ces auteurs, les abondances en lactobacilles en coques lactiques et en levures de ce
grain sont en effet denviron 108 cfu.g-1, 104 cfu.g-1 et 107 cfu.g-1 respectivement. Le grain de
kfir KJ sen cartait par contre par la prsence de bactries actiques ; le grain tudi par ces
auteurs en est dpourvu. La population de bactries actiques du grain KJ tait plus abondante
que dans les grains tudis par Garrote et al. (2001) o elle est comprise entre 2,5 . 105 cfu.g-1
135

DISCUSSION

et 3,6 . 105 cfu.g-1. Bien quidentifis dans des grains de kfir (Angulo et al., 1993 ; Lin et al.,
1999a ; Garrote et al., 2001 ; Witthuhn et al., 2004 ; Mainville et al., 2006 ; Chen et al.,
2008), les leuconostocs nont, ma connaissance, jamais fait lobjet dune quantification.
Les dnombrements de lactobacilles, de coques lactiques et de levures taient assortis
dune variabilit qui avait, en regard de la prcision des mthodes appliques, une
signification biologique : elle exprimait une variabilit de l'abondance de ces groupes
microbiens dans le grain.
4.2.3 Origine de la variabilit de labondance des groupes microbiens

S'agissant de concentrations microbiennes, leur variation pourrait tre lie un


processus de diffusion de composs ou d'eau partir du milieu extrieur et/ou un processus
biologique rsultant de l'activit des micro-organismes du grain. Les micro-organismes
contribuent en effet directement la composition du grain en produisant de la biomasse et du
kfirane, qui est un constituant majeur de sa matrice (la Rivire & Kooiman, 1967).
Des conditions favorables l'expression d'un processus de dilution, la rptition
hebdomadaire de sjours prolongs dans de leau, ont conduit une modification de la
composition microbienne du grain de kfir KJ. Dans ce cas, la concentration en lactobacilles
tait plus faible que celle observe dans le grain cultiv dans les conditions habituelles.
Cependant, sous l'action du seul processus de dilution de la matrice, tous les groupes
microbiens du grain auraient d tre affects, ce qui n'tait pas le cas.
Les modifications de composition microbienne de grains de kfir rapportes dans la
littrature sont associes une rupture des conditions de culture : conglation des grains
(Garrote et al., 1997), changement de substrat (Abraham & De Antoni, 1999) ou modification
de la composition du lait (Witthuhn et al., 2005). Les cycles de fermentation du grain de kfir
KJ comprenaient des pisodes de rupture, d'une part, par le rajustement hebdomadaire et non
quotidien du taux d'ensemencement, et d'autre part, par la prolongation de la dure
d'incubation qui passait de 24 72 heures en fin de semaine. Cependant, le rythme des
vnements de maintenance et de culture entre deux chantillonnages successifs tait
conserv au cours du temps : ces vnements et les dnombrements taient effectus des
jours fixes de la semaine.

136

DISCUSSION

Les conditions ambiantes dans lesquelles les grains taient entretenus quotidiennement
taient, par contre, non contrles et prsentaient ds lors une source potentielle de variabilit
au cours du temps. Les essais ont t effectus durant 7 semaines conscutives de mi-avril
dbut juin, une priode sujette des variations mtorologiques de temprature, dans une
pice non climatise. Le lait de renouvellement, en particulier, tait prserv et manipul
temprature ambiante. Paralllement, le schma exprimental prvoyait de placer les cultures
des diffrents essais en mme temps dans l'tuve et impliquait que les premires cultures de
grains KJ entretenues, restaient temprature ambiante pendant un certain temps. Ce temps et
la temprature du lait taient suffisants pour promouvoir une activit microbienne comme en
tmoignait labaissement du pH du lait : d'un pH initial de 6,7 le lait passait un pH compris
entre 5,3 et 6,0 (rsultats non prsents). La variabilit du pH du lait mesur avant de placer
les cultures ltuve confirmait en outre l'incidence d'un facteur agissant en dbut de
fermentation sur la variabilit de lactivit de la microflore du grain. Par ailleurs, les microorganismes responsables de lacidification primaire du kfir, les coques lactiques (Koroleva,
1988), taient ceux qui montraient le plus de variabilit de leur population au cours du temps.
Les lactocoques, membres exclusifs de ce groupe dans le grain KJ, sont de plus connus pour
leur sensibilit la chaleur (Dellaglio et al., 1994).
Paralllement linconstance du nombre de coques lactiques et, dans une moindre
mesure, de levures au cours du temps, une variabilit de labondance de tous les groupes
microbiens tait mesure entre les deux cultures individuelles du grain de kfir KJ. L'origine
de cette variabilit permanente a t dtermine par une analyse des oprations de
maintenance et des conditions de culture du grain qui auraient pu diffrer entre les deux
cultures.
Parmi les oprations de maintenance, le rinage et l'gouttage du grain avant le
renouvellement quotidien du lait taient des actes manuels dont les intensits taient laisses
l'apprciation de l'oprateur. La subjectivit associe cette tape de maintenance n'tait pas
une source majeure de variabilit pour les lactobacilles et pour les levures : supprime dans un
essai men en parallle, elle ne modifiait pas leur abondance dans le grain. La suppression de
cette tape ne modifiait pas, non plus, labondance des coques lactiques dans le grain mais,
dans ce cas, la variabilit au cours du temps tait tellement grande quelle masquait limpact
de ce facteur au niveau de la dispersion entre les doubles. Les coques lactiques, par leur
localisation la surface des grains (Rea et al., 1996 ; Guzel-Seydim et al., 2005), sont par
137

DISCUSSION

ailleurs plus susceptibles que les lactobacilles et les levures tre entrans avec leau de
rinage.
Les conditions de culture appliques aux deux cultures individuelles taient identiques
mais elles gnraient, par la localisation des grains en surface et la synrse du lait, un
environnement immdiat htrogne non contrl. Au sortir de l'incubateur, une partie des
grains tait en contact avec de l'air tandis que l'autre tait en contact avec du petit lait ou du
caill. L'influence de cette htrognit environnementale sur lactivit des microorganismes du grain capables de fermenter le lactose, les bactries lactiques dans le cas du
grain de kfir KJ, a t visualise l'aide d'un substrat chromogne. Lincubation du grain
dans les conditions conduisant une htrognit de l'environnement immdiat entranait
aussi une distribution htrogne des micro-organismes sa surface tandis quelle tait
uniforme lorsque le grain tait incub dans un milieu homognis. Schroevers & Britz
(2003) ont compar la microflore d'un grain de kfir cultiv statiquement et sous agitation
continue. L'cart des dnombrements microbiens effectus par ces auteurs est plus faible sous
agitation continue mais les donnes disponibles ne permettent pas d'entriner statistiquement
l'influence positive de l'homognisation du milieu sur la variabilit de la microflore du grain.
L'homognisation du lait pendant l'incubation est un fait rarement mentionn, tant
dans les descriptions de prparation traditionnelle du kfir que dans celles de culture
exprimentale de grains de kfir. Seuls, ma connaissance, trois documents font rfrence
une pratique de culture comprenant une homognisation du lait. Il s'agit dans deux cas
d'agitations ponctuelles occasionnelles du lait (Lacrosse, 1981 ; Simova et al., 2002) et dans
un cas d'une agitation continue (Guzel-Seydim et al., 2005). Ceci suppose qu'usuellement, le
kfir est prpar et les grains sont reproduits en culture statique. L'application d'une culture
sous agitation continue ne semble pas modifier la structure des grains: le grain expriment
par Schroevers & Britz (2003) conserve au terme de 22 jours la morphologie typique en forme
de chou-fleur mais cette mme tude tend montrer qu'elle modifie ses compositions
chimique et microbienne.
Les conditions de culture appliques pour propager des grains en vue de l'tude de leur
microflore sont diverses et parfois imprcises ou non prcises : les taux d'ensemencement
varient de 0,1 % (p/v) 10-12 % (Pintado et al., 1996 ; Rea et al., 1996 ; Abraham & De
Antoni, 1999 ; Garrote et al., 2001 ; Simova et al., 2002 ; Witthuhn et al., 2004 ; Chen at al.,
138

DISCUSSION

2008) ou ne sont pas mentionns (Rea et al., 1996 ; Takizawa et al., 1998 ; Guzel-Seydim et
al., 2005 ; Mainville et al., 2006) tandis que la temprature d'incubation est comprise entre

18-20 C et 25 C lorsqu'elle est contrle (Rea et al., 1996 ; Takizawa et al., 1998 ; Abraham
& De Antoni, 1999 ; Garrote et al., 2001 ; Simova et al., 2002 ; Witthuhn et al., 2004 ;
Guzel-Seydim et al., 2005 ; Mainville et al., 2006 ; Chen et al., 2008), et est dtermine par la
temprature ambiante dans le cas contraire (Pintado et al., 1996). La dure d'incubation varie
de 20 48 heures (Abraham & De Antoni, 1999 ; Garrote et al., 2001 ; Simova et al., 2002 ;
Witthuhn et al., 2004 ; Mainville et al., 2006 ; Chen et al., 2008), ou est dtermine par la
frquence de renouvellement du lait (Pintado et al., 1996 ; Guzel-Seydim et al., 2005), ou par
la formation d'un caill (Rea et al., 1996). Les conditions appliques au grain de kfir KJ en
divergeaient nanmoins par le taux d'ensemencement qui tait plus lev.
L'tude conduite par Simova et al. (2002), avec un taux d'ensemencement de 10 % et 3
5 agitations en cours de fermentation, repose sur des mesures ponctuelles, non rptes dans
le temps, de cultures individuelles de grains d'une mme origine. Calculs partir des
donnes des auteurs, les carts types relatifs gomtriques des dnombrements de
lactobacilles, de coques lactiques et de levures du grain sont dans ce cas respectivement de
32 %, 18 % et 57 %. Ces chiffres expriment une variabilit comparable celle observe entre
les deux cultures individuelles du grain de kfir KJ ensemences raison de 20 % et laisses
au repos. L'absence de donnes relatives la prcision des mthodes de dnombrement
utilises par Simova et al. (2002) ne permet toutefois pas de garantir que la variabilit
calcule partir des donnes de ces auteurs a une signification biologique.
4.3

Identification molculaire des bactries lactiques du grain de kfir KJ

Les bactries lactiques du grain de kfir KJ ont t identifies par une approche
molculaire indpendante disolements bactriens, base sur lanalyse de la squence
nuclotidique de lADNr 16S.
La composition de la flore lactique des grains de kfir est le plus souvent dtermine
partir des micro-organismes qui en ont t isols sur des milieux de culture slectifs. Parmi les
tudes recenses, celles faisant appel une mthode indpendante disolements bactriens
sont au nombre de trois : il sagit des tudes de Garbers et al. (2004), de Wang et al. (2006) et
de Chen et al. (2008). Les rsultats des tudes de Garbers et al. (2004) et de Wang et al.
(2006) reposent exclusivement sur des mthodes indpendantes d'isolements bactriens tandis
139

DISCUSSION

que ceux de Chen et al. (2008) reposent la fois sur une mthode dpendante et sur une
mthode indpendante de cultures bactriennes.
4.3.1 Pertinence du choix de lapproche

Par rapport la dmarche classique, lindpendance vis--vis disolements bactriens


de lapproche adopte prsente un avantage technique de rapidit et, surtout, un avantage qui
peut avoir des rpercussions sur la qualit des rsultats : elle contourne les difficults lies la
croissance des micro-organismes sur des milieux de synthse (Ninane et al., 2007).
Applique au grain de kfir KJ, lapproche molculaire a permis dy dtecter la
prsence de Lactobacillus parakefiri, une espce spcifique du kfir rarement isole : seule
une quipe (Garrote et al., 2001) indpendante de celle des auteurs qui ont dcrit ce taxon
(Takizawa et al., 1994 ; Takizawa et al., 1998) la isole. On ne peut prjuger de la prsence
de cette espce dans les autres grains mais lexamen des conditions exprimentales des tudes
recenses laissent penser que son absence dans ces grains pourrait tre lie au choix des
milieux de culture utiliss pour en isoler les micro-organismes. Le milieu de culture favorable
la croissance de Lb. parakefiri et qui a permis Takizawa et al. (1994) de rvler l'existence
de cette espce n'est pas utilis par les autres quipes de recherche. Witthuhn et al. (2004)
rapportent par ailleurs avoir observ, dans des grains de kfir, des micro-organismes
incapables de se dvelopper sur les milieux de culture quils avaient slectionns.
De nombreuses mthodes d'identification molculaire applicables directement
l'chantillon, sans isolement pralable des micro-organismes sur des milieux de culture, sont
dcrites.
Certaines reposent sur la rponse dune raction molculaire amorce par une
molcule spcifique lorganisme cibl ; lhybridation de lADN avec des sondes ou des
amorces spcifiques (Klijn et al., 1991 ; Tilsala-Timisjrvi & Alatossava, 1997) en est un
exemple courant. Ces techniques ne sont toutefois applicables qu' un nombre limit d'espces
dtermines.
Dautres approches reposent sur la comparaison dlments permettant de distinguer
les molcules de l'ADN cibl entre elles : profil de restriction enzymatique de l'ADN amplifi
(Ward et al., 1998 ; Delfederico et al., 2006), profil de migration de lADN amplifi en
gradient de gel dnaturant (Fasoli et al., 2003 ; Theunissen et al., 2005 ; Chen et al., 2008),
140

DISCUSSION

squences nuclotidiques de lADN (Woo et al., 2002 ; Florez & Mayo, 2006 ; Wang et al.,
2006) entre autres. Dans ces cas, le champ dapplication est conditionn par ltendue de la
collection dlments de rfrence disponible. Lanalyse de la squence nuclotidique de
lADN prsente de ce point de vue un avantage par la disposition dune collection publique de
squences dorigine connue, facilement accessible par le rseau Internet.
Indpendantes dune slection prdtermine des espces recherches, ces dernires
permettent en outre de rvler, le cas chant, la prsence de nouvelles espces ou de
bactries inhabituelles dans lenvironnement considr. Le cas n'tait pas avr dans le grain
de kfir KJ ; toutes les espces mises en vidence taient connues et avaient t isoles de
grains de kfir antrieurement (Takizawa et al., 1998 ; Lin et al., 1999a ; Garrote et al., 2001 ;
Simova et al., 2002 ; Witthuhn et al., 2004 ; Mainville et al., 2006 ; Chen et al., 2008). L'atout
majeur de ces approches sest par contre concrtis dans l'tude de Garbers et al. (2004) par
l'identification, dans des grains de kfir, de lactobacilles connus mais qui navaient jamais t
isols de grains de kfir auparavant : Lactobacillus crispatus et Lb. gallinarum. Les bactries
"inhabituelles" que ce type d'approche permet de mettre en vidence peuvent aussi se rvler
indsirables ;

c'est

une

contamination

de

leurs

grains

par Sphingobacterium sp.,

Acinetobacter sp. et Enterobacter sp., ou par Pseudomonas sp., que Wang et al. (2006), ou

Chen et al. (2008) dans le cas du Pseudomonas sp., ont ainsi dcouvert.
4.3.2 Domaine dapplication de la cible molculaire

La cible molculaire de lapproche applique au grain de kfir, le gne de l'ARNr 16S,


est la base de l'tude des relations phylogniques entre bactries, entreprise par Woese en
1987 puis utilises comme base de classement dans la seconde dition du "Bergey's Manual of
Systematic Bacteriology" (2005), et est intgre dans les schmas modernes de taxonomie

polyphasique (Vandamme et al., 1996).


En matire didentification molculaire toutefois, l'appartenance de deux bactries
une espce commune reste dtermin par leur taux dhybridation ADN-ADN (Wayne et al.,
1987 ; Stackebrandt et al., 2002). Par rapport ce critre, le pouvoir discriminant de la
molcule d'ADNr 16S est parfois limit. Certaines squences quasiment identiques de
l'ADNr 16S proviennent d'espces distinctes ; le cas est notamment rapport pour l'ADNr 16S
de Bacillus globisporus et B. psychrophilus (Fox et al., 1992).

141

DISCUSSION

En ce qui concerne les bactries lactiques, les squences de l'ARNr 16S des 55 espces
analyses par Collins et al. (1991) sont diffrentes entre elles mais prsentent parfois de fortes
similitudes. Parmi les squences pour lesquelles le degr de similitude est chiffr, celles
provenant de Lactobacillus amylovorus et d'un autre lactobacille appartenant au complexe de
Lb. acidophilus, atteignent 99,3 % d'homologie (Collins et al., 1991). Au sein du groupe cibl

pour identifier les bactries lactiques du grain de kfir KJ, les ADNr 16S les plus proches
prsentent 97,2 % d'homologie ; ils proviennent de Lb. kefiranofaciens et de Lb. helveticus
(Collins et al., 1991).
Au niveau de la sous-espce, la molcule de lADNr 16S a un pouvoir de rsolution
taxonomique variable (Vandamme et al., 1996). Dans le cas du groupe bactrien cibl, elle
autorise la diffrenciation des sous-espces lactis et cremoris de Lactococcus lactis (Ward et
al., 1998) mais ne permettait pas de diffrencier les sous-espces de Lactobacillus
kefiranofaciens et de Leuconostoc mesenteroides.

Lapproche didentification molculaire applique aux bactries lactiques du grain de


kfir KJ tait base sur lanalyse de courtes squences cibles de lADNr 16S et non sur celle
de lentiret de la molcule. Elle reposait sur la distribution ingale des diffrences
nuclotidiques entre les squences de lADNr 16S des micro-organismes. Les diffrences
entre les ARN 16S des micro-organismes ne sont en effet pas uniformment rparties dans la
molcule mais sont concentres en certaines rgions (Neefs et al., 1993).
4.3.3 Adquation des courtes squences de l'ADNr 16S lidentification des bactries
cibles

Les rgions de lADNr 16S prsentant le plus de variabilit entre les membres du
groupe bactrien cibl ont t identifies en comparant des squences despces lactiques
rapportes comme tant constitutives de grains de kfir. Trois rgions de lADNr 16S ont t
identifies ; elles correspondent aux rgions variables V1, V2 et V3 dcrites par Neefs et al.
(1993).
La rgion V1 de lADNr 16S prsentait le plus de variabilit entre les squences
examines. Au sein des lactobacilles et des coques lactiques, les diffrences entre les espces
affectaient dans cette rgion un nombre de nuclotides qui devait raisonnablement permettre
de les distinguer l'une de l'autre. Kullen et al. (2000) posent la mme hypothse pour des
142

DISCUSSION

espces qui diffrent parfois, dans cette rgion de l'ADNr 16S, par un nombre plus petit de
nuclotides : celles autrefois associes au complexe de Lactobacillus acidophilus. Applique
diverses souches de leur collection, l'identification molculaire base sur cette hypothse
concorde avec l'identification prsuppose des souches de Lb. acidophilus, de Lb. crispatus et
de Lb. gallinarum, tandis qu'elle concorde avec une souche sur deux de Lb. amylovorus
(Kullen et al., 2000). Les donnes de ces auteurs montrent par contre que l'identification
molculaire des souches de Lb. gasseri et de Lb. johnsonii diverge de l'identification
prsuppose ou est incertaine en regard du faible taux d'homologie entre les squences de ces
souches avec celles des souches types. Toutefois, l'absence d'indications mthodologiques
quant l'identification pralable de ces souches laisse planer un doute sur la certitude de
celle-ci. Les espces de ce groupe microbien ne peuvent en effet pas tre identifies sur la
seule base phnotypique (Hammes & Vogel, 1995).
La variabilit de la rgion V1 est par ailleurs exploite pour dterminer la squence de
sondes et d'amorces spcifiques permettant d'identifier des espces lactiques. Cest
prcisment le cas pour Lactobacillus acidophilus (Walter et al., 2000) dont la squence
prsentait le moins de diffrences avec celles des autres lactobacilles constitutifs de grains de
kfir. C'est aussi le cas pour d'autres espces associes des produits laitiers : les amorces et
sondes d'identification spcifique de Lb. brevis, de Lb. fermentum, de Lb. kefiri, de
Lb. paracasei et de Lb. plantarum (Ehrmann, 199429 ; Vogel et al., 1994 ; Ward & Timmins,

1999 ; Chagnaud et al., 2001) ainsi que de Lactococcus lactis et de Lc. raffinolactis (Klijn et
al., 1991) sont dtermines dans la rgion V1.

Les rgions V1 de deux espces de leuconostocs taient par contre identiques, rendant
impossible leur identification sur cette base. La rgion de l'ADNr 16S montrant le taux de
variabilit le plus lev aprs la rgion V1, tait la rgion V3. C'est aussi dans cette rgion V3
que Klijn et al. (1991) dterminent des amorces d'amplification gnique spcifiques
l'identification de leuconostocs au niveau de l'espce. Cependant, l'alignement des rgions V2
et V3 de squences provenant exclusivement de leuconostocs montrait une plus grande

29

Ehrmann

M.

(1994).

Klassifizierung

und

identifizierung

van

milchsurebakterien

mit

hilfe

molekularbiologischer methoden. PhD thesis, Technical University of Munich, Munich, Germany. Cit par :
Schleifer et al., 1995

143

DISCUSSION

variabilit des nuclotides au sein de la rgion V2. Prises deux deux, les diffrences entre
les espces affectaient plus de nuclotides dans la rgion V2 que dans la rgion V3.
4.3.4 Degr de confiance de l'identification molculaire

Le pouvoir discriminant des rgions V1 et V2 de l'ADNr 16S a t tabli pour un


groupe dtermin de bactries lactiques. Ce dernier incluait toutes les espces rapportes
comme constitutives de grains de kfir lexception de Lactobacillus crispatus et de
Lb. gallinarum. Ces dernires font toutefois parties des espces associes au complexe de
Lb. acidophilus dont les rgions V1 ont t examines sous l'angle d'un outil d'identification

par Kullen et al. (2000). Parmi les squences V1 examines par ces auteurs, celles provenant
de Lb. crispatus, de Lb. gallinarum et de Lb. acidophilus sont diffrentes et ont conduit une
identification correcte de diverses souches de leur collection (Kullen et al. 2000).
Les rgions V1 et V2 des squences de l'ADNr 16S examines permettaient de
diffrencier les bactries lactiques cibles. L'examen des rgions V1 et V2 portait cependant
sur un nombre limit de squences reprsentatives de l'espce et ne prenait ds lors pas en
compte la variabilit des squences au sein de chacune d'elles.
Par rapport la variabilit des rgions V1 et V2 de l'ADNr 16S des bactries lactiques
cibles, l'identification molculaire de l'origine bactrienne tait nanmoins acceptable pour la
plupart des squences du grain de kfir KJ. C'tait le cas pour celles assignes
Lactobacillus kefiranofaciens, Lb. kefiri, Lb. parakefiri et Lactococcus lactis. Elle tait

par contre incertaine pour les trois squences de la rgion V2 assignes Leuconostoc
mesenteroides.

L'identification molculaire tait par ailleurs confirme par l'identification


phnotypique traditionnelle d'isolats bactriens provenant du grain de kfir KJ.
4.3.5 Sensibilit de la mthodologie

La mthodologie applique reposait sur l'identification pralable des groupes lactiques


du grain KJ par une approche classique base sur leur capacit crotre sur des milieux de
culture slectifs. La diversit des groupes considrs reposait sur les descriptions antrieures
de grains de kfir et la justesse de la rponse, sur le choix des milieux de culture.

144

DISCUSSION

Wang et al. (2006) et Chen et al. (2008) ont explor la diversit d'un grain de kfir par
une approche molculaire indpendante de ces deux facteurs dterminants. Compares aux
donnes obtenues par la voie classique (Ottogalli et al., 1973 ; Angulo et al., 1993 ; Pintado et
al., 1996 ; Lin et al., 1999a ; Garrote et al., 2001 ; Simova et al., 2002 ; Mainville et al.,

2006 ; Chen et al., 2008), celles obtenues par Wang et al. (2006) rvlent une plus grande
richesse du grain en bactries contaminantes mais pas en bactries lactiques ; elles y sont
uniquement reprsentes par des lactobacilles. Dans l'tude de Chen et al. (2008), la diversit
des groupes lactiques mise en vidence avec la mthode indpendante d'isolements bactriens
est moindre que celle mise en vidence avec la mthode classique d'isolements bactriens
dans deux grains sur trois, et quivalente dans un des trois grains. Dans ce cas, la mthode
indpendante d'isolements bactriens a rvl la prsence d'un groupe non identifi par la
mthode classique, les coques lactiques, mais a, paralllement, omis celle d'un autre groupe,
les leuconostocs.
Dans la mthode utilise par Wang et al. (2006) et par Chen et al. (2008), l'ADNr 16S
amplifi provient de l'ensemble du consortium bactrien du grain et les fragments
d'ADNr 16S d'origines diffrentes sont spars par migration en gradient de gel dnaturant
(DGGE). Fasoli et al. (2003) montrent qu'en dessous d'une quantit quivalent 1 % de la
flore totale, une bactrie lactique ajoute du lait ferment n'est pas dtecte par cette
mthode. La sensibilit de la mthode n'aurait ds lors pas permis de dtecter la prsence des
coques lactiques et des leuconostocs dans le grain de kfir KJ.
Dans l'approche molculaire adopte pour identifier les bactries lactiques du grain
KJ, l'ADNr 16S des populations minoritaires en terme d'units viables, les coques lactiques et
les leuconostocs, tait examin sparment de celui de la population dominante, les
lactobacilles. Au sein de chacune des populations, le niveau de dtection des espces tait
dtermin par le nombre de fragments clons analyss. Celui-ci avait t calcul pour dtecter
avec une probabilit de 95 % les espces dont l'abondance au sein de chacune des
populations, les lactobacilles et les coques lactiques plus les leuconostocs, pouvait diffrer
respectivement d'un facteur 10 et d'un facteur 4. Le nombre de fragments clons analyss tait
ainsi thoriquement suffisant pour dtecter avec une probabilit de 95 % les espces
dominantes en terme d'units viables de toutes les composantes des populations cibles :
lactobacilles homofermentaires et htrofermentaires pour les uns, coques lactiques et
leuconostocs pour les autres.
145

DISCUSSION

Cette assertion thorique supposait une amplification gale de chacune des molcules
d'ADNr 16S prsentes dans le pool d'ADN gnomique. Cependant, dans un mlange de
molcules d'ADNr 16S, l'amplification peut-tre slective vis--vis de l'une ou l'autre d'entreelles (Reysenbach et al., 1992 ; Ercolini et al., 2003). L'absence d'une telle slectivit n'a pas
t vrifie dans le cadre de cette tude et l'ventualit d'une slectivit vis--vis de
l'ADNr 16S provenant d'un membre du consortium microbien du grain KJ ne peut tre
carte.
Applique au grain KJ, la mthode a nanmoins effectivement permis d'identifier des
espces appartenant chacune des composantes vises. Elle a de surcrot permis d'identifier
deux espces de la composante dcrite comme reprsentant 10 % de la population concerne
dans les grains de kfir : les lactobacilles htrofermentaires (Kandler & Kunath, 1983).
4.4

Composition microbienne du grain de kfir KJ

Le grain de kfir KJ incluait des bactries lactiques, des levures et des bactries
actiques. Sauf exception pour un des grains de Witthuhn et al. (2004), qui relve
vraisemblablement de problmes techniques et non de la composition du grain, les bactries
lactiques et les levures sont des groupes microbiens toujours reprsents dans les grains de
kfir (Ottogalli et al., 1973 ; Angulo et al., 1993 ; Pintado et al., 1996 ; Lin et al., 1999a ;
Garrote et al., 2001 ; Simova et al., 2002). Au contraire de ceux-ci, les bactries actiques ne
font pas ncessairement parties des consortiums de grain identifis ; c'est le cas pour certains
grains de Ottogalli et al. (1973) et d'Angulo et al. (1993) ainsi que pour celui de Pintado et al.
(1996) et pour ceux de Witthuhn et al. (2004). Ce groupe microbien jouerait nanmoins un
rle important dans la prservation du grain (Koroleva, 1988).
Les taxons identifis dans le grain de kfir KJ incluaient les bactries lactiques
Lactobacillus kefiranofaciens subsp. kefirgranum, Lb. kefiri, Lb. parakefiri, Lactococcus
lactis subsp. lactis et Leuconostoc mesenteroides ; la levure Kazachstania exigua et la

bactrie actique Acetobacter sp.

146

DISCUSSION

4.4.1 Bactries lactiques


Caractristiques taxonomiques

La composition du grain KJ en bactries lactiques tait proche de celle des grains


dcrits par Mainville et al. (2006) et par Chen et al. (2008) au niveau de l'espce ; ces grains
comprennent, l'instar du grain KJ, les espces Lactobacillus kefiranofaciens, Lb. kefiri,
Lactococcus lactis et Leuconostoc mesenteroides. Elle en diffrait uniquement par la prsence

dans le grain KJ de Lb. parakefiri qui fait dfaut dans les grains dcrits par ces auteurs. La
prsence, simultane et exclusive au niveau des Lactobacillus sp., de Lb. kefiranofaciens, de
Lb. kefiri et de Lb. parakefiri dans un grain de kfir est par contre dcrite dans une tude

consacre ce genre lactique, celle de Takizawa et al. (1998).


Les espces Lactobacillus kefiranofaciens, Lb. kefiri et Lb. parakefiri ont, ma
connaissance, exclusivement t isoles de kfir ou de grains de kfir et sont ce titre
spcifiques du kfir.
Au niveau de la sous-espce, la composition du grain de kfir KJ diffrait de celle du
grain de Mainville et al. (2006) par l'absence de Lactococcus lactis. subsp. cremoris et de
celle du grain de Takizawa et al. (1998) par l'absence de Lactobacillus kefiranofaciens subsp.
kefiranofaciens.
Production de kfirane

Pour tre fonctionnel, le consortium doit inclure des bactries productrices de kfirane,
le polysaccharide typique du kfir et constitutif de la matrice des grains de kfir (la Rivire &
Kooiman, 1967). Les souches pour lesquelles une production de kfirane a jusqu prsent t
tablie appartiennent deux taxons qui n'ont pas t identifis dans le grain KJ : Lactobacillus
kefiranofaciens subsp. kefiranofaciens et Lb. brevis (la Rivire & Kooiman, 1967 ; Fujisawa
et al., 1988).

Les

deux

sous-espces

de

Lactobacillus

kefiranofaciens,

kefirgranum

et

kefiranofaciens, taient indistinguables sur base de lanalyse de lADNr 16S, mme dans

dautres rgions que celle examine : les squences compltes de leur ADNr 16S taient
identiques. Lidentification plus prcise de Lb. kefiranofaciens dtecte dans le grain de kfir
KJ a t effectue partir du profil fermentaire disolats bactriens provenant du kfir KJ. Les
reprsentants de Lb. kefiranofaciens isols du kfir KJ appartenaient tous la sous-espce
147

DISCUSSION

kefirgranum ; aucun reprsentant de la sous-espce kefiranofaciens de Lb. kefiranofaciens,

dcrite par Fujisawa et al. (1988) comme produisant du kfirane, na t isole partir du
kfir KJ. Une omission par inadquation du milieu de culture utilis est improbable du fait de
lutilisation de celui adapt par Toba et al. (1986) pour favoriser la croissance des bactries
mucodales du kfir, associes la production de kfirane, et qui est l'origine de l'isolement
primaire de Lb. kefiranofaciens subsp. kefiranofaciens par Fujisawa et al. (1988). Sur ce
milieu de culture, les souches de Lb. kefiranofaciens subsp. kefirgranum isoles du grain KJ
produisaient de lexopolysaccharide. Une production dexopolysaccharide par ce taxon est
indirectement suggre par Vancanneyt et al. (2004) au travers de la description de sdiments
floconneux quil forme mais na, ma connaissance, jamais t dcrite explicitement. A
fortiori, la nature de lexopolysaccharides produit par ce taxon est indtermine. Il nest ds

lors pas exclu, par la parent de Lb. kefiranofaciens subsp. kefirgranum avec le producteur
avr de kfirane, que lexopolysaccharide produit par les souches isoles du grain KJ soit du
kfirane.
Il est par ailleurs probable que la bactrie productrice de kfirane isole et identifie
comme Lactobacillus brevis par la Rivire & Kooiman (1967) appartienne l'espce
Lb. kefiri. Les auteurs l'origine de la description de Lb. kefiri, Kandler & Kunath (1983),

rapportent en effet que le profil fermentaire des isolats de cette nouvelle espce est identique
celui d'une souche provenant de kfir (DSM 20485) et identifie l'poque comme Lb. brevis.
La distinction entre Lb. kefiri et Lb. brevis porte sur leur ADN, aspect qui n'tait pas examin
l'poque et en particulier pas par la Rivire & Kooiman (1967) lors de l'identification de leur
isolat producteur de kfirane.
Diversit

La diversit des bactries lactiques identifies dans le grain de kfir KJ comprenait 5


espces : 3 lactobacilles, 1 coque lactique et 1 leuconostoc. Elle comprenait un plus petit
nombre despces lactiques que le grain de Simova et al. (2002) qui inclut 4 lactobacilles et 2
coques lactiques. Elle comprenait galement un plus petit nombre de coques lactiques quun
des grains de Angulo et al. (1993) qui en inclut aussi 2 espces. Elle tait nanmoins gale ou
suprieure celle mise en vidence dans tous les autres grains dont la population bactrienne
lactique a fait l'objet d'une caractrisation tendue (Ottogalli et al., 1973 ; Angulo et al.,
1993 ; Garrote et al., 2001 ; Mainville et al., 2006 ; Chen et al., 2008) et restait cet gard
reprsentative de la diversit lactique des grains de kfir au niveau de lespce.
148

DISCUSSION

4.4.2 Levures
Kazachstania exigua, la levure isole du grain de kfir KJ, est une levure prsente

dans d'autres grains de kfir : Angulo et al. (1993) et Witthuhn et al. (2004) en ont isol dans,
respectivement, un et deux de leurs grains. C'est une levure incapable de fermenter le lactose
comme la plupart des levures identifies dans des grains de kfir, savoir Candida friedrichii,
Candida inconspicua, Candida maris, Candida tenuis, Pichia fermentans, Saccharomyces
cerevisiae, Saccharomyces unisporus, Torasporula delbrueckii, Yarrowia lipolytica et
Zygosaccharomyces sp. (Ottogalli et al., 1973 ; Angulo et al., 1993 ; Pintado et al., 1996 ; Lin
et al., 1999a ; Barnett et al., 2000 ; Simova et al., 2002 ; Witthuhn et al., 2004).

La prsence d'une unique espce de levure dans les grains de kfir, comme c'est le cas
pour le grain KJ, est frquente : pas moins de 11 grains sur les 26 dcrits dans la littrature
examine (Ottogalli et al., 1973 ; Angulo et al., 1993 ; Pintado et al., 1996 ; Lin et al., 1999a ;
Garrote et al., 2001 ; Simova et al., 2002 ; Witthuhn et al., 2004) ne renferment qu'une seule
espce de levure. Cependant, certains peuvent en contenir 3 ou 4, voire jusqu' 7 pour l'un
d'entre-eux, et, par rapport ces derniers, la diversit du grain KJ en levures parat faible.
4.4.3 Bactries actiques

Lorsqu'elles sont prsentes dans des grains de kfir, les bactries actiques
appartiennent, comme c'est le cas de celle du grain KJ, au genre Acetobacter.
4.5

Formation du grain de kfir KJ

Jamais un grain de kfir na, ma connaissance, pu tre constitu in vitro partir de


cultures microbiennes. Les grains sont jusqu prsent reproduits par fragmentation
(Koroleva, 1988). Naturellement ou mcaniquement, des morceaux se dtachent dun grain
existant et grossissent pour fournir leur tour de petits grains.
4.5.1 Constitution in vitro dune structure de Gingerbeer plant : applicabilit aux grains de
kfir

Les Gingerbeer plant sont des associations de bactries lactiques et de levures utilises
pour fermenter de leau sucre. Elles se prsentent sous la forme de petites masses
translucides qui ont, linstar des grains de kfir, la proprit de se multiplier.
149

DISCUSSION

Pidoux (1988 & 1989) a isol du consortium de Gingerbeer plant une souche
bactrienne capable de produire un dextrane insoluble qui forme un gel. Cette structure
bactrienne fige a la particularit de prendre la forme de la structure mre lorsquelle est
cultive sur un milieu glos.
La souche capable de produire ce dextrane insoluble appartient un taxon,
Lactobacillus hilgardii, qui ne fait pas partie du consortium identifi dans les grains de kfir

(Ottogalli et al., 1973 ; Angulo et al., 1993 ; Pintado et al., 1996 ; Takizawa et al., 1998 ; Lin
et al., 1999a ; Garrote et al., 2001 ; Simova et al., 2002 ; Witthuhn et al., 2004 ; Mainville et
al., 2006 ; Chen et al., 2008). Par ailleurs, lexopolysaccharide cohsif de la matrice des

grains de kfir est du kfirane et non du dextrane (la Rivire & Kooiman, 1967).
Plusieurs souches produisant du kfirane ont t isoles de grains de kfir (la Rivire
et al., 1967 ; Toba et al., 1986 ; Toba et al., 1987 ; Yokoi et al., 1990). Le kfirane quelles

produisent, de mme que celui extrait de la matrice des grains est un exopolysaccharide
soluble (Kooiman, 1968). Le kfirane en solution glifie une temprature de 5 C en un gel
mou qui acquiert de la fermet en prsence dalcool et plus encore en prsence simultane
dalcool et de casine (Mukai et al., 1991). Dans le grain de kfir KJ lexpression de cette
proprit tait lie lactivit microbienne. La solubilit du kfirane de la matrice des grains
se manifestait lors des essais par la "disparition" de fragments du grain de kfir KJ dans du
lait. Dans les conditions usuelles de fermentation du kfir, lajout dalcool au lait namliorait
pas la prservation des fragments de grain. Celle-ci tait amliore lorsque, en prsence
d'alcool, les conditions d'atmosphre stimulaient la croissance des lactobacilles ou lorsque les
conditions de culture stimulaient simultanment la production locale dalcool par les levures
et la croissance des lactobacilles. Ces observations laissent penser que la transformation du
kfirane en gel ferme et son maintien au sein des grains rsultent dune dynamique
microbienne plus complexe que celle des Gingerbeer plant.
4.5.2 Processus de formation par croissance dbauches de grain

Daprs la description de la formation des grains de kfir in situ faite par Beijerinck
(188930), les grains de kfir se forment sur les parois des barriques en bois servant la

30

Beijerinck M.W., 1889. Sur le kfir. Arch. Nerl. Sci. Exactes Nat. 23, 428-444. Cit par : Pidoux, 1984.

150

DISCUSSION

prparation du kfir. La formation de structures microbiennes sur des surfaces solides est bien
connue dans les milieux aquatiques. Elle est dcrite comme un processus squentiel (Lasa,
2006) : des bactries libres se fixent sur la surface et y prolifrent, elles produisent ensuite la
matrice exopolysaccharidique, les premires bauches de l'architecture du biofilm
apparaissent puis la structure volue vers une architecture mature. Lorsque la structure du
biofilm est mature, des bactries sen dtachent pour coloniser le support. Au contraire des
biofilms, les grains de kfir ne semblent pas coloniser le support : Beijerinck (1889), en
prcisant lapparition "a et l" des grains, dcrit un vnement sporadique. Nanmoins, dans
lhypothse o les grains de kfir se forment selon un processus analogue celui de
ltablissement de ces biofilms, leur formation donnerait naissance des bauches de grain de
petite dimension voluant vers de plus grosses structures de grain matures.
Dans des conditions exprimentales simulant les conditions de formation de grain in
situ, le consortium microbien du grain de kfir KJ ne formait pas de structures microbiennes

sapparentant des grains.


4.5.3 Adquation des essais l'tablissement d'un processus de formation par croissance
dbauches de grain

Dans ces essais, du caill de premire fermentation, frais et sch, tait prserv au
cours de repiquages successifs dans du lait. Dans les milieux aquatiques, la formation de
certaines structures microbiennes est dcrite comme un processus impliquant une mobilit
microbienne (Filloux & Vallet, 2003 ; Dingding et al., 2006 ; Picioreanu et al., 2007). Ce type
de processus est le fruit de micro-organismes capables de se dplacer activement dans le
milieu. Le consortium du grain de kfir KJ comprenait un membre dot de cette capacit :
Acetobacter sp. (rsultat non prsent). La mobilit des micro-organismes intervient deux

stades de la formation des biofilms : au stade de l'adhsion initiale la surface solide et au


stade de l'laboration de l'architecture du biofilm. Le grain de kfir est, au contraire de ces
biofilms aquatiques, une structure compacte au sein de laquelle il est peu probable que le
micro-organisme, Acetobacter sp., puisse se dplacer. Il nest par contre pas exclu que sa
mobilit ait un rle au stade de la fixation du biofilm sur la paroi. Dans cette hypothse,
l'adhsion de Acetobacter sp. aux parois des barriques devait avoir lieu avant que le microorganisme soit immobilis dans les caills. La phase exprimentale autorisant cette mobilit
tait la formation des caills primaires.
151

DISCUSSION

Lors de cette phase, la fermentation du lait ensemenc avec des extraits du grain de
kfir KJ aboutissait une prise en masse du lait au terme de 2 semaines dincubation.
L'adhsion des bactries et la formation subsquente d'un biofilm est dcrite par Costerton &
Lewandowski (1995) comme un processus rapide. Le consortium microbien du grain de kfir
KJ formait, dans des essais indpendants, des structures microbiennes en 2 semaines. Dans ce
laps de temps, il en formait dans des bouillons de synthse ainsi que dans du lait incub dans
des conditions similaires celles appliques pour former les caills primaires. Ces structures
ne sapparentaient pas des grains de kfir mais elles tmoignaient de la rapidit de la
formation dune organisation microbienne par ce consortium. Par ailleurs, Lactobacillus
hilgardii forme in vitro des structures similaires celles des grains matures de Gingerbeer

plant en 10 jours (Pidoux, 1989).


Un mcanisme de rgulation du comportement des communauts microbiennes li
leur densit de population, appel quorum sensing, intervient dans la formation de divers
biofilms (Hentzer et al., 2004). Lassociation des micro-organismes en communaut
structure est dans ces cas dtermine par la concentration dans le milieu en molcules "de
communication" qu'elles produisent. Lorsque la densit de population microbienne crot dans
le milieu, la concentration en ces molcules "de communication" augmente et induit,
lorsqu'elle atteint un niveau suffisant, la formation du biofilm. Ces molcules "de
communication" agissent sur les membres du taxon qui les produisent et aussi, pour certaines,
sur ceux d'autres taxons (Diggle et al., 2007). Dans lhypothse o un tel mcanisme de
rgulation dterminerait la formation des grains de kfir, il serait conditionn par la densit
microbienne du lait ferment en membres du consortium l'origine d'une production de
molcules "de communication". Les conditions et la dure d'incubation appliques pour
former les caills primaires mis en uvre dans les essais de formation de grain, ainsi que la
maturit des caills, permettent de supposer que la densit microbienne globale y tait au
moins aussi leve que celle dterminant la formation des grains in situ. La densit
microbienne a toutefois pu hypothquer un tel processus au niveau de la densit individuelle
dun, ou de plusieurs, micro-organisme(s) en prsence. La densit relative (balance) des
diffrents micro-organismes du consortium, qui tait un paramtre non contrl, semblait en
effet dterminante dans la formation de biofilms par les extraits de grain.
Selon Lacrosse (1981) la crote spongieuse forme in situ sur les parois constitue,
aprs schage et morcellement, des grains de kfir schs. Dans lhypothse o les grains se
152

DISCUSSION

forment sur les parois des conteneurs comme le dcrit Beijerinck (1889), cela suppose que des
bauches de grains aient t emportes avec les fragments schs de crote spongieuse. Cette
gense a t simule in vitro en schant du caill form en botes de Petri. Dans ce schma
exprimental, les parois des botes servaient de support de fixation aux grains en formation.
De texture lisse, les surfaces des botes ne constituaient probablement pas un obstacle ce que
des bauches de grain soient entranes avec le caill sch. Les supports la fixation des
bauches de grain dans le caill frais, simuls par des copeaux de bois, taient conservs au
cours des repiquages successifs dans du lait.
Les repiquages successifs des caills frais et schs devaient permettre aux bauches
de grain dacqurir une taille suffisante pour tre dceles dans les caills. Laccroissement
des grains est dcrit comme un processus lent (Beijerinck, 1889). Cest un processus qui varie
dun grain lautre et en fonction des conditions de culture (Kuo & Lin, 1999 ; Garrote et al.,
2001 ; Ninane, 2002 ; Schroevers & Britz 2003). A priori de mme nature, les bauches de
grain et le grain mre taient supposs avoir des rythmes de croissance similaires dans des
conditions de culture comparables. Cependant, par le fait de leur proximit avec du caill, les
conditions de culture des bauches de grain diffraient de celles du grain mre cultiv dans du
lait. Ceci tait particulirement avr pour les bauches de grain potentiellement formes sur
les parois des copeaux de bois inclus dans les caills frais. Les bauches entranes avec le
caill sch taient probablement partiellement en contact avec du lait et taient
potentiellement dans des conditions plus proches de celles du grain mre. Leur rythme de
croissance a t extrapol partir de celui du grain mre cultiv dans les mmes conditions
dincubation et avec un taux densemencement plus dfavorable la croissance. Par ailleurs,
la dure de l'essai visait l'acquisition par les bauches de grain d'une taille surestime.
Toutefois, la dure des cycles de fermentation des bauches tait plus longue que celle du
grain mre et a pu en ralentir leur croissance.
4.5.4 Adquation du lait la croissance d'bauches de grain

La conception des essais reposait sur la confrontation et linterprtation des


observations sommaires relatives la formation de grains de kfir in situ relayes par
Beijerinck (1889) et par Lacrosse (1981). La formation de grains matures dans un
environnement de caill tait dduite de ces observations et se pouvait en tre indpendante.

153

DISCUSSION

Elle pouvait aussi voir le jour au contact direct du substrat de fermentation, le lait.
Cependant, le grain de kfir KJ ne se dveloppait pas, ou peu, dans du lait lorsquil tait
morcel. En dessous dune taille denviron 0,3 mm3, les fragments de grain ne se
dveloppaient ni dans du lait nature ni dans du lait modifi de faon favoriser la
structuration de la matrice du grain ou simuler le contexte environnemental cr par la
prsence de caillettes de veau comme le prcisent Beijerinck (1889) et Lacrosse (1981). Qui
plus est, des structures de grain denviron 3 ~ 6 mm3 disparaissaient dans du lait ;
probablement par dissolution du kfirane, une substance cohsive majeure du grain. Des
conditions de culture favorisant la glification du kfirane autorisaient la croissance ou la
prservation de fragments 10 fois plus gros, dune taille denviron 3 mm3. Les plus petits
grains matures, cest--dire capables de se reproduire dans du lait et ds lors de sy prserver,
rapports dans la littrature, ont un diamtre de 2-3 mm, cest--dire un volume de 4 14
mm3 (Bottazzi & Bianchi, 1980).
4.5.5 Hypothse de formation de grains par l'intermdiaire d'un biofilm

Le consortium microbien du grain de kfir KJ formait la surface du lait des biofilms.


Ces biofilms se formaient en conditions darobiose, dans du lait additionn d'extrait de
levure ou dans du lait nature selon le mode de constitution du consortium lorigine de leur
formation : extrait ensemble du grain ou reconstitu partir des souches individuelles isoles
du grain KJ. La formation de biofilms se caractrisait par une absence dacidification et de
texturation des laits ferments.
Les descriptions de formation de grains de kfir in situ rapportes par Beijerinck
(1889) et par Lacrosse (1981) ne mentionnent pas la prsence de biofilm mais leur occurrence
n'est pas exclue. Indirectement, par l'vocation de problmes d'altration, la description de
Beijerinck (1889) laisse penser quil a pu y avoir, certains moments, un dfaut
dacidification et de texturation du lait ferment. Dans ce cas, les caractristiques lies la
prsence des biofilms forms in vitro partir du consortium du grain KJ, sont rencontres.
Daprs les descriptions de Beijerinck (1889) et de Lacrosse (1981) les parois des
conteneurs constituent le sige de la formation des grains. Il est plausible que ces biofilms, de
nature collante, aient adhrs aux parois des conteneurs loccasion de leur manipulation.

154

DISCUSSION

Par ailleurs, la morphologie de certains grains de kfir laisse penser quils pourraient
provenir dun film : certains sont dcrits comme "pouvant tre drouls en une sorte de
feuille" (Marshall & Cole, 1984).
4.5.6 Adquation du consortium microbien la gense de grains

Les consortiums mis en oeuvre dans les essais de reconstitution du grain ont t
prpars par dispersion de grains de kfir KJ de faon inclure tous les micro-organismes du
grain mre et taient a priori complets. Mme "dispers", le consortium du grain mre de
kfir KJ tait capable de former des structures microbiennes. Les structures formes se
prsentaient toutefois dans ce cas sous la forme de biofims souples et non sous la forme de
grains plus consistants. Le consortium du grain KJ n'autorisait par ailleurs pas la croissance
et/ou la prservation de trs petites structures de grains, reprsentes dans les essais par des
fragments du grain mre.
L'anomalie au niveau de la cohsion de la matrice de ces structures microbiennes
(biofilms et fragments de grain), considres ici comme primaires dans la gense des grains,
pourraient provenir de l'absence d'un intervenant microbien pionnier, c'est dire d'un microorganisme ou d'un ensemble de micro-organismes qui amorce la formation de la structure
microbienne, dans le consortium du grain KJ. Un processus de colonisation squentielle des
surfaces, amorc par un petit nombre d'espces bactriennes pionnires puis colonis par
d'autres, a lieu notamment dans la formation de la plaque dentaire (Yoshida et al., 2006).
D'autres exemples de colonisation squentielle des surfaces sont connus, notamment dans le
milieu marin (Compre, 1999). Dans les cas relevs, une "disparition" des micro-organismes
pionniers de la structure microbienne, comme ce serait hypothtiquement le cas dans le grain
de kfir KJ, n'est pas relate. Cela n'exclut toutefois pas l'ventualit d'un tel vnement dans
les grains de kfir ; il s'agit de structures microbiennes qui s'cartent en de nombreux points
de ces exemples.

155

CONCLUSIONS ET PERSPECTIVES

CONCLUSIONS ET PERSPECTIVES
Lobjectif de ce travail tait de caractriser la composition microbienne dun grain de

kfir tant du point de vue qualitatif que quantitatif. Il incluait un aspect mthodologique par la
recherche dune stratgie didentification bactrienne rapide et fiable, adapte la flore
lactique de grains de kfir.
Ce travail visait galement entamer une rflexion exprimentale en matire de
reconstitution dun grain de kfir. Cet objectif sinscrivait dans la perspective, qui reste
dactualit, de valider le caractre complet de l'identification microbienne du grain par
comparaison du produit de fermentation du grain mre avec celui du grain reconstitu partir
des souches microbiennes qui en ont t isoles.
5.1

Caractristiques microbiennes du grain de kfir KJ

5.1.1 Flore contaminante

La sensibilit du grain une contamination par des germes pathognes a t value


au travers de son acidit. Dans les conditions de culture appliques au laboratoire, l'acidit du
grain de kfir KJ tait telle quelle permet de le qualifier de "peu sensible" une
contamination par des germes pathognes mais n'carte pas l'ventualit d'une telle
contamination : certains pathognes rsistent des pH proches de celui que le grain affichait.
L'innocuit de la microflore du grain de kfir a t vrifie, d'une part, par la recherche
de germes tmoignant d'un dfaut d'hygine et, d'autre part, par la recherche des germes
pathognes prvalant dans nos rgions et susceptibles de tolrer l'acidit du grain. Le lait
ferment partir du grain de kfir KJ tait exempt, dans des limites de dtection dduites de
la lgislation en vigueur ou des recommandations de la Fdration internationale de laiterie
(FIL, Bruxelles), de germes indicateurs de dfauts d'hygine et de germes pathognes. La
qualit hyginique du grain de kfir KJ satisfaisait ds lors aux impratifs sanitaires inhrents
une distribution publique mais, tant un paramtre conditionnel, elle ne peut tre considre
comme dfinitivement acquise.

157

CONCLUSIONS ET PERSPECTIVES

5.1.2 Flore banale

La premire tape de la caractrisation de la flore banale, non contaminante, du grain


KJ visait identifier les groupes de micro-organismes participant au consortium. Elle a t
effectue par la mthode classique disolement sur des milieux de culture slectifs et reposait
sur une connaissance prdtermine de la composition microbienne de grains de kfir : le
choix des milieux de culture prenait en compte les groupes microbiens dont la prsence dans
des grains de kfir est mentionne dans la littrature. Cette tape a permis de rvler la
prsence, dans le grain KJ, de lactobacilles, de coques lactiques, de leuconostocs, de levures
et de bactries actiques. Elle a, paralllement, permis d'en carter les pdiocoques, les
microcoques et Weisella viridescens. La microflore banale du grain de kfir KJ comprend
ainsi tous les groupes microbiens dcrits comme ayant une fonctionnalit dans la qualit du
kfir et/ou dans la constitution et la prservation des grains, et est dpourvue des groupes
gnralement associs dautres matrices alimentaires.
Les membres de la plupart des groupes microbiens rvls dans le grain KJ ont ensuite
t identifis, un niveau taxonomique plus fin, l'aide de plusieurs mthodes reposant sur
des critres analytiques de nature diffrente - phnotypique, gnotypique et/ou physicochimique de faon asseoir la fiabilit de l'identification. Seul l'identification du groupe des
bactries actiques reposait sur un unique critre. Toutes ces mthodes taient indpendantes
dune connaissance prdtermine des espces et autorisaient, cette tape de la
caractrisation de la flore banale du grain, la mise au jour de micro-organismes inhabituels ou
non encore dcrits. Cette potentialit tait renforce, pour les bactries lactiques, par
l'application d'une stratgie d'identification indpendante d'isolements bactriens par culture.
La flore banale identifie dans le grain KJ comprenait exclusivement des micro-organismes
habituels de grains de kfir, cest--dire qui avaient dj t identifis par d'autres dans des
grains de kfir et est de ce point de vue ordinaire. Elle incluait une levure incapable de
fermenter le lactose, Kazachstania exigua, comme le sont la plupart des levures de grains de
kfir, ce qui renforce le caractre conforme du grain KJ, et les trois lactobacilles typiques du
kfir : Lactobacillus kefiranofaciens, Lb. kefiri et Lb. parakefiri qui lui confrent un caractre
dauthenticit.
La diversit des micro-organismes identifis au sein de chacun des groupes reposait
sur la morphologie des colonies dveloppes sur les milieux de cultures et, pour les bactries
158

CONCLUSIONS ET PERSPECTIVES

lactiques, sur la sensibilit de la mthode molculaire applique pour les identifier sans les
isoler pralablement par culture. La sensibilit de la mthode molculaire a t fixe de faon
dtecter les espces dominantes, en terme dunits viables, de chacun des groupes de
bactries lactiques identifis dans le grain KJ ou dont la prsence tait pressentie sur base des
donnes bibliographiques (lactobacilles de types fermentaires distincts). Chacun des groupes
cibls a livr une espce, l'exception du groupe des lactobacilles htrofermentaires qui en
comptait deux. La mthode indpendante d'isolements par culture a permis de rvler au sein
de ce groupe la prsence d'un lactobacille, Lb. parakefiri, peu enclin se dvelopper sur les
milieux de culture slectionns et dont la morphologie des colonies ne permettait pas de le
distinguer des autres, plus abondants. La diversit des bactries lactiques tablies pour le grain
KJ tait comparable celle des grains les plus fournis mais on ne peut en garantir le caractre
complet. Le grain KJ se caractrise, par ailleurs, par une faible diversit des levures ; seule
une espce y a t identifie alors que les grains de kfir peuvent en contenir trois ou quatre,
voire jusqu' sept mais c'est exceptionnel.
La flore du grain KJ tait dpourvue des taxons pour lesquels une production avre
de kfirane, lexopolysaccharide constitutif de la matrice des grains de kfir, est dmontre :
Lb. kefiranofaciens subsp. kefiranofaciens et Lb. brevis. Cela ne compromet probablement

pas la prsence de producteurs de kfirane parmi les taxons identifis : ils incluaient
Lb. kefiranofaciens subsp. kefirgranum et Lb. kefiri, des taxons apparents avec les

producteurs avrs de kfirane et dont les souches isoles du grain KJ taient capables de
produire de lexopolysaccharide. Lidentification de la nature des exopolysaccharides produits
par ces souches, qui sinscrit dans la continuit de ce travail, permettra d'asseoir cette
assertion. Elle permettra paralllement de prciser le rle de ces exopolysaccharides dans la
fonctionnalit du grain et en particulier dans la constitution de la matrice du grain. Les
exopolysaccharides que les souches de Lb. kefiranofaciens subsp. kefirgranum et de Lb. kefiri
isoles du kfir KJ produisaient semblaient en effet diffrer par leur viscosit et par leur
fonctionnalit. Ce qui n'exclut pas qu'il puisse s'agir dans les deux cas de kfirane : le
polysaccharide extrait de grains de kfir et dfini comme tel prsente parfois deux pics
distincts en chromatographie.
Du point de vue quantitatif, la flore du grain KJ se caractrisait par une dominance des
bactries lactiques, essentiellement du fait des lactobacilles, vis--vis des levures et des
bactries actiques.
159

CONCLUSIONS ET PERSPECTIVES

5.1.3 Variabilit quantitative de la microflore

Les lactobacilles, les coques lactiques et les levures ont t dnombrs rgulirement
pendant 7 semaines dans des chantillons de grains cultivs en parallle. Les rsultats de ces
dnombrements ont montr que l'application d'une pratique de culture usuelle, conduite avec
un taux d'ensemencement et des conditions d'incubation contrls, gnre une variabilit de
labondance microbienne du grain qui affecte ingalement les diffrents groupes microbiens.
Cette variabilit de la composition quantitative du grain a eu des rpercussions sur lactivit
biosynthtique du consortium. Elle a permis de rvler lexistence de biofilms de kfir et tait
ce titre intressante dans le cadre de ce travail. Dans dautres perspectives exprimentales
toutefois, une moindre variabilit du consortium serait prfrable. Les sources potentielles de
variabilit ont t identifies pour orienter la recherche dune pratique de culture mieux
matrise. Elles concernent la temprature initiale du lait de renouvellement des cultures,
lintensit du rinage des grains et lhtrognit de lenvironnement immdiat des grains
lie notamment la pratique d'une culture statique de grain.
5.2

Atouts, contraintes et performances de la mthode molculaire d'identification des


bactries lactiques

5.2.1 Universalit et indpendance vis--vis d'une connaissance pr-dtermine des espces


recherches

L'outil molculaire choisi pour identifier les bactries lactiques du grain tait lanalyse
de la squence du gne codant pour lARNr 16S. Dans l'approche adopte, lorigine
bactrienne des squences de l'ADNr 16S tait dtermine par comparaison avec des
squences dorigine connue. La disposition dune banque publique de squences identifies
de lADNr 16S, facilement accessible et quipe d'outils de comparaison performants, confre
cette approche un caractre universel, applicable dans tout laboratoire. Elle conserve un
autre aspect intressant des dterminations phnotypiques classiques : l'indpendance vis-vis d'une connaissance pr-dtermine des espces recherches, parmi le groupe bactrien
cibl.

160

CONCLUSIONS ET PERSPECTIVES

5.2.2 Indpendance vis--vis d'isolements par culture

La mthode a t applique au consortium du grain, sans isolement pralable des


micro-organismes par culture, et prsente de ce fait, par rapport aux mthodes classiques, un
avantage technique de rapidit. Elle gagne aussi en assurance et en possibilits exploratrices :
indpendante de la croissance des micro-organismes, qui revt pour certains dentre eux un
caractre conditionnel strict, elle permet dviter le risque domission despces li
lincapacit des micro-organismes se dvelopper sur les milieux slectionns ou
actuellement disponibles.
5.2.3 Sensibilit

L'ADNr 16S provenant des diffrents micro-organismes du consortium du grain a t


individualis par clonage dans Escherichia coli. Avec ce mode de sparation de lADNr 16S,
la sensibilit de la mthode, c'est--dire la diversit microbienne identifie, dpend du nombre
de squences analyses. Le nombre de squences analyser pour obtenir une sensibilit
dtermine dpend des quantits relatives d'ADNr 16S issus des diffrents micro-organismes :
il crot en fonction de l'ampleur du dsquilibre dans la balance des populations microbiennes,
en terme de quantit ou copies d'ADNr 16S. Dans ce travail, le nombre de squences
analyser a t limit en traitant sparment l'ADNr 16S des groupes microbiens d'abondance
ingale dans le grain. Cette stratgie na pas requis d'tape mthodologique supplmentaire :
elle a t effectue l'occasion de l'amplification de l'ADNr 16S du consortium qui est un
pralable indispensable toute mthode base sur l'analyse d'une molcule gnomique.
Ralise l'aide d'amorces spcifiques pour mettre en exergue les populations minoritaires,
cette stratgie est applicable d'autres consortiums de bactries lactiques sous condition que
les populations dominantes et minoritaires concernent les mmes groupes microbiens que
ceux du grain KJ. Dans le cas contraire, elle doit tre adapte en dterminant d'autres amorces
d'amplification spcifique.
L'analyse des squences a t limite de courtes rgions cibles de l'ARNr 16S o
sont concentres les diffrences entre les espces. Cette technique permettait une analyse
visuelle des squences plus fine que celle autorise par les outils informatiques disponibles :
la nature des nuclotides non apparis pouvait de cette faon aisment tre identifie et
interprte. Elle inscrivait par ailleurs la mthode dans les contraintes des nouveaux types
dappareils de squenage et largissait ainsi la perspective dune application en routine.
161

CONCLUSIONS ET PERSPECTIVES

Toutefois, en limitant aussi drastiquement la longueur de la squence analyse, on perd de


l'information et on diminue le pouvoir discriminant de la molcule, mme en ciblant des
rgions contenant essentiellement de l'information utile lapplication prsente.
5.2.4 Fiabilit et limitations

Ces courtes rgions de l'ADNr 16S ont des pouvoirs discriminants variables selon le
groupe microbien considr. Les plus discriminantes vis--vis des bactries lactiques de
grains de kfir ont t identifies. Une delles, la rgion V1, autorisait une diffrenciation
fiable des lactobacilles et des coques lactiques au niveau de lespce et lidentification des
membres du genre Leuconostoc. La diffrenciation des Leuconostoc sp. a t effectue dans
une autre rgion de lADNr 16S, la rgion V2. Bien quelle tait la plus discriminante vis-vis des leuconostocs, elle ne permet pas lidentification fiable de ces derniers au niveau de
lespce.
La fiabilit de lidentification molculaire repose sur lexactitude de lidentification de
la bactrie lorigine de la squence homologue celle inconnue. Elle est certaine lorsquil
sagit de la squence de la souche type. Dans les autres cas, la prudence impose de vrifier la
source.
5.2.5 Perspectives d'application

Conue pour identifier les bactries lactiques d'un consortium susceptible d'inclure des
spcimens appartenant une large diversit d'espces laitires, la mthode d'identification
pourrait fiablement tre applique d'autres consortiums laitiers que les grains de kfir. Cette
mthode conviendrait, par exemple, pour caractriser les diffrents laits ferments
traditionnels que l'on trouve par le monde.
5.3

Avances en matire de reconstitution d'un grain de kfir

5.3.1 Paramtres microbiens dterminant la formation de structures

Les Gingerbeer plant sont des structures microbiennes apparentes aux grains de kfir
dont une constitution in vitro, partir de souches isoles, a t dcrite. Elles diffrent
cependant des grains de kfir par un aspect fondamental au niveau de la formation de la
structure physique : la nature de l'exopolysaccharide de la matrice des Gingerbeer plant revt
162

CONCLUSIONS ET PERSPECTIVES

un caractre insoluble dans l'eau tandis que celle des grains de kfir est soluble dans l'eau.
Dans le cas des grains de kfir, le comportement de fragments du grain KJ incubs dans un
substrat lact a montr que la prservation de la structure solide en milieu aqueux est lie
une activit microbienne. La dpendance microbienne de cette proprit physique implique un
schma exprimental de constitution plus complexe que celui des Gingerbeer plant.
La simulation exprimentale des conditions naturelles de formation de grains in situ
n'a pas conduit la reconstitution du grain partir de son consortium. Les descriptions des
conditions naturelles prvalant lors de cette formation sont sommaires et en partie
hypothtiques. Aussi, leur simulation dans une logistique de laboratoire pouvait diffrer de la
ralit par certains points. Par la nature du substrat et les conditions dincubation, elle en
restait nanmoins vraisemblablement proche. Effectus partir de consortiums a priori
complets, labsence de grains lissue de ces essais de simulation a montr que la prsence
simultane de tous les membres du consortium ne suffit pas la reconstitution du grain dans
des conditions proches de celles lorigine de sa formation.
Les consortiums microbiens mis en oeuvre dans ces essais de simulation comprenaient
a priori tous les membres du consortium du grain. Il n'est toutefois pas exclu que d'autres

micro-organismes aient t impliqus dans sa gense. L'observation in situ de la gense de


grains de kfir et l'analyse de l'volution la composition microbienne des structures en
formation serait un moyen de vrifier si l'amorage de leur gense implique des microorganismes qui ne persistent pas dans le grain mature. La formation de grains de kfir est
toutefois un vnement li une pratique ancienne qui n'est peut-tre plus d'application. La
ralisation d'essais de reconstitution du grain KJ et de croissance de fragments du grain dans
sa rgion d'origine, le Caucase, serait alors une alternative possible pour mettre en vidence
une intervention de micro-organismes d'amorage dans la gense du grain KJ. Dans
l'hypothse o de tels micro-organismes sont ncessaires la gense du grain KJ, c'est en effet
dans l'environnement microbien de sa rgion d'origine qu'on a le plus de chance de les
trouver.
Des consortiums microbiens de compositions qualitatives identiques montraient des
aptitudes diffrentes former des structures microbiennes dans du lait. Extraits de grains dont
la composition quantitative tait variable, ces aptitudes variables former des structures sont
probablement lies la balance des micro-organismes en prsence. La formation de ces
163

CONCLUSIONS ET PERSPECTIVES

structures tait associe une activit neutralisante vis--vis du substrat qui traduisait
vraisemblablement un dveloppement intense de la levure du consortium. Un autre paramtre
microbien semblait dterminant dans la formation de ces structures : la prsence dun facteur
connu pour stimuler la production de kfirane, lexopolysaccharide constitutif de la matrice
des grains. Paralllement, un consortium reconstitu avec des souches pour lesquelles cette
production avait t induite en prculture formait des structures en labsence de ce facteur.
Lincidence de ce conditionnement cellulaire, et de ltat dactivit biosynthtique des
producteurs de kfirane, sur la formation de structures doit toutefois tre confirme. Dans
laffirmative, cela signifie que la formation de structures microbiennes est conditionne par la
balance microbienne et par ltat dactivit biosynthtique du (ou des) producteur(s) de
kfirane.
5.3.2 Hypothse de formation de grains par l'intermdiaire de biofilms

Les structures microbiennes formes dans le lait par le consortium microbien du grain
de kfir avaient laspect de biofilms souples et lastiques. La formation de telles structures
dans le contexte du kfir n'est pas dcrite mais les lments de la littrature en expriment
indirectement la possibilit. Par ailleurs, le lait, nature ou modifi, tait inappropri la
croissance de petites structures de grain KJ, rendant peu probable un processus de formation
du grain par croissance de petites structures initiales de grain dans du lait de vache. Pour
autant que le consortium du grain KJ renferme tous les micro-organismes ncessaires sa
formation, un tel processus au sein des biofilms ou lvolution de ces biofilms vers une
structure de grain de consistance plus ferme est par contre envisageable mais reste
dmontrer.
Cette perspective exprimentale peut s'envisager en incubant les biofilms forms par le
consortium dans des conditions favorables la constitution de la matrice du grain, c'est dire
la production et la glification du kfirane. L'observation du comportement du grain
morcel a, indirectement, permis de les identifier : il s'agit d'une incubation en anarobiose
dans du lait additionn de glucose ou d'thanol.

164

CONCLUSIONS ET PERSPECTIVES

5.3.3 Rle des diffrents micro-organismes dans la formation des grains

La comprhension du rle des diffrents intervenants microbiens et de leur(s)


mcanisme(s) d'action dans la formation des grains de kfir est un vaste domaine qui reste
largement explorer.
La possibilit de pouvoir crer une structure microbienne in vitro largit les
perspectives d'investigation pour tudier son processus de formation. Elle permet notamment
de statuer directement et formellement sur l'implication d'un facteur microbien ou chimique
dans celle-ci. Ce travail ouvre de telles perspectives pour la formation des biofilms de kfir.
Bien que diffrentes des grains de kfir, ces structures microbiennes manent du
comportement d'agrgation propre au consortium du grain et offrent un support la
comprhension des mcanismes sous-jacents.
Ce travail laisse par ailleurs entrevoir la possibilit de rduire le nombre d'intervenants
microbiens manipuler pour tudier le processus de formation des biofilms. La croissance,
l'activit biosynthtique et l'aptitude s'agglutiner variables des diffrents protagonistes
laissent en effet penser que leur degr d'implication dans la formation des biofilms est ingal.
Compltes par des informations bibliographiques, les observations releves suggrent un
rle dterminant de la levure du consortium, Kazachstania exigua, et de Lactobacillus kefiri
et un rle de moindre importance des taxons Lb. kefiranofaciens subsp. kefirgranum,
Leuconostocs mesenteroides et Lactococcus lactis dans la formation de ces biofilms.

Disposant de souches individuelles isoles du grain capables de former ces biofilms, la


vrification de cette prsomption peut s'envisager par l'observation du comportement d'un
consortium partiellement reconstitu, dans lequel les espces pressenties comme tant de
moindre importance feraient dfaut.
Une ambigut concernant un aspect de la formation du grain, intervenant
probablement un stade ultrieur de sa reconstitution, a t souleve. La caractrisation du
consortium a en effet rvl la prsence dans le grain KJ de deux micro-organismes
susceptibles d'intervenir dans la constitution de la matrice du grain : Lb. kefiranofaciens
subsp. kefirgranum et Lb. kefiri. Leur rle dans cet aspect de la formation du grain pourrait
tre prcis en comparant la nature des exopolysaccharides produits par ces micro-organismes
avec celle de l'exopolysaccharide prsent dans le grain.

165

ANNEXE I

ANNEXE I : ANCIENNES DNOMINATIONS DES MICRO-ORGANISMES DU KFIR

Taxons actuels (2007)

Anciennes dnominations

Rfrences des citations

Lactobacillus kefiranofaciens

Takizawa et al., 1998

Lactobacillus kefirgranum

Takizawa et al., 1998

Lactobacillus paracasei
subsp. pseudoplantarum
Lactobacillus casei
subsp. tolerans
Lactobacillus casei
subsp. rhamnosus
Streptococcus lactis
Streptococcus salivarius
subsp. thermophilus
Lactobacillus viridescens

Angulo et al., 1993


Simova et al., 2002
Angulo et al., 1993

Angulo et al., 1993

Acetobacter rancens

Ottogalli et al., 1973

Kazachstania exigua

Candida holmii

Kluyveromyces lactis
Kluyveromyces marxianus

Saccharomyces lactis
Candida pseudotropicalis
Candida kefyr

Saccharomyces cerevisiae
Yarrowia lipolytica

Saccharomyce Carlbergensis
Candida lipolytica

Angulo et al., 1993


Witthuhn et al., 2004
Ottogalli et al., 1973
Ottogalli et al., 1973
Angulo et al., 1993
Witthuhn et al., 2004
Ottogalli et al., 1973
Witthuhn et al., 2004

Bactries lactiques
Lactobacillus kefiranofaciens
subsp. kefiranofaciens
Lactobacillus kefiranofaciens
subsp. kefirgranum
Lactobacillus paracasei
subsp. paracasei
Lactobacillus paracasei
subsp. tolerans
Lactobacillus rhamnosus
Lactococcus lactis subsp. lactis
Streptococcus thermophilus
Weissella viridescens

Angulo et al., 1993


Ottogalli et al., 1973
Angulo et al., 1993

Bactries actiques
Acetobacter pasteurianus
Levures

167

ANNEXE II

ANNEXE II : CODE DES ACIDES NUCLIQUES DE L'UNION INTERNATIONALE DE


BIOCHIMIE (CORNISH-BOWDEN,

1985).

Code Description
A
C
G
T
U
R
Y
M
K
W
S
B
D
H
V
N

Adenine
Cytosine
Guanine
Thymine
Uracile
Purine (A ou G)
Pyrimidine (C, T, ou U)
C ou A
T, U, ou G
T, U, ou A
C ou G
C, T, U, ou G (pas A)
A, T, U, ou G (pas C)
A, T, U, ou C (pas G)
A, C, ou G (pas T, pas U)
N'importe quelle base (A, C, G, T, ou U)

169

BIBLIOGRAPHIE

BIBLIOGRAPHIE
Abraham A.G. & De Antoni G.L. (1999). Characterization of kefir grains grown in cows' milk and in soya milk.
J. Dairy Res. 66, 327-333
Achtman M. & Wagner M. (2008). Microbial diversity and the genetic nature of microbial species. Nat. Rev.
Microbiol. (In press).
Alais C. (1974). Les fromages. Les enzymes coagulants. Les mthodes modernes. In Alais C., ed. Science du
lait : principes des techniques laitires. Paris : SEP, p. 583-712
Alonso L., Cuesta E.P. & Gilliland S.E. (2003). Production of free conjugated linoleic acid by Lactobacillus
acidophilus and Lactobacillus casei of human intestinal origin. J. Dairy Sci. 86, 1941-1946
Altermann E., Russell W.M., Azcarate-Peril M.A., Barrangou R., Buck B.L., McAuliffe O., Souther N., Dobson
A., Duong T., Callanan M., Lick S., Hamrick A., Cano R. & Klaenhammer T.R. (2005). Complete
genome sequence of the probiotic lactic acid bacterium Lactobacillus acidophilus NCFM. Proc. Natl.
Acad. Sci. U.S.A. 102, 3906-3912
Amiel C., Mariey L., Curk-Daubi M.C., Pichon P. & Travert J. (2000). Potentiality of Fourier transform
infrared spectroscopy (FTIR) for discrimination and identification of dairy lactic acid bacteria. Lait 80,
445-459
Angulo L., Lopez E. & Lema C. (1993). Microflora present in kefir grains of the Galician region (North-West of
Spain). J. Dairy Res. 60, 263-267
Anonyme AFSCA (2004). Avis 28-2004 - Risques lis Enterobacter sakazakii. [en ligne]. Accessible sur
Internet : <http://www.afsca.be/home/com-sci/doc/avis04/Avis_2004-28.pdf>, consult le 21 juin 2007.
Anonyme Centre belge d'information pharmacothrapeutique (2008). Rpertoire comment des mdicaments,
septembre 2008. [en ligne]. Accessible sur Internet : <http://www.cbip.be>, consult le 08 septembre
2008.
Anonyme Centre for Infections (2007). Identification of glucose non-fermenting Gram negative rods. [en ligne].
Accessible
sur
Internet :
<http://www.hpastandardmethods.org.uk/documents/bsopid/pdf/bsopid17.pdf>, consult le 21 juin 2007.
Anonyme DSMZ (2001). Acetobacter Peroxydans Medium: Medium 254. Braunschweig, Allemagne : Deutsche
Sammlung von Mikroorganismen und Zellkulturen.
Anonyme FDA (1999). Factors affecting the growth of some foodborne pathogens. In The "Bad Bug Book".
Rockville, MD, USA : U.S. Food & Drug Administration. [en ligne]. Accessible sur Internet :
<http://www.cfsan.fda.gov/~mow/factors.html>, consult le 4 juin 2007.
Anonyme
Groupe
Danone
(2006).
Actualits.
[en
ligne].
Accessible
sur
Internet :
<http://www.danone.com/wps/portal/jump/DanoneCorporate.Presse.Actualites.CommunCommuniques?
ref=CMS.DanoneCorporate.Presse.Actualites.Communiques.Trimestre3.070906>, consult le 25 mai
2007.
Anonyme Groupe Danone (2007). Marques et Produits. [en ligne]. Accessible sur Internet :
<http://www.danone.com/wps/portal/jump/DanoneCorporate.Marques.ProdLaitiers>, consult le 23 mai
2007.
Anonyme European Food Safety Authority (2005). Zoonoses in the European Union. [en ligne]. Accessible sur
Internet :
<http://www.efsa.europa.eu/etc/medialib/efsa/publications.Par.0011.File.dat/efsa_zoonoses_2005_broc
hure_en.pdf>, consult le 8 juin 2007.
Anonyme FAO/WHO (2001). Health and nutritional properties of probiotics in food including powder milk with
live lactic acid bacteria. Cordoba, Argentina, 1-4 October 2001. [en ligne]. Accessible sur Internet :
<http://www.who.int/foodsafety/publications/fs_management/en/probiotics.pdf>, consult le 28
novembre 2007.

171

BIBLIOGRAPHIE

Anonyme INRA (2008). Flore d'affinage des fromages. [en ligne]. Accessible sur Internet :
<http://www.inra.fr/internet/Directions/DIC/presinra/SAQfiches/floreaffin.htm>, consult le 11 avril
2008.
Anonyme Lifeway (2005). How cultured are you ?
<www.lifeway.net/about.php >, consult le 24 mai 2007.
Anonyme RDP (2008). Ribosomal Database Project
<http://rdp.cme.msu.edu>, consult le 02 juin 2008.

II.

[en
[en

ligne].
ligne].

Accessible
Accessible

sur

Internet :

sur

Internet :

Anonyme Valio (2007). SIA Valio International, Latvia. [en ligne]. Accessible sur Internet :
<http://www.valio.fi/portal/page/portal/valiocom/Valio_worldwide/Subsidiaries/sia_valio_international
04082006150235>, consult le 25 mai 2007.
Arihara K., Toba T. & Adachi S. (1990). Immunofluorescence microscopic studies on distribution of
Lactobacillus kefiranofaciens and Lactobacillus kefir in kefir grains. Int. J. Food Microbiol. 11, 127134
Assadi M.M., Pourahmad R. & Moazami N. (2000). Use of isolated kefir starter cultures in kefir production.
World J. Microbiol. Biotechnol. 16, 541-543
Athanasiadis I., Boskou D., Kanellaki M. & Koutinas A.A. (2001). Effect of carbohydrate substrate on
fermentation by kefir yeast supported on delignified cellulosic materials. J. Agric. Food Chem. 49, 658663
Athanasiadis I., Boskou D., Kanellaki M., Kiosseoglou V. & Koutinas A.A. (2002). Whey liquid waste of the
dairy industry as raw material for potable alcohol production by kefir granules. J. Agric. Food Chem.
50, 7231-7234
Barnett J.A., Payne R.W. & Yarrow D. (2000). Saccharomyces exiguus Reess 1870. In Barnett J.A., Payne R.W.
& Yarrow D., eds. Yeasts: characteristics and identification. Cambridge, UK : Cambridge University
Press, p. 646
Bergmaier D. (2002). Production d'exopolysaccharides par fermentation avec des cellules immobilises de Lb.
rhamnosus RW-9595M d'un milieu base de permat de lactosrum. [en ligne]. Accessible sur
Internet :
<http//archimede.bibl.ulaval.ca/archimede/files/ff2434b9-5952-4866-b23a2bf6ba292499/20383.html >, consult le 06 dcembre 2007.
Bhowmik T. & Marth E. (1990). Role of Micrococcus and Pediococcus species in cheese ripening: a review. J.
Dairy Sci. 73, 859-866
Bottazzi V. & Bianchi F. (1980). A note on scanning electron microscopy of micro-organisms associated with
the kefir granule. J. Appl. Bacteriol. 48, 265-268
Brenner D.J., Fanning G.R., Rake A.V. & Johnson K.E. (1969). Batch procedure for thermal elution of DNA
from hydroxyapatite. Anal. Biochem. 28, 447-459
Brenner D.J., Staley J.T. & Krieg N.R. (2005). Classification of procaryotic organisms and the concept of
bacterial speciation. In Brenner D.J., Staley J.T. & Krieg N.R., eds. Bergey's manual of systematic
bacteriology, Vol. 2. New York, USA : Springer, p. 27-32
Bringel F., Castioni A., Olukoya D.K., Felis G.E., Torriani S. & Dellaglio F. (2005). Lactobacillus plantarum
subsp. argentoratensis subsp. nov., isolated from vegetable matrices. Int. J. Syst. Evol. Microbiol. 55,
1629-1634
Browne N. & Dowds B.C.A. (2002). Acid stress in food pathogen Bacillus cereus. J. Appl. Microbiol. 92, 404414
Cai H., Rodrguez B.T., Zhang W., Broadbent J.R. & Steele J.L. (2007). Genotypic and phenotypic
characterization of Lactobacillus casei strains isolated from different ecological niches suggests
frequent recombination and niche specificity. Microbiol. 153, 2655-2665
Cammarota M.C. & Sant'Anna G.L. (1998). Metabolic blocking of exopolysaccharides synthesis: effects on
microbial adhesion and biofilm accumulation. Biotechnol. Lett. 20, 1-4
Cerning J. (1990). Exocellular polysaccharides produced by lactic acid bacteria. FEMS Microbiol. Rev. 87, 113130

172

BIBLIOGRAPHIE

Chagnaud P., Machinis K., Coutte L.A., Marecat A. & Mercenier A. (2001). Rapid PCR-based procedure to
identify lactic acid bacteria: application to six common Lactobacillus species. J. Microbiol. Meth. 44,
139-148
Cheirsilp B., Shimizu H. & Shioya S. (2003a). Enhanced kefiran production by mixed culture of Lactobacillus
kefiranofaciens and Saccharomyces cerevisiae. J. Biotechnol. 100, 43-53
Cheirsilp B., Shoji H., Shimizu H. & Shioya S. (2003b). Interactions between Lactobacillus kefiranofaciens and
Saccharomyces cerevisiae in mixed culture for kefiran production. J. Biosci. Bioeng. 96, 279-284
Chen C. & Liu B.Y. (2000). Changes in major components of tea fungus metabolites during prolonged
fermentation. J. Appl. Microbiol. 89, 834-839
Chen M.J., Liu J.R., Sheu J.F., Lin C.W. & Chuang C.L. (2006). Study on skin care properties of milk kefir
whey. Asian-Aust. J. Anim. Sci. 19, 905-908
Chen C., Chan H.M. & Kubow S. (2007). Kefir extracts suppress in vitro proliferation of estrogen-dependent
human breast cancer cells but not normal mammary epithelial cells. J. Med. Food 10, 416-422
Chen H.C., Wang S.Y. & Chen M.J. (2008). Microbiological study of lactic acid bacteria in kefir grains by
culture-dependent and culture-independent methods. Food Microbiol. 25, 492-501
Choi I.K., Jung S.H., Kim B.J., Park S.Y., Kim J. & Han H.U. (2003). Novel Leuconostoc citreum starter culture
system for the fermentation of kimchi, a fermented cabbage product. Antonie Van Leeuwenhoek 84,
247-253
Christensen H., Angen O., Mutters R., Olsen J.E. & Bisgaard M. (2000). DNA-DNA hybridization determined in
micro-wells using covalent attachment of DNA. Int. J. Syst. 50, 1095-1102
Clarke L.A., Rebelo C.S., Gonalves J., Boarida M.G. & Jordan P. (2001). PCR amplification introduces errors
into mononucleotide and dinucleotide repeat sequences. J Clin Pathol 54, 351-353
Cilia V., Lafay B. & Christen R. (1996). Sequence heterogeneities among 16S ribosomal RNA sequences, and
their effect on phylogenetic analyses at the species level. Mol. Biol. Evol. 13, 451-461
Coeuret V., Dubernet S., Bernardeau M., Gueguen M. & Vernoux J.P. (2003). Isolation, characterisation and
identification of lactobacilli focusing mainly on cheeses and other dairy products. Lait 83, 269-306
Cohan F.M. & Perry E.B. (2007). A systematic for discovering the fundamental units of bacterial diversity. Curr.
Biol. 17, R373-R386
Collins M.D., Rodrigues U., Ash C., Aguirre M., Farrow J.A.E., Martinez-Murcia A., Phillips B.A., Williams
A.M. & Wallbanks S. (1991). Phylogenetic analysis of the genus Lactobacillus and related lactic acid
bacteria as determined by reverse transcriptase sequencing of 16S rRNA. FEMS Microbiol. Lett. 77, 512
Collins M.D., Samelis J., Metaxopoulos J. & Wallbanks S. (1993). Taxonomic studies on some leuconostoc-like
organisms from fermented sausage: description of a new genus Weissella for the Leuconostoc
paramesenteroides group of species. J. Appl. Bacteriol. 75, 595-603
Compre C. (1999). Biofilms en milieu marin. Tec. Sci. Mthodes 11, 48-54
Cornish-Bowden A. (1985). Nomenclature for incompletely specified bases in nucleic acid sequences:
recommendations 1984. Nucl. Acids Res. 13, 3021-3030
Costerton J.W. & Lewandowski Z. (1995). Microbial biofilms. Annu. Rev. Microbiol. 49, 711-745
Crosa J.H., Brenner D.J. & Falkow S. (1973). Use of a single-strand specific nuclease for analysis of bacterial
and plamid deoxyribonucleic acid homo- and heteroduplexes. J. Bacteriol. 115, 904-911
Curk M.C., Boeufgras J.M., Decaris B., Gavini F., Kersters K., Larpent J.P., Le Bourgeois P., Renault P., de
Roissart H. & Rouvier C. (1994a). Mthodes d'identification des bactries lactiques. In de Roissart H. &
Luquet F.M., eds. Bactries lactiques I. Uriage, France : Lorica, p. 141-168
Curk M.C., Peladan F., Hubert J.C. (1994b). Fourier transform infrared spectroscopy for identifying
Lactobacillus species. FEMS Microbiol. Lett. 123, 241-248
Cusick S.M. & O'Sullivan D.J. (2000). Use of a single, triplicate arbitrarily primed-PCR procedure for molecular
fingerprinting of lactic acid bacteria. Appl. Environ. Microbiol. 66, 2227-2231

173

BIBLIOGRAPHIE

De Ley J., Cattoir H. & Reynaerts A. (1970). The quantitative measurement of DNA hybridization from
renaturation rates. Eur. J. Biochem. 12, 133-142
De Ley J., Gillis M. & Swings J. (1984). Family VI. Acetobacteraceae Gillis and De Ley 1980. In Krieg N.R. &
Holt J.G., eds. Bergey's manual of systematic bacteriology, Vol. 1. Baltimore, USA : William &
Wilkins, p. 267-278
Delfederico L., Hollmann A., Martinez M., Iglesias G., De Antoni G. & Semorile L. (2006). Molecular
identification and typing of lactobacilli isolated from kefir grains. J. Dairy Res. 73, 20-27
Dellaglio F., de Roissart H., Torriani S., Curk M.C. & Janssens D. (1994). Taxonomie, mtabolisme, croissance
et gntique des bactries lactiques. In de Roissart H. & Luquet F.M., eds. Bactries lactiques I. Uriage,
France : Lorica, p. 23-116
Denis C., Gueguen M., Henry E. & Levert D. (2001). New media for the numeration of cheese surface bacteria.
Lait 81, 365-379
Desmazeaud M. (1992). Les germes utiles. In Hermier J., Lenoir J. & Weber F., eds. Les groupes microbiens
d'intrt laitier. Paris : Cepil, p. 9-60
Desmazeaud M.J. (1994). Le lait milieu de culture. In de Roissart H. & Luquet F.M., eds. Bactries lactiques II.
Uriage, France : Lorica, p. 25-36
De Urraza P.J., Gomez-Zavaglia A., Lozano M.E., Romanowski V. & De Antoni G.L. (2000). DNA
fingerprinting of thermophilic lactic acid bacteria using repetitive sequence-based polymerase chain
reaction. J.Dairy Res. 67, 381-392
De Vuyst L., De Vin F., Vaningelgem F. & Degeest B. (2001). Recent developments in the biosynthesis and
applications of heteropolysaccharides from lactic acid bacteria. Int. Dairy J. 11, 687-707
Diggle S.P., Gardner A., West S.A. & Griffin A.S. (2007). Evolutionary theory of bacterial quorum sensing:
when is a signal not a signal? Philos. Trans. R. Soc. B Biol. Sci. 362, 12411249
Dimitrellou D., Kourkoutas Y., Banat I.M., Marchant R. & Koutinas A.A. (2007). Whey-cheese production
using freeze-dried kefir cultures as a starter. J. Appl. Microbiol. 103, 1170-1183
Dingding A., Danhorn T., Fuqua C. & Parsek M.R. (2006). Quorum sensing and motility mediate interactions
between Pseudomonas aeruginosa and Agrobacterium tumefaciens in biofilm cocultures. PNAS 103,
3828-3833
Dobson C.M., Chaban B., Deneer H. & Ziola B. (2004). Lactobacillus casei, Lactobacillus rhamnosus, and
Lactobacillus zeae isolates identified by sequence signature and immunoblot phenotype. Can. J.
Microbiol. 50, 482-488
Duboc P. & Mollet B. (2001). Applications of exopolysaccharides in the dairy industry. Int. Dairy J. 11, 759-768
Duitschaever C.L., Kemp N. & Smith A.K. (1988). Microscopic studies of the microflora of kefir grains and of
kefir made by different methods. Milchwiss. 43 (8), 479-481
Dziuba B., Babuchowski A., Nacz D. & Niklewicz M. (2007). Identification of lactic acid bacteria using FTIR
spectroscopy and cluster analysis. Int. Dairy J. 17, 183-189
Elliot J. (1984). Genus Acinetobacter Brisou and Prvot 1954. In Krieg N.R. & Holt J.G., eds. Bergey's manual
of systematic bacteriology, Vol. 1. Baltimore, USA : William & Wilkins, p. 303-307
Ercolini D., Hill P.J. & Dodd C.E.R. (2003). Bacterial community structure and location in Silton cheese. Appl.
Environ. Microbiol. 69, 3540-3548
Esteller M.S., Zancanaro O., Palmeira C.N.S. & da Silva Lannes S.C. (2006). The effect of kefir addition on
microstructure parameters and physical properties of porous white bread. Eur. Food Res. Technol. 222,
26-31
Euzby J.P. (2004). Dictionnaire de bactriologie vtrinaire. [en ligne]. Accessible sur Internet :
<http://www.bacterio.cict.fr/bacdico/ww/weissella.html>, consult le 9 dcembre 2007.
Evans J.B. & Niven C.F. (1951). Nutrition of the heterofermentative lactobacilli that cause greening of cured
meat products. J. Bacteriol. 62, 599-603

174

BIBLIOGRAPHIE

Ezaki T., Hashimoto Y. & Yabuuchi E. (1989). Fluorometric deoxyribonucleic acid-deoxyribonucleic acid
hybridization in microdilution wells as an alternative to membrane filter hybridization in which
radioisotopes are used to determine genetic relatedness among bacterial strains. Int. J. Syst. Bacteriol.
39, 224-229
Farber J.M., Sanders G.W., Dunfield S. & Prescott R. (1989). The effect of various acidulants on the growth of
Listeria monocytogenes. Lett. Appl. Microbiol. 9, 181-193
Farnworth E.R. (1999). Kefir : from folklore to regulatory approval. J. Nutraceuticals Funct. Med. Foods. 1, 5768
Fasoli S., Marzotto M., Rizzotti L., Rossi F., Dellaglio F. & Torriani S. (2003). Bacterial composition of
commercial probiotic products as evaluated by PCR-DGGE analysis. Int. J. Food Microbiol. 82, 59-70
Filipcev B., Simurina O. & Bodroza-Solarov M. (2007). Effect of native and lyophilized kefir grains on sensory
and physical attributes of wheat bread. J. Food Process.Preserv. 31, 367-377
Filloux A. & Vallet I. (2003). Biofilms : mise en place et organisation d'une communaut bactrienne. Med. Sci.
19, 77-83
Florez A.B., Lopez-Diaz T.M., Alvarez-Martin P. & Mayo B. (2006). Microbial characterization of the
traditional Spanish blue-veined Cabrales cheese: identification of dominant lactic acid bacteria. Eur.
Food Res. Technol. 223, 503-508
Florez A.B. & Mayo B. (2006). Microbial diversity and succession during the manufacture and ripening of
traditional, Spanish, blue-veined Cabrales cheese, as determined by PCR-DGGE. Int. J. Food
Microbiol. 110, 165-171
Fox G.E, Wisotzkey J.D. & Jurtshuk P. (1992). How is close : 16S rRNA sequence identity may not be sufficient
to guarantee species identity. Int. J. Syst. Bacteriol. 42, 166-170
Fujisawa T., Adachi S., Toba T., Arihara K & Mitsuoka T. (1988). Lactobacillus kefiranofaciens sp. nov.
isolated from kefir grains. Int. J. Syst. Bacteriol. 38 , 12-14
Fuller R. (1989). Probiotics in man and animals. J. Appl. Bacteriol. 66, 365-378
Gagnaire V., Thierry A. & Lonil J. (2001). Propionibacteria and facultatively heterofermentative lactobacilli
weakly contribute to secondary proteolysis of Emmental cheese. Lait 81, 339-353
Gahan C.G., ODriscoll B. & Hill C. (1996). Acid adaptation of Listeria monocytogenes can enhance survival in
acidic foods and during milk fermentation. Appl. Environ. Microbiol. 62, 3128-3132
Garbers I.M., Britz T.J. & Witthuhn R.C. (2004). PCR-based denaturing gradient gel electrophoretictypification
and identification of the microbial consortium present in kefir grains. World J. Microbiol. Biotechnol.
20, 687-693
Garrote G.L., Abraham A. G. & De Antoni G. L. (1997). Preservation of kefir grains, a comparative study.
Lebensm. Wiss. Technol. 30, 77-84
Garrote G.L., Abraham A. G. & De Antoni G. L. (1998). Characteristics of kefir prepared with different
grain:milk ratios. J. Dairy Res. 65, 149-154
Garrote G.L., Abraham A. G. & De Antoni G. L. (2000). Inhibitory power of kefir: the role of organic acids. J.
Food Prot. 63, 364-369
Garrote G.L., Abraham A. G. & De Antoni G. L. (2001). Chemical and microbial characterisation of kefir
grains. J. Dairy Res. 68, 639-652
Garvie E.I. (1984). Separation of species of the genus Leuconostoc and differentiation of the leuconostocs from
other lactic acid bacteria. Methods Microbiol. 16, 147-178
Garvie E.I. (1986). Genus Pediococcus Claussen 1903. In Sneath P.H.A., ed. Bergey's manual of systematic
bacteriology, Vol. 2. Baltimore, USA : William & Wilkins, p. 1075-1082
Germond J.-E., Lapierre L., Delley M., Mollet B., Felis G.E. & Dellaglio F. (2003). Evolution of the bacterial
species Lactobacillus delbrueckii: a partial genomic study with reflections on prokaryotic species
concept. Mol. Biol. Evol. 20, 93-104

175

BIBLIOGRAPHIE

Gibson T. & Abdel-Malek Y. (1945). The formation of carbon dioxyde by lactic acid bacteria and Bacillus
licheniformis and a cultural method of detecting the process. J. Dairy Res. 14, 35-44
Gillis M., Vandamme P., De Vos P., Swings J. & Kersters K. (2005). Polyphasic taxonomy. In Brenner D.J.,
Staley J.T. & Krieg N.R., eds. Bergey's manual of systematic bacteriology, Vol. 2. New York, USA :
Springer, p. 43-48
Giraffa G., Lazzi C., Gatti M., Rossetti L., Mora D. & Neviani E. (2003). Molecular typing of Lactobacillus
delbrueckii of dairy origin by PCR-RFLP of protein-coding genes. Int. J. Food Microbiol. 82, 163-172
Golowczyc M.A., Mobili P., Garrote G.L., Abraham A.G. & De Antoni G.L. (2007). Protective action of
Lactobacillus kefir carrying S-layer protein against Salmonella enterica serovar Enteridis. Int. J. Food
Microbiol. 118, 264-273
Golowczyc M.A., Gugliada M.J., Hollmann A., Delfederico L., Garrote G.L., Abraham A.G., Semorile L. & De
Antoni G. (2008). Characterization of homofermentatibe lactobacilli isolated from kefir grains: potential
use as probiotic. J. Dairy Res. 75, 211-217
Goris J., Suzuki K.I., De Vos P., Nakase T. & Kersters K. (1998). Evaluation of a microplate DNA:DNA
hybridization method compared with the initial renaturation method. Can. J. Microbiol. 44, 1148-1153
Grimont P.A.D., Popoff M.Y., Grimont F., Coynault C. & Lemelin M. (1980). Reproducibility and correlation
study of three deoxyribonucleic acid hybridization procedures. Curr. Microbiol. 4, 325-330
Gueguen M. & Schmidt J.L. (1992). Les levures et Geotrichum candidum. In Hermier J., Lenoir J. & Weber F.,
eds. Les groupes microbiens d'intrt laitier. Paris : Cepil, p.165-220
Gulmez M. & Guven A. (2003). Survival of Escherichia coli O157:H7, Listeria monocytogenes 4b and Yersinia
enterocolitica O3 in different yogurt and kefir combinations as prefermentation contaminant. J. Appl.
Microbiol. 95, 631-636
Gven A., Gven A. & Glmez M. (2003). The effect of kefir on the activities of GSH-Px, GST, CAT, GSH and
LPO levels in carbon tetrachloride-induced mice tissues. J. Vet. Med. 50, 412-416
Guzel-Seydim Z.B., Wyffels J.T., Seydim A.C. & Greene A.K. (2005). Turkish kefir and kefir grains: microbial
enumeration and electron microcopic observation. Int. J. Dairy Technol. 58, 25-29
Guzel-Seydim Z.B., Seydim A.C., Greene A.K. & Tas T. (2006). Determination of antimutagenic properties of
acetone extracted fermented milks and changes in their total fatty acid profiles including conjugated
linoleic acids. Int. J. Dairy Technol. 59, 209-215
Hall C., Leroi F., Dousset X. & Pidoux M. (1994). Les kfirs : des associations bactries/levures. In de Roissart
H. & Luquet F.M., eds. Bactries lactiques II. Uriage, France : Lorica, p. 169-182
Hammes W.P. & Vogel R.F. (1995). The genus Lactobacillus. In Wood B.J.J. & Holzapfel W.H., eds. The
genera of lactic acid bacteria. Glasgow, UK : Blackie academic & professional, p. 19-54
Hardie J.M. (1986). Genus Streptococcus Rosenbach 1884. In Sneath P.H.A., ed. Bergey's manual of systematic
bacteriology, Vol. 2. Baltimore, USA : William & Wilkins, p. 1043-1071
Hemme D. & Foucaud-Scheunemann C. (2004). Leuconostoc, characteristics, use in dairy technology and
prospects in functional foods. Int. Dairy J. 14, 467-494
Hentzer M., Givskov M. & Eberl L. (2004). Quorum sensing in biofilms: gossip in slime city. In Ghannoum M.
& O'Toole G., eds. Microbial biofilms. Washington, DC : ASM Press, p. 118-140
Hertzler S.R. & Clancy S.M. (2003). Kefir improves lactose digestion and tolerance in adults with lactose
maldigestion. J. Am. Diet. Assoc. 130, 582-587
Huys G., Vancanneyt M., D'Haene K., Vankerkhoven V., Goossens H. & Swings J. (2006). Accuracy of species
identity of commercial bacterial cultures intended for probiotic or nutritional use. Res. Microbiol. 157,
803-810
Imberechts H., Vanholme L. & Dierick K. (2004). Trends and sources Report on zoonotic agents in Belgium in
2004.
[en
ligne].
Accessible
sur
Internet :
<http://www.afsca.be/home/pub/doc/autre/Report_TS_%202004_S.pdf>, consult le 8 juin 2007.
Jamotte P. (1974). Note technique sur le kfir. Gembloux, Belgique : Station laitire de lEtat.

176

BIBLIOGRAPHIE

Jiang J., Bjrck L. & Fondn R. (1998). Production of conjugated linoleic acid by dairy starter cultures. J. Appl.
Microbiol. 85, 95-102
Jouve J.L. (1996). Produits laitiers frais. In Jouve J.L., ed. La qualit microbiologique des aliments : matrise et
critres. Paris : Polytechnica, p. 411-420.
Kabayama S., Osada K., Tachibana H., Katakura Y. & Shirahata S. (1997). Enhancing effects of food
components on the production of interferon from animal cells suppressed by stress hormones.
Cytotechnology 23, 119-125
Kandler O. & Kunath P. (1983). Lactobacillus kefir sp. nov., a component of the microflora of kefir. System.
Appl. Microbiol. 4, 286-294
Kandler O. & Weiss N. (1986). Genus Lactobacillus Beijerinck 1901. In Sneath P.H.A., ed. Bergey's manual of
systematic bacteriology, Vol. 2. Baltimore, USA : William & Wilkins, p. 1209-1239
Kao Y.T., Liu Y.S. & Shyu Y.T. (2007). Identification of Lactobacillus spp. in probiotic products by real-time
PCR and melting curve analysis. Food Res. Int. 40, 71-79
Khanal R.C. (2004). Potential health benefits of conjugated linoleic acid (CLA): a review. Asian-Aust. J. Anim.
Sci. 17, 1315-1328
Klijn N., Weerkamp A.H. & De Vos W. (1991). Identification of mesophilic lactic acid bacteria by using
polymerase chain reaction-amplified variable regions of 16S rRNA and specific DNA probes. Appl.
Environ. Microbiol. 57, 3390-3393
Koeppel A., Perry E.B., Sikorski J., Krizanc D., Warner A., Ward D.M., Rooney A.P., Brambilla E., Connor N.,
Ratcliff R.M., Nevo E. & Cohan F.M. (2008). Identifying the fundamental units of bacterial diversity: a
paradigm shift to incorporate ecology into bacterial systematics. PNAS 19, 2504-2509
Kocur M. (1986). Genus I. Micrococcus Cohn 1872. In Sneath P.H.A., ed. Bergey's manual of systematic
bacteriology, Vol. 2. Baltimore, USA : William & Wilkins, p. 1004-1010
Kojima S., Takizawa S., Tamura S., Funjinaga S., Benno Y. & Nakase T. (1993). An improved medium for the
isolation of lactobacilli from kefir grains. Biosci. Biotech. Biochem. 57, 119-120
Kooiman P. (1968). The chemical structure of kefiran, the water soluble polysaccharide of the kefir grain.
Carbohyd. Res. 7, 200-211
Koroleva N.S. (1988). Technology of kefir and kumys. Bull. Int. Dairy Fed. 227, 96
Kosikowski F.V. (1982). Fermented milks. In Kosikowski F.V. & Assoc., eds. Cheese and fermented milk foods.
New York, USA : Brooktondale, p. 37-48
Koutinas A.A., Athanasiadis I., Bekatorou A., Psarianos C., Kanellaki M., Agouridis N. & Blekas G. (2007).
Kefir-yeast technology: Industrial scale-up of alcoholic fermentation of whey, promoted by raisin
extracts, using kefir-yeast granular biomass. Enzyme Microb. Technol. 41, 576-582
Krieg N.R. (2005). Identification of procaryotes. In Brenner D.J., Staley J.T. & Krieg N.R., eds. Bergey's
manual of systematic bacteriology, Vol. 2. New York, USA : Springer, p. 33-38
Krooneman J., Faber F., Alderkamp A.C., Oude Elferink S.J.H.W., Driehuis F., Cleenwerck I., Swings J.,
Gottschal J.C. & Vancanneyt M. (2002). Lactobacillus diolivorans sp. nov., a 1,2-propanedioldegrading bacterium isolated from aerobically stable maize silage. Int. J. Syst. Evol. Microbiol. 52, 639646
Kullen M.J., Sanozky-Dawes R.B., Crowell D.C. & Klaenhammer T.R. (2000). Use of the DNA sequence of
variable regions of the 16S rRNA gene for rapid and accurate identification of bacteria in the
Lactobacillus acidophilus complex. J. Appl. Microbiol. 89, 511-516
Kuo C.Y. & Lin C.W. (1999). Taiwanese kefir grains: their growth, microbial and chemical composition of
fermented milk. Aust. J. Dairy Technol. 54, 19-23
Kurtzman C.P. (2003). Phylogenetic circumscription of Saccharomyces, Kluyveromyces and other members of
the Saccharomycetaceae, and the proposal of the new genera Lachancea, Nakaseomyces, Naumovia,
Vanderwaltozyma and Zygotorasporula. FEMS Yeast Res. 4, 233-245
Kwon Y.I., Apostolidis E. & Shetty K. (2006). Anti-diabetes functionality of kefir culture-mediated fermented
soymilk supplemented with Rhodolia extracts. Food Biotechnol. 20, 13-29

177

BIBLIOGRAPHIE

Lacrosse R. (1970). Le kfir, lait ferment dittique. Rev. Agric. 10, 1485-1489
Lacrosse R. (1981). Le kfir, boisson lacte fermente. Lait Nous 4, 7-9
la Rivire J.W.M. & Kooiman P. (1967). Kefiran, a novel polysaccharide produced in the kefir grain by
Lactobacillus brevis. Arch. Mikrobiol. 59, 269-278
Lasa I. (2006). Towards the identification of the common features of bacterial biofilm development. Int.
Microbiol. 9, 21-28
Laws A.P. & Marshall V.M. (2001). The relevance of exopolysaccharides to the rheological properties in milk
fermented with ropy strains of lactic acid bacteria. Int. Dairy J. 11, 709-721
Lee I.S., Slonczewski J.L. & Foster J.W. (1994). A low-pH-inducible, stationary-phase acid tolerance response
in Salmonella typhimurium. J. Bacteriol. 176, 1422-1426
Lee M.Y., Ahn K.S., Kwon O.K., Kim M.J., Kim M.K., Lee I.Y., Oh S.R. & Lee H.K. (2007). Antiinflammatory and anti-allergic effects of kefir in a mouse asthma model. Immunobiology 212, 647-654
Leisner J.J., Pot B., Christensen H., Rusul G., Olsen J.E., Wee B.W., Muhamad K. & Ghazali H.M. (1999).
Identification of lactic acid bacteria from chili bo, a Malaysian food ingredient. Appl. Eviron. Microbiol.
65, 599-605
Libudzisz Z. & Piatkiewicz A. (1990). Kefir production in Poland. Dairy Ind. Int. 55, 31-33
Lilly D.M. & Stillwell R.H. (1965). Probiotics: growth-promoting factors produced by microorganisms. Science
147, 747-748
Lin C.W., Chen H.L. & Liu J.R. (1999a). Identification and characterisation of lactic acid bacteria and yeasts
isolated from kefir grains in Taiwan. Aust. J. Dairy Technol. 54 (1), 14-18
Lin T.Y., Lin C.W. & Lee C.H. (1999b). Conjugated linoleic acid concentration as affected by lactic cultures and
added linoleic acid. Food Chem. 67, 1-5
Lindsay R.C. & Day E.A. (1965). Rapid quantitative method for determination of acetaldehyde in lactic starter
cultures. J. Dairy Sci. 48, 665-669
Liu J.R., Chen M.J. & Lin C.W. (2002a). Characterization of polysaccharide and volatile compounds produced
by kefir grains grown in soymilk. J. Food Sc. 67, 104-108
Liu J.R., Wang S.Y., Lin Y.Y. & Lin C.W. (2002b). Antitumor activity of milk kefir and soy milk kefir in
tumor-bearing mice. Nutr. Cancer 44, 182-187
Liu J.R, Wang S.Y., Chen M.J., Yueh P.Y. & Lin C.W. (2006a). The anti-allergenic properties of milk kefir and
soymilk kefir and their benefical effects on the intestinal microflora. J. Sci. Food Agric. 86, 2527-2533
Liu J.R, Wang S.Y., Chen M.J., Chen H.L., Yueh P.Y. & Lin C.W. (2006b). Hypocholesterolaemic effects of
milk-kefir and soyamilk-kefir in cholesterol-fed hamsters. Br. J. Nutr. 95, 939-946
Loones A. (1994). Laits ferments par les bactries lactiques. In de Roissart H. & Luquet F.M., eds. Bactries
lactiques II. Uriage, France : Lorica, p. 135-154
Mainville I., Robert N., Lee B., Farnworth E.R. (2006). Polyphasic characterization of the lactic acid bacteria in
kefir. Syst. Appl. Microbiol. 29, 59-68
Makarova K., Slesarev A., Wolf Y., Sorokin A., Mirkin B., Koonin E., Pavolv A., Pavlova N., Karamychev V.,
Polouchine N., Shakhova V., Grigoriev I., Lou Y., Rohksar D., Lucas S., Huang K., Goldstein D.M.,
Hawkins T., Plengvidhya V., Welker D., Hughes J., Goh Y., Benson A., Baldwin K., Lee J.-H., DiazMuniz I., Dosti B., Smeianov V., Wechter W., Barabote R., Lorca G., Altermann E., Barrangou R.,
Ganesan B., Xie Y., Rawsthorne H., Tamir D., Parker C., Breidt F., Broadbent J., Hutkins R.,
O'Sulllivan D., Steele J., Unlu G., Saier M., Klaenhammer T., Richardson P., Kozyavkin S., Weimer B.
& Mills D. (2006). Comparative genomics of the lactic acid bacteria. Proc. Natl. Acad. Sci. U.S.A. 103,
15611-15616
Marshall V.M. & Cole W.M. (1984). Studies on kefir. Bull. Int. Dairy Fed. 179, XIII
Masco L., Huys G., Gevers D., Verbrugghen L. & Swings J. (2003). Identification of Bifidobacterium species
using rep-PCR fingerprinting. Syst. Appl. Microbiol. 26, 557-563

178

BIBLIOGRAPHIE

Matsuu M., Shichijo K., Okaichi K., Wen C.Y., Fukuda E., Nakashima M., Nakayama T., Shirahata S.,
Tokumaru S. & Sekine I. (2003). The protective effect of fermented milk kefir on radiation-induced
apoptosis in colonic crypt cells of rats. J. Radiat. Res. 44, 111-115
Mc Donald L.C., Flemming H.P. & Hanssen H.M. (1990). Acid tolerance of Leuconostoc mesenteroides and
Lactobacillus plantarum. Appl. Environ. Microbiol. 56, 2120-2124
Mehlen A., Goeldner M., Ried S., Stindl S., Ludwig W. & Schleifer K.H. (2004). Development of a fast DNADNA hybridization method based on melting profiles in microplates. Syst. Appl. Microbiol. 27, 689-695
Miyamoto M., Nakajima H., Muigai C.W., Kiiyukia C. & Miyamoto T. (2005). Identification of lactic acid
bacteria isolated from kenyan traditional fermented milk, Maziwa lala, and their symbiotic relationship.
Milchwiss.-Milk Sci. Int. 60, 416-418
Molska I., Koco J. & Zmarlicki S. (1980). Electron microscopic studies on structure and microflora of kefir
grains. Acta Alim. Pol. VI, 145-154
Monnet V. & Gripon J.C. (1994). Mtabolisme azot des bactries lactiques. In de Roissart H. & Luquet F.M.,
eds. Bactries lactiques I. Uriage, France : Lorica, p. 331-347
Monsan P., Bozonnet S., Albenne C., Joucla G., Willemot R.M. & Remaud-Simon M. (2001).
Homopolysaccharides from lactic acid bacteria. Int. Dairy J. 11, 675-685
Mori K., Yamazaki K., Ishiyama T., Katsumata M., Kobayashi K., Kawai Y., Inoue N. & Shinano H. (1997).
Comparative sequence analyses of the genes coding for 16S rRNA of Lactobacillus casei-related taxa.
Int. J. Syst. Bacteriol. 47, 54-57
Mori S., Mori K., Suzuki I. & Kasumi T. (2004). Phylogenetic analysis of Lactococcus lactis subspecies based
on decoding the sequence of the pepT tripeptidase gene, the pepV dipeptidase gene and 16S rRNA.
Syst. Appl. Microbiol. 27, 414-422
Mounier J., Gelsomino R., Goerges S., Vancanneyt M., Vandemeulebroecke K., Hoste B., Scherer S., Swings J.,
Fitzgerald G.F. & Cogan T.M. (2005). Surface microflora of four smear-ripened cheeses. Appl. Environ.
Microbiol. 71, 6489-6500
Muir D.D., Tamine A.Y. & Wszolek M. (1999). Comparison of the sensory profiles of kefir, buttermilk and
yogurt. Int. J. Dairy Technol. 52, 129-134
Mukai T., Watanabe N., Toba T., Itoh T. & Adachi S. (1991). Gel-forming characteristics and rheological
properties of kefiran. J. Food Sci. 56, 1017-1026
Murofushi M., Shiomi M. & Aibara K. (1983). Effect of orally administered polysaccharide from kefir grain on
delayed-type hypersensitivity and tumor growth in mice. Japan J. Med. Sci. Biol. 36, 49-53
Nagira T., Narisawa J., Teruya K., Katakura Y., Shim S.Y., Kusumoto K., Tokumaru S., Tokumaru K., Barnes
D.W. & Shirahata S. (2002). Suppression of UVC-induced cell damage and enhancement of DNA
repair by the fermented milk, kefir. Cytotechnology 40, 125-137
Naumann D., Fijala V., Labischinski H. & Giesbrecht P. (1988). The rapid differentiation and identification of
pathogenic bacteria using Fourier transform infrared spectroscopic and multivariate statistical analysis.
J. Mol. Struct. 74, 165-170
Neefs J.M., Van de Peer Y., De Rijk P., Chapelle S & De Wachter R. (1993). Compilation of small ribosomal
subunit RNA structure. Nucleic Acids Res. 21, 3025-3049
Neve H. (1992). Analysis of kefir grain starter cultures by scanning electron microscopy. Milchwiss. 47, 275-278
Niemann S., Puehler A., Tichy H.V., Simon R. & Selbitschka W. (1997). Evaluation of the resolving power of
three different DNA fingerprinting methods to discriminate among isolates of a natural Rhizobium
meliloti population. J. Appl. Microbiol. 82, 477-484
Ninane V. (2002). Le kfir : procds de fabrication et caractrisation du consortium de micro-organismes.
Mmoire de fin d'tudes. Gembloux, Belgique : Facult Universitaire des Sciences Agronomiques de
Gembloux.
Ninane V., Berben G., Romnee J.M. & Oger R. (2005a). Variability of the microbial abundance of a kefir grain
starter cultivated in partially controlled conditions. Biotechnol. Agron. Soc. Environ. 9, 191-194

179

BIBLIOGRAPHIE

Ninane V., Dehareng F. Oger R. & Berben G. (2005b). Conjugated linoleic acid content of kefir. In Prospects
for health, well-being and safety, Proc. Fourth Nizo Dairy Conf., Papendal, The Netherlands, 15-17
June 2005. Oxford, UK : Elsevier.
Ninane V., Mukandayambaje R. & Berben G. (2006). Use of 16S rRNA V1 region analysis for the identification
of lactobacilli occurring in a kefir grain. In Scientific and technological challenges in fermented milk,
Proc. Second IDF Dairy Sci. Technol. Week, Sirmione Italy 15-19 May 2006. Bruxelles : FIL-IDF.
Ninane V., Mukandayambaje R. & Berben G. (2007). Identification of lactic acid bacteria within the consortium
of a kefir grain by sequencing 16S rDNA variable regions. J. AOAC Int. 90, 1111-1117
Niven C.F. & Evans J.B. (1957). Lactobacillus viridescens nov. spec., a heterofermentative species that produces
a green discoloration of cured meat pigments. J Bacteriol. 73: 758759
ODriscoll B., Gahan C.G.M. & Hill C. (1996). Adaptative acid tolerance response in Listeria monocytogenes:
isolation of an acid-tolerant mutant which demonstrates increased virulence. Appl. Environ. Microbiol.
62, 1693-1698
Ogier J.C., Son O., Gruss A., Tailliez P. & Delacroix-Buchet A. (2002). Identification of the bacterial microflora
in dairy products by temporal temperatre gradient gel electrophoresis. Appl. Environ. Microbiol. 68,
3691-3701
Ogier J.C, Lafarge V., Girard V., Rault A., Maladen V., Gruss A., Leveau J.Y. & Delacroix-Buchet A. (2004).
Molecular fingerprinting of dairy microbial ecosystems by use of temporal temperature and denaturing
gradient gel electrophoresis. Appl. Environ. Microbiol. 70, 5628-5643
Oguntoyinbo F.A. (2007). Identification and functional properties of dominant lactic acid bacteria isolated at
different stages of solid state fermentation of cassava during traditional gari production. World J.
Microbiol. Biotechnol. 23, 1425-1432
Ota A. (1999). Protection against an infectious disease by enterohaemorrhagic E. coli O-157. Med. Hypotheses
53, 87-88
Ottogalli G., Galli A., Resmini P. & Volonterio G. (1973). Composizione microbiologica, chimica ed
ultrastruttura dei granuli di kefir. Ann. Microbiol. 23, 109-121
Pariza M.W. (2004). Perspective on the safety and effectiveness of conjugated linoleic acid. Am. J. Clin. Nutr.
79, 1132S-1136S
Parker R.B. (1974). Probiotics, the other half of the antibiotic story. Anim. Nutr. Health 29, 4-8
Pearson W.R. & Lipman D.J. (1988) Improved tools for biological sequence analysis. Proc Natl Acad Sci USA
85, 2444-2448
Picioreanu C., Kreft J.U., Klausen M., Haagensen J.A.J., Tolker-Nielsen T. & Molin S. (2007). Microbial
motility involvement in biofilm structure formation a 3D modelling study. Water Sci. Technol. 55,
337-343
Pidoux M. (1984). Les kfirs : kfirs lacts et kfirs sucrs. Tech. Lait Avril, 29-33
Pidoux M., Brillouet J.M. & Quemener B. (1988). Characterization of the polysaccharides from a Lactobacillus
brevis and from sugary kefir grains. Biotechnol. Lett. 10, 415-420
Pidoux M. (1989). The microbial flora of sugary kefir grain (the gingerbeer plant) : biosynthesis of the grain
from Lactobacillus hilgardii producing a polysaccharide gel. MIRCEN J. 5, 223-238
Pidoux M., Pilet M.F. & Ripoche V. (1992). Growth performances of Lactobacillus hilgardii immobilized in
dextran gel and in continuous fermentation. World J. Microbiol. Biotechnol. 8, 393-398
Piermaria J.A., de la Canal M.L. & Abraham A.G. (2008). Gelling properties of kefiran, a food-grade
polysaccharide obtained from kefir grain. Food Hydrocolloids 22, 1520-1527
Pintado M.E., Da Sylva L.J.A., Fernandes P.B., Malcata X. & Hogg J.A. (1996). Microbiological and
rheological studies on Portuguese kefir grains. Int. J. Food Sci. Technol. 31, 15-26
Plessas S., Pherson L., Bekatorou A., Nigam P. & Koutinas A.A. (2005). Bread making using kefir grains as
baker's yeast. Food Chem. 93, 585-589

180

BIBLIOGRAPHIE

Plessas S., Bekatorou A., Kanellaki M., Koutinas A.A., Marchant R. & Banat I.M. (2007a). Use of immobilized
cell biocatalysts in baking. Process Biochem. 42, 1244-1249
Plessas S., Trantallidi M., Bekatorou A., Kanellaki M., Nigam P. & Koutinas A.A. (2007b). Immobilization of
kefir and Lactobacillus casei on brewery spent grains for use in sourdough wheat bread making. Food
Chem. 105, 187-194
Plessas S., Kollopoulos D., Kourkoutas Y., Psarianos C., Alexopoulos A., Marchant R., Banat I.M. & Koutinas
A.A. (2008). Upgrading of discarded oranges through fermentation using kefir in food industry. Food
Chem. 106, 40-49
Pot B., Vandamme P. & Kersters K. (1994). Analysis of electrophoretic whole-organism protein fingerprints. In
Goodfellow M. & O'Donnell A.G., eds. Chemical methods in prokaryotic systematics. Chichester,
U.K. : Wiley J. & sons.
Powell J.E., Todorov S.D., Van Reenen C.A., Dicks L.M.T. & Witthuhn R.C. (2006). Growth inhibition of
Enterococcus mundtii in kefir by in situ production of bacteriocin ST8KF. Lait 86, 401-405
Qiu Y., Wu L., Huang H., Mc Donel P.E., Palumbo A.V., Tiedje J.M. & Zhou, J. (2001) Evaluation of PCRgenerated chimeras, mutations and heteroduplexes with 16S rRNA gene-based cloning. Appl Environ
Microbiol 67, 880-887
Quiros A., Hernandez-Ledesma B., Ramos M., Amigo L. & Recio I. (2005). Angiotensin-converting enzyme
inhibitory activity of peptides derived from caprine kefir. J. Dairy Sci. 88, 3480-3487
Rainer L. & Heiss C.J. (2004). Conjugated linoleic acid: health implications and effects on body composition. J.
Am. Diet. Assoc. 104, 963-968
Rea M.C., Lennartsson T., Dillon P., Drinan F.D., Reville W.J., Heapes M. & Cogan T.M. (1996). Irish kefirlike grains : their structure, microbial composition and fermentation kinetics. J. Appl. Bact. 81, 83-94
Renard A.C. (2000). Les ingrdients sant la conqute de l'Europe. Rev. Lait. Fr. 598, 16-21
Reynaud M.J. (1997). Kfir de lait Yalacta. Document 301/80-6/200. Caen, France : Yalacta.
Reysenbach A.L., Giver L.J., Wickham G.S. & Pace N.R. (1992). Differential amplification of rRNA genes by
polymerase chain reaction. Appl. Environ. Microbiol. 58, 3417-3418
Richard C. (1984). Genus Enterobacter Hormaeche and Edwards 1960. In Krieg N.R. & Holt J.G., eds. Bergey's
manual of systematic bacteriology, Vol. 1. Baltimore, USA : William & Wilkins, p. 465-469
Rimada P.S. & Abraham A.G. (2001). Polysaccharide production by kefir grains during whey fermentation. J.
Dairy Res. 68, 653-661
Rochelle P.A., Fry J.C., Parkes R.J. & Weightman A.J. (1992). DNA extraction for 16S rRNA gene analysis to
determine genetic diversity in deep sediment communities. FEMS Microbiol. Lett. 100, 59-66
Rou M. (1996). Information scientifique et dsinformation. [en ligne]. SPS 221. Accessible sur Internet :
<http:/www.pseudo-sciences.org/spip.php?article149>, consult le 14 mars 2007.
Rozier J., Carlier V. & Bolnot F. (1985). Classification et principales caractristiques des micro-organismes des
denres alimentaires animales et d'origine animale. In Rozier J., Carlier V. & Bolnot F., eds. Bases
microbiologiques de l'hygine des aliments. Paris : Ecole nationale vtrinaire de Maisons-Alfort, p. 1728
Ruas-Madiedo P., Hugenholtz J. & Zoon P. (2002). An overview of the functionality of exopolysaccharides
produced by lactic acid bacteria. Int. Dairy J. 12, 163-171
Salminen, S., Bouley C., Boutron-Ruault M.-C., Cummings J.H., Franck A., Gibson G.R., Isolauri E., Moreau
M.-C., Roberfroid M. & Rowland I. (1998). Functional food science and gastrointestinal physiology and
function. Br. J. Nutr. 80, S147-S171
Snchez I., Sesea S. & Palop L. (2003). Identification of lactic acid bacteria from spontaneous fermentation of
"Almagro" eggplants by SDS-PAGE whole cell protein fingerprinting. Int. J. Food Microbiol. 82, 181189
Snchez J.I., Martnez B. & Rodrguez A. (2005). Rational selection of Leuconostocs strains for mixed starters
based on the physiological biodiversity found in raw milk fermentations. Int. J. Food Microbiol. 105,
377-387

181

BIBLIOGRAPHIE

Santos A., San Mauro M., Sanchez A., Torres J.M. & Marquina D. (2003). The antimicrobial properties of
different strains of Lactobacillus spp. isolated from kefir. System. Appl. Microbiol. 26, 434-437
SAS Institute Inc. (1994). SAS/STAT User's Guide. Cary, NC, USA : Statistical Analysis System Institute.
Schleifer K.H., Kraus J., Dvorak C., Kilpper-Blz R., Collins M.D. & Fischer W. (1985). Transfer of
Streptococcus lactis and related streptococci to the genus Lactococcus gen. nov. System. Appl.
Microbiol. 6, 183-195
Schleifer K.H., Ehrmann M., Beimfohr C., Brockmann E., Ludwig W. & Amann R. (1995). Application of
molecular methods for the classification and identification of lactic acid bacteria. Int. Dairy J. 5, 10811084
Shiomi M., Sasaki K., Murofushi M. & Aibara K. (1982). Antitumor activity in mice of orally administered
polysaccharide from kefir grain. Japan J. Med. Sci. Biol. 35, 75-80
Shinohara K. (1995). Functional foods for specific health use - The needs for compositional data. In Greenfield
H., ed. Quality and accessibility of food related data. Proc. First Int. Food Data Base Conf., Australia,
22-24 September 1993. Arlington, VA, USA : AOAC International, p. 305-310
Simova E., Beshkova D., Angelov A., Hristozova Ts., Frengova G. & Spasov Z. (2002). Lactic acid bacteria and
yeasts in kefir grains and kefir made from them. J. Ind. Microbiol. Biotechnol. 28, 1-6
Simpson P.J., Fitzgerald G.F., Stanton C. & Ross R.P. (2006). Enumeration and identification of pediococci in
powder-based products using selective media and rapid PFGE. J. Microbiol. Methods 64, 120-125
Schroevers A. & Britz T. (2003). Influence of different culturing conditions on kefir grain increase. Int. J. Dairy
Technol. 56, 183-187
SSTC (2002). Des risques pour la sant lis l'alimentation aux normes des produits alimentaires : rapport de
synthse. Bruxelles : Politique scientifique fdrale.
Stackebrandt E. & Goebel B.M. (1994). Taxonomic note: a place for DNA-DNA reassociation and 16S rRNA
sequence analysis in the present species definition in bacteriology. Int. J. Syst. Bacteriol. 44, 846-849
Stackebrandt E., Frederiksen W., Garrity G.M., Grimont P.A.D., Kmpfer P., Maiden M.C.J., Nesme X.,
Rossell-Mora R., Swings J., Trper H.G., Vauterin L., Ward A.C. & Whitman W.B. (2002). Report of
the ad hoc committee for the re-evaluation of the species definition in bacteriology. Int. J. Syst. Evol.
Microbiol. 52, 1043-1047
Stackebrandt E. (2003). The richness of prokaryotic diversity: there must be a species somewhere. Food
Technol. Biotechnol. 41, 17-22
Stackebrandt E. & Ebers J. (2006). Taxonomic parameters revisited: tarnished gold standards. Microbiol. Today
33, 152-155
Staley J.T. & Krieg N.R. (1984). Classification of procaryotic organisms: an overview. In Krieg N.R. & Holt
J.G., eds. Bergey's manual of systematic bacteriology, Vol. 1. Baltimore, USA : William & Wilkins, p.
1-4
Stoesser G., Baker W., van den Broek A.E., Camon E., Garcia-Pastor M., Kanz C., Kulikova T., Lombard V.,
Lopez R., Parkinson H., Redaschi N., Sterk P., Stoehr P. & Tuli M.A. (2001). The EMBL nucleotide
sequence database. Nucleic Acids Res. 29, 17-21
St-Onge M.P., Farnworth E.R., Savard T., Chabot D., Mafu A. & Jones P. (2002). Kefir consumption does not
alter plasma lipid levels or cholesterol fractional synthesis rates relative to milk in hyperlipidemic men:
a randomized controlled trial. [en ligne]. Accessible sur Internet : < http/www.biomedcentral.com/14726882/2/1 >, consult le 14 janvier 2007.
Suskovic J., Kos B., Matosic S. & Besendorfer V. (2000). The effect of bile salts on survival and morphology of
a potential probiotic strain Lactobacillus acidophilus M92. World J. Microbiol. Biotechnol. 16, 673-678
Tada S., Katakura Y., Ninomiya K. & Shioya S. (2007). Fed-batch coculture of Lactobacillus kefiranofaciens
with Saccharomyces cerevisiae for effective production of kefiran. J. Biosci. Bioeng. 103, 557-562
Tae-Woon K., Jung S.H., Lee J.Y., Choi S.K., Park S.H., Jo J.S. & Kim H.Y. (2003). Identification of lactic acid
bacteria in Kimchi using SDS-PAGE profiles of whole cell proteins. J. Microbiol. Biotechnol. 13, 119124

182

BIBLIOGRAPHIE

Takizawa S., Kojima S., Tamura S., Fujinaga S., Benno Y. & Nakase T. (1994). Lactobacillus kefirgranum sp.
nov. and Lactobacillus parakefir sp. nov., two new species from kefir grains. Int. J. System. Bacteriol.
44, 435-439
Takizawa S., Kojima S., Tamura S., Fujinaga S., Benno Y. & Nakase T. (1998). The composition of the
lactobacillus flora in kefir grains. System. Appl. Microbiol. 21, 121-127
Talon R. & Montel M.C. (1994). Activits estrasiques et lypolitiques des bactries lactiques. In de Roissart H.
& Luquet F.M., eds. Bactries lactiques I. Uriage, France : Lorica, p. 349-352
Tannock G.W. (2002). Probiotics and prebiotics: where are we going? In Tannock G.W., ed. Probiotics and
prebiotics: where are we going? Norfolk, U.K. : Caister Academic Press, p. 1-40
Temmerman R., Scheirlinck I., Huys G. & Swings J. (2003). Culture-independent analysis of probiotic products
by denaturing gradient gel electrophoresis. Appl. Environ. Microbiol. 69, 220-226
Temmerman R., Huys G. & Swings J. (2004). Identification of lactic acid bacteria: culture-independent methods.
Trends Food Sci. Technol. 15, 348-359
Teoh A.L., Heard G. & Cox J. (2004). Yeast ecology of Kombucha fermentation. Int. J. Food Microbiol. 95,
119-126
Teuber M. (1995). The genus Lactococcus. In Wood B.J.B. & Holzapfel W.H., eds. The genera of lactic acid
bacteria. London : Chapman & Hall, p.173-234
Theunissen J., Britz T.J., Torriani S. & Witthuhn R.C. (2005). Identification of probiotic microorganisms in
South African products using PCR-based DGGE analysis. Int. J. Food Microbiol. 98, 11-21
Thompson J.D., Higgins D.G. & Gibson T.J. (1994). Clustal W: improving the sensitivity of progressive
multiple sequence alignment through sequence weighting, position-specific gap penalties and weight
matrix choice. Nucleic Acids Res. 22, 4673-4680
Thoreux K. & Schmucker D.L. (2001). Kefir milk enhances intestinal immunity in young but not old rats. J.
Nutr. 131, 807-812
Tilsala-Timisjrvi A. & Alatossava T. (1997). Development of oligonucleotide primers from the 16S-23S rRNA
intergenic sequences for identifying different dairy and probiotic lactic acid bacteria by PCR. Int. J.
Food Microbiol. 35, 49-56
Toba T., Abe S., Arihara K. & Adachi S. (1986). A medium for the isolation of capsular bacteria from kefir
grains. Agric. Biol. Chem. 50, 2673-2674
Toba T., Arihara K., & Adachi S. (1987). Comparative study of polysaccharides from kefir grains, an
encapsulated Lactobacillus species and Lactobacillus kefir. Milchwiss. 42, 565-568
Tosun H., Sekin K. & Aktu Gnl S. (2007). Acid adaptation effect on survival of Escherichia coli O157:H7
in fermented milk products. Turk. J. Vet. Anim. Sci. 31, 61-66
Umeda C., Sonoyama K., Yamaguchi N., Saito R., Akashi K., Motoshima H. & Kawabata J. (2005). Oral
administration of freeze-dried kefir reduces intestinal permeation of oral sensitization to ovalbumine in
mice. Biosci. Biotechnol. Biochem. 69, 249-251
Urbach E., Daniels B., Salama M.S., Sandine W.E. & Giovannoni S.J. (1997). The ldh phylogeny for
environmental isolates of Lactococcus lactis is consistent with rRNA genotypes but not with
phenotypes. Appl. Environ. Microbiol. 63, 694-702
Vaillant V., de Valk H, Baron E., Ancelle E., Colin P., Delmas M.C., Dufour B., Pouillot R., Le Strat Y.,
Weinbreck P., Jougla E. & Desenclos J.C. (2005). Foodborne infections in France. Foodborne Pathog.
Disease 2, 221-232
Vancanneyt M., Mengaud J., Cleenwerck I., Vanhonacker K., Hoste B., Dawyndt P., Degivry M., Ringuet D.,
Janssens D. & Swings,J. (2004). Reclassification of Lactobacillus kefirgranum Takizawa et al. 1994 as
Lactobacillus kefiranofaciens subsp. kefirgranum subsp. nov. and emended description of L.
kefiranofaciens Fujisawa et al. 1988. Int. J. Syst. Evol. Microbiol. 54, 551-556
Vandamme P., Pot B., De Vos P., Kersters K. & Swings J. (1996). Polyphasic taxonomy, a consensus approach
to bacterial systematics. Microbiol Rev 60, 407-438

183

BIBLIOGRAPHIE

Vanos V. (1991). Importance of streptococci group D in fermented dairy products, as indicators of quality
assurance in comparison with coliforms. Bull. Int. Dairy Fed. 264, 20-25
Varga Zs., Plvlgyi M., Juhsz-Romn M. & Tth-Markus M. (2006). Development of therapeutic kefir-like
products with low galactose content for patients with galactose intolerance. Acta Aliment. 35, 295-304
Vayssier Y. (1978). Le kfir : analyse qualitative et quantitative. Rev. Lait. Fr. 361, 73-75
Verstraete W. (2008). Gestion des ressources microbiennes : vers une nouvelle biotechnologie
environnementale. Leon inaugurale de la Chaire Francqui, Gembloux, le 06 mars 2008.
Vinderola G., Perdigon G., Duarte J., Farnworth E. & Matar C. (2006). Effects of the oral administration of the
products derived from milk fermentation by kefir microflora on immune stimulation. J. Dairy Res. 73,
472-479
Vogel R.F., Bcker G., Stolz P., Ehrmann M., Fanta D., Ludwig W., Pot B., Kerster K., Schleifer K.H. &
Hammes W.P. (1994). Identification of lactobacilli from sourdough and description of Lactobacillus
pontis sp. nov. Int. J. Syst. Bacteriol. 44, 223-229
Vujii I.F., Vuli M. & Knyves T. (1992). Assimilation of cholesterol in milk by kefir cultures. Biotechnol.
Lett. 14, 847-850
Walter J., Tannock G.W., Tilsala-Timisjarvi A., Rodtong D., Loach D.M., Munro K. & Alatossava T. (2000).
Detection and identification of gastrointestinal Lactobacillus species by using denaturing gradient gel
electrophoresis and species-specific PCR primers. Appl. Environ. Microbiol. 66, 297-303
Wang Y.Y., Li H.R., Jia S.F., Wu Z.J. & Guo B.H. (2006). Analysis of bacterial diversity of kefir grains by
denaturing gradient gel electrophoresis and 16S rDNA sequencing. Wei Sheng Wu Xue Bao, 46, 310313
Ward L.J.H., Brown J.C.S. & Davey G.P. (1998). Two methods for genetic differentiation of Lactococcus lactis
ssp. lactis and cremoris based on differences in the 16S rRNA gene sequence. FEMS Licrobiol. Lett.
166, 15-20
Ward L.J.H. & Timmins M.J. (1999). Differentiation of Lactobacillus casei, Lactobacillus paracasei and
Lactobacillus rhamnosus by polymerase chain reaction. Lett. Appl. Microbiol. 29, 90-92
Wayne L.G., Brenner D.J., Colwell R.R., Grimont P.D.A., Kandler O., Krichevski M.I., Moore L.H., Moore
W.E.C., Murray R.G.E., Stackebrandt E., Starr M.P. & Trper H.G. (1987). Report of the ad hoc
Committee on reconciliation of approaches to bacterial systematics. Int. J. Syst. Bacteriol. 37, 463-464
Wiebe G.J., Pershad R., Escobar H., Hawes J.W., Hunter T., Jackson-Machelski E., Knudtson K.L., Robertson
M. & Thannhauser T.W. (2003). DNA sequencing research group (DSRG) 2003 A general survey of
core DNA sequencing facilities. J. Biomol. Tech. 14, 231-237
Wilmes-Riesenberg M.R., Bearson B., Foster J.W. & Curtiss R. (1996). Role of the acid tolerance response in
virulence of Salmonella typhimurium. Infect. Immun. 64, 1085-1092
Witthuhn R.C., Schoeman T. & Britz T. (2004). Isolation and characterization of the microbial population of
different South African kefir grains. Int. J. Dairy Technol. 57, 33-37
Witthuhn R.C., Schoeman T. & Britz T. (2005). Characterisation of the microbial population at different stages
of kefir production and kefir grain mass cultivation. Int. Dairy J. 15, 383-389
Woese C.R. (1987). Bacterial evolution. Microbiol. Rev. 51, 221-271
Woo P.C.Y., Fung A.M.Y., Lau S.K.P. & Yuen K.Y. (2002). Identification by 16S rRNA gene sequencing of
Lactobacillus salivarius bacteremic cholecystitis. J. Clin. Microbiol. 40, 265-267
Wood B.J.B. (1995). The lactic acid bacteria. In Wood B.J.B. & Holzapfel W.H., eds. The genera of lactic acid
bacteria. London : Chapman & Hall, series preface
Wszolek M., Tamine Y.A., Muir D.D. & Barclay M.N.I. (2001). Properties of kefir made in Scotland and Poland
using bovine, caprine and ovine milk with different starter cultures. Lebensm.-Wiss. u.-Technol. 34,
251-261
Wuyts J., Perrire G. & Van de Peer Y. (2004). The European ribosomal RNA database. Nucleic Acids Res. 32,
D101-D103

184

BIBLIOGRAPHIE

Yabuuchi E., Kaneko T., Yano I., Moss W.C. & Miyoshi N. (1983). Sphingobacterium gen. nov.,
Sphingobacterium spiritovorum comb. nov., Sphingobacterium multivorum comb. nov.,
Sphingobacterium mizutae sp. nov. and Flavobacterium indologenes sp. nov.: glucose-non fermenting
Gram negative rods in CDC group IIK-2 and IIb. Int. J. Syst. Bacteriol. 33, 580-598
Yaman H., Ulukanl Z., Elmali M. & Unal Y. (2006). The effect of a fermented probiotic, the kefir, on intestinal
flora of poultry domesticated geese. Rev. Med. Vet. 157, 379-386
Yang D. & Woese C.R. (1989). Phylogenetic structure of the 'leuconostocs': An interesting case of a rapidly
evolving organism. Syst. Appl. Microbiol. 12, 145-149
Yokoi H., Watanabe T., Fujii Y., Toba T. & Adachi S. (1990). Isolation and characterization of polysaccharideproducing bacteria from kefir grains. J. Dairy Sci. 73, 1684-1689
Yoshida Y., Palmer R.J., Yang J., Kolendrander P.E. & Cisar J.O. (2006). Streptococcal receptor
polysaccharides: recognition molecules for oral biofilm formation. BMC Oral Health 6, S12
Zacconi C., Scolari G., Vescovo M. & Sarra P.G. (2003). Competitive exclusion of Campylobacter jejuni by
kefir fermented milk. Ann. Microbiol. 53, 179-187
Zhang G. & Holley R.A. (1999). Development and PFGE monitoring of dominance among spoilage lactic acid
bacteria from cured meats. Food Microbiol. 16, 633-644
Zourari A. & Anifantakis E.M. (1988). Le kfir - Caractres physico-chimiques, microbiologiques et
nutritionnels. Technologie de production. Lait 68, 373-392

185

LISTE DES DOCUMENTS PUBLIS DANS LE CONTEXTE DE CE TRAVAIL

LISTE DES DOCUMENTS PUBLIS DANS LE CONTEXTE DE CE TRAVAIL


Articles soumis un comit de lecture
Ninane V., Berben G., Romnee J.M. & Oger R. (2005). Variability of the microbial abundance of a kefir grain
starter cultivated in partially controlled conditions. Biotechnol. Agron. Soc. Environ. 9, 191-194
Ninane V., Mukandayambaje R. & Berben G. (2007). Identification of lactic acid bacteria within the consortium
of a kefir grain by sequencing 16S rDNA variable regions. J. AOAC Int. 90, 1111-1117
Ninane V., Mukandayambaje R. & Berben G. (2009). Probiotiques, aliments fonctionnels et kfir : le point sur la
situation rglementaire en Belgique et sur les avances scientifiques en matire d'valuation des effets
de sant du kfir. Biotechnol. Agron. Soc. Environ. 13, (sous presse)

Actes de congrs
Rondia P., Dehareng F., Beckers Y., Ninane V., Laloux J. et Wavreille J. (2005). Diffrenciation et
fonctionnalit des produits agricoles. In L'Elevage: hier, aujourd'hui, demain. Quelles attentes? Pour
quels enjeux? Actes 10me Carrefour Prod. Anim., Gembloux, Belgique, 26 janvier 2005. Gembloux,
Belgique : CRA-W FUSAGX.
Ninane V., Dehareng F. Oger R. & Berben G. (2005). Conjugated linoleic acid content of kefir. In Prospects for
health, well-being and safety, Proc. Fourth Nizo Dairy Conf., Papendal, The Netherlands, 15-17 June
2005. Oxford, UK : Elsevier.
Ninane V, Dehareng F, Laloux J. (2006). Les transformations fermires du lait. In Le lait... une filire
dynamique, Actes 11me Carrefour Prod. Anim., Gembloux, Belgique, 25 janvier 2006. Gembloux,
Belgique : CRA-W FUSAGX., p. 59-65
Wavreille J, Ninane V, Vandeplas S, Beckers Y, Bartiaux-Thill N. (2006). Les probiotiques en alimentation
animale et la qualit de la viande. In Microbiologie et viande : que faire demain ? Actes Journ. Etud.
BAMST, Gembloux, Belgique, 05 avril 2006. Gembloux, Belgique : CRA-W, p. 55-62
Ninane V., Mukandayambaje R. & Berben G. (2006). Use of 16S rRNA V1 region analysis for the identification
of lactobacilli occurring in a kefir grain. In Scientific and technological challenges in fermented milk,
Proc. Second IDF Dairy Sci. Technol. Week, Sirmione Italy 15-19 May 2006. Bruxelles : FIL-IDF.

187

LISTE DES FIGURES

LISTE DES FIGURES


Figure 1.1.1 : Illustration de grains de kfir (Marshall & Cole, 1984) ; a : grain en forme de "feuille" ; b : grain
en forme de "feuille enroule" ; c & d : grain de forme non dfinie ; e & f : grain en forme de "chou-fleur".
Reproduit avec l'aimable autorisation de la Fdration internationale de laiterie (FIL-IDF, Building
Diamant, 80 Bd A. Reyers, 1030 Bruxelles, Belgique).
13
Figure 1.1.2 : Illustration d'un grain de kfir en grossissement de 7000 X (Guzel-Seydim et al., 2005). Reproduit
avec l'aimable autorisation de Wiley-Blackwell Publishing (Oxford, UK).
14
Figure 1.1.3 : Illustration de l'unit de six sucres, du D-glucose (D-G) ou du D-galactose (D-Gal), rpte dans
la structure du kfirane telle que propose par Kooiman (1968).
21
Figure 3.1.1 : Evolution de lacidit du grain de kfir KJ au cours dun cycle de culture de 24 heures.

78

Figure 3.2.2 : Visualisation du dveloppement microbien du grain l'aide d'un substrat chromogne (X-gal). La
rpartition des micro-organismes capables de mtaboliser le X-gal, zones fonces, tait htrogne aprs
un jour de culture sans agitation (a I et a II), tandis qu'elle tait homogne lorsque la culture tait agite (b).
Les prlvements microbiens destins vrifier la prsence de micro-organismes capables de mtaboliser
le X-gal dans les zones restes inactives du grain ont t effectus aux endroits indiqus par les flches
(a I).
84
Figure 3.3.1 : Variabilit des nuclotides successifs de l'ADNr 16S de bactries lactiques, schmatise partir de
l'alignement des 16 squences indiques par un astrisque dans le Tableau 3.3.1. Le nombre de nuclotides
diffrents en une position donne de l'alignement est reprsent par les symboles suivants : . pour 1 mme
nuclotide dans toutes les squences de bactries lactiques alignes ; o, o et O pour respectivement 2, 3 et
4 nuclotides diffrents. Les rgions variables V1, V2 et V3 sont soulignes et identifies dans la marge de
gauche.
88
Figure 3.3.2 :Alignement de la rgion V1 de l'ADNr 16S de bactries lactiques dont les numros d'accession
sont donns dans le Tableau 3.3.1. Les squences sont crites dans le sens 5' 3', avec, en marges, le
nom de l'espce dont elles sont issues et le nombre de nuclotides qu'elles comportent. Les squences de
certaines espces incluent les squences de plusieurs oprons ou sous-espces pouvant comporter des
diffrences nuclotidiques. Le cas chant, les nuclotides diffrents sont identifis par la lettre
symbolique, souligne, du code de l'Union internationale de biochimie (Cornish-Bowden, 1985) donn en
Annexe II. A chaque position de la squence, les nuclotides identiques sont indiqus par un mme
contraste monochrome entre le fond et le caractre.
90
Figure 3.3.3 :Alignement des rgions V2 et V3 de l'ADNr 16S de leuconostocs dont les numros d'accession
sont donns dans le Tableau 3.3.1. Les squences sont crites dans le sens 5' 3', avec, en marges, le
nom de l'espce dont elles sont issues et le nombre de nuclotides qu'elles comportent. A chaque position
de la squence, les nuclotides identiques sont indiqus par un mme contraste monochrome entre le fond
et le caractre.
91
Figure 3.3.4 : Reprsentation schmatique des fragments amplifis avec l'amorce commune aux lactobacilles
(R350), ou spcifique aux coques lactiques plus leuconostocs (R485), combine avec l'amorce bactrienne
universelle 27F dcrite par Rochelle et al. (1992). Les rgions variables V1 et V2 de l'ADNr 16S sont
reprsentes par les zones hachures. Les positions des nuclotides terminaux des rgions variables et des
amorces, dans l'ADNr 16S de Escherichia coli numro d'accession X80725 (Cilia et al., 1996), sont
donnes par les nombres surmontant les flches les pointant.
93
Figure 3.3.5 : Rendements de l'extraction de l'ADN gnomique de Lactobacillus acidophilus, Lb. casei,
Lb. kefiranofaciens subsp. kefirgranum et Lb. kefiri en trois rptitions chacun. Migration en gel d'agarose
de quantits d'extraits ajusts en fonction du poids des culots cellulaires.
95
Figure 3.3.6 : Squences de la rgion V1 de l'ADNr 16S de 83 + 21 fragments issus du grain de kfir KJ,
classes en groupes de similarit nots de A E. Les squences des groupes A, B et C comportaient des

189

LISTE DES FIGURES

diffrences entre-elles ; les nuclotides diffrents sont indiqus en caractres gras tandis que les
nuclotides identiques ceux de la squence consensus sont reprsents par des points. La frquence de
chaque squence est indique dans la marge de gauche. Les squences ont t enregistres dans la banque
de l'EMBL sous les numros d'accession AM419051, AM419054, AM419055, AM419056 et AM419052
respectivement pour les groupes A, B, C, D et E.
97
Figure 3.3.7 : Squence de la rgion V2 de l'ADNr 16S des 3 fragments du groupe E. Les squences des trois
fragments diffraient d'un nuclotide indiqu en caractre gras avec, en regard, le nuclotide de
substitution. La squence du groupe a t enregistre dans la banque de l'EMBL sous le numro
d'accession AM419053.
99
Figure 3.4.1 : Comparaison du profil de migration des protines, par lectrophorse en conditions dnaturantes
(SDS-PAGE), de la souche isole du kfir KJ avec les profils de souches de leuconostocs provenant du
Belgian Co-ordinated Collections of Micro-organisms (Gand, Belgique). Les souches l'origine des profils
sont identifies dans la marge de droite ; la souche isole du kfir KJ est identifie sous le numro
ID10403 tandis que celles provenant de la collection sont identifies par leur numro de rfrence,
complt par la lettre T pour les souches types. Les sous-espces de Leuconostoc mesenteroides sont
respectivement : (I) cremoris, (II) mesenteroides et (III) dextranicum. Le degr de similarit entre les
profils est reprsent par le dendrogramme donn dans la marge de gauche.
108
Figure 3.4.2 : Arbre phylogntique tabli partir de la squence partielle de l'ADNr 16S de l'isolat du kfir KJ
et des souches types de diverses espces actiques. Les souches l'origine des squences sont identifies
dans la marge de droite ; celle isole du kfir KJ est identifie sous le numro ID10595. Les numros
d'accession des squences des souches types sont donns l'extrme droite. La distance entre les
squences, en terme de diffrences nuclotidiques, est reprsente par la longueur des "branches" de l'arbre
reprsent dans la marge de gauche.
109
Figure 3.5.1 : Structure des cultures microbiennes dveloppes aprs 2 semaines d'incubation en arobiose (I) et
en anarobiose (II) dans les bouillons M 17, MRS5,4, Rogosa-CW et KPL partir d'un extrait du grain KJ.
Les biofilms forms dans le fond des botes de Petri ont t briss par agitation.
115
Figure 3.5.2 : Biofilm form la surface du lait ensemenc par le consortium reconstitu partir des microorganismes individuels isols du grain KJ. Le biofilm est prsent dans de leau et a t froiss
loccasion de la manipulation. Constitu de matire collante, il na pas t possible de le redployer. 128

190

LISTE DES TABLEAUX

LISTE DES TABLEAUX


Tableau 1.1.1, 1re partie : Composition microbienne de grains de kfir. Les diffrentes espces sont
mentionnes sous leur appellation actuelle ; un tableau reprenant les anciennes dnominations utilises par
les diffrents auteurs est donn en Annexe I.
16
Tableau 1.1.1, 2me partie : Composition microbienne de grains de kfir. Les diffrentes espces sont
mentionnes sous leur appellation actuelle ; un tableau reprenant les anciennes dnominations utilises par
les diffrents auteurs est donn en Annexe I.
17
Tableau 1.1.1, 3me partie : Composition microbienne de grains de kfir. Les diffrentes espces sont
mentionnes sous leur appellation actuelle ; un tableau reprenant les anciennes dnominations utilises par
les diffrents auteurs est donn en Annexe I.
18
Tableau 1.1.1, 4me partie : Composition microbienne de grains de kfir. Les diffrentes espces sont
mentionnes sous leur appellation actuelle ; un tableau reprenant les anciennes dnominations utilises par
les diffrents auteurs est donn en Annexe I.
19
Tableau 2.2.1 : Mthodes appliques pour la recherche des germes pathognes et indicateurs de dfaut
d'hygine.
60
Tableau 2.3.1 : Conditions de culture appliques pour lisolement et lnumration des groupes microbiens du
grain.
62
Tableau 2.6.1 : Conditions de prculture des souches microbiennes utilises dans les essais mis en uvre partir
du consortium reconstitu.
73
Tableau 2.6.2 : Conditions de culture des tmoins de croissance des souches individuelles utilises dans les
essais de formation de biofilms partir du consortium reconstitu.
75
Tableau 3.1.1 : Qualit hyginique du lait ferment partir du grain de kfir KJ (juin 2007).

79

Tableau 3.2.1 : Coloration de Gram, raction au test de catalase et morphologie cellulaire des bactries
dveloppes sur les milieux de culture slectifs.
81
Tableau 3.2.2 : Dnombrements des groupes microbiens participant au consortium du grain de kfir KJ.

82

Tableau 3.2.3 : Dnombrements des groupes microbiens du grain de kfir KJ soumis des conditions de culture
diffrentes par rapport celles appliques habituellement.
83
Tableau 3.3.1 : Squences de l'European Molecular Biology Laboratory (Stoesser et al., 2001) utilises pour
identifier les rgions variables de l'ADNr 16S des bactries lactiques cibles.
86
Tableau 3.4.1 : Profils fermentaires des lactobacilles homofermentaires isols du grain de kfir KJ (R-CW et
KPL). Le profil fermentaire de la souche type (T a1) du taxon assign aux isolats KJ ainsi que ceux dduits
de la description bibliographique du taxon (Rf. a1) et du taxon apparent (Rf. a2) sont juxtaposs aux
profils des isolats KJ.
104
Tableau 3.4.2 : Profils fermentaires des lactobacilles htrofermentaires isols du grain de kfir KJ (R-CW et
KPL). Les profils fermentaires des souches types (T b et T c) des taxons assigns aux isolats KJ ainsi que
ceux dduits de leur description bibliographique (Rf. b et Rf. c) sont juxtaposs aux profils des isolats
KJ.
105
Tableau 3.4.3 : Profils fermentaires des coques lactiques et des leuconostocs isols du grain de kfir KJ (RM).
Le profil fermentaire de la souche type (T d) du taxon assign aux coques lactiques isols du grain, celui
dduit de sa description bibliographique (Rf. d) et ceux de divers leuconostocs (Rf. e1, Rf. e2 et Rf.
e3) sont juxtaposs aux profils des isolats KJ.
106

191

LISTE DES TABLEAUX

Tableau 3.5.1 : Nombre et taille des structures de grain rcoltes dans les laits ferments partir dun extrait de
grain grossirement filtr.
119
Tableau 3.5.2 : Aspect des laits ensemencs avec des extraits du grain KJ, aprs 2 semaines dincubation
22 C. Les donnes concernent la structure (Structure) ainsi que la texture et le pH des gels aprs
homognisation (Texture/pH) ou le pH des liquides (pHliquide).
121
Tableau 3.5.3 : Aspect des laits ensemencs avec le consortium reconstitu partir des micro-organismes isols
du grain KJ, aprs 2 semaines dincubation 22 C. Les donnes concernent la structure (Structure) ainsi
que la texture et le pH des gels aprs homognisation (Texture/pH) ou le pH des liquides (pHliquide). 126

192

TABLE DES MATIRES

TABLE DES MATIRES


RSUM

SUMMARY

INTRODUCTION

11

1.1

Grains de kfir

13

1.1.1
1.1.2
1.1.3
1.1.4

Structure des grains de kfir


Microflore des grains de kfir
Composition microbienne qualitative des grains de kfir
Composition microbienne quantitative des grains de kfir
Matrice des grains de kfir
Formation du grain de kfir

13
15
15
19
21
22

1.2

Prparation et qualit du kfir

24

1.2.1

Contribution des diffrents groupes microbiens aux transformations du lait


Acidification du lait
Synthse de composs aromatisants
Synthse dagents texturants
Lipolyse
Synthse d'acide linolique conjugu
Fermentation alcoolique
Procds de fabrication
Qualit du lait
Prparation traditionnelle
Procds industriels

24
24
25
26
27
27
28
28
28
29
29

1.2.2

Prparation du levain
Prparation du kfir

29
31

1.2.3

Composition du lait ferment


Acides organiques
Lactose
Composs aromatisants
Protines, matire grasse et acide linolique conjugu
Alcool et CO2

32
32
33
33
33
34

1.3

Perspectives de dveloppement

35

1.3.1
1.3.2

1.3.4

Rputation du kfir
Notions de probiotique et d'aliment fonctionnel
Probiotiques
Aliments fonctionnels
Contexte rglementaire
Application mdicamenteuse
Application alimentaire
Application zootechnique
Avances scientifiques en matire d'valuation des effets sant du kfir

35
36
36
37
38
38
39
40
41

1.4

Mthodes didentification des bactries lactiques

46

1.4.1
1.4.2
1.4.3
1.4.4

Notion despce bactrienne


Identification microbienne
Mthodes phnotypiques
Mthodes physico-chimiques
Profils protiques
Spectres infra-rouge transforme de Fourier (IRTF)
Mthodes gnotypiques
Hybridation ADN-ADN et stabilit thermique des hybrides

46
49
49
50
50
50
51
51

1.3.3

1.4.5

193

TABLE DES MATIRES

Squenage de l'ADNr
Typage molculaire
Hybridation spcifique

51
53
55

1.5

Objectifs du travail

55

MATRIEL ET MTHODES

59

2.1

Matriel biologique

59

2.1.1
2.1.2

Origine et maintenance du grain de kfir KJ


Origine des souches de rfrence

59
59

2.2

Qualit hyginique du grain de kfir KJ

60

2.2.1
2.2.2

Mesure du pH du grain
Recherche des germes pathognes et indicateurs de dfauts d'hygine

60
60

2.3

Identification et quantification des groupes microbiens du grain de kfir KJ

61

2.3.1
2.3.2

2.3.3
2.3.4

Identification des groupes microbiens


Dnombrements des groupes microbiens
Echantillonnage et prparation des dilutions en vue des dnombrements
Mthodes de dnombrement
Estimation de la prcision des mthodes de dnombrement
Traitement des donnes
Statistiques des essais rpts dans le temps
Activit -galactosidase de la microflore du grain

61
61
61
61
62
62
63
63

2.4

Identification molculaire des bactries lactiques du grain de kfir KJ

64

2.4.1
2.4.2
2.4.3
2.4.4
2.4.5

Comparaison des squences de l'European Molecular Biology Laboratory


Squences bordant les rgions V1, V2 et V3 de l'ADNr 16S
Taux de variabilit des nuclotides
Stratgie d'isolement et d'identification de l'ADN cibl
Extraction de l'ADN gnomique
Mthode dextraction
Rendement de la mthode dextraction
Amplification des fragments cibls d'ADN
Clonage des fragments d'ADN
Extraction de l'ADN plasmidique des clones de Escherichia coli
Squenage des inserts
Estimation du nombre de fragments squencer
Mthode de squenage
Traitement des squences

64
64
64
65
65
65
66
66
67
67
68
68
68
69

2.5

Isolement des micro-organismes du grain de kfir KJ et identification des isolats

69

2.5.1

Isolement des micro-organismes du grain de kfir


Mise en culture
Amplifications gniques pour la slection des isolats de lactobacilles
Purification des isolats
Tests didentification
Bactries lactiques
Bactrie actique
Levure

69
69
70
70
71
71
72
72

2.6

Formation du grain de kfir KJ

73

2.6.1
2.6.2
2.6.3
2.6.4

Prparation des extraits de grain


Conditions de prculture des souches individuelles
Bouillons de synthse utiliss pour vrifier les proprits d'agglutination du consortium
Bouillons base de lait utiliss dans les essais daptitude du lait la croissance et dans les essais
de formation de biofilms
Taux densemencement des bouillons

73
73
74

2.4.6
2.4.7
2.4.8
2.4.9

2.5.2

2.6.5

194

74
74

TABLE DES MATIRES

2.6.6

Conditions de culture des tmoins de croissance des souches individuelles

75

RSULTATS

77

3.1

Qualit hyginique du grain de kfir KJ

77

3.1.1
3.1.2

Evolution du pH du grain au cours des cycles hebdomadaires de culture


Germes pathognes et indicateurs de dfauts d'hygine

77
78

3.2

Identification et quantification des groupes microbiens du grain de kfir KJ

79

3.2.1
3.2.2
3.2.3

Identification des groupes microbiens du grain


Quantification des groupes microbiens du grain
Identification des conditions de culture l'origine de la variabilit des abondances microbiennes
dans le grain de kfir
Influence de sjours rpts dans de leau et du rinage des grains sur labondance du grain en
lactobacilles, en coques lactiques et en levures
Influence de lagitation des grains pendant la fermentation sur lactivit -galactosidase du
consortium

79
81

3.3

Identification molculaire des bactries lactiques du grain de kfir KJ

85

3.3.1

Identification des rgions variables de l'ADNr 16S


Slection des squences
Localisation des rgions variables de lADNr 16S
Dtermination de l'applicabilit des rgions variables la diffrenciation des espces
Dtermination des amorces d'amplification gnique
Nombre de fragments analyss
Analyse des squences
Classement des squences de la rgion V1 de lADNr 16S
Identification molculaire des bactries du grain partir de la rgion V1
Identification des leuconostocs partir de la rgion V2 de lADNr 16S

85
85
87
89
92
94
95
96
96
99

3.3.2
3.3.3
3.3.4

83
83
84

3.4

Identification des isolats microbiens

100

3.4.1
3.4.2
3.4.3
3.4.4
3.4.5
3.4.6

Isolement des souches microbiennes


Identification des isolats de lactobacilles
Identification des isolats de coques lactiques
Identification des isolats de leuconostoc
Identification de lisolat actique
Identification de l'isolat de levure

100
101
103
103
108
110

3.5

Formation du grain de kfir KJ

111

3.5.1
3.5.2

Concepts sous-tendant les essais de reconstitution du grain


Essais de reconstitution du grain partir du consortium microbien extrait du grain
Cycles de culture
Dure des essais
Structure des caills au terme des essais
Agglutination en milieux de synthse du consortium microbien extrait du grain
Aptitude du lait nature et modifi la croissance de fragments de grain
Caractrisation des extraits de grain
Taux d'ensemencement des laits avec les extraits
Structures apparentes des grains rcoltes dans les laits ferments
Conditions favorables la croissance et/ou la prservation de petites structures de grain
Activits de biosynthse du consortium microbien extrait du grain
Expression des activits de biosynthse
Identification des activits de biosynthse variables et de leurs acteurs
Origine de la variabilit des activits de biosynthse
Activits de biosynthse du consortium reconstitu partir des souches individuelles
Conception des essais
Aspect des gels
Structures microbiennes
Comportement des souches individuelles

111
111
112
113
114
114
115
117
117
118
119
120
120
122
123
124
124
125
125
126

3.5.3
3.5.4

3.5.5

3.5.6

3.5.7

195

TABLE DES MATIRES

3.5.8

Croissance des souches individuelles


Agglutination des souches individuelles
Aspect des biofilms

126
127
128

DISCUSSION

129

4.1

Qualit hyginique du grain de kfir KJ

129

4.1.1
4.1.2

Sensibilit du grain des germes contaminants


Germes pathognes et indicateurs de dfauts d'hygine

129
131

4.2

Identification et quantification des groupes microbiens du grain de kfir KJ

133

4.2.1
4.2.2
4.2.3

Identification des groupes microbiens


Quantification des groupes microbiens
Origine de la variabilit de labondance des groupes microbiens

133
135
136

4.3

Identification molculaire des bactries lactiques du grain de kfir KJ

139

4.3.1
4.3.2
4.3.3
4.3.4
4.3.5

Pertinence du choix de lapproche


Domaine dapplication de la cible molculaire
Adquation des courtes squences de l'ADNr 16S lidentification des bactries cibles
Degr de confiance de l'identification molculaire
Sensibilit de la mthodologie

140
141
142
144
144

4.4

Composition microbienne du grain de kfir KJ

146

4.4.1

4.4.2
4.4.3

Bactries lactiques
Caractristiques taxonomiques
Production de kfirane
Diversit
Levures
Bactries actiques

147
147
147
148
149
149

4.5

Formation du grain de kfir KJ

149

4.5.1
4.5.2
4.5.3
4.5.4
4.5.5
4.5.6

Constitution in vitro dune structure de Gingerbeer plant : applicabilit aux grains de kfir
149
Processus de formation par croissance dbauches de grain
150
Adquation des essais l'tablissement d'un processus de formation par croissance dbauches de
grain
151
Adquation du lait la croissance d'bauches de grain
153
Hypothse de formation de grains par l'intermdiaire d'un biofilm
154
Adquation du consortium microbien la gense de grains
155

CONCLUSIONS ET PERSPECTIVES

157

5.1

Caractristiques microbiennes du grain de kfir KJ

157

5.1.1
5.1.2
5.1.3

Flore contaminante
Flore banale
Variabilit quantitative de la microflore

157
158
160

5.2

Atouts, contraintes et performances de la mthode molculaire d'identification des bactries


lactiques
160

5.2.1
5.2.2
5.2.3
5.2.4
5.2.5

Universalit et indpendance vis--vis d'une connaissance pr-dtermine des espces recherches


Indpendance vis--vis d'isolements par culture
Sensibilit
Fiabilit et limitations
Perspectives d'application

160
161
161
162
162

5.3

Avances en matire de reconstitution d'un grain de kfir

162

5.3.1
5.3.2
5.3.3

Paramtres microbiens dterminant la formation de structures


Hypothse de formation de grains par l'intermdiaire de biofilms
Rle des diffrents micro-organismes dans la formation des grains

162
164
165

196

TABLE DES MATIRES

ANNEXE I : ANCIENNES DNOMINATIONS DES MICRO-ORGANISMES DU KFIR


ANNEXE II : CODE DES ACIDES
BOWDEN, 1985).

NUCLIQUES DE L'UNION INTERNATIONALE DE BIOCHIMIE

167
(CORNISH169

BIBLIOGRAPHIE

171

LISTE DES DOCUMENTS PUBLIS DANS LE CONTEXTE DE CE TRAVAIL

187

Articles soumis un comit de lecture


Actes de congrs

187
187

LISTE DES FIGURES

189

LISTE DES TABLEAUX

191

TABLE DES MATIRES

193

197