LEMBRANDO O DOGMA CENTRAL

DA BIOLOGIA E CONTROLE DA
EXPRESSÃO GÊNICA

O QUE EXISTE EM COMUM ENTRE OS ORGANISMOS? O QUE FAZ UM ORGANISMO DIFERENTE DO OUTRO? .

TODOS VIERAM DE UM MESMO ANCESTRAL COMUM .

A MAQUINARIA GENÉTICA É A MESMA .

FLUXO DA INFORMAÇÃO GENÉTICA 5’ ATG GAG TTA TTG AAC TCT TAC AAT 3’ 3’ TAC GTC AAT AAC TTG AGA ATC TTA 5’ DNA REPLICAÇÃO 3’ TAC CTC AAT AAC TTG AGA ATC TTA 5’ 5’ AUG GAG UUA UUG AAC UCU UAG AAU 3’ RNA TRANSCRIÇÃO RNA mensageiro = mRNA Código redundante TRADUÇÃO PROTEÍNA AUG GAG AUG GAG UUAUUA UUG UUG AAC AAC UCU UCU UAG UAGAAU AAU M E L L N S Y N .

MAS NÃO É TÃO SIMPLES… .

AINDA TEM A EPIGENÉTICA .

DOGMA CENTRAL DA BIOLOGIA A informação genética. armazenada nos cromossomos. sendo expressa através da transcrição em mRNA e traduzida subsequentemente em cadeias polipeptídicas. DNA RNA Proteína . é transferida às células filhas através da replicação do DNA.

componentes estruturais de ribossomos – RNA mensageiro (mRNA) .contém a informação genética para a sequência de aminoácidos das proteínas – RNA transportador (tRNA) .várias funções – RNA ribossomal (rRNA) .identifica e transporta os aminoácidos até o ribossomo – snRNA. . microRNA. etc.ÁCIDOS NUCLEICOS • DNA: Armazenamento da informacão genética – Estabilidade • RNA: síntese de macromoléculas .

or T) .ÁCIDOS NUCLEICOS São polímeros de nucleotídeos Grupo fosfato O O=P-O O 5 CH2 O N C1 C4 Pentose C3 C2 Base nitrogenada (A. C. G.

COMPONENTES DOS NUCLEOTÍDEOS Carbono 5 Carbono 2 .

C . T.COMPONENTES DOS NUCLEOTÍDEOS Purinas: A. G Pirimidinas: U.

ATP É UM NUCLEOTÍDEO! .

LIGAÇÕES FOSFODIÉSTER Entre o carbono 3’ (grupo OH-) do nucleotídeo de “cima” e o carbono 5’ (grupo fosfato) do nucleotídeo de “baixo”. .

3’ – 5’ Interações Cargas .DNA – FITA DUPLA! Entre o carbono 3’ (grupo OH-) do nucleotídeo de “cima” e o carbono 5’ (grupo fosfato) do nucleotídeo de “baixo”.

DNA – FITA DUPLA! .

RELEMBRANDO O RNA… Polímero de 4 tipos de ribonucleotídeos unidos por ligação fosfodiéster. existente como fita simples RNAm RNAr RNAt .

VISÃO GERAL .

REPLICAÇÃO DO DNA  O DNA replica-se por um mecanismo semiconservativo: a medida que os dois filamentos complementares de uma dupla hélice parental se desenrolam e se separam. cada um serve como um molde para a síntese de um novo filamento complementar .

 A replicação é iniciada em origens únicas e em geral continua bidirecionalmente a partir de cada origem.REPLICAÇÃO DO DNA  O DNA replica-se por um mecanismo semiconservativo.  Os potenciais de pontes de H das bases dos filamentos moldes especificam as sequências de bases complementares nos filamentos de DNA nascentes. .

A REPLICAÇÃO DO CROMOSSOMO CIRCULAR A replicação é bidirecional A velocidade da forquillha de replicação de procarioto é cerca de 30.000 pb/min 1 único replicon .

4. uma fita ocorre no sentido 5’ → 3’ e a outra no sentido 3’ → 5’ • Como ocorre então a replicação nos dois sentidos? .PRINCIPAIS ENZIMAS ENVOLVIDAS 1. 2. 3. DNA Polimerases Helicases Topoisomerases (girases) Primases Telomerases • Se a replicação é semi-conservativa e a polimerização deve ser sempre no sentido 5´→3´ • Mas o DNA é antiparalelo ou seja. 5.

.

youtube.com/watch?v=tBkhK3t6Aw0 .Síntese das fitas contínua e descontínua é independente Animação: https://www.

MAS O QUE É UM GENE? .

e todos os introns dentro do gene .DEFINIÇÃO DE GENE Wilhelm Johannsen 1909  gene  Um gene  unidade da informação genética que controla a síntese de polipeptídios ou uma molécula de RNA estrutural mRNA  polipeptídeo tRNA e rRNA  RNA estrutural  Gene inclui as regiões 5´e 3´não codificantes. que estão envolvidas na regulação da transcrição e tradução.

GENE TÍPICO DE PROCARIOTOS mRNA .

GENE TÍPICO DE EUCARIOTOS Sinais para a terminação da transcrição Regulação da tradução Regulação da transcrição Transcrição Transcrito primário Remoção dos introns mRNA Códon de iniciação Polipeptídeo Códon de terminação Tradução .

000 Saccharomyces cerevisiae 13 ~6.000 Caenorhabditis elegans 97 ~20.000 Homo sapiens 3.NÚMERO DE GENES EM EUCARIOTOS Espécies Genoma (Mb) Genes Drosophila melanogaster 165 ~12.300 ~30.000 .

COMPARAÇÃO NO TAMANHO DE GENOMAS 670000 700000 5000 290000 Tamanho do genoma (Mpb) 4500 4000 200000 3500 3000 3000 2700 2300 2500 2000 1500 1000 1000 400 500 0 5 12 97 120 500 125 A complexidade de um organismo não é diretamente proporcional ao tamanho do genoma. alguns organismos unicelulares possuem muito mais DNA que os humanos. .

GENES NA MOLÉCULA DE DNA Bactéria 20 Kb gene gene gene gene gene gene gene gene gene gene gene gene gene Levedura gene 20 Kb gene gene gene gene gene gene gene gene gene Drosophila 200 Kb gene gene gene gene gene gene gene gene Humano 200 Kb gene gene gene Grande variação nos tamanho dos genes geradas pela presença dos introns! .

POR QUE É PRECISO CONHECER A ESTRUTURA DE GENES DE PROCARIOTOS E EUCARIOTOS? .

TRANSCRIÇÃO  A informação genética contida num segmento do DNA é reescrita em uma fita simples de RNA. com substituição de T por U.  Esta fita apresenta uma sequência de ribonucleotídeos complementar a uma das fitas da dupla hélice de DNA (molde) e idêntica à sequência da outra fita (codificadora). .

.ENZIMA RNA POLIMERASE (Alberts et al. 1999) .

ETAPAS DA
TRANSCRIÇÃO

CARACTERÍSTICAS GERAIS DA SÍNTESE DE RNA
1. Os precursores são ribonucleotídeos;
2. Apenas 1 fita de DNA é utilizada como molde para a síntese de RNA
complementar;
3. As cadeias de RNA são sintetizadas sem a necessidade de um filamento
primer preexistente (atuação da RNA polimerase);
4. Síntese é complementar ao DNA, no entanto A  U;
5. Polimerização sentido 5’  3’;
6. RNA polimerase inicia a transcrição em sequências específicas de
nucleotídeos  promotores;
7.

RNA polimerase termina a transcrição em sequências específicas de
nucleotídeos  terminadores (finalizadores).

DUPLICAÇÃO DO DNA

DNA polimerases
Propriedades gerais

Necessitam de um iniciador (primer);

Não iniciam cadeias (precisam de um terminal
3´- OH disponível);

Adicionam nucleotídeos trifosfato ao terminal 3’;

Têm atividade de polimerização 5’-3’.

TRANSCRIÇÃO

RNA polimerases
Propriedades gerais

Não necessitam de um iniciador
(primer);

Polimerização sentido 5´-3´;

NÃO CONFUNDA!!!!!!!

. a partir do ponto de início da transcrição.REGIÃO PROMOTORA DE UM GENE 5’ 3’  Diz-se que as sequências que antecedem o ponto de início da transcrição localizam-se à montante (upstream) e as que o sucedem localizam-se à jusante (downstream).  A posição das bases é numerada nos dois sentidos. Os valores aumentam (valor positivo) à jusante e diminuem (valor negativo) à montante. ao qual se atribui o valor +1.

EM SÍNTESE… REGIÕES CHAVE DO DNA NA TRANSCRIÇÃO PROCARIOTO Promotor Éxon 1 Éxon 2 Éxon 3… Terminador EUCARIOTO Promotor Éxon Íntron Terminador .

TERMINO DA TRANSCRIÇÃO  o término das cadeias de RNA ocorre quanto a RNA polimerase encontra um sinal de término. . quando isso ocorre o complexo é liberado.

youtube.com/watch?v=fynGKohVYHw .START E STOP CODONS a região codante (região que é transcrita e traduzida) Região codante do gene AUG 5’ UTR 3’ UTR AAUAAA  Delimitam AAA https://www.

DNA -35 -10 +1 STOP CODON 3’ START CODON 5’ TTGACA-14N-TATAATAA-9N-CACAGGAGGATTATTTATGAAATTCCCTTCTTGGTGA mRNA PROTEINA CACAGGAGGAUUAUCCAUGAAAUUCCCUUCUUGGUGA MET LYS PHE PRO SER TRY .

GUG ou UUG podem ser encontrados.  Stop codon UAA.  EUCARIOTOS – AUG é quase sempre o codon de iniciação.START E STOP CODONS  Start codon  PROCARIOTOS – 90% das vezes AUG é o codon de iniciação mas também AUA. UAG. UGA – sempre sinal para o término da tradução .

DNA fita codificadora DNA fita molde Nomenclatura: • DNA fita codificadora (senso) • DNA fita molde (anti-senso) RNA transcrito .TRANSCRIÇÃO • Processo pelo qual uma molécula de RNA é sintetizada a partir da informação contida na sequência de nucleotídeos de uma molécula de DNA fita dupla.

mRNA . • Este conjunto de modificações no transcrito nuclear originará o mRNA. – Montagem de segmentos codificadores ("splicing").PROCESSAMENTO DO RNA (TRANSCRITO) PRIMÁRIO EM EUCARIOTOS • As modificações que podem ocorrer nos transcritos nucleares são basicamente de três tipos: – Capeamento ("capping") do terminal 5'. – Poliadenilação do terminal 3'. pronto para migrar para o citoplasma.

youtube.com/watch?v=FVuAwBGw_pQ .https://www.com/watch?v=DoSRu15VtdM https://www.youtube.

ISOFORMAS DE PROTEÍNAS .

TRANSCRIÇÃO Nos eucariotos a transcrição ocorre no núcleo. . sendo os dois processos acoplados. enquanto a tradução ocorre no citoplasma. Já nos procariotos tal separação celular não existe.

TRADUÇÃO Interpretação Código genético .

. Cada aminoácido é especificado por três bases (códon) no mRNA – código genético universal.  As cadeias polipeptídicas são sintetizadas da extremidade amina (NH3) para a carboxila terminal (COOH) – ligação peptídica.  A tradução é realizada nos ribossomos.CARACTERÍSTICAS GERAIS DA TRADUÇÃO  Todos os RNAs mensageiros são lidos na direção 5’.3’. com os RNA transportadores como adaptadores entre o molde de mRNA e os aminoácidos.

LIGAÇÃO PEPTÍDICA Proteína .direção d e sintese .

CÓDON E ANTICÓDON .

MAS O QUE É CÓDIGO GENÉTICO? .

O CÓDIGO GENÉTICO É REDUNDANTE E DEGENERADO! .

Existem 20 aminoácidos e 61 trincas (codons) que os codificam start codon -iniciador stop codon -terminador .

A leitura correta do código genético pelo ribossomo é vital!!! .

Vários polipeptideos auxiliam o início da tradução! .

START CODON E STOP CODON Início: códon de iniciação da síntese protéica – AUG - METIONINA Terminação: três códons terminam a síntese protéica – UAG – UAA – UGA - .

START CODON E STOP CODON Região codante do gene AUG 5’ UTR mRNA a região codante (região que é transcrita e traduzida!) 3’ UTR AAUAAA  Delimitam AAA .

TRADUÇÃO: INÍCIO E FIM TTCATACTTGGTTAAGACCTTTACAAGCCGACCAACGTGGTGAC AGTGTCGTCCTTTACGCACCGAATCCCTTTATCATTGAATTAGT AGAAGAGCGATACTTAGGACGTCTTCGGATGGAATCTTGGTCCC GTTGCCTGGAACGTCTTGAAACTGAATTCCCGCCAGAAGATGTT CATACTTGGTTAAGACCTTTACAAGCCGACCAACGTGGTGACAG TGTCGTCCTTTACGCACCGAATCCCTTTATCATATTGAATTAGT AGAAGAGCGATACTTAGGACGTCTTCGGGAATTGTTATCCTATT TCTCAGGAATACGTGAAGTAGTCCTTGCAATTGGCTCACGACCT AAAACAACAGAACTACCCGTACCAGTAGACACTACAGGACGTTT GTCTTCAACAGTCCCATTTAACGGAAATCTCGACACACACTATA ACTTTGATAATTTTGTTGAGGGACGAAGCAATCAACTCGCTCGT GCTGCAGCTTGGCAAGCGGCACAGAAACCGGGAGACCGTACTCA CAACCCTCTATTGCTCTATGGTGGGACTGGTTTGGGTAAAACCC ATTTAATGTTTGCTGCAGGTAACGTAATGCGGCAAGTAAACCCA ACTTATAAAGTAATGTATCTTCGTTCGGAACAGTTTTTCAGCGC CATGATAAGAGCGTACAAGATAAAAGTATGGATCATAAGGGTAA .

TRADUÇÃO INICIAÇÃO ALONGAMENTO TÉRMINO DOBRAMENTO DE PROTEÍNAS .

DNA PROMOTOR -35 -10 +1 STOP CODON 3’ START CODON 5’ TTGACA-14N-TATAATAA-9N-CACAGGAGGATTATTTATGAAATTCCCTTCTTGGTGA mRNA PROTEINA CACAGGAGGAUUAUCCAUGAAAUUCCCUUCUUGGUGA MET LYS PHE PRO SER TRY TRADUÇÃO EM PROCARIOTOS .

TRADUÇÃO EM EUCARIOTOS .

com/watch?v=DcCnmPeutP4 .youtube.VISÃO GERAL https://www.

.

APLICANDO O CONHECIMENTO… .

Variabilidade inter-individual Nutrição Nutrigenômica .

.

.

. Nutrigenômica  a ciência que estuda o papel dos nutrientes e compostos bioativos de diferentes alimentos na expressão do gene.Qual a diferença entre nutrigenômica e nutrigenética? Nutrigenética  a ciência que estuda o efeito da variação genética em resposta à dieta.

com/watch?v=UdueAqv1DbE .youtube.https://www.

php?idTema=33 http://www.youtube.com/watch?v=-ygpqVr7_xs&feature=related http://qnint.br/qni/visualizarTema.youtube.com/watch?v=4PKjF7OumYo .VISUALIZANDO O PROCESSO… http://www.youtube.sbq.com/watch?v=4PKjF7OumYo http://www.org.

6 e 7 .LEITURA RECOMENDADA Capítulos: 5.

Estrutura e função do DNA. 5. com modificações: Profa. Diferença na estrutura dos genes de eucariotos e procariotos. Maria Carolina Quecine Departamento de Genética . Definição de gene. Região codante: start codon e stop codon. 4. Principais tipos e funções dos RNAs.Processo de tradução Aula cedida. 8. 9.Região promotora e sua importância para a transcrição em eucariotos e procariotos. 6. 2. 7.ESTUDO DIRIGIDO 1. Diferenças fundamentais entre DNA e RNA. Principais características da dupla hélice do DNA. 3.

Sign up to vote on this title
UsefulNot useful