Vous êtes sur la page 1sur 7

Journal of Plant Diseases and Protection, 117 (3), 122128, 2010, ISSN 1861-3829.

Eugen Ulmer KG, Stuttgart

A method to determine the pollen-mediated spread of target-site resistance to acetyl-


coenzyme A carboxylase inhibitors in black grass (Alopecurus myosuroides Huds.)
Eine Methode zur Bestimmung der Ausbreitung einer wirkortspezifischen Resistenz gegen Acetyl-Coenenzym-A-
Carboxylase-Inhibitoren bei Ackerfuchsschwanz (Alopecurus myosuroides Huds.) ber den Pollen
J. Petersen1,*, M. Dresbach-Runkel1 & J. Wagner2
1 University of Applied Science Bingen, Faculty of Life Sciences and Engineering, Bingen/Rhein, Germany
2 IdentXX GmbH, Stuttgart, Germany
* Corresponding author, e-mail petersen@fh-bingen.de

Received 22 February 2010; accepted 3 March 2010

Abstract setzt. Von den berlebenden Ackerfuchsschwanzpflanzen


wurde eine Blattprobe entnommen und die DNA isoliert. Mit
In this study the spread of target-site resistance to ACCase einer Analyse von PCR-Produkten mittels Pyrosequenzing
inhibitors via pollen was characterized in a population of wurde der Genotyp [sensitiv (Ile1781), heterozygot (Ile/
Alopecurus myosuroides. The spread of target-site resistance Leu1781) oder homozygot (Leu1781)] jeder einzelnen
was assessed in a three-year model crop rotation experiment Pflanze untersucht. Da durch die isolierten Einzelparzellen
with 20 plots (round circles of 1 m diameter and enclosed by eine Verschleppung von Ackerfuchsschwanzsamen durch
concrete walls of 50 cm height to avoid seed spread) in a total Bodenbearbeitungs- und Erntegerte ausgeschlossen war,
area of 90 m2. In one plot (so called initial plot) an A. myo- mussten Pflanzen, die eine wirkortspezifische Resistenz
suroides population with a known target-site resistance (Leu1781) auerhalb der initialen Parzelle aufwiesen, diese
(Leu1781) was sown. A herbicide sensitive biotype (Ile1781) ber den Pollen von resistenten Pflanzen erhalten haben. Die
was sown in all others plots. In a cereal crop rotation the Ergebnisse zeigen, dass im ersten Versuchsjahr im Winter-
second and third crop were treated with field rate of fenox- weizen 0,4 bis 3,3% der Pflanzen in den Einzelparzellen eine
aprop and leaf samples of surviving plants were taken for DNA wirkortspezifische Resistenz trugen. Die maximale Entfer-
analysis. The Pyrosequencing technology was applied to nung, die der Pollen dabei berbrckte, waren 4 m. Im darauf
determine the genotype of sensitive (Ile1781) heterozygous folgenden Jahr wurden Anteile von resistenten Ackerfuchs-
(Ile/Leu1781) and homozygous (Leu1781) individuals. Plants schwanzpflanzen von 7,9 bis 26,8% in den Einzelparzellen
carrying a heterozygous target-site resistance outside the identifiziert. Dabei waren die Auskreuzungen im zweiten Jahr
initial plot were a first indication for outcrossing via pollen Ereignisse, die zwischen Pflanzen in den Einzelparzellen und
between the plots. Results showed an outcrossing frequency innerhalb einer Einzelparzelle stattfinden konnten. Whrend
of 0.4 to 3.3% of Leu1781 into wild-type (Ile1781). The im ersten Jahr zumeist heterozygote Biotypen auftraten,
maximal distance for outcrossing from the initial plot was 4 m konnten in Parzellen, die bereits im Jahr zuvor resistente
and 37% of the plots were infested with resistant plants. The Individuen aufwiesen, auch homozygote Pflanzen identifi-
frequency of Leu1781 increased in the second year from 7.9 to ziert werden. Die zweijhrigen Ergebnisse zeigen, dass die
26.6% and most plots were infested with herbicide-resistant verwendete Methode geeignet ist, die Ausbreitungsgeschwin-
plants. Outcrossing events decreased with increasing distance digkeit von Herbizidresistenz ber Pollen zu verstehen. Wei-
from the initial plot. After the first application, all plants iden- tere Studien dieser Art sind notwendig, um die Ausbreitungs-
tified as resistant outside the initial plot were heterozygous, geschwindigkeit von Resistenz ber den Pollen im Feld zu er-
while homozygous resistant plants were detected in the fassen. Der hier vorgestellte Ansatz ermglicht die Erhebung
second year and indicated inbreeding between and within the von Daten unter feldhnlichen Bedingungen.
plots. The results obtained over two years demonstrate the
strong potential of the study to model the spread of resistance Stichwrter: Auskreuzung, Fenoxaprop, Herbizidresistenz,
via pollen in allogamous species in narrow spaces. Hence, we Pyrosequencing
provide a method for obtaining data under conditions close to
field conditions.
1 Introduction
Key words: fenoxaprop, herbicide resistance, outcrossing,
pyrosequencing Alopecurus myosuroides Huds. (ALOMY, black-grass) is one of
the main graminaceous weeds in Western Europe. ALOMY is
a predominant annual grass weed in small grain cereals and
Zusammenfassung oilseed rape. The use of one to three herbicide applications
per crop in winter barley, winter wheat, spring barley and
Die Ausbreitung einer wirkortspezifischen Resistenz gegen winter oilseed rape is quite common. Post emergence treat-
ACCase-Inhibitoren ber Pollen wurde in einem dreijhrigen ments apply aryloxyphenoxypropionates and cyclohexanedi-
Fruchtfolgeversuch untersucht. Kleine Einzelparzellen (Innen- ones as well as phenylpyrazolines to control ALOMY. These
durchmesser 1 m) aus Beton wurden auf einer Freiflche herbicides belong to the class of acetyl-coenzyme A carboxy-
(90 m2) aufgestellt. In 19 der 20 Parzellen wurde eine herbi- lase inhibitors (ACCase inhibitors) and have been used in
zidsensitive Population des Ackerfuchsschwanz eingest. In many fields for more than 25 years. The resulting selection
einer zentral gelegenen Parzelle wurde eine Population mit pressure led to the development of herbicide resistant bio-
einer wirkortspezifischen Resistenz (Leu1781) etabliert. In types. Resistance of black-grass to ACCase inhibitors was first
einer Getreidefruchtfolge (Sommergerste-Winterweizen-Din- reported in the UK in 1982. Since then resistance occurred in
kel) wurde im zweiten und dritten Fruchtfolgeglied Fenoxa- many countries, such as Belgium (1996), Denmark (2001),
prop zur Ackerfuchsschwanzbekmpfung in maximal zuge- France (1993), Germany (1983) and Turkey (2001) (HEAP
lassener Aufwandmenge ber den gesamten Versuch einge- 2008). Two mechanisms of resistance to ACCase-Inhibitors

J.Plant Dis.Protect. 3/2010


Petersen et al.: Determination of the spread of resistance to acetyl-coenzyme A carboxylase inhibitors in black grass 123
are known in ALOMY. The most common mechanisms of resis- door experiment was 500 m away. Consequently, the risk of
tance are an enhanced metabolism of herbicides and a change natural interference with our experiment was low.
in sensitivity of the target caused by point mutations within The trial started in March 2006 by sowing spring barley and
the target gene, (target-site resistance). The proportion of ALOMY seeds in all plots. In each plot we sowed approx. 1,600
both mechanisms in relation to the total resistance cases is ALOMY seeds. In 19 of the 20 plots a herbicide sensitive bio-
different in the UK, France, and Germany. However, in total type (Ile1781; origin Isseroda near Weimar, Thringen, Ger-
the spread of non-target-site resistance mechanisms to ACCase many), while in the central plot (no. 11, see Figs. 4 and 5) an
inhibitors seems to be higher. DELYE et al. (2007) showed that ACCase target-site resistant biotype was established. The ori-
75% of the ALOMY plants resistant to ACCase-inhibiting her- gin of this biotype is a field at Vaihingen/Enz near Stuttgart,
bicides in France are resistant due to increased metabolism. Baden-Wrttemberg, Germany. This biotype was previously
Nevertheless, alleles of ACCase target-site resistance were characterised to carry a Leu1781 mutation (BALGHEIM et al.
detected in 57% of the investigated populations. This indi- 2006), which ACCase leads to high resistant factors for many
cates that target-site alleles are widespread and will play an ACCase inhibitors, such as fenoxaprop and cycloxydim (DELYE
increasing role in the ongoing resistance evolution. The high- et al. 2008; PETERSEN et al. 2008). Both ALOMY biotypes used
est proportion of target-site resistance in ALOMY is observed in the experiment showed no differences in morphology or
in the UK (approx. 50%) compared to only 10% in Germany phenology and had synchronous pollination.
(MENNE 2009). The distribution of resistant ALOMY biotypes During the growing period of the spring barley in the first
in fields is probably due to the selection pressure of ACCase year no herbicides were used. Barley as well as the following
inhibiting herbicides in combination with agronomic factors crops were harvested late to ensure that all ALOMY seeds were
promoting high ALOMY densities (> 100 plants m2). Regard- shed to the ground of the plots (for details see trial protocol in
ing the management of present resistance by farmers and con- Table 1). The plots were irrigated as necessary. After harvest,
sultants it is important to know the underlying mechanism. In straw was removed from the plots prior to a shallow (max.
the case of metabolic resistance cross-resistance to herbicides 15 cm) stubble tillage was done by hand using a spate in all
with alternative mode of action has to be considered, while in years. Upcoming weeds on the stubbles including ALOMY
the case of target-site resistance to ACCase-inhibitors cross-re- were controlled by two glyphosate (Clinic 360 g l1 a.i.;
sistance can take place only within this mode of action. How- Nufarm, Cologne, Germany) applications with 1,080 g ha1
ever, managing a present resistance should also try to avoid active ingredient (application dates see Table 1). After a
further spreading of resistance within and between popula- shallow seed bed preparation (max. 10 cm) in autumn, winter
tions. A prerequisite for this is however knowledge of the wheat (2006) and spelt (2007) were sown (3 cm depth). In
means of resistance spreading. Germany the relation of 66% winter to 33% spring crops is
The speed of herbicide resistance spread depends among very common in rotations. In both crops no additional ALOMY
other things on the initial rate of resistance alleles of ACCase seeds were added to the plots. In autumn 2006 and in spring
and the shift of their frequencies in the population. While it 2008 82.8 g ha1 fenoxaprop-P-ethyl (Ralon Super 69 g l1
can be assumed that the use of machines plays an important a.i., Nufarm) was applied by a precision plot sprayer (spraying
role for the spread of seeds in fields, the role of pollen for the volume: 200 l ha1 water; nozzles: Agrotop AI 110 025, pres-
spreading of resistance depends on factors such as density of sure: 2.100 hPa; speed: 4.5 km h1) to control ALOMY in the
flowering plants and the probability of successful crossing by Triticum crops. The number of ALOMY plants per plot was
wind diffusion. The latter depends on the distance of counted before, 4 weeks after herbicide application. At the
pollen-donating and pollen-accepting plants. Since ALOMY is end of May the number of ALOMY ears per plot was counted.
known to be a facultative cross pollinating species (LETOUZE From each ALOMY plant that survived the fenoxaprop
and GASQUEZ 2000), the role of pollen in mediating resistance treatment a single leaf sample was taken and stored in a paper
in field population is of importance. bag. The samples of ALOMY in wheat were taken on 6th of
As our knowledge on pollen-mediated spread of resistance March 2007 and in spelt on 6th of May 2008. From the initial
is still limited, the main focus of this study was to create and resistant plot only five (2007) or 10 (2008) plants were
evaluate an experimental design for analysing the speed of sampled.
herbicide resistance spread in ALOMY by using a combination
of an outdoor pot experiment and a DNA-based technique to
analyse individual plants. 2.2 Analysis of plants for target-site mutations
DNA preparation

2 Materials and Methods Leaf samples of individual plants were collected and air-dried
for three days. The DNA of each individual plant was extracted
2.1 Mini plot field trial in a 96-well format with the Wizard Magnetic 96 DNA Plant
System kit (Promega, Mannheim, Germany). The kit uses
To exclude the spread of ALOMY seeds the outdoor crop rota- MagneSilParamagnetic Particles, that can be considered a
tion experiment was designed with 20 isolated pots on a total mobile solid phase. Each single leaf was placed in a well of

baden, Germany). A volume of 300 l lysis buffer (Lysis Buffer


area of 90 m2. The round plots were pots of concrete with an a 96-deep-well plate (Costar Assay Block, 1 ml; Corning, Wies-
external dimension of 120 cm, an internal dimension of
100 cm and a height of 50 cm. The plot area was about 0.8 m2. A) and a 5 mm bead (steel) for grinding were added before
The plots were set up at a distance of 80 cm next to each other the plant material was disrupted by a mill (Retsch MM200;

matter content 1%, pH 7.3), which did not contain seeds of


(see Figs. 4 and 5) and filled with silty to loamy sand (organic Retsch, Haan, Germany). The plates were centrifuged at

125 l of each sample was transferred to a 96-well-U-bottom


1,700 g for 10 min to collect the cell debris. A volume of

plate (included in the kit) amended with 60 l of MagneSil/


any grass weed species. The plots were placed close to the
campus in Bingen. The vegetation around the plots was cut
regularly to avoid seed shed into the plots. The plots were Lysis Buffer B and pipetted to mix. After minutes of incubation
arranged in a rectangle with longer site (seven plots) placed in at room temperature, samples were mixed once again. The
the main wind directions (W and E). Due to technical reasons plate was placed in a MagnaBot96 Magnetic Separation
only three plots could be installed in the north-south direc- Device with MagnaBot Spacer for 1 min. During this time the
tion. As a consequence the design was imbalanced but, never- MagneSil Paramagnetic Particles moved out of the suspen-
theless eligible to study outcrossing of target-site resistance in sion and were collected close to the magnetic device at the
ALOMY. ALOMY is a very rare species in the arable cropping wall of the wells, where they formed a pellet. Subsequently,
area of the experimental site. The next arable land to the out- the liquid was discarded by pipetting and the pellet was resus-

J.Plant Dis.Protect. 3/2010


124 Petersen et al.: Determination of the spread of resistance to acetyl-coenzyme A carboxylase inhibitors in black grass
Table 1: Field trial protocol

Spring barley 2006 Winter wheat 2007 Winter spelt 2008


(Hordeum vulgare) (Triticum aestivum) (Triticum spelta)

Cultivar Braemar Hybred Baulnder Spelz


Crop sowing date 20 Mar. 2006 17 Oct. 2006 24 Oct. 2007
Crop seeds/plot 350 120* 200
Fertilization 20 Mar. 2006 10 Nov. 2006 + 12 Mar. 2007 30 Jan. 2008 + 21 Apr. 2008
N amount (kg ha1) 60 60 + 60 60 + 60
Application of fenoxaprop-P-ethyl No herbicide 10 Nov. 2006 4 Apr. 2008
Harvest 3 Aug. 2006 15 Jul. 2007 20 Jul. 2008
Stubble tillage 3 Aug. 2006 15 Jul. 2007 20 Jul. 2008
Application of glyphosate 3 Sep. 2006 + 29 Sep. 2006 2 Sep. 2007 + 27 Sep. 2007 8 Aug. 2008 + 17 Sep. 2008

* low number of seeds per plot because variety is a hybrid.

pended in 150 l of a wash solution. The procedure was formed according to the manufacturers instructions using the

temperature for 5 min before it was resuspended in 50 l of


repeated, but this time the remaining pellet was dried at room PSQ 96 SNP Reagent Kit (Qiagen), which contained the
enzyme, substrate, and nucleotides. The assays were per-
TE buffer. The procedure was repeated one more time and formed on the PSQ96MA (Qiagen) using the nucleotide
remaining pellet of MagneSil Paramagnetic Particles now dispensation orders shown in Figure 1 (see sequencing order
forming the purified DNA, was transferred to a fresh U-bottom below pyrograms: GACTGACA). Pyrosequencing results were
plate and stored at 20C until use. In total the DNA of 138 in- analysed and the sample genotype was determined with
dividual ALOMY plants was extracted in this way. The quality built-in software tools. A two-letter code reflects the sequenc-

standards to assess the concentration of DNA per l.


of DNA was assessed via gel electrophoresis with quantity ing results on position 1781. The sequence results provided
three different genotypes: plants with A/A were assessed as
homozygous wild-type (herbicide sensitive), plants with A/C
were assessed as heterozygous resistant, and plants showing
2.3 PCR C/C were assessed as homozygous resistant (Fig. 1).
The three possible genotypes are A/A, A/C, and C/C. The

(Qiagen, Hilden, Germany) in a total volume of 50 l contain-


The PCR was carried out using the HotStar Taq Master Mix Kit letters are referred to the first position of the triplet: A/A

ing 0.4 M of each PCR primer (upstream: 5GCACACAAGA-


means wild type, both alleles of ACCase gene have A in ATA,
the triplet coding for isoleucine at amino acid position 1781.
TGCAGCTAGATAGT3 and downstream: BT-5TCCGATTCCA- The plant is homozygous sensitive. A/C means heterozygous
ACAGTTCGT3, BT= biotinylated) and approx. 5 ng genomic target-site resistant genotype TSR, the plant is heterozygous
DNA. PCRs were performed on an Eppendorf Master Cycle resistant due to isoleucine (ATA) and leucine, (TTA). One
Gradient Thermocycler (Eppendorf, Hamburg, Germany. The allele carries A (resistant) and the other T, wild type, both
program consisted of 35 cycles of 95C for 30 s, 53C for 30 s, alleles of ACCase gene are present in the diploid plant. C/C
and 72C for 30 s. The quality and amount of PCR products means wild type, both alleles of ACCase gene have C in CTA,
was assessed via gel electrophoresis using a 100 bp ladder. For the triplet coding for leucine at amino acid position 1781. The
pyrosequencing analysis one primer needs a 5-biotinylation. plant is homozygous target-site resistant.
In this analysis the downstream primer was labelled.

2.5 Data analysis


2.4 Pyrosequencing reactions
To summarise the results we created four groups that were
Pyrosequencing is a DNA sequencing technique based on characterised by their distance from the initial resistant plot.
sequencing-by-synthesis enabling rapid real-time sequence Distance 0 m was the initial plot itself and since there was only
determination. In this study, we used pyrosequencing for one initial resistant plot there were no replications. Distance
genotyping alleles at position 1781 of ACCase. Therefore, sin- 2 m comprised the six plots that were next to the initial plot,

the Pyrosequencing Vacuum Prep Tool (Qiagen). Two l of


gle-stranded biotinylated PCR products were prepared using although the four plots on the corners had a little wider
distance. Distance 4 m compromised six plots with a distance

Uppsala, Sweden) were added to 40 l binding buffer (10 mM


Streptavidin Sepharose HP beads (Amersham Biosciences, from their centre to the centre of the initial plot. The last
group compromised fives plots with the largest distance of

mixed with 25 PCR product and 13 l water (total volume:


Tris-HCl, pH 7.6, 2 M NaCl, 1 mM EDTA, 0.1% Tween 20) and 6 m. The rate of outcrossing was calculated by the ratio of the

80 l) for 10 min at room temperature using an 96-well-plate


ALOMY plant number before fenoxaprop application and the
number of plants carrying an ACCase target-site mutation in
shaker). The beads containing the immobilized templates both years.
were captured on the ?lter probes after the vacuum was ap-
plied and then washed with 70% ethanol for 8 s, denaturation
solution (0.2 M NaOH) for 8 s, and washing buffer (10 mM 3 Results
Tris-acetate, pH 7.6) for 8 s. The vacuum was then released,

containing 44.86 l annealing buffer (20 mM Tris-acetate,


and the beads were released into a PSQ 96 Plate Low (Qiagen) In 2006 the ALOMY-populations were established in the

2 mM Mg-acetate, pH 7.6) and 0.13 l of 100 M sequencing


different plots. Although spring barley is a strong competitor
towards ALOMY, weed plants developed well and reached

tion of 0.3 M primer. Pyrosequencing reactions were per-


primer (5ATGGACTAGGTGTGGAGAAC3) in end concentra- densities per plot that are shown in Figure 2. In the first year,
90 ears m2 in the resistant initial plot were counted. In the

J.Plant Dis.Protect. 3/2010


Petersen et al.: Determination of the spread of resistance to acetyl-coenzyme A carboxylase inhibitors in black grass 125

Position Ile1781-to-leu pyrogram

Genotype:
A/A (sensitive)

Genotype:
A/C (resistant,
heterozygous)

Genotype:
C/C (resistant,
homozygous)
Fig. 1: Pyrograms of the three
G A C T G A C A
identified genotypes of Alopecurus
myosuroides for the position 1781.

1600
1400
1200
1000
distance to initial
number of ALOMY ears/m

800
600 resistant plot
400 0m
2m
150 4m
6m

100

50
Fig. 2: Development of Alopecu-
rus myosuroides ears m2 in a three
0 year cereal crop rotation depend-
2006 2007 2008 year ing on the distance to initial plot
no herbicide fenoxaprop fenoxaprop with an ACCase resistant popula-
tion.

plots with the sensitive biotype the densities ranged from 51 62%. These results correlate well with the results of ear den-
to 70 ears m2. In 2007 the number of ears in the initial resis- sity (Fig. 2).
tant plot increased to over 1,450 ears m2, but decreased again Despite the partly high level of control, the DNA analysis of
in the spelt crop to a density of 540 ears m2. The lower the plants that survived the fenoxaprop treatment confirmed
density was mainly due to a stronger competitive crop. In a spread of the ACCase resistance between plots (Fig. 4). In
contrast, the density in the plots with the original sensitive 2007, heterozygous resistant plants were found in seven of the
biotype remained stable in 2007 and showed no difference 19 plots surrounding the initial resistant plot, while homozy-
with increasing distances from the initial resistant plot. In the gous plants were not identified outside the initial resistant
third year the density of ALOMY in the different groups of plot. This shows that no seeds have spread from the initial
plots was quite diverse. The plots closer to the initial resistant resistant plot to the neighbouring plots, because nearly 50%
plot (2 m) showed a higher density of ears compared to the of the resistant population showed the exchange of the amino

2 m distance was 30% higher than the years before, while the
plots with a wider distance (4/6 m). The number of ears in the acid at position 1781 on both alleles and therefore was
homozygous.
4 and 6 m distance groups showed a lower ear density than the The crop canopy of the winter wheat in 2007 was not as
years before. good as that of the more competitive barley in 2006. Conse-
The efficacy of the fenoxaprop treatment in 2007 showed quently, ALOMY found better conditions to grow and pollen
no differences between the plots with the sensitive biotype flow was less influenced by the crop. As a consequence and
independent of the distance from the resistant initial plot due to the initial spread of resistance in 2006 much more

a 5% efficacy in the resistant plot in both years. In 2008 the


(Fig. 3). The efficacy showed on average of 93%, compared to resistant plants occurred in 2008 (Fig. 5). Nearly all plots
(17 of 20) contained resistant plants. In the plots where in
efficacy increased with increasing distance from the initial 2007 heterozygous resistant plants could be found, some
resistant plot. At a distance of 2 m the efficacy was only about plants showed mutations on both alleles. Furthermore, it is

J.Plant Dis.Protect. 3/2010


126 Petersen et al.: Determination of the spread of resistance to acetyl-coenzyme A carboxylase inhibitors in black grass

100
distance to resistant
90 initial plot

80 0m
2m
70 4m
Efficacy [%]

6m
60

50

40

30 Fig. 3: Efficacy of fenoxaprop


20 treatment on number of Alope-
curus myosuroides plants 4 weeks
10 after treatment in relation to the
0
number of plants before herbicide
2007 year 2008
application depending on the
winter wheat crop winter spelt distance to the initial plot with an
ACCase resistant population.

E W

20 19 18 17 16 15

14 13 12 11 10 9 8

Fig. 4: Result of pyrosequencing


on spread of ACCase resistance in
7 6 5 4 3 2 1 Alopecurus myosuroides in second
year (samples taken in winter
susceptible biotype (A/A at position 1781) wheat on 6th of March 2007); each
surviving plant but analysis failed symbol marks an ALOMY plant
resistant heterozygous biotype (A/C at position 1781) that survived the fenoxaprop
resistant homozygous biotype (C/C at position 1781)
treatment; No. 11 is the initial
resistant plot.

E W

20 19 18 17 16 15

14 13 12 11 10 9 8
Fig. 5: Result of pyrosequencing
on spread of ACCase resistance in
Alopecurus myosuroides in third
7 6 5 4 3 2 1 year (samples taken in Triticum
spelta on 7th of May 2008).

obvious that the plots surrounding the initial resistant plot plants from the initial resistant plot and the remaining sensi-
showed a higher density of ALOMY compared to the plots at tive plots as well as between plants of plots that carried a
the edge of the trial. resistance since 2007.
The outcrossing frequency of the ACCase inhibitor resis-
tance ranged from 0.4 to 3.3% in 2007 and from 7.9 to 26.6%
in 2008 (Fig. 6). The outcrossing rate in both years decreased 4 Discussion
with increasing distance to the initial resistant plot. Higher
outcrossing rates in the second year probably resulted from a Outcrossing in open-pollinating species is common and prob-
lower crop competition. Furthermore, as a spread of resis- ably the basis for a fast evolution in plant populations. It is
tance could be found already in the first year, outcrossing in also one reason for a high genetic diversity within the popula-
2008 should have been a mixture of potential crosses between tion. The spread of herbicide resistant alleles in weed popula-

J.Plant Dis.Protect. 3/2010


Petersen et al.: Determination of the spread of resistance to acetyl-coenzyme A carboxylase inhibitors in black grass 127

40
distance to resistant
initial plot
Outcrossing frequency [%]

30 2m
4m
6m

20

10

Fig. 6: Outcrossing frequency of


0 ACCase target-site resistance of
2007 2008 Alopecurus myosuroides in an out-
year door pot crop rotation experiment
with isolated mini plots.

tions is one consequence of a high selection pressure exerted mous species like many grasses. Important factors that pro-
by herbicide application. A genetic exchange target-site resis- mote the speed of spreading ACCase resistance in ALOMY
tance trait to herbicides via pollen was previously described under field conditions are: high resistance factors to most
for Setaria faberi and ACCase inhibitors (VOLENBERG and ACCase inhibitors, even for heterozygous individuals (DELYE et
STOLTENBERG 2002) and for sulfonylureas in Kochia scoparia al. 2008), resistance based on single nucleotide polymor-
(STALLINGS et al. 1995). For spread of resistance via pollen it is phism (DELYE 2005), open-pollinating, the fact that ACCase
essential that the resistant gene is based in the nuclear ge- gene is based in nuclear genome and can be spread via pollen,
nome. A target-site resistance that is anchored in the extra no fitness costs of most common target-site mutant (Leu1781)
chromosomal DNA (e.g. target-site resistance of photosystem (DELYE et al. 2007, MENCHARI et al. 2008) and the fact that
II inhibitors) can not be mediated by pollen (reviewed in ALOMY often reaches high plant densities as it is a main weed
JASIENIUK et al. 1996). However, ACCase gene is a nuclear gene in many Western European countries. These factors together
and is thus expressed in the pollen (LETOUZE and GASQUEZ with high selection pressure due to the high frequency of
2000). using ACCase inhibitors may explain why during the last
The outcrossing frequency in our experiment was influ- decade high portions of ALOMY populations in the UK and in
enced by the distance of the plants to the initial resistant plot. France developed an ACCase target-site resistance. In Ger-
The maximum distance travelled by the pollen in the experi- many this process seems to be just starting.
ment was 6 m. That distance was reached in the second year. If a farmer is trying to avoid occurrence of resistance by
However, 6 m is not very far and it can be assumed that viable implementing anti-resistance management strategies, he still
ALOMY pollen can be transported over much longer distances. faces the risk of adopting resistance from neighbouring fields
How far viable ALOMY pollen can be transported is, however, by pollen flow. To reduce this risk, a farmer should reduce the
unknown. For open-pollinating grass species distances from density of ALOMY on his fields as far as he can. Furthermore,
200 m to several km are described (ROGNLI et al. 2000; PFENDER he should grow competitive crops and avoid growing the same
et al. 2007). Weather (wind speed, wind direction, rainfall, air crop as grown on adjacent fields as this ALOMY will differ in
humidity), topographic aspects, pollen competition and size time of flowering on both fields and the outcrossing rate is
of the pollen source are the major factors affecting the out- reduced. That recommendation should be followed especially
crossing rate (WILKINSON et al. 1995). Taking into account that if the neighbouring field has obvious problems with resistant
our model was a small scale experiment with a pollen source ALOMY.
of only 0.8 m2, higher outcrossing rates may occur under Another problem of outcrossing in ALOMY might be the
larger field conditions. Although the experiment was not mating of two populations carrying target-site resistance to
repeated in space and time, we believe that this experimental different mode of action. In the UK target-site resistance of
design is useful on a larger scale with longer distances to ALOMY to aceto-lactase-synthase inhibitors (ALS inhibitors)
investigate the spread of herbicide resistance within and is already apparent (MARSHALL and MOSS 2008). Therefore, if
between agricultural areas. ALS and ACCase target-site resistant populations cross, post
Furthermore, our experiment clearly demonstrates the dy- emergence ALOMY control in cereals is nearly impossible.
namic character of the process if selection pressure continues. That scenario should motivate to avoid further spread of
From a few resistant plants outside the initial plot in 2007 target-site resistance in ALOMY by implementing site-specific
there was a steep increase of the number or resistant plants in anti-resistance management programmes whereever possible.
2008. While a farmer would not notice a decrease in herbicide
efficacy at a low, initial outcrossing level, there is a high risk
for a spread of resistance in the following year if he continues Acknowledgements
to use a herbicide with equal mode of action. At that point he
might realize a resistance problem, but it might be too late to We thank Mrs. S. Seidler and Mr. H. Daiksel for their engaged
stop the evolutionary process at reasonable costs. work in the trial and Mrs. B. Truebenbach for correcting the
Our results indicate that spread of ACCase inhibitor tar- English. Furthermore we wish to thank Bayer CropScience AG
get-site resistance can be mediated via pollen. This means that (Frankfurt, Germany) for providing access to the lab facilities
there is a high risk for a fast spread of the resistance in alloga- to perform the genotyping studies.

J.Plant Dis.Protect. 3/2010


128 Petersen et al.: Determination of the spread of resistance to acetyl-coenzyme A carboxylase inhibitors in black grass
References boxylase alleles endowing herbicide resistance in black-grass
Alopecurus myosuroides. J. Appl. Ecol. 45, 939-947.
BALGHEIM, N., J. WAGNER, J.P. RUIZ-SANTAELLA, R. DE PRADO, MARSHALL, R., S.R. MOSS, 2008: Characterisation and molecular
K. HURLE, 2006: Resistenz gegen ACCase-Inhibitoren bei basis of ALS inhibitor resistance in the grass weed Alopecurus
Alopecurus myosuroides Huds. Aufklrung der Mechanis- myosuroides. Weed Res. 48, 439-447.
men in ausgewhlten Biotypen. Mitt. Biol. Bundesanst. MENNE, H., 2009: Bayer CropScience, personal communica-
Land-Forstwirtsch. 400, 248. tion.
DELYE, C., Y. MENCHARI, J.P. GUILLEMIN, A. MATEJICEK, S. MICHEL, PETERSEN, J., J.M. NESER, M. DRESBACH-RUNKEL, 2008: Resistant
C. CAMILLERI, B. CHAUVEL, 2007: Status of black grass (Alope- factors of target-site and metabolic resistant black-grass
curus myosuroides) resistance to acetyl-coenzyme A carbox- (Alopecurus myosuroides Huds.) biotypes against different
ylase inhibitors in France. Weed Res. 47, 95-102. ACCase-inhibitors. J. Plant Dis. Protect. Spec. Issue 21,
DELYE, C., 2005: Weed resistance to acetyl coenzyme A carbox- 25-29.
ylase inhibitors: an update. Weed Sci. 53, 728-746. PFENDER, W., R. GRAWS, W. BRADLEY, M. CARNEY, L. MAXWELL,
DELYE, C., A. MATEJICEK, S. MICHEL, 2008: Cross-resistance 2007: Emission rates, survival, and modelled dispersal of
patterns to ACCase-inhibiting herbicides conferred by mu- viable pollen of creeping bentgrass. Crop Sci. 47, 2529-2538.
tant ACCase isoforms in Alopecurus myosuriodes Huds. ROGNLI, O.A., N. NILSSON, M. NURMINIEM, 2000: Effects of dis-
(black-grass), re-examined at the recommend herbicide field tance and pollen competition on gene flow in the wind pol-
rate. Pestic. Manage. Sci. 64, 1179-1186. linated grass Festuca pratensis Huds. Heredity 85, 550-560.
HEAP, I., 2008: International Survey of Herbicide Resistant STALLINGS, G.P., D.C. THILL, C.A. MALLORY-SMITH, B. SHAFH, 1995:
Weeds. [Online]. Available: http://www.weedscience.com Pollen-Mediated gene flow of sulfonylurea-resistant Kochia
[12 January 2009]. (Kochia scoparia). Weed Sci. 43, 95-102.
JASIENIUK, M., A.L. BRULE-BABEL, I.N. MORRISON, 1996: The evo- VOLENBERG, D.S., D.E. STOLTENBERG, 2002: Giant foxtail (Setari
lution and genetics of herbicide resistance in weeds. Weed faberi) outcrossing and inheritance of resistance to acetyl-co-
Sci. 44, 176-193. enzyme A carboxylase inhibitors. Weed Sci. 50, 622-627.
LETOUZE, A., J. GASQUEZ, 2000: A pollen test to detect ACCase WILKINSON, M.J., A.M. TIMMONS, Y. CHARTERS, S. DUBBELS, A.
target-site resistance within Alopecurus myosuroides popula- ROBERTSON, N. WILSON, S. SCOTT, E. OBRIEN, H.W. LAWSON,
tions. Weed Res. 40, 151-162. 1995: Problems of risk assessment with genetically modified
MENCHARI, Y., B. CHAUVEL, H. DARMENCY, C. DELYE, 2008: Fitness oilseed rape. Proc. Brighton Crop Prot. Conf. Weeds 3,
costs associated with three mutant acetyl-coenzyme A car- 1035-1044.

J.Plant Dis.Protect. 3/2010

The author has requested enhancement of the downloaded file. All in-text references underlined in blue are linked to publications on ResearchGate.