Journal of Dairy Research- (2008) 75 107–112.

f Proprietors of Journal of Dairy Research 2008 107

doi:10.1017/S0022029907003020 First published online 29 January 2008 Printed in the United Kingdom

A novel method for species identification in milk

and milk-based products
Silvia Reale*1,2, Angela Campanella1, Amalia Merigioli2 and Fabio Pilla1
1
Dipartimento S.A.V.A., Università del Molise, Via de Sanctis snc 86100 Campobasso, Italy
2
Parco Scientifico e Tecnologico del Molise ‘‘ Moliseinnovazione ’’ S.C.a r.l., Via de Sanctis snc 86100 Campobasso, Italy

Received 13 March 2007 and accepted for publication 30 October 2007

This study describes a method for species-specific detection of animal DNA from different
species (cattle, sheep, goat, water buffalo) in milk and dairy products. A primer set was designed
in conserved region on the basis of the alignment of the sequence codifying the genomic
k-casein gene in order to amplify all four species with a single primer pair. Polymorphisms were
detected via minisequencing with extension primers designed in conserved sequences for
haplotype determination that allow unambiguous assignment to each species. The method was
successfully applied to the detection of raw and pasteurized milk from the four different species
considered as well as to cheese products from the retail trade. Estimation of the limit of
detection was carried out using a progression of dilutions of genomic DNA as well as DNA
isolated from milk of a known number of somatic cells from different species in order to be able
to achieve detection rates as low as 0.1% bovine milk mixed with buffalo milk.

Keywords: Species identification, food traceability, milk.

Identification of the species of origin of the milk used in
cheese has a particular importance because of the possi-
bility of detecting fraudulent procedures. These facts are of
concern particularly in relation to authenticity and label-
ling regulations which require accurate declaration of
product compounds, adulterations, and adverse reactions
(allergies) towards some milk proteins.
Until now, various analytical approaches have been used
for this purpose : isoelectric focusing (Addeo et al. 1990 ;
Moio et al. 1990), HPLC (Mayer et al. 1997; Moatsou et al.
2004), ELISA (Beer et al. 1996; Hurley et al. 2004) and
capillary electrophoresis (Recio et al. 2004). Serological
tests are specific and sensitive, but cross-reaction of closely
related species cannot be ruled out. Additionally, protein-
based methods may fail because of the excessive proteolysis
induced by high temperature treatments. More recently,
DNA-based techniques have received particular attention.
Lipkin et al. (1993) have demonstrated that it is possible to
use milk as a source of DNA and a substrate for polymerase
chain reaction (PCR). Milk from health mammary glands
contains a large number of somatic cells (leukocytes and
epithelial mammary cells) which persist during cheese
manufacturing and ripening. Thus, residual DNA from
nucleated somatic cells of milk or milk-derived products is
*For correspondence; e-mail : reale@unimol.it
exploited to identify unequivocally the nature of the prod-
uct. Early approaches to identify components within mixed
sample involve the detection of species-specific DNA se-
quences via PCR. At the present, most of the DNA-based
studies for species identification in milk-derived products
are based on specific PCR amplification of mitochondrial
DNA (Bania et al. 2001 ; Maudet et al. 2001; Rea et al. 2001;
Bottero et al. 2002, 2003; Mafra et al. 2004). To date, the
DNA-based tests for species identification do not rely on a
single assay. The tendency is to use multiplex amplifications
to perform simultaneous identification of different species
as proposed by Matsunaga et al. (1999), Rea et al. (2001) and
Bottero et al. (2003). However, the more fragments involved
in the multiplexes, the greater the number of problems likely
to occur not only in terms of amplification competition
and false positives, but the band interpretation and reading
of gel-based assays is also more difficult. Furthermore,
selective amplification assays are not easily automated, and,
since they are based on mt-DNA, further developments of
DNA quantification tests are not reliable, since the number
of mitochondrion for each cell is variable.
The objective of the present study was to solve the
aforesaid problems by developing a reliable, fast and sen-
sitive single test based on nuclear DNA, to be used for
species discrimination in all the main species (cow, water
buffalo, sheep and goat) involved in milk and milk-derived
products.
108 S Reale and others

Table 1. List of 57 samples analysed in the study and profiles Table 1. (Cont.)
obtained. The code in the column labelled ‘ Declared origin’ is Declared
OV = Ovis aries, CA = Capra hircus, BO = Bos taurus, BU = No. origin Breed/type Profile result
Bubalus bubalis. Breed/type refers to breed of animal or the type
of dairy product tested. Blood samples were used to test the Milk samples
method, cheese and milk samples to verify the quantitative 46 OV Milk Sheep
applicability of the test 47 OV Milk Sheep
48 OV Milk Sheep
Declared 49 CA Milk Goat
No. origin Breed/type Profile result 50 CA Milk Goat
Sheep blood samples 51 CA Milk Goat
1 OV Gentile di Puglia Sheep 52 BO Milk Cow
2 OV Gentile di Puglia Sheep 53 BO Milk Cow
3 OV Altamurana Sheep 54 BO Milk Cow
4 OV Altamurana Sheep 55 BU Milk Buffalo
5 OV Laticauda Sheep 56 BU Milk Buffalo
6 OV Laticauda Sheep 57 BU Milk Buffalo
7 OV Comisana Sheep 1
Sample 39 was declared as buffalo Mozzarella cheese but was found to
8 OV Comisana Sheep contain a mixture of buffalo and cow milk. The profiles of all other sam-
9 OV Leccese Sheep ples were as expected
Goat blood samples
10 CA Girgentana Goat
11 CA Girgentana Goat
12 CA Maltese Goat Materials and Methods
13 CA Maltese Goat Samples
14 CA Derivata di Siria Goat
15 CA Derivata di Siria Goat DNA used as the authentic standard was isolated from
16 CA Grigia Molisana Goat blood samples of different breeds from the following
17 CA Grigia Molisana Goat animal species : cow, buffalo, goat and sheep. DNA was
18 CA Saanen Goat also isolated from fresh bulk milk obtained from local
19 CA Camosciata Goat farmers. Five mozzarella cheeses labelled PDO (Protected
20 CA Garganica Goat Designation of Origin) ‘Mozzarella di bufala campana
21 CA Sarda Goat
DOP ’ and cheese samples made from cows’, ewes’, goats’
22 CA Teramana Goat
and buffalos’ milk were analysed. All samples used in the
Cow blood samples study are listed in Table 1.
23 BO Podolica Cow
In order to evaluate the LOD (Limit of Detection) of the
24 BO Frisona Cow
25 BO Frisona Cow
method, a progression of dilutions were prepared using
26 BO Romagnola Cow a mixture of DNA belonging to the different individual
27 BO Maremmana Cow species. First, genomic DNA from a cow was mixed with
28 BO Pezzata rossa Cow water buffalo DNA to obtain the following proport-
29 BO Piemontese Cow ions : 50–50%, 75–25 %, 82.5–17.5 %, 93.75–6.25 %,
30 BO Marchigiana Cow 96.87–3.13 %, 98.43–1.57 %, 99.21–0.79 % and vice
31 BO Chianina Cow versa. Furthermore, DNA from different quantities of
Buffalo blood samples raw milk from cows and buffalos with a known number
32 BU Mediteranean Buffalo of cells per ml, were mixed and analysed in order to obtain
33 BU Mediteranean Buffalo a : 0.1, 0.3, 0.5, 1, 2 and 3% ratio of cells of one species
34 BU Mediteranean Buffalo to the other. For each sample, before mixing, the Somatic
35 BU Mediteranean Buffalo Cell Count (SCC) was determined using the optofluori-
Cheese samples metric detection method with a Fossomatic 5000 (Foss,
36 BU Mozzarella Cheese PDO Buffalo Denmark). Each mixture from which DNA has been iso-
37 BU Mozzarella Cheese PDO Buffalo lated, was prepared to a final volume of 20 ml and 200,000
38 BU Mozzarella Cheese PDO Buffalo
cells/ml.
39 BU Mozzarella Cheese PDO Buffalo & Cow1
40 BU Mozzarella Cheese PDO Buffalo
41 BO Fresh Cheese Cow DNA extraction
42 OV/BO mix Cheese Sheep/Cow
43 OV/BO mix Caciotta Cheese Sheep/Cow DNA for reference standard was extracted from 250 ml
44 OV Cheese Sheep blood samples of different breeds of the four species
45 CA Cheese Goat considered in the study according to the Sambrook (1989)
Protocol.
 Method for species identification in milk and cheese 109

Table 2. Primers used in the study. Amplification primers were used to amplify the target fragment for all the four species under
study, extension primers were used to perform the minisequence of the three SNPs which allow the species discrimination. SNP
position indicates the position of the SNP in the fragment
Primer name Sequence (5kp3k) Fragment lenght/ SNP Position Type
F1 CAGTTAGGTCACCTGCCCAAA 164 bp amplification primers
R1 AGGGATTTCTGTTTTATCCTGAT
BUB-R1 AAAAAATAAATGTGGGTGTGGGTGACGTG 48 extension primer
OVI-F1 AAAAAAAAAATCTTCAATGGCAAGTTTTGCCAAT 90 extension primer
BB/CO-R1 AGGGATTTCTGTTTTATCCTGAT 141 extension primer

OV/CA-BO-BU

BU/CA-OV-BO

CA-OV/BO-BU

Fig. 1. Multiple sequence alignment of exon 4 k casein fragment amplified from each species. Large (large or bold type) empty arrows
indicates amplification primers, narrow black arrows show extension primers, whereas the three polymorphisms analysed are
indicated by oval circles.

DNA was isolated from milk and cheese using the
DNeasyTM Tissue Kit (Quiagen) with some modifications.
MILK: 20 ml Phosphate Buffered Saline (PBS) were ad-
ded to 20 ml fresh milk and centrifuged at 1000 g, at 4 8C
for 10 min. In order to eliminate fat residues, additional
washing was performed by adding 10 ml PBS to the re-
sulting cell pellet and centrifuging. The obtained pellet
was re-suspended in 220 ml PBS and purified based on the
manufacturer’s instructions until clean DNA was obtained.
CHEESE: 4 g cheese cut in small strips were added to
10 ml extraction buffer (50 mM-Tris-HCl, 20 mM-HCl,
1 mM-EDTA, 10 g SDS/l and 400 mg Proteinase K) and in-
cubated in a water bath at 55 8C for 1 h and at 70 8C for
10 min. The subsequent purification steps were performed
as described in the manufacturer’s instruction manual.
The DNA concentration in all the samples was evalu-
ated by gel electrophoresis.
Primer Design
After a search in the NCBI database (www.ncbi.nlm.nih.
gov) for gene sequences with a high level of homology
among species, the k-casein gene was selected. Amplific-
ation primers were designed in exon 4 regions with 100%
homology among the most important species in milk pro-
duction considered in the study (cow, water buffalo, sheep
and goat), obtaining a 164 bp fragment, which is easy to
amplify even from DNA isolated from heat-treated and
processed food that can be degraded. Three conserved
interspecific SNPs (single nucleotide polymorphism),
whose allele combination generates haplotype that pro-
vides the unambiguous determination of each species,
were located in the amplified fragment at position 48, 90
and 141. Extension primers were designed in region with a
high percentage of homology among the different species.
Different length polyA tail were added to the 5’ ends to
enable them to be used for minisequencing multiplex
testing. Two out of three extension primers were designed
in 100 % homology regions, for the third the homology is
not complete. Primer sequences and the overview of ex-
perimental design are shown in Table 2 and Figure 1.
In Table 3 SNPs expected halotype pattern for each
species is shown.
PCR
PCR reactions were performed in a total volume of 10 ml
containing 20 ng DNA, 0.5 U AmpliTaq GoldÕ DNA
110 S Reale and others

Table 3. Three SNPs haplotype pattern for each species. This

30 40
scheme is useful for species attribution to each profile obtained
Ovis aries
SNPs
C
BU-BO/ BU/CA- OV/CA- CG
Species CA-OV OV-BO BO-BU
Ovis aries C C G
Capra hircus C C A
Bos taurus T C A Capra hircus A
Bubalus bubalis T T A C
C
Polymerase (Applied Biosystems, Foster City, CA) and
200 mM dNTPs, 1X PCR buffer, 2 mM-MgCl2, 0.3 mm of
each primer (Table 2) synthesised by Sigma Genosys
(Haverhill, UK) in a Mastercycler gradient (Eppendorf Bos taurus
AG, Hamburg, Germany) under the following conditions :
T
initial denaturation at 94 8C for 5 min, touch down of 6 A
cycles at 94 8C for 20 s, 60 8C for 30 s (– 1 8C for each C
cycle), 72 8C for 1 min, followed by 30 cycles at 94 8C for
20 s, 55 8C for 30 s and 72 8C for 1 min, and a final ex-
tension at 72 8C for 5 min. PCR products were visualised
Bubalus bubalis
by 2 % agarose gel electrophoresis in 0.5X TBE buffer
and with a BioPhotometer (Eppendorf AG, Hamburg, T T
Germany).
A

Single nucleotide primer extension

Amplification products were purified from primers and
dNTPs residues through Exo-SAP treatment. A total volume
of 10 ml containing 5 ml PCR product, 5 U Exonuclease I
which degrades single-stranded DNA in a 3k = > 5k direc-
tion (New England BioLabs, Hertfordshire, UK), 1X Buffer
Exo and 1 U SAP (Shrimp Alkaline Phosphatase, Promega,
Madison, WI) were incubated for 1 h at 37 8C and for
15 min at 75 8C to inactivate the enzyme. The extension
primers (Table 2) were designed in regions with 100%
homology within the four species considered with the 3’
terminal end, one base before polymorphism. For the pri-
mer extension reaction the following mix was used : 1 ml
purified PCR product, 1.2 mm of each extension primer
and 1.25 ml ABI PrismÕ SNaPshotTM Multiplex System
SNaPshot premix (Applied Biosystem) in a total volume of
5 ml. The reaction contains ddNTPs only, which ensures
that the DNA polymerase adds no more than a single nu-
cleotide to a primer. The following conditions were ap-
plied: 25 cycles at 96 8C for 10 s, 50 8C for 5 s and 60 8C
for 10 s and 4 8C for 10 s, according to the manufacturers
instructions.
Reaction products were purified by adding 0.5 ml
0 1 U/ml SAP and 0.5 ml Buffer SAP. The cycling conditions
. expected size and the minisequence analysis revealed the
were: 37 8C for 1 h and 75 8C for 15 min. Purified pro-
ducts (1–2 ml) were added to 0.5 ml LIZ 120 internal standard
(Applied Biosystems) and 7.5–8.5 ml Hi-Dye formamide
(Applied Biosystems). The mixtures were denatured at
95 8C for 5 min prior to loading on a capillary electro-
phoresis automatic sequencer ABI Prism 310 (Applied
Biosystems) to detect the kind of nucleotide added to each
Fig. 2. Example of the three discriminating SNPs ‘‘ SNaPshot
peaks ’’ obtained for each species.
primer, thus the type of mutation revealed, using POP-4
separation polymer at standard running conditions.
GeneMapper Software Version 4.0 was used to analyse
raw data and determine peak sizes.
Results and Discussion
Two out of three extension primers are designed in 100%
homology regions, for the third, the homology is not
complete, but this does not affect its activity efficiency
(Figs 1 & 2). Tests were carried out on 35 genomic DNA
isolated from blood samples of cow, water buffalo, sheep
and goat (Table 1) drawn from different breeds, in order to
verify the specificity of primer pair amplification and the
polymorphism conservativity among breeds of each spe-
cies. All samples produced specific PCR fragments of the
expected haplotype for each species.
Amplicon length was restricted to 164 bp in order to
enhance chances of amplification of DNA isolated from
heat-treated and processed food that can be degraded. So
far, mt-DNA has been the nucleic acid of choice in species
identification assays because the greater number of
mt-DNA copies per cell compared with nuclear DNA
 Method for species identification in milk and cheese
improves the success and the yield of DNA extraction. In
fact, there can be more than one mitochondrion per cell
and several copies of mt-DNA per mitochondrion. But
only considering mononuclear genomic DNA the pro-
portion of alleles reflects the amount of DNA present in
the sample, hence it can be used in quantitative tests. In
order to make progress in quantitative assays, genomic
DNA has been chosen for our method, and drawbacks
regarding low yield in DNA extraction have been over-
come with the efficient extraction method and the small
amplicon to amplify.
The sensitivity of the method estimating LOD, defined
as the smallest concentration of somatic cells detectable as
their concentration approaches zero, was determined.
Particularly, in our study the LOD describes the smallest
concentration of somatic cells of one species detectable in
a mixture. An analysis was performed using dilutions of
genomic DNA from cow and buffalo, the lowest percent-
age of cow in buffalo DNA obtained was 0.79 %, thus
encouraging us to perform further experiment using milk.
Only two out of four species were considered in this ex-
periment since DNA extraction protocol from milk has
already been tested successfully on all the species and
species provenience does not affect cell quality. DNA was
then isolated from the milk of the two species mixed as a
function of the number of somatic cells in order to obtain
the desired ratio of each species. The method demon-
strated detection sensitivity as low as 0.1 % bovine milk
mixed with buffalo milk, but it was not able to detect
0.1 % buffalo milk mixed with 99.9 % cows’ milk. Other
species combination were not tested, assuming that the
method is transposable to other DNAs. SCC via opto-
fluorimetric method may not have been completely accu-
rate, thus leading to an alteration of the desired
proportions. In both cases, however, it was possible to
detect minor alleles in ‘ 0.3 % cells’ samples. This data
provides the order of magnitude of the LOD, which in-
dicates that this method may be described as very sensitive
considering that the official methods being used in the EU
(Commission Regulation No. 213/01 of 9 January, 2001)
and in Italy (Decree of the Italian Minister of Agricultural,
Food and Forestry Resources, 1996), based respectively on
isoelectrofocusing of c-casein after plasminolysis (Addeo
et al. 1989) and on HPLC (Pellegrino et al. 1991), have a
detection limit of 1% and so it is the limit of toleration for
involuntary cross-contamination during the cheese-making
process (Commission Regulation No. 213/01 of 9 January,
2001). Previously, Plath et al. (1997) detected 0.5 % cow’s
milk in cheese made from ewe’s and goat’s milk, the
methods of Feligini (2005) and Mafra et al. (2004) based
on mitochondrial DNA have a detection limits of 0.1 %
and 0.5 %, respectively.
The method has been tested with both processed and
unprocessed food. Twelve samples of raw milk from local
farmers, three from each of the four species considered,
were analysed: all results obtained were coherent with
haplotype expectations. Cheese samples labelled ‘ pure’
111
BU 75 %-BO 25%
Size
T standard
peak
C
BU 82,5 %-BO 12,5%
T Size
standard
peak
C
BU 93,55%-BO 6,45%
T Size
standard
peak
C
Fig. 3. Example of haplotype for DNA quantitation. As a result
of minisequencing with primer BUB-R1, two peaks were
obtained (except the size standard one) one belonging to cow,
the other one to bubalus. The ratio between the height of one
peak and the sum of the height of both peaks, allows to estimate
the percentage of one species in the sample analysed.
or ‘mixed ’, purchased from Italian supermarkets, were
analysed to evaluate the applicability of the test to dairy
products from the retail trade.
In all PDO-labelled Mozzarella di bufala campana
DOP samples analysed (Fig. 3), a buffalo profile was
found, but one (sample CH5) revealed both cow and
buffalo profiles. The calculation was made on the basis of
the relative fluorescences obtained from minisequencing
from the cow and buffalo alleles, computing the cow’s
peak height on the sum of the heights of the two peaks,
allowed an estimate the ratio of samples in CH5 to be
10 % of cows’ milk in buffalos’ milk. In this case, the
presence of 10 % of cow’s milk suggests a fraud. But lower
quantity which give no economic advantage are unlikely
to be adulteration (less than 1 %, the limit of toleration for
involuntary cross-contamination, as mentioned above) and
may be a consequence of using, in sequence, the same
112 S Reale and others
production lines for different products, which occurs fre-
quently in cheese plants in southern Italy (Bottero et al.
2002).
Thus, the minisequencing method which shows a
correlation between allelic frequency and relative fluor-
escence (Lee et al. personal communication), would be
suitable for a quantitative detection of the proportion of
two alleles within a sample. However, the calculation has
to be made with the assumption that cow and buffalo
milks mixed, were similar in number of cells/ml. The
technique employed, can be used more reliably for the
measurement of alleles when the DNA source is meat or
meat-derived products rather than milk or cheese. Meat, in
fact, is made up of cells which generally contain a single
copy of the whole nuclear genome representative of the
individual, and therefore of the species to which it be-
longs. The proportion of alleles found by using this test
reflects the amount of meat present in the sample. Thus,
the assay can also be applied to species detection in an-
imal feed.
In conclusion, in this study we propose a new, fast and
sensitive method able to detect the species composition of
raw or processed milk and cheese from a variety of breeds
of cow, buffalo, goat and sheep. To our knowledge, this is
the first time that a method allowing simultaneous identi-
fication of the main species involved in milk production
has been utilized. A test as sensitive as the one described
here, better helps to label milks as single or double species
and would guarantee species purity to consumers wishing
to avoid certain milks, perhaps because of allergic reac-
tion. In addition, the employment of nuclear DNA and
SNPs, which may be used on an industrial scale in cost
effective and high throughput assays, constitutes another
step forward in the quantitative approach. The methods
can be useful for anti-fraud institutions monitoring as
well as for the food industry to control their productive
standards.
References
Addeo F, Moio L, Chianese C, Stingo C, Resini P, Berner I, Krause I, Di
Luccia A & Bocca A 1990 Use of plasmin to increase the sensitivity of
the detection of bovine milk in ovine cheese by gel isoelectric focusing
of caseins. Milchwissenschaft 5 708–711
Bania J, Ugorski M, Polanowski A & Adamczyk E 2001 Application of
polymerase chain reaction for detection of goats’ milk adulteration by
milk of cow. Journal of Dairy Research 68 333–336
Beer M, Krause I, Stapf M, Schwarzer C & Klostermeyer H 1996
Indirect competitive enzyme-linked immunosorbent assay for the de-
tection of native and heat-denatured bovine b-lactoglobulin in ewes’
and goats’ milk cheese. European Food Research and Technology 203
21–26
Bottero MT, Civera T, Anastasio A, Turi RM & Rosati S 2002 Identification
of cows’s milk in ‘‘buffalo ’’ cheese by duplex polymerase chain re-
action. Journal of Food Protection 65 362–366
Bottero MT, Civera T, Nucera D, Rosati S, Sacchi P & Turi RM 2003 A
multiplex polymerase chain reaction for the identification of cows’,
goats’ and sheep’s milk in dairy products. International Dairy Journal
13 277–282
Commission Regulation (E.C.) No. 213/01 of 9 January, 2001 lying down
detailed rules for the application of Council Regulation (E.C.) No.
1255/1999 as regards methods for the analysis and quality evaluation
of milk and milk products and amending Regulations (E.C.) No. 2771/
1999 and (E.C.) No. 2799/1999. Official Journal of the European
Communities, L037: 1–99
Feligini M, Ionizzi I, Curik VC, Parma P, Greppi GF & Enne G 2005
Detection of Adulteration in Mozzarella Cheese. Food Technology and
Biotechnology. 43 91–95
Gazzetta Ufficiale della Repubblica Italiana (10 April, 1996) Decree of
the Italian Minister of Agricultural, Food and Forestry Resources.
Official Journal of the Italian Republic, 135 (11 June, 1996).
Hurley P, Coleman RC, Ireland HE & Williams JHH 2004 Measurement of
Bovine IgG by Indirect Competitive ELISA as a Means of Detecting
Milk Adulteration. Journal of Dairy Science 87 543–549
Lipkin E, Shalom A, Khatib H, Soller M & Friedmann A 1993 Milk as a
source of deoxyribonucleic acid and substrate for the polymerase
chain reaction. Journal of Dairy Science 76 2025–2032
Mafra I, Ferreira I, Faria MA & Oliveira BPP 2004 A Novel Approach to
the Quantification of Bovine Milk in Ovine Cheeses Using a Duplex
Polymerase Chain Reaction Method. Journal of Agricultural Food
Chemistry 52 4943–4947
Matsunaga T, Chikuni K, Tanabe B, Muroya B, Shibata K, Yamada J &
Shinmura Y 1999 A quick and simple method for the identification of
meat species and meat products by PCR assay. Meat Science 51
143–148
Maudet C & Taberlet P 2001 Detection of cow’s milk in goat’s cheeses
inferred from mitochondrial DNA polymorphism. Journal of Dairy
Research 68 229–235
Mayer HK, Heidler D & Rockenbauer C 1997 Determination of the
Percentages of Cows’, Ewes’ and Goats’ Milk in Cheese by Isoelectric
Focusing and Cation-exchange HPLC of c- and Para-k-Caseins.
International Dairy Journal 7 619–628
Moatsou G, Hatzinaki A, Psathas G & Anifantakis E 2004 Detection of
caprine casein in ovine Halloumi cheese. International Dairy Journal 3
219–226
Moio L, Sasso ML, Chianese L & Addeo F 1990 Rapid detection of bovine
milk in ovine, caprine and water buffalo milk or cheese by gel iso-
electric focusing on phastsystem. Italian Journal of Food Science 3
185–190
Pellegrino L, De Noni I, Tirelli A & Resmini P 1991 Detection of cow milk
in non-bovine cheese by HPLC of whey proteins. Scienze e.
Tecnologie Lattiero Casearie 42 87
Plath A, Krause I & Einspanier R 1997 Species identification in dairy
products by three different DNA-based techniques. Zeitschrift für
Lebensmitteluntersuchung und -Forschung 205 437–441
Recio I, Garcı́a-Risco MR, Amigo L, Molina E, Ramos M & Martı́n-Álvarez
PJ 2004 Detection of Milk Mixtures in Halloumi Cheese. Journal of
Dairy Science 87 1595–1600
Rea S, Chikuni K, Branciari R, Sangamaya RS, Ranucci D & Avellini P
2001 Use of duplex polymerase chain reaction (duplex-PCR)
technique to identify bovine and water buffalo milk used in making
mozzarella cheese. Journal of Dairy Research 68 689–698