Vous êtes sur la page 1sur 2

Breagitta Dwi Yuniarto

230110140009
Perikanan a

LOCUS JF310708 843 bp mRNA linear VRT 27-FEB-


2011
DEFINITION Osphronemus goramy growth hormone mRNA, complete cds.
ACCESSION JF310708
VERSION JF310708.1 GI:323695734
KEYWORDS .
SOURCE Osphronemus goramy (giant gourami)
ORGANISM Osphronemus goramy
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Actinopterygii; Neopterygii; Teleostei; Neoteleostei;
Acanthomorphata; Anabantaria; Anabantiformes; Anabantoidei;
Osphronemidae; Osphronemus.
REFERENCE 1 (bases 1 to 843)
AUTHORS Nugroho,E., Kristanto,A.H., Alimuddin and Carman,O.
TITLE Direct Submission
JOURNAL Submitted (08-FEB-2011) Departement of Aquaculture, Bogor
Agricultural University, Jl. Lingkar Akademik, Bogor, West Java
16680, Indonesia
FEATURES Location/Qualifiers
source 1..843
/organism="Osphronemus goramy"
/mol_type="mRNA"
/db_xref="taxon:270604"
/tissue_type="pituitary gland"
/PCR_primers="fwd_name: ggGH-F, fwd_seq:
gtatctgatttcacaaccgctatggac, rev_name: AP2, rev_seq:
ctatagggcacgcgtggt"
CDS 16..630
/codon_start=1
/product="growth hormone"
/protein_id="ADX99496.1"
/db_xref="GI:323695735"

/translation="MDKVVFLLSVLSVGVSSQPITDSQRLFSIAVSRVQHLHLLAQRL

FSDFESSLQTEEQRQLNKIFLQDFCNSDYIISPIDKHETQRSSVLKLLSISYRLIESW

EFPSRSLYGGSAQRYQISPKLSELMRGIQLLIKANQDGAEMFSDGVVPQLAPYGNYYQ
SLGDDESLRRSYELLACFKKDMHKVETYLTVAKCRLSPEANCTL"
ORIGIN
1 gatttcacaa ccgctatgga caaagttgtg ttcctgctgt ctgtcctgtc tgtgggcgtc
61 tcctctcagc caatcacaga cagccagcgt ctcttctcca tcgccgtgag cagagtccaa
121 cacctgcacc tgctcgccca gagactcttc tccgacttcg agagctcttt gcagactgag
181 gagcagcgtc aactcaacaa aatcttcctg caggattttt gtaactcaga ttacatcatc
241 agccctatcg acaagcacga gacccagcgc agctctgtgc tgaagctgtt atcgatctct
301 tatcggctga tcgagtcctg ggagttcccc agccggtctc tgtatggagg ttctgctcaa
361 agataccaga tttctcccaa actgtcggag ctgatgcgag gaatccagct gctgatcaag
421 gccaatcagg atggagcaga gatgttctct gacggcgtgg ttccgcagct cgctccgtac
481 ggaaactact accagagtct gggagatgac gagtcgctga gacgcagcta tgaactgctg
541 gcctgcttca aaaaggacat gcacaaggtg gagacgtacc tgactgtggc taaatgccga
601 ctctctccag aagctaactg cactctgtag cccccccatc tggacaatga catcatcgtg
661 tttgttctat agccctgttc tttactctgt gaactagcat tagcaatagc attagcctct
721 ttctggtggt tttttgttgc aggttgaaca caaagtgatg tcacactgtc agtacatgaa
781 ataaagtttg tttgattctg aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa
841 aaa