Vous êtes sur la page 1sur 124

Instituto Nacional de Pesquisas da Amaznia - INPA

Programa de Ps-Graduao em Entomologia - PPG-ENT

Taxonomia de Macronema Pictet (Insecta: Trichoptera:


Hydropsychidae) e associao de larvas e adultos por meio de COI

Thyago Augusto da Silva Vidovix

Manaus, Abril de 2013


Instituto Nacional de Pesquisas da Amaznia INPA
Programa de Ps-Graduao em Entomologia - PPG-ENT

Taxonomia de Macronema Pictet (Insecta: Trichoptera:


Hydropsychidae) e associao de larvas e adultos por meio de COI

Aluno: Thyago Augusto da Silva Vidovix


Orientadora: Dra. Ana Maria Oliveira Pes
Coorientadora: Dra. Janisete Gomes da Silva Miller

Dissertao de Mestrado, apresentada ao


conselho da PPGEnto, como parte dos requisitos
para obteno do ttulo de Mestre em Cincias
Biolgicas, rea de concentrao em
Entomologia.

Manaus, Abril de 2013

ii
Ficha Catalogrfica

AXXX Vidovix, Thyago Augusto da Silva

Taxonomia de larvas e adultos de Macronema Pictet (Insecta: Trichoptera: Hydropsychidae) em


igaraps de Floresta de terra firme, Amazonas, Brasil /Thyago Augusto da Silva Vidovix. --- Manaus:
[s.n.], 2013. f.: il. (algumas coloridas)

Dissertao (mestrado) -- INPA, Manaus, 2013


Orientadora: Dra. Ana Maria Oliveira Pes
Coorientadora: Dra. Janisete Gomes Silva Miller
rea de concentrao: Entomologia

1. Macronema Taxonomia 2. Associao 3. DNA Barcoding 4. Amaznia


CDD XXXXXXXXX

Sinopse:

Estudou-se a taxonomia das larvas e adultos das espcies do gnero Macronema


coletadas no estado do Amazonas, utilizando a combinao de caracteres
moleculares, DNA mitocondrial gene COI, com caracteres morfolgicos. Atravs
deste estudo, foi possvel associar larvas com adultos, fmeas com machos,
descrever 12 larvas, 3 pupas e 7 novas espcies para o gnero.

Palavras-chave: Insetos aquticos, DNA Barcoding, Floresta Amaznica, taxonomia


integrativa, biodiversidade.

iii
A cincia se torna fascinante
quando voc no fica s na
teoria.
Marcelo Gleiser

A imaginao mais importante


que a cincia, porque a cincia
limitada, ao passo que a
imaginao abrange o mundo
inteiro.
Albert Einstein

iv
Aos meus pais Odair Francisco Vidovix
e Euvanir da Silva Vidovix, a minha
irm Tatiani da Silva Vidovix, minha
sobrinha Pietra Vidovix. Vocs so a
minha inspirao, alegria e apoio.

v
Agradecimentos

Agradeo primeiramente aos meus pais, Euvanir da Silva Vidovix e Odair Francisco
Vidovix , por terem sempre me apoiado e acreditado nas minhas escolhas e nos meus estudos,
e principalmente na minha vinda para o Amazonas. Obrigado pais por estarem presentes
mesmo estando longe. Pai sempre lembrarei de voc e dos seus conselhos. A minha irm
Tatiani que sempre me aturou, que compartilha momentos incrveis da minha vida e que ajuda
nas minhas decises. A minha sobrinha Pietrinha, por colocar alegria no meu caminho, pelos
beijos adorveis na poca que estava etudando para o mestrado. Amo todos vocs, minha
famlia, minha base diamantada.
Aos meus tios Oscar e Vera que abriram suas portas no comeo da minha caminhada,
e sempre me aconselharam, aos tios Edivar e Marlene pelo apoio na minha formao em
Cincias Biolgicas e por acreditar no meu sonho, muitas saudades de vocs.
A Simone Halfen o grande amor da minha vida, que compartilha momentos a sete
anos, amiga dos momentos difceis e alegres, companheira, minha inspirao, meu
aconchego. Pela sua incrvel ajuda de todos os momentos, do nosso namoro a distncia
durante um ano. Agradeo muito meu amor, tudo o que voc j fez e faz por mim, agradeo
por ter te conhecido e ter te dado as mos, assim juntos possamos construir, planejar e realizar
nossos sonhos.
Aos professores da UEMS, pelas conversas enriquecedoras, obrigado pela ajuda e
pelos momentos incrveis de todas as coletas e momentos nos laboratrios. As professoras e
orientadoras da graduao, professora Iana A. D. Valle de Oliveira e a professora Dra. Valria
F. Batista da Silva, por me orientarem e ajudarem no comeo da minha carreira, acreditando
no meu sonho, correndo atrs e conquistando uma bolsa de iniciao cientfica. Todo o
pessoal dos laboratrios que compartilharam comigo momentos inesquecveis. A professora
Dra. Milza Abelha pelas incrveis conversas e ser uma excelente professora aumentando em
mim a vontade de ser um professor acadmico e cientista.
A todos os meus amigos da graduao, Anderson, Dhonatan, Alessandro, Daiane,
Diovani, Marilene, Gisa, Fernando, Adriano, Dani, Cristina, Cristiane, Bianca, dentre muitos
outros que me ajudaram a construir um passado to bonito e inesquecvel. Ao Ederlon e
Rafael e a todos que moraram comigo no comeo da minha vida em Manaus, Thiago, Diego e
Amauri, que proporcionaram timas lembranas.

vi
Ao professor Adolfo Calor que possibilitou meu estgio no seu laboratrio em
Ribeiro preto no perodo da graduao, pela fora quando eu no passei na prova do
mestrado da UFBA e por sempre compartilhar conhecimento.
Agradeo a minha orientadora Dra. Ana Pes pela ajuda desde a graduao tirando
minhas dvidas e compartilhando artigos, por compartilhar momentos no laboratrios e nas
coletas, por aturar minhas piadas e meu jeito de ser, por abrir as portas do seu laboratrio
possibilitando a minha jornada com os tricpteros, estes incrveis insetos quaticos. A minha
coorientadora Dra. Janisete Miller por me ajudar na prtica e terica da parte molecular.
A Dra. Neusa Hamada, pela infraestrutura do laboratrio e das coletas, por todo o
suporte disponibilizado, pela ajuda e dicas, por ser um exemplo profissional da rea de
sistematica, ecologia e gentica de insetos aquticos. Agradeo tambm a dupla dinmica
Jefferson e Ccero, pela ajuda logstica e suporte nas coletas, onde dvamos muitas risadas
dos imprevistos e das estrias engraadas.
As doutoras Vivian Dutra e a Vanderly Andrade de Souza que me ajudaram muito na
teoria e prticas moleculares. A todo o pessoal do laboratrio de insetos aquticos Ulisses,
Paulo, Vvian, Karina, Nayra, Tohnson, Cludio Jr., Gisele, Cludio Neto, Luciana, Renato,
Higor, Galileu, Kak obrigado pela ajuda.
A turma de mestrado 2011-2013 da Entomologia do INPA, por nossos momentos
alegres e tristes desde quando nos conhecemos na disciplina ministrada na Reserva Ducke.
Aos grandes colegas da entomologia que eu fiz Val, Vito, Gacho (Gaudrio da
entomologia), Rodrigo, Cinta e Edigar (os entomlogos mais baianos que conheo) Josenir,
Mery por todas as risadas e companheirismo compartilhados.
Aos companheiros de laboratrios: Rafita por ser alm de tudo um grande amigo, pela
ajuda nas idias e discusses cientficas. A Bianca pela sua amizade, alegria, preocupao e
por compartilhar os momentos. A Paula por me aguentar tanto tempo enchendo sua pacincia
e pela amizade e ao Lucas o entomlogo mais Goiano e facebuqueiro que conheo.
Aos professores Dr. Carlos G. Nunes da Silva, Dr. Sergio Luiz Luz e a Dra. Gislene A.
de Carvalho Zilse, por terem aceitado a participar da minha aula de qualificao, dando
sugestes construtivas ao meu projeto. Aos membros do Conselho de Curso, onde adquiri
conhecimentos importantes por um ano, conhecendo um pouco mais do mundo administrativo
da entomologia. Tambm a Lenir, que sempre me ajudou antes mesmo de eu entrar no
mestrado. Agradeo tambm a todos os professores da entomologia e aqueles de outros
estados que vem ministrar disciplinas aqui no INPA, por compartilharem seus conhecimentos

vii
e suas experincias. Ao Chiquinho pelo seu grande conhecimento tcnico ajudando assim a
tirar muitas dvidas, pela parte logstica e muitas brincadeiras e histrias divertidas.
O projeto foi desenvolvido com recursos e infra estrutura provenientes dos seguintes
projetos: Taxonomia e Biologia de Trichoptera (Insecta) na Amaznia Central - CNPq
processo: 558776/2008-6; Insetos Aquticos: Biodiversidade, Ferramentas Ambientais e a
Popularizao da Cincia para Melhoria da Qualidade de Vida Humana no Estado do
Amazonas - PRONEX/CNPq/FAPEAM; CAPES-Pr-Equipamentos, CNPq pela bolsa de
mestrado concedida, ao INPA pela viabilizao das coletas. Coletas foram realizadas com as
Licenas do SISBIO: 12482-1, 24303-1, 2403-2, 28811-1.

Muito obrigado a todos.

viii
Resumo
Apesar da famlia Hydropsychidae e do gnero Macronema possurem uma elevada tolerncia
a alteraes ambientais, a sua utilizao em programas de biomonitoramento de qualidade de
gua doce tem sido altamente impedida pela falta de larvas identificadas e ilustradas.
Ferramentas convencionais para associar larvas com adultos, geralmente so demoradas e
problemticas, assim uma tcnica rpida e segura proposta, integrando a morfologia com a
anlise molecular, principalmente do gene mitocondrial COI. Foram coletados adultos e
larvas em dois municpios Manaus, Presidente Figueiredo e Barcelos/AM, dos quais foram
identificados os adultos machos utilizando-se a genitlia e o padro de colorao das asas
anteriores e as larvas separadas em morftipos antes de submetidas anlise molecular. Dos
espcimes descritos e morfotipados, foi extrado o DNA e amplificado um fragmento do gene
mitocondrial Citocromo Oxidase subunidade 1 (COI) de 43 espcimes, os quais foram
sequenciados. A sequncia do grupo externo (da mesma regio mitocondrial) foi obtido no
GenBank e de exemplares do gnero Macrostemum ulmeri (Banks). As anlises filogenticas
foram realizadas utilizando-se os mtodos de Mxima Parcimnia (MP), Mxima
Verossimilhana (ML) e Neighbor-Joining (NJ) utilizando-se o modelo evolutivo Kimura-2-
Parmetros (K2P). Como resultado, oito espcies de larvas foram associadas com xito, seis
fmeas tambm foram associadas com os machos atravs do padro de colorao e anlise do
DNA. Foram descritas neste trabalho trs novas espcies para a cincia e quatro larvas no
associadas facilitando trabalhos futuros de associao. Este estudo pode ser til tambm para
relacionar macho e fmea, ajudar na identificao de espcies e revelar espcies crpticas, no
s do gnero Macronema, mas tambm abrangendo outros nveis taxonmicos.

ix
Abstract
Although the family Hydropsychidae and the genus Macronema have a high tolerance to
environmental changes, its use in freshwater biomonitoring programs has been greatly
hampered by the lack of identified and illustrated larvae. Conventional tools to associate
larvae with adults have generally been slow and problematic, so a faster and safer technique is
proposed, integrating morphology with molecular analysis. Integrative taxonomy is defined
by the integration of different types of analyzes, for example using morphological and
molecular characters available to delimit species. Adults and larvae were collected in two
municipalities, Manaus and Presidente Figueiredo/AM, which were identified using the adult
male genitalia and the staining pattern of the forewings, and the larvae classified in
morphotypes before the molecular analysis. DNA was extracted from the morphotyped
specimens and a fragment of the mitochondrial DNA gene cytochrome oxidase subunit 1
(COI) was amplified for 43 specimens, which were sequenced. The sequence from an
outgroup (from the same mitochondrial region) was obtained from GenBank. Phylogenetic
analyses were carried out using the methods of Maximum Parsimony (MP), Neighbor-Joining
(NJ) and Maximum Likelihood using the Kimura-2-parameters (K2P) model. As a result,
eight species of larvae were associated successfully, six females were also associated with the
males through the staining pattern and DNA analysis. Two new species to science and four
larvae not associated before were described in this study facilitating further the association
studies. This study may also be useful to associate male and female, to assist in species
identification and reveal cryptic species not just within the genus Macronema, but also
encompassing other taxonomic levels.

x
SUMRIO

1. Introduo .............................................................................................................................. 1
1.2. Aspectos gerais da ordem ................................................................................................... 1
1.3. DNA mitocondrial ............................................................................................................... 4
1.3. DNA Barcoding ................................................................................................................... 5
2. JUSTIFICATIVA .................................................................................................................. 6
3. OBJETIVOS .......................................................................................................................... 7
3.1. Geral ................................................................................................................................... 7
3.2. Especficos .......................................................................................................................... 7
4. MATERIAL E MTODOS ................................................................................................... 7
4.1. reas de estudo.................................................................................................................... 7
4.2. Municpio de Presidente Figueiredo ................................................................................... 8
4.2.1. Igaraps ............................................................................................................................. 8
4.3. Reserva Florestal Ducke ...................................................................................................... 8
4.3.1. Igaraps ............................................................................................................................. 9
4.4. Coletas ................................................................................................................................. 9
4.5. Identificao e descries .................................................................................................... 9
4.6. Anlises Moleculares......................................................................................................... 11
4.6.1. Extrao do DNA ........................................................................................................... 11
4.6.2. Reao em cadeia da polimerase (PCR) ......................................................................... 11
4.6.3. Eletroforese dos produtos amplificados ......................................................................... 12
4.6.4. Reao de Purificao dos fragmentos amplificados ..................................................... 12
4.6.5. Reconstruo filogentica............................................................................................... 15
5. RESULTADOS E DISCUSSO ......................................................................................... 16
5.1. Descries e Material Examinado ..................................................................................... 27
6. CONCLUSES .................................................................................................................... 93
7. REFERNCIAS BIBLIOGRFICAS ................................................................................. 94

xi
LISTA DE TABELAS

Tabela 1: Primers utilizados (Folmer et al., 1994 )..................................................................12

Tabela 2: Programas especficos utilizados para as amplificaes de cada par de


oligonucleotdeos iniciadores (primers) para espcies de Macronema....................................13

Tabela 3: Espcies de Macronema com COI sequenciado em 2012........................................19

Tabela 4: Valores de distncia gentica baseados no modelo Kimura-2-


Parmetros.................................................................................................................................21
Tabela 5: Distncia Interespecfica utilizando o modelo K2P das sequncias do gene
mitocondrial Citocromo Oxidase Subunidade I (COI) entre espcies dos gneros Macronema,
Macrostemum e Smicridea da famlia Hydropsychidae..........................................................25

xii
LISTA DE FIGURAS

Figura 1: No item A a larva considerada associada se as sequncias do mesmo fragmento


de gene so similares. No item B a larva considerada associada quando for um grupo
irmo (monofiletismo com ancestral mais recente) dos adultos identificados. No item C
exigiria uma maior amostragem de adultos adicionais da mesma espcie at que a larva
ficasse dentro de um dos dois critrios anteriores (Adaptado de Zhou et al., 2007) ............... 17
Figura 2: Reconstruo filogentica pelo mtodo de Neighbor-Joining utilizando sequncias
de COI para larvas e adultos de espcies do gnero Macronema usando o mtodo Kimura-2-
parmetros com anlise de bootstrap com 1000 rplicas ......................................................... 22
Figura 3: Reconstruo filogentica pelo mtodo da Mxima Parcimnia utilizando
sequncias de COI para larvas e adultos de espcies do gnero Macronema com anlise de
bootstrap com 1000 rplicas .................................................................................................... 23
Figura 4: Reconstruo filogentica pelo mtodo de Mxima Verossimilhana utilizando
sequncias de COI para larvas e adultos de espcies do gnero Macronema usando o mtodo
Kimura-2-parmetros com anlise de bootstrap com 1000 rplicas ........................................ 24
Figura 5: Macronema argentilineatum. Macho em vista dorsal ............................................. 27
Figura 6: Macronema bifidum. Macho em vista dorsal .......................................................... 28
Figura 7: Macronema bifidum. Diagrama da posio e tipo de brnquias do meso, metanoto e
segmentos abdominais I-VIII. S = um filamento simples, sem ramificaes laterais. S(R) =
um filamento simples, com ramificaes laterais. D = dois filamentos simples ramificados
(S(R)), de uma mesma base comum ......................................................................................... 30
Figura 8: Larva de Macronema bifidum. A. Corpo - vista lateral; B. Trax - vista dorsal; C.
Labro - vista dorsal; D. Mandbulas - vista ventral; E. Prosternito- vista ventral; F. Cabea -
vista dorsal; G. Cabea - vista ventral; H. Cabea - vista lateral ............................................. 32
Figura 9: Larva de Macronema bifidum. A. Trocantim e coxa da perna anterior - vista
dorsolateral; B. Fmur da perna anterior - vista dorsolateral; C. Fmur da perna anterior - vista
dorsal; D. Fmur da perna anterior - vista ventral; E. Pernas anterior, mediana e posterior -
vista dorsolateral; F. Cerdas espatuladas na margem do fmur da perna anterior - vista lateral .
.................................................................................................................................................. 33
Figura 10: Pupa Macronema bifidum. A. Pupa - vista dorsal; B. Placas em forma de gancho -
vista dorsal (3a 8a), nmero dos segmentos abdominais, a = anterior e p = posterior; C.
Labro e mandbulas - vista ventral; D. Processo pical - vista dorsal. ..................................... 34

xiii
Figura 11: Macronema burmeisteri. Asa anterior de um macho, vista dorsal ........................ 35

Figura 12: Macronema exophthalmum. Asa anterior de um macho, vista dorsal ................... 38
Figura 13: Macronema exophthalmum. Diagrama das bifurcaes e posio das brnquias do
mesonoto, metanoto e dos segmentos abdominais I-VIII. S = um filamento central fino
simples, sem filamentos finos laterais. S(R) = um filamento central simples, com ramificaes
laterais. D = dois filamentos simples ramificados (S(R)), de uma mesma base comum ......... 38
Figura 14: Larva de Macronema exophthalmum. A. Corpo - vista lateral. B. Trax - vista
dorsal. C. Labro - vista dorsal. D. Mandbulas - vista ventral. E. Prosternito - vista ventral. F.
Cabea - vista dorsal. G. Cabea - vista ventral. H. Cabea - vista lateral............................... 40
Figura 15: Larva de Macronema exophthalmum. A. Trocantim e coxa da perna anterior -
vista dorsolateral. B. Fmur da perna anterior - vista ventral. C. Fmur da perna anterior -
vista dorsal. D. Fmur da perna anterior - vista ventrolateral. E. Pernas anterior, mediana e
posterior - vista dorsolateral. F. Cerdas espatuladas e espinhos na margem do fmur da perna
anterior - vista lateral ................................................................................................................ 41

Figuras 16: Pupa Macronema exophthalmum. A. Pupa - vista dorsal; B. Labro - vista dorsal;
C. Mandbulas - vista dorsal; D. Segmento abdominal IX - vista dorsal; E. Placas em forma de
gancho da pupa, nmero dos segmentos abdominais, a = anterior, p = posterior) .......................
.................................................................................................................................................. 42

Figura 17: Macronema fragile. Asa anterior de um macho, vista dorsal ................................ 45
Figura 18: Macronema fragile. Diagrama das bifurcaes e posio das brnquias do
mesonoto, metanoto e dos segmentos abdominais I-VIII. F= um filamento central fino
simples, sem filamentos finos laterais. S = um filamento central simples, com filamentos finos
laterais. D = dois filamentos simples ramificados (S(R)), de uma mesma base comum ......... 45

Figura 19: Larva de Macronema fragile. A. Corpo - vista lateral. B. Trax - vista dorsal; C.
Labro - vista dorsal. D. Mandbulas - vista lateral. E. Prosternito - vista lateral. F. Cabea -
vista dorsal. G. Cabea - vista ventral. H. Cabea - vista lateral .............................................. 47

Figura 20: Larva de Macronema fragile. A. Trocantim e coxa da perna anterior - vista
dorsolateral. B. Fmur da perna anterior - vista ventral. C. Fmur da perna anterior - vista
dorsal. D. Espinhos distribudos na margem ventrolateral da perna anterior vista lateral. E.
Pernas anterior, mediana e posterior - vista dorsolateral .......................................................... 48

xiv
Figura 21: Pupa Macronema fragile. A. Pupa - vista dorsal; B. Labro - vista dorsal; C.
Mandbulas - vista dorsal; D. Segmento abdominal IX - vista dorsal; E. Placas em forma de
gancho da pupa, nmero dos segmentos abdominais, a = anterior, p = posterior) ................... 49

Figura 22: Macronema hageni. Asa anterior de um macho, vista dorsal................................ 51


Figura 23: Macronema hageni. Diagrama das bifurcaes e posio das brnquias do
mesonoto, metanoto e dos segmentos abdominais I-VIII. S = um filamento central afinalado
simples, sem filamentos finos laterais. S(R) = um filamento central simples, com ramificaes
laterais. D = dois filamentos simples ramificados (S(R)), de uma mesma base comum ......... 52
Figura 24: Larva de Macronema hageni. A. Corpo - vista lateral. B. Trax - vista dorsal. C.
Labro - vista dorsal. D. Mandbulas - vista ventral. E. Prosternito - vista ventral; F. Cabea -
vista dorsal. G. Cabea - vista ventral. H. Cabea - vista lateral .............................................. 53
Figura 25: Larva de Macronema hageni. A. Trocantim e coxa da perna anterior - vista
dorsolateral. B. Fmur da perna anterior - vista ventral. C. Fmur da perna anterior - vista
dorsal. D. Espinhos distribudos na margem ventrolateral da perna anterior vista lateral. E.
Pernas anterior, mediana e posterior - vista dorsolateral. F. Cerdas espatuladas vista
lateral........................................................................................................................................ 54

Figura 26: Macronema parvum. Macho, vista dorsal ............................................................. 55

Figura 27: Macronema pennyi. Asa anterior de um macho, vista dorsal ................................ 58
Figura 28: Macronema pennyi. Diagrama das bifurcaes e posio das brnquias do
mesonoto, metanoto e dos segmentos abdominais I-VIII. S = um filamento central afinalado
simples, sem filamentos finos laterais. S(R) = um filamento central simples, com ramificaes
laterais. D = dois filamentos simples ramificados (S(R)), de uma mesma base comum ......... 58
Figura 29: Larva de Macronema pennyi. A. Corpo - vista lateral. B. Trax - vista dorsal. C.
Labro - vista dorsal. D. Mandbulas - vista ventral. E. Prosternito - vista ventral. F. Cabea -
vista dorsal. G. Cabea - vista ventral. H. Cabea - vista lateral .............................................. 59
Figura 30: Macronema pennyi. A. Trocantim e coxa da perna anterior - vista dorsolateral. B.
Fmur da perna anterior - vista ventrolateral. C. Fmur da perna anterior - vista dorsal. D.
Fmur da perna anterior - vista ventral. E. Pernas anterior, mediana e posterior - vista
dorsolateral. F. Espinhos distribudos na margem ventrolateral da perna anterior vista
lateral. G. Cerdas espatuladas na margem do fmur da perna anterior - vista lateral .............. 60

Figura 31: Macronema percitans. Macho, vista dorsal ........................................................... 61

Figura 32: Macronema sp. nov. 1. Asa anterior de um macho, vista dorsal ........................... 63

xv
Figura 33: Macronema sp. nov. 1. Genitlia masculina: A vista lateral. B - vista dorsal. C
falo vista lateral. D pice do falo vista lateral. E pice do falo vista ventral. F pice
do falo vista dorsal................................................................................................................. 63

Figura 34: Macronema sp. nov. 2. Asa anterior de um macho, vista dorsal ........................... 64

Figura 35: Macronema sp. nov. 3. Asa anterior do macho, vista dorsal ................................. 65
Figura 36: Macronema sp. nov. 3. Diagrama das bifurcaes e posio das brnquias do
mesonoto, metanoto e dos segmentos abdominais I-VIII. S = um filamento central afinalado
simples, sem filamentos finos laterais. S(R) = um filamento central simples, com ramificaes
laterais. D = dois filamentos simples ramificados (S(R)), de uma mesma base comum ......... 67

Figura 37: Larva de Macronema sp. nov. 3. A. Corpo - vista lateral. B. Trax - vista dorsal.
C. Labro - vista dorsal. D. Mandbulas - vista ventral. E. Prosternito - vista ventral. F. Cabea
- vista dorsal. G. Cabea - vista ventral. H. Cabea - vista lateral ........................................... 67
Figura 38: Macronema sp. nov. 3. A. Trocantim e coxa da perna anterior - vista dorsolateral.
B. Fmur da perna anterior - vista dorsal. C. Fmur da perna anterior - vista ventrolateral. D.
Perna anterior, vista lateral. E. Espinhos e cerdas espatuladas distribudos na margem
ventrolateral da perna anterior - vista lateral. F. Pernas anterior, mediana e posterior - vista
dorsolateral ............................................................................................................................... 68
Figura 39: Macronema sp. nova 4. Genitlia masculina: A vista lateral. B - vista dorsal. C
falo vista lateral. D pice do falo vista lateral. E pice do falo vista ventral...................... 70

Figura 40: Macronema sp. nov. 6. Asa anterior de um macho, vista dorsal ........................... 73
Figura 41: Macronema sp. nov. 6. Genitlia masculina: A vista lateral. B - vista dorsal. C
falo vista lateral. D pice do falo vista dorsal. E pice do falo vista lateral ....................... 74

Figura 42: Macronema sp. nov. 6. Diagrama das bifurcaes e posio das brnquias do
mesonoto, metanoto e dos segmentos abdominais I-VIII. S = um filamento central fino
simples, sem filamentos finos laterais. S(R) = um filamento central simples, com ramificaes
laterais. D = dois filamentos simples ramificados (S(R)), de uma mesma base comum .........75

Figura 43: Larva de Macronema sp. nov. 6. A. Corpo - vista lateral. B. Trax - vista dorsal.
C. Labro - vista dorsal. D. Mandbulas - vista ventral. E. Prosternito - vista ventral. F. Cabea
- vista dorsal. G. Cabea - vista ventral. H. Cabea - vista lateral. .......................................... 75
Figura 44: Larva de Macronema sp. nov. 6. Legenda: A. Trocantim e coxa da perna anterior -
vista dorsolateral. B. Fmur da perna anterior - vista ventrolateral. C. Fmur da perna anterior
- vista dorsal. D. Fmur da perna anterior - vista ventral. E. Pernas anterior, mediana e

xvi
posterior - vista dorsolateral. F. Cerdas espatuladas e espinhos na margem do fmur da perna
anterior vista lateral............................................................................................................... 76

Figura 45: Macronema sp. nova 7. Asa anterior de um macho, vista dorsal [lcool].............78

Figura 46: Macronema sp. nov. 7. Diagrama da posio e tipo de brnquias do meso,
metanoto e segmentos abdominais I-VIII. S = um filamento simples, sem ramificaes
laterais. S(R) = um filamento simples, com ramificaes laterais. D = dois filamentos simples
ramificados (S(R)), de uma mesma base comum. .................................................................... 79
Figura 47: Larva de Macronema sp. nova 7. A. Corpo - vista lateral; B. Trax - vista dorsal;
C. Labro - vista dorsal; D. Mandbulas - vista ventral; E. Prosternito - vista ventral; F. Cabea
- vista dorsal; G. Cabea - vista ventral ; H. Cabea - vista lateral .......................................... 79
Figura 48: Macronema sp. 7. Larva A. Trocantim e coxa da perna anterior - vista
dorsolateral; B. Fmur da perna anterior - vista ventrolateral; C. Fmur da perna anterior -
vista dorsal; D. Fmur da perna anterior - vista ventral; E. Pernas anterior, mediana e posterior
- vista dorsolateral; F. Cerdas espatuladas e espinhos na margem do fmur da perna anterior -
vista lateral................................................................................................................................ 80

Figura49: Macronema sp. 1. Diagrama das bifurcaes e posio das brnquias do mesonoto,
metanoto e dos segmentos abdominais I-VIII. S = um filamento central afinalado simples,
sem filamentos finos laterais. S(R) = um filamento central simples, com ramificaes laterais.
D = dois filamentos simples ramificados (S(R)), de uma mesma base comum ....................... 82
Figura 50: Larva de Macronema sp. 1. A. Corpo - vista lateral; B. Trax - vista dorsal; C.
Labro - vista dorsal; D. Mandbulas - vista ventral; E. Prosternito- vista ventral; F. Cabea -
vista dorsal; G. Cabea - vista ventral; H. Cabea - vista lateral ............................................. 83
Figura 51: Larva de Macronema sp. 1. A. Trocantim e coxa da perna anterior - vista
dorsolateral; B. Fmur da perna anterior - vista dorsolateral; C. Fmur da perna anterior - vista
dorsal; D. Fmur da perna anterior - vista ventral; E. Pernas anterior, mediana e posterior -
vista dorsolateral; F. Cerdas espatuladas na margem do fmur da perna anterior - vista lateral .
.................................................................................................................................................. 84

Figura 52: Macronema sp. 2. Diagrama das bifurcaes e posio das brnquias do
mesonoto, metanoto e dos segmentos abdominais I-VIII. S = um filamento central fino
simples, sem filamentos finos laterais. S(R) = um filamento central simples, com ramificaes
laterais. D = dois filamentos simples ramificados (S(R)), de uma mesma base comum ......... 86

xvii
Figura 53: Larva de Macronema sp. 2. A. Corpo - vista lateral. B. Trax - vista dorsal. C.
Labro - vista dorsal. D. Mandbulas - vista ventral. E. Prosternito - vista ventral. F. Cabea -
vista dorsal. G. Cabea - vista ventral. H. Cabea - vista lateral .............................................. 87
Figura 54: Larva de Macronema sp. 2. A. Trocantim e coxa da perna anterior - vista
dorsolateral. B. Fmur da perna anterior - vista ventral. C. Fmur da perna anterior - vista
dorsal. D. Espinhos distribudos na margem ventrolateral da perna anterior vista lateral. E.
Cerdas espatuladas vista lateral ............................................................................................. 88

Figura 55: Macronema sp. 3. Diagrama das bifurcaes e posio das brnquias do
mesonoto, metanoto e dos segmentos abdominais I-VIII. S = um filamento central afinalado
simples, sem filamentos finos laterais. S(R) = um filamento central simples, com ramificaes
laterais. D = dois filamentos simples ramificados (S(R)), de uma mesma base comum ......... 90

Figura 56: Larva Macronema sp. 3. A. Corpo - vista lateral; B. Trax - vista dorsal; C. Labro
- vista dorsal; D. Mandbulas - vista ventral; E. Prosternito - vista ventral; F. Cabea - vista
dorsal; G. Cabea - vista ventral; H. Cabea - vista lateral ...................................................... 91

Figura 57: Larva Macronema sp. 3. A. Trocantim e coxa da perna anterior - vista
dorsolateral; B. Fmur da perna anterior - vista ventral; C. Fmur da perna anterior - vista
dorsal; D. Fmur da perna anterior - vista ventrolateral; E. Pernas anterior, mediana e
posterior - vista dorsolateral; F. Cerdas espatuladas e espinhos distribudos na margem
ventrolateral da perna anterior - vista lateral. ........................................................................... 92

xviii
1.INTRODUO

1.2. Aspectos gerais da ordem

A ordem Trichoptera Kirby, 1813 significativamente a maior entre as outras ordens


de insetos restritamente de ambientes aquticos (Neboiss, 1991). O nome da ordem deve-se ao
fato de suas asas possurem cerdas (grego: trichos = cerda (pelo) e ptera = asas) que
supostamente estas cerdas tm como funo repulsar as molculas de gua (Calor, 2007).

Os tricpteros so insetos holometbolos com registro fssil no Trissico


aproximadamente 230 milhes de anos atrs (Morse, 1997; Ansorge, 2003; Grimaldi e Engel,
2005; Holzenthal et al., 2007). A ordem Trichoptera tem atualmente 49 famlias, 616 gneros
e 14.548 espcies descritas no mundo (Morse, 2013). So registrados para o Brasil 16
famlias, 70 gneros e 579 espcies, para o estado do Amazonas 13 famlias, 42 gneros e 168
espcies at o momento (Santos et al., 2013).
Apenas as formas imaturas so aquticas, sendo os adultos terrestres (Holzenthal et
al., 2007). As larvas distinguem-se pelo comportamento de construo de refgios fixos
alguns com redes de captura de alimento e abrigos mveis que carregam enquanto se
alimentam (Huamantinco e Nessimian, 1999).

As larvas possuem cabea distinta com cpsula ceflica totalmente desenvolvida e


esclerotinizada, com omatdios presentes. As antenas so curtas, embora na famlia
Leptoceridae as antenas sejam mais longas (pelo menos 4 a 5 vezes mais longas que largas) e
conspcuas. Ao contrrio dos adultos, as larvas possuem peas bucais bem desenvolvidas que
consistem em um pequeno labro, um par de mandbulas, um par de maxilas e um lbio. Cada
segmento torcico diferenciado na esclerotinizao, geralmente o primeiro par diferenciando
do segundo e terceiro (Holzenthal et al., 2007). O abdmen membranoso, podendo ter
brnquias respiratrias externas e o nono segmento dotado de um par de falsas pernas anais
providas de ganchos (Angrisano, 1998).

As pupas geralmente so aquticas e semelhantes aos adultos, porm possuem


estruturas exclusivas: labro com cerdas rgidas, extremo abdominal com um par de apndices
com cerdas; mandbulas fortes, pernas com cerdas natatrias, tergitos abdominais com
ganchos dorsais e geralmente possuem brnquias abdominais externas (Angrisano, 1998).

Os adultos possuem asas recobertas de cerdas e algumas escamas, so geralmente de


colorao marrom, cinza, amarelo, bege, entre outros tons escuros, provavelmente uma
adaptao que permite a camuflagem durante o dia na vegetao, j alguns possuem
combinaes de cores vibrantes, possivelmente relacionados com comportamento de corte e
cpula. O comprimento do corpo dos adultos varia entre 1,5-3 mm em Hydroptilidae e alguns
Glossosomatidae, chegando at 30-45 mm nas famlias Hydropsychidae e Odontoceridae
(Holzenthal, et al., 2007, Flint, 1978; Paprocki e Holzenthal, 2002). Possuem palpos
maxilares e labiais desenvolvidos, algumas espcies podem ter as peas bucais atrofiadas,
longas antenas filiformes em algumas espcies at quatro vezes mais longas que o corpo. Os
adultos so encontrados prximos a lagos e cursos dgua, sob a vegetao ou pedras
(Angrisano, 1995).

A maioria das espcies de Trichoptera identificada a partir de machos adultos, pois a


genitlia masculina complexa e, relativamente invarivel intraespecificamente. Porm em
alguns grupos a colorao das asas, trax e cabea so importantes para a taxonomia
(Holzenthal et al., 2007).

A famlia Hydropsychidae encontrada em todos os domnios biogeogrficos do


mundo menos na regio Antrtica, sendo mais diversa nas regies temperadas e tropicais
(Flint, 1991). So reconhecidas atualmente para esta famlia cinco subfamlias:
Arctopsychinae, Macronematinae, Hydropsychinae, Diplectroninae e Smicrideinae. As
relaes filogentica destas subfamlias indicam que a famlia monofiltica, porm ainda
no foi estabelecida uma classificao estvel (Holzenthal, 2007; Geraci et al., 2005;
Schefter, 1996, 2005).
O gnero Macronema Pictet, 1836 tem distribuio restrita para a regio Neotropical,
possui atualmente 30 espcies descritas (Morse, 2013) desde o sul do Mxico at a Argentina
(Paprocki, 2008), com 16 espcies citadas para o Brasil e com 12 espcies para a Amaznia
(Flint, 1978, 1991). Paprocki (2008) faz referncia a nove espcies novas do gnero, dessas,
duas novas espcies so coletadas no estado do Amazonas. Os adultos do gnero so
coloridos, geralmente com asas, trax e cabea recobertos por pequenas escamas brilhantes de
colorao verde, amarela e branca. O abrigo da pupa mais espessado que o abrigo da larva e
raramente as pupas so coletadas.

A primeira larva descrita para o gnero por Flint & Bueno-Sria (1982) para
Macronema variipenne Flint e Bueno, 1979, com os seguintes caracteres diagnsticos: gena
lisa sem estrutura de estridulao, falsas pernas anais longas e delgadas com regio mediana
dobrvel, brnquias abdominais com talo central grosso com ramificaes muito finas e
uniformes (penada), ausncia de brnquia no trax.

2
Os imaturos dessa espcie so encontrados associados a folhas e razes de macrfitas,
no constroem rede de captura de alimento, alimentam-se de fragmentos vegetais pertencendo
assim categoria fragmentador. Constroem seus abrigos em formato de tubos frouxos de seda
e sedimento, geralmente preso a razes no remanso ou sob rochas (Flint e Bueno-Soria, 1982).
Foi observado que larvas de diferentes espcies de Macronema alimentam-se de
fragmentos de razes vivas (Pes, comunicao pessoal) e esse um fator importante, pois
provavelmente essas larvas devem ter associao com algum micro-organismo para a
absoro de nutrientes e degradao da celulose, indicando que larvas desse gnero podem ser
bons alvos para pesquisas biotecnolgicas.
A famlia Hydropsychidae possui uma elevada tolerncia a alteraes ambientais
(Lenat, 1993), porm, a sua utilizao em programas de biomonitoramentos de qualidade de
gua doce tem sido altamente impedida pela falta de larvas identificadas e ilustradas. Assim, a
identificao dos estgios imaturos de espcies da famlia Hydropsychidae torna-se um pr-
requisito e uma ferramenta indispensvel para estes tipos de estudos (Zhou et al., 2007).
So poucas as espcies de Trichoptera que tm seus estdios imaturos descritos,
dificultando dessa forma a realizao de estudos como o de ecologia de comunidades
aquticas. Atualmente vem crescendo o nmero de trabalhos que associam larvas com os
adultos desta ordem na regio amaznica (e.g. Flint, 1983; Flint et al., 1999; Pes e Hamada,
2003, 2004; Pes et al., 2008; Pes, 2001; Pes, 2005; Pes et al., 2005; Albino et al., 2011;
Camargos, 2012).

Uma tcnica empregada para associar adultos e larvas o mtodo metamorftipo,


onde pode se observar o adulto farado dentro da cutcula pupal. Nesta fase, a genitlia do
macho j est formada podendo identificar ao nvel de espcie, os escleritos da larva tambm
permanecem dentro do abrigo pupal, permitindo a associao dos estgios: larva, pupa e
adulto. Mas esta tcnica na maioria das vezes tem o empecilho por demandar a coleta de
pupas faradas. As larvas do gnero Macronema so pouco estudadas tendo apenas uma
associao com o adulto descrita para a espcie Macronema variipenne obtida por meio de
criao em laboratrio (Flint e Bueno, 1982).

At o momento, todos os trabalhos utilizaram o mtodo metamorftipo, criao e


emergncia no laboratrio para associar larvas e adultos na Amaznia (Albino et al., 2011;
Camargos, 2012), tcnicas moleculares utilizando sequncias de DNA mitocondrial podem
resolver o problema e otimizar o processo de associao dos estgios de vida para a ordem
Trichoptera. Em outros pases, diversos trabalhos obtiveram sucesso na associao de larvas e

3
adultos das mesmas espcies utilizando principalmente o gene mitocondrial Citocromo
Oxidase subunidade I (COI) (Blaxter, 2004; Shan et al., 2004a, b; Johanson, 2007; Zhou et
al., 2007; Waringer et al., 2008; Graf et al., 2009; Zhou, 2009; Zhou et al., 2009; Pauls et al.,
2010; Geraci et al., 2011; Zhou et al., 2011; Ruiter et al., 2013). Cabe ressaltar que o
conhecimento completo das fases da vida de uma espcie de suma importncia para a
compreenso de sua taxonomia, gentica, filogenia, evoluo, biogeografia, ecologia, assim
como para biomonitoramento.

Uma abordagem molecular utilizando o gene mitocondrial COI (Citocromo Oxidase


I), juntamente com a taxonomia alfa tem revelado resultados promissores oferecendo um
mtodo rpido e confivel para a associao de larvas e adultos de uma mesma espcie (Zhou
et al., 2007; Ruiter et al., 2013).

1.3. DNA mitocondrial

As mitocndrias so organelas presentes no citoplasma dos organismos eucariotos e


seu DNA o nico extracromossmico dentro da clula (exceto nos cloroplastos das plantas)
(Taylor e Turnbull, 2005). So responsveis pelo processo de respirao celular, e so
excelentes usinas de produo da energia (ATP), sendo de suma importncia para o timo
funcionamento da clula (Junqueira e Carneiro, 1997).
O genoma mitocondrial composto por duas fitas de DNA circular, tendo uma
distribuio assimtrica de guaninas e citosinas do qual gera um filamento H (fita pesada) e o
filamento L (fita leve), com um tamanho chegando a 16.600 pares de bases, tendo apenas 37
genes (Taylor e Turnbull, 2005).
H evidncias de que a gentica mitocondrial diferente da gentica Mendeliana por
possuir seu prprio arcabouo gentico. O DNA mitocondrial (mtDNA), tem sido muito
utilizado em trabalhos na rea de sistemtica em nvel de espcie. So excelentes marcadores
por possurem as seguintes caractersticas: ausncia de ntrons, rpida evoluo (devido sua
elevada taxa de coalescncia), recombinao limitada, fcil disponibilidade de primers
universais para a maioria dos animais, ausncia de mecanismos de reparos de mutaes,
elevado nmero de molculas, herana uniparental materna sendo haplide, poucas inseres
e delees e, poucos problemas de alinhamento (Lang, et al., 1999; Saccone et al., 1999;
Taylor e Turnbull, 2005).

Porm, sua recombinao tem sido analisada e questionada para alguns artrpodes
(Hebert et al., 2004a ; Ladoukakis e Zouros, 2001; Moulton et al., 2010; Smith e Smith, 2002)
4
e a presena de cpias de pseudogenes mitocondriais no ncleo (numts) (Antunes e Ramos,
2005), por vezes, pode chegar a uma incorreta reconstruo filogentica, sendo recomendados
outros marcadores moleculares, caracteres morfolgicos e ecolgicos para estes estudos,
diminuindo assim a probabilidade de erros (Burns et al., 2007, Decans e Rougerie 2008;
Song et al., 2008; Zhou et al., 2007).

1.4. DNA Barcoding

O DNA Barcoding uma sequncia com um comprimento mnimo (600 a 800 pares
de bases) de um gene padronizado, geralmente o gene Citocromo Oxidase Sub Unidade 1
(COI). Este gene comparado a outros genes mitocondriais possui traos filogenticos mais
robustos, sendo assim o mais utilizado e sugerido para identificar e registrar o mximo de
espcies (Hebert et al., 2003a, b,; Hebert et al., 2004a; Hebert e Gregory, 2005).

Devido ao crescimento de estudos envolvendo o DNA Barcoding, foi criado um


projeto ambicioso para identificar todas as espcies da Terra, unindo diversas instituies de
pesquisa, museus de histria natural e universidades, chamado de Barcode of Life Initiative
(Savolainen et al., 2005). Projetos semelhantes focados para os invertebrados de gua doce
esto apenas comeando e a ordem Trichoptera a mais completa at o momento tendo 2.636
espcies sequenciadas (Trichoptera Barcode of Life, 2013).
Estudos desta finalidade utilizando DNA (Tautz et al., 2003; Monaghan et al., 2006;
Vogler e Monaghan, 2006) e a tcnica DNA Barcoding (Hebert et al., 2003a, b) utilizam
como critrio primordial para identificao e delimitao de espcies utilizam a distncia
gentica. Estes estudos tm mostrado uma elevada taxa no sucesso da identificao de
espcies, acima de 95% (Hebert et al., 2004a, b; Meyer e Paulay, 2005), atingindo 100% para
alguns grupos de insetos (Hebert et al., 2003a).
Para que esta identificao seja concluda com sucesso, modelos e anlises so
aplicados utilizando o modelo de Kimura-2-Parmetros (K2P), que serve para calcular a
divergncia de nucleotdeos. Utiliza tambm a anlise de Neighbor-Joining (NJ) (Saitou e
Nei, 1987) para relacionar os txons, esta anlise usualmente usada devida sua robustez
(Hebert et al., 2004a; Zhou et al., 2007; Pauls et al., 2010; Geraci et al., 2011). Mas outras
anlises so tambm utilizadas como a Mxima Parcimnia (MP) (Ekrem et al., 2007) e
Mxima Verossimilhana (ML) (Sutou et al., 2011; Matz e Nilsen, 2005).
Atualmente j se descobriu diversas aplicaes e benefcios do DNA Barcoding para
a cincia em vrias reas como a biodiversidade, tais como:
5
1. Diagnosticar diversos organismos dentre eles plantas (Chase e Fay, 2009; Li et al.,
2012); fungos (Begerow et al., 2010; Kelly et al., 2011); invertebrados como:
moluscos, aneldeos, platelmintos dentre outros (Folmer et al., 1994); insetos de
diversas ordens como Coleoptera (Sheffield et al., 2008), Lepidoptera (Kaila e Stahls,
2006), Ephemeroptera (Webb et al., 2012) e Trichoptera (Johanson, 2007; Zhou et al.,
2007; Pauls et al., 2010).

2. Propiciar a descoberta e separao de espcies crpticas (Hebert et al., 2003a, b; Pauls


et al., 2009; Hausmann et al., 2009; Pauls et al., 2010; Clare et al., 2011).

3. Fornecer identificaes taxonmicas padronizadas para outras reas da cincia, e.g.


biomedicina (parasita e vetores), agricultura (pragas), estudos de conservao
(espcies ameaadas de extino) (Savolainen et al., 2005), no entanto esta abordagem
precisa ser complementada com outros mtodos para que os esforos de conservao
sejam mais eficazes (Krishnamurthy e Francis, 2012).

4. Identificar diversas fases da vida de uma mesma espcie (por exemplo, mudas e
larvas).

5. Fornecer para o pblico em geral uma ferramenta de bioliteratura (enciclopdia) de


fcil acesso, para o aumento do conhecimento bitico (Savolainen et al., 2005).

6. Alm de ser uma ferramenta de custo acessvel (Caterino et al., 2000).

2. JUSTIFICATIVA

Um estudo realizado em 92 igaraps da Reserva Ducke, das Reservas do Programa de


Diversidade Biolgica e Fragmentos Florestais (PDBFF) e do municpio de Presidente
Figueiredo, foi associada por meio de metamorftipo somente uma espcie (Macronema
exophthalmum Flint, 1978), das larvas de 11 espcies do gnero Macronema que foram
morfotipadas (Pes, 2005) apesar das diversas tentativas de criao da larva em laboratrio
para a obteno do adulto, nestes ltimos anos, no se obteve sucesso (Pes, comunicao
pessoal).
A tcnica usualmente empregada at o momento (mtodo metamorftipo) possui
algumas limitaes que dificulta o trabalho de associao, pois requer a coleta de pupa de
macho farado diminuindo, dessa forma, a probabilidade de ser coletada. O processo de
criao de imaturos em laboratrio para a famlia Hydropsychidae pode ter alguns empecilhos
6
como: mudana radical de habitat, substrato, alimentao, temperatura, pH e oxigenao da
gua, j a criao de campo est sujeita a problemas imprevisveis relacionados a causas
naturais. Devido ao insucesso da identificao das larvas em nvel de espcie e pelo grande
potencial desse gnero para os programas biotecnolgicos e de conservao, este trabalho
utilizando o DNA mitocondrial gene COI uma tentativa diferenciada de superar estas
dificuldades.

3. OBJETIVOS

3.1. Geral
Contribuir para o estudo da taxonomia do gnero Macronema tendo como base
aspectos morfolgicos e moleculares.

3.2. Especficos:

a) Associar larvas e adultos de Macronema utilizando uma ferramenta molecular, atravs da


comparao de sequncias de um fragmento do gene mitocondrial Citocromo Oxidase
Subunidade I (COI) e metamorftipo;
b) Descrever eventuais txons novos e larvas de espcies conhecidas;
c) Elaborar chaves dicotmicas para identificar as espcies de larvas e adultos do gnero
Macronema;
d) Atualizar registros de distribuio das espcies.

4.MATERIAIS E MTODOS

4.1. reas de estudo

As reas amostradas incluem municpios prximos a Manaus, que esto dentro do


domnio das florestas de terra firme, esta possui um solo que classificado como latossolo
amarelo com textura desde mdia a muito argilosa, com altos ndices de alumnio, o que est
relacionado com o baixo pH (solos cidos), pois resulta na formao de fosfato de alumnio,
diminuindo os percentuais de fsforo disponveis. Esses solos esto recobertos por floresta
densa e em locais onde o solo mais raso e a drenagem alta, ocorre formao da
vegetao tipo campinarana (Brasil, Departamento Nacional de Produo Mineral/projeto
RADAMBRASIL, 1978).

7
Pela classificao de Kppen, o clima dessa regio pertence ao grupo A (Clima
Tropical Chuvoso) que apresenta montantes pluviomtricos anuais superiores a 2.000 mm. A
umidade relativa bastante elevada variando de 85 a 95%. As temperaturas mdias anuais
tm variaes limitadas pelas isotermas de 24 C e 26 C (Brasil, Departamento Nacional de
Produo Mineral/projeto RADAMBRASIL, 1978).

Os igaraps da Amaznia Central em sua maioria possuem guas cidas com valores
de pH entre 4,4 e 5,3 e temperatura da gua entre 20-26o C (Ferrari et al., 1997, Couceiro et
al., 2012).

4.2. Municpio de Presidente Figueiredo

Presidente Figueiredo devido sua formao geomorfolgica possui flora e fauna


exuberantes como: cavernas, igaraps e rios com corredeiras e cachoeiras. Essas cachoeiras
so formadas sobre rochas sedimentares das formaes Nhamund e Manacapuru (Nogueira e
Sarges, 2001). Os igaraps e rios dessa rea fazem parte das Bacias dos Rios Urubu, Urubu e
Uatum, que por sua vez so afluentes do Rio Amazonas.

Este municpio sofre com a ao antrpica em diversos locais devido ao desmatamento


para agricultura, pecuria, extrao mineral e pela construo da Represa da Usina
Hidreltrica de Balbina, que alagou uma extensa rea de floresta (Barcellos e Lima, 2002;
Santos e Oliveira, 1999).
4.2.1.Igaraps
Independente da ordem do igarap, as predominncias dos substratos so de fundo
rochoso, com bancos de areia, pedras soltas e seixos, alguns igaraps e rios possuem razes
submersas, advindas da vegetao marginal. As macrfitas como a Thurnia sphaerocephala
(Rudge) Hook. f., (Thurniaceae) e Tonina fluviatilis Aubl. (Eriocaulaceae), podem estar em
bancos de areia (Holzenthal e Pes, 2004).

4.3. Reserva Ducke


Essa reserva pertence ao Instituto Nacional de Pesquisas da Amaznia (INPA), est
localizada a 26 km da cidade de Manaus entre 0255 e 0301S e entre 5953 e 5959O e
compreende uma rea de 10.000 ha. de floresta de terra firme (Mendona et al., 2005). A
reserva possui um plat central que divide claramente o sistema hidrolgico dos igaraps, no
sentido norte-sul, entre duas bacias. Os igaraps afluentes da bacia do igarap do Tarum -
Rio Negro situados no lado oeste da reserva (Barro Branco, Acar e Bolvia). A bacia leste

8
est o igarap gua Branca e os igaraps afluentes (Tinga, Uber e Ipiranga), os quais drenam
para o rio Puraquequara, desaguando no rio Amazonas (Ribeiro et al., 1999). A reserva possui
um sistema de 10 trilhas a cada 1 Km, cortando a reserva de norte a sul (N-S) e 10 de leste a
oeste (L-O), o que facilitou o trabalho das coletas. (Baccaro et al., 2008).

4.3.1. Igaraps
Os igaraps amostrados possuem substratos principalmente compostos por areia,
folhas soltas e razes. A macrfita aqutica mais abundante nos igaraps da Reserva Ducke
Thurnia sphaerocephala (Ribeiro et al, 1999).

4.4. Coletas
Para a realizao do presente estudo, foram utilizados larvas e adultos de Macronema
obtidos de duas formas: a partir de material j coletado que estava devidamente fixado em
lcool absoluto (99,9 P.A.) e armazenado em freezer -20 C no Laboratrio de Citotaxonomia
e Insetos Aquticos do INPA (LACIA), atravs de coletas que foram realizadas na Reserva
Ducke e nos igaraps do Municpio de Presidente Figueiredo, Amazonas, Brasil. As larvas
foram coletadas com auxlio de rede entomolgica aqutica (Rede D ou rapich) com malha
de no mximo 0,5 mm de abertura e bandeja branca. Os exemplares foram fixados com lcool
etlico absoluto (99,9 P.A.) e mantidos em temperaturas amenas at a chegada ao laboratrio,
onde foram acondicionados em freezer -20 C. Os adultos foram coletados por meio de
armadilhas de luz tipo Pennsylvania (Frost, 1957) e armadilhas do tipo suspensa (Rafael e
Gorayeb, 1982), instaladas a 1 m acima da superfcie da gua nos mesmos locais de
amostragem das larvas e armadilha Malaise, instaladas a cerca de 0,30 m da superfcie da
gua.

4.5. Identificao e descries


As identificaes dos estgios de vida: larva, pupa e adulto, foram realizadas por meio
de descries e redescries das espcies do gnero Macronema (Banks, 1910, 1915, 1924;
Botosaneanu e Flint, 1982; Burmeister, 1988; Flint, 1964, 1966, 1968, 1972, 1974, 1978,
1982, 1983a, b, 1991; Flint e Bueno-Soria, 1979, 1982; Oliveira, 2006; Paprocki, 2008; Pes,
2005; Ulmer, 1905; Wiggins 1996a, b, 2004). Como um grande nmero de espcimes
coletados so fmeas, foi utilizada a comparao pela colorao das asas e venao para
associar com os machos.

9
Para a identificao e descrio das larvas foram utilizados os seguintes caracteres:
comprimento da larva; na cabea: marcaes das inseres musculares, formato, colorao,
tipo e disposio de cerdas na regio dorsal seguindo o mtodo de quetotaxia de Williams e
Wiggins (1981), forma do labro e mandbulas; no trax foram empregados: manchas de
insero de msculos, formato e disposio das cerdas nas placas dorsais, formato do
prosternito; nas pernas anteriores os principais caracteres usados foram: forma do trocantim,
formato da coxa, nmero e disposio de cerdas, formato do fmur bem como a disposio,
forma e nmero de cerdas na margem ventral mediana. Os caracteres morfolgicos para as
descries das pupas foram comprimento total, forma do labro e mandbulas, processo
terminal, nmero e, formato dos ganchos dorsais dos segmentos abdominais.

Para as descries dos adultos foram usadas as seguintes caractersticas: comprimento,


padro de colorao da asa anterior, colorao do trax; frmula de espores tibiais; formato
da regio posteroventral do VIII segmento abdominal, formato do IX tergito abdominal,
formato do X tergito, formato e insero do falo e formato do esclerito flico na genitlia
masculina.

Para a identificao das espcies foram utilizados machos dos quais foi destacado o
abdmen e clarificado em cido ltico 85% aquecido a 110 - 125 C, durante pelo menos 1
hora e 30 minutos em banho-maria, ajudando tambm na expanso da genitlia. A estrutura
foi monitorada at a completa clarificao. Algumas genitlias que no ficaram
completamente diafanizadas ou ainda retinham musculatura foram colocadas em KHO 10%
em banho-maria por 25 minutos, lavadas com gua destilada e em seguida com cido actico
50% (50% cido actico e 50% lcool etlico 92) por 15-20 minutos, aps o que foram
lavadas em gua destilada. As genitlias foram acondicionadas em microtubos (eppendorf)
com glicerina ou junto ao exemplar, em lcool 80%. A estrutura foi observada em lmina
escavada, contendo lcool gel 40-70% e glicerina para proporcionar uma maior consistncia e
evitar o ressecamento do meio.
As identificaes foram realizadas sob microscpio estereoscpico, auxiliado, quando
necessrio, por um microscpio ptico. Para a descrio das larvas, estas foram fotografadas
com o auxlio de cmera fotogrfica DFC420 acoplada ao estereomicroscpio Leica
(M165C), Software de Processamento de Imagem Digital, Leica Application Sute V3. 4.1. A
genitlia e algumas estruturas menores da larva foram fotografadas em microscpio ptico
Olympus com cmera fotogrfica acoplada e as fotos foram montadas no software livre
CombineZP (Hadley, 2010).

10
As pernas anteriores das larvas foram destacadas, como j estavam em lcool absoluto
foram colocadas no secador de ponto crtico por vapor de CO 2 . Logo aps a desidratao,
foram montadas sobre fita adesiva de dupla face sob stubs de 32 mm e identificadas, a
seguir as amostras foram metalizadas com uma camada de ouro e fotografadas em
microscpio eletrnico de varredura (MEV) no Laboratrio Temtico de Microscopia
Eletrnica do INPA. A terminologia utilizada na descrio das larvas foi conforme Flint e
Bueno-Soria, 1982. Aps a publicao os exemplares sero depositados na Coleo de
invertebrados do INPA.
As espcies de nmero 2, 3, 5 e 7 so espcies novas (dados no publicados) da tese
de Henrique Paprocki (Paprocki, 2008).

4.6. Anlises Moleculares

4.6.1. Extrao do DNA

Para a extrao do DNA foram utilizados 3 pernas, msculos do trax e uma parte do
abdmen das larvas, j para os adultos foram utilizados os 3 pares de pernas e uma parte do
trax. No isolamento do DNA total da extrao destrutiva e no destrutiva, foi utilizado o kit
de extrao de DNA DNeasy Blood & Tissue (Qiagen), conforme as instrues do
fabricante. Cada amostra de DNA foi sequenciada nos dois sentidos da fita: primer forward e
com o primer reverse (fita pesada).
A extrao no destrutiva no foi eficiente, nas 3 extraes realizadas utilizando
somente larvas. Foram mantidas em lcool absoluto como material testemunho as seguintes
estruturas da larva: cabea, escleritos torcicos, trs pernas de cada indivduo e falsas pernas
anais, os intestinos foram removidos cuidadosamente para reduzir uma provvel
contaminao. Nos adultos foram retiradas cabea, asas e a genitlia, as quais tambm foram
mantidas em lcool como material testemunho (Tabela 3).
Das espcies novas e raras, no entanto, apenas alguns indivduos estavam disponveis
para a extrao. Os exemplares de larvas foram coletados nos mesmos pontos que foram
coletados os adultos, facilitando a associao por meio de anlise molecular.

4.6.2. Reao em cadeia da polimerase (PCR)


Nas reaes em cadeia da polimerase (PCR) foram utilizados os primers LCO 1490 e
HCO 2198 (Folmer et al., 1994) (Tabela 1), para amplificao de um fragmento do gene
Citocromo Oxidase Subunidade I (COI) das espcies de Macronema. Cada 25 L da reao

11
continha 3 L de DNA, 1,2 L de cada primer (forward e reverse) e 11,3 L de dH 2 O. As
amplificaes foram realizadas nos termocicladores (Swift Maxi Thermal Cycler (ESCO) e
TC-512 (Techine)) do Laboratrio de prospeco de bioativos de insetos do Instituto Nacional
de Pesquisas da Amaznia utilizando-se os seguintes programas que obtiveram xito (Tabela
2), dando destaque para o programa (Teste 1), sendo este utilizado para todas as amostras. Os
produtos de PCR foram mantidos em freezer em temperaturas prximas de - 20 C.

Tabela 1: Primers utilizados (Folmer et al., 1994 )

Cdigo Primers
LCO 1490 5 GGTCAACAAATCATAAAGATATTGG 3
HCO 2198 5 TAAACTTCAGGGTGACCAAAAAATCA 3

4.6.3. Eletroforese dos produtos amplificados

Para cada reao de amplificao, foram feitas eletroforese de gis de agarose a 1%


corados com GelRed (10.000X) em tampo TBE 0,5X preparado de acordo com Sambrook
e Russel (2001). As amostras foram preparadas utilizando-se 2 L de produto de PCR, 2 L
de uma soluo de azul de bromofenol 0,25%, xileno cianol 0,25% e sacarose 40% eL
4 de
X174 DNA/
gua milli-Q estril. Como marcador de peso molecular foi usado BsuRI

(Fermentas ). As bandas de DNA foram observadas e fotografadas em um fotodocumentador
com luz ultravioleta (UV).

4.6.4. Reao de Purificao dos fragmentos amplificados


Os produtos de PCR foram purificados para a eliminao de resduos de
dinucleotdeos trifosfato, de oligonucleotdeos iniciadores e RNA que poderiam interferir no
sequenciamento dos fragmentos de DNA que foram amplificados. Para a purificao foram
utilizadas as enzimas exonuclease I de Escherichia coli (EXOI) e fosfatase alcalina de
camaro (SAP), adicionada ao produto de PCR.

12
Tabela 2: Programas especficos utilizados para as amplificaes de cada par de oligonucleotdeos iniciadores
(primers) para espcies de Macronema.

Etapa Temperatura Tempo (min)


Teste 1
Desnaturao inicial 94 C 3:00
Desnaturao 94 C 1:00
Anelamento dos iniciadores 45 C 1:30 36 ciclos
Extenso 72 C 1:30
Extenso final 72 C 5:00
Teste 2
Desnaturao inicial 94 C 5:00
Desnaturao 94 C 0:30
Anelamento dos iniciadores 40 C 0:30 35 ciclos
Extenso 72 C 1:00
Extenso final 68 C 5:00
Teste 3
Desnaturao inicial 94 C 4:00
Desnaturao 94 C 0:45
Anelamento dos iniciadores 45 C 1:30 38 ciclos
Extenso 72 C 1:30
Extenso final 70 C 6:00

As reaes de purificao foram realizadas em termociclador (Mastercycler


Gradiente, Eppendorf) onde foram incubadas a 37 C por 30 minutos e em seguida a 80 C
por 15 minutos. Para cada reao de purificao, foram corridos gis de agarose a 1%,
corados com GelRed (10.000X), utilizando-se o tampo TBE 0,5X preparado de acordo com
Sambrook e Russel (2001). Essa etapa foi realizada no laboratrio de prospeco de bioativos
de insetos do INPA.
As amostras foram preparadas utilizando-se 14 L de produto de PCR na concentrao
de 20 ng/L, 0,875 L de EXOI, 1,75 L de FasATP. O marcador de peso molecular utilizado
foi Low DNA Mass Ladder (Invitrogen). Os gis foram visualizados e fotografados em um
fotodocumentador com luz ultravioleta (UV).
Os produtos de PCR foram sequenciados com os mesmos oligonucleotdeos
iniciadores utilizados na reao de amplificao. O sequenciamento dos fragmentos de DNA
amplificados foi realizado em um sequenciador de capilar 3.500 xL ABI no Centro de Estudos
do Genoma Humano da Universidade de So Paulo.
O alinhamento das sequncias foi conduzido utilizando-se o programa Clustal W
(Thompson et al., 1994), dentro do programa BIOEDIT 7.0.8 (Hall, 1999). Para chegar a uma
matriz de dados robustos para anlises das sequncias, foram adotadas as seguintes etapas:

13
1) As duas sequncias (53 e 35) foram unicamente conferidas com os seus
eletroferogramas correspondentes, as sequncias de qualidade inferior foram descartadas.

2) Foi realizado o reverso complemento da sequncia reverse e juntamente alinhadas no


programa Clustal W (Thompson et al., 1994). Logo depois de obter-se as fitas de
consensos, estas foram comparadas, e conferidas com os seus eletroferogramas para a
correo dos nucleotdeos.

3) As sequncias consenso foram nomeadas com o nome das espcies correspondentes e


logo em seguida salvas.
4) No fim foram unidas todas as 44 sequncias num nico bloco onde novamente foi
realizado um novo alinhamento e comparadas eliminando os gaps e corrigindo os
nucleotdeos no confiveis par a par. As bordas iniciais e finais foram excludas para
garantir homologia entre os stios e que todas as sequncias ficassem do mesmo tamanho
e ultimamente revisadas visualmente.

As sequncias nucleotdicas tambm foram conferidas, utilizando-se o programa


MEGA 5.0 (Tamura et al., 2011), a fim de verificar possveis erros como mutaes gnicas
por substituies e causadas pela insero ou deleo de um ou mais pares de bases. As
espcies deste estudo foram comparadas com Macronema spp., anteriormente armazenados
em bancos de dados virtuais disponveis no BLAST (www.ncbi.nlm.nih.gov/BLAST.cgi),
para confirmar a identidade da regio analisada. As sequncias deste trabalho sero
futuramente depositadas no GenBank.
No caso das espcies raras e novas espcies, no entanto, apenas alguns indivduos
estavam disponveis para a extrao. Os exemplares de larvas foram coletados nos mesmos
pontos que foram coletados os adultos, facilitando a associao molecular.

4.6.5. Reconstruo filogentica

Foram realizadas trs tipos de anlises filogenticas para relacionar os 44 espcimes


sequenciados sendo elas:
(1) Mxima parcimnia (MP), este mtodo assume o critrio da parcimnia, minimizando o
nmero de passos evolutivos aceitos na rvore. baseado no princpio da homologia, ou seja,
se uma caracterstica compartilhada por dois txons, esta foi herdada do ltimo ancestral
comum a ambos (Schneider, 2007).

14
(2) Neighbor-Joining (NJ) (Saitou e Nei, 1987), esta anlise no examina todas as topologias
possveis, mas procura encontrar sequencialmente vizinhos que minimizem o comprimento
total da rvore (Schneider, 2007).
(3) Mxima Verossimilhana (ML) (Felsenstein, 1981), esta anlise precisa de um modelo
probabilstico de evoluo de caracteres e considera todos os stios indistintamente
(Schneider, 2007). O modelo escolhido para as anlises foi o Kimura-2-Parmetros (Kimura,
1980), este leva em considerao a diferena das taxas de substituio por transio e
transverso, assumindo frequncias de bases iguais (Schneider, 2007), a divergncia dos
nucleotdeos foi calculada usando o mesmo modelo. Foi calculado o grau de confiabilidade
dos ramos em todas as rvores utilizando a medida de suporte estatstico no-paramtrico de
bootstrap (Felsenstein, 1985).
Foram realizadas 1000 replicaes, resultando para cada anlise uma rvore de
consenso como resultado, os valores em percentuais foram colocados para cada n interno das
rvores, representando quantas vezes o clado foi recuperado. A significncia para os ramos
obtidos a partir do teste de bootstrap foram considerados nesta ordem: valores fracos (51-
69%), valores moderados (70-94%) e valores significativos maiores que 95% (Hillis e Bull,
1993; Schneider, 2007).
Foi usado para a construo das rvores o programa Mega 5.0 (Tamura et al., 2011).
Para testar a associao entre larvas e adultos da mesma espcie o ramo teria que ter um
suporte alto e estar dentro de um clado monoespecfico (Zhou et al., 2007).
Para determinar os estados ancestrais ou derivados de um determinado carter, foram
includas na analise, sequncias de duas espcies, Macrostemum ulmeri Banks, 1913 e
Smicridea catherinae Blahnik, 1995, (esta ltima foi utilizada a sequncia obtida do GenBank
cdigo (HM065092.1)), como grupo externo, pois so esses grupos que permitem a
polarizao, e foram utilizada duas espcies de gneros diferentes, corroborando com alguns
autores, por indicarem a incluso de mais de um grupo externo em estudos filogenticos,
evitando assim que paralelismos em um dos grupos externos resultem em falsas interpretaes
sobre a evoluo de caracteres no grupo interno (Miyaki et al., 2001).

5. RESULTADOS E DISCUSSO

Este estudo foi capaz de associar de forma eficiente larvas de 5 espcies j conhecidas
(M. bifidum, M. exophthalmum, M. pennyi, M. hageni, M. fragile) e 3 espcies novas
(Macronema sp. nov. 3, Macronema sp. nov. 6, Macronema sp. nov. 7) totalizando 8

15
associaes. Para as espcies M. bifidum, M. exophthalmum foram confirmadas suas
associaes por meio do mtodo metamorftipo (Milne, 1938; Wiggins, 1996a), confirmando
assim a confiabilidade da ferramenta molecular no emprego da associao; M. fragile foi
associada apenas pelo metamorftipo, pois as larvas utilizadas eram antigas e no foi possvel
a extrao do DNA.
O tamanho estimado do fragmento de DNA do gene COI neste estudo foi de 606 pares
de bases para os 44 espcimes, sendo 20 sequncias para larvas anteriormente morfotipadas,
20 sequncias de 8 espcies j descritas e 2 de espcies novas (Tabela: 1)
Todas as associaes estavam dentro dos trs critrios rigorosos de separao (Figura
1) propostas por Zhou et al.,2007, sendo eles:
1. uma ou mais larvas tero que ser idnticas para um ou mais adultos atravs de ambos
os genes sequenciados, tendo as sequncias parecidas;
2. a larva considerada associada quando fica dentro de um clado com adultos
identificados;
3. a condio mostrada (figura 2C) exigiria uma amostragem maior de adultos adicionais
da mesma espcie at satisfazer um dos dois critrios anteriores.

Zhou et al. (2007) recomendam mais genes para associar larvas e adultos para espcies
de Trichoptera, no entanto outros trabalhos conseguiram sucesso em suas associaes e
delimitaes de espcies utilizando apenas um gene (COI), para a ordem Trichoptera (Graf et
al.,2005; 2009; Waringer et al.,2008; Pauls, et al., 2010) e para a ordem Coleoptera (Miller et
al., 2005, 2007).

Figura 1: No item A a larva considerada associada se as sequncias do mesmo fragmento de gene so


similares. No item B a larva considerada associada quando for um grupo irmo (monofiletismo com ancestral
mais recente) dos adultos identificados. No item C exigiria uma maior amostragem de adultos adicionais da
mesma espcie at que a larva ficasse dentro de um dos dois critrios anteriores (Adaptado de Zhou et al., 2007).

16
A mdia da composio nucleotdica das sequncias de COI para o gnero
Macronema mostrou uma alta porcentagem para timina (42,1%) e adenina (31,3%). No grupo
externo no houve diferena significativa na composio nucleotdica, para a espcie
Macrostemum ulmeri foi de T=40,1% e A=34,0% e para Smicridea catherinae foi de
T=41,1% e A=32,8%, mostrando que tal porcentagem comum do genoma mitocondrial de
artrpodes (Wilson et al., 2000).
Houve diferenas na topologia das rvores de Neighbor-Joining (Fig. 2) e Mxima
Verossimilhana (Fig. 4) em relao aos 11 grupos formados e 10 grupos para a rvore de
Mxima Parcimnia (Fig. 3). Os grupos ficaram em posies diferentes nas trs rvores, mas
no foram alterados, mostrando a robustez dos clados. Os dois espcimes adultos da espcie
M. argentilineatum no foram recuperados no mesmo clado na anlise de Mxima Parcimnia
(Fig. 4), devido sua variao intraespecfica ser muito elevada, mas no ficou relacionada
com a espcie M. bifidum que foi a espcie que teve a divergncia interespecfica mais
prxima de M. argentilineatum com 9,78% (Tab. 4).
A eficincia do DNA Barcoding depende muito de clados bem compreendidos e uma
relao com espcies bem amostradas. Para a maioria das espcies analisadas at agora existe
um Gap Barcoding onde a variao intraespecfica no pode ultrapassar a divergncia
interespecfica, mas tambm existe uma sobreposio entre as duas divergncias Overlap
(Meyer e Paulay, 2005).
Wiemers e Fiedler (2007) defendem que estudos com DNA Barcode precisam ser
combinados com outros dados, para a resoluo clara da delimitao das espcies.
Os seis espcimes de M. exophthalmum formaram um clado muito robusto (bootstrap
= 100), os valores tambm foram altos para a associao das outras sete espcies.
A variao gentica intraespecfica foi baixa para quase todas as espcies exceto para
M. argentilineatum e M. hageni (Tab. 3) que apresentaram os valores de 10,18% e 5,76%,
respectivamente. Em outro estudo, essa caracterstica foi observada em duas espcies da
famlia Hydropsychidae que apresentaram uma variao intraespecfica prxima a 12%,
enquanto que os menores valores estavam prximos de 7%, bem diferente da maioria dos
valores interespecficos que geralmente variaram entre 12-18% (Pauls et al., 2010). Outras
espcies estudadas por Zhou et al. (2007), Hydropsyche ovatus, Mexipsyche grahami,
Mexipsyche rhomboana e Mexipsyche n. sp. Cdigo 20060413_01, apresentaram uma
variao intraespecfica de 9,04%, 11,75%, 6,38%, e 10,48%, respectivamente, onde estes
dois estudos encontraram espcies que possuem uma alta variao intraespecfica, acima de
3%.

17
As espcies Macronema exophthalmum, M. bifidum, M. pennyi, Macronema sp. nov.1,
Macronema sp. nov. 6, Macronema sp. nov. 7, apresentaram uma variao intraespecfica de
3%, limite este estabelecido como gap barcoding (Smith et al.,2005) (Tabela 3).
A rvore obtida atravs da anlise de Neighbor-Joining (Fig. 3) foi similar rvore de
Mxima verossimilhana (Fig. 5), porm s foi observada diferena em relao topologia,
no alterando a associao das espcies e relaes filogenticas entre as espcies.
Para Macronema sp. nov. 1 foram associados macho e a fmea com um suporte alto
(bootstrap = 100) no tendo nenhuma larva associada, este elevado suporte foi obtido nas trs
rvores consenso (Fig. 3 5).

18
Tabela 3: Espcies de Macronema com COI sequenciado em 2012
Espcie/ morftipo Estgio de vida Voucher N Localizao Data Coletores
Brasil, Amazonas
M. argentilineatum Macho EXT5M.argAd#1 Manaus, Reserva Ducke, Igarap Bolvia 01-03.ii.2012 T.A.S. Vidovix
M. argentilineatum Macho EXT5M.argAd#6 Presidente Figueiredo, BR AM-240, Km 18,5 26.viii.2009 R. Boldrini
M. exophthalmum Fmea EXT7M.exoAd1# Presidente Figueiredo, BR AM-240, Km 18,5 26.viii.2009 R. Boldrini
M. bifidum Fmea EXT7M.biAd3# Manaus, Reserva Ducke, Ig. Bolvia 01-03.ii.2012 T.A.S. Vidovix
Macronema sp. nov. 6 Macho EXT16M.sp.n.6Ad#2 Manaus, Reserva Ducke, Ig. Barro Branco 16.iii.2010 C.B. Souza
M. exophthalmum Macho EXT5M.exoAd#4 Presidente Figueiredo, BR AM-240, Km 18,5 26.viii.2009 R. Boldrini
M. fragile Macho EXT16M.fraAd#1 Manaus, Reserva Ducke, Ig. Barro Branco 29.vii.2010 C.B. Souza
M. bifidum Macho EXT3M.fraAd#5 Manaus, Reserva Ducke, Ig. Bolvia 01-03.ii.2012 T.A.S. Vidovix
Macronema sp. 1 Larva EXT2M.sp.3L#1 Manaus, Reserva Ducke, Ig. L1 afluente do Ig. Acar 05.i.2012 T.A.S. Vidovix
M. pennyi Macho EXT13M.penAd#2 Manaus, Reserva Ducke, Ig. Barro Branco 23.xi.2011 T.A.S. Vidovix
Macronema sp. nov. 6 Macho EXT14M.sp.n.6#6 Manaus, Reserva Ducke, Ig. Afluente do Ig. Acar 03.viii.2012 T.A.S. Vidovix
M. pennyi Macho EXT16M.penAd#3 Manaus, Reserva Ducke, Ig. Barro Branco 29.vii.2010 C.B. Souza
M. bifidum Larva EXT2M.bifL#3 Manaus, Reserva Ducke, Ig. 13 afluente do Ig. Acar 25.i.2012 T.A.S. Vidovix
M. hageni Fmea EXT16M.haAd#6 Presidente Figueiredo, Pousada Sossego da Pantera, Ig. da Ona 14-16.vii.2012 A.M.O. Pes
Macronema sp. nov. 1 Fmea EXT16M.sp.n.1#5 Presidente Figueiredo, Pousada Sossego da Pantera, Ig. da Ona 14-16.vii.2012 A.M.O. Pes
Macronema sp. nov. 3 Fmea EXT16M.sp.n.3#7 Presidente Figueiredo, Pousada Sossego da Pantera, Ig. da Ona 14-16.vii.2012 A.M.O. Pes
Macrostemum ulmeri Macho EXT18Mct.ulmAd#14 Manaus, Reserva Ducke, Ig. Barro Branco 16.iii.2010 J.L.V. Lima e Pes
Macronema sp. nov. 2 Macho EXT18M.sp.n.2Ad#18 Manaus, Reserva Ducke, Ig. Barro Branco 16.iii.2010 J.L.V. Lima e Pes
M. exophthalmum Larva EXT18M.exoL#13 Manaus, Reserva Ducke, Ig. 12 afluente do Ig. Bolvia 01.ii.2012 T.A.S. Vidovix
Macronema sp. nov. 1 Macho EXT18M.sp.n.1Ad#19 Presidente Figueiredo, Pousada Sossego da Pantera, Ig. da Ona 14-16.vii.2012 A.M.O. Pes
Macronema sp. nov. 3 Macho EXT18M.sp.n.3Ad#15 Manaus, Reserva Ducke, Ig. Barro Branco 28.vii-03.viii.12 T.A.S. Vidovix
M. percitans Fmea EXT13M.perAd#1 Barcelos, Rio Arac, Emb. do Rio Demene 07.viii.2009 N.Hamada e Pes
Macronema sp. nov. 7 Larva EXT18M.sp.n.7L#7 Manaus, Reserva Ducke, Ig. 13 afluente do Ig. Bolvia 01.ii.2012 T.A.S. Vidovix
Continuao...
M. hageni Larva EXT18M.haL#10 Manaus, Reserva Ducke, Ig. Acar 02.vii.2010 C.B. Souza
Macronema sp. nov. 7 Fmea EXT9M.sp.n.7Ad#3 Manaus, Reserva Ducke, Ig. Acar 25.i.2012 T.A.S. Vidovix
Macronema sp. nov. 7 Fmea EXT9M.sp.n.7Ad#4 Manaus, Reserva Ducke, Ig. Acar 25.i.2012 T.A.S. Vidovix
Macronema sp. nov. 6 Larva EXT17M.sp.n.6L#4 Manaus, Reserva Ducke, Ig. Bolvia 05.viii.2010 C.B. Souza
Macronema sp. 9 Larva EXT15M.sp.9L#1 Manaus, Reserva Ducke, Ig. Bolvia 05.viii.2010 C.B. Souza
M. percitans Fmea EXT11M.perAd#2 Barcelos, Rio Jauari Pt. 431 23-24.vii.2009 N.Hamada e Pes
M. hageni Fmea EXT11M.haAd#3 Barcelos, Rio Jauari Pt. 431 23-24.vii.2009 N.Hamada e Pes
M. pennyi Larva EXT17M.peL#2 Manaus, Reserva Ducke, Ig. Acar 24.i.2012 T.A.S. Vidovix
M. exophthalmum Larva EXT18M.exoL#1 Barcelos, Ig. da Anta Pt. 647 22.vii.2009 A.M.O. Pes
M. hageni Larva EXT18M.haL#5 Barcelos, Rio Acar Pt 630 04.viii.2009 A.M.O. Pes
M. exophthalmum Larva EXT18M.exoL#6 Barcelos, Bacuquara Ig. Car 29.vii.2009 A.M.O. Pes
Macronema. sp. 8 Larva EXT18M.sp.8L#3 Barcelos, Rio Acar Pt 630 04.viii.2009 A.M.O. Pes
Macronema sp. nov. 3 Larva EXT18M.sp.n3L#7 Manaus, Reserva Ducke, Ig. 13 afluente do Ig. Bolvia 01.ii.2012 T.A.S. Vidovix
Macronema sp. 10 Larva EXT18M.sp.L#11 Presidente Figueiredo, Pousada Sossego da Pantera, Ig. da Ona 06.i.2010 A.M.O. Pes
Macronema sp. nov. 3 Larva EXT17M.sp.n.3#1 Manaus, Reserva Ducke, Ig. Barro Branco 21.i.2010 C.B. Souza
M. exophthalmum Larva EXT18M.exoL#2 Manaus, Reserva Ducke, Ig. 13 afluente do Ig. Acar 25.i.2012 T.A.S. Vidovix
Macronema sp. nov. 7 Larva EXT10M.sp.n.7L#2 Manaus, Reserva Ducke, Ig. 32 afluente do Ig. Acar 24.i.2012 T.A.S. Vidovix
Macronema sp. nov. 7 Larva EXT10M.sp.n.7L#3 Manaus, Reserva Ducke, Ig. 32 afluente do Ig. Acar 24.i.2012 T.A.S. Vidovix
M. bifidum Larva EXT10M.biL#5 Manaus, Reserva Ducke, Ig. 32 afluente do Ig. Acar 24.i.2012 T.A.S. Vidovix
M. bifidum Larva EXT10M.biL#7 Manaus, Reserva Ducke, Ig. 32 afluente do Ig. Acar 24.i.2012 T.A.S. Vidovix
Smicridea catherinae Larva (HM 065092.1) GenBank

20
Tabela 4: Valores de distncia gentica baseados no modelo Kimura-2-Parmetros.
Espcies Limites da distncia
Macronema argentilineatum 0,1018
M. bifidum 0
M. exophthalmum 0 - 0,0033
M. fragile --
M. hageni 0 - 0,0576
M. pennyi 0,0050 - 0,0204
M. percitans 0
Macronema sp. nov. 7 0
Macronema sp. nov. 1 0,0101
Macronema sp. nov. 2 --
Macronema sp. nov. 3 0 - 0,0033
Macronema sp. nov. 6 0,0055 - 0,0186
Onde: -- Indica nenhuma distncia disponvel, pois apenas um espcime foi sequenciado.

Neste estudo o gene mitocondrial COI DNA Barcoding foi uma ferramenta robusta
para associar os estgios de vida larva e adulto, identificar e separar as espcies do gnero
Macronema. O emprego do Barcoding vem crescendo elevadamente na identificao de
espcies e vrios outros interesses na biodiversidade do mundo. A biodiversidade da
Amaznia ainda pouco explorada, devido ao nmero de taxnomos ser baixo alm da
velocidade do desmatamento. A taxonomia integrativa uma excelente abordagem para a
identificao das espcies e sua diversidade, facilitando e otimizando o trabalho dos
taxonomistas.
Figura 2: Reconstruo filogentica pelo mtodo de Neighbor-Joining utilizando sequncias de COI para larvas
e adultos de espcies do gnero Macronema usando o mtodo Kimura-2-parmetros com anlise de bootstrap
com 1000 rplicas.

22
Figura 3: Reconstruo filogentica pelo mtodo da Mxima Parcimnia utilizando sequncias de COI para
larvas e adultos de espcies do gnero Macronema com anlise de bootstrap com 1000 rplicas.

23
Figura 4: Reconstruo filogentica pelo mtodo de Mxima Verossimilhana utilizando sequncias de COI
para larvas e adultos de espcies do gnero Macronema usando o mtodo Kimura-2-parmetros com anlise de
bootstrap com 1000 rplicas.

24
Tabela 5: Distncia Interespecfica utilizando o modelo K2P das sequncias do gene mitocondrial Citocromo Oxidase Subunidade I (COI) entre espcies dos gneros
Macronema, Macrostemum e Smicridea da famlia Hydropsychidae.

Cdigo/espcie 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22
1. M. argentilineatum
2. M. argentilineatum 0,1018
3. M. exophthalmum 0,1171 0,1429
4. M. bifidum 0,0978 0,1114 0,1151
5. Macronema sp. nov. 6 0,1720 0,1613 0,1716 0,1677
6. M. exophthalmum 0,1171 0,1429 0,0000 0,1151 0,1716
7. M. fragile 0,1556 0,1410 0,1457 0,1411 0,1893 0,1457
8. M. bifidum 0,0978 0,1114 0,1151 0,0000 0,1677 0,1151 0,1411
9. Macronema sp. 1 L 0,0959 0,0959 0,1113 0,0644 0,1613 0,1113 0,1329 0,0644
10. M. pennyi 0,1056 0,1171 0,0865 0,1112 0,1719 0,0865 0,1354 0,1112 0,1055
11. Macronema sp. nov. 6 0,1574 0,1490 0,1571 0,1532 0,0169 0,1571 0,1764 0,1532 0,1469 0,1572
12. M. pennyi 0,1074 0,1152 0,0828 0,1093 0,1552 0,0828 0,1334 0,1093 0,1017 0,0255 0,1409
13. M. bifidum L 0,0978 0,1114 0,1151 0,0000 0,1677 0,1151 0,1411 0,0000 0,0644 0,1112 0,1532 0,1093
14. M. hageni 0,1408 0,1408 0,1550 0,1289 0,1695 0,1550 0,1375 0,1289 0,1308 0,1269 0,1611 0,1328 0,1289
15. Macronema sp. nov. 1 0,1379 0,1352 0,1455 0,1172 0,1829 0,1455 0,1771 0,1172 0,1250 0,1419 0,1725 0,1338 0,1172 0,1823
16. Macronema sp. nov. 3 0,1210 0,1328 0,1288 0,1328 0,1632 0,1288 0,1535 0,1328 0,1230 0,1348 0,1509 0,1268 0,1328 0,1468 0,1498
17. Macrostemum ulmeri 0,1780 0,1842 0,1780 0,1782 0,2019 0,1780 0,1936 0,1782 0,1738 0,1781 0,1888 0,1823 0,1782 0,1612 0,2063 0,1653
18. Macronema sp. nov. 2 0,1249 0,1429 0,1329 0,1409 0,1678 0,1329 0,1431 0,1409 0,1288 0,1211 0,1594 0,1230 0,1409 0,1489 0,1499 0,1491 0,1886
19. M. exophthalmum L 0,1151 0,1408 0,0017 0,1131 0,1738 0,0017 0,1436 0,1131 0,1093 0,0847 0,1591 0,0810 0,1131 0,1529 0,1434 0,1308 0,1759 0,1309
20. Macronema sp. nov. 1 0,1441 0,1475 0,1498 0,1233 0,1916 0,1498 0,1839 0,1233 0,1291 0,1502 0,1789 0,1420 0,1233 0,1934 0,0101 0,1604 0,2154 0,1583 0,1477
21. Macronema sp. nov. 3 0,1210 0,1328 0,1288 0,1328 0,1632 0,1288 0,1534 0,1328 0,1229 0,1348 0,1509 0,1268 0,1328 0,1468 0,1497 0,0033 0,1694 0,1490 0,1308 0,1602
22. M. percitans 0,1450 0,1510 0,1533 0,1230 0,1886 0,1533 0,1617 0,1230 0,1055 0,1390 0,1717 0,1309 0,1230 0,1429 0,1552 0,1490 0,1955 0,1572 0,1512 0,1616 0,1489
23. M. sp. novaC L 0,1288 0,1368 0,1230 0,1308 0,1825 0,1230 0,1656 0,1308 0,1268 0,1288 0,1635 0,1151 0,1308 0,1674 0,1337 0,1469 0,2192 0,1369 0,1210 0,1398 0,1469 0,1328
24. M. hageni L 0,1408 0,1408 0,1550 0,1289 0,1695 0,1550 0,1375 0,1289 0,1308 0,1269 0,1611 0,1328 0,1289 0,0000 0,1823 0,1468 0,1612 0,1489 0,1529 0,1934 0,1468 0,1429
25. M. sp. nov. C 0,1288 0,1368 0,1230 0,1308 0,1825 0,1230 0,1656 0,1308 0,1268 0,1288 0,1635 0,1151 0,1308 0,1674 0,1337 0,1469 0,2192 0,1369 0,1210 0,1398 0,1469 0,1328
26. M. sp. nov. C 0,1288 0,1368 0,1230 0,1308 0,1825 0,1230 0,1656 0,1308 0,1268 0,1288 0,1635 0,1151 0,1308 0,1674 0,1337 0,1469 0,2192 0,1369 0,1210 0,1398 0,1469 0,1328
27. M. sp. nova 6 L 0,1574 0,1449 0,1612 0,1532 0,0186 0,1612 0,1807 0,1532 0,1469 0,1614 0,0050 0,1450 0,1532 0,1632 0,1724 0,1509 0,1887 0,1636 0,1633 0,1832 0,1509 0,1738
28. M. sp9 L 0,1192 0,1348 0,1597 0,1558 0,1763 0,1597 0,1626 0,1558 0,1512 0,1514 0,1639 0,1514 0,1558 0,1572 0,1624 0,1431 0,1634 0,1411 0,1618 0,1712 0,1430 0,1683
29. M. percitans 0,1450 0,1510 0,1533 0,1230 0,1886 0,1533 0,1617 0,1230 0,1055 0,1390 0,1717 0,1309 0,1230 0,1429 0,1552 0,1490 0,1955 0,1572 0,1512 0,1616 0,1489 0,0000
30. M. verif_ F 0,1209 0,1170 0,1348 0,1209 0,1716 0,1348 0,1330 0,1209 0,1131 0,1170 0,1591 0,1190 0,1209 0,1035 0,1574 0,1449 0,1822 0,1449 0,1328 0,1658 0,1449 0,1390
31. M. pennyi L 0,1074 0,1132 0,0810 0,1054 0,1656 0,0810 0,1334 0,1054 0,0997 0,0050 0,1511 0,0204 0,1054 0,1288 0,1379 0,1288 0,1801 0,1250 0,0791 0,1462 0,1288 0,1370
32. M. exophthalmum L 0,1171 0,1429 0,0000 0,1151 0,1716 0,0000 0,1457 0,1151 0,1113 0,0865 0,1571 0,0828 0,1151 0,1550 0,1455 0,1288 0,1780 0,1329 0,0017 0,1498 0,1288 0,1533
33. M. hageni L 0,1408 0,1488 0,1551 0,1289 0,1675 0,1551 0,1356 0,1289 0,1388 0,1210 0,1571 0,1289 0,1289 0,0576 0,1784 0,1572 0,1614 0,1409 0,1530 0,1895 0,1571 0,1389
34. M. exophthalmum L 0,1151 0,1408 0,0017 0,1131 0,1738 0,0017 0,1436 0,1131 0,1093 0,0847 0,1591 0,0810 0,1131 0,1529 0,1434 0,1308 0,1759 0,1309 0,0000 0,1477 0,1308 0,1512
35. M. sp. 8 L 0,1209 0,1170 0,1348 0,1209 0,1716 0,1348 0,1330 0,1209 0,1131 0,1170 0,1591 0,1190 0,1209 0,1035 0,1574 0,1449 0,1822 0,1449 0,1328 0,1658 0,1449 0,1390
36. Macronema sp. nov. 3 L 0,1230 0,1349 0,1308 0,1348 0,1612 0,1308 0,1556 0,1348 0,1249 0,1368 0,1530 0,1288 0,1348 0,1489 0,1519 0,0017 0,1674 0,1512 0,1328 0,1625 0,0050 0,1511
37. Macronema sp.10 L 0,1408 0,1512 0,1535 0,1552 0,1867 0,1535 0,1455 0,1552 0,1511 0,1532 0,1759 0,1470 0,1552 0,1511 0,1746 0,1469 0,2062 0,1469 0,1514 0,1813 0,1469 0,1614
38. Macronema sp. nov. 3 L 0,1210 0,1328 0,1288 0,1328 0,1632 0,1288 0,1535 0,1328 0,1230 0,1348 0,1509 0,1268 0,1328 0,1468 0,1498 0,0000 0,1653 0,1491 0,1308 0,1604 0,0033 0,1490
39. M. exophthalmum L 0,1190 0,1449 0,0017 0,1170 0,1737 0,0017 0,1477 0,1170 0,1132 0,0884 0,1591 0,0847 0,1170 0,1570 0,1454 0,1308 0,1780 0,1349 0,0033 0,1497 0,1308 0,1553
40. M. sp_novaC L 0,1288 0,1368 0,1230 0,1308 0,1825 0,1230 0,1656 0,1308 0,1268 0,1288 0,1635 0,1151 0,1308 0,1674 0,1337 0,1469 0,2192 0,1369 0,1210 0,1398 0,1469 0,1328
41. M. sp_novaC L 0,1288 0,1368 0,1230 0,1308 0,1825 0,1230 0,1656 0,1308 0,1268 0,1288 0,1635 0,1151 0,1308 0,1674 0,1337 0,1469 0,2192 0,1369 0,1210 0,1398 0,1469 0,1328
42. M. bifidum L 0,0978 0,1114 0,1151 0,0000 0,1677 0,1151 0,1411 0,0000 0,0644 0,1112 0,1532 0,1093 0,0000 0,1289 0,1172 0,1328 0,1782 0,1409 0,1131 0,1233 0,1328 0,1230
43. M. bifidum L 0,0978 0,1114 0,1151 0,0000 0,1677 0,1151 0,1411 0,0000 0,0644 0,1112 0,1532 0,1093 0,0000 0,1289 0,1172 0,1328 0,1782 0,1409 0,1131 0,1233 0,1328 0,1230
44. Smicridea catherinae 0,1906 0,1736 0,2058 0,1993 0,2284 0,2058 0,2236 0,1993 0,2015 0,2059 0,2127 0,1928 0,1993 0,2327 0,2260 0,2281 0,2192 0,2147 0,2036 0,2377 0,2281 0,2307
Continuao....

23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44

0,1674
0,0000 0,1674
0,0000 0,1674 0,0000
0,1677 0,1632 0,1677 0,1677
0,1593 0,1572 0,1593 0,1593 0,1638
0,1328 0,1429 0,1328 0,1328 0,1738 0,1683
0,1348 0,1035 0,1348 0,1348 0,1632 0,1449 0,1390
0,1249 0,1288 0,1249 0,1249 0,1552 0,1493 0,1370 0,1170
0,1230 0,1550 0,1230 0,1230 0,1612 0,1597 0,1533 0,1348 0,0810
0,1758 0,0576 0,1758 0,1758 0,1550 0,1514 0,1389 0,0978 0,1230 0,1551
0,1210 0,1529 0,1210 0,1210 0,1633 0,1618 0,1512 0,1328 0,0791 0,0017 0,1530
0,1348 0,1035 0,1348 0,1348 0,1632 0,1449 0,1390 0,0000 0,1170 0,1348 0,0978 0,1328
0,1490 0,1489 0,1490 0,1490 0,1530 0,1451 0,1511 0,1469 0,1308 0,1308 0,1592 0,1328 0,1469
0,1612 0,1511 0,1612 0,1612 0,1759 0,1513 0,1614 0,1493 0,1512 0,1535 0,1451 0,1514 0,1493 0,1490
0,1469 0,1468 0,1469 0,1469 0,1509 0,1431 0,1490 0,1449 0,1288 0,1288 0,1572 0,1308 0,1449 0,0017 0,1469
0,1249 0,1570 0,1249 0,1249 0,1632 0,1617 0,1553 0,1368 0,0828 0,0017 0,1572 0,0033 0,1368 0,1328 0,1555 0,1308
0,0000 0,1674 0,0000 0,0000 0,1677 0,1593 0,1328 0,1348 0,1249 0,1230 0,1758 0,1210 0,1348 0,1490 0,1612 0,1469 0,1249
0,0000 0,1674 0,0000 0,0000 0,1677 0,1593 0,1328 0,1348 0,1249 0,1230 0,1758 0,1210 0,1348 0,1490 0,1612 0,1469 0,1249 0,0000
0,1308 0,1289 0,1308 0,1308 0,1532 0,1558 0,1230 0,1209 0,1054 0,1151 0,1289 0,1131 0,1209 0,1348 0,1552 0,1328 0,1170 0,1308 0,1308
0,1308 0,1289 0,1308 0,1308 0,1532 0,1558 0,1230 0,1209 0,1054 0,1151 0,1289 0,1131 0,1209 0,1348 0,1552 0,1328 0,1170 0,1308 0,1308 0,0000
0,1928 0,2327 0,1928 0,1928 0,2127 0,2080 0,2307 0,2191 0,1993 0,2058 0,2372 0,2036 0,2191 0,2303 0,2258 0,2281 0,2080 0,1928 0,1928 0,1993 0,1993

26
5.1. Descries e Material Examinado

Macronema argentilineatum Ulmer, 1905

(Fig. 5)

Macronema argentilineatum Ulmer, 1905:77 [descrio original, macho, distribuio]; Flint,


1966: 6 [macho, asas do holtipo]; Macronema polygramma Navs, 1927a: 42 [sinonmia,
macho]; Flint, 1978:392, 402 [sinonmia, distribuio].
5

Figura 5: Macronema argentilineatum. Macho em vista dorsal.

Material examinado: BRASIL Amazonas, Manaus, Reserva Ducke, Igarap Barro Branco,
025546,7 S 595822,00 O, 04-08.ii.2010, L.C. de Pinho e H. Mendes leg., 4 machos
[lcool]; mesmos dados, exceto 16.iii.2010, C.B. de Souza leg., 1 macho [lcool]; mesmos
dados, exceto 23.ix.2011, T.A.S. Vidovix e L.M. de Camargos leg., 2 machos [lcool];
Igarap Bolvia, 025919,6 S 595648,3 O, 01-03.ii.2012, T.A.S. Vidovix leg., 3 machos
[lcool]; Igarap Acar, 025605 S 595716 O, 25.i.2012, T.A.S. Vidovix leg., 2 machos
[lcool]; Igarap Tinga, 025915 S 595313 O, 10-13.vi.2012, T.A.S. Vidovix leg., 1
macho [lcool]; Manaus, Km 18, 5, AM-240, 024900,8 S 600205,6 O, 26.viii.2009, R.
Boldrini leg., 1 macho [lcool].

Distribuio geogrfica: Brasil (Amazonas), Guiana e Suriname.

Bionomia: Esta espcie foi encontrada em arbustos prximos a igaraps de 1 2 e 3 ordem,


sendo atradas por armadilhas de luz. No foi associada larva desta espcie, desconhecendo
assim o comportamento deste estgio.
Macronema bifidum Flint, 1974

(Fig. 6 10)
Macronema bifidum Flint, 1974c: 113 [Descrio original, macho, distribuio]; Paprocki,
2008 [distribuio].
6

Figura 6: Macronema bifidum. Macho em vista dorsal.

Diagnose: Larva: Macronema bifidum se assemelha a Macronema sp. 3, pela ausncia de


cerdas curtas e grossas (espinhosas) na margem interna do fmur e pela presena de uma srie
contnua de cerdas espatuladas curtas, no entanto M. bifidum possui 10 cerdas, enquanto que
Macronema sp. 3 possui 12. Estas duas espcies tambm se diferenciam na colorao da
cabea e na disposio das marcas de inseres musculares. Macronema sp. 3 possui
colorao marrom escuro na cabea, e poucas manchas de inseres musculares e M. bifidum
tem colorao amarelo claro com diversas manchas marrons das inseres musculares. A
cabea de M. bifidum similar a M. hageni e Macronema sp. 2, devido a distribuio de
marcas de inseres musculares, mas diferem no formato da cabea, sendo que M. bifidum
possui uma cabea estreitada e alongada, enquanto que M. hageni e Macronema sp. 2,
possuem uma cabea alargada e semicircular na margem posterior, diferem tambm no
formato e disposio das cerdas no fmur das pernas anteriores, enquanto que o fmur de M.
bifidum possui uma srie de 11 cerdas espatuladas, no tendo cerdas curtas e grossas, as
outras duas possuem um tufo de cerdas espatuladas e possuem cerdas curtas e grossas. Pupa:
As pupas de M. bifidum possuem o par da placa de ganchos abdominais dorsais do segmento
III (3a) semelhante ao de M. fragile, com trs ganchos na direita e dois ganchos na esquerda; a
placa de ganchos dorsais (3p) assemelha-se a M. variipenne no formato, mas difere no
nmero de ganchos; o par de placas de ganchos dorsais do segmento IV (4a) so semelhantes
ao de M. exophthalmum, pois no possuem ganchos; o par de placas de ganchos dorsais (4p)

28
assemelha-se a M. variipenne no formato e sentido dos ganchos, voltados anteriormente,
diferindo das pupas M. exophthalmum e M. fragile, placas de ganchos dorsais (4p) que
possuem os ganchos voltados posteriormente. Os pares das placas de ganchos (5a), (6a), (7a)
(8a) so similares a M. fragile, porm os ganchos de M. bifidum so mais contrados e a placa
(8a) esquerda, difere no nmero e tamanho, esta possui dois ganchos pequenos, enquanto que
M. fragile possui somente um gancho grande.

Descrio: Larva - Comprimento 19-20 mm (n = 3), escleritos e pernas amarelos com


marcaes musculares de cor marrom na cabea e trax, corpo revestido por poucas cerdas
(Fig. 8 A). Cabea, sub-retangular levemente mais longa que larga; dorsalmente com
colorao amarela com algumas marcaes das inseres musculares de cor marrom escuro;
cutcula recoberta por cerdas longas e finas; cerdas nas posies 1, 7, 12, 17 presentes, cerdas
curtas e grossas na regio mediana e latero-dorsal, sutura coronal longa, cerca de 1/3 do
comprimento da cabea. Frontoclpeo com a margem anterior ligeiramente cncava, par de
manchas levemente mais clara na regio mediana, trs pares de cerdas curtas na margem
anterior (Fig. 8 F). Gena ventral sem cerdas; colorao amarela clara; inseres musculares
mais escuras na regio mediana posterior; sutura de ecdise ventral somente de um lado (Fig. 8
G). Vista lateral com linha reta de cerdas espinhosas curtas dos olhos at a regio mediana
posterior (Fig. 8 H). Mandbulas em vista dorsal, assimtricas, curtas e largas, linha lateral da
margem externa convexa com cerdas longas (cerca de cinco), colorao amarela com a
margem interna e o pice marrom escuro, margem interna de cada mandbula com um
pequeno dente truncado, sem escova de cerdas. Mandbula esquerda em vista lateral
triangular, com trs dentes na regio apical; mandbula direita, em vista dorsal, trapezoidal,
mais curta que a esquerda, com regio apical pontiaguda e um pequeno dente mediano na
margem interna, em vista dorsal (Fig. 8 D), com trs dentes em vista lateral. Labro curto, duas
vezes mais largo que longo, regio anterior com uma constrio mediana e margens
arredondadas, regio mediana anterior recoberta por uma linha de nove cerdas mdias em
cada lbulo e diversas cerdas curtas, escova de cerdas laterais ausentes (Fig. 8 C). Trax,
Pronoto amarelo na metade anterior e marrom na metade posterior, meso e matanoto amarelos
com marcas de inseres musculares de cor marrom, recobertos por cerdas curtas e mdias
muito finas. Pronoto subdividido longitudinalmente; com uma constrio marcada dividindo o
esclerito verticalmente, metade anterior reta com uma linha uniforme de cerdas mdias
(espinhosas) esparsas at a regio mediana, metade posterior mais escura; sem cerdas com
manchas das inseres musculares (Fig. 8 B). Prosternito em vista ventral com colorao

29
marrom claro escuro no centro; margem anterior e posterior com uma protuberncia central,
formando um ngulo agudo; invaginao mediana presente; bordas laterais largas (Fig. 8E).
Margem anterior do mesonoto com cerdas curtas (espinhosas) e esparsas na regio mediana e
posterior, intercaladas por muitas cerdas finas e curtas, marcaes musculares de colorao
marrom escuro. Metanoto 1/3 mais largo que longo, margem da regio anterior com poucas
cerdas mdias e finas, cerdas finas e curtas distribudas, marcaes musculares de colorao
marrom (Fig. 8 B). Primeiro par de pernas com vrias cerdas curtas e espinhosas e finas e
longas; trocantim curto e estreito com a regio apical truncada e arredondada, com uma ou
duas cerdas grossas (espinhosa) na margem dorsal, coxa curta e larga com muitas cerdas
curtas e grossas, intercaladas por cerdas finas de tamanho mdio, margem dorsal com uma ou
duas cerdas (espinhosa) em vista lateral (Fig. 9 A); fmur longo e estreito, comprimento cerca
de duas vezes e meia a largura, levemente curvado em vista lateral, margem dorsal com uma
cerda dorsomediana e uma apicodistal, ambas curtas e grossas (espinhosas) (Fig. 9 B, C),
margem ventral com 10-11 cerdas espatuladas curtas e arredondadas (Figs. 9 B, D, F).
Segundo e terceiro par de pernas similares, longas e finas, recobertas por cerdas longas e finas
e por cerdas curtas e grossas (espinhosas) (Fig. 9 E). Par de brnquias torcicas simples
ventrais no metanoto. Abdmen branco e poucas cerdas longas e finas espaadas; brnquias
com muitos filamentos dispostos simetricamente (Fig. 8 A). Tufo de cerdas laterais finas e
longas em cada segmento. Regio ventral dos segmentos abdominais VIII e IX com tufo de
cerdas longas e finas; escleritos ventrais claros, com muitas cerdas longas e finas. Papilas
anais retradas. Garras das falsas pernas anais, longas e finas, com uma constrio mediana,
com muitas cerdas longas e finas na base (Fig. 8A).

Ventro-
S D DD DD D D S(R) S(R) S S(R) S(R) S S (R) S
lateral
Ventral
MESO META I II III IV V VI VII VIII
Figura 7: Macronema bifidum. Diagrama da posio e tipo de brnquias do meso, metanoto e segmentos
abdominais I-VIII. S = um filamento simples, sem ramificaes laterais. S(R) = um filamento simples, com
ramificaes laterais. D = dois filamentos simples ramificados (S(R)), de uma mesma base comum.

Pupa - Comprimento 8,5 mm (n = 1). Cabea: Retangular, com quatro cerdas longas
distribudas no vrtice da cabea em vista dorsal. Labro curto e semicircular com um tufo de
cerdas curtas na margem anterior, um par de lbulos arredondados basolaterais, com quatro
cerdas curtas. Mandbulas membranosas, retradas, com margem semitriangular. Antenas
compridas, afiladas, ultrapassando o comprimento do corpo, no envolvendo o abdmen (Fig.

30
10 A). Trax: Meso-e metanoto com cerdas curtas e finas esparsas e um conjunto de cerdas
finas na regio posterior do mesonoto. Pernas medianas com tbias e tarsos achatados e
franjados na margem. Abdmen: Presena de brnquias laterais, nos segmentos I-VIII.
Regio dorsal com pares de placas de ganchos anteriores (a) presentes nos segmentos
abdominais 38 e placas de ganchos posteriores nos segmentos 34 (Fig. 10 C). Par de placas
(3a) com dois ganchos em cada par; par de placas (3p) com 18 a 21 ganchos pequenos; placa
(4a) simples sem gancho proeminente, (4p) placa com 9 a 11 voltados para a regio anterior;
(5a7a) com 1 gancho simples e longo voltado para a regio posterior e 8a com 1 gancho
longo e 1 curto. Processo apical bilobado arredondado lateralmente, com uma densa franja de
cerdas escuras, longas e finas na margem posterior (Fig. 10 B).

Material examinado: BRASIL, Amazonas, Manaus, Reserva Ducke, Igarap Acar,


025605 S 595716 O, 25.i.2012, T.A.S. Vidovix leg., 2 machos [lcool]; mesmos dados
exceto, Igarap 13 afluente do Ig. Acar, 025656,0 S 595653,9 O, 3 larvas [lcool];
mesmos dados exceto, Igarap 32 afluente do Ig. Acar, L-O 3: 2.900 m, 24.i.2012, 2 larvas
[lcool]; mesmos dados exceto, 03.viii.2010, C.B. de Souza leg., 1 larva [lcool]; mesmos
dados exceto, 24.i.2012, T.A.S. Vidovix leg., 1 larva [lcool]; Igarap Bolvia, 025511,0 S
595942,6 O, 30.i.2012 a 01.ii.2012, T.A.S. Vidovix leg., 7 machos [lcool]; Igarap
afluente do Ig. Bolvia, 025952,8 S 595647,9 O, 05.viii.2010, C.B. de Souza leg., 2
larvas [lcool]; Igarap 12 afluente do Ig. Bolvia, 025919,6 S 0595648,3 O, U.G. Neiss
leg., 3 larvas [lcool]; Igarap Barro Branco, 02 5546,7 S 59 5822,00 O, C. de S. Barros
leg., 1 larva [lcool]; Barcelos, Com. Bacuquara, Igarap Cor, 0008'48,12"N 6309'58,7"O,
29.vii.2009, A. M. O. Pes e N. Hamada leg., 1 larva [lcool]; P.F. Stio do Rodrigo, Viru, 23-
25.ii.2007, A. M. O. Pes leg., 1 pupa [lcool]; Ig. Bolvia, 025919,6 S 595648,3 O, 01-
03.ii.2012, 1 fmea [lcool]; mesmos dados exceto, 1 macho [lcool];

Distribuio: Suriname, Guiana, Brasil (Amazonas) (Novo Registro).

Binmia: Esta espcie foi encontrada em igaraps de 1 2 e 3 ordem, localizados em reas


de mata fechada (terra firme), encontradas nos igaraps de Barcelos e Reserva Ducke. As
larvas foram encontradas prximas a corredeiras em razes localizadas nas margens. Os
adultos foram encontrados em arbustos prximos dos igaraps, atrados por armadilhas
luminosas.

31
Figura 8: Larva de Macronema bifidum. A. Corpo - vista lateral; B. Trax - vista dorsal; C. Labro - vista dorsal;
D. Mandbulas - vista ventral; E. Prosternito- vista ventral; F. Cabea - vista dorsal; G. Cabea - vista ventral; H.
Cabea - vista lateral.

32
Figura 9: Larva de Macronema bifidum. A. Trocantim e coxa da perna anterior - vista dorsolateral; B. Fmur da
perna anterior - vista dorsolateral; C. Fmur da perna anterior - vista dorsal; D. Fmur da perna anterior - vista
ventral; E. Pernas anterior, mediana e posterior - vista dorsolateral; F. Cerdas espatuladas na margem do fmur
da perna anterior - vista lateral.

33
10

Figura 10: Pupa Macronema bifidum. A. Cabea - vista ventral; B. Processo pical - vista dorsal. C. Placas em
forma de gancho - vista dorsal (3a 8a), nmero dos segmentos abdominais, a = anterior e p = posterior.

34
Macronema burmeisteri Banks, 1924

(Fig. 11)
Macronema burmeisteri Banks, 1924: 452 [Descrio original, fmea, asas]; Flint, 1967: 9
[lecttipo]; 1978: 393, 402 [macho, asas, distribuio]; Flint e Bueno, 1979: 527 [macho].

11
Figura 11: Macronema burmeisteri. Asa anterior do macho, vista dorsal.

Material examinado: Amazonas, Presidente Figueiredo, Pousada Sossego da Pantera,


Igarap da Ona, 020052 S 600143 O, 3-4.v.2000, A. M. O. Pes leg., 1 macho [lcool].

Distribuio geogrfica: Brasil (Amazonas), Costa Rica, Equador, Nicargua, Panam, Peru.

Bionomia: Esta espcie foi encontrada em arbustos prximos a igaraps de 1 2 e 3 ordem,


sendo atradas por armadilhas de luz. No foi associada larva desta espcie, desconhecendo
assim o comportamento deste estgio.

Macronema exophthalmum Flint, 1978


(Fig. 12-16)
Macronema exophthalmum Flint, 1978:391, 401 [descrio original; macho, asas,
distribuio].
Diagnose: Larva de Macronema exophthalmum difere das demais espcies por possuir
cabea marrom escura delimitada com marcas de inseres musculares amarelas. M.
exophthalmum similar a M. hageni e Macronema sp. 5, pela perna anterior com fmur
alargado e tufo de cerdas espatuladas na margem ventral, mas diferem no nmero de cerdas,
no qual, M. exophthalmum contm trs cerdas curtas e grossas e 9-11 cerdas espatuladas, e M.
hageni tem duas cerdas curtas e grossas e 11 a 12 cerdas espatuladas e Macronema sp. 5 com
duas cerdas curtas e grossas e trs cerdas espatuladas. Pupa esta espcie difere das demais
espcies por possuir escleritos abdominais direitos (5a 8a) com trs ganchos enquanto M.

35
variipenne possui dois ganchos, M. bifidum e M. fragile possuem apenas um gancho. M.
exophthalmum possui o esclerito abdominal (4a) simples sem gancho, similar M. bifidum;
placa (4p) de M. exophthalmum semelhante a M. fragile, pelo mesmo nmero de ganchos e
a mesma direo (voltados para a regio posterior).
Descrio: Larva - Comprimento 17-21 mm (n = 5), escleritos e pernas marrom claros com
manchas de inseres musculares escuras na cabea e trax, corpo revestido por numerosas
cerdas longas e finas (Fig. 14 A). Cabea: sub-retangular, levemente mais longa que larga,
dorsalmente com uma mancha marrom escura delimitada marcada por manchas das inseres
musculares claras; cutcula recoberta por cerdas curtas e grossas at a margem da sutura
clipeal e numerosas cerdas longas e finas; cerdas nas posies 1, 4, 7, 11 e 12 presentes,
cerdas curtas e grossas na regio mediana e lateral, sutura coronal longa, cerca de 1/3 do
comprimento da cabea. Frontoclpeo com a margem anterior ligeiramente cncava, um par
de manchas clara na regio mediana, seis manchas claras das inseres musculares no pice
da margem posterior, um par de cerdas na regio anterior (Fig. 14 F). Gena ventrolateral com
poucas cerdas curtas da regio lateral, amarela clara, sutura de ecdise ventral somente de um
lado (Fig. 14 G). Vista lateral com duas fileiras de cerdas curtas e grossas, quase em linha reta
abaixo dos olhos at a regio mediana posterior, (Fig. 14 H). Mandbulas em vista dorsal,
colorao amarela com a margem interna e o pice marrom escuro, assimtricas, curtas e
largas, formato triangular, linha lateral da margem externa convexa com cerdas (variando
entre 11-14), sem escova de cerdas na margem interna. Mandbula esquerda com dois dentes
na regio apical em vista lateral, margem interna sem dentes; mandbula direita mais curta que
a esquerda, com dois dentes na regio apical em vista lateral, um pequeno dente truncado
mediano na margem interna, sulco margeando desde o dente mediano at o pice (Fig. 14 D).
Labro curto, duas vezes mais largo que longo, regio anterior com uma constrio mediana e
margens arredondadas, regio mediana anterior recoberta por uma linha de 14 cerdas mdias
em cada lbulo e numerosas cerdas curtas, escova de cerdas laterais ausentes (Fig. 14 C).
Trax: tergitos torcicos amarelos com marcas de insero musculares escuras, recobertos
por cerdas curtas a mdias muito finas. Pronoto subdividido verticalmente, mais largo na
regio anterior; regio mediana com uma constrio vertical bem marcada, margem anterior
reta com uma linha uniforme de esparsas cerdas curtas e grossas, cerdas mdias e longas 1, 2,
5, 13, 22 presentes, regio posterior lisa com marcas das inseres musculares (Fig. 14 B).
Prosternito em vista ventral de colorao marrom claro escuro nas laterais, margem anterior e
posterior com uma protuberncia central (Fig. 14 E). Mesonoto quadrado, margem da regio
anterior com numerosas cerdas curtas e finas, margem mediana anterior com algumas cerdas

36
curtas e grossas e cerdas longas e finas, marcas de inseres musculares escuras na regio
posterior. Metanoto levemente mais largo que longo, com numerosas cerdas curtas e finas na
margem anterior, marcas de inseres musculares escuras lateralmente na regio posterior,
regio ventral com um par de brnquias simples com base esclerosada (Fig. 14 B). Primeiro
par de pernas com numerosas cerdas curtas e grossas e cerdas finas e longas. Trocantim curto
com a regio apical truncada arredondada com duas cerdas grossas e curtas na margem dorsal;
coxa estreita e longa com numerosas cerdas longas e finas, e numerosas cerdas curtas e
grossas na margem ventrolateral (Fig. 15 A). Trocnter com vrias cerdas espatuladas longas
e estreitas. Fmur estreito e longo, levemente convexo em vista dorsal (Fig. 15 C),
comprimido e lateralmente com muitas cerdas longas e finas (Fig. 15 B), regio ventral
mediana com trs cerdas curtas e grossas e um conjunto de 9-11 cerdas espatuladas longas e
estreitas, agrupadas na margem ventral proximal (Figs. 15 B, F). Segundo e terceiro par de
pernas similares, longas e finas recobertas por numerosas cerdas longas e finas e por cerdas
curtas e grossas (Fig. 15 E). Par de brnquias torcicas simples ventrais no metanoto.
Abdmen, lils com numerosas cerdas longas e finas e cerdas finas e curtas; brnquias com
muitos filamentos dispostos simetricamente (Fig. 14 A). Tufos de cerdas longas e finas em
cada segmento lateral. Regio ventral dos segmentos abdominais VIII e IX com tufo de cerdas
longas e finas, escleritos ventrais claros, com muitas cerdas finas e longas. Papilas anais
retradas. Garras das falsas pernas anais, longas e finas, com uma constrio mediana com
muitas cerdas longas e finas (Fig. 14 A).
Pupa- Comprimento 9 mm , macho (n = 1) (Fig. 16 A). Cabea: Semicircular, com um par
de cerdas longas no vrtice da cabea em vista dorsal. Labro curto e semicircular com um tufo
de cerdas curtas na margem anterior, 28 minsculas cerdas afinaladas distribudas na regio
anterior, um par de lbulos arredondados basolaterais, com seis cerdas curtas. Mandbulas
membranosas retradas, com margem semitriangular. Antenas compridas, afinaladas, pice
enrolado, ultrapassando o comprimento do corpo, no envolvendo o abdmen (Fig. 16 C).
Trax: Meso-e metanota com trs pares de cerdas distribudas na regio lateral. Pernas
medianas com tbias e tarsos legeiramente achatados e franjados nas margens laterais.
Abdmen: Possui brnquias laterais, nos segmentos I-VIII. Regio dorsal com placas de
ganchos: pares de placas de ganchos anteriores (a) presentes nos segmentos abdominais 38 e
placas de ganchos posteriores presentes nos segmentos 3-4 (Fig. 16 B). Par de placas (3a) com
seis ganchos na placa esquerda e quatro ganchos na placa direita; placa (3p) esquerda com
quarenta e um ganchos pequenos e direita com cinquenta ganchos; placa (4a) simples sem
gancho proeminente, placa (4p) direita com onze ganchos e esquerda com oito, dispostos em

37
linha reta; placa (5a) esquerda com dois ganchos, direita com trs ganchos; placa (6a)
esquerda e direita tendo trs ganchos; placas (7a-8a) com a mesma quantidade, com dois
ganchos na placa esquerda e trs ganchos na placa direita. Processo apical em vista dorsal,
com uma densa franja de cerdas, com dois lbulos arredondados, algumas cerdas curtas e
finas distribudas na margem posterior do IX segmento (Fig. 16 D).

12

Figura 12: Macronema exophthalmum. Asa anterior do macho, vista dorsal.

Ventro-lateral S D DD DD DD S(R) S S(R) S S (R) S


Ventral
MESO META I II III IV V VI VII VIII
Figura 13: Macronema exophthalmum. Diagrama das bifurcaes e posio das brnquias do mesonoto,
metanoto e dos segmentos abdominais I-VIII. S = um filamento central afinalado simples, sem filamentos finos
laterais. S(R) = um filamento central simples, com ramificaes laterais. D = dois filamentos simples
ramificados (S(R)), de uma mesma base comum.

Material examinado: BRASIL Amazonas, Manaus: Reserva Ducke, Igarap Barro Branco,
025546,7 S 595822,00 O, 21.i.2010, C.B. de Souza leg., 9 larvas [lcool]; mesmos
dados, exceto, 16.iii.2010, 4 larvas [lcool]; mesmos dados exceto, 18.xi.2011, T.A.S.
Vidovix leg., 1 larva [lcool]; Igarap Bolvia, 025511,0 S 595942,6 O, 05.viii.2010,
C.B. de Souza leg., 1 larva [lcool]; mesmos dados exceto, 01-03.ii.2012, 1 macho [lcool];
Igarap 12 afluente do Ig. Bolvia, 025919,6 S 595648,3 O, 15.x.2009, U.G. Neiss leg.,
1 larva [lcool]; mesmos dados exceto, 01.ii.2012, T.A.S. Vidovix leg., 4 larvas [lcool];
Igarap 13 afluente do Ig. Bolvia, 025923,6 S 59 5721,3 O, 01.ii.2012, T.A.S. Vidovix
leg., 4 larvas [lcool]; Igarap 21 afluente do Ig. Bolvia, 025907,4 S 595540,7 O, 01-
03.ii.2012, T.A.S. Vidovix leg., 9 larvas [lcool]; Igarap Acar, 025605 S 595716 O,
02.viii.2010, C.B. de Souza leg., 6 larvas [lcool]; mesmos dados, exceto 24.i.2012, T.A.S.
Vidovix leg., 1 larva [lcool]; Igarap 13 afluente do Ig. Acar 025656,0 S 59 5653,9
38
O, 03.viii.2010, C.B. de Souza leg., 1 larva [lcool]; mesmos dados exceto, 25.i.2012, T. A. S.
Vidovix leg., 6 larvas [lcool]; Ig. 32 afluente do Ig. Acar, 24.i.2012, T. A. S. Vidovix leg., 2
larvas [lcool]; Igarap 13 afluente do Ig. Ipiranga, 025912,8 S 595614,3 O, 11.ii.2012,
T. A. S. Vidovix leg., 2 larvas [lcool]; Igarap 21 afluente do Ig. Ipiranga, 025852,4 S
595402,9 O, 12.ii.2012, T.A.S. Vidovix leg., 2 larvas [lcool]; Igarap Ipiranga,
025853,1 S 59 5405,5 O, 13.ii.2012, T.A.S. Vidovix leg., 1 larva [lcool]; Igarap
Barro Branco, 025546,7 S 595822,00 O, 16.iii.2010, C.B. de Souza leg., 1 macho
[lcool]; mesmos dados exceto, Ig. Tinga, 10-13.vi.2002, A. M. O. Pes leg., 1 pupa [lcool];
Manaus, Km 18, AM-240, 024900,8 S 600205,6 O, 26.viii.2009, R. Boldrini leg., 2
machos e 1 fmea [lcool]; mesmos dados, exceto 27.x.2009, R. Boldrini leg., 2 machos
[lcool]; Presidente Figueiredo, Igarap do Sr. Jos Souza, Ramal do km 24, AM 240,
020106 S 594927 O, 24.ii.2000, A. M. O. Pes leg., 3 machos [lcool]; pousada Sossego
da Pantera, Igarap da Ona, 020052 S 600143 O, 3-4.v.2000, A. M. O. Pes leg., 1
macho [lcool]; mesmos dados, exceto 24.vii.2012, T. A. S. Vidovix e P. Barcelos leg., 1
macho [lcool]; mesmos dados exceto, 06.i.2010, A. M. O. Pes e V. Souza leg., 14 larvas
[lcool]; mesmos dados exceto Igarap do Et, 03.viii.2000, A. M. O. Pes leg., 1 pupa
[lcool].].

Distribuio geogrfica: Brasil (Amazonas).

Bionomia: As larvas foram encontradas prximas a corredeiras em razes localizadas nas


margens de igaraps de 1 2 e 3 ordem, localizados em reas de mata fechada (terra firme),
esta espcie uma das mais abundantes nos igaraps de Presidente Figueiredo e Reserva
Ducke (Pes, 2005). Hbito herbvoro foi observado nas larvas, devido o contedo intestinal,
onde foram encontrados diversos fragmentos de razes, assim como nas demais espcies de
Macronema. A pupa foi encontrada fixa nas razes em remanso. Os adultos foram coletados,
atrados por armadilhas luminosas, ou de interceptao de vo.

39
14

Figura 14: Larva de Macronema exophthalmum. A. Corpo - vista lateral. B. Trax - vista dorsal. C. Labro -
vista dorsal. D. Mandbulas - vista ventral. E. Prosternito - vista ventral. F. Cabea - vista dorsal; G. Cabea -
vista ventral. H. Cabea - vista lateral.

40
Figura 15: Larva de Macronema exophthalmum. A. Trocantim e coxa da perna anterior - vista dorsolateral. B.
Fmur da perna anterior - vista ventral. C. Fmur da perna anterior - vista dorsal. D. Fmur da perna anterior -
vista ventrolateral. E. Pernas anterior, mediana e posterior - vista dorsolateral. F. Cerdas espatuladas e espinhos
na margem do fmur da perna anterior - vista lateral.

41
Figura 16: Pupa Macronema exophthalmum. A. Pupa - vista dorsal; B. Placas em forma de gancho - vista dorsal
(3a 8a), nmero dos segmentos abdominais, a = anterior e p = posterior; C. Cabea - vista ventral; D. Processo
pical - vista dorsal.

42
Macronema fragile Banks, 1915
(Figs. 17 21)

Macronema fragile Banks, 1915:631 [descrio original]; Flint, 1967: 10 [holtipo, macho];
1978: 403 [macho, asas, distribuio], Pes, 2005 [larva, bionomia (como Macronema sp. 4)];
Paprocki, 2008 [macho, asas, distribuio].

Diagnose: Larva M. fragile difere das demais espcies por possuir a regio dorsal da cabea
recoberta por uma densa camada de pequenas cerdas finas e no apresentar cerdas curtas e
grossas (espinhosas), tambm possui na margem ventral do fmur das pernas anteriores, sete
cerdas curtas e grossas (espinhosas) e ausncia de cerdas espatuladas. O fmur da perna
anterior de M. fragile, semelhante Macronema sp. 5 por ser alargado e globoso, mas difere
por apresentar apenas quatro cerdas curtas e grossas na margem ventral e quatro cerdas
espatuladas. Pupa de Macronema fragile se diferencia das outras espcies por possuir no
pice do IX segmento uma margem ondulada com trs projees de cada lado, j para M.
bifidum o pice reto com um par de projees e M. exophthalmum o pice tem a margem
levemente arredondada. O esclerito abdominal 3a de M. fragile assemelha o da M. bifidum no
nmero e formato, tendo trs ganchos no lado esquerdo e dois no direito em M. fragile, j em
M. bifidum possui dois ganchos nos dois lados. Os escleritos abdominais dos segmentos 5a,
6a, 7a, 8a possuem apenas um forte gancho, diferindo das demais espcies.
Descrio: Larva - Comprimento 9-12 mm (n = 3), escleritos e pernas amarelos, cabea com
marcas de inseres musculares claras, regio anterior do corpo revestido por poucas cerdas
curtas e finas (Fig. 19 A). Cabea: subarredondada, to longa quanto larga. Dorsalmente com
colorao amarela alaranjada, com manchas de inseres musculares difusas, e a cutcula
recoberta por numerosas cerdas finas e curtas, incluindo o frontoclpeo, cerdas curtas e
grossas ausentes. Frontoclpeo com a margem anterior ligeiramente cncava, com um par de
cerdas longas e finas (Fig. 19 F). Gena ventral amarelo alaranjada, com algumas cerdas curtas
e grossas ventrolateralmente (Fig. 19 G); sutura de ecdise ventral somente de um lado. Gena
em vista lateral recoberta por uma densa camada de cerdas muito finas e curtas e cerdas curtas
e grossas (espinhosas) situadas prximas dos olhos (Fig. 19 H). Mandbulas em vista dorsal,
amarelas com a margem interna e o pice marrom escuro, assimtricas, curtas e largas com
formato triangular, linha lateral da margem externa convexa com 4 a 7 cerdas curtas e finas,
escova de cerdas da margem interna ausentes; mandbula esquerda com dois dentes na regio
apical em vista lateral, margem interna sem dentes; mandbula direita mais curta que a
esquerda, com dois dentes na regio apical em vista lateral, um pequeno dente truncado

43
mediano na margem interna (Fig. 19 D). Labro curto, duas vezes mais largo que longo, regio
anterior com uma constrio mediana e margens arredondadas, regio mediana anterior
recoberta por poucas cerdas curtas a mdias e finas (Fig. 19 C). Trax: prosternitos marrom
claros, recobertos por numerosas cerdas finas e curtas. Pronoto subdividido
longitudinalmente, regio mediana com uma constrio vertical marcada, margem anterior
cncava, com uma linha uniforme de cerdas finas e curtas, cerdas curtas e grossas nas laterais,
metade posterior lisa com manchas das inseres musculares (Fig. 19 B). Prosternito em vista
ventral de colorao marrom claro com as laterais pretas, margem anterior e posterior com
uma protuberncia central, regio mediana de colorao marrom escuro, bordas laterais
estreitas (Fig. 19 E). Mesonoto to largo quanto longo, margem anterior reta, cerdas finas e
curtas distribudas uniformemente. Metanoto mais largo que longo, margem anterior reta, com
uma srie de cerdas finas pequenas, e cerdas finas e curtas (Fig. 19 B). Primeiro par de pernas
curtas, com cerdas longas e finas e cerdas curtas e grossas espinhosas; trocantim truncado e
quadrado sem espinhos, coxa curta e larga, com vrias cerdas mdias e algumas cerdas curtas
e grossas (Fig. 20 A). Trocnter, com cerdas longas e finas e cerdas espatuladas ausentes.
Fmur curto e largo em vista dorsal e dorsolateral (Figs. 20 B, C), margem ventral
arredondada com cinco cerdas fortes, grossas e curtas, cerdas espatuladas ausentes (Figs. 20
B, D). Segundo e terceiro par de pernas, longas e estreitas recobertas por cerdas longas e finas
e por cerdas curtas e grossas. Segundo par de pernas com a coxa alongada com vrias cerdas
curtas e grossas distribudas em linha reta na regio mediana da coxa e margem ventral do
fmur e tbia, terceiro par de pernas com a coxa mais larga e com poucas cerdas curtas e
grossas (Fig. 20 E). Par de brnquias torcicas simples ventrais no metanoto. Abdmen:
marrom claro, com algumas cerdas curtas e finas na regio posterior, brnquias com muitos
filamentos dispostos simetricamente. Tufo de cerdas longas e finas em cada segmento lateral.
Regio ventral dos segmentos abdominais VIII e IX com tufo de cerdas finas e longas,
escleritos ventrais claros, com numerosas cerdas finas e longas. Papilas anais retradas. Garras
das falsas pernas anais, longas e finas, com uma constrio mediana, com muitas cerdas
longas e finas na base (Fig. 19 A).
Pupa (macho farado) - Comprimento 7 mm, macho (n = 1) (Fig. 21 A). Cabea: Retangular,
com seis cerdas longas, um par de cada lado da cabea e um par na margem anterior central
em vista dorsal. Labro curto e semicircular com um tufo de cerdas curtas na margem anterior,
16 minsculas cerdas finas distribudas na regio anterior, um par de lbulos arredondados
basolaterais, com sete cerdas curtas. Mandbulas membranosas retradas, com margem
subtriangular. Antenas compridas, finas com pice enrolado, ultrapassando o comprimento do

44
17
Figura 17: Macronema fragile. Asa anterior do macho, vista dorsal.

Ventro-lateral S D D S(R) D D S(R) S S(R) S S (R) S


Ventral
MESO META I II III IV V VI VII VIII
Figura 18: Macronema fragile. Diagrama das bifurcaes e posio das brnquias do meso, metanoto e
segmentos abdominais I-VIII. Onde: S = um filamento central fino simples, sem filamentos finos laterais. S(R) =
um filamento central simples, com ramificaes laterais. D = dois filamentos simples ramificados (S(R)), de uma
mesma base comum.

corpo, no envolvendo o abdmen (Fig. 21 C). Trax: Meso-metanoto com um par de cerdas
distribudas lateralmente. Pernas medianas com tbias e tarsos legeiramente achatados e
franjados nas margens laterais. Abdmen: Possui brnquias laterais, nos segmentos I-VIII.
Regio dorsal com placas de ganchos: pares de placas de ganchos anteriores (a) presentes nos
segmentos abdominais 3 8 e placas de ganchos posteriores presentes nos segmentos 3 4
(Fig. 21 B). Par de placas (3a) com quatro pequenos ganchos e direita com dois ganchos; par
de placas (3p) esquerda com 20 ganchos pequenos e direita com 16; par de placas (4a) com
um gancho, par de placas (4p) direita com 11 ganchos e esquerda com 8, direcionados para a
regio posterior; par de placas (5a) com um gancho curto e grosso; par de placas (6a8a) com
um gancho longo e fino (Fig. 21 B). Processo apical em vista dorsal, com trs pares de cerdas
finas; com dois pares de lobos e uma densa franja de cerdas escuras, longas e finas na margem
posterior do IX segmento (Fig. 21 D).

Material examinado: BRASIL Amazonas, Manaus: Reserva Ducke, Igarap Barro Branco,
025546,7 S 595822,00 O, 29.vii.2010, C.B. de Souza leg., 1 macho [lcool];Ig. 15
afluente do Ig. Bolvia, 17.v.2002, A.M.O. Pes leg., 4 larvas [lcool]; Presidente Figueiredo,
Reserva Biolgica do Uatum, Ponto #15, 014850 S 591621 O, 22.viii.2008, J.L.D.
Albino leg., 1 pupa farada macho [lcool].

Distribuio geogrfica: Brasil (Amazonas), Guiana e Suriname.

45
19

Figura 19: Larva de Macronema fragile. A. Corpo - vista lateral. B. Trax - vista dorsal. C. Labro - vista dorsal.
D. Mandbulas - vista lateral. E. Prosternito - vista lateral. F. Cabea - vista dorsal. G. Cabea vista ventral. H.
Cabea - vista lateral.

46
Figura 20: Larva de Macronema fragile. A. Trocantim e coxa da perna anterior - vista dorsolateral. B. Fmur da
perna anterior - vista ventral. C. Fmur da perna anterior - vista dorsal. D. Espinhos distribudos na margem
ventrolateral da perna anterior vista lateral. E.Pernas anterior, mediana e posterior - vista dorsolateral.

47
21

Figura 21: Pupa Macronema fragile. A. Pupa - vista dorsal; B. Placas em forma de gancho - vista dorsal (3a
8a), nmero dos segmentos abdominais, a = anterior e p = posterior; C. Cabea - vista ventral; D. Processo apical
- vista dorsal.

48
Macronema hageni Banks, 1924

(Figs. 22-25)

Macronema hageni Banks, 1924: 452 [descrio original, distribuio]; Flint, 1967: 10
[lecttipo, macho, asas]; 1978: 392 [distribuio]; 1991: 79 [macho, distribuio, asas];
Blahnik et al., 2004 [distribuio].

Diagnose: Larva de M. hageni difere das demais espcies pela larva possuir no fmur da
perna anterior duas cerdas curtas e grossas e 13 a 15 cerdas espatuladas, similar M. pennyi
e Macronema sp. nov. 6 com relao ao padro de colorao e disposio das marcaes
musculares da cabea, mas difere pela gena em vista ventral que apresenta marcaes
musculares, escuras e bem definidas, j M. pennyi e Macronema sp. nov. 6 no possuem as
marcaes escuras.

Descrio: Larva Comprimento 12-15 mm (n = 4), escleritos e pernas de colorao


amarela com marcas de inseres musculares marrom na cabea e trax, corpo revestido por
poucas cerdas longas e finas (Fig. 24 A). Cabea: subarredondada, levemente mais longa
que larga. Dorsalmente marrom escura com marcas de inseres musculares amarelas,
cutcula recoberta por cerdas longas e finas; cerdas nas posies 1, 7, 12, 17 presentes; cerdas
curtas e grossas presentes na regio mediana, lateral e entorno dos olhos; sutura coronal longa
cerca de 1/3 do comprimento da cabea. Frontoclpeo com a margem anterior ligeiramente
cncava, par de manchas claras emarginada por colorao mais escura na regio mediana,
dois pares de cerdas curtas presentes na margem anterior (Fig. 24 F). Gena ventrolateral
amarelo clara com oito cerdas curtas e grossas, inseres musculares mais escuras na regio
mediana posterior, sutura de ecdise ventral somente de um lado (Fig. 24 G). Vista lateral com
uma fileira de cerdas curtas espinhosas espaadas, quase em linha reta abaixo dos olhos at a
regio mediana posterior (Fig. 24 H). Mandbulas em vista dorsal, amarelas com a margem
interna e o pice marrom escuro; assimtricas, triangulares, curtas e largas, linha lateral da
margem externa convexa com cerca de 9 cerdas longas; mandbula direita trapezoidal, mais
curta que a esquerda, margem interna com um pequeno dente truncado mediano (Fig. 24 D).
Labro curto, duas vezes mais largo que longo, regio anterior com uma forte constrio
mediana e margens arredondadas, regio mediana anterior recoberta por uma linha de 8
cerdas mdias em cada lbulo com numerosas cerdas curtas, escova de cerdas laterais
ausentes (Fig. 24 C). Trax: tergitos torcicos marrom claros, com marcas de inseres
musculares marrom escuras, recobertas por cerdas curtas e mdias muito finas e cerdas curtas

49
e grossas. Pronoto subdividido verticalmente, mais largo que longo, margem anterior convexa
com uma linha uniforme de cerdas mdias espaadas at a regio mediana, metade posterior
lisa com manchas das inseres musculares mais claras (Fig. 24 B). Prosternito marrom claro,
centro de cor marrom escura, margem anterior estendida e pontiaguda (Fig. 24 E). Mesonoto
mais comprido do que largo, margem anterior com cerdas curtas e grossas espaadas na
regio mediana e posterior, intercaladas por algumas cerdas finas e curtas, marcas de
inseres musculares marrom escuras na regio mediana e posterior. Metanoto subtriangular
levemente mais largo que longo, margem da regio anterior com poucas cerdas mdias a finas
e curtas e regio posterior com cerdas finas e curtas, marcas de inseres musculares marrons
na regio mediana posterior (Fig. 24 B). Primeiro par de pernas com numerosas cerdas
curtas finas a longas. Trocantim curto com a regio apical truncada e arredondada, com trs
cerdas curtas e grossas na margem dorsal, coxa longa com muitas cerdas curtas e grossas, e
cerdas finas, longas (Fig. 25 A). Trocnter com vrias cerdas espatuladas longas e finas.
Fmur da perna anterior levemente cncavo em vista dorsal (Fig. 25 C), curvado em vista
dorsolateral, margem dorsal com uma cerda grossa dorsomedina e uma apicodistal (Fig. 25
B), margem ventral com 13 15 cerdas espatuladas longas e finas, agrupadas na margem
ventral proximal e duas cerdas curtas e fortes e numerosas cerdas mdias grossas (Figs. 25 D,
F). Segundo e terceiro par de pernas similares, longas e finas recobertas por cerdas finas,
longas e por cerdas curtas e grossas (Fig. 25 E). Par de brnquias torcicas simples ventrais no
metanoto. Abdmen: Colorao da cutcula branca e algumas cerdas longas e finas
espaadas, brnquias com muitos filamentos dispostos simetricamente (Fig. 24 A) com
tonalidade de lils. Tufo de cerdas longas e finas em cada segmento lateral. Regio ventral
dos segmentos abdominais VIII e IX com tufo de cerdas longas e finas, escleritos ventrais
claros, com muitas cerdas longas e finas. Papilas anais retradas. Garra das falsas pernas anais,
longas e finas, com uma constrio mediana, com muitas cerdas longas e finas na base (Fig.
24 A).

22
Figura 22: Macronema hageni. Asa anterior do macho, vista dorsal.

50
Ventro-lateral S D DD DD D D S(R) S(R) S S(R) S(R) S S (R) S
Ventral
MESO META I II III IV V VI VII VIII
Figura 23: Macronema hageni. Diagrama das bifurcaes e posio das brnquias do mesonoto, metanoto e dos
segmentos abdominais I-VIII. Onde, S = um filamento central fino simples, sem filamentos finos laterais. S(R) =
um filamento central simples, com ramificaes laterais. D = dois filamentos simples ramificados (S(R)), de uma
mesma base comum.

Material examinado: BRASIL, Amazonas, Barcelos, Igarap Serrinha tributrio do rio


Arac, 02.viii.2009, A. M. O. Pes; N. Hamada, 6 larvas [lcool]; mesmos dados exceto,
28.vii.2009, 2 larvas [lcool]; mesmos dados exceto, Rio Jauari Pt. 431, 23-24.vii.2009 1
fmea [lcool]; mesmos dados exceto, Rio Acar Pt. 630, 04.viii.2009, 1 larva [lcool];
Presidente Figueiredo, Pousada Sossego da Pantera, Ig. da Ona, 020052 S 600143 O,
14-16.viii.2012, 1 fmea [lcool].
Distribuio geogrfica: Argentina, Bolvia, Brasil (Amazonas, Minas Gerais e Par),
Colmbia, Equador, Guiana, Paraguai, Peru, Suriname, Venezuela.
Bionomia: As larvas foram encontradas prximas a corredeiras em razes localizadas nas
margens de igaraps de 1 2 e 3 ordem, localizados em reas de mata fechada (terra firme).
As larvas so fragmentadoras, devido o contedo intestinal, onde foram encontrados diversos
fragmentos de razes, assim como nas demais espcies de Macronema.

51
24

Figura 24: Larva de Macronema hageni. A. Corpo - vista lateral. B. Trax - vista dorsal. C. Labro - vista dorsal.
D. Mandbulas - vista ventral. E. Prosternito - vista ventral. F. Cabea - vista dorsal. G. Cabea - vista ventral. H.
Cabea - vista lateral.

52
25

Figura 25: Macronema hageni. Larva. A. Trocantim e coxa da perna anterior - vista dorsolateral. B. Fmur da
perna anterior - vista ventral. C. Fmur da perna anterior - vista dorsal. D. Espinhos distribudos na margem
ventrolateral da perna anterior vista lateral. E. Pernas anterior, mediana e posterior - vista dorsolateral. F.
Cerdas espatuladas vista lateral.

53
Macronema muelleri Banks, 1924

Macronema muelleri Banks, 1924: 453 [Descrio original]; Flint, 1967: 11 [lecttipo,
macho]; 1978: 393, 402 [macho, asas, distribuio]; Paprocki, 2008 [macho, distribuio].

Material examinado: BRASIL, Amazonas, Presidente Figueiredo, Pousada Sossego da


Pantera, Igarap da Ona, 020052 S 600143 O, 18-24.iv.2008, A.M.O. Pes leg., 1
macho [lcool].

Distribuio geogrfica: Brasil (Amazonas) e Venezuela.

Bionomia: Esta espcie foi coletada prximas a igaraps de 4 ordem de fundo rochoso, em
rea de dossel aberto, com presena de vegetao marginal.

Macronema parvum Ulmer, 1905

(Fig. 26)

Macronema parvum Ulmer, 1905: 73 [Descrio original]; Flint, 1966: 7 [lecttipo, macho,
asas]; 1978: 393, 402 [macho, asas, distribuio].

26

Figura 26: Macronema parvum. Macho - vista dorsal.

Material examinado: BRASIL, Amazonas, Presidente Figueiredo, pousada Sossego da


Pantera, Igarap da Ona, 020052 S 600143 O, 3-4.vii.2000, A. M. O. Pes leg., 1 macho
[lcool].

Distribuio geogrfica: Brasil (Amazonas), Guiana e Suriname.

54
Bionomia: Esta espcie foi coletada com armadilha malaise em igaraps de 1 2 e 3 ordens
de fundo arenoso e com deposito de folhas, e razes localizados em mata primria de terra
firme.

Macronema pennyi Flint, 1978

(Fig. 27 30)

Macronema pennyi Flint, 1978: 401 [Descrio original; macho, asas, distribuio]; Paprocki,
2008 [macho, distribuio].

Diagnose: larva de M. pennyi difere das demais espcies por possuir na margem ventral do
fmur da perna anterior com seis cerdas curtas e grossas e trs cerdas espatuladas, labro com
uma constrio reta central na margem anterior e cada lobo lateral com cinco cerdas longas,
similar a Macronema sp. nov. 6, pois ambas apresentam o mesmo padro de colorao e
marcas de inseres musculares, terem o fmur da perna anterior semelhante no formato e
presena de duas cerdas grossas e curtas na margem dorsal, mas diferem no nmero de cerdas
curtas e grossa e das espatuladas, enquanto que M. pennyi possui seis cerdas espinhosas e trs
espatuladas, Macronema sp. nov. 6 possui cinco espinhosas e duas espatuladas.

Descrio: Larva - Comprimento 17-21 mm (n = 4), escleritos e pernas marrom claros com
marcas de inseres musculares escuras na cabea e trax, regio anterior e posterior do corpo
revestido por algumas cerdas longas e finas (Fig. 29 A). Cabea: subretangular, levemente
mais longa que larga. Dorsalmente com colorao marrom com marcas mais escuras das
inseres musculares; cutcula recoberta por cerdas curtas a mdias e finas; cerdas nas
posies 1, 4, 7, 11 e 12 presentes, vrias cerdas curtas e grossas at a margem da sutura
clipeal, margem lateral dos olhos com cerdas curtas e espinhosas. Frontoclpeo com par de
cerdas curtas na regio anterior, colorao marrom escura com um par de manchas claras,
margem anterior ligeiramente cncava (Fig. 29 F). Gena ventral marrom clara com algumas
marcas escuras das inseres musculares, com vrias cerdas curtas e grossas e finas na regio
lateroventral, sutura de ecdise ventral somente de um lado (Fig. 29 G). Vista lateral com
vrias cerdas curtas quase em linha reta abaixo dos olhos, marcas escuras de insero
muscular (Fig. 29 H). Mandbulas em vista dorsal amarelas com a margem interna preta, e
pice marrom escura, assimtricas, curtas e largas, formato triangular, linha lateral da margem
externa convexa com uma srie de 8-13 cerdas, mandbula esquerda com a margem interna
sem dentes, mandbula direita com um dente truncado e pequeno (Fig. 29 D). Labro curto,
duas vezes mais largo que longo, com as laterais globosas e uma constrio no centro da
55
margem anterior e diversas cerdas longas e curtas, base posterior reta (Fig. 29 C). Trax:
tergitos torcicos amarelos com marcas escuras de inseres musculares. Pronoto subdividido
verticalmente, mais alargado na regio anterior. Regio mediana com uma constrio vertical
levemente marcada, margem anterior levemente cncava com uma linha uniforme de cerdas
curtas e grossas e cerdas mdias e longas at a constrio longitudinal, regio posterior
marrom com algumas marcas escuras das inseres musculares (Fig. 29 B). Prosternito em
vista ventral marrom claro escurecido no centro, margem anterior e posterior com uma
protuberncia central (Fig. 29 E). Mesonoto quadrado, margem da regio anterior sem cerdas
espinhosas, sulco mediano convexo margeando at as bordas da regio anterior, diversas
cerdas curtas e finas. Metanoto mais largo que longo, regio anterior reta com vrias cerdas
curtas, sulco mediano margeando at as bordas da regio anterior, com numerosas cerdas
curtas e finas, marcas das inseres musculares presentes. Primeiro par de pernas curtas, com
numerosas cerdas longas e finas (Fig. 30 A); trocantim longo e pice arredondado; coxa curta
com cerdas curtas e grossas, cerdas longas e finas em vista dorsolateral (Fig. 30 A). Trocnter
com vrias cerdas espatuladas longas e estreitas na margem ventral. Fmur estreito, levemente
convexo em vista dorsal, com duas cerdas espinhosas espaadas na regio mediana dorsal e 1
cerda apical, cerdas curtas e mdias presentes (Fig. 30 B, C); regio lateroventral com 5 6
cerdas fortes e curtas (Figs. 30 B, D, F), e 3 cerdas espatuladas curtas (Fig. 30 F). Segundo e
terceiro par de pernas longas e finas recobertas por numerosas cerdas finas, mdias e longas e
por cerdas curtas e grossas (Fig. 30 E). Brnquias torcicas ausentes. Abdmen: lils na
regio dorsal e lateralmente com algumas cerdas longas e finas espaadas, brnquias longas
com muitos filamentos dispostos simetricamente (Figs. 28 29 A). Tufo de cerdas longas e
finas em cada segmento lateral. Regio ventral dos segmentos abdominais VIII e IX com tufo
de cerdas longas e finas, escleritos ventrais claros, com muitas cerdas longas e finas. Papilas
anais retradas. Garras das falsas pernas anais, longas e finas, com constrio mediana com
muitas cerdas longas e finas (Fig. 29 A).

Material examinado: BRASIL, Amazonas, Manaus: Reserva Ducke, Igarap Barro Branco,
025546,7 S 595822,00 O, 16.iii.2010, C.B. de Souza leg., 1 macho [lcool]; mesmos
dados, exceto 29.vii.2010, C.B. de Souza leg., 2 machos [lcool]; mesmos dados, exceto,
23.xi.2012, T.A.S. Vidovix leg., 1 macho [lcool]; Igarap Acar, 025605 S 595716 O,
24.i.2012, T.A.S. Vidovix leg., 1 larva [lcool]. Presidente Figueiredo, Igarap do Sr. Jos
Souza, Ramal do km 24, AM 240, 020106 S 594927 O, 24.ii.2000, A.M.O. Pes leg., 6
machos [lcool].

56
Distribuio geogrfica: Brasil (Amazonas).

Bionomia: As larvas foram encontradas prximas a corredeiras em razes localizadas nas


margens de igaraps de 1 2 e 3 ordem, localizados em reas de mata fechada (terra firme)
com fundo rochoso e arenoso e muitas razes submersas, as larvas so fragmentadoras, pois
foi observado o contedo intestinal, onde foram encontrados somente fragmentos de razes,
assim como nas demais espcies de Macronema.

27

Figura 27: Macronema pennyi. Asa anterior de um macho, vista dorsal.

Ventro-lateral S D D S(R) DD D S(R) S S(R) S(R) S S (R) S


Ventral
MESO META I II III IV V VI VII VIII
Figura 28: Macronema pennyi. Diagrama das bifurcaes e posio das brnquias do mesonoto, metanoto e dos
segmentos abdominais I-VIII. Onde S = um filamento central fino simples, sem filamentos finos laterais. S(R) =
um filamento central simples, com ramificaes laterais. D = dois filamentos simples ramificados (S(R)), de uma
mesma base comum.

57
Figura 29: Macronema pennyi. Larva - vista lateral. B. Trax - vista dorsal. C. Labro - vista dorsal. D.
Mandbulas - vista ventral. E. Prosternito - vista ventral. F. Cabea - vista dorsal. G. Cabea - vista ventral. H.
Cabea - vista lateral.

58
Figura 30: Macronema pennyi. Larva. A. Trocantim e coxa da perna anterior - vista dorsolateral. B. Fmur da
perna anterior - vista ventrolateral. C. Fmur da perna anterior - vista dorsal. D. Fmur da perna anterior - vista
ventral. E. Pernas anterior, mediana e posterior - vista dorsolateral. F. Espinhos distribudos na margem
ventrolateral da perna anterior vista lateral. G. Cerdas espatuladas na margem do fmur da perna anterior -
vista lateral.

59
Macronema percitans Walker, 1860

(Fig. 31)

Macronema percitans Walker, 1860: 177 [Descrio original; macho, distribuio]; Betten e
Mosely 1940: 203 [redescrio, holtipo, macho]; Flint, 1978: 392, 402 [macho, distribuio,
asas]; 1996: 411 [distribuio]; Paprocki, 2008 [macho, asas, distribuio] .

Material examinado: BRASIL, Amazonas, Manaus: Reserva Ducke, Igarap Barro Branco,
025546,7 S 595822,00 O, 23.xi.2011, T.A.S. Vidovix leg., 1 macho [lcool]; mesmos
dados, exceto 02.viii.2012, T.A.S. Vidovix e A.M.P. Junior leg., 1 macho [lcool]; mesmos
dados, exceto, T.A.S. Vidovix leg., 2 fmeas [lcool]; Barcelos, Rio Jauari, Pt. 431, 23-
24.vii.2009, N. Hamada e A.M.O. Pes leg., 1 fmea [lcool]; mesmos dados exceto, Rio
Arac, Emb. do Rio Demene, 07.viii.2009, 1 fmea [lcool].

31

Figura 31: Macronema percitans. Macho, vista dorsal.

Distribuio geogrfica: Brasil (Amazonas, Mato Grosso, Par), Equador, Guiana, Guiana
Francesa, Peru e Suriname.

Bionomia: Esta espcie foi coletada com armadilha de luz, prximas a igaraps de 1 a 3
ordem, com fundo de areia em rea de mata primria.

60
Macronema sp. nov. 1

(Fig. 32-33)

Diagnose: Macronema sp. nov. 1 difere das demais espcies por possuir dois pares de
escleritos falotremal, um fino e alongado e um par curvado em forma de anzol, os dois no
centro do falo em vista ventral, falo bfido em vista ventral. O falo de Macronema sp. nov. 1
em vista lateral se assemelha a M. hageni por ser curto e ter uma projeo ventral no pice,
mas difere por ter a projeo estreita, enquanto M. hageni possui uma projeo larga.

Adulto: Comprimento da asa anterior de 11,5 12 mm (n = 3). Cabea e olhos marrons,


regio mediana coberta por diversas cerdas verdes e brancas prateadas at a base das antenas,
labro retangular, palpos maxilar e labial marrom claros. Pernas marrom claras com o 5
tarsmero marrom escuro. Asa anterior com a regio apical de colorao marrom (em lcool),
regio subapical da asa com duas manchas de cerdas amarelas, duas faixas estreitas de
colorao branca da veia R5 at a Cu1a (possivelmente o trax e parte marrom das asas sejam
cobertos por escamas verdes). Frmula Tibial 0,4,4. Genitlia masculina: tergito IX com
margem anterior ondulada em vista lateral, margem posterior com aproximadamente 16
cerdas longas, presena de curta projeo laterodorsal; margem posterior ligeiramente
cncava (Fig. 33 A, B), apndice inferior longo, pice arredondado, recoberto por cerdas finas
(Fig. 33 A); Segmento X ,vista dorsal com regio apical bfida. Falo curto, pice vista lateral
com um processo ventral externo longo e um interno curto; em vista ventral, processo longo
curvado para dentro (Fig. 33 C), vista ventral com um par de lobos membranosos laterais;
esclerito flico de forma anelar em torno do ducto ejaculatrio em vista ventral e dorsal (Fig.
33 E, F); em vista dorsal com regio apical terminado em processos digitiformes e abertura do
ducto ejaculatrio em fenda (Fig. 33 E).

Material examinado: BRASIL, Amazonas, Presidente Figueiredo, Pousada Sossego da


Pantera, Igarap da Ona, 020052 S 600143 O, 14-16.vii.2012, A.M.O. Pes leg., 2
machos e 1 fmea [lcool].

Distribuio geogrfica: Brasil (Amazonas).

Bionomia: Esta espcie foi coletada com armadilha de luz em igarap de 4 ordem com 12 a
20 m de largura e profundidade entre 0,15 a 1,5 m de profundidade, com fundo rochoso, areia,
seixos, razes e troncos da vegetao marginal, rea de dossel aberto, porem com vegetao
marginal parcial.

61
32
Figura 32: Macronema sp. nov. 1, asa anterior do macho, vista dorsal.

Figura 33: Macronema sp. nov. 1. Genitlia masculina: A vista lateral. B - vista dorsal. C falo vista lateral.
D pice do falo vista lateral. E pice do falo vista ventral. F pice do falo vista dorsal.

62
Macronema sp. nov. 2

(Fig. 34)

Paprocki, 2008 [Macho, asas e distribuio].

Material examinado: BRASIL, Amazonas, Manaus: Reserva Ducke, Igarap Barro Branco,
025546,7 S 595822,00 W, 16.iii.2010, C.B. de Souza leg., 1 macho [lcool]; mesmos
dados, exceto 29.vii.2010 C.B. de Souza leg., 1 macho [lcool].

Distribuio geogrfica: Brasil (Amazonas).

34

Figura 34: Macronema sp. nov. 2, Asa anterior do macho, vista dorsal.

Macronema sp. nov. 3

(Fig. 35-38)

Paprocki, 2008 [Macho, asas e distribuio].

Diagnose, Larva: Macronema sp. nov. 3 difere das demais espcies por possuir o corpo
recoberto de cerdas longas e finas. Cabea de Macronema sp. nov. 3 similar a de
Macronema sp. 3, por ser alongada e no possuir cerdas curtas, mas difere de Macronema sp.
nov. 3 pela colorao marrom escura enquanto que Macronema sp. 3 possui uma colorao
alaranjada. O fmur da perna anterior de Macronema sp. nov. 3, difere de Macronema sp. 3
pelo nmero e formas de cerdas, enquanto que Macronema sp. nov. 3 possui trs cerdas curtas
e grossas e duas a trs cerdas espatuladas, Macronema sp. 3 tem duas cerdas curtas e grossas e
cinco a seis cerdas mdias e grossas e quatro cerdas espatuladas.

63
35

Figura 35: Macronema sp. nov. 3. Asa anterior do macho, vista dorsal.

Descrio: larva - comprimento 24 26 mm (n = 3), escleritos e pernas amarelo claros,


marca de inseres musculares no trax marrom, cabea marrom escura e marca de inseres
musculares amarela, corpo revestido por muitas cerdas longas e finas (Fig. 36 A). Cabea:
retangular, levemente mais longa que larga. Dorsalmente marrom escura com marca de
inseres musculares amarelas, cutcula recoberta por cerdas longas a mdias e finas; cerdas
nas posies 1, 2, 3, 12, 15 presentes, sutura coronal longa, cerca de 1/3 do comprimento da
cabea. Frontoclpeo com a margem anterior ligeiramente cncava, com um par de manchas
claras na regio mediana anterior (Fig. 36 D). Gena ventral amarelo clara com trs pares de
cerdas curtas e finas, inseres musculares claras, presena de cerdas mdias e finas,
lateroventralmente (Fig. 36 E). Vista lateral com linha reta, dos olhos at a regio mediana
posterior de cerdas curtas e finas, constrio na regio anterior logo acima dos omatdeos
(Fig. 36 F). Mandbulas em vista dorsal, amarelas com a margem interna e o pice pretas,
assimtricas, curtas e largas, linha lateral da margem externa convexa com cerdas longas
(cerca de oito), sem escova de cerdas na margem interna. Mandbula esquerda triangular, em
vista lateral com dois dentes regio apical vista lateral; mandbula direita trapezoidal, mais
curta que a esquerda, regio apical pontiaguda e com dois dentes no pice vista lateral, um
pequeno dente truncado mediano na margem interna em vista dorsal. Labro curto, duas vezes
mais largo que longo, regio anterior com uma leve constrio mediana com uma linha de
cerdas curtas, margens laterais arredondadas, regio mediana anterior recoberta por uma
densa camada de cerdas finas de tamanho mdio, em cada lbulo e cerdas curtas e finas
distribudas em toda a superfcie, escova de cerdas laterais ausentes (Fig. 36 C). Trax:
tergitos torcicos amarelos com marcas de inseres musculares marrom claras, recobertos
por cerdas finas de comprimento mdio a longo. Pronoto subdividido verticalmente, margem

64
anterior ligeiramente cncava com uma linha de cerdas mdias e grossas, metade posterior
lisa com marcas das inseres musculares (Fig. 36 B). Prosternito em vista ventral amarelo,
protuberncia central da margem anterior curta e pontiaguda, protuberncia central da
margem posterior estreita. Mesonoto: margem anterior com cerdas finas e curtas e trs pares
de cerdas mdias e grossas nas laterais, algumas cerdas curtas e grossas esparsas na regio
mediana, intercaladas por muitas cerdas longas e curtas finas, marcas de inseres musculares
marrom claras na regio mediana. Metanoto to largo quanto longo, margem da regio
anterior com cerdas mdias e curtas finas, cerdas finas curtas e longas espaadas, marcas de
inseres musculares marrons na regio mediana (Fig. 36 B). Primeiro par de pernas com
cerdas curtas e grossas, e cerdas finas e longas. Trocantim curto com a regio apical
pontiaguda, com uma ou duas cerdas grossas e curtas na margem dorsal, coxa curta e larga
com cerdas longas e finas (Fig. 38 A). Fmur longo e estreito, cncavo em vista lateral,
margem dorsal e ventral com vrias cerdas longas e finas (Fig. 38 B), margem ventral com
duas cerdas curtas, grossas e trs cerdas mdias e duas cerdas espatuladas (Figs. 38 B, D).
Segundo e terceiro par de pernas similares, segundo par de pernas com vrias cerdas longas e
finas e cerdas curtas e grossas, terceiro par de pernas com poucas cerdas longas, coxa longa
(Fig. 38 E). Um par de brnquias torcicas simples presentes ventrais no metanoto.
Abdmen: Colorao da cutcula lils, com muitas cerdas longas e finas espaadas em vista
dorsal e lateral, brnquias com muitos filamentos dispostos simetricamente (Figs. 36 A 37).
Tufo de cerdas longas e finas em cada segmento lateral. Regio ventral dos segmentos
abdominais VIII e IX com tufo de cerdas finas e longas, diversas cerdas longas (tufo de
cerdas), escleritos ventrais claros, com muitas cerdas finas e longas. Papilas anais presentes,
curtas. Garras das falsas pernas anais, longas e finas, com uma constrio mediana, com
muitas cerdas longas e finas da base at as garras (Fig. 38 A).

Material examinado: BRASIL, Amazonas, Manaus: Reserva Ducke, Igarap Acar 0256
05 S 595716 O, 24.i.2012, T.A.S. Vidovix leg., 1 larva [lcool]; Igarap Barro Branco,
025546,7 S 595822,00 O, data, C.B. de Souza leg., 1 larva [lcool]; mesmos dados
exceto, 28.vii-03.viii.2012, T.A.S. Vidovix leg., 1 macho [lcool]; Presidente Figueiredo,
Pousada Sossego da Pantera, Ig. da Ona, 020052 S 600143 O, 14-16.vii.2012, A.M.O.
Pes leg., 1 fmea [lcool].

65
Ventro-lateral S DDD DD DD DD S(R) S(R) S(R) S(R) S S(R) S
Ventral
MESO META I II III IV V VI VII VIII
Figura 36: Macronema sp. nov. 3. Diagrama das bifurcaes e posio das brnquias do mesonoto, metanoto e
dos segmentos abdominais I-VIII. Onde S = um filamento central fino simples, sem filamentos finos laterais.
S(R) = um filamento central simples, com ramificaes laterais. D = dois filamentos simples ramificados (S(R)),
de uma mesma base comum.

37

Figura 37: Larva de Macronema sp. nov. 3. Legenda: A. Corpo - vista lateral. B. Trax - vista dorsal. C. Labro -
vista dorsal. D. Cabea - vista dorsal. E. Cabea - vista ventral. F. Cabea - vista lateral.

66
Figura 38: Macronema sp. nov. 3. Larva A. Trocantim e coxa da perna anterior - vista dorsolateral. B. Fmur da
perna anterior - vista ventrolateral. C. Fmur da perna anterior - vista dorsal. D. Espinhos e cerdas espatuladas
distribudos na margem ventrolateral da perna anterior - vista lateral. E. Pernas anterior, mediana e posterior -
vista dorsolateral.

67
Bionomia: Esta espcie foi coletada em igarap de 4 ordem com 12 a 20 m de largura e
profundidade entre 0,15 a 1,5 m de profundidade, com fundo rochoso, areia, seixos, razes e
troncos da vegetao marginal, rea de dossel aberto, porem com vegetao marginal parcial,
bem como em igaraps de 2 ordem em rea de mata fechada com substrato de folhas e razes
e fundo de areia.

Macronema sp. nov. 4

(Fig. 39)

Diagnose: Macho de Macronema sp. nov. 4 difere das demais espcies por possuir processos
digitiformes no pice do falo em vista lateral, dois pares de escleritos falotremal; X tergito
curto bfido com um par de projees laterobasais. Em vista lateral a genitlia de Macronema
sp. nov. 4 assemelha a M. burmeisteri, na forma do tergito IX estreito, com a margem anterior
reta e margem posterior ondulada, mas difere por possuir uma projeo pontiaguda em M.
burmeisteri e arredondada em Macronema sp. nov. 4.

Descrio: macho adulto, comprimento da asa anterior 12 mm (n = 1). Cabea com olhos
compostos pretos, regio mediana coberta por diversas cerdas marrons at a base das antenas,
asa anterior com 2/3 de colorao marrom clara (em lcool) e 1/3 com uma faixa transversal
clara, regio subapical com duas manchas esbranquiadas e uma pequena mancha branca no
pice entre a veia R2 e R3 at entre as veias R4 e R5, possivelmente a parte escura das asas
seja coberto por cerdas verdes no individuo seco. Pernas marrom escuras. Frmula tibial
0,4,4. Genitlia masculina: IX tergito com margem anterior ondulada e margem posterior
convexa com uma cerca de nove cerdas longas e na margem dorsal e um tufo de seis cerdas
mdias nas laterais em vista lateral e subtriangular em vista dorsal (Figs. 39A, B), apndice
inferior longo e fino (Fig. 39A ); X tergito curto, sem tubrculos, com uma projeo pequena
com cerdas curtas em vista lateral, vista dorsal com um par de com duas projees pequenas
laterobasal e pice bfido. Falo curto e largo, pice em vista lateral arredondado com dois
pares de escleritos flicos, em vista lateral um na regio ventroapical e o outro na regio
dorsomediana, externamente com vrios processos papilares digitiformes (Figs. 39C D),
pice dividido ventralmente em dois lobos membranosos (Fig. 39E).

68
Material examinado: BRASIL, Amazonas, Presidente Figueiredo, pousada Sossego da
Pantera, Igarap da Ona, 020052 S 600143 O, 31.v.2000, A. M. O. Pes leg., 1 macho
[lcool].

Distribuio geogrfica: Brasil (Amazonas).

Bionomia: Esta espcie foi coletada com armadilha de luz em igarap de 4 ordem com 12 a
20 m de largura e profundidade entre 0,15 a 1,5 m de profundidade, com fundo rochoso, areia,
seixos, razes e troncos da vegetao marginal, rea de dossel aberto porem, com vegetao
marginal parcial.
39

Figura 39: Macronema sp. nov. 4. Genitlia masculina: A vista lateral. B - vista dorsal. C falo vista lateral.
D pice do falo vista lateral. E pice do falo vista ventral.

69
Macronema sp. nov. 5

Paprocki, 2008 [Macho, asas e distribuio].

Material examinado: BRASIL Amazonas, Presidente Figueiredo, Igarap do Sr. Jos Souza,
Ramal do km 24, AM 240, 020106 S 594927 O, 31.v.2000, A. M. O. Pes leg., 1 macho
[lcool].

Distribuio geogrfica: Brasil (Amazonas).

Bionomia: Esta espcie foi coletada com armadilha de luz, prxima a igarap 3 ordem, com
fundo rochoso em rea de mata fechada.

Macronema sp. nov. 6

(Fig. 40 43)

Diagnose: macho de Macronema sp. nov. 6 difere das demais por apresentar falo em vista
ventral com duas pequenas projees laterais e dois pares de escleritos, um par curvo e fino
laterais e um par triangular central, similar a M. burmeisteri na forma do falo, mas difere por
apresentar um esclerito ventroapiacal em vista lateral, ausente em M. burmeisteri, margem
dorsal mediana do IX tergito com triangular que em M. burmeisteri cncava. A larva de
Macronema sp. nov. 6 semelhante a M. pennyi, por possuir o mesmo padro de colorao e
distribuio das marcas de inseres musculares marrom escuras em vista dorsal da cabea,
diferem pelo nmero de cerdas na margem do fmur da perna anterior enquanto Macronema
sp. nov. 6 possui quatro cerdas curtas e grossas e quatro cerdas espatuladas, M. pennyi tem
seis cerdas curtas e grossas e trs cerdas espatuladas.

Descrio: Adulto macho, comprimento da asa anterior de 9 10 mm (n = 5). Asas anteriores


2/3 marrom escuras, 1/3 com faixa transversal marrom clara, regio posterior marrom escura,
regio mediana dorsal amarela (Fig. 40). Cabea com olhos compostos pretos, recoberta por
cerdas brancas, e cerdas pretas na base das antenas. Genitlia masculina: Tergito IX com
margem triangular e projeo de cada lado, com 7 cerdas longas e 3 curtas em cada projeo
lateral, em vista dorsal, com, uma forte projeo ventral em vista lateral. Tergito X curto,
pice bfido com uma forte depresso na regio mediana com um lbulo com cerdas em cada
lado e cada projeo longa e estreita, em vista dorsal. Apndice inferior longo e fino, pice
arredondado (Figs. 41A B). Falo longo, com o pice dilatado e arredondado em vista lateral,
ventralmente com dois lbulos laterais, um par de escleritos falotremal, um em forma de seta

70
central outro de forma semi-eltrica trs em vista lateral, um dorsal longo e um ventral
simplse e um central complexo (Figs. 41C D). Larva, comprimento 14-19 mm (n = 4),
escleritos e pernas amarelos com marcas de inseres musculares escuras na cabea e trax,
corpo revestido por poucas cerdas (Fig. 43 A). Cabea to longa quanto larga, dorsalmente
com colorao marrom clara com marcas de inseres musculares marrom escuras, cutcula
recoberta de numerosas cerdas curtas e grossas e poucas cerdas longas e finas; cerdas nas
posies 1, 2, 3, 14, 15 e 16 presentes; linha ecdisial bem marcada. Frontoclpeo com um par
de cerdas finas na margem anterior, colorao marrom escuro com trs manchas claras duas
laterais e uma central; margem anterior cncava (Fig. 43 F). Gena ventral, marrom clara com
marcas das inseres musculares na regio posterior, com cerdas curtas e espinhosas
ventrolateral, sutura de ecdise ventral somente de um lado (Fig. 43 G). Vista lateral marrom
clara com manchas de inseres musculares marrons escuras, com uma linha reta de cerdas
espinhosas dos olhos at a regio mediana posterior, sem constrio no frontoclpeo (Fig. 43
H). Mandbulas assimtricas com formato triangular em vista dorsal, marrom claras e pretas
no pice; direita mais curta que a esquerda, pice superior e inferior com um dente em cada;
margem interna com um pequeno dente truncado; linha lateral da margem externa com cerdas
(Fig. 43 D). Labro curto, duas vezes mais largo que longo, regio anterior com uma forte
constrio mediana e margens arredondadas, regio mediana anterior recoberta por diversas
cerdas curtas a mdias, margem posterior reta (Fig. 43 C). Trax: Tergitos torcicos marrom
claros, com algumas marcas de inseres musculares escuras, recobertos por poucas cerdas.
Pronoto com formato quadrado subdividido longitudinalmente, margem reta; regio mediana
com uma constrio longitudinal marcada, algumas cerdas espinhosas distribudas na margem
lateral e na regio anterior; regio anterior marrom claro, regio posterior marrom escuro com
algumas marcaes. Prosternito de colorao marrom claro mais escuro no centro, margem
anterior com pice central afinalada, pice central da margem posterior arredondada (Fig. 43
E). Mesonoto quadrado de colorao marrom claro com marcaes musculares de cor marrom
escuro, forte constrio na regio mediana seguindo at a margem anterior, numerosas cerdas
finas e curtas distribudas pela cutcula, margem lateral com algumas cerdas curtas e grossas,
regio anterior com a margem reta. Matanoto retangular, marrom claro com marcas de
inseres musculares marrom escuras, margem anterior reta com cerdas curtas, forte
constrio na regio mediana (Fig. 44 B). Primeiro par de pernas curtas, com numerosas
cerdas longas e finas (Fig. 44 M); trocantim longo, pice arredondado, com cerdas grossas
curtas; coxa com cerdas longas e finas em vista dorsolateral, margem anterior com quatro
cerdas curtas e grossas (Fig. 44 I). Fmur em vista dorsal longo e estreito margem dorsal com

71
duas cerdas mdias grossas na regio central (Fig. 44 K) em vista dorsolateral largo, com
numerosas cerdas finas e mdias na margem ventral, margem dorsal com trs cerdas curtas e
grossas, regio lateroventral com uma srie de cerdas curtas e grossas (Fig. 44 J, L), cinco
cerdas curtas e grossas na regio ventrolateral, duas cerdas espatuladas curtas (Fig. 44 N).
Segundo e terceiro par de pernas longas e estreitas recobertas por numerosas cerdas finas e
longas e por diversas cerdas grossas curtas a mdias (Fig. 44 M). Abdmen: de colorao
lils; cutcula com algumas cerdas curtas e finas, brnquias com muitos filamentos dispostos
simetricamente (Figs. 42, 43A). Linha de cerdas finas e claras laterais. Garras das falsas
pernas anais, longas e finas, com uma constrio mediana, com vrias cerdas longas e finas na
base (Fig. 43 A). Regio ventral dos segmentos abdominais VIII e IX com tufo de cerdas
finas e longas, diversas cerdas longas (tufo de cerdas), dois escleritos claros, papilas anais
retradas.

Figura 40: Macronema sp. nov. 6, asa anterior do macho, vista dorsal.

Material examinado: BRASIL, Amazonas, Manaus: Reserva Ducke, Igarap Barro Branco,
025546,7 S 595822,00 O, 29.vii.2010, C. B. de Souza leg., 1 macho [lcool]; mesmos
dados exceto 16.iii.2010, C. B. de Souza leg., 1 adulto [lcool]; mesmos dados exceto Igarap
31 Acar, 025641,1 S 595722,0 O, 28.vii.2012, T.A.S. Vidovix leg. 3 larvas [lcool];
mesmos dados exceto, Igarap 13 afluente do Ig. Acar, 025656,0 S 595656,09 O,
02.viii.2010, C. B. de Souza leg., 1 larva [lcool]; mesmos dados exceto, 03.viii.2010, 4
larvas [lcool]; mesmos dados exceto, 24.i.2012, T. A. S. Vidovix, leg. 1 larva [lcool];
Igarap Bolvia , 025581,0 S 595942,6, 05.viii.2010, C. B. de Souza leg., 1 larva
[lcool]; Presidente Figueiredo, Pousada Sossego da Pantera, Igarap da Ona, 020052 S
600143 O, 06.i.2010, A. M. O. Pes e V. Souza leg., 1 larva [lcool]; mesmos dados exceto
T.A.S. Vidovix e P. Barcelos leg., 2 larvas [lcool]; Barcelos, Igarap da Anta, 22.vii.2009,

72
004803,3 N 632922,7 O; A. M. O. Pes leg., 1 macho [lcool]; mesmos dados exceto
Com. Ucuqui, prop. Sr. Miranda, Rio Jauar, 23-24.vii.2009, A. M. O. Pes leg., 1 macho
[lcool].

Distribuio geogrfica: Brasil (Amazonas).

Bionomia: As larvas foram encontradas razes localizadas nas margens de igaraps de 1 2 e


3 ordem, localizados em reas de mata fechada (terra firme). Adultos foram coletados
prximos a estes locais com armadilha de luz.

Figura 41: Macronema sp. nov. 6. Genitlia masculina: A vista lateral. B - vista dorsal. C falo vista lateral.
D pice do falo vista dorsal. E pice do falo vista lateral.

73
Ventro-lateral S S(R) D DD DD DD S(R) S(R) S S(R) S(R) S S (R) S
Ventral
MESO META I II III IV V VI VII VIII
Figura 42: Macronema sp. nov. 6. Diagrama das bifurcaes e posio das brnquias do mesonoto, metanoto e
dos segmentos abdominais I-VIII. S = um filamento central fino simples, sem filamentos finos laterais. S(R) =
um filamento central simples, com ramificaes laterais. D = dois filamentos simples ramificados (S(R)), de uma
mesma base comum.

43

Figura 43: Larva de Macronema sp. nov. 6. Legenda: A. Corpo - vista lateral. B. Trax - vista dorsal. C. Labro -
vista dorsal. D. Mandbulas - vista ventral. E. Prosternito - vista ventral. F. Cabea - vista dorsal. G. Cabea -
vista ventral. H. Cabea - vista lateral.

74
44

Figura 44: Larva de Macronema sp. nov. 6. Legenda: A. Trocantim e coxa da perna anterior - vista dorsolateral.
B. Fmur da perna anterior - vista ventrolateral. C. Fmur da perna anterior - vista dorsal. D. Fmur da perna
anterior - vista ventral. E. Pernas anterior, mediana e posterior - vista dorsolateral. F. Cerdas espatuladas e
espinhos na margem do fmur da perna anterior vista lateral.

75
Macronema sp. nov. 7
(Fig. 45-48)

Paprocki, 2008 [Macho, asas e distribuio].

Diagnose: larva de Macronema sp. nov. 7 difere das demais espcies por possuir 25 31
cerdas espatuladas formando um tufo na margem do fmur da perna anterior. Essa espcie
similar a Macronema sp. 3 por possuir cabea marrom escura uniforme, mas difere no nmero
e disposio das cerdas espatuladas, enquanto que a espcie Macronema sp. nov. 7 possui um
tufo de cerdas espatuladas entre 25 31, Macronema sp. 3 apresenta 12 cerdas espatuladas.

Descrio: Larva- Comprimento 15-18 mm (n = 3), escleritos e pernas marrons com algumas
marcas de inseres musculares escuras na cabea e trax, numerosas cerdas longas e finas na
parte anterior do corpo e o abdmen (Fig. 47 A). Cabea: marrom, dorsalmente marrom com
marcas de inseres musculares marrom escuras; subquadrada, aproximadamente to longa
quanto larga, dorso recoberto por fortes cerdas grossas e curtas at a margem da sutura
clipeal, algumas cerdas longas e finas distribudas, cerdas nas posies 1, 4, 7, 11 e 12
presentes, margem lateral dos olhos com cerdas curtas e grossas. Frontoclpeo com algumas
cerdas na regio anterior, colorao marrom com um par de manchas claras lateramedianas,
margem anterior reta (Fig. 47 F). Ventralmente com colorao marrom com marcas escuras
de inseres musculares, regio anterior cncava; numerosas diversas cerdas curtas e grossas
nas laterais desde a regio anterior at a mediana; linha ecdisial simples somente de um lado
(Fig. 47 G). Lateralmente com vrias cerdas curtas quase em linha reta abaixo dos olhos (Fig.
47 H). Mandbulas amarelas com a margem interna e o pice preto, assimtricas, curtas e
largas com uma srie de cerdas na linha lateral da margem externa mediana, em vista dorsal.
Mandbula esquerda triangular, pice superior da com um dente grande, com um sulco at a
regio mediana; margem interna sem dentes. Mandbula direita com um dente no pice (Fig.
47 D). Labro curto, duas vezes mais largo que longo, margem anterior com uma leve
constrio mediana e margens arredondadas, regio mediana anterior recoberta por numerosas
cerdas curtas a mdias, regio posterior levemente cncava (Fig. 47 C). Trax: tergitos
torcicos marrom claros com marcas das inseres musculares escuras, recobertos por
numerosas cerdas curtas. Pronoto subdividido longitudinalmente, formato quadrado, regio
anterior reta com muitas cerdas mdias e longas finas, uma srie uniforme de cerdas curtas e
mdias grossas na margem at a regio mediana, regio posterior sem cerdas com vrias
marcas de insees musculares escuras (Fig. 47 B). Prosternito em vista ventral marrom claro,

76
margem central anterior triangular formando um ngulo agudo afilado e margem central
posterior com uma protuberncia quadrada; sulco mediano presente; bordas laterais largas
(Fig. 47 E). Mesonoto mais longo que largo, margem da regio anterior com uma srie de
cerdas curtas e finas, margem mediana vrias cerdas (espinhosas), e vrias cerdas curtas
afiladas, manchas escuras na regio posterior, sulco nas bordas laterais da regio posterior.
Metanoto retangular, com uma srie uniforme de cerdas curtas e algumas cerdas longas e
finas distribudas pela cutcula, manchas escuras das inseres musculares (Fig. 47 B).
Primeiro par de pernas curtas, cerdas longas e finas (Fig. 48 E); trocantim alongado com a
regio apical arredondada com trs cerdas grossas (espinhos) na margem dorsal; coxa estreita
e curta com vrias cerdas finas compridas, vrios espinhos curtos e mdios distribudos (Fig.
48 A). Fmur estreito, levemente convexo, com algumas cerdas finas em vista dorsal (Fig. 48
B), alongado e expandido dorsolateral com muitas cerdas longas e finas (Fig. 48 C); regio
ventral mediana com conjunto de cerdas espatuladas agrupadas na margem ventral proximal
(Fig. 48 B, D, F), 25-32 cerdas espatuladas grossas e longas (Fig. 48 F). Segundo e terceiro
par de pernas amarelas, longas e finas recobertas por numerosas cerdas finas e longas e por
cerdas curtas e grossas (Fig. 48 E). Abdmen: amarelo; cutcula com cerdas longas e finas
espaadas, brnquias longas com muitos filamentos dispostos simetricamente, uma brnquia
simples ventro-lateral, no segmento abdominal I, duas brnquias duplas ventro-lateral nos
segmentos abdominais II-VIII, uma brnquia simples ventro-lateral nos segmentos
abdominais VII-VIII. Linha de cerdas finas e claras laterais; garras das falsas pernas anais,
curtas e finas, com uma constrio mediana com muitas cerdas longas e finas (Fig. 46 A).

45

Figura 45: Macronema sp. nov. 7. Asa anterior de um macho, vista dorsal [lcool].

77
Ventro-lateral S D DD DD DD S(R) S(R) S S(R) S(R) S S (R) S
Ventral
MESO META I II III IV V VI VII VIII
Figura 46 Macronema sp. nov. 7. Diagrama da posio e tipo de brnquias do meso, metanoto e segmentos
abdominais I-VIII. S = um filamento simples, sem ramificaes laterais. S(R) = um filamento simples, com
ramificaes laterais. D = dois filamentos simples ramificados (S(R)), de uma mesma base comum.

47

Figura 47: Larva de Macronema sp. nova 7. Legenda: A. Corpo - vista lateral; B. Trax - vista dorsal; C. Labro
- vista dorsal; D. Mandbulas - vista ventral; E. Prosternito - vista ventral; F. Cabea - vista dorsal; G. Cabea -
vista ventral ; H. Cabea - vista lateral.

78
Material examinado: BRASIL, Amazonas, Manaus: Reserva Ducke, Igarap Acar 013,
025605 S 595716 O, 25.i.2012, Malaise, T.A.S. Vidovix leg., 1 macho, 2 fmeas
[lcool]; mesmo dados exceto, Ig. 13 afluente do Ig. Bolvia, 01.ii.2012, T.A.S. Vidovix, 1
larva [lcool].

48

Figura 48: Macronema sp. 7. Larva A. Trocantim e coxa da perna anterior - vista dorsolateral; B. Fmur da
perna anterior - vista ventrolateral; C. Fmur da perna anterior - vista dorsal; D. Fmur da perna anterior - vista
ventral; E. Pernas anterior, mediana e posterior - vista dorsolateral; F. Cerdas espatuladas e espinhos na margem
do fmur da perna anterior - vista lateral.

79
Distribuio geogrfica: Bolvia, Brasil (Amazonas) e Peru.

Bionomia: As larvas foram encontradas prximas a corredeiras em razes localizadas nas


margens de igaraps de 2 e 3 ordem, localizados em reas de mata fechada (terra firme).
Adultos foram coletados prximos a estes locais com armadilha de luz.

Macronema sp. 1
(Fig. 49 51)
Diagnose: Larva de Macronema sp. 1 assemelha a Macronema sp. 7, por possurem uma
cabea marrom escura, curta mas diferem nas cerdas do fmur pois Macronema sp. 1
apresenta na margem do fmur uma linha de 10 cerdas espatuladas enquanto Macronema sp 7
apresenta 25-32 cerdas espatuladas em 3 fileiras. Macronema sp. 1 similar a M. bifidum, por
serem as nicas a possurem na margem do fmur a linha de 10 cerdas espatuladas, mas
diferem em outras caractersticas, Macronema sp. 1 possui uma cabea escura, enquanto M.
bifidum possui, cabea amarela com marcaes escuras das inseres musculares.

Descrio: Larva - Comprimento 19 20 mm (n = 2), escleritos e pernas amarelos com


marcas de inseres musculares marrom na cabea e trax, corpo revestido por poucas cerdas
(Fig. 50 A). Cabea: curta, sub-retangular mais longa que larga, marrom escura, com algumas
marcas de inseres musculares amarelo claras, cutcula recoberta por cerdas longas e finas,
cerdas nas posies 1, 2, 3, 7, 14 presentes, cerdas curtas e grossas na regio mediana e
lateral, sutura coronal de ecdise longa 1/3 do comprimento da cabea. Frontoclpeo com a
margem ligeiramente cncava, com duas manchas claras na regio mediana (Fig. 50 F). Gena
ventral marrom, inseres musculares mais escuras na regio mediana posterior, com 15
cerdas curtas e finas da regio anterior at a regio mediana, sutura de ecdise ventral somente
de um lado (Fig. 50 G). Vista lateral com duas linhas retas de cerdas curtas e grossas dos
olhos at a regio mediana posterior, vrias cerdas curtas e grossas at a regio dorsal (Fig. 50
H). Mandbulas em vista dorsal, marrom com a margem interna e o pice marrom escuro,
assimtricas, curtas e largas, linha lateral da margem externa convexa com cerdas longas, sem
escova de cerdas na margem interna. Mandbula esquerda triangular; mandbula direita
trapezoidal, mais curta que a esquerda, regio apical com trs dentes, um dente truncado
mediano na margem interna em vista dorsal (Fig. 50 D). Labro curto, duas vezes mais largo
que longo, regio anterior reta e margens laterais arredondadas, regio mediana anterior
recoberta por uma linha de oito cerdas mdias em cada lbulo e diversas cerdas curtas, escova
de cerdas laterais ausentes (Fig. 50 C). Trax: tergitos torcicos marrons, com marcas de

80
inseres musculares marrom escuros, recobertos por cerdas curtas e mdias muito finas.
Pronoto subdividido verticalmente; regio mediana com uma marcao longitudinal, margem
anterior reta com algumas cerdas mdias e grossas e, vrias cerdas longas esparsas at a
regio mediana, metade posterior lisa de colorao marrom escuro, com manchas das
inseres musculares (Fig. 50 B). Prosternito de colorao marrom claro escurecido na regio
mediana; margem anterior e posterior com uma protuberncia central, margem anterior curta e
pontiaguda (Fig. 50 E). Mesonoto: mais longo que largo, margem anterior reta, com poucas
cerdas curtas, vrias cerdas curtas e grossas na lateral, logo abaixo da margem anterior at a
regio mediana, intercaladas por cerdas curtas e finas, marcas de inseres musculares na
regio mediana marrom escuras. Metanoto retangular, mais largo que longo, margem da
regio anterior com cerdas mdias e finas nas laterais, cerdas finas e curtas distribudas por
toda a placa, marca de inseres musculares na regio mediana marrom escuras (Fig. 50 B).
Primeiro par de pernas com numerosas cerdas curtas e grossas, e finas e longas. Trocantim
alongado e estreito com a regio apical arredondada, com quatro cerdas curtas e grossas na
margem dorsal, coxa curta e larga com muitas cerdas curtas e grossas, margem dorsal com
trs cerdas fortes curtas e grossas em vista lateral (Fig. 51 A). Fmur longo e estreito,
levemente convexo em vista lateral, margem dorsal com uma cerda dorsomediana e uma
apicodistal (Fig. 51 B), margem ventral com 11 13 cerdas espatuladas curtas e arredondadas
dispostas em uma nica linha reta (Figs. 51 D, E). Segundo e terceiro par de pernas similares,
longas e finas, recobertas por cerdas finas e longas e por cerdas curtas e grossas (Fig. 51 E).
Par de brnquias torcicas simples ventrais presente no metanoto. Abdmen amarelo, com
poucas cerdas longas e finas espaadas em vista dorsal, brnquias com muitos filamentos
dispostos simetricamente (Fig. 50 A). Tufos de cerdas finas, curtas e longas presentes nas
laterais em cada segmento. Garras das falsas pernas anais, longas e finas, com uma constrio
mediana, com muitas cerdas longas e finas da base at as garras. Regio ventral dos
segmentos abdominais VIII e IX com tufo de cerdas finas e longas, numerosas cerdas longas,
escleritos ventrais claros, com muitas cerdas finas e longas. Papilas anais retradas.

Ventro-lateral S D DD DD DD S(R) S(R) S(R) S(R) S(R) S


S S
Ventral
MESO META I II III IV V VI VII VIII
Figura49: Macronema sp. 1. Diagrama das bifurcaes e posio das brnquias do mesonoto, metanoto e dos
segmentos abdominais I-VIII. S = um filamento central fino simples, sem filamentos finos laterais. S(R) = um
filamento central simples, com ramificaes laterais. D = dois filamentos simples ramificados (S(R)), de uma
mesma base comum.

81
50

Figura 50: Larva de Macronema sp. 1. Legenda: A. Corpo - vista lateral; B. Trax - vista dorsal; C. Labro -
vista dorsal; D. Mandbulas - vista ventral; E. Prosternito- vista ventral; F. Cabea - vista dorsal; G. Cabea -
vista ventral; H. Cabea - vista lateral.

82
51

Figura 51: Larva de Macronema sp. 1. Legenda: A. Trocantim e coxa da perna anterior - vista dorsolateral; B.
Fmur da perna anterior - vista dorsolateral; C. Fmur da perna anterior - vista dorsal; D. Fmur da perna
anterior - vista ventral; E. Pernas anterior, mediana e posterior - vista dorsolateral; F. Cerdas espatuladas na
margem do fmur da perna anterior - vista lateral.

83
Material examinado: BRASIL, Amazonas, Manaus: Reserva Ducke, Igarap 31 afluente Ig.
Acar, 025641,1 S 595722,0 S, 12.ii.2012, 4 larvas [lcool]
Bionomia: as larvas foram encontradas prximas a corredeiras em razes localizadas nas
margens de igaraps de 2ordem, com fundo de areia e muitas razes marginais localizados em
reas de mata fechada (terra firme).

Macronema sp. 2

(Fig. 52 54)

Diagnose: A cabea de Macronema sp. 2 assemelha a Macronema sp. nov. 6, no padro de


distribuio das manchas de inseres musculares, mas difere por Macronema sp. 2 possui
sete cerdas curtas e duas cerdas espatuladas longas na margem ventral do fmur da perna
anterior, j Macronema sp. nov. 6 possui cinco cerdas curtas e grossas e duas cerdas
espatuladas curtas na margem ventral do fmur.

Descrio: Larva - Comprimento 14-17 mm (n = 3), escleritos e pernas de colorao amarela


com marcas de inseres musculares marrom na cabea e trax, corpo revestido por poucas
cerdas (Fig. 53 A). Cabea, sub-retangular levemente mais longa que larga. Dorsalmente
amarela com algumas marcas de inseres musculares marrons escuras, cutcula recoberta por
cerdas longas e finas, cerdas nas posies 1, 2, 12, 15, 16 presentes, cerdas curtas e grossas na
regio mediana e lateral. Frontoclpeo com a margem anterior cncava, par de manchas mais
clara na regio mediana, (Fig. 53 F). Gena ventral sem cerdas, amarelo claras, marcas de
inseres musculares mais claras na regio mediana posterior, sutura de ecdise ventral
somente de um lado (Fig. 53 G). Vista lateral com linha reta de cerdas curtas e grossas dos
olhos at a regio mediana posterior (Fig. 53 H). Mandbulas amarelas com a margem interna
e o pice marrom escuro, em vista dorsal, assimtricas, curtas e largas, linha lateral da
margem externa convexa com cerdas longas (cerca de 11), sem escova de cerdas na margem
interna. Mandbula esquerda triangular, em vista lateral com dois dentes na regio apical;
mandbula direita trapezoidal, mais curta que a esquerda, regio apical pontiaguda, com um
pequeno dente mediano na margem interna em vista dorsal (Fig. 53 D). Labro curto, duas
vezes mais largo que longo, regio anterior com uma forte constrio mediana e margens
laterais arredondadas, regio mediana anterior recoberta por uma linha de sete cerdas mdias

84
em cada lbulo e diversas cerdas curtas, escova de cerdas laterais ausentes (Fig. 53 C).
Trax: tergitos torcicos amarelos, com marcas de inseres musculares marrom, recobertos
por cerdas curtas e mdias muito finas. Pronoto subdividido verticalmente; margem anterior
reta com cerdas mdias grossas esparsas at a regio mediana, cutcula com manchas das
inseres musculares marrom (Fig. 53 B). Prosternito em vista ventral marrom claro
escurecido no centro (Fig. 53 E). Mesonoto: margem anterior nas laterais com cerdas curtas
grossas, esparsas na regio mediana, intercaladas por muitas cerdas curtas e finas e, marcas de
inseres musculares marrom escuras. Metanoto retangular, mais largo que longo, margem da
regio anterior com uma srie de cerdas mdias e finas, cerdas finas e curtas, manchas de
inseres musculares marrom (Fig. 53 B). Primeiro par de pernas com cerdas curtas e grossas
e finas e longas. Trocantim truncado com o pice redondo, com uma ou duas cerdas curtas e
grossas na margem dorsal, coxa curta e estreita, com cerdas curtas e grossas, intercaladas por
cerdas finas mdias e longas, margem dorsal duas cerdas curtas e grossas em vista lateral (Fig.
54 A). Fmur longo e largo, levemente curvado em vista lateral, margem dorsal com uma
cerda dorsomediana e uma apicodistal (Fig. 54B), margem ventral com sete cerdas curtas e
grossas e duas cerdas espatuladas longas e estreitas (Figs. 54 E). Segundo e terceiro par de
pernas similares, longas e finas recobertas por cerdas finas e longas e por cerdas curtas e
grossas. Par de brnquias torcicas simples ventrais no metanoto. Abdmen lils, com poucas
cerdas longas e finas espaadas em vista dorsal, brnquias com muitos filamentos dispostos
simetricamente (Fig. 53 A). Algumas cerdas longas laterais em cada segmento. Garras das
falsas pernas anais, longas e finas, com uma constrio mediana, com muitas cerdas longas e
finas da base at as garras. Regio ventral dos segmentos abdominais VIII e IX com tufo de
cerdas finas e longas, diversas cerdas longas (tufo de cerdas), escleritos ventrais claros, com
muitas cerdas finas e longas. Papilas anais retradas.

Ventro-lateral S D DD DD DD S(R) S(R) S(R) S(R) S(R) S


S S
Ventral
MESO META I II III IV V VI VII VIII
Figura 52: Macronema sp. 2. Diagrama das bifurcaes e posio das brnquias do mesonoto, metanoto e dos
segmentos abdominais I-VIII. S = um filamento central afinalado simples, sem filamentos finos laterais. S(R) =
um filamento central simples, com ramificaes laterais. D = dois filamentos simples ramificados (S(R)), de uma
mesma base comum.

Material examinado: BRASIL, Amazonas, Manaus: Reserva Ducke, Igarap Barro Branco,
025546,7 S 595822,00 O, 23.xi.2011, T.A.S. Vidovix leg., 1 larva [lcool].

85
Bionomia: as larvas foram encontradas prximas a corredeiras em razes localizadas nas
margens de igaraps de 2ordem, com fundo de areia e muitas razes marginais localizados em
reas de mata fechada (terra firme).
53

Figura 53: Larva de Macronema sp. 2. Legenda: A. Corpo - vista lateral. B. Trax - vista dorsal. C. Labro -
vista dorsal. D. Mandbulas - vista ventral. E. Prosternito - vista ventral. F. Cabea - vista dorsal. G. Cabea -
vista ventral. H. Cabea - vista lateral.

86
54

Figura 54: Larva de Macronema sp. 2. Legenda: A. Trocantim e coxa da perna anterior - vista dorsolateral. B.
Fmur da perna anterior - vista ventral. C. Fmur da perna anterior - vista dorsal. D. Espinhos distribudos na
margem ventrolateral da perna anterior vista lateral. E. Cerdas espatuladas vista lateral.

87
Macronema sp. 3
(Fig. 55 57)

Diagnose: Macronema sp. 3 semelhante a Macronema sp. nov. 3, pela cabea longa, sem
cerdas curtas na regio dorsal, fmur da perna anterior alargado, porm diferem por
Macronema sp. 3 fmur da perna anterior com quatro cerdas curtas e grossas e quatro cerdas
espatuladas, enquanto que Macronema sp. nov. 3 tem a margem do fmur da perna anterior
com dois espinhos e trs cerdas espatuladas.
Descrio: larva - Comprimento 2125 mm (n = 4), escleritos e pernas amarelas com
manchas de inseres musculares escuras no trax e manchas claras na cabea, regio anterior
e posterior do corpo revestido por poucas cerdas longas e finas (Fig. 56 A). Cabea retangular
mais longa que larga. Dorsalmente com colorao marrom alaranjado com manchas claras das
inseres musculares; cutcula recoberta por cerdas curtas a mdias finas, cerdas nas posies
1, 4, 7, 11 e 12 presentes, margem lateral dos olhos com cerdas curtas e finas, amarela clara.
Frontoclpeo marrom alaranjado com um par de manchas claras ultrapassando a linha ecdisial,
margem anterior reta, linha ecdisial fortemente marcada (Fig. 56 F). Cabea com gena
ventralmente de amarela com algumas manchas de inseres musculares claras, com vrias
cerdas finas que se projetam da regio lateral, linha ecdisial simples somente de um lado (Fig.
56 G). Cabea lateral com vrias cerdas curtas e desigualmente distribudas (Fig. 56 H).
Mandbulas amarelas, com a margem interna e o pice preto, assimtricas. Mandbula
esquerda longa, com um dente no pice sem dentes na margem interna. Mandbula direita
com um dente no pice e com um grande dente truncado mediano na margem interna.
Mandbulas com cerdas na linha lateral da margem externa mediana (Fig.56 D). Labro curto,
duas vezes mais largo que longo, com as laterais globosas e uma constrio no centro da
margem anterior e diversas cerdas longas e curtas (Fig. 56 C). Trax, tergitos torcicos
amarelos com manchas escuras das inseres musculares. Pronoto quadrado subdividido
longitudinalmente, margem da regio anterior reta com diversas cerdas mdias e longas
espaadas; margem da regio posterior triangular, vrias manchas escuras das inseres
musculares, cutcula sem cerdas grossas (espinhos) (Fig. 56 B). Prosternito em vista ventral
de colorao marrom claro escurecido nas laterais com as pontas de colorao marrom escuro
(Fig. 56 E). Mesonoto alongado, margem da regio anterior sem cerdas curtas e grossas, com
uma srie de pequenas cerdas finas, um par de manchas circulares laterais, diversas cerdas
curtas e finas distribudas na cutcula. Metanoto quadrado, regio anterior levemente cncava,

88
um par de manchas circulares laterais, sulco lateral margeando desde a regio anterior at a
regio mediana, vrias cerdas curtas e longas distribudas na cutcula. Primeiro par de pernas
curta, com vrias cerdas longas e finas (Fig. 57 E); trocantim alongado e pontiagudo, com
uma cerda curta e grossa dorsal; coxa curta com diversas cerdas longas e finas em vista
dorsolateral (Fig. 57 A). Fmur em vista dorsal , levemente convexo, cerdas curtas e mdias
distribudas (Fig. 57 C); fmur em vista ventral com diversas cerdas finas e mdias, longo e
estreito em vista lateral, (Fig. 57 B); com 4 cerdas curtas e grossas e quatro cerdas espatuladas
curtas e finas na margem ventral (Fig. 57 D). Segundo par de pernas com muitas cerdas
mdias e longas finas com algumas cerdas curtas e grossas, terceiro par de pernas com
algumas cerdas curtas e mdias distribudas por toda a superfcie (Fig. 57 E). Abdmen,
branco com a cutcula recoberta por algumas cerdas curtas e finas, brnquias alongadas com
muitos filamentos dispostos simetricamente. Linha de cerdas finas e claras laterais; garras das
falsas pernas anais, longas e finas, com uma constrio mediana com muitas cerdas longas e
finas (Fig. 56 A). Regio ventral dos segmentos abdominais VIII e IX com tufo de cerdas
finas e longas, esclerito ventral claro, com muitas cerdas finas e longas. Papila anais retradas.

Ventro-lateral S D DD DD DD S(R) S(R) S(R) S(R) S (R) S


S S
Ventral
MESO META I II III IV V VI VII VIII
Figura 55: Macronema sp. 3. Diagrama das bifurcaes e posio das brnquias do mesonoto, metanoto e dos
segmentos abdominais I-VIII. S = um filamento central afinalado simples, sem filamentos finos laterais. S(R) =
um filamento central simples, com ramificaes laterais. D = dois filamentos simples ramificados (S(R)), de uma
mesma base comum.

Material examinado: BRASIL, Amazonas, Manaus: Reserva Ducke, Igarap 13 afluente do


Ig. Bolvia, PT. 05, 15.iv.2002, rede D, Azevedo e A. M. O. Pes leg., 1 larva [lcool]; mesmos
dados exceto Igarap 12 afluente do Ig. Bolvia, 025919,6 S 595648,3 O, 15.x.2009,
U.G. Neiss leg., 1 larva [lcool].

Bionomia: As larvas foram encontradas razes localizadas nas margens de igaraps de 1


ordem, localizados em reas de mata fechada (terra firme).

89
56

Figura 56: Larva Macronema sp. 3. Legenda: A. Corpo - vista lateral; B. Trax - vista dorsal; C. Labro - vista
dorsal; D. Mandbulas - vista ventral; E. Prosternito - vista ventral; F. Cabea - vista dorsal; G. Cabea - vista
ventral; H. Cabea - vista lateral.

90
57

Figura 57: Larva Macronema sp. 3. Legenda: I. Trocantim e coxa da perna anterior - vista dorsolateral; J. Fmur
da perna anterior - vista ventral; K. Fmur da perna anterior - vista dorsal; L. Fmur da perna anterior - vista
ventrolateral; M. Pernas anterior, mediana e posterior - vista dorsolateral; N. Cerdas espatuladas e espinhos
distribudos na margem ventrolateral da perna anterior - vista lateral.

91
CONCLUSES

Este trabalho mostra que a unio entre a observao morfolgica e ferramentas


moleculares, neste caso utilizando o DNA Barcode, pode ser muito construtivo para a
associao de larvas e adultos e na descrio de novas espcies do gnero Macronema. Nosso
estudo representa o primeiro a utilizar sequncias de DNA do gene COI para associar lavas e
adultos e descrever novas espcies de Trichoptera na regio Amaznica.
Foram identificadas 17 espcies, sendo sete delas novas para a cincia, do qual foram
descritas e ilustradas trs espcies sendo que quatro espcies j foram ilustradas na tese do
Paprocki (2008). Nosso estudo associou sete espcies de Macronema com suas respectivas
larvas, alm de associar sete fmeas utilizando o padro de colorao da asa e quatro destas
confirmadas com o DNA Barcode.

92
REFERNCIAS BIBLIOGRFICAS

Albino, J.L.D.; Pes, A.M.; Hamada, N. 2011. Smicridea (Trichoptera, Hydropsychidae) from
3 Brazilian Amazonian States: New species, larval taxonomy and bionomics. Zootaxa,
3113: 1-35.

Angrisano, E.B. 1998. Trichoptera. In: Morrone, J.J.; Coscarn, S. (Eds). Biodiversidad de
Artrpodos Argentinos: una Perspectiva Biotaxonomica. Ediciones Sur, La Plata,
Argentina. p. 374-384.

Angrisano, E.B. 1995. Insecta Trichoptera. In: Lopretto, E.C.; Tell, G. (Eds). Ecosistemas de
Aguas Continentales: metodologias para su estudio. Vol. 3. Ediciones Sur, La Plata,
Argentina. p. 1199-1237.

Ansorge, J.A. 2003. Upper Liassic Amphiesmenopterans (Trichoptera + Lepidoptera) from


Germany a review. Acta Zoologica Cracoviensia, 46: 285-290.

Antunes, A.; Ramos, M.J. 2005. Discovery of a large number of previously unrecognized mi-
tochondrial pseudogenes in fish genomes. Genomics, 86: 708-717.

Baccaro, F.B.; Drucker, D.P.; Vale, J.; Oliveira, M.L.; Magalhes, C.; Lepsch-Cunha, N.;
Magnusson, W.E. 2008. A Reserva Ducke. In: Oliveira, M.L.; Baccaro, F.B.; Braga-
Neto, R.; Magnusson, W.E. (Eds). Reserva Ducke: A biodiversidade atravs de uma
grade. ttema Design Editorial, Manaus, Amazonas. p. 21-30.

Barcellos, E.A.; Lima, M.H.M.R. 2002. Minerao e desflorestamento na Amaznia Legal,


CETEM, 56-66 (http://www.cetem.gov.br/publicacao/CTs/CT2002-016-00.pdf). Acesso:
22/01/2013.

Banks, N. 1910. New South American neuropteroid insects. Proceedings of the


Entomological Society of Washington, 12: 146-160.

Banks, N. 1915. New neuropteroid insects, native and exotic. Proceedings of the Academy of
Natural Sciences of Philadelphia, 66: 608-632.

Banks, N. 1924. Description of new neuropteroid insects. Bulletin of the Museum of


Comparative Zoology at Harvard College, 65: 421-455.

93
Begerow, D.; Nilsson, H.; Unterseher, M.; Maier, W. 2010. Current state and perspectives of
fungal DNA barcoding and rapid identification procedures. Applied Microbiology and
Biote- chnology, 87: 99-108.

Blaxter, M.L. 2004. The promise of a DNA taxonomy. Philosophical Transactions of the
Royal Society of London. Series B, Biological sciences, 359: 669-679.

Botosaneanu, L.; Flint, O.S.Jr. 1982. On some Trichoptera from northern Venezuela and
Ecuador (Insecta). Beaufortia, 32(2): 13-26.

Brasil. Departamento Nacional da Produo Mineral. 1978. Projeto RADAMBRASIL: Folha


SA. 20 Manaus; geologia, geomorfologia, pedologia, vegetao e uso potencial da terra.
Rio de Janeiro, RJ, Brasil. 628 pp.

Burmeister, E. 1988. Der Lectotypus von Macronema maculatum (Perty, 1833) (Tricho-
ptera, Hydropsychidae). Spixiana, 11: 259-262.

Burns, J.M.; Janzen, D.H.; Hajibabaei, M.; Hallwachs, W.; Hebert, P.D.N. 2007. Dna
barcodes of closely related (but morphologically and ecologically distinct) species of
skipper butterflies (Hesperiidae) can differ by only one to three nucleotides. Journal of
the Lepidopterists Society, 61(3): 138-153.

Calor, A.R. 2007. Trichoptera. In: Guia on-line: Identificao de larvas de Insetos Aquticos
do Estado de So Paulo. (http://sites.ffclrp.usp.br/aguadoce/guiaonline). Acesso:
28/10/2011.

Camargos, L.M. 2012. Taxonomia e distribuio de Odontoceridae (Insecta, Trichoptera) no


Brasil. Dissertao de Mestrado, Instituto Nacional de Pesquisas da Amaznia, Manaus,
Amazonas. 116pp.

Caterino, M.S.; Cho, S.; Sperling, F.A.H. 2000. The current state of insect molecular
systematics: a thriving Tower of Babel. Annual Review of Entomology, 45: 1-54.

Chase, M.W.; Fay, M.F. 2009. Barcoding of Plants and Fungi. Science, 325: 682-683.

Clare, E.L.; Lim, B.K.; Fenton, M.B.; Hebert, P.D.N. 2011. Neotropical bats: estimating
species diversity with DNA barcodes. Public Library of Science One, 6(7): 1-14.

94
Consortium for the Barcode of Life, 2009. Data Standards for Barcode records in INSDC
(BRIs) (http://barcoding.si.edu/PDF/DWG_data_standards-Final.pdf). Acesso:
04/12/2012.

Couceiro, S.R.M.; Hamada, N.; Forsberg, B.R.; Pimentel, T.P.; Luz, S.L.B. 2012. A
macroinvertebrate multimetric index to evaluate the biological condition of streams in the
Central Amazon region of Brazil, Ecological Indicators, 18: 118-125.

Decans, T.; Rougerie, R. 2008. Descriptions of two new species of Hemileucinae


(Lepidoptera: Saturniidae) from the region of Muzo in Colombia evidence from
morphology and DNA barcodes. Zootaxa, 1944: 34-52.

Ekrem, T.; Willassen, E.; Stur, E. 2007. A comprehensive DNA sequence library is essential
for identification with DNA barcodes. Molecular Phylogenetics and Evolution, 43(2):
530-542.

Felsenstein, J. 1981. A likelihood approach to character weighting and what it tells us about
parsimony and compatibility. Biological Journal of the Linnean Society, 16: 183-96.

Felsenstein, J. 1985. Confidence limits on phylogenies: an approach using the bootstrap.


Evolution, 39: 783-791.

Ferrari, F.; Procopiak, L.K.; Alencar, Y.B.; Alvim, T.; Ludwig, V. 1997. Eunotiaceae
(Bacillariophyceae) em igaraps da Amaznia Central, Manaus e Presidente Figueiredo,
Brasil. Acta Amazonica, 37(1): 1-16.

Flint, O.S.Jr. 1964. The Caddisflies (Trichoptera) of Puerto Rico.University of Puerto Rico,
Agricultural Experiment Station, Technical Paper, 40: 1-80.

Flint, O.S.Jr. 1966. Studies of Neotropical Caddis Flies, III: Types of some species described
by Ulmer and Brauer. Proceedings of the United States National Museum, 120(3559): 1-
20.

Flint, O.S.Jr. 1968. Bredin-Archbold-Smithsonian Biological Survey of Dominica, 9. The


Trichoptera (Caddisflies) of the Lesser Antilles. Proceedings of the United States
National Museum, 125: 1-86.

95
Flint, O.S.Jr. 1972. Studies of Neotropical caddisflies, XIV: On a collection from Northern
Argentina. Proceedings of the Biological Society of Washington, 85(17): 223-248.

Flint, O.S.Jr. 1974. The Trichoptera of Surinam. Studies on the Fauna of Suriname and other
Guyanas,14(55): 1-151.

Flint, O.S.Jr. 1978. Studies of Neotropical Caddisflies, XXII: Hydropsychidae of the Amazon
Basin (Trichoptera). Amazoniana, 6(3): 373-421.

Flint, O.S.Jr.1982. Trichoptera of the Area Platense. Biologia Acutica, 2: 1-70.

Flint, O.S.Jr. 1983a. Studies of Neotropical caddisflies, XXXIII: new species from austral
South America (Trichoptera). Smithsonian Contributions to Zoology, 377: 1-100.

Flint, O.S.Jr. 1983b. Studies of Neotropical caddisflies, XXXIV: The genus


Plectromacronema (Trichoptera: Hydropsychidade). Proceedings of the Entomological
Society of Washington, 96(2): 225-237.

Flint, O.S.Jr. 1991. Studies of Neotropical Caddisflies, XLV: The taxonomy, Phenology, and
faunistcs of the Trichoptera of Antioquia, Colombia. Smithsonian contributions to
Zoology, 520: 1-113.

Flint, O.S.Jr.; Bueno-Soria, J. 1979. Studies of Neotropical Caddisflies, XXIV. The genus
Macronema in Mesoamerica (Trichoptera: Hydropsychidae). Proceedings of the
Biological Society of Washington, 81: 522-535.

Flint, O.S.Jr.; Bueno-Soria, J. 1982. Studies of Neotropical Caddisflies, XXXII: The


immature stages of Macronema viriipenne Flint & Bueno, with the division Macronema
by the resurrection of Macrostemum (Trichoptera: Hydropsychidae). Proceedings of the
Biological Society of Washington, 95: 358-370.

Flint, O.S.Jr.; Holzenthal, R.W.; Harris, S.C. 1999. Catalog of the Neotropical Caddisflies
(Trichoptera). Ohio Biological Survey, Columbus, Ohio, USA. 239pp.

Folmer, O.; Black, M.; Hoeh, W.; Lutz, R.; Vrijenhoek, R. 1994. DNA primers for
amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan
invertebrates. Molecular Marine Biology and Biotechnology, 3: 294-297.

96
Frost, S.W. 1957. The Pennsylvania insect light trap. Journal of Economic Entomology, 50:
287-292.

Geraci, C.J.; Kjer, K.M.; Morse, J.C.; Blahnik, R. 2005. Phylogenetic relationships of
Hydropsychidae subfamilies based on morphology and DNA sequence data. In: Tanida,
K.; Rossiter, A. (Eds.). Proceedings of the 11th International Symposium on Trichoptera.
Tokai University Press, Japan. p. 131-136.

Geraci, C.J.; Al-Saffar, M.A.; Zhou, X. 2011. DNA barcoding facilitates description of
unknown faunas: a case study on Trichoptera in the headwaters of the Tigris River, Iraq.
Journal of the North American Benthological Society, 30: 163-173.

Graf, W.; Lubini, V.; Pauls, S. 2005. Larval description of Drusus muelleri McLachlan, 1868
(Trichoptera: Limnephilidae) with some notes on its ecology and systematic position
within the genus Drusus. Annales de Limnologie, 41: 93-98.

Graf, W.; Waringer, J.; Pauls, S.U. 2009. The larva of Rhyacophila ferox Graf, 2006
(Trichoptera: Rhyacophilidae) from the Eastern Alps (Carinthia, Austria). Aquatic
Insects, 31(2): 111-117.

Grimaldi, D.A.; Engel, M.S. 2005. Evolution of the Insects. Cambridge University Press, New
York, NY, USA. 772pp.

Hadley, A. 2010. CombineZP (http://www.hadleyweb.pwp.blueyonder.co.uk). Acesso:


14/04/2012.

Hall, T.A. 1999. BioEdit a user friendly biological sequence alignment editor and analysis
program for Windows 95/98/NT. Nucleic Acids Symposium Series, 41: 95-98.

Hausmann, A.; Hebert, P.D.N.; Mitchell, A.; Rougerie, R.; Sommerer, M.; Edwards, T.;
Young, C.J. 2009. Revision of the Australian Oenochroma vinaria Guene, 1858 species-
complex (Lepidoptera: Geometridae, Oenochrominae): DNA barcoding reveals cryptic
diversity and assesses status of type specimen without dissection. Zootaxa, 2239: 1-21.

Hebert, P.D.N.; Cywinska, A.; Ball, S.; de Waard, J.R. 2003a. Biological identifications
through DNA barcodes. Proceedings of the Royal Society of London, Series B, Biological
Sciences, 270: 313-321.

97
Hebert, P.D.N.; Ratnasingham, S.; deWaard, J.R. 2003b. Barcoding animal life: cytochrome c
oxidase subunit 1 divergences among closely related species. Proceedings of the Royal
Society of London, Series B, Biological Sciences, 270: 596-599.

Hebert, P.D.N.; Penton, E.H.J.; Burns, M.; Janzen, D.H.; Hallwachs, W. 2004a. Ten species
in one: DNA barcoding reveals cryptic species in the neotropical skipper butterfly
Astrapes fulgerator. Proceedings of the National Academy of Sciences, 101(41): 14812-
14817.

Hebert, P.D.N.; Stoeckle, M.Y.; Zemlak, T.S.; Francis, C.M. 2004b. Identification of birds
through DNA barcodes. Public Library of Science Biology, 2(10): 1657-1663.

Hebert, P.D.N.; Gregory, T.R. 2005. The Promise of DNA Barcoding for Taxonomy.
Systematic Biology, 54(5): 852-859.

Hillis, D.M.; Bull, J.J. 1993. An empirical test of bootstrapping as a method for assessing
confidence in phylogenetic analysis. Systematic Biology, 42: 182-192.

Holzenthal, R.W.; Pes, A. M. O. 2004. A new genus of long-horned caddisfly from the
Amazon basin (Trichoptera: Leptoceridae: Grumichellini). Zootaxa, 621: 1-16.

Holzenthal, R.W.; Blahnik, R.J.; Prather, A.L.; Kjer, K.M. 2007. Order Trichoptera Kirby,
1813 (Insecta), Caddisflies. Zootaxa, 1668: 639-698.

Huamantinco, A.A.; Nessimian, J.L. 1999. Estrutura e distribuio espacial da comunidade de


larvas de Trichoptera (Insecta) em um tributrio de primeira ordem do Rio Paquequer,
Terespolis, RJ. Acta Limnologica Brasiliensia, 11: 1-16.

Johanson, K.A. 2007. Association and description of males, females and larvae of two New
Caledonian Xanthochorema species (Trichoptera: Hydrobiosidae) based on mitochondrial
16S and COI sequences. Entomological Science, 10: 179-199.

Junqueira, L.C.; Carneiro, J.1997. Biologia Celular e Molecular. 6 edio. Editora Guanabara
Koogan, Rio de Janeiro, RJ, Brasil. 299pp.

Kaila, L.; Stahls, G. 2006. DNA barcodes: Evaluating the potential of COI to diffentiate
closely related species of Elachista (Lepidoptera: Gelechioidea: Elachistidae) from
Australia. Zootaxa, 1170: 1-26.

98
Kelly, L.J.; Hollingsworth, P.M.; Coppins, B.J.; Ellis, C.J.; Harrold, P.; Tosh, J.; Yahr, R.
2011. DNA barcoding of lichenized fungi demonstrates high identification success in a
floristic context. New Phytologist, 191: 288-300.

Kimura, M. 1980. A simple method for estimating evolutionary rates of base substitutions
through comparative studies of nucleotide sequences. Journal of Molecular Evolution 16,
111-120.

Krishnamurthy, K.P.; Francis, R.A. 2012. A critical review on the utility of DNA barcoding in
biodiversity conservation. Biodiversity and Conservation, 21: 1901-1919.

Ladoukakis, E.D.; Zouros, E. 2001. Direct evidence for homologous recombination in mussel
(Mytilus galloprovincialis) mitochondrial DNA. Molecular Biolology and Evolution,
18(7): 1168-1175.

Lang, B.F., Gray, M.W.; Burger, G. 1999. Mitochondrial genome evolution and the origin of
eukaryotes. Annual Review of Genetics, 33: 351-97.

Lenat, D.R. 1993. A biotic index for the southeastern United States: derivation and list of
tolerance values, with criteria for assigning water-quality ratings. Journal of the North
American Benthological Society, 12: 279-290

Li, H.Q.; Chen, J.Y.; Wang, S.; Xiong, S.Z. 2012. Evaluation of six candidate DNA
barcoding loci in Ficus (Moraceae) of China. Molecular Ecology Resources, 12: 783-790.

Matz, M.V.; Nielsen, R. 2005. A likelihood ratio test for species membership based on DNA
sequence data. Philosophical Transactions of the Royal Society of London. Series B,
Biological sciences, 360: 1969-1974.

Mendona, F.P.; Magnussom, W.E.; Zuanon, J. 2005. Relationships between habitat


characteristics and fish assemblages in small streams of Central Amazonia. Coupeia (4):
751-764.

Meyer, C.P.; Paulay, G. 2005. DNA barcoding: Error Rates Based on Comprehensive Sam-
pling. Public Library of Science Biology, 3(12): 2229-2238.

99
Miller, K.B.; Alarie, Y.; Wolfe, W.; Whiting, M.F. 2005. Association of insect life stages
using DNA sequences: the larvae of Philodytes umbrinus (Motschulsky) (Coleoptera:
Dytiscidae). Systematic Entomology, 30: 499-509.

Miller, K.B.; Alarie, Y.; Whiting, M.F. 2007. Description of the larva of Notaticus fasciatus
(Coleoptera: Dytiscidae) associated with adults using DNA sequence data. Annals of the
Entomological Society of America, 100(6): 787-797.

Milne, M. 1938. The "metamorphotype method" in Trichoptera. Journal of the New York
Entomological Society, 46: 435-437.

Miyaki, C.Y.; Russo, C.A. de M.; Pereira, S.L. 2001. Reconstruo Filogentica: Introduo e
o Mtodo da Mxima Parcimnia. In: Matioli, S.R. (Eds). Biologia Molecular e
Evoluo. Holos, Ribeiro Preto, So Paulo. p. 97-107.

Monaghan, M.T.; Balke, M.; Pons, J.; Vogler, A.P. 2006. Beyond barcodes: complex DNA
taxonomy of a South Pacific Island radiation. Proceedings of the Royal Society Serie B,
273: 887-893.

Morse, J.C. 1997. Phylogeny of Trichoptera. Annual review of entomology, 42: 427-50.

Morse, J.C., 2013. Trichoptera World Checklist. (Ed.). (http://entweb.clemson.edu/database/


trichopt/index.htm). Acesso: 16/10/2011.

Moulton, M.J.; Song, H.; Whiting, M.F. 2010. Assessing the effects of primer specificity on
eliminating numt coamplification in DNA barcoding: a case study from Orthoptera
(Arthropoda: Insecta). Molecular Ecology Resources, 10: 615-627.

NCBI BLAST, 2013. (http://blast.ncbi.nlm.nih.gov/Blast.cgi). Acesso: 12/01/2013.

Neboiss, A. 1991. Trichoptera. In: Nauman, I.D.; Carne, P.B.; Laurence, J.F.; Nielsen, E.S.;
Spradbury, J.P. (Eds). The Insects of Australia: A Textbook for Students and Researchs
Workers. Vol. 2. Cornell University Press, Ithaca, NY, USA. p. 787-816.

Nogueira, A; Sarges, R. 2001. Characterization and genesis of waterfalls of the Presidente


Figueiredo region, northeast State of Amazonas, Brazil. Anais Academia Brasileira de
Cincias, 73(2): 287-301.

100
Oliveira, L.G. 2006. Trichoptera. In: Costa, C.; Ide, S.; Simonka, C.E.(Eds). Insetos Imaturos:
Metamorfose e Identificao. Editora Holos, Ribeiro Preto, So Paulo. p. 161-174.

Paprocki, H. 2008. A Taxonomic revision of Macronema (Trichoptera: Hydropsychidae) and


selected studies of Neotropical Trichoptera. Tese de Doutorado, University of Minnesota,
Minneapolis, Minnesota, Estados Unidos. 407pp.

Paprocki, H.; Holzenthal, R.W. 2002. A review of the Brazilian genus Barypenthus
Burmeister (Trichoptera: Odontoceridae). Nova Supplementa Entomologica, 15: 223-230.

Pauls, S.U.; Theissinger, K.; Ujvarosi, L.; Balint, M.; Haase, P. 2009. Patterns of population
structure in two closely related, partially sympatric caddisflies in Eastern Europe: historic
introgression, limited dispersal, and cryptic diversity. Journal of the North American
Benthological Society, 28(3): 517-536.

Pauls, S.U.; Blahnik, J.R.; Zhou, X.; Wardwell, C.T; Holzenthal, R.W. 2010. DNA barcode
data confirm new species and reveal cryptic diversity in Chilean Smicridea (Smicridea)
(Trichoptera: Hydropsychidae). Journal of the North American Benthological Society, 29:
1058-1074.

Pes, A.M.O. 2001. Taxonomia e Estrutura de Comunidade de Trichoptera (Insecta) no


Municpio de Presidente Figueiredo, Amazonas, Brasil. Dissertao de Mestrado,
Instituto Nacional de Pesquisas da Amaznia, Manaus, Amazonas. 164pp.

Pes, A.M.O. 2005. Taxonomia, estrutura e riqueza das assemblias de larvas e pupas de
Trichoptera (Insecta), em igaraps na Amaznia Central. Tese de Doutorado, Instituto
Nacional de Pesquisas da Amaznia, Manaus, Amazonas. 188pp.

Pes, A.M.O.; Hamada, N. 2003. The occurrence of Taraxitrichia Flint & Harris, 1992
(Trichoptera: Hydroptilidae) in Brazil, with description of the final larval stage. Zootaxa,
328: 1-7.

Pes, A.M.O.; Hamada, N. 2004. Ceratotrichia Flint, 1992 (Trichoptera: Hydroptilidae) larval
and pupal description and new genus records for Brazil. Entomotropica, 19(1): 31-37.

101
Pes, A.M.O.; Hamada, N.; Nessimian, J.L. 2005. Chaves de identificao de larvas para
famlias e gneros de Trichoptera (Insecta) da Amaznia Central, Brasil. Revista
Brasileira de Entomologia, 49: 181-204.

Pes, A.M.O.; Hamada, N.; Soares, C.C. 2008. Description of the last-instar larva and pupa
and the bionomics of Smicridea (Smicridea) truncata Flint (Trichoptera:
Hydropsychidae) in Central Amazonia, Brazil. Zootaxa, 1732: 54-60.

Rafael, J.A.; Gorayeb, I.S. 1982. Tabanidae (Diptera) da Amaznia. I. Uma nova armadilha
suspensa e primeiros registros de mutucas de copas de rvores na Amaznia. Acta
Amazonica, 12(1): 232-236.

Ribeiro, J.E.L.S.; Hopkins, M.J.G.; Vicentini, A.; Sothers, C.A.; Costa, M.A.S.; Brito, J.M.;
Souza, M.A.D.; Martins, L.H.P.; Lohmann, L.G.; Assuno, P.A.C.L.; Pereira, E.C.;
Silva, C.F.; Mesquita, M.R.; Procpio, L.C. 1999. Flora da Reserva Ducke: Guia de
Identificao das Plantas Vasculares de uma Floresta de Terra-firme na Amaznia
Central. Editora INPA, Manaus, AM, Brasil. 793 pp.

Rueda-Martn, P.A. 2006. Colecta, cra y asociacin en Atopsyche (Banks) (Trichoptera:


Hydrobiosidae). Nectopsyche-Neotropical Trichoptera Newsletter, 3: 5-7.

Ruiter, D.E.; Boyle, E.E.; Zhou, X. 2013. DNA barcoding facilitates associations and
diagnoses for Trichoptera larvae of the Churchill (Manitoba, Canada) area. BMC ecology,
13(5): 1-56.

Saccone, C.; De Giorgi, C.; Gissi, C.; Pesole, G.; Reyes, A. 1999. Evolutionary genomics in
Metazoa: the mitochondrial DNA as a model system. Gene, 238: 195-209.

Saitou N.; Nei, M. 1987. The Neighbor-Joining method: a new method for reconstructing
phylogenetic trees. Molecular Biology and Evolution, 4: 406-425.

Sambrook, J.; Russel, D.W. 2001. Molecular Cloning: A Laboratory Manual.3rd ed. Cold
Spring Harbor Laboratory, Cold Spring Harbor, New York, NY, USA. 2344 pp.

Santos, G.M.; Oliveira, A.B.Jr. 1999. A pesca no reservatrio da hidreltrica de Balbina


(Amazonas, Brasil). Acta Amazonica, 29(1): 145-163.

102
Santos, A.P.M; Dumas, L.L; Jardim, G.A; Nessimian, J.L., 2013. Brazilian Caddisflies:
Checklists and Bibliography, (https://sites.google.com/site/braziliancaddisflies). Acesso:
02/11/2011.

Savolainen, V.; Cowan, R.S.; Vogler, A.P.; Roderick, G.K.; Lane, R. 2005. Towards writing
the encyclopedia of life: an introduction to DNA barcoding. Philosophical Transactions
of the Royal Society of London, Series B, Biological Sciences, 360: 1805-1811.

Schefter, P.W. 1996. Phylogenetic relationships among subfamily groups in the


Hydropsychidae (Trichoptera) with diagnoses of the Smicrideinae, new status, and the
Hydropsychinae. Journal of the North American Benthological Society, 15: 615-633.

Schefter, P.W. 2005. Reevaluation of genera in the subfamily Hydropsychinae (Trichoptera:


Hydropsychidae). Aquatic Insects, 27: 133-154.

Schneider, H. 2007. Mtodos de anlise filogentica: um guia prtico. Editora Holos e


Sociedade Brasileira de Gentica, Ribeiro Preto, SP, Brasil. 200pp.

Sheffield, N.C.; Song, H.; Cameron, S.L.; Whiting, M.F. 2008. A comparative analysis of
mitochondrial genomes in Coleoptera (Arthropoda: Insecta) and genome descriptions of
six new beetles. Molecular Biology and Evolution, 25(11): 2499-2509.

Shan, L., Yang, L.; Sun, C. 2004a. DNA-based identification of ecologically important
caddisfly larvae (Trichoptera: Hydrobiosidae). Acta Zootaxonomica Sinica, 29: 434-439.

Shan, L., Yang, L.; Wang, B. 2004b. The association of larval and adult stages of ecologically
important caddisfly (Insecta: Trichoptera) using mitochondrial DNA sequences.
Zoological Research, 25(4): 351-355.

Smith, J.M.; Smith, N.H. 2002. Recombination in Animal Mitochondrial DNA. Molecular
Biology and Evolution, 19(12): 2330-2332.

Smith, M.A.; Fisher, B.L.; Hebert, P.D.N. 2005. DNA barcoding for effective biodiversity
assessment of a hyperdiverse arthropod group: the ants of Madagascar. Philosophical
transactions of the Royal Society of London. Series B, Biological sciences, 360: 1825-
1834.

103
Song, H.; Buhay, J.E.; Whiting, M.F.; Crandall, K.A. 2008. Many species in one: DNA
barcoding overestimates the number of species when nuclear mitochondrial pseudogenes
are coamplified. Proceedings of the National Academy of Sciences of the United States of
America, 105(36): 13486-13491.

Sutou, M.; Kato, T.; Ito, M. 2011. Recent discoveries of armyworms in Japan and their
species identification using DNA barcoding. Molecular Ecology Resources, 11(6): 992-
1001.

Tamura, K.; Peterson, D.; Peterson, N; Stecher, G.; Nei, M.; Kumar, S. 2011. MEGA 5:
Molecular evolutionary genetics analysis using maximum likelihood, evolutionary
distance, and maximum parsimony methods. Molecular Biology and Evolution, 28: 2731-
2739.

Tautz, D.; Arctander, P.; Minelli, A.; Thomas, R.H.; Vogler, A.P. 2003. A plea for DNA
taxonomy. Trends in Ecology and Evolution, 18(2): 70-74.

Taylor, R.W.; Turnbull, D.M. 2005. Mitochondrial DNA mutations in human disease. Nature
Reviews Genetics, 6(5): 389-402.

Thompson, J.D., Higgins, D.G.; Gibson, T.J. 1994. CLUSTAL W: improving the sensitivity
of progressive multiple sequence alignment through sequence weighting, position-
specific gap penalties and weight matrix choice. Nucleic Acids Research, 22: 4673-4680.

Trichoptera Barcode of Life. 2013. Barcode sequence library for caddisflies.


(http://trichopterabol.org/). Acesso: 15/02/2013.

Ulmer, G. 1905. Neue und wenig bekannte Trichopteren der Museen zu Brussel und Paris.
Annales de la Socit Entomlogique de Belgique, 49: 17-42.

Vogler, A.M.; Monaghan, M.T. 2006. Recent advances in DNA taxonomy. Journal of
Zoological Systematics and Evolutionary Research, 45: 1-10.

Zhou, X.; Kjer, K.M.; Morse, J.C. 2007. Associating larvae and adults of Chinese
Hydropsychidae caddisflies (Insecta: Trichoptera) using DNA sequences. Journal of the
North American Benthological Society, 26: 719-742.

104
Zhou, X. 2009. The larvae of Chinese Hydropsychidae (Insecta: Trichoptera), part I:
Arctopsyche shimianensis, Parapsyche sp. A, and Diplectrona obscura. Zootaxa, 2174:
1-17.

Zhou, X.; Adamowicz, S.J.; Jacobus, L.M.; Dewalt, R.E.; Hebert, P.D.N. 2009. Towards a
comprehensive barcode library for arctic life - Ephemeroptera, Plecoptera, and
Trichoptera of Churchill, Manitoba, Canada. Frontiers in Zoology, 6(30): 1-9.

Zhou, X., Robinson, J.L.; Geraci, C.J.; Parker, C.R.; Flint, O.S. Jr.; Etnier, D.A.; Ruiter, D.R;
DeWalt, E.; Jacobus, L.M.; Hebert; P.D.N. 2011. Accelerated construction of a regional
DNA barcode reference library: caddisflies (Trichoptera) in the Great Smoky Mountains
National Park. Journal of the North American Benthological Society, 30(1): 131-162.

Waringer, J.; Graf, W.; Pauls, S.U.; Vicentini, H.; Lubini, V. 2008. DNA based association
and description of the larval stage of Drusus melanchaetes McLachlan, 1876
(Trichoptera: Limnephilidae: Drusinae) with notes on ecology and zoogeography.
Limnologica - Ecology and Management of Inland Waters, 38: 34-42.

Webb, J.M.; Jacobus, L.M.; Funk, D.H.; Zhou, X.; Kondratieff, B.; Geraci, C.J.; DeWalt,
R.E.; Baird, D.J.; Richard, B.; Phillips, I.; Hebert, P.D.N. 2012. A DNA barcode library
for North American Ephemeroptera: Progress and Prospects. Public Library of Science
One, 7(5): 1-6.

Wiemers, M.; Fiedler, K. 2007. Does the DNA barcoding gap exist? a case study in blue
butterflies (Lepidoptera: Lycaenidae). Frontiers in zoology, 4(8): 1-16.

Williams, N.E.; Wiggins, G.B. 1981. A proposed setal nomenclature and homology for larval
Trichoptera. Proceedings of the third International Symposium on Trichoptera, Series
Entomologica, 20: 421-429.

Wilson, K.; Cahill, V.; Ballment, E.; Benzie, J. 2000. The Complete Sequence of the
Mitochondrial Genome of the Crustacean Penaeus monodon: Are Malacostracan
Crustaceans More Closely Related to Insects than to Branchiopods? Molecular Biology
and Evolution, 17(6): 863-874.

Wiggins, G.B. 1996a. Larvae of the North American Caddisfly genera (Trichoptera). 2nd ed.
University of Toronto Press, Toronto, CA, USA. 457pp.

105
Wiggins, G.B. 1996b. Trichoptera families. In: Merritt, R.W.; Cummins, K.W. (Eds). An
Introduction to the aquatic insects of North America. 3rd ed. Dubuque, Kendall Hunt,
Publishing Company, USA. p. 309-385.

Wiggins, G.B. 2004. Caddisflies: the underwater architects. University of Toronto Press
Incorporated, Toronto, CA, USA. 292pp.

106