BioSc 231 General Genetics Exam 3 Name __________________________________

Multiple Choice. (2 points each)

_____The base thymine is always paired with ___.

A. Adenine
B. Guanine
C. Cytosine
D. Thymine

_____The sequence of one strand of DNA is 5’ TCGATC 3’. The sequence of the complementary strand would be

A. 5’ AGCTAG 3’
B. 5’ TCGATC 3’
C. 5’ CTAGCT 3’
D. 5’ GCTAGC 3’
E. 5’ GATCGA 3

_____ DNA polymerase III is thought to add nucleotides

A. to the 5' end of the RNA primer
B. to the 3' end of the RNA primer
C. in the place of the primer RNA after it is removed
D. on single stranded templates without need for an RNA primer
E. in the 3' to 5' direction

_____ DNA replication in vivo is discontinuous due to

A. polymerase slippage
B. trinucleotide repeats
C. being restricted to synthesis in the 5' to 3' direction
D. topoisomerases cutting the DNA in a random fashion
E. sister chromatid exchange

_____ Considering the structure of double stranded DNA, what kinds of bonds hold one complementary strand to the other?

A. ionic
B. covalent
C. Van der Waals
D. hydrogen
E. hydrophobic and hydrophilic

_____ The presence of a ___ with a free 3'-OH group is essential for DNA polymerase to synthesize DNA since no known DNA
polymerase is able to initiate chains.

A. origin of replication
B. restriction endonuclease
C. palindrome
D. primer
E. promoter

_____ The RNA polymerase that produces the primer necessary for DNA synthesis is called the ___.

A. origin of replication
B. convertase
C. primase
D. ligase
E. topoisomerase

_____ ___ is an enzyme that catalyzes the formation of a covalent bond between adjacent 5'-P and 3'-OH termini of separate fragments of DNA. ligases _____ The chemical bonds in DNA by which the sugar components of adjacent nucleotides are linked through the phosphate groups are called ____ bonds. Submetacentric chromosome B. It must replicate accurately so that the information it contains is precisely inherited by the daughter cells C. twistases C. A. topoisomerases E. Chromatids D. ionic _____ Which of the following is not an essential attribute that a biological molecule would need to be a useful genetic material? A. origin of replication B. hydrogen C. such that the information it carries is altered in a heritable way D. hydrophilic E. Nucleosomes B. Does not undergo supercoiling _____ A chromosome with its centromere in the terminal end is a A. primase D. shoutases D. Metacentric chromosome C. Has telomeres C. phosphodiester B. All are essential attributes of useful genetic material. change the relationship of the strands and then seal the break to remove underwinding or overwinding of the DNA helix. topoisomerase _____ __ are enzymes that introduce single strand breaks. It must carry all of the information needed to direct the specific organization and metabolic activities of the cell B. A. Euchromatin C. ligase E. It must be capable of undergoing occasional mutations. convertase C. hydrophobic D. Telocentric chromosome . A. 30 nm chromatin _____ E. coli DNA A. _____ Clusters of highly repetitive DNA located near the centromeres and telomeres are called A. Heterochromatin E. Has a single centromere B. coli genomic DNA differs from a eukaryotic chromosome in that E. It must have highly repetitive DNA sequences. Is circular D. helicases B. E. Acrocentric chromosome D.

Polycistronic mRNA usually has a single ribosome binding site D. Guanine. mRNA is rapidly degraded B. Thymine B. Cytosine _____ To describe the genetic code as degenerate indicates that A. Cytosine. Some amino acids have more than one codon D. Cytosine E. Termination is at inverted repeats . Involves removal of exons C. Thymine. Promoter sequences _____ Which of the following is true regarding the machinery of translation? A. Multiple RNA polymerase molecules D. Adenine. Inosine. tRNAs released from the ribosome are degraded E. Coupled transcription-translation C. Polycistronic mRNA B. Uracil. Spliceosomes are present in organelles and nuclei B. stem-loop sequences in mRNA B. Exon processing C. None of the above _____ Which of the following features is common to both DNA replication and transcription? A. Removal of introns D. Stop codons may have corresponding tRNA molecules _____ Which of the following is unique to eukaryotic mRNA synthesis? A. Guanine D. Guanine. A sugar-phosphate bond is formed between the 3' hydroxyl and the 5' phosphate C. Nucleotides are added to the 5' end of the newly synthesized strand B. Guanine._____ Which of the following is true regarding RNA processing? A. Guanine. Occurs in prokaryotes E. Frameshift mutations are tolerated E. mRNA capping E. Adenine. Deoxyribonucleotides are incorporated into the growing sequence D. Polyribosome formation _____ The four ribonucleotide triphosphates incorporated into mRNA are A. The code is not universal among organisms C. Inosine. Eukaryotes have nuclear ribosomes C. Uracil. Involves removal of one or more introns. Thymine C. Cytosine. Both RNA and DNA polymerase initiate at promoter sequences _____ Normal self-termination of transcription occurs due to the presence of A. Termination proteins C. Both RNA and DNA polymerase require oligonucleotide priming E. 3' polyadenylation D. Polysomes _____ Which of the following is unique to prokaryotic mRNA synthesis? A. Uracil. Adenine. Initiation usually begins at an AUG codon B. D. Coupled transcription-translation B.

+ indicates 1 . 5 independent auxotrophic mutants which all require compound G (an amino acid) as a nutritional supplement were analyzed with 5 compounds that are precursors in the synthesis of M A B C D E G compound G. Are the same as carbon-source mutants E. C. . A. They are found in the nucleus. Lack an essential metabolic protein C. duplication _____ The process of producing an amino acid polymer (polypeptide) from a RNA template is called __. a 2 . replication B. + . Are also called prototrophs D. . A chromatid is a chromosome that has been replicated but has not yet separated from its sister chromatid. D. + t 4 . transcription C. They are rich in basic amino acids B. Short Answer. Grow on minimal medium B. (variable points) The table to the right shows the results of a series of experiments Compound tested to determine the sequence of intermediates in a biochemical pathway. + growth that is supported by the indicated precursor. B._____ Nutritional mutants A. replication B. . translation D. A telomere is always on the end of a eukaryotic chromosome. + . + . + . A. H2. The kinetichore is the site of attachment of the centromere to the nuclear spindle apparatus. + + + . translation D. _____ Which of the following is not true about chromosome structure? A. + 5 + + + + . . H1. . They are associated with the nucleosome. + n 3 . A centromere is always in the middle of a eukaryotic chromosome C. . transcription C. H1 functions as a monomer. H3 and H4 form the nucleosome core. D. What is the order of the intermediates in the pathway and indicate which step t in the pathway is catalyzed by each mutant. Are usually antibiotic resistant _____ The process of producing a RNA polymer from a DNA template is called __. E. Each mutant was grown on a minimal medium u supplemented with each of the indicated compounds. E. duplication _____ Which of the following is not true for histones? A. Heterochromatin are primarily associated with the centromere and telomere regions.

A. What end (5' or 3') of the molecule is indicated by arrow number 1? B. Which enzyme is indicated by arrow number 2? Translate the following mRNA 5’ GAGGCCGACGUGCCGACGUCAGAUGGCUAAAGAAAUGUAUGACGCUUAU GGUGAAACUGCUAAUGCCUAGCCAAAGGCUCCUUUUGGAGCUUUUUUUU 3’ . What kind of nucleic acid is indicated by arrow number 4? D. What end (5' or 3') of the molecule is indicated by arrow number 8? C. What do you call the short DNA fragments indicated by arrow number 5? E.The following 5 questions refer to the numbers on this figure. What enzyme functions to join the short fragments indicated by arrow number 6? F.

The bacteria were then transferred to a medium that only contained the light form of nitrogen. . At different time points. DNA was isolated from the bacteria and subjected to density gradient ultracentrifugation. after 1 generation. Use the following test tube pictures to indicate the location of the DNA band(s) at the beginning of the experiment. after 2 generations and after 4 generations. 1 Generation 2 Generations 4 Generations Complete the structure of the nucleotide below by filling in the boxes with the letter of the appropriate functional group. Starting DNA. Bacterial cells were grown in the presence of heavy nitrogen until all the DNA contained the heavy form.Meselson and Stahl used a heavy form of nitrogen to demonstrate semi-conservative DNA replication.

Short Essay (6pts). Describe the structure of eukaryotic chromatin from the basic building blocks to the compact structure found in metaphase cells. List the enzymes and proteins involved in DNA replication. 1. Describe the function of each. 2. Include all proteins involved in forming the structure and all intermediate structures 3. Using boxes or lines as a schematic representation of template DNA. Answer one of the following three questions. A) Promoter -10 and -35 B) AUG C) Ribosome binding site D) Coding sequence E) Transcriptional terminator F) Amino and carboxyl ends of the resulting protein. . diagram the parts indicated below (from a prokaryote). mRNA and protein.

Some of the nucleotide analogs being used to treat HIV infections are called dideoxy nucleotides. (4 pts) One of the earliest drugs used to treat patients with HIV infections was the nucleotide analog AZT. Dideoxy nucleotides include a ribose sugar that lacks both a 2’ and 3’ hydroxyl group. what effect do you think these analogs have on viral nucleic acid synthesis.Bonus question. A nucleotide analog has a structure and function similar to a nucleotide. . Based on what you know about nucleic acid synthesis.

Master your semester with Scribd & The New York Times

Special offer for students: Only $4.99/month.

Master your semester with Scribd & The New York Times

Cancel anytime.