BioSc 231 General Genetics Exam 3 Name __________________________________

Multiple Choice. (2 points each)

_____The base thymine is always paired with ___.

A. Adenine
B. Guanine
C. Cytosine
D. Thymine

_____The sequence of one strand of DNA is 5’ TCGATC 3’. The sequence of the complementary strand would be

A. 5’ AGCTAG 3’
B. 5’ TCGATC 3’
C. 5’ CTAGCT 3’
D. 5’ GCTAGC 3’
E. 5’ GATCGA 3

_____ DNA polymerase III is thought to add nucleotides

A. to the 5' end of the RNA primer
B. to the 3' end of the RNA primer
C. in the place of the primer RNA after it is removed
D. on single stranded templates without need for an RNA primer
E. in the 3' to 5' direction

_____ DNA replication in vivo is discontinuous due to

A. polymerase slippage
B. trinucleotide repeats
C. being restricted to synthesis in the 5' to 3' direction
D. topoisomerases cutting the DNA in a random fashion
E. sister chromatid exchange

_____ Considering the structure of double stranded DNA, what kinds of bonds hold one complementary strand to the other?

A. ionic
B. covalent
C. Van der Waals
D. hydrogen
E. hydrophobic and hydrophilic

_____ The presence of a ___ with a free 3'-OH group is essential for DNA polymerase to synthesize DNA since no known DNA
polymerase is able to initiate chains.

A. origin of replication
B. restriction endonuclease
C. palindrome
D. primer
E. promoter

_____ The RNA polymerase that produces the primer necessary for DNA synthesis is called the ___.

A. origin of replication
B. convertase
C. primase
D. ligase
E. topoisomerase

hydrophobic D. It must replicate accurately so that the information it contains is precisely inherited by the daughter cells C. ionic _____ Which of the following is not an essential attribute that a biological molecule would need to be a useful genetic material? A. Metacentric chromosome C. change the relationship of the strands and then seal the break to remove underwinding or overwinding of the DNA helix. It must have highly repetitive DNA sequences. Does not undergo supercoiling _____ A chromosome with its centromere in the terminal end is a A. A._____ ___ is an enzyme that catalyzes the formation of a covalent bond between adjacent 5'-P and 3'-OH termini of separate fragments of DNA. coli DNA A. Nucleosomes B. hydrophilic E. such that the information it carries is altered in a heritable way D. hydrogen C. topoisomerase _____ __ are enzymes that introduce single strand breaks. It must be capable of undergoing occasional mutations. convertase C. origin of replication B. Has a single centromere B. A. Acrocentric chromosome D. helicases B. topoisomerases E. Has telomeres C. ligases _____ The chemical bonds in DNA by which the sugar components of adjacent nucleotides are linked through the phosphate groups are called ____ bonds. E. coli genomic DNA differs from a eukaryotic chromosome in that E. _____ Clusters of highly repetitive DNA located near the centromeres and telomeres are called A. All are essential attributes of useful genetic material. shoutases D. Is circular D. Telocentric chromosome . Submetacentric chromosome B. Heterochromatin E. Euchromatin C. phosphodiester B. primase D. It must carry all of the information needed to direct the specific organization and metabolic activities of the cell B. A. Chromatids D. twistases C. 30 nm chromatin _____ E. ligase E.

Polycistronic mRNA B. Cytosine _____ To describe the genetic code as degenerate indicates that A. The code is not universal among organisms C. Spliceosomes are present in organelles and nuclei B. mRNA is rapidly degraded B. Involves removal of exons C. Inosine. Occurs in prokaryotes E. Deoxyribonucleotides are incorporated into the growing sequence D. A sugar-phosphate bond is formed between the 3' hydroxyl and the 5' phosphate C. D. Inosine. Both RNA and DNA polymerase initiate at promoter sequences _____ Normal self-termination of transcription occurs due to the presence of A. Cytosine E. Termination is at inverted repeats . Eukaryotes have nuclear ribosomes C. Polyribosome formation _____ The four ribonucleotide triphosphates incorporated into mRNA are A. Uracil. Some amino acids have more than one codon D. Multiple RNA polymerase molecules D. Coupled transcription-translation B. 3' polyadenylation D. Adenine. Uracil. tRNAs released from the ribosome are degraded E. Guanine. Cytosine. Guanine. None of the above _____ Which of the following features is common to both DNA replication and transcription? A. Guanine. Guanine D. Promoter sequences _____ Which of the following is true regarding the machinery of translation? A. Coupled transcription-translation C. Thymine B. Involves removal of one or more introns. Stop codons may have corresponding tRNA molecules _____ Which of the following is unique to eukaryotic mRNA synthesis? A. Polycistronic mRNA usually has a single ribosome binding site D. Nucleotides are added to the 5' end of the newly synthesized strand B. Frameshift mutations are tolerated E. stem-loop sequences in mRNA B. Thymine C. Thymine. Guanine._____ Which of the following is true regarding RNA processing? A. Adenine. Removal of introns D. Initiation usually begins at an AUG codon B. Cytosine. Uracil. mRNA capping E. Adenine. Both RNA and DNA polymerase require oligonucleotide priming E. Exon processing C. Polysomes _____ Which of the following is unique to prokaryotic mRNA synthesis? A. Termination proteins C.

They are rich in basic amino acids B._____ Nutritional mutants A. + 5 + + + + . transcription C. H1 functions as a monomer. A. H3 and H4 form the nucleosome core. . translation D. transcription C. H1. _____ Which of the following is not true about chromosome structure? A. Are usually antibiotic resistant _____ The process of producing a RNA polymer from a DNA template is called __. + . + + + . E. D. + n 3 . duplication _____ Which of the following is not true for histones? A. . The kinetichore is the site of attachment of the centromere to the nuclear spindle apparatus. + t 4 . + indicates 1 . + . (variable points) The table to the right shows the results of a series of experiments Compound tested to determine the sequence of intermediates in a biochemical pathway. A chromatid is a chromosome that has been replicated but has not yet separated from its sister chromatid. . Each mutant was grown on a minimal medium u supplemented with each of the indicated compounds. A. + growth that is supported by the indicated precursor. Are also called prototrophs D. A centromere is always in the middle of a eukaryotic chromosome C. They are associated with the nucleosome. Heterochromatin are primarily associated with the centromere and telomere regions. . a 2 . B. replication B. D. A telomere is always on the end of a eukaryotic chromosome. E. 5 independent auxotrophic mutants which all require compound G (an amino acid) as a nutritional supplement were analyzed with 5 compounds that are precursors in the synthesis of M A B C D E G compound G. H2. Lack an essential metabolic protein C. Grow on minimal medium B. . They are found in the nucleus. + . What is the order of the intermediates in the pathway and indicate which step t in the pathway is catalyzed by each mutant. C. . + . Are the same as carbon-source mutants E. duplication _____ The process of producing an amino acid polymer (polypeptide) from a RNA template is called __. translation D. Short Answer. replication B.

What end (5' or 3') of the molecule is indicated by arrow number 8? C. What end (5' or 3') of the molecule is indicated by arrow number 1? B. What kind of nucleic acid is indicated by arrow number 4? D.The following 5 questions refer to the numbers on this figure. Which enzyme is indicated by arrow number 2? Translate the following mRNA 5’ GAGGCCGACGUGCCGACGUCAGAUGGCUAAAGAAAUGUAUGACGCUUAU GGUGAAACUGCUAAUGCCUAGCCAAAGGCUCCUUUUGGAGCUUUUUUUU 3’ . What do you call the short DNA fragments indicated by arrow number 5? E. A. What enzyme functions to join the short fragments indicated by arrow number 6? F.

1 Generation 2 Generations 4 Generations Complete the structure of the nucleotide below by filling in the boxes with the letter of the appropriate functional group. Bacterial cells were grown in the presence of heavy nitrogen until all the DNA contained the heavy form. Starting DNA. Use the following test tube pictures to indicate the location of the DNA band(s) at the beginning of the experiment. The bacteria were then transferred to a medium that only contained the light form of nitrogen. after 2 generations and after 4 generations.Meselson and Stahl used a heavy form of nitrogen to demonstrate semi-conservative DNA replication. . At different time points. DNA was isolated from the bacteria and subjected to density gradient ultracentrifugation. after 1 generation.

Describe the function of each. diagram the parts indicated below (from a prokaryote). A) Promoter -10 and -35 B) AUG C) Ribosome binding site D) Coding sequence E) Transcriptional terminator F) Amino and carboxyl ends of the resulting protein. Include all proteins involved in forming the structure and all intermediate structures 3. mRNA and protein. Answer one of the following three questions. Describe the structure of eukaryotic chromatin from the basic building blocks to the compact structure found in metaphase cells.Short Essay (6pts). List the enzymes and proteins involved in DNA replication. . 1. Using boxes or lines as a schematic representation of template DNA. 2.

A nucleotide analog has a structure and function similar to a nucleotide. Dideoxy nucleotides include a ribose sugar that lacks both a 2’ and 3’ hydroxyl group.Bonus question. Some of the nucleotide analogs being used to treat HIV infections are called dideoxy nucleotides. (4 pts) One of the earliest drugs used to treat patients with HIV infections was the nucleotide analog AZT. what effect do you think these analogs have on viral nucleic acid synthesis. . Based on what you know about nucleic acid synthesis.

Master your semester with Scribd & The New York Times

Special offer for students: Only $4.99/month.

Master your semester with Scribd & The New York Times

Cancel anytime.