Vous êtes sur la page 1sur 286

Mejoramiento gentico y

biotecnolgico de plantas
Mejoramiento gentico y
biotecnolgico de plantas
Presentacin

Nos maravillamos con frecuencia de las creaciones humanas modernas pero muy pocas
veces nos detenemos a pensar sobre los alimentos que ingerimos a diario. La abrumadora
mayora de productos agrcolas que conocemos y empleamos, no son el resultado de la
evolucin natural de las plantas sino de la manipulacin de los humanos. La
domesticacin, un proceso prolongado y simultneo en las grandes civilizaciones antiguas,
no fue sino resultado de la seleccin inducida de las plantas por agricultores que buscaban
alcanzar un mayor rendimiento en sus frutos comestibles o utilizables para satisfacer sus
necesidades.

A mediados del siglo pasado, esta actividad practicada por la mayora de los agricultores
del mundo, se convirti en una ciencia a partir del conocimiento de la gentica de los seres
vivos. Lo que antes demandaba largos procesos de seleccin emprica, fue reemplazada o
acelerada por el mejoramiento gentico en laboratorios y por la introduccin de genes para
potenciar las plantas con relacin a su entorno. As se han obtenido variedades con nuevas
caractersticas y mayor resistencia a plagas y enfermedades, a la escasez del agua o a las
variaciones climticas extremas.

En un peldao superior, la biotecnologa moderna ha combinado genes de especies


diferentes para obtener mayores resultados en la agricultura. An cuando hay resistencias a
estas acciones, lo cierto es que la ciencia deber continuar buscando los caminos que
permitan producir ms alimentos con menos recursos y que estos cultivares adems,
reduzcan los efectos colaterales de una agricultura que requiere producir ms alimentos e
insumos para otras actividades.

El Banco Agropecuario (AGROBANCO) a travs de su coleccin AGROSABER, se


complace en apoyar la publicacin de la segunda edicin revisada y mejorada, del trabajo
Mejoramiento gentico y biotecnolgico de plantas. Mtodos de mejoramiento en
Autgamas y Algamas de los cientficos y docentes de la Universidad Nacional Agraria
de La Molina (UNALM), Flix Camarena Mayta, Julin Chura Chuquija y Ral Humberto
Blas Sevillano.

Este monumental trabajo pone en manos de los cientficos, acadmicos y todas las
personas interesadas en entender los misterios que encierra cada cultivar con los cuales
elevamos la productividad de los escasos suelos agrcolas del pas, enfrentamos los
desafos del cambio climtico y le conferimos valor a nuestra biodiversidad incorporndola
a ese gran legado humano que es la agricultura.

Hugo Wiener Fresco


Presidente
Banco Agropecuario
INTRODUCCIN

El incremento de la produccin de un cultivo se puede obtener, ya sea aumentando las reas de


cultivo o la produccin por unidad de rea y mediante la utilizacin de la biotecnologa.

La tecnologa para el cultivo en zonas ridas y desrticas de la costa del Per ya existen por las
experiencias a travs del Mundo. La produccin en esta regin, se viene incrementando
aceleradamente por la agroexportacion creciente, requiriendo de tecnologas de punta tales como el
uso eficiente del agua y las buenas prcticas agricolas que la Universidad Nacional Agraria la
Molina (UNALM), viene implementando.

En las zonas altoandinas, se van agravando los problemas por los cambios climticos, se reduce las
fuentes de provisin de agua, se incrementan los suelos erosionados y pobres, aguas contaminadas,
lluvias acidas por las minas, entre otros. Otro aspecto importante es que se va perdiendo la
biodiversidad y con esto genes importantes para las generaciones futuras que es necesario
preservar.

La selva se caracteriza por ser fuente de biodiversidad, de regulacin del clima en el mundo, se
debe preservar el ambiente y ser fuente de captura del CO2.

En cuanto a la biotecnologa para el caso del Per, requiere de considerable apoyo tecnolgico y
econmico. Sin embargo, las perspectivas son prometedoras para su adecuada valoracin de la
biodiversidad del pas. La UNALM viene impulsando fuertemente trabajos de investigacin en este
sentido.

Fenmenos actuales en el mundo como la globalizacin y el Tratado de Libre Comercio exigen una
mejor competitividad de los cultivos. El mejoramiento gentico de plantas en este contexto debe
responder con la formacin de cultivares que respondan a las exigencias diversas de los
consumidores tanto en el Per como en el Mundo. Igualmente debe jugar un rol importante dentro
del contexto de la sostenibilidad de la agricultura y la preservacion del ambiente.

Las nuevas variedades deben tener genes de tolerancia a plagas y enfermedades, a suelos salinos, a
climas adversos, entre otros aspectos, con cualidades de valor alimenticio, industrial y medicinal.

El propsito de la presente publicacin apunta a incentivar a los investigadores a tener en cuenta


que el Mejoramiento Gentico de Plantas es una disciplina importante para la formacin de una
variedad y que debe responder a las diferentes condiciones ambientales. Esperamos que nuestros
lectores asi lo comprendan.
PRLOGO

MEJORAMIENTO GENETICO Y BIOTECNOLGICO DE PLANTAS

El acelerado desarrollo de las ciencias agrarias junto a otros fenmenos como el cambio
climtico y hechos sociales tales como la globalizacin, el TLC con diferentes pases, hace
que cambie aceleradamente el escenario de la produccin de alimentos.

El desarrollo de la biotecnologa y la informacin, necesita de nuevas tecnologas de


cultivos tales como, la agricultura de precisin, labranza mnima, agricultura orgnica,
utilizacin del sistema de informacin geogrfica, adems de la obtencin de cultivos
transgnicos. Todos estos hechos hace que se oferten tecnologas nuevas tal como se
exponen en esta publicacin que se espera sea de uso para profesionales, alumnos y toda
persona interesada en los ultimos avances de la investigacin agrcola en cuanto al aspecto del
mejoramiento gentico y la biotecnologa.

El texto est compuesto de cuatro partes. La primera parte, trata sobre la historia del mejoramiento
genetico de plantas desde sus origenes hasta nuestros dias, destacando los logros que a nuestro
entender marcaron hitos en la revolucin de la produccin agrcola a traves de la historia.
Igualmente, en esta primera parte, se trata sobre un tema trascendental actual: el rol que juega el
mejoramiento gentico de plantas en una agricultura sustentable.

La segunda parte, trata sobre el mejoramiento gentico de plantas autogamas comprendiendo


metodologas desde las clsicas hasta las actuales como la seleccin gamtica y la recurrente y el
mejoramiento por caracteres multiples y de resistencia duradera. Igualmente se destaca las formas
de inicio de seleccin en generaciones tempranas durante el proceso de seleccin, llegando a
utilizar los dobles haploides o dihaploides.

La tercera parte trata sobre el mejoramiento genetico de plantas alogamas utilizando metodologas
de obtencin de hibridos de alta produccin con tecnologas modernas, asi como la obtencin de
lineas a partir de poblaciones mejoradas y la introduccion de genes con resistencia favorables a
factores bioticos y abioticos en lneas elites.

La cuarta parte comprende la biotecnologa, con las ltimas tecnologas del mejoramiento genetico
de plantas donde trata sobre el cultivo de tejidos In vitro, asi como la transformacin genetica de
las plantas y el uso de marcadores moleculares.

Es as que la UNALM pone a disposicin de la agricultura nacional los resultados de sus


avances de investigacin en este Libro MEJORAMIENTO GENETICO Y
BIOTECNOLGICO DE PLANTAS Mtodos de Mejoramiento en Algamas y
Autgamas, este texto constituye una herramienta elemental en el proceso de mejoramiento
gentico.

Los Autores
FLIX CAMARENA MAYTA
Doctor en Ciencias Agronmicas obtenido en la
Facult Universitaire des Sciences Agronomiques
de Gembloux-Blgica.
Profesor principal de la Universidad Nacional
Agraria La Molina. Jefe del PIPS de Leguminosas
de Grano y Oleaginosas Miembro de European
Academy of Sciences. Distincin como Profesor HONORARIO de la
Universidad Tecnolgica de los Andes, Abancay. Recibi el Ttulo de Honor
y Medalla Doctor en Filosofa de la Educacin, PhD durante la I Cumbre
Iberoamericana Rumbo a la Calidad Educativa en Punta del Este, Uruguay
por el Consejo Iberoamericano en Honor a la Calidad Educativa.

Promotor y ejecutor de convenios de proyeccin social y de investigacin


entre la Cooperacin Belga y la Facultad de Ciencias Agronmicas de
Gembloux-Blgica..

JULIAN CHURA CHUQUIJA


Ing. Agrnomo, M. Sc. en Mejoramiento Gentico
de Plantas obtenido en la Universidad Nacional
Agraria La Molina (UNALM). Docente y miembro
activo del Programa Cooperativo de Investigaciones
en Maz (PCIM) de la UNALM. rea principal de
investigacin es el Mejoramiento de Maz Amarillo
Duro y Manejo del Banco de Germoplasma del PCIM. Es miembro de la
Sociedad Peruana de Gentica. Fue Director del IRD-Sierra en la UNALM.

RAL BLAS SEVILLANO


Ing. Agrnomo y MSc. en mejoramiento gentico
de plantas, obtenido en la Universidad Nacional
Agraria La Molina (UNALM), Lima-Per y PhD.
en ciencias agronmicas e ingeniera biolgica
obtenido en la Facult de Sciences Agronomiques
de Gembloux-Blgica. En el ao 1997 se incorpor
D OD IDFXOWDG GH DJURQRPtD \ 'HSDUWDPHQWR GH WRWHFQLD GH OD 81$/0
Actualmente es profesor Principal y dicta cursos de pre y post grado en el rea
de Gentica, mejoramiento gentico de plantas y doctorado en agricultura
sustentable. Es miembro del instituto de Biotecnologa de la UNALM, rea
de biologa molecular. Su principal rea de investigacin es en gestin de
recursos genticos vegetales de la regin andina y mejoramiento de plantas.
PRIMERA PARTE
INTRODUCCIN AL MEJORAMIENTO GENTICO DE PLANTAS

1
1. MEJORAMIENTO GENTICO DE PLANTAS

1.1. Historia del mejoramiento gentico

La domesticacin es un proceso por el cual las plantas silvestres se convierten en


cultivadas. En la poca de la agricultura incipiente, el hombre aprendi a obtener semillas
de las plantas silvestres y a sembrarlas para beneficiarse de la cosecha. Poco a poco fue
usando algunos procedimientos elementales de seleccin para mejorar sus cultivos,
basados en la simple observacin de que los hijos se parecen a los padres.

Aunque los procedimientos de seleccin deben haberse hecho ms eficientes a medida que
la agricultura desarrollaba, lo ms probable es que las grandes diferencias que ahora se
notan entre las plantas cultivadas y sus parientes silvestres, hayan sido producto de la
adaptacin a un medio ms controlado y a otros procesos naturales, ms que a la aplicacin
de mtodos eficientes de seleccin. El mejoramiento de cultivos hasta llegar a las formas
que actualmente conocemos, tiene que haberse realizado con la aplicacin de alguna forma
de seleccin.

La metodologa para hacer la seleccin es muy variada, y casi se puede generalizar


sosteniendo que cada mejorador tiene una metodologa de seleccin. Sin embargo, parte de
esa metodologa es comn, y debe de seguir rigurosamente los postulados de la ciencia de
la gentica en los que se basa la seleccin. Esa metodologa comn, aplicada a diferentes
formas de produccin de las plantas es lo que se denomina Mtodos de Mejoramiento.
Todos los mtodos tienen como objetivo seleccionar los mejores genotipos dentro de una
poblacin, o crear genotipos nuevos con caractersticas previamente definidas. Todos los
mtodos estn diseados, para en mayor o menor grado:

1. Generar semilla cuya descendencia reproduzca el genotipo deseado.


2. Hacer mximo uso de la variabilidad gentica presente en la (s) poblacin(es)
seleccionada (s).
3. Crear mayor variabilidad gentica, a travs de la hibridacin y recombinacin, para
obtener nuevos genotipos.
4. Evaluar la descendencia para definir el genotipo.
5. Ejercer control del mecanismo de floracin y polinizacin.
6. Controlar el efecto del ambiente, de la interaccin genotipo por ambiente y del error
experimental, para mejorar la heredabilidad.

Es relativamente fcil para el mejorador de plantas implementar cualquiera de estas siete


acciones, para seleccionar o crear los genotipos deseados. Lo que no es tan fcil y requiere
mucho conocimiento y formacin es hacerlo lo ms rpido y econmicamente posible, en
trminos de costos y uso de recursos tanto humanos como fsicos.

Las evidencias histricas de la seleccin de plantas para producir cultivares antes del siglo
XX son muy escasas. Se sabe que los chinos desarrollaron variedades mejoradas de arroz
hace 6000 aos. La existencia de semillas especialmente guardadas en tumbas de culturas
que crean en la continuidad de la vida, es la mejor evidencia del valor que tena la semilla
en esas culturas.

2
La seleccin para la siembra de semillas provenientes de plantas con las caractersticas
deseadas, debe haber sido una prctica comn casi desde los albores de la agricultura. Pero
el mejoramiento de plantas recin puede considerarse como una actividad cientfica cuando
se empieza a ejercer control artificial en la floracin y la polinizacin de las plantas. Por
eso es que se considera el inicio de esta actividad cuando Camerarius en 1694 demostr
que las plantas tenan sexo. La evidencia de algunas pinturas egipcias de ms de 4000 aos
de antigedad, que muestran hombres polinizando palmeras datileras, es un indicio de que
el control de la polinizacin interes al hombre desde muy temprana edad.

En 1766, Kelreuter hizo una serie de contribuciones en ese campo: observ esterilidad en
cruzas interespecficas de Nicotiana; describi el polen y formas de polinizacin elica y
entomfila; descubri el vigor hbrido en la F1. Los resultados con relacin al vigor hbrido
fueron corroborados por Beal en los Estados Unidos, cruzando variedades de maz. En
1878, este investigador sugiri el uso de hbridos intervarietales de maz. En el mismo pas,
en 1906, East y Shull, describen la depresin por endocra en maz y la heterosis que
restituye el vigor en las cruzas entre lneas endocriadas. En 1917, Jones propone la
formacin de hbridos dobles, y se inicia la produccin de hbridos de maz que
revolucionaron la agricultura de los Estados Unidos.

En 1921, Wright public una serie de trabajos sobre sistemas de apareamiento y sent las
bases tericas del fenmeno de endocra. Ya en esa poca estaba perfectamente definido
que los caracteres que se heredaban en forma cuantitativa tenan una base mendeliana. En
1918, Fisher en Inglaterra haba publicado su trabajo titulado: "La correlacin entre
relacionados bajo la suposicin de herencia mendeliana."

La aplicacin de la Estadstica Experimental en la solucin de problemas genticos que


desarroll Galton en Inglaterra a fines del siglo XIX, confirm la creencia de que los
factores responsables de la herencia se mezclaban en el hbrido, en contraposicin a los
descubrimientos de Mendel. En 1906, Nilsson Ehle public un artculo en el que expuso la
dificultad de obtener buenos genotipos por simple seleccin dentro de una poblacin,
recomendando los cruzamientos artificiales como el mejor modo de combinar varios
caracteres deseables. Anteriormente Nilsson Ehle haba probado que un carcter que
aparentemente era gobernado por factores que se mezclaban en el hbrido y mostraban una
variacin continua, era gobernado por tres pares de genes mendelianos con efectos
aditivos. Este investigador consider la utilizacin de la segregacin transgresiva como un
mtodo de Mejoramiento.

El Mejoramiento de Plantas se inicia mucho antes de que se definan los mtodos de


mejoramiento sobre bases mendelianas. A principios del siglo XVIII, la Compaa
Vilmorn en Francia inicia sus actividades; en 1856, ellos reportan que la cantidad de
azcar de remolacha se haba incrementado significativamente usando pruebas de
progenie. Ya las pruebas de progenie" y la seleccin de lneas puras haban sido
utilizadas en Europa por Le Couteur y Shirreff, para producir variedades mejoradas de
trigo y avena respectivamente. Tambin la prueba de progenie se utiliz por Hays en
Estados Unidos y por Hjalmar Nilsson en Suecia.

En 1856, Gregor Mendel public los resultados de sus investigaciones que dan lugar a las
leyes que llevan su nombre, pero ellas no se usaron para explicar la eficiencia de los
mtodos o para crear nuevos, hasta que su trabajo se redescubri en 1900, cuando el

3
holands De Vries, el alemn Correns, y el austriaco Tschermak, publicaron experimentos
similares a los de Mendel, y se dieron cuenta de la importancia de ellos. En 1901, De Vries
y Tschermak, visitaron la Estacin Experimental de Svalff en Suecia, y contaron a los
mejoradores sobre sus investigaciones que corroboraron los resultados de Mendel. Ese
momento puede considerarse como el inicio del uso de los conceptos de Gentica en el
Mejoramiento de las Plantas.

Muy rpidamente se desarroll la ciencia de la gentica y su aplicacin en el


mejoramiento. En 1903 el dans Johannsen propuso el concepto de la "lnea pura", y se
defini: "genotipo y fenotipo". La conclusin de que la seleccin en base a las diferencias
fenotpicas dentro de una lnea pura es ineficiente, fue el punto de partida para la bsqueda
de mtodos que distinguen claramente entre genotipo y fenotipo.

El mtodo de Retrocruzas fue aplicado en las plantas en 1920 por Harlan y Pope. Sin
embargo, se considera que un mtodo similar se aplicaba en mejoramiento animal, aun
antes del redescubrimiento de las leyes de Mendel; podemos concluir que todos los
mtodos tradicionales de mejoramiento aplicados en plantas autgamas: seleccin masal,
lnea pura, prueba de progenies y retrocruzas, existan ya antes de las leyes de Mendel. Sin
embargo, muchas modificaciones se desarrollaron despus, que hicieron mucho ms
eficiente los mtodos, no slo para lograr un mejoramiento ms rpido sino para conservar
la variabilidad en el proceso de seleccin, o restaurarla si fuese necesario. La sugerencia de
Nilsson-Ehle de usar la segregacin transgresiva, se puede considerar como el punto de
partida del mtodo genealgico o de pedigree. l mismo en 1908 inici en Svaloff la
aplicacin del mtodo del Bulk. Mucho despus se idearon algunas modificaciones, como
el "Single Seed Descent".

A pesar del xito logrado por Vilmorn en remolacha azucarera, los mtodos de
mejoramiento aplicados en algamas fueron muy poco eficientes, sobre todo cuando se
aplicaron para mejorar caracteres de baja heredabilidad. La utilizacin de la heterosis en
maz cubri con creces esa ineficiencia.

La seleccin masal y seleccin familial se viene utilizando mucho ms intensamente, desde


que en la Universidad de Carolina del Norte, se aplicaron los conceptos de relaciones
genticas entre relacionados, que se usaban ya en gentica animal; y desde que en la
Universidad de Nebraska se idearon las modificaciones de los mtodos tradicionales,
basados principalmente en un mayor control ambiental del error y de las interacciones; as
como un mayor control parental y una ms eficiente explotacin de variancia gentica
aditiva primero, y no aditiva posteriormente.

La seleccin recurrente consiste bsicamente en recombinar los genotipos seleccionados


para formar una poblacin de la que se seleccionan nuevamente los genotipos superiores;
es el mtodo general que se usa en el mejoramiento de plantas algamas. Sin embargo,
ltimamente se est utilizando tambin en plantas autgamas, y en plantas de reproduccin
vegetativa.

En la actualidad se viene priorizando la utilizacin amplia de genes con la preservacin de


los recursos genticos para una agricultura sostenida. Igualmente se viene utilizando las
tcnicas de mejoramiento con la aplicacin de la biotecnologa basado en la ingeniera
gentica y la obtencin de plantas transgnicas, que son tratados en otros textos.3-4

4
1.2. Importancia social y econmica del mejoramiento

En el Per, podemos preciarnos de ser herederos de la gran Cultura Inca y Pre-Inca, donde
seleccionaron especies vegetales de gran valor nutritivo para las diferentes condiciones
ambientales. Sin embargo, no tenemos la certeza de la metodologa seguida para obtener
las variedades que muchas de ellas perduran sin ser superadas por las tecnologas actuales;
ejemplo el maz (Zea mays) gigante Blanco Urubamba, maz dulce para cancha Chullpi,
pallar (Phaseolus lunatus L.) gigante criollo, el chocho o tarwi (Lupinus mutabilis Sweet)
de alto contenido proteco y de aceite, cultivado sobre los 3000 msnm, el frijol (Phaseolus
vulgaris L.) reventn tipo ua o numia. Tambin tenemos las especies como
Chenopodium quinoa Willd. (quinua), Lepidium meyenii Walp. (maca) cultivado a 4000
msnm, Chenopodium pallidicaule (caihua), Amaranthus caudatus L. (kiwicha),
Amaranthus sp. (atacjo, ataco, ataco casha, yuyo, jetka), todas estas especies de gran valor
nutritivo. Sera de gran importancia colectar informaciones bsicas sobre el proceso
desarrollado en el mejoramiento por los antiguos agricultores andinos para desarrollar estas
especies.

Dada la importancia de la papa (Solanum tuberosum) a nivel mundial, se acord realizar el


secuenciamiento del genoma de la papa. Un grupo de 18 pases se encargan de este trabajo
liderado por la Universidad de Wageningen-Holanda. En Amrica Latina, Brasil, Chile y
Per se encargan del estudio del cromosoma 3. En el Per, la Universidad Peruana
Cayetano Heredia (UPCH), conjuntamente con el Centro Internacional de la Papa (CIP)
son los encargados de este trabajo. Para este estudio se us como progenitores Solanum
tuberosum di-haploide y Solanum phureja doble monoploide, para secuenciar y ensamblar
un genoma de 844 megabases. Las seudo molculas construidas de cada uno de los doce
cromosomas anclaron genticamente 623 megabases o sea el 86 % del genoma. Se
identificaron 2 619 loci; algunos identificaron protenas que son la base para resistencia a
enfermedades. Esos genes se identificaron y mapearon en Solanum phureja. Los genes que
codificaron protenas, representando todos los principales tipos de tejido, estados de
desarrollo y respuestas a estreses biticos y abiticos, abren muchas posibilidades para
solucionar problemas de esos estreses con medios genticos.

Tambin hay productos que aclaran el origen de la papa y las relaciones con otras especies.
La divergencia entre la papa y la uva ocurri hace 89 millones de aos y la divergencia
entre las dos principales ramas de las dicotiledneas ocurri hace 185 55 millones de
aos. La secuencia de genes conservativos a travs de las especies, por ejemplo entre papa
y tomate es notable; seguramente que ese fenmeno se debe presentar tambin con otras
Solanceas. Las herramientas bioinformticas que se han creado en ese proyecto para
descubrir genes usando las secuencias genmicas de la papa, es un producto tecnolgico
que ser usado tambin para generar herramientas similares para otras especies.2

Durante la Colonia se introdujeron especies tales como el trigo (Triticum aestivum L.),
cebada (Hordeum vulgare L.), arroz (Oryza sativa L.), entre otros, que se adaptaron y
forman parte de la dieta diaria del poblador peruano. Actualmente se va dando prioridad a
cultivos de exportacin pero que todava en muchos casos, falta desarrollar tecnologas
para cumplir los requerimientos de calidad de exportacin. Mediante estudios
biotecnolgicos se vienen analizando las propiedades funcionales y nutritivas de los
cultivos nativos altoandinos.11

5
El impacto del maz hbrido en la economa de los EEUU, fue impresionante en los
primeros 25 aos de desarrollo. En 1955 se estim que la inversin anual de US$ 2.8
millones, produca un retorno neto anual de US$ 230 millones; la inversin en
investigacin en la produccin de hbridos, una actividad netamente de mejoramiento
gentico, produjo un retorno por ao de 700 %.

La mayor ventaja que tiene el mejoramiento gentico es que su efecto es multiplicativo, o


sea el trabajo realizado por muy pocas personas con una inversin muy limitada, puede
causar un impacto muy grande. El caso ms evidente de esa situacin ha sido el
mejoramiento del trigo cuya difusin en Mxico, la India y Pakistn produjo lo que se ha
llamado la "Revolucin verde".

En 1990, tres centros internacionales de investigacin agrcola de Amrica Latina (CIAT,


CIMMYT y CIP) invirtieron US$ 22.3 millones en investigacin en frijol, maz, arroz y
trigo. Luego el aumento de la produccin agrcola resultante del uso de variedades
mejoradas de estos cultivos bsicos report a la regin utilidades de ms de mil millones
de dlares alrededor de 46 veces la suma invertida en investigacin en los cuatro
productos, y 11 veces la suma del presupuesto de los tres centros para 1990.10 Durante el
periodo 1966 1989, la produccin de trigo en la regin prcticamente se duplic. La
produccin de arroz se increment en 93 %, la de maz en 58 %, la de papa en 57 % y la de
frijol en 12 %. El crecimiento de la produccin de carne y leche durante 1974 1989 fue
de 23 % y 34 % respectivamente. Los aumentos en la produccin se atribuyen
principalmente al incremento en la produccin de alimentos por rea sembrada.9 Estos
aumentos sirvieron para que la produccin de alimentos de Amrica Latina se mantuviera
por encima del crecimiento de la poblacin.

En 1987 1989, los nueve productos del CIAT, CIMMYT y CIP generaron ganancias de $
26.6 mil millones sobre la inversin en tierra, mano de obra y capital. Los economistas
estimaron que un agricultor promedio latinoamericano gana $ 640 por ao, lo que permite
pensar que por lo menos 41.5 millones de personas viven de estos cultivos. Estos productos
aportan directamente 59 % de las caloras y 75 % de la protena que consume los pueblos
de esta regin. Los cientficos de los Programas Nacionales de Investigacin y de los
Centros Internacionales colaboraron en la investigacin que llev al aumento en la
produccin y, posteriormente, a la reduccin del precio de estos alimentos en las
ciudades, dice el Dr. Willem Janssen, coordinador del estudio y vinculado al CIAT hasta
hace poco. En consecuencia, atribuimos el 50 % de las ganancias a la investigacin
nacional. Con esta distribucin, las tasas de retorno para la investigacin realizada por los
centros en el mejoramiento de los principales cultivos de Amrica Latina (maz, arroz y
trigo) oscilaron entre 50 % y 70 %.

Actualmente, el CIAT, el CIMMYT y el CIP dirigen su atencin no solo al mejoramiento


de cultivos, sino tambin a la biotecnologa y al manejo de los recursos naturales, una
estrategia para desarrollar sistemas agrcolas productivos y ambientalmente sanos que
protejan los ecosistemas frgiles del trpico latinoamericano, amenazados por el uso
agresivo de la tierra. La investigacin postcosecha y de mercadeo ha aumentado la
disponibilidad de alimentos para los consumidores urbanos y ha abierto nuevos mercados
para los agricultores.

6
La investigacin es una actividad de alto riesgo de la cual se espera un alto grado de
retribucin, explica Sanint.11 Treinta y cinco estudios sobre la rentabilidad de la inversin
en investigacin en Amrica Latina realizados durante los ltimos 20 aos, arrojan
indicadores de rentabilidad social superiores al 20 %. Esto demuestra que la investigacin
s es una inversin rentable de los dineros pblicos.

En el pas se han hecho algunos estudios de impacto econmico donde se muestran


resultados muy positivos. Con resultados logrados por el Centro Internacional de la Papa
en el Per, en relativamente pocos aos se cambiaron las variedades tradicionales de
camote, que resultaron muy susceptibles al complejo viral (SPVD) por dos variedades
mejoradas logradas por el CIP apoyando al INIEA: INA-100 y Huambachero, que en el
ao 2002 ocuparon el 38 % y 53 % de la superficie cultivada de camote en el valle de
Caete, respectivamente.

El beneficio neto adicional por el reemplazo de la variedad Jonathan por la variedad


INIEA-100 result en US$ 579 por hectrea; asimismo el beneficio neto adicional del
reemplazo de la variedad Morada por Huambachero fue de 328 dlares por hectrea. Los
beneficios netos obtenidos considerando el rea sembrada con esas dos variedades son
aproximadamente US$ 1300,000 y la tasa interna de retorno, 44 %. En cuanto a camote se
estima que el rendimiento nacional ha aumentado en ms de 50 % debido al aumento de 9
a 14 t/ha en el periodo 1985-2003.17

La variedad mejorada Canchan-INIA es una de las variedades de papa ms cultivadas en el


pas. Se liber en el ao 1990 y se adopt rpidamente por su precocidad, resistencia a la
rancha, alto rendimiento, buena apariencia y calidad culinaria. Los beneficios econmicos
de esta variedad se estiman en US$550 por hectrea, debido a un menor uso de fungicidas,
mejor precio en el mercado y mayor rendimiento. La sustitucin de la variedad tradicional
Yungay por Canchan INIA, significa un beneficio de 283.5 dlares por hectrea en la
campaa grande y 605 dlares en la campaa chica. El costo total de la investigacin que
dio origen a la variedad Canchan, es aproximadamente US$ 480,000. Proyectando la
siembra de la variedad hasta alcanzar el 15 % del rea nacional, en el 2020 se estima un
beneficio neto de US$8 millones y una tasa interna de retorno del 26 %.17

La cebada (Hordeum vulgare L.) se cultiva en el Per sobre los 3000 msnm en terrenos
marginales, climas adversos y con tecnologa rudimentaria. Bajo estas condiciones se
requiere mejorar su productividad, haciendo necesario el desarrollo de variedades
mejoradas de este cultivo. Es as que el Programa de Cereales y Granos Nativos de la
UNALM inicia sus trabajos en 1971 asociado con las empresas industriales de este rubro,
con el objeto de mejorar la produccin y la productividad de la cebada en el Per. Este
esquema de trabajo conjunto ha permitido el desarrollo de las variedades Zapata 588, UNA
80, UNA 8270, Yanamuclo, Buenavista, UNA La Molina 94 (Mejorada), UNA La Molina
95, UNA La Molina 96 y Centenario que hoy se siembran en el 90 % del rea nacional,
que para el ao 2003 fue de 135 963 has. Con estas nuevas variedades el rendimiento
promedio nacional ha aumentado de 800 kg/ha en el ao 1978 a 1296 kg/ha en el ao 2003,
equivalente al 62 % de incremento. El rendimiento potencial se increment de 1500 a 2000
kg/ha con la variedad Zapata, de 4500 a 6000 kg/ha con la variedad UNA La Molina 96 y
la variedad Centenario. En los departamentos Junn, Huancavelica y Ayacucho que tienen
influencia directa del Programa de Cereales-UNALM, los rendimientos sobrepasan los
4000 kg/ha es decir 350 % ms que el rendimiento promedio nacional. Se incrementan

7
adems las ganancias del agricultor; si consideramos el promedio nacional del ao 1978
igual a 855 kg/ha y el ao 2003 de 1283 kg/ha, el incremento de rendimiento ser igual a
496 kg/ha como efecto de la aplicacin de mtodos de mejoramiento; dndole un valor
monetario sera igual a US$ 73.4 por hectrea cultivada. La ganancia econmica por el uso
de las variedades mejoradas es igual a US$ 9 979 684.2 anuales a nivel nacional. Tambin
se incrementa el empleo de mano de obra en 10 jornales adicionales por hectrea con el
uso de variedades mejoradas, en relacin al uso de las variedades tradicionales donde se
utiliza 20 jornales desde la siembra a la cosecha.13

En arroz se obtuvieron tambin resultados similares, aumentando la produccin en muchos


pases donde el arroz es el alimento principal, como Filipinas, Ceiln, Malasia, Pakistn y
algunos pases de Latinoamrica. Per no escap de estos hechos, como posteriormente se
expondr el caso. La revolucin verde, cuya vigencia hoy es discutible, jug un rol
preponderante en el mejoramineto de la poduccin.

1.3. Logros recientes del mejoramiento gentico en Per y Amrica Latina

Los gorgojos brchidos (Zabrotes subfasciatus Boheman y Acanthoscelides obtectus Say),


son las plagas ms serias del frijol almacenado en frica y Amrica Latina; al perforar la
semilla donde pasan las primeras etapas de su vida, causan prdidas en almacenamiento
calculados en 13-15 % de la produccin total en Amrica Latina. El Centro Internacional
de Agricultura Tropical (CIAT) ha venido buscando resistencia a estos gorgojos y ha
evaluado ms de 800 accesiones de frijol cultivado, sin encontrar ninguna con niveles
adecuados de resistencia. Slo al evaluar una pequea coleccin de frijoles silvestres de
Mxico se encontraron altos niveles de resistencia a ambas especies de brchidos. Aunque
los Phaseolus vulgaris silvestres resistentes a los brchidos son trepadores dehiscentes de
grano pequeo, se pueden cruzar fcilmente con variedades cultivadas.

Los estudios del CIAT mostraron que estas semillas de P. vulgaris tienen un efecto
significativamente adverso sobre la biologa de los insectos y su capacidad de sobrevivir
despus de la reproduccin (antibiosis). El nmero de gorgojos adultos que emergen de las
larvas dentro de la semilla se reduce drsticamente, y se retrasa su etapa reproductiva en el
ciclo de vida. Adems, sus descendientes son marcadamente pequeos. En accesiones
altamente resistentes las colonias de insectos ni siquiera pueden desarrollarse y mueren a
las dos o tres generaciones. Mientras se haca esta investigacin en el CIAT, cientficos de
un proyecto colaborativo en la Universidad de Wisconsin identificaban una protena
presente solo en las accesiones resistentes al brchido. Esta se llam "arcelina'" en honor a
Arcelia, un pueblo de Mxico en cuyas cercanas se encontraron las accesiones silvestres.
Se supuso que dicha protena es el factor responsable de la resistencia a los brchidos. El
CIAT ensay muchas accesiones con fines de mejoramiento, con o sin presencia de
arcelina. Todas aquellas protenas positivas en arcelina fueron resistentes a Z. Subfasciatus.
Se hicieron semillas artificiales con harina de una variedad susceptible a la cual se le
aadi arcelina purificada en cantidades crecientes. Estas semillas preparadas fueron
probadas por su resistencia a Z. subfasciatus. A medida que la concentracin de arcelina en
la semilla aumentaba, el ciclo de vida se prolongaba y el porcentaje de adultos se reduca
drsticamente. Despus de confirmar esta relacin se inici la evaluacin de tcnicas para
detectar la protena en las primeras poblaciones segregantes. Ahora se la puede detectar por
electroforesis, pruebas serolgicas (placas de Ouchter lony), y pruebas ELISA. Estudios
iniciales en el CIAT, la Universidad Estatal de Michigan y el Instituto de Nutricin de

8
Centroamrica y Panam (INCAP), Guatemala, indican que la arcelina no tiene efectos
adversos sobre el crecimiento o metabolismo de ratas que las consumen en forma de
frijoles cocidos, lo cual probablemente indica lo mismo en humanos. El CIAT contina
desarrollando lneas avanzadas de material resistente a ambos brchidos en tipos de granos
aceptables al consumidor. Estas lneas sern evaluadas en la red internacional de
germoplasma. Las variedades que resulten resistentes tendrn un gran impacto sobre el
problema de los gorgojos en frica y Amrica Latina. Investigaciones paralelas en la
Universidad de Durham and Natural Resources Institute, Reino Unido, sugieren que el
factor responsable por la resistencia a A. obtectus es probablemente una glicoprotena
presente en las accesiones silvestres resistentes a una especie. Los cientficos estn
tratando de caracterizar y aislar este componente para desarrollar una prueba sencilla de
diagnstico de su presencia en el frijol.7

Dentro del rea de mejoramiento gentico de plantas igualmente se han hecho avances
muy importantes en cuanto al mejoramiento de calidad de las protenas de las plantas
cultivadas en aos recientes. El descubrimiento del gen mutante opaco-2 ha permitido
producir variedades de maz con el doble de concentracin de lisina y triptofano que los
maces normales. En Etiopa existe una variedad de cebada denominada high proly", que
contiene el doble de lisina que la cebada ordinaria y en el caso del algodonero se han
logrado producir variedades sin gosipol, que es un principio txico que impeda la
utilizacin de la pasta de semilla de algodonero en la alimentacin humana. Actualmente
se cuenta con plantas que tienen gosipol en la planta pero no en el grano.1

Avances espectaculares se vienen obteniendo con estudios de investigacin de la gentica


en maz, es as que Hallauer et al.,14 dan a conocer el incremento del rendimiento de maz
en Estados Unidos desde 1865 hasta la fecha. Desde 1865 hasta 1925 con el uso de
variedades de libre polinizacin se tena rendimientos medios de 1,5 t/ha; luego de 1925 a
1955 con el uso de cruzas dobles el rendimiento se elev a 3 t/ha. Con el uso de cruzas
simples con lneas mejoradas desde 1956 a 1985 el rendimiento subi a 7 t; finalmente de
1986 hasta la dcada del 2010, con el uso de organismos genticamente modificados
obtenidos por ingenieria gentica el rendimiento alcanz las 9 t/ha.

En previsin al dficit de produccin de arroz en el Per en la dcada del 70, se hizo un


estudio de incremento de la produccin de este cultivo.11 En el estudio sobre el potencial
arrocero se concluy que la regin que ofreca las mejores perspectivas de incremento de la
produccin a corto plazo era la selva, por la existencia de cerca de 120 000 has de suelos
buenos para su cultivo bajo riego. Se seleccionaron las reas de Jaen, Bagua, Alto Mayo y
Huallaga Central. El problema que presentaban era la presencia de enfermedades: el
aublo o piricularia, la helmintosporiosis y otras enfermedades fungosas. El virus de la
mosca blanca es particularmente severo en Bagua y sus alrededores.

Con la introduccin de variedades mejoradas de arroz del CIAT, la primera etapa de


mejoramiento se concentr en la seleccin de materiales para el ecosistema de riego en la zona
de mayor prioridad, Alto Mayo y Huallaga Central, cuyo potencial conjunto fue cubrir 30 000
has a corto plazo y de 100 000 has a mediano plazo. En 1983 el Programa de Arroz de INIPA
hoy INIEA liber la variedad colombiana CICA 8 para la zona de Alto Mayo. Esta variedad es
resistente a aublo, produce altos rendimientos y tiene un periodo vegetativo que permite dos
cosechas por ao. A mediados de 1984, el rea sembrada con arroz haba aumentado un 67 %.
Solamente CICA 8 se estaba cultivando en ms de un 60 % del rea sembrada.

9
Para la zona de Huallaga Central, el INIEA liber la variedad PA-2, ms resistente al
Cercospora orizae y al volcamiento que CICA 8. Adems se aplic un sistema de siembra
directa en el lodo, utilizacin de agroqumicos (herbicidas) y de segadoras pequeas, entre
otras inovaciones. Mientras que en 1982 se produjeron 30 000 t en la zona de Alto Mayo,
en 1984 se duplic la produccin a 60 000 t.

Segn la proyeccin en 1987 la zona producira 180 000 t o sea tres veces el nivel actual de
produccin. Igualmente en la zona del Huallaga central se produjeron 25 000 t en 1984,
mientras que en 1982 se haba producido slo 10 000 t. El pronstico para 1987 fue una
produccin de 90 000 t. En conjunto, los tcnicos calcularon que la produccin de las dos
zonas alcanzaran las 300 000 t para 1987, cantidad que represent aproximadamente un 30
% de la produccin total del pas.

El impacto logrado por este proyecto en tan corto plazo es un ejemplo de la optimizacin
con escasos recursos. El estudio inicial estimaba conservadoramente, un aumento en la
produccin de 20 000 t para todo el pas al dcimo ao despus de terminado el proyecto;
en contraste, el incremento obtenido en las dos zonas mencionadas, a slo dos aos de
iniciado el proyecto, fue de 45 000 t.6 Debido a la gran demanda de agua de este cultivo, en
la actualidad tanto la UNALM como el INIA vienen desarrollando variedades de arroz
para cultivo en secano.

En el norte peruano con centro en Jan-Cajamarca tanto las Instituciones publicas en


asociacin con las privadas vienen haciendo investigacin y desarrollo de nuevas
variedades de arroz con los mejores rangos de productividad y calidad. Las variedades
comerciales obtenidos para la costa y selva por este trabajo conjunto son: IR-43,
Tinajones, Mallares, Fortaleza, Capirona, La Esperanza y "La Conquista". El
uso de estas variedades, con paquetes tecnolgicas adecuados, est permitiendo obtener
ms de 14 t/ha en la costa y 9 t/ha en la selva.18

Cientficos britnicos de Syngenta desarrollaron una nueva variedad de arroz


genticamente modificada rica en beta caroteno, la sustancia que necesita el organismo
para producir vitamina A. El llamado arroz dorado logra producir una cantidad de beta
caroteno 20 veces superior a la que contiene un grano normal. Este nuevo tipo de arroz
transgnico podra ayudar a reducir la deficiencia de vitamina A y disminuir la ceguera
infantil en el mundo en desarrollo. Se trata de la primera evidencia concreta de que la
tecnologa gentica puede producir cultivos destinados a resolver los grandes problemas
del mundo en desarrollo.5

En el caso del algodn se viene trabajando desde 1923. En 1908, el Sr. Fermn Tanguis
obtiene la variedad TANGUIS caracterizado por ser de das cortos y ciclo vegetativo largo
(10 meses), de tipo semiarbustivo, rstico, tolerante a temperaturas relativamente bajas, a
la sequa y a la salinidad del suelo. Adems es tolerante a las enfermedades radiculares
como marchitez causado por Verticillium sp. Luego se sigui mejorando por otras
caractersticas, cultivndose en casi todos los valles de la costa central. Actualmente se
tiene variedades de algodn UNALM-1 y UNALM-2 con caractersticas de precocidad,
obtenida por el Programa de Algodn de la UNALM.

10
La investigacin del camote en el Per se inici a comienzos de la dcada del 40. En 1975
se obtuvieron variedades de camote con alta calidad nutritiva produciendo el pan de
camote en la UNALM, el pan de camote caetano y el pan de camote chinchano. En 1979 -
1983 se lograron buenos hbridos con tolerancia a nematodes por parte del INIEA. El
camote es rico en vitamina A, cuya deficiencia es factor de riesgo en mujeres embarazadas
y constituye la mayor causa de mortalidad infantil en buena parte del Continente Africano
y las zonas altoandinas de Amrica Latina. En el Per actualmente se siembran 13
variedades mejoradas de camote provenientes del material gentico del CIP y dos
variedades nativas seleccionadas como variedades comerciales (Helena y Huambachero).
La mayora de estas variedades son resistentes al nemtodo del nudo de la raz
(Meloidogyne incgnita).17

1.4. Importancia de la semilla de las variedades mejoradas en el desarrollo agrcola

La semilla en una agricultura eficiente es esencial en todo proceso de desarrollo, ms aun


si se toma en cuenta que en los pases en vas de desarrollo, ms del 50 % de la poblacin
vive de la agricultura. Una agricultura eficiente necesita de insumos, los que deben ser de
fcil aplicacin y estar al alcance de los agricultores en el precio, cantidad y oportunidad,
acordes con la realidad de la regin.

Sevilla,16 menciona que la semilla de tipo ortodoxo tiene varias caractersticas, que si se
comparan con otros insumos agrcolas se ve su importancia con las siguientes
caractersticas:

1. Es un insumo muy econmico, generalmente el insumo que menos representa en el


costo de cultivo. Por ejemplo en el caso del maz, la semilla de los hbridos
representa slo el 10 % de los gastos de cultivo.
2. Es de fcil produccin o sea no requiere grandes inversiones, ni de utilizacin de
tecnologa cuya adquisicin demanda grandes costos. El proceso de produccin no
est sujeto a la dependencia tecnolgica.
3. Es de fcil transporte y distribucin, porque generalmente la semilla botnica es
pequea, slida, no se desintegra o aglutina, y aunque es perecible puede
permanecer en buen estado un buen tiempo en condiciones normales de
almacenamiento.
4. Es de fcil aplicacin y no requiere que el agricultor aprenda a usarla; no requiere
medidas, recipientes, equipos especiales; instrucciones para una aplicacin
eficiente, entre otros factores.
5. En algunas clases de semilla se puede evitar la transmisin de enfermedades.

2. EL MEJORAMIENTO GENTICO Y LA AGRICULTURA SOSTENIBLE

La investigacin agrcola busca que no solo se produzcan ms alimentos, sino que adems
la agricultura se administre para satisfacer las necesidades cambiantes de la humanidad,
mientras que se conserven los recursos naturales y se evite la degradacin del medio
ambiente.

El mejoramiento gentico vegetal puede contribuir mejorando el grado de sostenibilidad de


los sistemas agropecuarios de produccin, mediante el desarrollo de genotipos adaptados a
nuevos requerimientos ambientales y nuevas demandas del mercado de consumo. Esto

11
requiere en el plano de la investigacin gentica, la consideracin de cambios en la
priorizacin de objetivos, en las tcnicas de seleccin y en la bsqueda y utilizacin de
variabilidad gentica. La evolucin biolgica y el mejoramiento gentico de plantas, se
realiz a travs de un largo proceso de evolucin biolgica dirigida por el hombre, a fin de
lograr un ajuste cada vez mayor entre las caractersticas de las especies vegetales y las
necesidades que se deben satisfacer.

2.1. El mejoramiento en la agricultura moderna

La necesidad de aumentar la produccin sigue un proceso de transformacin, desde la


economa de subsistencia a la produccin para el mercado. Ambos tipos de economa
requieren de dos principios:

Economa de subsistencia. Persigue la seguridad de los resultados ms que la obtencin


de altos rendimientos, con variedades tradicionales o razas locales de produccin baja y
estable, hay heterogeneidad gentica en las variedades.
Economa de Produccin. Es cuando la produccin est dirigida al mercado. Las
variedades mejoradas se caracterizan por su alta capacidad de produccin, adaptacin
especfica, genticamente homogneas y apariencia uniforme.

2.2. El mejoramiento y la sostenibilidad del sistema productivo

La necesidad de aumentar el potencial productivo preservando los recursos naturales, as


como el desarrollo de sistemas de agricultura sostenible, es decir, el logro de altos niveles
de produccin en el largo plazo, requiere de la adecuacin de los programas de
mejoramiento hacia un cambio en el espectro de ambientes al que ser sometido un
cultivar, para el cual se deben considerar los objetivos de los planes de mejoramiento,
criterios de seleccin y las modalidades de evaluacin. Todo esto con nuevas metas en el
desarrollo de variedades con caractersticas tales como, la alta capacidad de produccin y
eficiencia en el uso de energa, resistencia a enfermedades y plagas conferidas por grupos
de genes menores y la menor sensibilidad frente a condiciones ambientales desfavorables.

Hay necesidad de producir con mayor intensidad asegurando caractersticas fsicas y


qumicas de calidad y que respondan a los requerimientos crecientes de la industria. A
continuacion se indican algunos ejemplos de produccin sostenible.

El Cultivo de yuca en laderas. En la regin andina de Amrica del Sur buena parte de la
yuca se cultiva en laderas empinadas. Este cultivo sin embargo, requiere medidas para
controlar la erosin cuando se siembra en pendientes de ms de 10 %. El lento desarrollo
inicial de la raz y la perturbacin del suelo cuando se cosecha la yuca puede empeorar la
erosin.

Los cientficos del Programa de Yuca del CIAT observaron que ecolgica y
econmicamente se justifica usar fertilizantes: estos reducen la erosin del suelo, pues
hacen que las plantas crezcan ms rpido y produzcan hojas que los protegen del golpe de
la lluvia y multiplican por dos o tres los rendimientos. El uso de variedades mejoradas, la
seleccin del material de siembra y el control de las malezas tambin ayudan a las plantas a
crecer rpida y vigorosamente.

12
Prcticas como labranza mnima o nula, el cubrimiento del suelo con residuos de cosecha,
y la siembra en contornos, son algunas de las formas mejores y ms baratas de reducir la
erosin. Por otro lado, el control de malezas con un herbicida adecuado y la cobertura del
suelo con material muerto tambin disminuyen la prdida de suelo. Con base en estos
resultados, el CIAT est promoviendo la siembra de yuca con barreras de pastos, ambos
mejorados por seleccin gentica como el Brachiaria humidicola y leguminosas como el
Pueraria phaseolides, y con la siembra de rboles.8

Control de la erosin con pasturas. En Amrica Central muchas laderas se han


erosionado debido al sobrepastoreo. Esto se debe principalmente a la incapacidad de las
pasturas tradicionales para mantener el forraje durante la estacin seca que dura hasta seis
meses en muchas reas. Los nuevos pastos introducidos por el CIAT, de races ms
profundas y mayor tolerancia a sequas podran aliviar efectivamente este problema.
Muchos de los pastos son incluso capaces de rebrotar durante la estacin seca.

Los esfuerzos del Programa de Pastos Tropicales en la cuenca amaznica se concentran en


la Estacin del Instituto Veterinario de Investigaciones Tropicales y de Altura (IVITA) y la
Universidad Nacional Mayor de San Marcos en Pucallpa, Per. Aqu se han identificado
pastos y leguminosas mucho mejor adaptados a los suelos cidos e infrtiles del trpico
hmedo que los pastos ms exigentes que se utilizan actualmente. Estas especies adaptadas
y de alta capacidad de cobertura profundizan largas races en estos suelos cidos y de baja
fertilidad, lo cual contribuye a reciclar nutrimentos favoreciendo los sistemas ganaderos en
esta cuenca.

La especie Brachiaria dyctioneura es una gramnea que en asociacin con Centrosema


macrocarpum y C. acutifolium leguminosas promisorias del CIAT, conforman unas
pasturas agresivas que compiten con malezas para recuperar las deterioradas.15

Arachis pintoi, un pariente silvestre del man, es una de las pocas leguminosas que se
puede asociar con gramneas en este caso con Brachiarias, puede soportar la sombra,
apropiado para pendientes y de rpida cobertura, lo que lo hace un candidato para estos
sistemas.12

Desarrollo de la sabana. Los 300 millones de hectreas de sabanas en Amrica Latina


constituyen un ecosistema mucho menos frgil que el bosque hmedo. Los suelos de estas
sabanas son igualmente cidas e infrtiles, pero mientras la quema de los bosques hmedos da
a los colonizadores pobres una fertilidad temporal, las sabanas necesitaran de muchos insumos
para ser productivas; por esta razn ellas son colonizadas por empresarios de medianos
recursos, quienes utilizan la sabana nativa como forraje en un sistema de ganadera extensiva.

El potencial de las sabanas es mucho mayor cuando entran en escena los pastos y
leguminosas desarrollados por el CIAT. Estas pasturas son ms productivas que los pastos
nativos y con ellas las ganancias de peso del animal son ms del doble. Incluso, unas
cuantas filas de leguminosas sembradas en los pastos nativos pueden proporcionar
suficiente protena al rumen del animal para facilitar la digestin del pasto fibroso de la
sabana. La productividad de la tierra y de los animales tambin aumenta aceleradamente
con las nuevas pasturas: la capacidad de carga animal se incrementa en ms de cinco veces
, las ganancias de peso se duplican, y como resultado la productividad total del sistema
aumenta en ms de diez veces.10

13
Cultivo de frijol en frica. frica tiene graves problemas de conservacin de suelos. Los
agricultores africanos tradicionalmente han usado varios mtodos para preservar la
fertilidad y prevenir la erosin. Sin embargo, la presin poblacional est amenazando estos
sistemas. En algunos casos los agricultores saben como detener la erosin, pero no lo
pueden hacer en todos los cultivos.

En algunas partes de Ruanda los agricultores siembran frijoles trepadores, que rinden ms
y hacen eficiente el uso de los insumos. Las variedades resistentes a enfermedades que han
introducido del CIAT, estn aumentando la productividad del sistema.5

Uso ms eficiente de insumos. Las soluciones biolgicas, tales como la resistencia


gentica a las plagas, disminuyen el costo y el riesgo para los agricultores. La necesidad de
plaguicidas es menor y se reduce la contaminacin ambiental y el peligro de inducir
resistencia y destruccin de los enemigos naturales. Cuando se debe usar plaguicidas, el
CIAT recomienda el manejo integrado de plagas.

La filosofa de bajos insumos tiene implicaciones importantes para un uso ms eficiente de


los recursos naturales no renovables. Los avances en la fijacin del nitrgeno del frijol y de
los pastos minimizan la necesidad de fertilizantes nitrogenados. Los cientficos buscan
frijoles con una menor necesidad intrnseca de fsforo, o pastos que se puedan establecer y
mantener con menos fertilizantes. Las variedades adaptadas a los suelos cidos pueden
beneficiarse de la acidez que lentamente disuelve la roca fosfrica y libera fsforo. La roca
fosfrica abunda en Amrica Latina tropical y su uso ahorra la energa que se usa para
fabricar fertilizantes.5

2.3. La sostenibilidad en el Per

Se concentra bsicamente en la preservacin del recurso suelo, del control biolgico de


insectos y la conservacin de la diversidad gentica. Ser necesario desarrollar cultivares
que respondan eficientemente a niveles razonables de fertilizacin y que posean
mecanismos de tolerancia o resistencia gentica a enfermedades y plagas que contribuyan a
reducir el consumo de plaguicidas. Ser necesario que los mejoradores desarrollen
cultivares adaptados a diferentes ambientes y difundan la informacin sobre el ambiente
ms adecuado para su uso.

Las tcnicas de labranza conservacionista pueden posibilitar la habilitacin de reas de


cultivo actualmente no explotadas o que lo son irracionalmente. La ampliacin del efecto
ambiente y el consiguiente desarrollo de variedades con adaptacin especfica permitirn a
nivel general, ampliar la viabilidad gentica bajo cultivo, y en consecuencia reducir su
vulnerabilidad.

2.4. Factibilidad del mejoramiento para la sostenibilidad

Fuentes tradicionales de variabilidad, hibridacin sexual y la mutagnesis. Este ltimo


consiste en la utilizacin de agentes fsicos o qumicos que provocan cambios a nivel
gnico o de estructura cromosmica. La hibridacin sexual ha sido y seguramente
continuar siendo el procedimiento de generacin de variabilidad ms frecuentemente
utilizado, aunque se viene desarrollando aceleradamente el uso de la biotecnologa.

14
Biotecnologa y variabilidad. La biotecnologa es una herramienta que en el corto y
mediano plazo puede brindar a los fitomejoradores el acceso a una formidable fuente de
variabilidad. Ejemplo: Genes Bt de la bacteria Bacillus thuringiensis var. Kurstaki que
codifica la sntesis de protena con efecto insecticida sobre algunas de las especies de
lepidpteros. Otro caso es la incorporacin de los genes de resistencia al herbicida
glifosato en soya.

Otras fuentes de variabilidad. Debe agregarse la variabilidad intraespecfica y la


contenida en especies silvestres vecinas al cultivo. Es necesario tener en cuenta la
recoleccin, evaluacin y conservacin de la diversidad de los cultivos en bancos de
germoplasma (ex situ) o la conservacin en parcelas de agricultores (in situ). Esta
variabilidad aun no ha sido explotada suficientemente por los mejoradores, pero se espera
un incremento en su utilizacin, en la medida que sta sea caracterizada con un mayor
grado de anlisis.

Se espera la integracin de fitomejoradores, expertos en recursos genticos y


biotecnlogos. Si bien hay nuevos genes disponibles para el trabajo de mejoramiento, ellos
tambin se pueden seguir seleccionando en variedades nativas y otras poblaciones. Para
esto, ser importante conocer su expresin en distintos ambientes y su interaccin con el
resto de la maquinaria gentica del individuo receptor. El mejoramiento para los caracteres
requeridos en sistemas ms sostenibles, recibir los beneficios de esos esfuerzos
compartidos entre los especialistas de distintas disciplinas.

15
3. REFERENCIAS BIBLIOGRFICAS

1. Baudoin JP, Camarena MF, Lobo M, et al. Breeding Phaseolus for intercrop
combinations in Andean Highlands. In: Broadening the Genetic Base of crop
Production. IGPRI & FAO. CABI Publishing. 2001. Pt IV: 373-384.

2. Camarena MF, Sevilla PR, Huaringa JA, et al. Simposio de Mejoramiento de los
Cultivos Subutilizados. 2012. pp. 15-17.

3. Camarena MF, Huaringa JA, Mostacero NE. Mejoramiento gentico de especies del
gnero Phaseolus mediante metodologas convencionales e innovadoras con el fin
de incrementar la produccin y la oferta exportable del frijol comn (Phaseolus
vulgaris L.). Primera Edicin. Universidad Nacional Agraria la Molina - Consejo
Nacional de Ciencia, Tecnologa e Innovacin Tecnolgica. 2010. 270 p.

4. Camarena MF, Chura ChJ, Blas SR. Mejoramiento Gentico y Biotecnolgico de


plantas. Primera Edicin. UNALM-Concytec. 2008. 241 p.

5. CIAT (Centro de Agricultura Tropical). Informe de Investigacin y Cooperacin


Internacional. CIAT Centro Internacional de Agricultura Tropical. Vol. 2, No 4.
1983. 8 p.

6. CIAT (Centro de Agricultura Tropical). Una rvolucin Arrocera ven el Per. CIAT
Internacional. 1985. Sec. Vol. 4 (2).

7. CIAT (Centro de Agricultura Tropical). Frijoles silvestres; fuente de resistencia a


brchidos. Resmenes de frijol, 1988. 7 (1):6.8.

8. CIAT (Centro de Agricultura Tropical). Germplasm. En: Anual Repor 1989.


Tropical Pastures Program. Working No 70, 1989. 70 pp. 2:1-15.

9. CIAT (Centro de Agricultura Tropical). Avances en el desarrollo del suministro de


semillas de especies forrageras tropicales en Costa Rica y otros pases. In:
Memorias del segundo taller. Atenas, Costa Rica. 1990.

10. CIAT (Centro de Agricultura Tropical). Establecimiento y renovacin de pasturas:


Conceptos, experiencias y enfoques de investigacin. Lascano, C. y Spain J (eds).
Sexta reunin del Comit Asesor de la Red Internacional de Evaluacin de Pastos
Tropicales (RIEPT), Veracruz, Mxico, Noviembre de 1988. Cali Colombia 426 p.
Sistemas Mejorados de Alimentacin Basados en Leguminosas Forrajeras para
Ganado de Doble Propsito en Fincas de pequeo Productores de Amrica Latina
Tropical, Colombia. 1991. 75 p.

11. CIAT (Centro de Agricultura Tropical). Rice Program:Context and strategy.


Documento de trabajo para la reunin entre centros, Diciembre 1992. 46 p.

12. CIAT, TROPILECHE. Sistemas mejorados de alimentacin basados en


leguminosas forrajeras para ganado de doble propsito en fincas de pequeos
productores de Amrica Latina tropical, Colombia. 1999. 75 p.

16
13. Gmez PL. Impacto econmico y social de las variedades mejoradas de cebada en
el sistema agropecuario de la regin altoandina del Per. Revista AGRUM,
Universidad Nacional Agraria La Molina. Ao 4, No 12, 2004. 12-14.

14. Hallauer AR, Carena MJ, Miranda Filho JB. Quantitative Genetics in Maize
Breeding Iowa State University Press. USA. 2010. 663 p.

15. IVITA, UNMSM. Sistemas de Produccin Amaznicos. Segundo informe. Lima,


1989. 50 p.

16. Sevilla R. Entrenamiento en Mtodos para la Coleccin, Evaluacin y


Conservacin de Recursos Fitogenticos. Curso Internacional Mando Medio. En:
Centro de Informtica para la Investigacin Agrcola. Lima Per. Universidad
Nacional Agraria La Molina. 1982.

17. STCCGIAR. Logros y Resultados del CGIAR en el Per. Secretara Tcnica de


Coordinacin con el Grupo Consultivo de Investigacin Agrcola Internacional
(STC CGIAR). Lima Per. 2006. 35 p.

18. Taller Regional "Mejoramiento Gentico del Arroz para la Zona Tropical". 2013.
Investigaciones para obtener variedades superiores de arroz. Agronoticias. Ao
XXXV. Edicin N 389. 2013. pp 34-36.

17
SEGUNDA PARTE
MEJORAMIENTO GENTICO DE PLANTAS AUTGAMAS

18
1. SELECCIN EN EL MEJORAMIENTO GENTICO DE PLANTAS
AUTGAMAS

1.1. Introduccin

Finalidad:

Crear nuevos cultivares superiores a los actualmente existentes y ser utilizados en la


produccin agrcola, hortcola, industrial, medicinal y otros usos.

Objetivos:

1. Aumentar la productividad de los cultivos por el mejoramiento de su rendimiento y


el valor de su utilizacin.
2. Aumentar la calidad de la planta o de sus productos.
3. Elevar el atractivo del producto por el mejoramiento de su aspecto, su color, su
perfume y el mejoramiento de su sabor, es decir, debe ser un producto innovador.

Formas de lograr estos objetivos.-

1. Por una mejor adaptacin a las condiciones del medio (clima, suelo), as como una
mayor resistencia a enfermedades (virus, bacterias, hongos patgenos), plantas
superiores parsitas y semiparsitas, adems de plagas.
2. Por modificaciones favorables de caracteres morfolgicos y fisiolgicos de las
plantas.

Estas caractersticas tienen una base gentica que pueden ser controladas por uno o varios
genes o sea oligogenes y poligenes.

El mejorador tiene la funcin de reunir en un solo genotipo el mximo posible de genes


favorables. Como producto de su trabajo; si se juzga superior en algunas caractersticas a
los cultivares existentes, luego de los ensayos oficiales bajo la supervisin del INIA, es
inscrito en el Catlogo de Nuevos Cultivares, con una denominacin original que es
luego comercializado.

Utilizacin del nuevo cultivar

Las condiciones ptimas de explotacin del nuevo cultivar son determinados por ensayos
fitotcnicos, sean oficiales o no, pero que garanticen su veracidad.

Uno de los desafos del mejorador de plantas es obtener variedades mejoradas, razn
por la que se describirn los mtodos de seleccin para la obtencin de nuevas variedades.
Para entender los resultados de la seleccin en una poblacin es necesario conocer su
estructura gentica. En las plantas autgamas, los individuos se encuentran en estado
homocigtico; con la autofecundacin las plantas heterocigticas producen igualmente
progenies homocigticas en sus generaciones avanzadas. Si fuesen progenies
heterocigticos, segregaran en la generacin F2, plantas homocigticas y heterocigticas
en igual proporcin como se explica posteriormente.

19
Las autofecundaciones conducen a la homocigosis, pero no a la homogeneidad, pues
resulta que hay 2n lneas en la poblacin donde "n" es el nmero de genes segregantes. La
tasa de homocigosis luego de determinado nmero de generaciones de autofecundacin, es
igual a:

Tasa de homocigosis = ( )

Donde n = nmero de generacin de autofecundaciones


k = nmero de genes segregantes

Aplicacin:

- Para un monohbrido (Aa), grado 1 ( )

- Para un dihbrido (Aa Bb), grado 2 ( )

- Para un polihbrido de grado k ( )

1.2. Proceso de seleccin

Para la obtencin de un cultivar anual con las metodologas tradicionales se requieren en


promedio hasta de diez aos, desde el cruzamiento pasando por la seleccin hasta los
ensayos. Este proceso es mayor en especies perennes. Respecto a este perodo de tiempo
prolongado, las preguntas son: (a) cmo reducir este perodo y (b) cmo reconocer
fcilmente los genotipos superiores?. Para dar respuesta a estas preguntas debemos tener
en cuenta la generacin segregante en que se debe comenzar la seleccin y el mtodo de
seleccin.

Generacin segregante, el esquema general tradicional de un proceso de mejoramiento en


plantas autgamas se presenta en la Tabla 2.1.

Normalmente, si se trata de atributos gobernados por genes oligogenticos podemos


empezar la seleccin en generaciones tempranas (F2), pero si se trata de caracteres
cuantitativos, es conveniente iniciar el proceso de seleccin en generaciones avanzadas de
seleccin (F4 o F5), aunque hay metodologas que aceleran este proceso.

20
Tabla 2.1. Esquema general tradicional de mejoramiento en plantas autgamas.

Fase Generacin Observaciones


I AxB Seleccin de Progenitores, Cruzamientos
II F1 No hay seleccin
III F2 Segregacin y seleccin individual segn los casos
F3, F4 Mtodos de seleccin
IV
Extraccin de lneas puras
V F5 Prueba de lneas puras (F5)
VI Seleccin familial (F6, F7, F8)

VII FV Obtencin de la variedad mejorada (F9)


FL = generacin de lneas, FV = generacin de variedades

Criterios de Seleccin, son los siguientes:

- Seleccin por rendimiento per se.


- Seleccin por rendimiento va componentes de rendimiento, utilizacin de ndices de
seleccin.
- Anlisis morfo-fisiolgico, criterio bioqumico.
- Seleccin utilizando marcadores moleculares.
- Seleccin genmica.

Variedad o Cultivar, se define como un grupo de plantas con caractersticas distintas,


uniformes y estables. Una variedad debe presentar su propia identidad que la distingue de
las dems.

Los descriptores varietales que confieren la identidad de la variedad son: ciclo


vegetativo, caractersticas de grano, caracteres morfolgicos, reaccin a enfermedades y
plagas, produccin de granos, patrones enzimticos o de cidos nuclecos. La estabilidad
de la variedad es importante para una identificacin de generacin en generacin. El
trmino cultivar se usa como sinnimo de variedad, trmino originado por la contraccin
de dos palabras inglesas, cultivated variety (variedad cultivada).

2. BASES GENTICAS DEL MEJORAMIENTO EN PLANTAS AUTGAMAS

2.1. Cambios de la frecuencia genotpica de una poblacin en autogamia

En la Tabla 2.2, se muestra los cambios de las frecuencias genotpicas a partir de una
poblacin inicial de 0,25 AA, 0,50 Aa y 0,25 aa, sometidos a autofecundacin. En
conclusin, como resultado de este proceso de autogamia a travs de generaciones de
autofecundacin sin seleccin tenemos:

1. La poblacin progresa hacia la homocigosis.

2. Las frecuencias gnicas p y q se conservan a travs de las generaciones.

3. Las frecuencias genotpicas tienden hacia las frecuencias gnicas.

21
La poblacin natural puede contener cantidades iguales o desiguales de los dos
tipos de homocigotos.

Do = Re Do Re

Si He=Heterocigotas Do= Dominantes y Re= Recesivos

He 0
La tendencia es hacia las frecuencias gnicas o sea Do p
Re q

Tabla 2.2. Poblacin de base: descendencia terica de un monohbrido.

n Frecuencias
Composicin Frecuencias genotpicas
gnicas
Generaciones Poblac.
despus Ho AA He
AA Aa Aa Do AA Re aa p (A) q (a)
Aa aa Aa

1 2 1
4 4 4
1 Po. 0 0,25 0,25 0,50 0,50 0,50 0,50
2 1 2 1 2
8 8 8 8 8

3 2 3
2
8 8 8
Po. 1 0,375 0,375 0,75 0,25 0,50 0,50
6 1 2 1 6
16 16 16 16 16

7 2 7
3 Po. 2 0,4375 0,4375 0,875 0,125 0,50 0,50
16 16 16

He.0 1
2
.
1
He.1 1 : 2 2
2 2
. p = Do+ He/2
1 1
He.2 2 : 2 3
. 2 2
( ) q = Re+ He/2
( )
.
( ) ( )
.

n Po(n-1)

n 0 1 0 0.50 0.50

Fuente: Modificado de Seilleur. 86.

22
La evolucin de una poblacin autgama cuya frecuencia genotpica inicial es de 0,54 AA,
0,32 Aa y 0,14 aa se presenta en la Tabla 2.3. El resultado de este proceso es igual al caso
anterior (Tabla 2.2).

Tabla 2.3. Poblacin de base: descendencia natural de un monohbrido.

Frecuencia
Poblacin Composicin
Gnica (allica)
AA Aa aa (A) p (a) q
Po.0 0,54 0,32 0,14 0,7 0,3

0,54 0,08 0,16 0,08 0,14


Po.1 0,62 0,16 0,22 0,7 0,3

0,62 0,04 0,08 0,04 0,22


Po.2 0,66 0,08 0,26 0,7 0,3

0,66 0,02 0,04 0,02 0,26


Po.3 0,68 0,04 0,28 0,7 0,3

Po.n 0,7 0 0,3 0,7 0,3


n Don Hen Ren pn qn

Fuente: Modificado de Seilleur.86

p = Do + He
2
q = Re + He
2

2.2. Poblacin de base: Resultado de una cruza

Presentamos dos casos. El primer caso de una cruza inicial de dos monohbridos A1A2 x
A3A4 sometido a autofecundacin se presenta en la Tabla 2.4.

Tabla 2.4. Poblacin de base: dos monohbridos.

A1A2 x A3A4 Frecuencias gnicas


genotipos A1A3 A1A4 A2A3 A2A4 A1 A2 A3 A4
Po. 0
n

genotipos A1A1 A2A2 A3A3 A4A4
Po. n n

Fuente: Modificado de Seilleur.86

23
El segundo caso de una cruza inicial entre un monohbrido y un homocigota sometido a
autogamia tendremos resultados como las expuestas en la Tabla 2.5.

Tabla 2.5. Poblacin base: un monohbrido y un homocigoto.

A1A2 x A3A3 Frecuencias gnicas


genotipo A1A3 A2A3 A1 A2 A3
Po. 0 2/4
n

genotipo A1A1 A2A2 A3A3
2/4 2/4
Po. n n

Fuente: Modificado de Seilleur.86

La evolucin de la poblacin segregante es hacia la homocigosis tanto de genotipos como


de genes y la frecuencia gnica final es igual a la frecuencia gnica inicial. Si la poblacin
base es la F2 de un dihbrido, la frecuencia genotpica inicial se muestra en la Tabla 2.6.

Tabla 2.6. Poblacin de base: descendencia de un dihbrido AaBb.

Cruza Gentotipos Po.0 genotipos Frecuencias Po.1 y los


dihbrido siguientes
1 BB 1 AA BB **
1AA 2 Bb 2 AA Bb * 4 homocigotos 4/16 : 4 = 1/16 **
dobles
1 bb 1 AA bb **
8 homocigotos 8/16 : 4 = 2/16 2 **
simples 2*
1 BB 2 Aa BB *
2 Aa 2 Bb 4 Aa Bb 4/16
4 heterocigotos
1 bb 2 Aa bb *

1 BB 1 aa BB **
2 Bb 2 aa Bb *
1 aa 1 bb 1 aa bb **
Po.0 = poblacin inicial, Po.1 = poblacin 1

** Homocigota doble
* Homocigota simple

En la Tabla 2.7, se presenta las frecuencias de las generaciones siguientes de un dihbrido


sometido a autogamia. La tasa de homocigosis despus de n autofecundaciones tal como
se mencion en 1.1, son:

24
1
2 n 1
- Para un monohbrido (Aa) n
2

2
2n 1
- Para un dihbrido (AaBb) n
2

k
2 n 1
- Para un polihbrido, grado k n
2

Tabla 2.7. Tasa de autofecundaciones y homocigosis.

Genotipos Po.0 Po.1 Po.2 Po.3 Po(n-1) Nmero de Homocigotos


n n+1
AA BB 1 9 49 225 4 -2 +1
2n+1-2

s
AA Bb 2 6 14 30
n n+1
AA bb 1 9 49 225 4 -2 +1
Aa BB 2 6 14 30 2n+1-2
Aa Bb 4 4 4 4 4
Aa bb 2 6 14 30 2n+1-2
4 n 2 n 1 1
aa BB 1 9 49 225 4n-2n+1+1
aa Bb 2 6 14 30 2n+1-2 4n
n n+1
aa bb 1 9 49 225 4 -2 +1
2
Poblacin 16 64 256 1024 2 n 1
4x4 n n
mnima 4x41 4x42 4x43 4x44 2
Nmero de
autofecundaciones 1 2 3 4 n
despus AaBb

Fuente: Modificado de Seilleur.86

La tasa de homocigosis de una poblacin monohbrida, dihbrida, trihbrida y un


tetrahbrida sometido a seis generaciones de autofecundacin se presenta en la Tabla 2.8.

Tabla 2.8. Evolucin en autogamia de polihbridos.

Poblacin Tasa de homocigosis


Mono Di Tri Tetra
Po.0 0,50 0,25 0,125 0,0625
Po.1 0,75 0,5625 0,4219 0,3164
Po.2 0,875 0,7656 0,6699 0,5862
Po.3 0,9375 0,8799 0,8249 0,7733
Po.4 0,9687 0,9385 0,9092 0,8808
Po.5 0,9843 0,9690 0,9538 0,9389
Po.6 0,9921 0,9844 0,9767 0,9691

25
En la figura 2.1 se observa el porcentaje de individuos homocigotos, a travs de
generaciones sucesivas de autogamia de poblaciones derivadas de hbridos heterocigotos
para 1, 5, 10, 20, 40, 100 loci.

Figura 2.1. Porcentaje de individuos homocigotas en funcin al nmero de


generaciones en autogamia con uno o ms loci.

2.3 Estimacin de la variancia gentica y sus componentes

Luego pasamos a estimar la variancia genotpica y sus componentes: variancia aditiva


(A2) y variancia de dominancia (D2) entre familias y dentro de familias al curso de
generaciones de autofecundacin sin seleccin (Tablas 2.9 y 2.10) para el cual partimos de
la escala de valores genotpicos tal como se presenta en el grfico siguiente.

Escala de valores genotpicos de la cruza de dos monohbridos

aa X Aa AA

(-) (0) (h) ()

h: es la relacin entre los alelos a y A


Si d = 0, A no domina a, entonces los alelos a y A son aditivos

26
Si d > 0, A domina a, esta dominancia puede ser:

Total :h=
Parcial :0<h<
Sobredominancia :h>

Tabla 2.9. Medias y variancias genotpicas bajo autofecundacin.

Generacin Familias y Genotipos (Ft ) Media


(Fn)

Progenitores AA x aa 1 0
F1 = S0 Aa x 0
1 1 1
AA Aa aa * * 1
F2 = S1 4 2 4 01
x x x 2

1 1
F3 =S2 1
AA 1 1 AA 1 Aa 1 aa 1 aa * 2 4
4 24 2 4 4
3 1 3
AA Aa aa * *
8 4 8
x x x

AA 1 1 AA 1 Aa 1 aa 3 aa *
F4 = S3 3 3 1
44 4 8
8 2 4 8
7 1 7
AA Aa aa * *
16 8 16
x x x

AA 1 1 AA 1 Aa 1 aa 7 aa *
F5 = S4 7 7 1
16 84 2 4 16 8 16

15 1 15
AA Aa aa * *
32 16 32

F = Sn
1
AA
1
aa 1 0
2 2

* Estructura familial, ** Estructura individual o genotpica; Ft = Coeficiente de endogamia;


= autofecundacin.
Si = Genera autofecundacin
Fuente: Mrquez.65

1
Por definicin el coeficiente de endogamia en la F2 es cero

27
La Tabla 2.9, muestra la estructura familial e individual en autofecundacin de cruzas entre
dos lneas homocigotas, y entre parntesis corresponde a la composicin genotpica de
cada familia.

La estimacin de la variancia total ( ), la variancia entre familias ( ) y la variancia


dentro de las familias( ), se estiman como sigue:

Generacin F2. En esta generacin slo existe estructura genotpica.

( )

( ) ( )

( )

Generacin F3. Se usa la estructura genotpica

( )

( ) ( )

( )

La variancia entre familias ( ) se obtiene en base a las medias familiares:

( ) ( ) ( )

28
Finalmente, la variancia dentro de familias( ) se obtiene exclusivamente de la familia
heterognea multiplicada por su proporcin:

[ ( ) ( ) ]

[ ]

[ ]

En la Tabla 2.10, se muestra las fracciones de las variancias aditiva y dominante existentes
entre y dentro de familias para varias generaciones de autofecundacin. Claramente se ve
que conforme transcurre la endogamia aumenta la variancia entre lneas hasta llegar a ser
slo y la existente dentro de lneas tiende a cero.

Tabla 2.10. Coeficiente de y entre familias y dentro de familias en generaciones


sucesivas autofecundadas de una cruza AA x aa.

Partimos de =1

Generacin
(n)
F2 1/4 --- --- 1/2 1/4
F3 1/2 1/16 1/4 1/8 3/4 3/16
F4 3/4 3/64 1/8 1/16 7/8 7/64
F5 7/8 7/256 1/16 1/32 15/16 15/256
F6 15/16 15/1024 1/32 1/64 31/32 31/1024
F 1 0 0 0 1 0

T2 = Variacin total, B2 = Variacin entre familias, W2 = Variacin dentro de familias


Fuente: Mrquez.65

Cuanto mayor es la variabilidad gentica, mayor es el progreso por seleccin, por eso se
debe evaluar y seleccionar un gran nmero de plantas F2. La seleccin entre familias es
ms eficiente que la efectuada dentro de familias donde la variabilidad gentica es menor.

29
Conforme avancen las generaciones, la variabilidad gentica aditiva es gradualmente
reducida dentro de lneas y la seleccin dentro de estas familias se tornan cada vez ms
ineficientes.

Una de las principales razones para el registro de la genealoga de las selecciones en el


mtodo genealgico es permitir al mejorador maximizar la diversidad entre lneas
seleccionadas.

La seleccin dentro de familias se justifica solamente en las primeras generaciones de


autofecundacin, cuando la variabilidad gentica es todava razonable.

Otro caso: Con dos pares de genes y si los progenitores hubieran sido dos lneas puras:

Para finalmente llegar a:

Si el objetivo de la relacin es obtener los homocigotos dominantes, se espera que en la


segregacin en generaciones avanzadas llegue a aparecer la lnea AABB superior a los
progenitores, la cual sera seleccionada.

2.4. Composicin gentica de un cultivar

Segn el proceso de seleccin para la obtencin de un cultivar, Borem 11 y Borojevic12


clasifican los cultivares en: lneas puras, multilneas, hbridos, sintticos, clones,
variedades de polinizacin abierta (poblaciones) y compuestos (mezclas).

Lneas Puras. Poblaciones homogneas y homocigotas, con coeficiente de parentesco


igual o superior a 0,87.13 La uniformidad es esencial, sin embargo, se pueden presentar
mutaciones, mezclas mecnicas, polinizaciones cruzadas.

Multilneas. Poblaciones homocigotas y heterogneas, son mezclas de lneas isognicas.


Uso: resistencia a enfermedades y estrs climtico imprevisible. La produccin de cada
constituyente se hace por separado, para luego ser mezcladas en proporciones pre-
establecidas, conforme varan las razas fisiolgicas en el campo. Es alternativa a la corta
vida til de las variedades.

Hbridos. Utilizacin de la heterosis. Poblaciones homogneas y heterocigotas, entre ellos,


hbridos de tomate, berenjena, trigo, cebada, arroz, sorgo.

30
Sintticos. Poblaciones heterocigotas y heterogneas. Obtenidas del entrecruzamiento de
lneas seleccionadas por su capacidad de combinacin. En autgamas es factible su
utilizacin con el uso de la esterilidad masculina o la autoincompatibilidad. Se caracterizan
por su menor reduccin del vigor en comparacin a los hbridos, mejor adaptacin al
ambiente y alta plasticidad en virtud de su heterogeneidad.

Clon. Poblaciones heterocigotas y homogneas. Grupo de individuos obtenidos por


propagacin asexual a partir de un slo progenitor. Existe alta correlacin entre el grado de
heterocigosis y vigor: las variedades clnales son altamente heterocigticas (porque
provienen de plantas algamas, si provienen de autgamas son lneas de reproduccin
asexual).

Variedades de polinizacin abierta o poblaciones. En algamas son poblaciones


heterocigticas y heterogneas. Consiste en una poblacin con diferentes genotipos de una
poblacin natural o local pero con una o ms caractersticas heredables que las diferencian
de otros cultivares. En poblaciones autgamas, cada genotipo presente en la poblacin es
homocigota. Es alternativa al uso de hbridos en poblaciones algamas.

Compuestos o Mezclas. En autgamas son poblaciones heterogneas y homocigotas. Son


cultivares producto de una mezcla mecnica de dos o ms cultivares en determinada
proporcin. Estas mezclas de diferentes genotipos son diferentes de las multilneas. Las
multilneas fueron propuestas por Harlan et al.,47 con el fin de reunir caractersticas de
diferentes progenitores en una sola poblacin, sometida a seleccin natural en la regin de
adaptacin durante varias generaciones. Tericamente, las variedades compuestas tienden
a presentar mxima adaptacin a una regin.

Hay adems, conceptos genticos que no necesariamente son cultivares tal como
MORFOTIPOS que se define como un grupo de entradas fenotpicamente iguales, pero no
necesariamente idnticas en trminos genticos. Tambin se define como variedades que
presentan los mismos caracteres morfolgicos pero que no necesariamente tienen la misma
carga gentica. Hay inseguridad en la composicin gentica porque en el campo se agrupa
en morfotipos de acuerdo a caracteres morfolgicos estables que se logra ver tales como
color y forma por ejemplo en los tubrculos de papa, color de tallo, forma de la lmina de
la hoja, etc. No se tiene en cuenta caracteres invisibles, tales como por ejemplo el sabor de
los tubrculos o el tiempo que demora para cocinar. Tampoco se considera caracteres
influenciados por el ambiente como altura de planta, produccin, reaccin a factores
biticos y abiticos.

Otra definicin son los ECOTIPOS que se definen como poblaciones de plantas de
especies silvestres adaptadas a travs de generaciones a una determinada zona geogrfica;
as tenemos en el caso del chocho o tarwi (Lupinus mutabilis Sweet), el ecotipo Norte que
es cultivado en las zonas altoandinas de los departamentos de Cajamarca y La Libertad de
clima benigno, caracterizado por tener plantas bastante altas de 2 m aproximadamente, de
largo perodo vegetativo (ocho meses) y bastante frondosos, que son diferentes al ecotipo
Sur cultivado en Cuzco y Apurmac, donde muestra plantas de mediana talla (1,5 m),
perodo vegetativo de cinco a seis meses (semiprecoces) y de crecimiento vegetativo ms
compacto en comparacin al ecotipo Norte. El clima en esta regin presenta frecuentes
heladas y sequas, es decir hay un mayor estrs ambiental.

31
En el punto 3.8 se definen las variedades multilneas.

2.5. Eleccin de progenitores

La eleccin adecuada de progenitores es un factor crtico e importante. Entre los criterios


que se toman en cuenta para la eleccin de progenitores, son en base a informaciones y
procedimientos cientficos dirigido a maximizar la posibilidad de obtener variedades
adecuadas y considerar aspectos legales al utilizar germoplasma obtenido por otras
instituciones, explicado en el punto 2.6.

Procedencia de los progenitores para cruzamientos

a) Comportamiento Varietal.- Cuando los progenitores son agronmicamente superiores


y adaptados a la regin del cultivo.

b) Comportamiento de germoplasma.- Puede presentar serias limitaciones en cuanto a


las caractersticas esenciales de las nuevas variedades. Los objetivos de este grupo en
general son de largo plazo y comprenden varios ciclos de mejoramiento puesto que
requieren principalmente de la adaptacin del germoplasma extico.

c) Estudios Genticos.- El mejorador debe estudiar los aspectos genticos de la especie


con que trabaja, tales como estudio de la herencia del hbito de crecimiento o la resistencia
a una enfermedad. Los progenitores deben ser bastante divergentes en cuanto a las
caractersticas en estudio. La clasificacin de cruzas en cuanto a la diversidad gentica de
los progenitores es bastante til para la definicin de las cruzas ms promisorias en la
obtencin varietal. Hay dos categoras:

Cruzamientos convergentes (Narrow cross).- Los progenitores son emparentados o


la distancia gentica entre progenitores es pequea. La progenie segregante presenta baja
variancia gentica asociada a su comportamiento medio. Se espera que las combinaciones
gnicas favorables sean preservadas y que las pequeas ganancias gnicas obtenidas
representen un incremento real en relacin al mejor progenitor. Comprende las cruzas:

- Variedad adaptada x variedad adaptada.


- Variedad adaptada x linaje lite.
- Linaje lite x linaje lite.

Cruzamiento divergente (Wide cross).- Cruzas con distancia gentica amplia entre
los progenitores. Las progenies segregantes de estas cruzas presentan gran variabilidad
gentica y un comportamiento bajo o moderado. En estas cruzas, los progenitores no
adaptados a la regin de cultivo pueden ser seleccionados por presentar caractersticas
inexistentes en el germoplasma local. En ciertos casos se debe mejorar la contribucin
gentica de tipos inadaptados por medio de retrocruzas con tipos adaptados.

Progenitores potenciales

Variedades comerciales. Las variedades en cultivo deben constituir la primera opcin


como fuente de progenitores, puesto que tienen caractersticas exigidas por el mercado y
generalmente son de buena productividad asociada a otras caractersticas de importancia

32
agronmica. La probabilidad de obtener lneas superiores cruzando variedades comerciales
es relativamente alta.

Linajes lite. Es cuando se incluyen linajes que se encuentran en su fase final de


evaluacin para la obtencin de variedades. La inclusin del linaje en el bloque de
cruzamiento antes de completar su evaluacin final puede resultar en la necesidad de
eliminar poblaciones segregantes, cuando algn aspecto limitante se detecta en el linaje
que se viene utilizando.

Linajes con caractersticas especficas. Hay linajes que no tienen un buen


comportamiento general, pero son portadores de uno o ms caractersticas de inters
especfico.

Accesiones del banco de germoplasma. Estas son excelentes fuentes de variabilidad. Sin
embargo, se debe tener cautela para su uso, puesto que la mayora de accesiones presentan
una o ms caractersticas indeseables para las variedades comerciales.

2.6. Mtodos de seleccin de progenitores

En Instituciones Internacionales tales como el Centro Internacional de Maz y Trigo


(CIMMYT) se realizan gran nmero de cruzas para su programa internacional de trigo.
Con un mtodo eficaz para elegir progenitores se puede reducir considerablemente el
nmero de cruzas. Hay dos tendencias antagnicas para la obtencin de una variedad
altamente productiva.

Maximizacin de la ganancia gentica.

En este caso tenemos la ecuacin siguiente:

G = ganancia gentica

h2 = heredabilidad

D = diferencial de seleccin

Para maximizar la ganancia gentica (G) se debe elevar el diferencial de seleccin (D). En
este caso debemos seleccionar un menor nmero de individuos superiores en la poblacin.
A mayor h2 se reduce la variancia ambiental utilizando ambientes ms uniformes y
aumentando la variancia gentica utilizando progenitores no emparentados. Aqu se utiliza
las cruzas divergentes.20

Maximizacin per se del comportamiento de la poblacin para la obtencin de la


nueva variedad.

El comportamiento de los individuos seleccionados en la poblacin se puede estimar con la


siguiente ecuacin:

33
= media de la poblacin de individuos seleccionados
= media de la poblacin original
= ganancia gentica

La ganancia gentica es slo uno de los componentes que influyen en la media de los
individuos seleccionados. Aqu utilizamos las cruzas convergentes con progenitores
altamente productivos. G es limitado, puesto que la media de la poblacin es alta,
resultando una elevada media de individuos seleccionados.

Como ejemplo aplicativo de esta metodologa, podemos tomar el caso de un estudio


realizado en frijol de palo (Cajanus cajan (L) Millsp) por Bautista5-6 para el cual tom
como material bsico una variedad local tradicional introducida de Guayaquil, Ecuador.
Este cultivar se caracteriza por su bajo rendimiento (0,9 t/ha), largo perodo vegetativo
(mayor a nueve meses), porte alto (ms de 2 m) y una maduracin hetergenea. Se
requiere, para las condiciones de costa central del Per de variedades mejoradas con
atributos de precocidad, alta produccin, uniforme y estable, baja altura de plantas y de
grano verde con calidad de exportacin.

Para este proceso de seleccin se plante los siguientes objetivos: identificar las
familias superiores en precocidad y rendimiento, determinar adems la efectividad de la
seleccin de familias y estimar el avance gentico por seleccin.

Este experimento consisti en tres etapas; en la primera etapa, se realiz la seleccin en


la poblacin original utilizando el mtodo de seleccin individual en parcelas
estratificadas, en la segunda etapa, la evaluacin de familias S1 y finalmente la evaluacin
de familias S2 en la tercera etapa. Con este material seleccionado S2 constituido por 16
familas se hicieron las evaluaciones en dos localidades: Chancay y Caete, utilizando el
diseo en bloque completo randomizado con tres repeticiones. Se tom datos de
rendimiento y sus componentes. Para este ejemplo mencionaremos solamente un atributo,
referido al rendimiento total promedio por planta de la primera cosecha en grano verde en
gramos.

Los parmetros estimados de este atributo son los siguientes:

Donde,

h2 = Heredabilidad
G = Ganancia por seleccin
Promedio de peso total de grano en verde por planta de familias seleccionadas.
= Promedio de peso total de grano en verde por planta de la poblacin original sin
seleccin

Maximizacin de las ganancias genticas (G)

G = h2 x D
G = 0,18 (61, 86 13,78) = 0,18 (48,08)
G = 8,65

34
Se obtiene una ganancia de 8,65 g de peso total en verde por planta. En porcentaje este
valor representa 8,65/13,78 = 0,62 = 62 %.

Maximizacin per se del comportamiento de la poblacin para la obtencin de la


nueva variedad

= 13,78 + 8,65

= 22,43

El peso de grano verde de la familia seleccionada de la generacin siguiente ser de 22,43


g.

Comportamiento per se de los progenitores. Un buen cruzamiento es cuando comprende


los mejores genotipos y que la media de los progenitores establece el desempeo de la
progenie. En este caso, la mayor parte de la variancia gentica es aditiva. Este hecho se
sustenta en que genotipos con buen comportamiento tienden a generar progenies con alto
comportamiento. Sin embargo, no siempre buenas variedades tienen un buen
comportamiento como progenitores.

Complementariedad para caractersticas importantes. Este mtodo enfatiza en la


complementariedad entre los progenitores para caractersticas correlacionadas con la
caracterstica principal del programa. Cuando la seleccin por la caracterstica de inters es
relativamente difcil, se puede utilizar la seleccin indirecta, es decir por medio de otras
caractersticas correlacionadas con la primera, ejemplo: rendimiento de granos con sus
componentes morfoagronmicos.

Con base a este mtodo el mejorador debe escoger progenitores que se complementen.
La preferencia de caractersticas deseables en ambos progenitores puede resultar en la
reunin de stas en un nico individuo, siendo por tanto superior a sus progenitores.

Comportamiento del progenitor. Es posiblemente el criterio ms importante. Aqu se


enfatiza la importancia de la capacidad de combinacin.

Pedigree del progenitor. Este criterio enfatiza la importancia de la diversidad gentica.


Cox et al.,27 sugieren que la eficiencia del programa de mejoramiento puede ser elevada si
se utiliza mayor diversidad gentica. Sin embargo, es necesario evitar que los genotipos
sean muy divergentes ya que pueden presentar limitaciones agronmicas en relacin a una
o ms caractersticas.

Prueba de generacin precoz. Cregan & Bush28, proponen el uso de esta prueba para
identificar cruzas promisorias en trigo. A partir de la generacin F2, cada poblacin
segregante fue conducida por los mtodos Bulk y Genealgico modificado, habiendo
concluido que para evaluar el desempeo de la generacin F2, el mejor de los criterios,
presenta apenas moderado valor predictivo en comparacin a la F1 de bajo valor predictivo.

35
El bajo nmero de evidencias como soporte a este mtodo, asociado al costo adicional
para la conduccin de pruebas de generacin precoz, reducen el inters del uso para la
prediccin de cruzas promisorias.

Mtodo de la capacidad combinatoria. Hay evidencias experimentales de que


progenitores de comportamiento mediocre pueden originar progenies con elevado
potencial, indicando que la capacidad de combinacin entre los progenitores puede ser
determinante en su eleccin. Se puede distinguir la aptitud combinatoria general (ACG) y
la aptitud combinatoria especifica (ACE) mediante cruzas diallicas. La importancia de la
capacidad de combinacin en la eleccin de progenitores es mayor cuando los efectos
gnicos no aditivos estn presentes.

Mtodo de Dudley. Dudley33-34 propuso una metodologa para identificar germoplasma


portador de alelos favorables. Dicho mtodo fue sujeto a crticas, con modificaciones
sugeridas por Metz67 y Bernardo10.

Mtodo de marcadores moleculares. Los marcadores moleculares pueden ser utilizados


para estimar la distancia gentica entre genotipos y para orientar al mejorador en la
eleccin de progenitores. La identificacin de lneas con alta aptitud combinatoria (AC) en
combinaciones hbridas es bastante costosa en programas de mejoramiento. El uso de
marcadores moleculares se recomienda para determinar grupos heterticos y tambin para
hacer las predicciones del comportamiento de hbridos en base a la distancia gentica entre
los progenitores.

En programas de retrocruzas, el uso de marcadores moleculares puede facilitar la


eleccin de progenitores donadores de menor distancia gentica del progenitor recurrente.

Para el planeamiento de cruzas con el fin de obtener variedades altamente productivas,


Borem11 de la Universidad Federal de Viosa propuso las siguientes estrategias para la
seleccin de progenitores en especies autgamas:

Identificar el germoplasma base que consistentemente presenten buen desempeo para


dar buena progenie, enfatizar luego su uso.
Mantener y mejorar el germoplasma base usando cruzamientos convergentes.
Conducir sub-programas dentro del programa global, para cada caracterstica
importante.

Los procedimientos inadecuados seran los siguientes:

Hacer seleccin en base a un nmero excesivo de objetivos tales como calidad


nutricional, resistencia a enfermedades, acame, productividad, altura de planta, entre
otros.
Ejecutar gran nmero de cruzas con progenitores aleatoriamente escogidos.
Dar nfasis a cruzas con progenitores divergentes.
Usar progenitores cuya aptitud a la combinacin no es conocida.
Considerar en demasa o no tomar en cuenta el germoplasma de otros programas de
mejoramiento.

36
3. MTODOS DE MEJORAMIENTO EN PLANTAS AUTGAMAS

Un cultivar nuevo de plantas normalmente autopolinizadas se originan del proceso de


seleccin a partir de una mezcla de plantas o de una planta seleccionada de un
germoplasma introducido, una mezcla de plantas o de una planta seleccionada de una
poblacin local o puede ser de una planta seleccionada de una poblacin hbrida.

3.1. Seleccin masal

Este mtodo consiste en la seleccin de un gran nmero de individuos, con caractersticas


fenotpicas similares que luego son mezclados para constituir la generacin siguiente. Es
uno de los ms antiguos mtodos de mejoramiento. Este mtodo es eficiente en
poblaciones heterogneas, constituidas por mezclas de lneas puras, en especies autgamas
o por individuos heterocigotos en el caso de algamas. La idea principal de la seleccin
masal es que al escoger los mejores fenotipos, se mejora el nivel de la poblacin con la
reunin de los fenotipos superiores ya existentes.

En la seleccin masal, las plantas individuales son seleccionadas fenotpicamente. Esto


es, con solamente informarnos sobre el fenotipo de los individuos que son considerados
superiores para la seleccin. Como los individuos con fenotipos semejantes pueden
presentar constitucin gentica distinta, la seleccin no siempre es efectiva. La seleccin
masal es generalmente poco utilizada para caractersticas de baja heredabilidad.

Objetivo: Formacin de poblaciones homocigotas y heterogneas.

Modalidades de aplicacin:

Positiva: el proceso consiste en la eleccin de fenotipos interesantes, luego de la cosecha


con mezcla de las semillas de estos individuos y finalmente se procede a la multiplicacin
de las semillas.

Negativa: el proceso consiste en la deteccin y eliminacin de individuos indeseables, los


genotipos que quedan constituyen la generacin siguiente.

3.1.1. Casos de utilizacin de seleccin masal

1) Seleccin masal a partir de variedades locales,


2) Seleccin masal de purificacin de variedades y
3) Seleccin masal despus de hibridacin.

1) Seleccin masal a partir de variedades locales. Variedad local es una mezcla de


genotipos diferentes donde la mayora son homocigotos, cuya caracterstica es la
plasticidad gentica que permite su adaptacin al medioambiente.

- Seleccin masal nica, el proceso de esta seleccin se muestra en la Figura 2.2 y


consiste:

Ao 1. Eleccin de fenotipos con caracteres favorables, cosecha de plantas individuales y


luego se mezcla.

37
Ao 2. Siembra de la mezcla de semillas: primera multiplicacin.
Ao 3. Segunda multiplicacin.
Ao 4. Produccin de una poblacin mejorada

CICLOS

0
Seleccin masal
POBLACIN positiva o negativa y
cosecha por planta

Mezcla de igual cantidad


de semilla por planta

Poblacin base
para otras
Evaluacin y selecciones
I
multiplicacin

Poblacin base
para otras
II selecciones
Multiplicacin
2 evaluacin
si es necesaria

Multiplicacin
III

Nueva
Variedad
Fuente: Modificado de Seilleur.86

Figura 2.2. Seleccin Masal nica.

38
El resultado de la seleccin masal depende de dos aspectos:

- Del atributo seleccionado

Si es estable, hay progreso rpido (homocigosis).


Si es fluctuante, es lento si la variabilidad ambiental es elevada.
Si se trata del rendimiento es poco eficiente.

- De la intensidad de seleccin

Si la intensidad de seleccin es baja, el avance por seleccin es lento.


Si la intensidad de seleccin es elevada, hay riesgo de desviacin de las caractersticas
iniciales (Deriva Gentica).

Apreciacin de los resultados:

Se debe ejecutar los ensayos comparativos de adaptacin y de rendimiento. Como testigo


se tiene la poblacin inicial.

- Seleccin masal repetida

Se utiliza cuando los resultados de la seleccin masal nica son insuficientes. El proceso
consiste en la eleccin de fenotipos interesantes, si la descendencia de las plantas
seleccionadas estn en vas de multiplicacin. Si la primera seleccin masal no ha sido
efectiva, se procede a una segunda seleccin masal y excepcionalmente a una tercera
cuando se trata de caracteres de baja heredabilidad (Figura 2. 3). El riesgo es que puede
suceder modificacin por efecto de la variabilidad local. El progreso es lento si el carcter
es sensible al ambiente. Es necesario evaluar en cada ciclo de seleccin.

Utilizacin, se utiliza cuando en la poblacin inicial hay proporcin elevada de


heterocigotos, es decir si hay fecundacin cruzada o una proporcin alta de mezcla de
genotipos.

- Seleccin masal con separacin de formas

Utilizacin, cuando la poblacin es heterognea entonces hay fenotipos con caracteres


tiles diferentes a probar.

Proceso: el proceso de esta seleccin tal como se muestra en la Figura 2.4, consiste en:

Ao 1. Formacin de fenotipos A, B, C.

Ao 2. Multiplicacin de semillas por cada fenotipo.

Ao 3. Contina la multiplicacin y ejecucin de ensayos comparativos.

Ao 4. Constitucin de nuevas poblaciones menos heterogneas.

39
CICLOS
Primera seleccin masal
cosecha por planta
POBLACIN
0

Mezcla de igual cantidad


de semilla por planta
Propagacin
Cultura Grande
Multiplicacin y
I evaluacin

Segunda
II
seleccin Propagacin
masal

Mezcla de
Semillas

Propagacin
Multiplicacin y
III evaluacin

Tercera
IV seleccin masal Propagacin

Mezcla de
Semillas

Multiplicacin y Propagacin
V evaluacin

Fuente: Modificado de Seilleur.86

Figura 2.3. Seleccin masal repetida.

40
A, B, C = Fenotipos seleccionados
P = Propagacin
C = Poblacin
M = Seleccin Masal

Fuente: Modificado de Seilleur.86

Figura 2.4. Seleccin masal con separacin de formas.

41
2) Seleccin masal de purificacin de variedades, se ejecuta si hay presencia de
fenotipos diferentes a la variedad original o si hay impurezas (mezclas) o hibridacin
natural.

Modalidad: Negativa.

Finalidad: Mantener la pureza de la variedad.

3) Seleccin masal despus de hibridacin, se utiliza durante las generaciones F2, F3, F4,
F5.

Modalidad de aplicacin:

Positiva: Eleccin de tipos superiores a conservar.


Ejemplo: Altura de planta, conformacin de espiga y tamao de grano.

Negativa: Deteccin y eliminacin de tipos indeseables.


Ejemplo: Sensibilidad a enfermedades o ausencia de precocidad.

Ventajas: Facilidad de conduccin y bajo costo operacional.

Limitaciones:

No es posible saber si las plantas seleccionadas son homocigotas.


No es posible saber si las plantas seleccionadas son superiores por su constitucin
gentica o ambiental. Esto excluye el uso de este mtodo para poblaciones
conducidas fuera del ambiente convencional de cultivo.
La seleccin masal puede ser utilizada en ambientes donde las caractersticas se
expresan.
La seleccin masal presenta poca eficiencia para caracteres de baja heredabilidad.

3.2. Seleccin individual o genealgica

El mtodo genealgico, conocido tambin como el mtodo pedigree, fue inicialmente


propuesto por Hjalman Nilsson. Aproximadamente en la misma poca, Louis de Vilmorin,
citado por Allard,3 usaba la seleccin individual de plantas como prueba de progenie,
metodologa que di origen al mtodo genealgico convencional.

Objetivo: Aislamiento de lneas puras

En el pasado, la lnea se desarroll por la identificacin de plantas superiores en una


variedad tradicional o en mezclas de genotipos. Actualmente un nuevo cultivar es
originado por el proceso de seleccin en poblaciones en segregacin luego de la
hibridacin. En ambos casos, la prueba de progenie es esencial en seleccin de lneas puras
y sirve para evaluar la caracterstica mejorada de la planta seleccionada (Figura 2.5).

La lnea mejorada no crea nuevos genotipos y su mejoramiento se limita al aislamiento


del mejor genotipo presente en la mezcla de la poblacin. Una vez que se prob la

42
superioridad del genotipo seleccionado, la poblacin debe ser incrementada, puesto el
nombre y distribuida como un nuevo cultivar.

El tiempo que el nuevo cultivar permanece puro depende de la mezcla con otras lneas,
cruce natural con otras lneas o cultivares y mutaciones.

3.2.1. Casos de utilizacin de seleccin genealgica

1. Seleccin genealgica a partir de variedades locales.


2. Seleccin genealgica de purificacin de variedades.
3. Seleccin genealgica despus de hibridacin.

CICLOS

Seleccin fenotpica individual

Siembra: planta/surco.
Seleccin por familias

Siembra: familia/surco.
Evaluacin y seleccin por familias

Ensayos comparativos

Multiplicacin

Fuente: Modificado de Seilleur.86

Figura 2.5. Mtodo de seleccin individual de plantas con prueba de progenie

43
1) Seleccin genealgica a partir de variedades locales

Objetivo: A partir de variedades locales tradicionales, aislar lneas puras en base a


fenotipos sobresalientes, compararlos y probarlos (Figura 2.6 y 2.7).

Poblacin inicial: La variedad local es la fuente de variacin, en este caso se llama G2


(analoga con F2).

Fuente: Modificado de Seilleur.86

Figura 2. 6. Seleccin genealgica a partir de variedades locales de gramneas.

44
Variedad local tradicional
Poblacin base

M = Multiplicacin
P = Prueba en ambientes

Fuente: Modificado de Seilleur.86

Figura 2.7. Seleccin genealgica a partir de variedades locales.

45
Procedimiento clsico de seleccin genealgica a partir de variedades locales en trigo
segn Seilleur:86

1) Siembra poco densa (100 a 150 plantas/m2) con toma de datos suficientes.
2)
G3)
2 Evaluacin morfolgica durante todo el perodo vegetativo (morfolgico, fisiolgico).
4) Cosecha individual de cada planta. Trilla de granos separndolos en dos partes: para
la siembra en G3 y la otra mitad como reserva.
5) El nmero de plantas a seleccionar es segn la disponibilidad del material y de
recursos, es mejor seleccionar un nmero elevado de plantas.
Siembra alternada entre el material selecionado y el testigo: 10 lneas con siembra en
G3 surco/lnea. Cada lnea proviene de una planta G2, y cada lnea est compuesta de 10 a
50 plantas. Un surco testigo: puede ser el material inicial de partida (G2) o la variedad
ms cultivada.
Las observaciones morfolgicas se efectan a lo largo del ciclo vegetativo y siempre
comparando con el testigo. Se determina el grado de homocigosis de la descendencia,
descripcin del fenotipo a partir de varios individuos idnticos, completado con
observaciones realizadas en aos anteriores (en ambientes diferentes). Se continua
con la eleccin de lneas ms interesantes entre los descendientes homogneos. En las
lneas heterogneas, seleccin eventual de aquellas plantas interesantes. Cosecha de
10 plantas de cada lnea seleccionada.
G1)
4 Siembra de una espiga de cada planta seleccionada: se siembran 10 lneas (familia)
alternado con los testigos.
a) Toma de observaciones morfolgicas y seleccin genealgica dentro de las familias
interesantes. De esta seleccin una parte se guarda como reserva y la otra parte para
ensayos comparativos.
G5 Continuacin de la seleccin genealgica. Lneas seleccionadas en cada familia G4
pasa a la familia G5. Toma de observaciones morfolgicas. Familias G5 salidas de una
misma familia G4: Si son idnticas se hace seleccin para conservar la homocigosis.
Sino son idnticas contina la seleccin genealgica como en G4. Realizacin de
ensayos comparativos de comportamiento y de rendimiento. Segn los resultados
viene la toma de decisin, se queda o se elimina; si se queda pasa a la G6.
G1)
6 Contina la seleccin genealgica o familial.
G2)
7 Ensayos comparativos en parcelas ms grandes.
G8 Continua al menos 3 aos para caracterizar la variedad.

Conclusin:

- Variedad local donde se aplica la seleccin genealgica para obtener una variedad
mejorada, la duracin es al menos de seis ciclos vegetativos.
- Eficacia: mayor que Seleccin Masal

46
Sntesis comparativa de Seleccin Masal y Seleccin Genealgica

Variedad o Mejoramiento Variedad obtenida


Raza local por seleccin

Variabilidad
natural

Fenotpica: explotado por S.M. progreso es bajo


Genotpica: explotado por S.G. progreso es alto

Si se llega al lmite de la variabilidad natural, se tiene la necesidad de crear variabilidad


artificial por medio de:

- Hibridacin intraespecfica
- Hibridacin interespecfica
- Mutacin
- Cultivo in-vitro
- Biotecnologa

Modalidades de seleccin clsica a partir de variedades locales:

1) Seleccin genealgica (S.G.) acelerada

- S.G. se detiene en F5 F6, antes del estado completo de lnea pura.


- Las lneas F6 de buen comportamiento se multiplican para dar semilla mejorada.

2) S.G. en el caso de cruzamientos complejos, ejemplo:

- Combinar la productividad del progenitor 1, con la resistencia al fro del progenitor


2 y la resistencia al oidium del progenitor 3
Procedimiento:

a) 1 x (2 x 3)

b) (1 x 2) x (1 x 3)

c) (1 x 2) x (2 x 3)

Seleccin Seleccin

( D1 x D2 )

47
Tcnicas para acelerar la seleccin, mediante:

a) Realizacin de varios ciclos de cultivo el mismo ao, siempre que sean precoces tal
como las hortalizas y las condiciones ambientales lo permitan.

b) Reemplazar mediante cmaras climatizadas la falta de seleccin natural.

c) Cambio de localidades que permitan pasar las generaciones por un clima similar al
de la localidad principal.

Procedimiento:

a) Para especies anuales:

- Cultivos sucesivos en dos ambientes diferentes: hemisferios N y S a la


misma latitud o costa y sierra baja segn lo permita el clima.

- Utilizacin en medios acondicionados (invernaderos climatizados).

b) Para especies bianuales:

- Obtencin de la floracin desde el primer ao por la induccin termo o


fotoperidica.

c) Complementar la deficiencia de las condiciones naturales de seleccin:

- Test de resistencia al fro en cmaras fras.

- Test de resistencia a enfermedades por infeccin artificial.

2. Seleccin genealgica para la conservacin de variedades

Finalidad : Conservacin de la pureza gentica del cultivar.

Medios : Sistemas de control de lneas.

Procedimiento : Mantener cada ao un nmero de lneas. Este nmero depender


de la especie y su grado de multiplicacin y del rea de cultivo de la
variedad (Figura 2.8).

48
Fuente: Modificado de Seilleur.86

Figura 2.8. Seleccin de purificacin en cereales autgamas

3) Seleccin genealgica despus de hibridacin

El registro de la genealoga de cada lnea, permite establecer el grado de parentesco entre


las lneas seleccionadas. La seleccin con prueba de progenie o conocimiento de la
genealoga de los tipos seleccionados permite la maximizacin de la eficiencia de la
seleccin. Ejemplo: aquellas lneas con elevado grado de homocigosis pero que presentan
un ancestro comn en una o dos generaciones anteriores deben ser consideradas
genticamente semejantes y slo una de ellas debe ser preservada para evaluaciones
futuras.

En el ejemplo presentado en la Figura 2.9, el cruzamiento Santa Rosa x UFV-1 fue


designado como V x 28; indicando que este fue el 28avo cruzamiento de soya realizado en
Viosa en un programa de desarrollo de variedades.11

49
Fuente: Borem.11
Figura 2.9. Sistema de nomenclatura de la genealoga en el mtodo de seleccin
genealgica.

El proceso de seleccin, se describe en la figura 2.9, la cruza entre los cultivares parentales
por ejemplo de los progenitores V con 28. La generacin F1 recibe idntica designacin, V
x 28 puesto que no fue sometida a seleccin. En la F2 se seleccionaron por ejemplo 100
plantas, cada planta seleccionada recibe la siguiente designacin V x 281, V x 282,...V x
28100. Suponiendo que dos plantas han sido seleccionadas dentro de la progenie V x 28-
3, ellos se designan como V x 28-3-1 y V x 28-3-2 y as sucesivamente. Siguiendo la
lectura de la genealoga de cada planta podemos determinar el parentesco de una planta
con otra.

Seleccin Durante las Generaciones Segregantes

La seleccin se basa en el fenotipo y genotipo de los individuos lo que confiere a este


mtodo una alta eficiencia para la seleccin de caracteres mono u oligogenticos (Figuras
2.9 y 2.10).

50
AxB

F1

F2 Seleccin individual

Siembra planta/surco
F3 Seleccin individual dentro
de familias seleccionadas

Siembra planta/surco
F4 Seleccin individual dentro
de familias seleccionadas

F 5-6 Siembra planta/surco


Seleccin familial

F7 EPR

RI R II

EIR, EAR
F8-9
EPR = Ensayo preliminar de rendimiento
EIR = Ensayo intermedio de rendimiento
EAR = Ensayo avanzado de rendimiento
RI R II R III

LANZAMIENTO DE VARIEDADES
Fuente: Borem, 1998.
Figura 2.10. Esquema de mtodo genealgico.

51
Variabilidad Gentica

Se modifica con las generaciones de autofecundacin. La variancia aditiva en una


poblacin sometida a seleccin aumenta entre lneas y se reduce dentro de lneas. Cuanto
mayor es la variancia gentica, mayor es el progreso por seleccin, por eso se debe evaluar
y seleccionar un gran nmero de plantas F2. Conforme avanzan las generaciones, la se
va reduciendo dentro de lneas y la seleccin dentro de estas lneas se torna inefectiva. Una
de las principales razones para el registro de la genealoga es permitir al mejorador de
maximizar la diversidad entre lneas seleccionadas. La seleccin dentro de familias es
justificable solamente en las primeras generaciones de autofecundacin, cuando la
variabilidad gentica es razonable.

El nmero de autofecundaciones a ser conducido en el mtodo genealgico va a


depender del nivel de uniformidad gentica deseada y la diversidad de progenitores
utilizados. En cruzamientos convergentes (narrow crosses), la F4 puede ser satisfactoria.
En otros casos puede ser necesaria F8 o ms, antes de iniciar los ensayos de rendimiento en
campo. En el caso del trigo, el proceso de seleccin se muestra en las Figuras 2.11, 2.12.

Caractersticas Seleccionadas

En la generacin F2, el nivel de heterocigosis es alto (50 % en un monohbrido y muchos


individuos expresan el vigor hbrido. Esta manifestacin de vigor hbrido o heterosis
puede influir en la seleccin de tipos heterocigticos y por caracteres cuantitativos lo que
constituye un problema.

Por esta razn, durante las primeras generaciones de segregacin, se deben seleccionar
principalmente individuos con caracteres mono u oligogenticos, segn el objetivo de
seleccin. Conforme avanzan las generaciones el nfasis puede ser dada a caractersticas
ms complejas. La productividad debe ser evaluada solamente a partir de generaciones en
que las lneas expresan uniformidad gentica.

Ventajas y Desventajas del Mtodo Genealgico

Ventajas

- Permite el control del grado de parentesco entre selecciones.


- Permite el descarte de individuos inferiores en generaciones precoces.
- Permite la utilizacin de datos obtenidos para estudios genticos.
- Permite el entrenamiento de mejoradores.

Desventajas

- Permite la conduccin de una nica generacin por ao, haciendo que este proceso
sea prolongado.
- Exige elevada demanda de mano de obra y campo experimental.
- Requiere personal calificado para seleccionar tipos deseables.

52
P1 x P2

F1

F2
Seleccin individual

Siembra planta/surco
F3 Seleccin familial

Siembra
familia/par
Evaluacin y
F4 multiplicacin por
familias

Seleccin individual
F5 dentro de familias
seleccionadas

Siembra planta/surco

F6
Seleccin por familia

Evaluacin y
multiplicacin
F7

M M
Multiplicacin
F8

Fuente: Modificado de Seilleur.86

Figura 2.11. Mtodo de ciclos sucesivos de seleccin, se ejecuta en Cambridge


(Inglaterra) y en Max Plank Institut en Kln(Alemania).

53
Fuente: Modificado de Seilleur.86

Figura 2.12. Seleccin genealgica despus de la hibridacin.

Reglas para registrar genealogas

La genealoga debe mostrar claramente la secuencia a travs de la cual se obtuvo una lnea
o variedad. La genealoga de cada lnea se debe registrar en un libro de campo y el libro de
historia de las cruzas, tambin se registra en todas la etiquetas de cruzamiento:

54
- El mtodo usado por el CIMMYT es el ms simple y en el cual las genealogas son fciles
de entender a primera vista.
- El mtodo usado por el Departamento de Agricultura de los Estados Unidos (USDA), ms
detallado y adaptable a las mquinas electrnicas.

Se debe tener, una lista de abreviaciones. Se han propuesto varios mtodos para registrar
las genealogas, pero hay dos que son ampliamente usadas. Los fitomejoradores deben
conocer ambos. En los ejemplos presentados a continuacin, las abreviaturas se usan tanto
en las genealogas del CIMMYT como en las del USDA.25

Mtodo del CIMMYT:

a) El progenitor femenino se pone en primer lugar y se separa del progenitor


masculino mediante el smbolo de cruza:

- : guin en la primera cruza, LR64-Son64


x : por en la segunda cruza, LR64-Son64xJar
/ : diagonal en la tercera cruza, LR64-Son64xJar/Aa
() : parntesis en la cuarta cruza, (LR64-Son64xJar/Aa)Bb
[] : corchete en la quinta cruza, [(LR64-Son64xJar/Aa)Bb]Cd
{} : llave en la sexta cruza, {[(LR64-Son64xJar/Aa)Bb]Cd}Cno67

b) El material progenitor involucrado en cualquier cruza incluye todo lo que se enlista


en un lado u otro del smbolo de cruza (-, x, /, ( ), etc.) hasta la siguiente cruza.
c) Las retrocruzas se presentan con un nmero ndice despus del nombre del
progenitor recurrente: LR64- Son64 x Jar3. Si el progenitor recurrente fue una cruza
compleja, toda la cruza se incluye dentro de un parntesis y el ndice se pone
despus del parntesis: LR64- Son64 (Cno67-H x Bb)3.
d) Cada cruza se designa con un nmero de cruza, por ejemplo, 8469 precedido por
una o dos letras que indican el programa, CM para trigos harineros y cristalinos, y
X para triticales.

En el programa del CIMMYT, las selecciones se designan mediante el nmero de planta de


cada seleccin despus de la F2 y por una letra que corresponde a la localidad donde se
hizo la seleccin (Y para Obregn en el Valle del Yaqui, M para Toluca en el Estado de
Mxico, B para El Batan, etc.). Ejemplo: CM 8469-2Y-3M-7Y-0M.

Mtodo del Departamento de Agricultura de los Estados Unidos

a) El progenitor femenino se pone en primer lugar y se separa del progenitor masculino


por:

Una diagonal / en la primera cruza, LR64/Son64


Doble diagonal // en la segunda cruza, LR64/Son64//Jar
Dos diagonales con el nmero de la cruza entre ellas, por ejemplo.
/3/, /4/, /5/, etc., en las cruzas subsecuentes

LR64/Son64//Jar/3/Aa
LR64/Son64//Jar/3/Aa/4/Bb

55
b) El material progenitor involucrado en cualquier cruza particular incluye todo lo que se
enlista a un lado u otro del smbolo de cruza (/, //, /S/, /4/, etc.) hasta la siguiente cruza
secuencialmente numerada.

c) Las retrocruzas se designan por el nmero de la retrocruza que se pone


inmediatamente despus del smbolo de cruza (2, //, /3/, etc.) al lado del progenitor
recurrente, con un asterisco * que lo separa de la genealoga que representa al progenitor
recurrente.

LR64/Son64//3*Jar
LR64/Son64//3*Con67/H/Bb

d) Las designaciones de las selecciones de cruzas simples o complejas pueden distinguirse


de la genealoga en si, mediante la utilizacin de tres smbolos diferentes: guin -,
parntesis ( ), o coma, dependiendo del significado del nmero de seleccin.

El parntesis ( ) se deber usar para distinguir las selecciones de cruza simples o


complejas dentro del cuerpo de la genealoga; el nmero de seleccin que sigue al
parntesis se refiere a todo el material incluido en ellos.

La coma "," separa una seleccin de la genealoga completa que le precede. La coma se
usa para denotar selecciones finales del pedigr completo.

EJEMPLOS

La secuencia completa de las cruzas de las cuales se obtuvo la variedad Sonora 64 puede
ilustrarse como sigue:

1. Yaqui 48, obtenido de la cruza Newthatch x Marroqu se cruz con Kentana 48, que se
obtuvo de la cruza Kenya 324 x Mentana.

Mtodo CIMMYT : Newthatch Marroqu x Kenya 324 Mentana,


N-M x k324- Mt

Mtodo del USDA : Newthatch / Marroqu // Kenya 324 / Mentana


N/M//k324/Mt

2. Una seleccin de la cruza previa se cruz con Frontana. De esta cruza se obtuvo
Yaktana 54, que fue la seleccin nmero P14-1H-14H-2H.

Mtodo del CIMMYT : N MxK324 Mt/Fn 14P-1H-14H-2H


Mtodo del USDA : N/M//K324/Mt/3/Fn14P-1H-14H-2H

3. Yaktana 54 se cruz con una seleccin de la cruza Noria 10 x Brevor.

Mtodo del CIMMYT : (N-MxK324-Mt/Fn)N10-B


Mtodo del USDA : N/M//K324/Mt/3/Fn/4/N10/B
: N/M//K324/Mt/3/Fn(P14-1H-14H-2H)/4/N10/B

56
4. Yaqui 54 se obtuvo como la seleccin 2245-1Y-2c-5Y, de la cruza entre Newthatch x
Marroqu y Timstein x Kenya.

Mtodo del CIMMYT : N M x T K, 2245 1Y 3c 5Y


Mtodo del USDA : N/M//T/K, 2245 1Y 3c 5Y

5. Sonora 64 se obtuvo como la seleccin 8469 2Y 6c 6Y 4c 2Y 1c de la


cruza obtenida en el punto 3, retrocruzndola dos veces con Yaqui 54.

Mtodo del CIMMYT : [ (N MxK324 Mt/Fn)N10 - B] (N M x T K)2


Mtodo del USDA : N/M//K324/Mt/3/Fn/4/N10/B/5/2*N/M//T/K
(N/M//K324/Mt/3/Fn)(P141H14H
2H)/4/N10/B/5/2*N/M//T/K(2245 1Y 3c 5Y).
8469 2Y 6c 6Y - 4c 2Y 1c.

3.2.2. Modificaciones del mtodo genealgico

Mtodo genealgico modificado por Lupton y Whitehouse

Lupton & Whitehouse,62 describen una serie de esquemas de mejoramiento en las que son
seleccionadas aproximadamente el 10 % de las plantas fenotpicamente superiores en una
poblacin de 2000 a 3000 individuos (Figura 2.13).
AxB

F1

Seleccin del 10 % de plantas


fenotpicamente superiores en una
F2 poblacin de 2000 a 3000 individuos.

Planta/surco. Son seleccionadas las


mejores progenies F3 y dentro de ellas las
mejores plantas.
Las plantas seleccionadas son conducidas
F3-4 separadamente en surcos en la generacin
F4. Un surco F4 o dos de cada familia
promisoria continan sometidas a
seleccin individual de plantas

Los dems surcos de familias


promisorias son cosechados en masa
F5 para el EPR

EPR = ensayo preliminar de rendimiento

Figura 2.13. Mtodo genealgico modificado por Lupton y Whitehouse.

57
Mtodo genealgico modificado por Akerman y Mackey

Modificacin del mtodo genealgico para minimizar la influencia del vigor hbrido
durante la seleccin, fue presentado por Akerman & Mackey.1

El principio de este mtodo supone que las generaciones de autofecundacin eliminan


la variancia gentica debido a la dominancia (Figura 2.14).

Figura 2.14. Mtodo genealgico modificado por Akerman y Mackey.

58
Desventajas del mtodo Akerman y Mackey

1. Evaluacin de lneas genticamente heterogneas en ensayos comparativos de


rendimiento.
2. El elevado nmero de individuos de cada lnea a partir de la generacin F 3 con el
fin de preservar la variabilidad gentica dentro de lneas.

Mtodo genealgico modificado por Valentine

Valentine95 sugiri el Mtodo genealgico acelerado para implementar con rapidez el


avance de generaciones con este mtodo.

La modificacin se basa en la premisa de que la seleccin por rendimiento con base a


una sola planta F2 es insuficiente. Valentine recomienda que el cruzamiento entre los
progenitores se realice en casa de mallas, durante la poca convencional.

Las generaciones F1 y F2 son conducidas en tinglado de mallas durante una estacin


media de manera que las semillas F3 estn disponibles para su siembra en campo en una
poca convencional. Las progenies F3 son conducidas separadamente y evaluadas por
rendimiento de grano, siendo las superiores sometidas a ensayos comparativos de
rendimiento convencional.

3.3. Mtodo de poblaciones hbridas o bulk population

El mtodo de poblaciones hbridas, tambin conocido como mtodo BULK


POPULATION, fue inicialmente propuesto por Nilsson - Ehle en 1908, cuando ejecutaba
sus trabajos en el Instituto Svalf de Suecia.

Cuatro aos ms tarde, Newman (1912), citado por Florell,38 describe el recin
originado mtodo en una reunin de mejoradores de Canad. En su artculo, Florell 38
presenta las principales ventajas del mtodo de poblaciones hbridas. Este autor discute las
bases tericas para determinar el nmero de generaciones necesarias antes de iniciar la
seleccin de plantas. Otros mejoradores incorporan el mtodo de poblaciones en su
propuesta de mejoramiento de especies autgamas (Harlan & Martini,46 Mackey67).

3.3.1. Descripcin del mtodo

Es simple y conveniente por ser menos laborioso, y es de menor costo en generaciones


tempranas en comparacin al metdo genealgico. El proceso del mtodo de poblaciones
hbridas se inicia con el cruzamiento de dos progenitores seleccionados conforme el
objetivo del programa. Las plantas F1 deben estar bien manejadas para obtener un gran
nmero de semillas. Todas las semillas cosechadas de plantas F1 son agrupadas y utilizadas
para obtener la generacin F2. La generacin F2 debe ser conducida en condiciones
edafoclimticas representativas de la zona donde la futura variedad debe ser cultivada. De
igual forma las prcticas agrcolas, tambin deben ser representativas de la zona.

Segn la maduracin, las plantas F2 son cosechadas en conjunto (Bulk) y una muestra
de las semillas F3 es utilizada para la obtencin de la generacin F3, que es conducida

59
como en la generacin F2. Este procedimiento es repetido hasta obtener el nivel de
homocigosis deseado.

Es necesario sembrar altas poblaciones y espaciadas en las generaciones de seleccin


para tener una mayor oportunidad de encontrar genes segregantes deseables.
En comparacin con el mtodo de pedigree selection, ninguna informacin puede ser
obtenida en las primeras generaciones de tratamientos especficos o el comportamiento de
lneas especificas. Durante las generaciones segregantes algunos genotipos deseables se
pueden perder en la poblacin, por ejemplo, plantas altas y tardas pueden suprimir a las
plantas bajas y precoces.

El proceso de seleccin del mtodo Bulk population puede ser modificado por la
seleccin en la F3 F4 y el comienzo de las pruebas de rendimiento se ejecutan mientras
que las lneas estn en segregacin. Las lneas superiores por rendimiento pueden ser
reseleccionadas mientras las pruebas de rendimiento continan (Figura 2.15).

Fuente: Modificado de Seilleur.86

Figura 2.15. Esquema del mtodo de seleccin de poblaciones hbridas.

60
Principio:

- Multiplicacin en mezcla desde las primeras generaciones luego de hibridacin.


- Seleccin retardada para aprovechamiento de la homocigosis.

Ejemplo de seleccin en trigo segn Seilleur (1985):


Plantas F1 cosecha en mezcla, todos los granos sembrados F2
2000 plantas F2 cosecha en mezcla, granos sembrados F3
20 000 plantas F3 cosecha en mezcla, granos sembrados F4
20 000 plantas F4 cosecha en mezcla, granos sembrados F5
20 000 plantas F5 comienzo de la seleccin, pero se puede comenzar en generaciones
siguientes.
1000 plantas F6
500 plantas F7
50 lneas F8

Comparacin del mtodo de poblaciones hbridas con la Seleccin Genealgica

- Hasta la Fs

Menos exigencia de trabajo.


Menos prdida de genotipos.
Tiende a la homocigosis.
Interviene la seleccin natural, pero la eliminacin puede comprender genes
recesivos interesantes que no se recuperan.

- En F5

Posibilidad de elegir varios individuos de un mismo genotipo y conducir lneas


idnticas hasta los ensayos comparativos.
En conjunto, dura ms tiempo.

Pruebas de pureza gentica en la obtencin de una nueva variedad:

1. Morfolgico: Todos los individuos son idnticos.

2. Gentico: Si tenemos el caso de un carcter mejorado (caracter dominante) x lnea


de prueba (recesiva).
1) Individuos F1 : todos son idnticos.
x Individuos F1 x caracter mejorado, todos los individuos idnticos a la lnea
mejorada.

3. Estadstico:10 plantas dan 10 descendientes con caracteres cuya distribucin de


frecuencias son idnticas.

4. Fisiolgico: comportamiento idntico de todas las plantas de la misma siembra.

5. Qumico: en base a pruebas especficas.


6. Molecular: bandas idnticas en electroforesis.

61
Ensayos de adaptacin y de rendimiento:

Idealmente se debe esperar la homocigosis de la lnea para realizar los ensayos de


adaptacin y rendimiento. En la prctica la seleccin se realiza antes de llegar a la
homocigosis (en semillas cosechadas en F5). El material gentico, depender de la cantidad
de semilla disponible:

1) Si hay suficiente semilla por lnea, la cosecha de cada planta ser para continuar la
seleccin genealgica (SG) y el resto de las semillas ser para realizar los ensayos
comparativos (EC).

2) Si hay poca semilla por lnea, la cosecha de cada lnea ser para la SG y el resto de
las familias sern para los EC.

Sin embargo, debemos tener la precaucin de continuar los ensayos comparativos que
tienen lneas todava no fijadas, debido a la variabilidad del medio, y al criterio de
seleccin. La seleccin se contina con las lneas de alto valor. La experimentacin se
contina con el siguiente procedimiento:

1) Ensayos comparativos

Primero, parcelas de tamao reducido donde se eliminan los genotipos no deseables.


Luego, parcelas ms grandes, en ambientes diferentes (locales o regionales) y la
eleccin de las mejores lneas.

2) Ensayo de pruebas del valor tecnolgico

Ventajas

- Economa de mano de obra en la conduccin de poblaciones segregantes.

- Posibilidad de conduccin de gran nmero de poblaciones con mayor facilidad.

- Aumento de proporcin de individuos ms adaptados y competitivos.

Desventajas

- Es inadecuado para especies cuyo producto comercial no son granos.

- Imposibilita el uso de tinglados para la conduccin de ms de una generacin por ao.

- No permite el uso de la poblacin para estudios de heredabilidad.

- Presenta el riesgo de prdida de genotipos deseables con baja capacidad de competencia,


ejemplo: los tipos semienanos.

62
3.3.2. Modificaciones del mtodo de poblaciones hbridas

Mtodo de Harrington

Con la idea de juntar las ventajas del mtodo de poblaciones o bulk con el mtodo
genealgico, Harrington48 propone modificar la metodologa original; la poblacin
segregante conducida por el mtodo de poblaciones o bulk requiere que las condiciones
favorables permitan la expresin de caracteres importantes hasta cuando se hace la
seleccin de plantas individuales, de aqu hacia adelante se conduce el material por el
mtodo genealgico.

Segn este autor, las condiciones favorables de seleccin corresponden a la falta al


exceso de unidades de fro, incidencia de enfermedades, etc. permitiendo que los genotipos
resistentes sobresalgan.
Las ventajas de este mtodo en relacin al genealgico son:

- Es flexible, las pruebas de progenie son efectuadas eficientemente cuando las condiciones
ambientales son favorables a la seleccin.

- Permite evaluar mayor cantidad de material.

Mtodo de Empig y Fehr

Estudiando diversas cruzas entre variedades de soya de diferentes grupos de maduracin,


Empig & Fehr35 propusieron conducir el mtodo de poblaciones por grupo de maduracin.
Este procedimiento consiste en subdividir la poblacin segregante en grupos con pocas de
maduracin diferentes, cada sub-poblacin es conducida segn el procedimiento original
hasta la generacin F5, de donde se extraen aleatoriamente lneas para los ensayos
preliminares de rendimiento. Esta modificacin tiende a eliminar la competencia entre
individuos de ciclos diferentes, por tanto, con diferentes habilidades de competicin.

Mtodo de Van Der Kley

Van Der Kley95 propuso el mtodo de la seleccin masal negativa gradual, tendiendo a
eliminar las caractersticas indeseables de la poblacin. En este mtodo se utiliza una
pequea presin de seleccin en la generacin F2, que luego es elevada gradualmente hasta
la generacin F4 F5. Este mtodo hace que la probabilidad de xito durante la formacin
de lneas de las generaciones avanzadas aumente.
Mtodo Jennings y Aquino

Jennings & Aquino56 verificaron que las plantas de arroz ms altas a nivel de poblaciones
son generalmente menos productivas que las bajas; cuando estn en competencia con las
altas, presentan baja produccin de granos debido al sombreamiento.

En estas condiciones, el mtodo de poblaciones favorece a los individuos de menor


potencial productivo, plantas altas en este caso. Estos autores propusieron el
despanojamiento de las plantas altas, antes de la floracin o la eliminacin de plantas antes
de la maduracin.

63
Mtodo evolucionista

Este mtodo consiste en conducir una poblacin segregante, obtenida por cruzamientos de
varios progenitores durante gran nmero de generaciones, por el mtodo de poblaciones o
bulk. El trabajo efectuado por Suneson,93 incluye 28 progenitores de cebada con los cuales
obtuvo 378 hbridos.

Se agrup igual nmero de granos de todas las cruzas, constituyendo los cruzamientos
compuestos, conducidos por 12 a 29 generaciones, dando oportunidad para que la
seleccin natural elimine los individuos con baja capacidad de competencia. Este autor
afirm que utilizando este mtodo fue posible encontrar genotipos que produjeron 56 %
ms que la variedad Atlas46 considerada productiva en aquella ocasin.

Gradualmente, los mejoradores perdieron inters por este mtodo, en virtud de la falta
de evidencias respecto de su eficiencia y el largo tiempo requerido para la formacin de
nuevas variedades.

3.4. Mtodo de descendencia nica de semilla o Single Seed Descent (SSD)

Goulden41 propuso la maximizacin del nmero de lneas en homocigosis descendientes de


diferentes individuos de la generacin F2. Este procedimiento garantiza que cada lnea
homocigtica de la poblacin final corresponde a una planta F2, o sea que todas la plantas
F2 estarn representadas en la poblacin final.

En 1961, Kaufmann propuso el Mtodo aleatorio para el mejoramiento en avena,


utilizando los mismos principios enunciados por Goulden. Kaufmann sugiere que los
avances de las generaciones a partir de F2 fuesen realizados en forma aleatoria, separando
esta fase de la etapa de seleccin.

3.4.1. Descripcin del mtodo

El mtodo consiste en avanzar las generaciones segregantes hasta un nivel satisfactorio de


homocigosis, tomando una semilla de cada individuo de una generacin para establecer la
generacin siguiente. Brim16 sugiere la siembra de dos a tres semillas de cada planta F2 en
golpes individuales para asegurar la germinacin. Luego de la emergencia, una sola planta
es preservada y el resto eliminada. Tal procedimiento es repetido en las generaciones
siguientes hasta que se obtenga el nivel de homocigosis deseado. De esta forma, cada lnea
corresponde a un progenitor F2 diferente.

La principal caracterstica de SSD es la reduccin del tiempo requerido para la


obtencin de lneas homocigotas. Considerando que en este mtodo el proceso de
evaluacin y seleccin de genotipos se inicia despus de la obtencin de lneas en
homocigosis, se pueden conducir tantas generaciones por ao posibles.

- Principios del mtodo SSD

Hay una separacin de la fase de aumento de homocigosis de la fase de seleccin. Las


poblaciones segregantes no necesitan ser conducidas en ambientes similares a las de la

64
futura variedad. El mtodo SSD se adapta al uso de casa de malla o de viveros fuera de la
regin o de pocas tpicas de cultivo de la especie, permitiendo as que ms de una
generacin pueda ser obtenida por ao.

La entre plantas de las poblaciones segregantes aumenta en razn de (1+F) ,


donde F es el coeficiente de endogamia de la generacin considerada.

La seleccin individual en generaciones avanzadas, como ocurre en este mtodo, se


beneficia de la mayor proporcin de variancia gentica aditiva presente. Como cada lnea
de la poblacin final corresponde a una planta F2 diferente, la variancia gentica es
maximizada. La variancia gentica de la poblacin avanzada puede ser disminuda si ms
de una lnea en la poblacin final corresponde a una misma planta F2.

En contraste con el mtodo de poblaciones la seleccin natural no ocurre en las


poblaciones segregantes, a menos que el ambiente afecte el poder germinativo de las
semillas o la capacidad de los individuos para producir semilla viable.

Una de las limitaciones de SSD es la reducida exploracin de la variabilidad de la


generacin F2. De cada planta de esta generacin, apenas una semilla representa toda la
variabilidad de cada individuo F2. En las cruzas convergentes en que la diversidad gentica
entre los progenitores es limitada, el grado de parentesco entre los individuos F 2 es
relativamente alto, consecuentemente la variabilidad entre semillas F3 proveniente de un
mismo individuo F2 es relativamente baja. En esta situacin, probablemente una sola
semilla es suficiente para representar la variabilidad de cada individuo F2.

Como se mencion, a no ser que el mejorador tenga recelo de que entre los individuos
no seleccionados est aquella que conducir a nuevas variedades, en poco tiempo estar
sobrecargado de lneas para su evaluacin, comprometiendo la eficiencia del
mejoramiento.

Una semilla F3 proveniente de cada individuo F2 es recogida aleatoriamente y agrupada


para constituir la generacin F3. Las semillas F3 agrupadas son sembradas y una semilla F4
de cada individuo F3 se cosecha a la maduracin.

Este procedimiento es repetido hasta la generacin F5, en la cual se seleccionan plantas


individuales, que son sometidas a la prueba de progenie. Las progenies F5:6 que se
muestran uniformes y superiores son cosechadas individualmente en bulk y evaluadas en
ensayos preliminares de rendimiento. Luego de esta etapa el procedimiento es comn a los
otros mtodos de mejoramiento (Figura 2.16).

Ventajas

Provee mxima variancia gentica entre lneas de la poblacin final.

Se llega rpidamente al nivel deseado de homocigosis.

Fcil conduccin.

No exige registro de genealoga.

65
Puede ser conducida fuera de la regin de adaptacin.

Requiere poca demanda de mano de obra.

Desventajas

Presenta poca oportunidad de seleccin en generaciones tempranas.

No se beneficia de la seleccin natural cuando sta es favorable.

F2 SSD

F3
SSD

F4 SSD
44

F5 SSD

F6 Surco/planta

F7 EPR

EIR
F8
EAR

Fuente: Modificado de Seilleur.86

Figura 2.16. Esquema del Mtodo Single Seed Descent (SSD).

66
3.4.2. Modificaciones del mtodo Single Seed Descent (SSD)

Descendencia de una sola vaina o Single Pod Descent (SPD)

Fue implementada por mejoradores de leguminosas que percibieron un exceso en mano de


obra y el tiempo innecesario que el SSD acarrea al cosechar una vaina por planta en las
generaciones segregantes y la necesidad de separar luego una sola semilla de cada una de
esas vainas.

En el caso de la soya, en que la mayora de las vainas poseen dos a tres semillas, la
utilizacin de estas vainas resultara en economa de tiempo y mano de obra, adems de
asegurar el mantenimiento del tamao de la poblacin, lo que no pasa con SSD al no
germinar algunas semillas. El mtodo SSD es menos utilizado para la formacin de lneas
en diversos programas de mejoramiento de soya, utilizando en parte el mtodo SPD.

Con el uso de SPD, muchas de las lneas de la poblacin final corresponden a una
misma planta F2. Esta caracterstica resulta con menor variabilidad gentica en la
poblacin final.11

Descripcin del Mtodo:

Una vaina de cada planta F2 es cosechada para constituir la generacin F3. Las vainas
cosechadas son agrupadas y trilladas en conjunto, las que son utilizadas para la siembra de
la generacin F3.

El procedimiento es repetido hasta que se alcance un nivel de homocigosis satisfactorio.


A partir de entonces, este mtodo se usa como SSD.

Tambin se puede cosechar las vainas y dividir las semillas en dos partes, una de ellas
para ser sembrada en la generacin siguiente y otra debe ser conservada como reserva para
eventualidades de prdida por factores climticos u otros. La cosecha puede ser vainas con
dos o tres semillas, pero pensando en mantener siempre un mismo nivel de poblacin.

Mtodo de descendencia de una sola semilla con siembra en golpes

En este mtodo se cosecha una vaina de cada planta en la F2 para constituir la generacin
F3. Estas semillas de cada vaina cosechadas en F2 son sembradas juntas en golpes
individuales. Luego de la germinacin, se hace el desahije, dejando una planta por golpe.
Este procedimiento es repetido hasta llegar a una homocigosis deseable, garantizando que
cada planta F2 tendr una descendencia en la poblacin final.

Este mtodo requiere de ms mano de obra para su ejecucin, se prefiere para realizar
estudios de estimacin de componentes de variacin gentica. A continuacin en la Tabla
2.11 se presenta un resumen comparativo de los tres ltimos mtodos de mejoramiento.

67
Tabla 2.11. Esquema del proceso de aplicacin de tres mtodos de formacin de lneas
a partir de una generacin F2 en un cereal.

Poblacin base F2 (alrededor de 2000 plantas)


Mtodo de Seleccin Mtodo
SSD
Genealgica Bulk

Seleccin de 300 a 500 Cosecha de 1 a 2 granos de Cosecha del total de plantas


espigas en F2 cada planta F2. F2, clasificacin segn
aspecto del grano.

Familias F3 Poblacin F3 Poblacin F3


Seleccin por resistencia a Cosecha de 1 a 2 granos de Cosecha total.
enfermedades y contenido de cada planta. Clasificacin por aspecto de
protenas del grano. grano.

Familias F4 Poblacin F4 Poblacin F4


(en viveros y en ensayos de Cosecha de 1 a 2 granos de Cosecha total.
20 a 50 familias) cada planta. Clsificacin por aspecto de
Seleccin por resistencia a grano.
enfermedades, ensayos de
rendimiento y el contenido de
protenas de grano.

Familias F5 (10 a 30 ) Poblacin F5 Poblacin F5


En viveros y en ensayos. Seleccin de espigas (inoculacin artificial)
Seleccin: igual que F4. Seleccin de espigas.

Familias F6 (6 a 15 ) Familias F6 (500 a 900 Familias F6 (500 a 900)


En viveros y en ensayos. plantas) Igual que el mtodo SSD
Seleccin: igual que F4. Seleccin por resistencia a
enfermedades y contenido de
protenas.

Familias F7 (5 a 12 ) Familias F7 (20 a 40) Familias F7 (20 a 30)


En viveros y en ensayos. En viveros y en ensayos. Igual que F6
Seleccin: igual que F4. Seleccin por rendimiento,
resistencia a enfermedades y
contenido de protenas.

Familias F8 (4 a 8 ) Familias F8 (10 a 20) Familias F8 (10 a 20)

3.5. Prueba de generacin precoz

3.5.1. Descripcin del mtodo

Propuesto por Immer,54 como metodologa para identificar progenitores de valor para
cruzamientos y en cada uno de ellos, seleccionar lneas con mayor potencialidad para

68
rendimiento de granos en generaciones avanzadas. Tambin, con esta prueba se procura
aumentar el porcentaje de lneas con alto rendimiento en generaciones precoces, que sern
sometidas a pruebas extensivas en generaciones ms avanzadas. Con la identificacin de
cruzas y familias menos promisorias, que son descartadas, el mejorador puede concentrar
recursos en la evaluacin del material remanente, aumentando la eficiencia de su
programa. La prueba de generacin precoz puede ser utilizada en poblaciones conducidas
con el mtodo genealgico o con el mtodo de poblaciones (Figura 2.17).

En 1978, Fehr sugiri el uso de generacin precoz en linajes F2 : 4 para produccin de


granos. El proceso es el siguiente:

AxB

xxxxxxx Autofecundacin
F1 xxxxxxx
xxxxxxx

F2 x x x ..x x x x Siembra y cosecha individual


x x x ..x x x x
x x x . x x x x

Semillas F3 de cada planta F2 seleccionadas son


F2:3 sembradas en lneas separadas. Se descartan lneas con
caractersticas agronmicas ntidamente inferiores.

Las semillas F2:4 de las lneas F2:3 remanentes se cosechan y


F2:4 son sembradas en ensayos de rendimiento con repeticiones.
Las lneas F2:4 identificadas como superiores se siembran
separadamente en la generacin F5. Prueba de rendimiento.

A la madurez, se seleccionan individualmente plantas F5 para


F2:5 constituir la generacin F6. Seleccin de Plantas.

Las lneas se siembran en surcos. Aquellas lneas que se


F5:6 muestran uniformes son cosechadas en bulk y son sometidas
a EPR. Prueba de progenie.

F5:7
EPR

RI R II

Figura. 2.17. Prueba de Generacin Precoz utilizando lineas F2:4.

69
3.5.2. Modificacin de la prueba de generacin precoz propuesta por Cregan y Bush

Cregan & Bush28, realizaron en trigo la prueba de generacin precoz asociado al mtodo de
poblaciones para predecir el potencial de diferentes cruzas. Entre varias opciones de
pruebas de seleccin en generacin precoz, determinaron que la evalucin de los bulks F2 y
F3 provee informacin satisfactoria para la prediccin de poblaciones con linajes
superiores en generaciones avanzadas. La metodologa es la siguiente (Figura 2.18).

AxB CxD Diversas cruzas entre progenitores


seleccionados. Cada cruza es conducida
separadamente.
F1 F1
Cultivadas espaciadamente para obtener
poblaciones F2 suficientemente grandes.

Prueba en Bulk F2. Las poblaciones


F2 segregantes F2 de todas las cruzas son
evaluadas en un ensayo comparativo de
rendimiento. A la madurez cada
poblacin F2 es cosechada
separadamente en bulk y evaluadas en
F3 con las dems.
.

F3

Prueba en Bulk F3. Tomando como base


el comportamiento medio de cada
poblacin, esto es bulk F2 y bulk F3, se
identifican las ms promisorias.

F4

Proseguir con las poblaciones superiores


hasta conseguir un nivel satisfactorio de
homocigosis, hasta que luego son
extradas las lneas para evaluacin en
EPR
.. .

Figura 2.18. Modificacin de la prueba de generacin precoz utilizando bulks F2 y F3 segn


Cregan y Bush.28

70
Dada la poca disponibilidad de semillas en las generaciones precoces, como en la F 2, los
ensayos comparativos en bulks generalmente se restringen a evaluaciones en una localidad
y se reduce el nmero de repeticiones, comprometindose as su eficacia. Oliveira69 cita
diversos ejemplos del uso de seleccin en generaciones precoces. A pesar de que muchos
autores han obtenido resultados positivos con este mtodo, la literatura menciona diversos
resultados desalentadores.

En cuanto a caracteres de baja heredabilidad, las pruebas comparativas en generaciones


precoces pueden ser poco informativas. Las posibles causas de los resultados
contradictorios encontrados en la literatura pueden ser enumeradas como sigue:

El efecto de la dominancia en generaciones precoces, dificulta la identificacin de


lneas superiores.

Los diferentes tipos de interaccin entre plantas en las poblaciones heterogneas


pueden ser de naturaleza complementaria, antagonstica o sinergstica.

Diversidad gentica de las poblaciones en varios estudios.

Interaccin genotipo x ambiente.

Evaluacin inadecuada de las poblaciones en pruebas precoces.

Ventajas de la prueba de generacin precoz

Descarte de cruzamientos o lneas inferiores en generaciones precoces, permitiendo


la concentracin de recursos en la conduccin de genotipos ms promisorios.

Desventajas de la prueba de generacin precoz

Compromiso de uso de recursos para evaluar poblaciones en generaciones con


limitada garanta de eficiencia de procedimiento.

Limitacin del nmero de generaciones que pueden ser avanzadas por ao,
representando retraso en la formacin de lneas homocigticas.

Poca eficiencia en caso de caractersticas con baja heredabilidad.

3.6. Produccion de dobles haploides o di-haploides

Los mtodos tradicionales para el mejoramiento vegetal han sido practicados por cientos
de aos. Actualmente se ha llegado a una etapa en donde estos mtodos son insuficientes
para hacer frente a las demandas mundiales de variedades. Los objetivos de mejoramiento
a largo plazo no podrn ser alcanzados a menos que se genere mucha variabilidad gentica
que pueda ser utilizada con estos fines y que existan metodos que acorten el tiempo
necesario para la obtencin de variedades.

71
El advenimiento de las tcnicas biotecnolgicas y los avances en biologa molecular
han permitido el desarrollo de nuevas herramientas de gran utilidad en el mejoramiento
vegetal. Entre stas, la produccin de haploides y doblehaploides es una herramienta
interesante ya que permite acortar el tiempo requerido para la obtencin de nuevas
variedades, siendo un buen complemento para los programas de mejoramiento
tradicionales (Figura 2.19).

Las poblaciones haploides o doblehaploides (DH) carecen de genotipos heterocigotas y


sirven para encontrar genotipos raros, especialmente en el caso de caracteres recesivos, ya
que estos no quedan enmascarados por los alelos dominantes. Estas poblaciones presentan
mayor variacin gentica aditiva y ausencia de variancia gentica debida a la dominancia,
si se las compara con poblaciones segregantes. Es decir que se eliminan las complejidades
del estado heterocigoto y se facilita enormemente el anlisis gentico. De esta manera
pueden distinguirse las mutaciones recesivas de forma inmediata, haciendo que el proceso
de seleccin sobre una poblacin de haploides resulte ms eficiente (Figura 2.20).

Mtodo Cruza Autofecundacin Evaluacin Pruebas de Incremento


Convencional inicial agronmica certificacin de semilla
F1 F2 F3 F4 F5 F6 F7 F8 varios aos
y
localidades
Tiempo (aos) 1 2 3 4 5 6 7 8 9-10 11-12 13

Mtodo Cruza Produccin Evaluciones Pruebas de Incremento


que incluye la inicial de agronmicas certificacin de semilla
haploidia (F1) haploides varios aos
y
localidades
Tiempo (aos) 1 2 3-4 5-6 7

Figura 2.19. Comparacin de un programa convencional de mejoramiento con el uso


de la produccin de haploides.

La produccin de haploides es una alternativa biotecnolgica de gran importancia y ha


resultado exitosa en varios cultivos, entre ellos cebada, arroz y trigo. Un sistema de
produccin de DH debe cumplir con tres requisitos bsicos para su utilizacin en
programas de mejoramiento:

- Debe producir lneas DH eficientemente a partir de todos los genotipos.

- Los DH obtenidos deben ser normales y estables.

- Estos deberan representar una muestra al azar del conjunto de gametos parentales.

72
AAbb x aaBB Generacin parental

Ab a Gametos
B

AaBb Generacin F1

Hibrido intervarietal

A A a a Gametos F1
B b B b

Autofecundacin Cultivo de anteras

Gametos despus del cultivo de


Genotipos posibles despus de un ciclo anteras: Plantas haploides
de autofecundacion de la F1: AB Ab aB ab
AB 1/4 Ab 1/4 aB 1/4 ab 1/4
AB 1/4 AABB AABb AaBB AaBb Duplicacin con colchicina
Plantas doblehaploides
Ab 1/4 AABb AAbb AabB Aabb
AABB AAbb aaBB aabb
aB 1/4 AaBb AaBb aaBB aaBb
ab 1/4 AaBb Aabb aaBb aabb
* La probabilidad de ocurrencia de los recuadros
internos es de 1/16 (1/4x1/4)

Figura 2.20. Ventajas del uso de haploides en el mejoramiento cuando los cultivares
parentales difieren, tericamente, en dos pares de genes. Si el genotipo buscado es, por
ejemplo, el doble recesivo aabb, se tiene por autofecundacion convencional, una probalidad
de 1/16 de encontrarlo. Si se induce haploida, el mismo genotipo tendr una probabilidad de
ocurrencia de 1/4 porque no se producirn los genotipos heterocigotos.

Hechas las cruzas, la progenie F1 se cultiva en el campo como en los mtodos


anteriores. Las anteras de las plantas F1 se cultivan in vitro y el nmero de cromosomas de
las plantas haploides se duplican con colchicina para producir dobles haploides. Las
progenies de las plantas dobles-haploides son evaluadas en el campo en generaciones F3 y
en F4 y las lneas superiores son evaluadas en pruebas de rendimiento en generaciones F 5 a
F6 (Figura 2.21). Los individuos haploides son portadores de una nica copia de
cromosoma caracterstico de la especie y presentan un contenido somtico o nmero n de
cromosomas tpicos de los gametos del organismo. Estos individuos haploides no tienen
aplicacin directa en el mejoramiento y pueden ser integrados en los programas de
mejoramiento de variedades si tuvieran sus cromosomas duplicados.

Los individuos haploides con el nmero de cromosomas duplicados son denominados


tambin dihaploides y son distintos de los diploides en cuanto a la pureza gentica. Los
dihaploides son completamente homocigticos a diferencia de los diploides que presentan
variados grados de heterocigosis. Las tcnicas ms tiles para la seleccin de haploides
incluyen, la identificacin y diploidizacin de haploides que ocurren naturalmente, la

73
hibridacin interespecfica seguida de la eliminacin de los cromosomas de las especies
nativas y el cultivo de polen y antera.

Variedad A x Variedad B

F1

F2 Dobles cromosomas
con colchicina Doble
Haploides Haploides

F3 Planta/surco

F4 Planta/surco

Ensayo preliminar
de rendimiento
F5

Pruebas de
rendimiento

Fuente: Borem.11
Figura 2.21. Mtodo de seleccin de dobles haploides.

74
Haploide (n)
Individuo con un solo juego de cromosomas.
Las plantas pueden crecer normalmente pero no forman semilla.
En su aspecto fsico generalmente son menos vigorosos y de menor tamao.

Doble Haploides (DH) o Dihaploides (2n)


Individuo con dos juegos de cromosomas idnticos, porque provienen de uno de los
progenitores que se ha duplicado.
Las plantas desarrollan normalmente y forman semilla.
Individuos completamente homocigotas.

Diploide (2n)
Individuo con dos juegos de cromosomas.
Individuos heterocigotas.

3.6.1. Caractersticas de los haploides

Los doble haploides producidos en una generacin tendrn un nivel ms alto de


homocigosis que las lneas autofecundadas desarrolladas por un nmero limitado de
generaciones de autofecundacin.
Las mutaciones son tiles en plantas haploides. Una mutacin recesiva ser observada
inmediatamente as como todo loci que est en la condicin de homocigoto (slo un
alelo por locus), y puede ser identificado desde el fenotipo.
La seleccin por alelos dominantes es facilitado en los haploides, los alelos recesivos
correspondientes en el haploide no se manifiestan si el locus en cuestin est ya
ocupado por el alelo dominante.
La segregacin gentica puede ser menos compleja en los polihaploides.
Los haploides son tiles en estudios citogenticos de poliploides ya que proveen el
material gentico del cual puede derivarse una serie monosmica.
Los polihaploides pueden ser utilizados para transferir genes del poliploide a una
especie diploide relacionada.
En especies con alelos autocompatibles en el cual la autopolinizacin es restringida,
los doblehaploides son una alternativa para la produccin de poblaciones
completamente homocigotas.

Entre las aplicaciones ms importantes de los doblehaploides en el mejoramiento vegetal


se tiene el acortamiento de los programas de mejoramiento. El desarrollo de nuevos
cultivares con los mtodos tradicionales actuales comprende tres etapas fundamentales:

1. Generacin de variabilidad gentica, ya sea por medio de hibridaciones sexuales intra e


interespecfica, por induccin de mutaciones, o por transformacin gentica.
2. Recuperacin de progenies homocigotos a travs de generaciones repetidas de
autofecundacin o retrocruzamiento, seleccionando a favor los caracteres de inters.
3. Evaluacin del comportamiento de los nuevos materiales en ensayos comparativos de
campo.

75
Estos pasos son bsicos en un programa de mejoramiento, pudiendo existir otras etapas en
funcin del modo reproductivo de la especie. As, por ejemplo, el tiempo requerido para la
obtencin de un nuevo cultivar de trigo de ciclo invernal, a travs del mejoramiento
tradicional es de aproximadamente diez aos. La biotecnologa se presenta como una
alternativa atractiva no slo para reducir el tiempo de obtencin de los genotipos deseados,
sino tambin para lograr una economa de mano de obra y espacio en el campo
experimental.

En las plantas autgamas, con los mtodos convencionales de mejoramiento, la


homocigosis prcticamente se logra recin luego de seis a ocho generaciones de
autofecundacin, mientras que con una tcnica de produccin de haploides, seguida de
duplicacin cromosmica, es posible llegar a homocigosis completa en una generacin.

En las plantas algamas, la produccin de homocigotos resulta de gran importancia. Al


trabajar con especies de polinizacin cruzada se favorece naturalmente la heterocigosidad
y de ser posible la autofecundacion, la obtencin de homocigotos se ve dificultada por la
endogamia.

En plantas bulbosas, rboles frutales y forestales, la homocigosis juega un rol muy


importante en el aceleramiento de los programas de mejoramiento. Debido al prolongado
tiempo requerido para alcanzar la fase adulta, el proceso de mejoramiento resulta
extremadamente largo, aun siendo posible la autopolinizacin.

Generacin de poblaciones para el mapeo gentico

Diversos tipos de poblaciones pueden ser utilizadas para el mapeo gentico de plantas. La
eleccin del tipo de poblacin se realiza en funcin de los objetivos de la investigacin y
del tiempo y recursos disponibles. Las poblaciones de mapeo con el mayor contenido de
informacin son aquellas obtenidas a partir del cruzamiento entre dos individuos
homocigotos contrastantes. En las plantas F1 obtenidas, el desequilibrio de ligamento es
mximo y las poblaciones derivadas a partir de estas plantas F1 procuran explotar este
desequilibrio. Para especies de autofecundacin o que toleran la autofecundacin pueden
utilizarse poblaciones F2, F3, ... Fn. Tambin pueden usarse los RILs (Recombinant
Imbreed Lines), derivadas de retrocruzas y doblehaploides. Las poblaciones de
doblehaploides representan la variabilidad gentica entre los progenitores luego de
ocurrida una meiosis (F1), y son especialmente indicadas cuando se realizan estudios con
QTL (Quantitative Trait Loci), ya que al obtenerse genotipos 100 % homocigotos se
dispone de poblaciones estables o inmortales de mapeo. Esto permite analizar la misma
poblacin en diferentes aos y localidades debido a la constante disponibilidad de semilla,
obtenindose estimaciones ms precisas de los parmetros de los caracteres cuantitativos a
ser mapeados.

Estudio de especies poliploides

La induccin de haploides en plantas poliploides facilita el trabajo de investigacin y


mejoramiento, ya que permite manejar niveles de ploidia menores para los estudios de
herencia y la combinancin de caracteres de inters.

76
Fusin de protoplastos

Al fusionar dos protoplastos haploides se origina un diploide que puede duplicarse y llevar
a la obtencin de un hbrido interespecfico o intergenrico, siendo eso una ventaja
importante cuando se trabaja en hibridacin somtica.

Variacin gametoclonal

La andrognesis in vitro provee un excelente sistema para analizar a nivel esporoftico, la


variacin debida a recombinacin y segregacin meitica. Las variantes gametoclonales
expresan el carcter recesivo a diferencia de las somaclonales, que requieren de
autofecundacin y anlisis de progenie. Algunos logros de esta tcnica:

- Frutos de tomates con mayor contenido de slidos.


- Plantas enanas de arroz con granos ms largos y con elevados niveles de protenas
de reserva y mayor macollaje.
- Plantas de Datura innoxia con contenidos ms elevados de alcaloides en las hojas.
- Plantas de tabaco con mayor resistencia a bajas temperaturas.
- Plantas de Brassica napus con mayor contenido de aceite del cido ercico en las
hojas. Este aceite se usa como lubricante en la industria.

Mutagnesis

Si se aplica mutagnesis a un sistema de haploides, se obtienen mutantes slidos,


logrndose la homocigosis rpidamente luego de la duplicacin con colchicina. Entre los
agentes mutagnicos ms frecuentemente utilizados se encuentran la N-metil-N-nitrosurea
(20 mM), los rayos X (0.5 krad), los rayos gamma y el etil metil sulfonato.

Trasformacin gentica

Rige el mismo principio que para la mutagnesis. La transformacin de haploides permite


la obtencin del transgen en homocigosis luego de la duplicacin con colchicina. Puede
realizarse con PEG, microinyeccin o utilizando Agrobacterium tumefaciens.

Produccin de plantas homogamticas

Asparagus officinalis es una especie cultivada, dioca, en la cual las plantas femeninas son
XX y las masculinas son XY. De esta manera, para obtener una poblacin de plantas deben
cruzarse ambos tipos, lo que dar una progenie constituda por 50 % de plantas XX y 50 %
de plantas XY. Sin embargo, desde el punto de vista del productor, es deseable la
obtencin de una poblacin constituda solamente por plantas XY, que tienen un menor
contenido de fibra y son por lo tanto, preferidas por los consumidores.

Para solucionar este problema y obtener 100 % de plantas masculinas se usa un sistema
que consiste en el cultivo de anteras y diploidizacin de plantas YY, llamadas
supermachos. La ventaja de estas plantas es que al ser cruzadas con plantas XX darn 100
% de plantas XY, como se muestra en este esquema.

77
Con este sistema, en 1990 fue liberada una variedad de esprrago llamada Andrea (es
un hbrido obtenido como se mencionara anteriormente). Andrea es una variedad muy
homognea, de alto rendimiento y de excelente calidad.

Progenitor masculino
XY

X Formacin de gametos
Y

X Y Cultivo de anteras: Plantas haploides

Duplicacin
YY Cromosmica: Hembra y supermacho
XX

X Y Formacin de
gametos

XY
Hibrido

3.6.2. Obtencin de haploides

Como se mencionara anteriormente, las plantas haploides aparecen en muy baja frecuencia
en la naturaleza, siendo necesaria la posterior ocurrencia de duplicacin cromosmica para
la obtencin de semillas. Por ello, la produccin artificial de haploides resulta siempre
efectiva.

Origen de los haploides

I. Ginogensis: Desarrollo de un gameto no fecundado. Esto se logra mediante:

1. Castracin y aislamiento de las flores. Por este tratamiento se han obtenido haploides de
Triticum monococcum.

2. Polinizacin retrazada. La castracin de las flores y la posterior polinizacin en el lmite


de la madurez receptiva del estigma permiten obtener hasta un 30 % de haploides en trigo.

3. Polinizacin con polen inviable:

a) Utilizando polen extrao (tpico de cruzamientos interespecfico), incapaz de fecundar a


la especie en cuestin, puede servir de estmulo para inducir haploida, como sucede en el
cruzamiento entre Solanum tuberosum x S. phureja (papa silvestre). El polen de la papa
silvestre contiene slo un ncleo generativo, producto de una gametognesis anormal, por

78
lo cual la fertilizacin doble no logra producirse, pero se forman embriones haploides por
gametognesis.

b) Utilizando polen previamente irradiado.

4. Cultivo de ovarios

Esta tcnica puede ser eficaz para obtener haploides a partir de cruzamientos
interespecficos.

II. Andrognesis

Desarrollo de un gameto

1) Cultivo de anteras: se ha inducido haploida en mono y dicotiledoneas, siendo ms


fcil en las ltimas. Es una tcnica simple que, dependiendo del genotipo y de las
condiciones de cultivo, permite obtener elevado nmero de plantas en un tiempo
relativamente corto. Ha sido ms difcil en los cereales; no obstante ello, se obtuvieron
haploides de arroz, trigo, cebada con diferentes grados de dificultad.

2) Cultivo de microsporas: en 1974, Nitsch68 indujo la regeneracin de plantas haploides


masivamente (ms de 7000 plantas por botn floral en tabaco), lo que permiti la
aplicacin de diferentes tratamientos a las microsporas, como transformacin o
mutagnesis para luego obtener plantas por embriognesis partiendo de una nica clula
inicial. Para conseguir diferenciar plantas a partir de microsporas es necesario quebrar el
mecansmo responsable de la asimetra en la primera mitosis del polen.

III. A partir de alguna clula haploide del saco embrionario distinta del gameto femenino
(sinrgias o antpodas).

IV. Cruzamientos interespecficos o intergenricos con eliminacin cromosmica.

Se produce la fertilizacin de manera que se forma un cigoto diploide, que a lo largo de las
sucesivas divisiones mitticas, va perdiendo el genoma del individuo que aport el gameto
masculino, como sucede en los cruzamientos entre Hordeum vulgare y H. bulbosum.

V. Interaccin ncleo-citoplasma

Utilizando lneas de sustitucin y restauracin nuclear se encontr que los individuos con
citoplasma de Aegilops caudata y ncleo de Triticum aestivum o triticale mostraban una
frecuencia de haploida de 3,1 % y de 52,9 % respectivamente. Esto se debe a que ciertas
interacciones entre un citoplasma y un ncleo extrao inducen haploida.

VI. Semigamia

El ncleo del gameto masculino penetra en la ovoclula pero sin fusionarse con el ncleo
femenino. Ambos ncleos comienzan a dividirse independientemente, produciendo un
individuo haploide con tejidos de origen materno y paterno.

79
3.3.3. Mtodos ms utilizados para la obtencin de plantas haploides

Entre los mtodos disponibles actualmente para la obtencin de doblehaploides, los ms


utilizados son la hibridacin interespecfica e intergenrica y la andrognesis.

Cultivo de anteras: Consiste en el cultivo de anteras inmaduras en un medio de induccin,


donde las microsporas competentes originarn callos, que sern luego transferidos a un
medio apropiado para la regeneracin de plantas. En algunas especies de dicotiledoneas el
nmero de plantas obtenidas por cada cien anteras cultivadas es muy elevado. En cambio
en las gramneas la tcnica no ha sido tan exitosa. Sin embargo, los progresos en los
mtodos de cultino in vitro durante las ltimas dcadas han permitido obtener buenos
resultados con gramneas, an en aquellas consideradas recalcitrantes. La capacidad de
respuesta al cultivo de anteras, denominada capacidad andrognica, puede ser evaluada a
travs de la produccin de callos y de plantas verdes, y su eficiencia es altamente
dependiente de:

a) El genotipo: Es quizs el factor ms importante que afecta al cultivo de anteras. En la


naturaleza, la haploida es controlada por el gen hap, llamado gen inhibidor de la haploida.
Existe suficiente evidencia que sugiere que la andrognesis in vitro tambien est bajo
control gnico y que este caracter puede ser transferido desde clones con alta respuesta a
otros no respondedores. Se ha hallado variabilidad en la respuesta entre especies y aun
dentro de ellas. En cebada y trigo los caracteres de induccin de callos y regeneracin de
plantas son altamente heredables, y ha sido sugerido que ambos caracteres estaran
controlados por muchos genes. Por lo tanto, el mejoramiento de la capacidad andrognica
no parece difcil, siendo la identificacin de genotipo con gran capacidad de respuesta un
paso indispensable para su incorporacin en los bloques de cruzamiento.

b) El porcentaje de albinismo: La ocurrencia de plantas albinas representa un serio


problema para la aplicacin del cultivo de anteras en programas de mejoramiento de
cereales. La incidencia depende no slo de la especie sino tambien de la variedad, citando
valores de 50, 70 y 100 % para tres variedades diferentes de arroz.97

Bernard9 ha sugerido que las altas temperaturas incrementan la diferencia entre la


velocidad de replicacin del material nuclear y el de los organelos, resultando en un
desarrollo retardado o incompleto de los plastidios, lo cual conducira a la produccin de
fenotipos albinos. De acuerdo con este autor, el desarrollo de un sistema fotosinttico
funcional es promovido por el tratamiento con bajas temperaturas, aunque no siempre un
pretratamiento con fro reduce la incidencia de albinismo.

c) Las condiciones de crecimiento de las plantas donantes: La edad y las condiciones


ambientales en que crecen las plantas afectan considerablemente la capacidad andrognica
de las mismas. Los factores ambientales ms crticos son el fotoperodo, la intensidad de
luz, la temperatura, la nutricin y la concentracin de CO2. Estos factores incidiran en la
capacidad de producir las divisiones celulares morfognicas que conducen al desarrollo de
embrioides y la regeneracin de plantas. Este ltimo paso es crtico dentro de todo el
proceso, es altamente dependiente de la calidad del callo y est asociado fuertemente a
toda la historia previa del cultivo. En general, se ha informado que la utilizacin de anteras
de las primeras floraciones favorece la respuesta andrognica, mientras que las colectadas
al final de la estacin muestran una menor respuesta al cultivo, generando una menor

80
cantidad de embrioides. En Brassica napus, el crecimiento de las plantas a bajas
temperaturas mejora la produccin de embrioides obtenidos a partir de anteras.

d) El estado de desarrollo de las microsporas: En la fase gametoftica de las plantas, que


comienza luego de la meiosis, las microsporas sufren inicialmente una divisin mittica
asimtrica que da origen a dos clulas de distintos tamaos: la generativa, ms pequea y
con un ncleo altamente condensado; y la vegetativa, ms grande y con un ncleo difuso.
En las gramneas, el ncleo generativo se divide nuevamente originando dos ncleos
espermticos. Uno generar el endosperma triploide al fusionarse con los dos ncleos
polares del saco embrionario, mientras que el segundo fertilizar a la oosfera produciendo
el cigoto diploide, que constituir el primer paso de la nueva fase esporoftica. Los
embrioides haploides se originan in vitro a partir de una de las vas que se enunciarn a
continuacin. Cuando la primera division mittica de la microspora es asimtrica, los
haploides se originan por repetidas divisiones de la clula vegetativa, de la generativa o de
ambas. Cuando la primera divisin mittica es simtrica, ambas clulas resultantes
contribuyen al desarrollo del haploide. Por lo tanto, una clula gamtica masculina puede
revertir su desarrollo gametoftico hacia el grano de polen y dar origen directamente a un
nuevo individuo.

En general, las microsporas que se encuentran en la primera divisin mittica son las
que mejor responden. Esto vara levemente con la especie vegetal, pero esta reversin no
es posible luego de iniciada la dispersin del almidn. El estadio ms apropiado para los
cereales es el de microspora uninucleada media y tarda.

e) Los pretratamientos: Distintos tipos de estreses aplicados durante el estado adecuado


pueden enmascarar el programa gametoftico e inducir la expresin de genes especficos
del desarrollo esporoftico. Si bien las bajas temperaturas son consideradas como el mejor
pretratamiento, tambien otros factores pueden estimular la andrognesis, como el calor, el
choque osmtico, la centrifugacin de las anteras o hasta una incisin en la parte superior
de la inflorescencia donante. Tambin se citan la poda, la pulverizacin con eter, la
irradiacin, la reduccin en la presin atmosfrica, la anaerobiosis, el tratamiento en una
atmsfera saturada de agua y la aplicacin de gametocidas. Las bajas temperaturas
aplicadas sobre la planta madre, sobre las yemas florales jvenes o sobre las anteras,
generalmente estimulan la embriognesis. El fro estimula la divisin mittica simtrica de
las microsporas. Esto se debera a una alteracin en la orientacin del huso que conducira
a una primera mitosis anormal del grano de polen. Por otra parte, se ha mencionado que las
bajas temperaturas retardan el envejecimiento de la pared de la antera, lo cual aumentara
la supervivencia y la viabilidad del polen. En general, las temperaturas citadas varan entre
2 a 10 C y la duracin del tratamiento de 2 a 30 das. Es importante determinar la
temperatura adecuada para cada especie vegetal, aun para variedades dentro de la misma
especie.

En algunas especies, tales como Capsicum annum, avena y algunos genotipos de trigo
se ha logrado xito con un choque con altas temperaturas. Temperaturas de 30 a 35 C
durante los primeros cuatro das del cultivo ayudaron a inducir la andrognesis en varias
especies de gnero Brassica.

81
f) La composicin del medio de cultivo: Es otro de los factores importantes para el xito
en el cultivo de anteras. No existe una recomendacin general y las variaciones dependen
de la especie a cultivar.

Medios de induccin: Dos tipos de estrs, osmtico y nutricional, han sido


identificados como causas disparadoras de la induccin de embriognesis en las
microsporas de mono y dicotiledneas. En tabaco, el cultivo de las anteras en un medio
carente de sacarosa durante los primeros seis das de la etapa de induccin permite una
mxima respuesta andrognica. Los carbohidratos cumplen dos roles fundamentales en los
medios de induccin ya que actan como osmolito y como nutriente. Los agentes
gelificantes representan otro aspecto importante en la evolucin de los medios de
induccin. Tradicionalmente se utiliz agar como gelificante de los medios de cultivo,
debido a su disponibilidad y bajo costo. Pero en 1973 se detect una mejor respuesta
andrognica en tabaco cuando las anteras fueron cultivadas en un medio solidificado con
agar y suplemento con carbn activado. En medios lquidos la adicin de Ficoll (polmero
sinttico de sacarosa, inerte, no inico y de alto peso molecular) incrementa la tensin
superficial y la viscosidad del medio. De esta manera, las anteras y callos flotan sobre el
medio lquido y se desarrollan en condiciones aerbicas, permitiendo elevadas tasas de
embriognesis y de produccin de plantas verdes. En cuanto a los reguladores de
crecimiento, la mayora de los cereales requiere de la presencia de auxinas y de citocininas
en el medio de cultivo y las respuestas parecen depender de los niveles endgenos de tales
reguladores. Por ejemplo, para lograr la induccin en trigo es indispensable el uso de 2,4-D
(cido 2,4 diclorofenoxiactico) en concentraciones de 1,5 a 2 mg/L. Existen otras
sustancias que, adicionadas al medio de cultivo, ayudan en la estimulacin de la
andrognesis, como la glutamina y el inositol.

Tambin se citan otros compuestos inespecficos como extracto de papa, de camote, de


yuca, de trigo germinado y de endospermas de arroz y de maz. En ocasiones, si el medio
se suple con leche de coco, los granos de polen desarrollan directamente en embrioides.

Medios de regeneracin: La variedad de medios de regeneracion citada es menor


comparada con la de los medios de induccin. Los ms utilizados son modificaciones
derivados del medio MS, con concentraciones de carbohidratos similares a los utilizados
en los medios de cultivo de tejidos tradicionales (60 g/l de sacarosa), utilizando agar (0,6
%) como gelificante, auxinas menos poderosas, y un balance hormonal a favor de las
citocininas.

g) Las condiciones de incubacin: Las caractersticas ideales de cultivo son especficas


para cada especie, y aun para cada genotipo dentro de una misma especie. Estas afectan
particularmente la tasa de absorcin final de nutrientes y la regeneracin de plantas verdes.
La duracin e intensidad lumnica, la temperatura y la orientacin de las anteras sobre el
medio de cultivo pueden tener un efecto considerable en algunas especies.

Cultivo de microsporas: Comprende la obtencin de individuos haploides a partir de


microsporas aisladas. Las espigas son pretratadas y las microsporas liberadas son
colocadas en un medio de cultivo donde desarrollarn embriones haploides, que sern
luego transferidos a un medio de regeneracin para originar plntulas.

82
Este sistema es considerado el de mayor potencial para la produccin de
doblehaploides, debido a que induce a los miles de microsporas que contiene una flor a
dividirse y producir embriones. La ausencia de la pared de la antera podra mejorar la
nutricin y eliminar las restricciones fisicas para la andrognesis.

El cultivo de microsporas tiene ventaja de originar embriones de similar tamao y etapa


fisiolgica debido a que pueden separarse las microsporas de tamao semejantes por
centrifugacin diferencial. La optimizacin de los diferentes pasos crticos para el xito de
esta tcnica puede llevar a la obtencin de una alta cantidad de plantas verdes con menores
costos y esfuerzos. Entre los factores determinantes de la eficiencia del mtodo podemos
citar:

a. Genotipo: Se han citado cultivares de cebada y otros cultivos con alta respuesta al
cultivo de microsporas, en contraste con otros de menor respuesta.
b. Albinismo: Al igual que en el cultivo de anteras, el nmero de plantas albinas depende
del genotipo, y tambien se ve influenciado por la densidad de cultivo de las
microsporas.
c. Condiciones de crecimiento de la planta donadora: El mantenimiento de las plantas
en condiciones controladas de fotoperodo y temperatura es esencial y debe ser
ajustado en funcin de la especie. Se han citado resultados en cebada cuando las
plantas son cultivadas en ambientes libres de patgeno, con alta humedad relativa (60-
80 %), fotoperodo de 16 h de luz, y adecuado regimen de fertilizacin y riego.
Cuando las plantas crecen estresadas, sea por riego excesivo, sequa, enfermedades o
la aplicacin de algn plaguicida, la respuesta al cultivo de microspora es menor.
d. Estadio: Como se citara anteriormente para el cultivo de anteras, es imprescindible la
verificacin del estadio correcto para que conserven su capacidad andrognica.
e. Pretratamiento: Los pretratamientos ms utilizados consisten en el uso de fro, estrs
osmtico, presencia o ausencia de determinados nutrientes, etc. Se ha demostrado que
los nutrientes disponibles durante el pretratamiento constituyen un factor decisivo que
determina la calidad de los embriones originados.
f. Densidad de cultivo: La densidad de las microsporas en cultivo afecta el desarrollo de
las mismas y el nmero que entran en divisin. Existe una concentracin mnima para
el desarrollo de las microsporas, y una densidad ptima para una mayor regeneracin.
Las condiciones ms favorables deben ajustarse en cada caso y para cada genotipo en
particular.
g. Medio de cultivo: Se han estudiado diferentes concentraciones de azcares, distintas
fuentes de nitrgeno orgnico, y la adicin de diferentes auxinas al medio. En general
se sugiere la sustitucin de sacarosa por maltosa como fuente de carbohidratos, la
disminucin de la concentracin de nitrato de amonio, el agregado de glutamina, y el
empleo de APA (cido fenil actico) como auxina para favorecer la induccin.59
h. Medio de regeneracin: La composicin del medio de regeneracion puede afectar el
vigor y supervivencia de las plntulas. Kasha et al.,59 trabajando con cebada,
encontraron en este mtodo una manera eficiente de produccin de DH, con una mejor
respuesta y una menor dependencia del genotipo que en el caso del cultivo de anteras.
A esto se le suma la ventaja de contar con una elevada cantidad de microsporas
haploides en un estado fisiolgico uniforme, que constituyen excelentes blancos para
la mutagnesis, la seleccin y la transformacin.

83
i. Hibridacin interespecfica e intergenrica: En este caso los haploides se originan a
travs de la eliminacin del genoma del polinizador. El sistema de hibridacin de trigo
x Hordeum bulbosum, inicialmente descubierto y empleado con xito en cebada, ha
sido considerado superior al cultivo de anteras por tres razones, la produccin de
haploides es ms fcil, el tiempo requerido para la regeneracin de plantas parece ser
mayor y la eficiencia en la regeneracin de plantas parece ser mayor.

La gran limitante de este sistema lo constituye el hecho de que la mayora de los cultivares
de trigo no pueden cruzarse con H. Bulbosum debido a la presencia de los genes de
incompatibilidad, Kr1 y Kr2, y al desconocimiento del estado de estos genes en los
genotipos de trigo y de H. bulbosum involucrados en los cruzamientos, debido a que los
genotipos se seleccionan sobre la base de criterios agronmicos y no a un sistema de
compatibilidad de cruzamientos con H. bulbosum. Para sortear estos inconvenientes se ha
sugerido como alternativa realizar los cruzamientos, en el caso del trigo, utilizando maz
como polinizador. Luego de la fertilizacin del vulo de trigo por el polen de maz, durante
las primeras mitosis del cigoto, los cromosomas del maz, son eliminados. Esto se debe a la
incompatibilidad entre los cinetocoros de estos cromosomas y las fibras de los husos
acromticos que hace que en las primeras anafases los cromosomas de maz vayan
quedando rezagados en el citoplasma, donde finalmente son degradados. El resultado de
este proceso es un embrin haploide de trigo. Seguidamente, los embriones inmaduros
deben ser rescatados en un medio de cultivo apropiado. A travs de las cruzas con maz se
han obtenido haploides de trigo de cultivares tanto compatibles como incompatibles con H.
bulbosum, lo cual sugiere que el sistema de incompatibilidad no afecta al mtodo de trigo x
maz, por lo que sera menos dependiente del genotipo.

3.6.4. Duplicacin cromosmica

Despus de la duplicacin cromosmica, ya sea espontnea o inducida, se logra la


homocigosis y se restaura la fertilidad. La planta haploide, sin duplicar es estril por lo que
no podra producir semillas. Entre las tcnicas que han sido utilizadas para la duplicacin
de haploides cabe mencionar:

a) Duplicacin espontnea durante la etapa de callo o de rescate de embriones.

b) Regeneracion de plantas doblehaploides a partir de callos de mdula de plantas


haploides de tabaco.60

c) Sustancias qumicas: aunque se conocen casos mediante agentes qumicos tales


como acenafteno, hidrato de cloral, sulfanilamida, etc., la mayor eficacia se ha
logrado con colchicina y el xido nitroso.

La aplicacin del xido nitroso bajo presin (2-6 atmosferas) resulta de especial inters por
su fcil penetracin en los tejidos y la rpida desaparicin de los mismos tejidos cuando
cesa la presin. Puede utilizarse en flores recin polinizadas. La ventaja que presenta este
tratamiento es que, al poder ser aplicado durante la primera divisin mittica del vulo
fecundado, se ve reducida la aparicin de quimeras. Por otro lado, los residuos de este
agente resultan menos txicos para la planta que otros que se aplican en forma lquida,
aunque la frecuencia de aneuploides puede ser muy elevada.

84
La accin de la colchicina fue descubierta en 1937 y desde entonces ha pasado a ser
prcticamente el agente diploidizante ms importante. Esta droga acta impidiendo el
autoensamblaje de la tubulina, inhibiendo as la formacin de los microtubulos del huso y
en consecuencia la segregacin anafsica de las cromtidas. Afecta por lo tanto slo a las
clulas que se encuentran en divisin. Puede aplicarse a plntulas, plantas adultas, semillas,
microsporas y anteras.

El tratamiento puede realizarse utilizando una solucin acuosa donde se sumergen las
races, dejando fuera la parte area. Tambin se puede hacer llegar la solucin al interior de
la planta utilizando una jeringa con la dosis deseada (microinyeccin), o por absorcin de
la solucin a travs de los tallitos decapitados. Otra forma de hacerlo es tratar los callos
con colchicina antes de trasladarlos al medio de regeneracin. Este ltimo mtodo permite
la obtencin de gran nmero de doblehaploides, pero presenta la desventaja de que la
mayora de las plantas asi obtenidas son mosaicos cromosmicos. Otra alternativa, para
microspora y anteras, es la adicin del agente duplicador directamente en el medio de
induccin, antes de la primera mitosis. La diploidizacin en este momento requiere menos
tiempo y esfuerzo y ha sido utilizada en programas de mejoramiento de trigo, maz y arroz.

El problema de la suplementacin del medio de induccin con colchicina es que reduce


la embriognesis en trigo, si bien en Oriza sativa y Brassica la puede incrementar. La
duracin del tratamiento y la concentracin de la solucin varan para cada especie.

Cualquiera que sea el mtodo con que se duplique los cromosomas, ya sea en planta, en
macollo o solo en una yema floral, lo importante es lograr que las semillas que stas
produzcan sean viables.

3.6.5. Consideraciones finales

La eleccin de los progenitores y la seleccin son etapas decisivas en un programa de


mejoramiento, que se avanzar luego generacin tras generacin hacia una homocigosis
que permita entrar en las etapas de evaluacin. Ganar tiempo en estos casos puede
significar una reduccin de costos muy importante y una ms temprana entrada en el
mercado de la nueva variedad. En el caso de una especie autgama como el trigo es posible
ganar generaciones haciendo dos cosechas en un ao, especialmente en aquellos cultivares
de corto ciclo vegetativo. Esto, sin embargo, dificulta la observacin de algunas
caractersticas agronmicas importantes, que no pueden ser observadas en los genotipos en
esas condiciones, atentando contra una seleccin eficiente. Para los trigos de tipo invernal
y de clima neutro, con ligeros requerimientos de vernalizacin, esta ganancia de
generaciones no es posible o es difcil. La produccin de individuos doblehaploides que
puedan participar anticipadamente en la etapa de evaluacin agronmica se plantea como
una solucin promisoria a este problema, reduciendo los tiempos y presupuestos. Muchos
interrogantes sin embargo quedan an sin resolver, limitando la aplicacin extensiva de
esta tecnologa a algunos modernos programas de mejoramiento vegetal.

Algunas preguntas a las que debemos encontrar respuestas son: En qu generacin


segregante se aplica el mtodo de doblehaploides? Cul es el nmero de individuos
doblehaploides derivados de un cruzamiento representativo de la variabilidad gamtica
creada en la cruza, que permite un aprovechamiento integral, comparable al logrado con el
mtodo convencional de seleccin en campo? Cmo superar la escasa cantidad de semilla

85
producida? Es una tcnica alternativa o complementaria del mejoramiento tradicional?
La eficiencia en la produccin de doblehaploides justifica su alto costo dentro de un plan
de mejoramiento?. Las generaciones segregantes adecuadas para producir doblehaploides
son la F2 y F3, sin embargo, las anteras que se cultivan provienen de plantas F1 o F2 para
obtener la mxima diversidad gentica entre las plantas haploides recuperadas.

Si eligieramos individuos F3, que ya cuentan con un ao de seleccin en campo durante


la F2, generacin que ha mostrado la mayor variancia gentica entre los dos padres,
estaramos evitando producir un gran nmero de plantas doblehaploides que no sern
agronmicamente promisorias. No obstante, debemos considerar que seran necesarios
varios cientos de individuos doble haploides (DH) para que el proceso tenga posibilidades
de xito agronmico.

En general, la produccin de doblehaploides resulta en un gasto excesivo en


comparacin a los mtodos tradicionales de mejoramiento, por lo cual en la mayora de los
programas slo genotipos lite son sometidos a este sistema. Si bien el costo de produccin
de los DH depende directamente del mtodo elegido y la eficiencia lograda, la aplicacin
de esta metodologa al mejoramiento vegetal se vislumbra ms bien como una herramienta
complementaria al mejoramiento tradicional, que en ningun modo intentara reemplazarlo.

La mayora de los cereales y casi todas las leguminosas producen pocas plantas
haploides. Se presenta gran porcentaje de albinismo y alto costo del medio de cultivo.

En la tabla 2.12 se hace una recopilacin de las principales ventajas y desventajas de los
mtodos de mejoramiento en plantas autgamas hasta aqui tratados.

Tabla 2.12. Principales ventajas y desventajas de los mtodos de mejoramiento en


autogamas hasta doble haploides (DH).

Mtodo Ventajas Desventajas


- Eficaz para caractersticas de alta - Prdida de variabilidad de caractersticas
Seleccin heredabilidad. poco heredables (efecto del medio, efecto
genealgica - Eliminacin rpida de genotipos de la competencia).
indeseables. - Desvio debido a la heterocigosis.
- Permite un buen conocimiento del - Costo (en comparacin al progreso).
material. - Proceso bastante prolongado.
- Permite trabajar con objetivos bastante
especficos.
- Simple pero costoso. - Efecto de la seleccin natural (riesgo de
Bulk - Permite el estudio de un gran nmero de desvio si la aptitud a la competencia y el
cruzamientos. valor agronmico no estn ligados).
- Conservacin de la variabilidad. - El manejo de los ensayos requiere de
bastante espacio y personal.
- Buena conservacin de la variabilidad. - Riesgo de prdida de material gentico
SSD - Eficaz para las caractersticas poco - El manejo de los ensayos requiere
heredables. bastante espacio y personal.
- Aceleracin de las generaciones. - Costo elevado
- Ganancia de tiempo. - Reduccin de la eficiencia de la
Doble haploide - Eficaz para caracteres poco heredables. recombinacin.
(DH) - Alta taza de fijacin de caracteres. - El manejo de los ensayos requiere
bastante espacio y personal.
- Costo elevado.

86
3.7. Mejoramiento por retrocruzamiento (BACK CROSS)

Utilizacin. Cuando disponemos de una variedad excelente pero deficiente por un


carcter, el cual se debe mejorar.

Condiciones previas, se debe disponer de:

- Progenitores: variedad local de alto valor que se constituye en padre recurrente (R), y de
otra variedad con un carcter transferible, es el padre donante (D).
- Carcter genticamente transferible.

- Tiempo: el necesario para la realizacin de los back cross (B.C.).

Caractersticas del mtodo:

- Es el nico mtodo de resultados previsibles y reproducibles

- El objetivo del mejoramiento es limitado

Principio:

.
.

3) Seleccin para mantener el carcter en la descendencia.

3.7.1. Evolucin de poblaciones despus de retrocruzamientos sucesivos

1) Recuperacin de homocigosis del progenitor recurrente recesivo sin seleccin

Primer caso: 1 slo locus: A/a, A dominante absoluto

Donante D: AA
Recurrente R: aa

Etapas Progenitores Frecuencia de la


descendencia
Aa aa
Hibridacin AA x aa 1
B. C. 1 Aa x aa 0,5 0,5
B. C. 2 (0,5Aa + 0,5aa) x aa 0,25 0,75
B. C. 3 (0,25Aa + 0,75aa) x aa 0,125 0,875

87
La tasa de aa aumenta en cada Back Cross:

Ejemplos:

Luego de 3 B. C. n=3 23 1 = 7 = 0,875


8 8

Luego de 6 B.C. n=6 26 1 = 63 = 0,984375


64 64

Segundo caso: dos locus: A/a, B/b

Donante D: AABB
Recurrente R: aabb

Frecuencia de la descendencia
Etapas Progenitores
AaBb Aabb aaBb aabb

Hibridacin AABB x aabb 1


B. C. 1 AaBb x aabb 0,25 0,25 0,25 0,25
B. C. 2 0,25 AaBb x aa bb 0,0625 0,0625 0,0625 0,0625
0,25 Aabb x aabb 0,125 0,125
0,25 aaBb x aabb 0,125 0,125
0,25 aabb x aa bb 0,25
Total B.C.2 0,0625 0,1875 0,1875 0,5625
B. C. 3 0,0625 AaBb x aabb 0,015625 0,015625 0,015625 0,015625
0,1875 Aabb x aabb 0,09375 0,09375
0,1875 aaBb x aabb 0,09375 0,09375
0,5625 aabb x aabb 0,5625
Total B.C.3 0,015625 0,109375 0,109375 0,765625

Luego de n retrocruzamientos, la tasa de homocigosis recesiva aabb es:

k
2 n 1 n = Nmero de Back Cross
aabb n k = Nmero de loci
2
Ejemplo:

n=3

k=2 [ ] [ ] [ ]

2
2 6 1
2
63
n=6 6 0,9689941
k=2 2 64

88
En conclusin, se muestra que la tasa de homocigosis se eleva en proporcin igual a una
poblacin en autofecundacin (Figura 2.22).

Si k es grande, en
cada generacin de
segregacin tenemos
la obligacin de
seleccionar antes de
otro Back Cross

Figura 2.22. Resumen comparativo de la tasa de homocigosis de una poblacin en


autofecundacin con las retrocruzas.

2) Recuperacin de un carcter en transferencia (Ca)

A. Caso ms simple:

Transferencia de un slo carcter monognico T/t.

a) Si el carcter en transferencia (Ca) es dominante

Progenitor donante:

Progenitor recurrente:

Hibridacin:

B.C. 1 :

B.C. 2 :

89
Carcter transferido:

- Se conserva al estado heterocigoto (Tt) en cada generacin.


- Aparecer el estado homocigoto (TT) por autofecundacin.

b) Si el carcter en transferencia (Ca) es recesivo

Progenitor donante :

Progenitor recurrente:

Hibridacin :
B.C. 1 :
B.C. 2 : Todos con el carcter
( )
dominante

El carcter en transferencia est encubierto luego de los Back Cross sucesivos, como Tt:
todos tienen el fenotipo del carcter dominante. Sin embargo, se expresa el gen t si
hacemos la autofecundacin: 1TT 2Tt 1tt. (tt es el objetivo de la seleccin).

Dificultad
- Autofecundacin necesaria luego de cada Back Cross.
- La frecuencia de t en la P0 (Poblacin inicial) se reduce con el nmero de Back
Cross.

B. Casos complejos:

- Carcter a transferir es monognico pero muy influenciado por el ambiente.


- Carcter a transferir es polignico.
- Varios caracteres a transferir a la vez, en este caso se debe proceder como sigue:

Un programa por cada carcter


Cruzar entre ellos segn el resultado
Seleccionar por la asociacin de caracteres en el mismo genotipo

Eliminacin de genes ligados al gene en transferencia

Posibilidad:
Si los genes se expresan en el fenotipo es factible hacer seleccin por su aspecto
fenotpico, pero si son poligenes no hay la posibilidad de hacer seleccin fenotpica.

Ejemplo:

90
a) Si los genes T/t y B/b no son ligados la segregacin es independiente.

Cruzamiento Poblacin
TtBb Ttbb ttBb ttbb
Hibridacin TTBB x ttbb 1
B.C. 1 TtBb x ttbb 0,250 0,250 0,250 0,250 S*
B.C. 2 0,5TtBb x ttbb 0,125 0,125 0,125 0,125
0,5Ttbb x ttbb 0,250 0,250
0,125 0,375 0,125 0,375 S*
* Seleccin contra el genotipo tt

Se observa eliminacin parcial de B suprimiendo /tB/ es la probabilidad de eliminar B


conservando T. Es decir que:

- Depende de la relacin entre Ttbb/ (TtBb + Ttbb) = 0,375 / 0,5 = 0,75

- Establecido por 1 0,5n ; donde n = nmero de B.C.

1 - 0,25 = 0,75

b) Si los genes estn ligados (en pareja), sern separados por Crossing Over (CO)

Unidad Morgan = unidad de distancia gentica = 100 centimorgans


1M = 100 centimorgans
Morgan = corresponde a la distancia entre dos genes
1 Morgan (mo) = 100 % de CO
1 CO de 10 % = 1 decimorgan (dmo)
1% = 1 centimorgan (cmo)

Donante 1cmo =1 % CO
( )
p= 1 % = 0,01 {0,005 + 0,005}

Recurrente

Cruzamiento Poblacin
TB/tb Tb/tb tB/tb tb/tb
Hibrid. TB/TB x tb/tb 1
BC1 TB/tb x tb/tb 0,495 0,005 0,005 0,495 s

s = Seleccin

Se elimina parcialmente B suprimiendo /tB/


Probabilidad de eliminar B ligada a T:

- Depende de la relacin

91
- Establecido por 1 (1 - p)n , donde n = nmero de BC y p = porcentaje de CO entre los
genes

Es decir, la probabilidad de romper el CO depende de p y aumenta con el nmero de BC

0,005/0,5 = 0,01; luego 1 (1 0,01)1 = 1 0,99 = 0,01

Esquemas de mejoramiento por retrocruzamiento

Varan segn el nivel de dominancia del carcter en transferencia.

a. GEN DOMINANTE

Donante

Recurrente

1) hbrido

2) BC1 ( )

BC2 ( )
.
.
.

BCn ( )

3) Autofecundacin

F2 Tt -----------> 0,25 TT + 0,5 Tt + 0,25 tt

F3 { {

4) Seleccin

b. GEN RECESIVO

Donante tt
Recurrente TT

92
1) hibridacin TT x tt Tt
2) BC1 Tt x TT TT + Tt (todos T)

Autofecundacin TT TT
Tt
tt seleccin

BC2 (Sel. BC1) x TT


.
.
BCn (Sel. BCn-1) x TT

3) Autofecundacin
F2 TT + Tt + tt Seleccin por tt
Fenotipo recurrente

c. CASOS COMPLEJOS

1) Hibridacin

BC1 -------------------------->
Seleccin por fenotipo
BC2 (sel. BC1) x R ---------> recurrente R

2)
Ciclo1
Autofecundacin F2 -------->
Con Carcter en
F3 --------> seleccin transferencia
fenotipo R

BC3 --------------------------->
Seleccin
BC4 ---------------------------> por R
3) Ciclo 2

Carcter en
Autofecundacin F2 ---------> Con
transferencia
F3 ---------> seleccin
fenotipo R

R= Fenotipo Recurrente
.
.
.

4) Ciclo n

93
3.7.2 Utilizacin del mtodo de la retrocruza realizado por el Programa Investigacin
de Leguminosas de Grano y Oleaginosas (PLGO) de la UNALM

Para este caso se realizaron dos trabajos de investigacin:

a) Incorporacin del GEN I de Resistencia al Virus del Mosaico comn (BCMV) en


frijol (Phaseolus vulgaris L.) Var. Canario Camanejo.7

En la Costa Sur del Per, la principal variedad de frijol que se cultiva es el Canario
Camanejo; ocupa aproximadamente el 90 % del rea cultivada en esta regin. Es la
principal opcin de rotacin con el cultivo principal que es el arroz. La susceptibilidad al
virus del mosaico comn (BCMV) se ha venido acrecentando en los ltimos aos,
especialmente en campos de agricultores que no utilizan semilla certificada. En las dos
ltimas dcadas se han hecho esfuerzos por generar y liberar nuevos cultivares con
resistencia al BCMV; pero los agricultores prefieren seguir cultivando el frijol Canario
Camanejo; ya que ste posee caracteres importantes tales como el peso de 100 semillas de
aproximadamente 45 g. La cubierta opaca de la semilla facilita su comercializacin;
asimismo, el hbito de crecimiento indeterminado y su buen rendimiento de grano seco de
aproximadamente 1500 kg/ha, entre otras.

Con el propsito de mejorar genticamente a la variedad Canario Camanejo, en los aos


1994 y 1995 en La Molina se ejecut la transferencia del gen I de resistencia al virus del
mosaico comn (BCMV), mediante el mtodo de Retrocruzamiento; se utiliz como
fuentes portadoras del gen I a los cultivares de frijol Canario Centinela y Canario 2000. Al
final de dos Retrocruzamientos y evaluacin de la primera Retrocruza en los cruces de
hbridos F1 (Canario Camanejo x Canario Centinela y Canario Camanejo x Canario 2000)
con el Canario Camanejo, se observ que el 50 % de las plantas fueron resistentes al virus
del mosaico comn, confirmando la herencia simple y dominante de resistencia, as como
su incorporacin al Canario Camanejo. Para el carcter hbito de crecimiento, se logr con
la primera Retrocruza un 50 % de homocigosis y para la testa de la semilla un 25 %, con
respecto al progenitor recurrente Canario Camanejo. El carcter tipo indeterminado del
Camanejo es dominante sobre el Canario.. y Canario 2000 que son recesivos.

Se observ segregacin transgresiva en la segregacin de la primera Retrocruza para


rendimiento de grano seco y nmero de vainas por planta, superando a los progenitrores,
hbridos F1 y sus respectivas generaciones F2; asimismo, la expresin del carcter nmero
de granos por vaina no vari significativamente, en las diferentes combinaciones,
manteniendo el promedio biparental en los hbridos F1, generacin F2 y la Retroruza 1.
Para peso de cien semillas, se observ una ganancia en el parecido o cercana hacia el
progenitor recurrente Canario Camanejo.

Se logr un promedio de 47,33 % en cuanto a la eficiencia de la hibridacin,


correspondiendo 48,66 y 46,00 % de eficiencia en las hibridaciones que intervinieron
Canario Centinela y Canario 2000 respectivamente; se logr en la Retrocruza 2 la
eficiencia ms alta. La eficiencia de la hibridacin es una medida que establece una
relacin entre el nmero de cruce efectivos y el nmero total de cruces efectuados,
expresado en porcentaje.

94
b) Incorporacin del Gen fin de hbito de crecimiento determinado en el frijol ua
(Phaseolus vulgaris L.).80

La ua es una planta nativa altoandina y una subespecie nica de Phaseolus vulgaris L.,
frijol comn. ua es slo una de las tantas denominaciones que se aplican a un grupo
grande de cultivos de Phaseolus vulgaris los cuales se consumen tostados.

El frijol ua, por su contenido proteico (20 %) y de carbohidratos (62 %) cumple un


rol importante en la nutricin del poblador de las zonas altas de Amrica Latina. Por el
hbito de crecimiento indeterminado esta planta tiene como sistema de cultivo el asociado
con el maz. Mayormente es cultivado por pequeos agricultores en la zona andina,
principalmente para autoconsumo. Sin embargo, hoy en da, la ua, puede ser utilizada en
la industria (Panadera, chocolatera, cafetera, entre otros), y puede ser tambin exportada
como Pop beano palomitas de frijol.
Para posibilitar su uso en la industria se debe superar las barreras de adaptacin
(restringida a ciertos nichos con clima benigno sin extremos de fro ni calor: 10 a 25 C,
hbito de crecimiento trepador y de largo periodo vegetativo con ocho a nueve meses,
susceptibilidad a enfermedades endmicas como la ascochyta, la antracnosis, roya etc.
Estas barreras pueden ser superadas, pero manteniendo la calidad del grano, mediante
acciones como: ampliar la adaptacin a otras zonas ms bajas (< 2800 msnm), cambiar el
hbito de crecimiento indeterminado a determinado, reducir el periodo vegetativo tardo a
intermedio o precoz e introducir genes de resistencia o tolerancia a enfermedades
endmicas.

El Programa de Leguminosas de Grano de la Universidad Nacional Agraria La Molina


evalu germoplasma de frijol con la finalidad de identificar genotipos superiores que
sirvan como progenitores con el objetivo de introducir el gen fin de hbito de crecimiento
determinado en el frijol ua mediante retrocruzas con el frijol comn (Phaseolus vulgaris
L). En este estudio se utilizaron como progenitores, frijoles ua que resultaron
promisorios por su calidad de tostado y el frijol comn resistente y/o tolerante a
enfermedades, provenientes del Banco de Germoplasma del PLGO de la UNALM (Tabla
2.13).

Tabla 2.13. Caractersticas del material gentico en estudio.

Genotipo Hbito de Periodo Color de Peso 100 Reventado


crecimiento vegetativo granos semillas de grano
Pavita IV 240 das Blanco * 93 g Si
G8717 IV 200 das Amarillo 61 g Si
Canario Centenario I 110 das Amarillo 55 g No

* Jaspeado con negro

La metodologa consisti en emplear la tcnica de hibridacin por emasculacin con el


estigma desnudo segn describe el CIAT.24

95
Las cruzas fueron realizadas entre los frijoles indeterminados como progenitores
masculinos y los frijoles determinados como progenitores femeninos, emplendose 10
plantas por progenitor. Las semillas de la F1, F2, parentales y primera retrocruza fueron
sembradas en un diseo de bloques completos al azar; con tres repeticiones, los
tratamientos correspondieron a los progenitores masculinos, femeninos, la F1, la F2 y
primera retrocruza.

Los caracteres evaluados fueron: Hbito de crecimiento, rendimiento de grano seco,


componentes de rendimiento (nmero de vainas por planta, nmero de granos por vaina y
peso de 100 semillas), das a floracin y comportamiento del grano seco al tostado.

El diseo estadstico empleado fue bloques completos al azar, siendo el modelo aditivo
lineal:

Yij = + ti + bj + eij

Donde:

i, = 1,2, 3 tratamientos

j = 1, 2, 3 bloques

Yij = observacin del tratamiento i, repeticin j

= es la media general del experimento

ti = efecto del tratamiento i

bj = efecto del bloque j

eij = efecto del error experimental para cada observacin ij

Anlisis de variancia bajo un modelo fijo, los resultados de los afectos de bloques y
tratamientos son vlidos solamente para estas variedades.

F. de V G.L. C.M. E.C.M


Bloque r-1 CMr + t2j/(r-1)
Tratamiento t-1 CMt + rt2i/(t-1)
Error (e-1)(t-1) CMe
Total tr-1

En la Tabla 2.14, se observa en el resumen final de hibridaciones de frijol tipo I x tipo


IV, el nmero de semillas hbridas obtenidas en las campaas 2005-2006.

96
Tabla 2.14. Resumen final de hibridaciones de frijol tipo I x tipo IV realizadas en
condiciones de La Molina 2005-2006.

Fecha de fenologa Resultado


Campaa Objetivos Progenitores crtica: floracin nmero semillas
(d.d.s.) hbridas
Efectuar cruzas iniciales y Canario Centenario
2005 obtener semilla F1 (C. C.) 50
Efectuar 1ra retrocruza y Upa Cashapa Murun
obtener semilla RC1 (U. C. M.) 60
Obtener semilla F2 ua Pavita (P) 70
F1 (C.C x U.C.M.) 60 100
F1 (C.C x P) 70 183
Evaluacin de 1ra
retrocruza, F1, F2 y Upa Cashapa Murun
2006 progenitores:
RC1: (C.C x U.C.M) x
U.C.M,
ua G 8717
RC1: (C.C x P) x P F1 (C.C x U.C.M.) 333
F1 (C.C x U.C.M.) F1 (C.C x P) 200
F1 (C.C x P) F2 (C.C x U.C.M.) 2450
F2 (C.C x U.C.M.) F2 (C.C x P) 2491
RC1: (C.C x U.C.M)
F2 (C.C x P) x U.C.M 243
Canario Centenario, Pavita,
Upa Cashapa Murun
RC1: (C.C x P) x P 225

Anlisis de componentes de rendimiento de una poblacin segregante F2

Los requerimientos alimenticios en el mundo tienen un incremento muy acelerado en


comparacin con el aprovisionamiento de los mismos, el Mejoramiento Gentico de las
Plantas est jugando un papel muy importante en el incremento de la frontera agrcola que
es una de las maneras de acrecentar la produccin de alimentos.

En el presente trabajo se busca obtener una variedad de frijol que presente calidad de
reventado y que sea de porte arbustivo para facilitar la cosecha mecanizada y que pueda
adaptarse a diferentes condiciones ambientales y de este modo, incrementar su frontera
agrcola. El grano del frijol ua presenta la caracterstica de reventado, sin embargo la
planta es de porte guiador, adems que su adaptacin a condiciones especficas de
humedad y altitud. El frijol Canario presenta porte arbustivo y planta pequea, no tiene
calidad de reventado, pero es adaptado a las condiciones de la costa peruana.

En el programa de mejoramiento, por medio de cruzamientos, se obtuvo las siguientes


poblaciones: C x P; C x C x P; (C x P) F1; y (C x P) F2. Donde C es el frijol
Canario, P representa al frijol ua Pavita, y F1 y F2 a las respectivas
generaciones.

El control gentico del porte esta controlado por un solo gen, el gen Fin. El frijol
canario, de porte arbustivo, presenta el genotipo Fin Fin mientras que el frijol ua
Pavita presenta el genotipo fin fin. Se llev a cabo el cruzamiento de Canario
Centenario () x ua Pavita () y se obtuvo la F1 en la que todas las plantas tenan

97
fenotipo guiador (de genotipo Fin fin). La autofecundacin de la F1, que se da de manera
natural, debido a que el cultivo es autgamo, nos produce una poblacin F 2 donde se puede
observar la segregacin para varias caractersticas.

Para los anlisis de los componentes de rendimiento, se consideraron las variables del
nmero de granos por planta, peso de 100 semillas, nmero de vainas por planta, promedio
del nmero de granos por vaina, promedio del nmero de lculos por vaina, peso de
semillas por planta.

De acuerdo a los resultados (Tabla 2.15), el color del grano es un carcter que estara
controlado por muchos genes; asimismo, el componente de rendimiento que est ms
correlacionado con el rendimiento total por planta es el nmero de granos por vaina, que
tambin presenta la ventaja de tener una considerable heredabilidad (h2 = 0.7). En
consecuencia, sera favorable si se emplea dicha caracterstica para efectos de seleccin
por rendimiento en los ciclos de retrocruza del progenitor recurrente (Canario Centenario)
con el progenitor donador del gen fin (ua Pavita).

En cuanto a la caracterstica nmero de granos por planta, tenemos que existe una
enorme heterocigosidad entre los parentales y la F1 (Cuadro 2.15). El contraste que puede
observarse entre la variancia del frijol Canario con respecto al frijol ua Pavita,
puede ser consecuencia de que el primero presenta un cierto nivel de variabilidad gentica.

De acuerdo a los resultados mostrados en el Cuadro 2.15, el nmero de granos estara


controlado por genes de efecto de dominancia y/o de sobredominancia (heterosis).

En cuanto al peso de 100 semillas, se tiene una situacin similar; donde incluso la
variabilidad del parental Canario es mayor que la variabilidad de la F2; lo cual resulta en
una heredabilidad negativa que puede despreciarse y considerarse como cero.

El nmero de vainas estara controlado por genes con efecto de dominancia; y en


comparacin a los otros componentes, existe homocedasticidad entre los parentales y la F1,
lo cual hace ms confiable la afirmacin.

En cuanto al componente de rendimiento ms importante, que es el peso de granos por


planta, tambin se muestra que el componente de dominancia es importante; y su
heredabilidad es del 57,2 %.

De acuerdo a los resultados, el programa de mejoramiento tendra que seguir el curso de


llevar a cabo generaciones de retrocruza del progenitor donador del gen fin (frijol Canario)
con el progenitor recurrente (frijol ua Pavita); donde se tendra que emplear el nmero
de vainas por planta para juzgar por el rendimiento, debido a que presenta una
heredabilidad considerable (h2=0.7), aunque puede reducirse si se consideran ms
ambientes y se correlaciona muy bien con el componente de rendimiento ms importante,
que sera el peso de granos por planta. Luego de seis a siete generaciones, se tendra que
llevar a cabo la seleccin para el carcter de reventado de los granos.

98
Tabla 2.15. Medias y variancias para cada componente del rendimiento evaluado en
la poblacin de parentales (Canario Centenario y ua Pavita), F1, F2 y
retrocruza (PxC) x P.

Componentes del rendimiento evaluados


Peso de N N Promedio Promedio Peso
N de
100 vainas vainas N N granos/
granos/
semillas llenas/ vanas/ granos/ lculos/ planta
planta
(g) planta planta planta vaina (g)
x
Canario (C)
8,473 1,763 2,156 2,232 0,697 0,721 1,533
2

15,116 0,069 1,069 0,005 0,001 0,000 0,272


Poblaciones de progenitores, F1, F2 y retrocruza.

x
Pavita (P)
6,731 1,811 2,929 2,116 0,648 0,717 1,441
2

3,400 0,001 1,095 0,026 0,005 0,001 0,069

x
F1(PxC)
11,547 1,904 2,493 2.121 0,653 0,689 2,009
2

7,891 0,065 0,711 0,003 0,000 0,001 0,016

x
(PxC)xP
12,220 1,831 2,483 2,213 0,689 0,711 1,970
2

12,627 0,057 0,382 0,005 0,001 0,001 0,038

x
F2(PxC)
4,142 1,605 4,381 3,225 0,664 0.714 1,180
2

15,161 0,015 3,316 1,301 0,005 0,001 0,278

Variancia E2
ambiental 8,803 0,045 0,958 0,011 0,002 0,001 0,119
Variancia 2
P
fenotpica 15,161 0,015 3,316 1,301 0,005 0,001 0,278
Variancia 2
G 6,358 -0,030 2,358 1,290 0,003 0,000 0,159
gentica
heredabilida h2
d 0,419 -1,955 0,711 0,992 0,592 0,287 0,572

99
3.8. Variedades multilneas

Se llaman variedades multilneas a las mezclas de lneas que difieren en una o muy pocas
caractersticas, que hasta ahora ha sido exclusivamente resistencia a enfermedades, sin que
tal mezcla afecte a caracteres agronmicos importantes (precocidad, maduracin, cosecha
mecnica, calidad, etc.).

Las lneas a mezclar se obtienen por retrocruzamientos paralelos que deberan ser
tericamente isognicas (es decir, idnticas en cuanto a todo el genotipo salvo en un nico
gen), pero en la prctica es imposible una gran similitud genotpica entre ellas. Aunque a
estas lneas se le llaman isognicas en la prctica, su nombre correcto es el de cuasi
isognicas. Aunque tericamente aceptable, el mtodo tropieza con la dificultad de
obtencin de isolneas; la isognica es difcil de conseguir. De hecho, por ahora, no han
tenido xito en la prctica agrcola, conocindose slo su aplicacin en muy pocos casos,
como el de la avena para resistencia a Helminthosporium victoreae.

Las multilneas son mezclas de varias lneas, cada una con caracteres genotpicos
similares pero con diferentes genes de resistencia vertical. Las multilneas tienen algunos
caracteres de ambas resistencias vertical y horizontal, toda vez que reducen no slo el nivel
inicial de la enfermedad sino tambin su tasa de multiplicacin.

Desafortunadamente, la dificultad para desarrollar y mantener multilneas limita su


posible uso nicamente a aquellas enfermedades con alta variabilidad patognica como
Pyricularia oryzae, para la cual no se puede obtener resistencia estable por mtodos ms
sencillos.

3.8.1. Formacion de variedades multilneas

Frey et al.,39 sealan que fue Rosen en 1949 quien primero propuso usar poblaciones
genticamente heterogneas para resistencia a enfermedades en avena. La variedad debera
tener genes de resistencia para la roya de la corona y para Helminthosporium victoriae, sin
prestarle mucha atencin a su uniformidad agronmica. Esto, sin embargo, no tuvo
aceptacin por la exigencia agrcola y comercial de altos estndares de uniformidad en los
cultivares de avena. Para resolver esto, Jensen57 propuso que tal tipo de variedades
deberan estar compuestas de lneas puras seleccionadas de un proyecto de mejoramiento
de avena por su uniformidad de apariencia, particularmente altura, maduracin, resistencia
a enfermedades, y a otras caractersticas esenciales en un tipo bsico agronmicamente
deseable.

Cada lnea debera contribuir con factores genticos deseables adicionales sin
menoscabo de la uniformidad fenotpica del compuesto. Este tipo de poblacin es lo que se
conoce como variedad multilineal (VML) o compuesto multilineal o multilnea y de
acuerdo a su heterogeneidad gentica la resistencia a razas fisiolgicas de los patgenos, la
poblacin presenta grados de resistencia a todas las razas prevalentes, lo que ha sido
llamado por Frey & Browning39 resistencia horizontal sinttica o resistencia
poblacional.

La bsqueda de variedades multilineales tiene por objeto obtener poblaciones de vida


til prolongada (al menos no efmera). Esta, de hecho, puede ser permanente mientras no

100
se cambie, por razones agrcolas, el fenotipo de la variedad multilineal en cuestin; an
cuando una de las lneas resultara eventualmente susceptible a alguna raza nueva, la
variedad multilineal continuar en vigencia por la simple sustitucin de tal lnea por una
nueva resistente.

El nmero de lneas que se han propuesto es de ocho a dieciseis. En teora, mientras


ms se incluyan, menor es el porciento de dao que se causa en la poblacin cuando una de
las lneas componentes deviene en susceptible, (Figura 2.23), lo mismo puede decirse en
torno a la uniformidad fenotpica; una lnea, unos cuantos centmetros ms corta en altura,
pasa menos desapercibida al mezclarse con un nmero alto de lneas en la variedad
multilineal que si est constituida por un nmero bajo de ellas.14

Ahora bien, de lo que hemos estado diciendo se puede apreciar que las lneas
correspondientes de una variedad multilineal son, lneas isognicas o isolneas, iguales en
su contenido gentico excepto en el locus o loci en que estn localizados los genes de
resistencia. Por lo tanto, el mtodo de mejoramiento gentico que se usa es el de la
retrocruza, usando como progenitor recurrente la variedad que se desea transformar en
multilineal, y como progenitores donantes una serie de variedades, cada una con diferentes
genes de resistencia.

101
Lneas
Lneas probadas a b c d e f g h
individualmente

Se continua la Se mezclan varias


prueba de todas a b c d e f g h i j k acd bdg egh multilneas
las lneas ms las experimetales y se
nuevas prueban

Se multiplicacin
Se contina la individual de los b d g
prueba de lneas componentes de la
mejor multilnea
experimental

Mezcla de los
Se contina la componentes, bdg
prueba de lneas multiplicacin y
distribucin a los
agricultores

Se contina la Se distribuye la
prueba de lneas multilnea a agricultores

Cuando las Se reemplaza la


pruebas muestran lnea
que una lnea a b c d e f g h i j k x adg fdg xdg susceptible con
componente de lneas resistentes y
una multilnea se se prueba las
hace suceptible multilneas
experimentales

Si se va tornando Multiplicacin
susceptible hay a b c d e f g h i j k x individual de los x d g
que descartar componentes de la
dicho mejor multilnea
componente experimental

Mezcla de los
Se contina la componentes,
prueba de lneas multiplicacin y
distribucin a los
agricultores

Se contina la Se distribuye la multilnea


prueba de lneas a los agricultores

.. y as se sigue sucesivamente

Figura 2.23. Diagrama de formacin de Variedades Multilineales (VML) de


avena y su liberacin para uso de agricultores. CIMMYT.26

102
En su forma general, el mtodo consiste en llevar los procesos de retrocruzamiento en cada
progenitor donante (V1, V2 y V3) por separado, seleccionando hacia los genes de
resistencia de estos y hacia las caractersticas agronmicas del progenitor recurrente (L).

Cuando se considera que ha habido suficiente recuperacin, las lneas isogenicas L1 con
genes de resistencia de V1; L2 con genes de resistencia de V2 y L3 con genes de resistencia
de V3 se mezclan mecnicamente constituyndose asi la variedad multilineal (VML). Este
proceso se muestra en la Figura 2.24.

V1 x L V2 x L V3 x L

F1 x L F1 x L F1x L

RC1 x L RC1 x L RC1 x L

RC2 x L RC2 x L RC2 x L

RCn-1 X L RCn-1 x L RCn-1 x L

L1 + L2 + L3
Variedad multilineal

Figura 2.24. Esquema general de la obtencin de una variedad multilineal mediante


retrocruzamiento a tres progenitores donantes (V1, V2 y V3); progenitor recurrente es L.

3.8.2. Procedimiento para obtener una multilnea

A continuacin se describe el procedimiento para obtener una multilnea conteniendo


cuatro lneas, cada una con un locus de resistencia diferente a cada raza del patgeno, a
partir de los siguientes progenitores:

Progenitor Recurrente: AABBCCDD

Progenitor Donante: aabbccdd

Se asume que hay dominancia completa, y que:

El gen aa confiere resistencia a la raza 1 del patgeno.


El gen bb confiere resistencia a la raza 2 del patgeno.
El gen cc confiere resistencia a la raza 3 del patgeno.
El gen dd confiere resistencia a la raza 4 del patgeno.

103
Solucin:

Obtencin de la lnea aaBBCCDD, resistencia a la raza 1 del patgeno.

1. Se hace la cruza entre el progenitor recurrente AABBCCDD y el donante aabbccdd y se


obtienen plantas heterocigotas en todos los loci. Esta progenie tiene 50 % de su
constitucin gentica como el progenitor recurrente.

2. Se hace la primera retrocruza RC1 con el progenitor recurrente y se obtiene segregacin


del locus A de inters, en genotipos AA y Aa. Esta progenie resultante tiene 75 % de su
constitucin gentica como el progenitor recurrente.

3. Debido a la dominancia ( ), los genotipos no son distinguibles fenotpicamente.


Entonces, se hace una autofecundacin a cada planta para poder obtener el genotipo aa de
inters.

4. Para distinguir el genotipo aa de inters se inoculan todas las plantas, se evalan y las
resistentes son las que poseen el genotipo deseado aa.

5. Se seleccionan esas plantas y se hace la retrocruza RC2. La progenie resultante tiene 87.5 %
de su constitucin gentica como el progenitor recurrente. Se siguen los pasos 3 y 4.

104
6. Se repite el procedimiento hasta aproximadamente RC5, donde se consigue la lnea
aaBBCCDD, que tiene las caractersticas adaptativas y agronmicas (96.87 % de genes del
recurrente) del progenitor recurrente, y adems el gen de inters aa del progenitor donante,
que da resistenca a la raza 1 del patgeno.

Evolucin de la frecuencia gnica al introducir el gen a que le da resistencia al


patgeno de la raza 1.

Etapas Progenitores Frecuencia de la descendencia


Aa Aa
Hibridacin AA x aa 1
RC. 1 Aa x aa 0,5 0,5
RC. 2 (0,5 Aa + 0,5 aa) x AA 0,75 0,25
RC. 3 (0,25 Aa + 0,75 aa) x AA 0,875 0,125
RC. 4 (0,875 Aa + 0,125 aa) x AA 0,937 0,0625
RC. 5 (0,937 Aa + 0,625 aa) x AA 0,968 0,03125

Obtencin de la lnea AAbbCCDD, resistente a la raza 2 del patgeno

105
1. Se hace la cruza entre el progenitor recurrente AABBCCDD y el donante aabbccdd y se
obtienen plantas heterocigotas en buena parte de los loci. Esta progenie tiene 50 % de su
constitucin gentica como el progenitor recurrente.

2. Se hace la primera retrocruza RC1 con el progenitor recurrente y se obtiene segregacin


del locus B de inters, en genotipos BB y Bb. Esta progenie resultante tiene 75 % de su
constitucin gentica como el progenitor recurrente.

3. Debido a la dominancia ( ), los genotipos no son distinguibles fenotpicamente.


Entonces, se hace una autofecundacin a cada planta para poder obtener el genotipo bb de
inters.

4. Para distinguir el genotipo bb de inters se inoculan todas las plantas, se evalan y las
resistentes son las que poseen el genotipo deseado bb.

5. Se seleccionan esas plantas y se hace la retrocruza RC2. La progenie resultante tiene


87,5 % de su constitucin gentica como el progenitor recurrente. Se siguen los pasos 3 y
4.

6. Se repite el procedimiento hasta aproximadamente RC5, donde se consigue la lnea


AAbbCCDD, que tiene las caractersticas adaptativas y agronmicas (96,87 % de genes del
recurrente) y adems el gen de inters bb del progenitor donante, que da resistenca a la
raza 2 del patgeno.

Evolucin de la frecuencia gnica al introducir el gen b que le da resistencia al


patgeno de la raza 2.

Etapas Progenitores Frecuencia de la descendencia


Aa Aa
Hibridacin BB x bb 1
RC. 1 Bb x bb 0,5 0,5
RC. 2 (0,5 Bb + 0,5 bb) x BB 0,75 0,25
RC. 3 (0,25 Bb + 0,75 bb) x BB 0,875 0,125
RC. 4 (0,875 Bb + 0,125 bb) x BB 0,937 0,0625
RC. 5 (0,937 Bb + 0,625 bb) x BB 0,968 0,03125

106
Obtencin de la lnea AABBccDD, resistente a la raza 3 del patgeno

1. Se hace la cruza entre el progenitor recurrente AABBCCDD y el donante aabbccdd y se


obtienen plantas heterocigotas en buena parte de los loci. Esta progenie tiene 50 % de su
constitucin gentica como el progenitor recurrente.

2. Se hace la primera retrocruza RC1 con el progenitor recurrente y se obtiene segregacin


del locus C de inters, en genotipos CC y Cc. Esta progenie resultante tiene 75 % de su
constitucin gentica como el progenitor recurrente.

3. Debido a la dominancia ( ), los genotipos no son distinguibles fenotpicamente.


Entonces, se hace una autofecundacin a cada planta para poder obtener el genotipo cc de
inters.

4. Para distinguir el genotipo cc de inters se inoculan todas las plantas, se evalan y las
resistentes son las que poseen el genotipo deseado cc.

5. Se seleccionan esas plantas y se hace la retrocruza RC2. La progenie resultante tiene


87,5% de su constitucin gentica como el progenitor recurrente. Se siguen los pasos 3 y 4.

107
6. Se repite el procedimiento hasta aproximadamente RC5, donde se consigue la lnea
AABBccDD, que tiene las caractersticas adaptativas y agronmicas (96,87 % de genes del
recurrente) y adems el gen de inters cc del progenitor donante, que da resistenca a la raza
3 del patgeno.

Evolucin de la frecuencia gnica al introducir el gen c que le da resistencia al


patgeno de la raza 3.

Etapas Progenitores Frecuencia de la descendencia


Cc Cc
Hibridacin CC x cc 1
RC. 1 Cc x cc 0,5 0,5
RC. 2 (0,5 Cc + 0,5 cc) x CC 0,75 0,25
RC. 3 (0,25 Cc + 0,75 cc) x CC 0,875 0,125
RC. 4 (0,875 Cc + 0,125 cc) x CC 0,937 0,0625
RC. 5 (0,937 Cc + 0,625 cc) x CC 0,968 0,03125

Obtencin de la lnea AABBCCdd, resistente a la raza 4 del patgeno

108
1. Se hace la cruza entre el progenitor recurrente AABBCCDD y el donante aabbccdd y se
obtienen plantas heterocigotas en buena parte de los loci. Esta progenie tiene 50 % de su
constitucin gentica como el progenitor recurrente.

2. Se hace la primera retrocruza RC1 con el progenitor recurrente y se obtiene segregacin


del locus D de inters, en genotipos DD y Dd. Esta progenie resultante tiene 75 % de su
constitucin gentica como el progenitor recurrente.

3. Debido a la dominancia ( ), los genotipos no son distinguibles fenotpicamente.


Entonces, se hace una autofecundacin a cada planta para poder obtener el genotipo dd de
inters.

4. Para distinguir el genotipo dd de inters se inoculan todas las plantas, se evalan y las
resistentes son las que poseen el genotipo deseado dd.

5. Se seleccionan esas plantas y se hace la retrocruza RC2. La progenie resultante tiene


87,5 % de su constitucin gentica como el progenitor recurrente. Se siguen los pasos 3 y
4.

6. Se repite el procedimiento hasta aproximadamente RC5, donde se consigue la lnea


AABBCCdd, que tiene las caractersticas adaptativas y agronmicas (96,87 % de genes del
recurrente) y adems el gen de inters dd del progenitor donante, que da resistenca a la
raza 4 del patgeno.

Evolucin de la frecuencia gnica al introducir el gen d que le da resistencia al


patgeno de la raza 4.

Etapas Progenitores Frecuencia de la descendencia


Dd Dd
Hibridacin DD x dd 1
RC. 1 Dd x dd 0,5 0,5
RC. 2 (0,5 Dd + 0,5 dd) x DD 0,75 0,25
RC. 3 (0,25 Dd + 0,75 dd) x DD 0,875 0,125
RC. 4 (0,875 Dd + 0,125 dd) x DD 0,937 0,0625
RC. 5 (0,937 Dd + 0,625 dd) x DD 0,968 0,03125

109
El procedimiento se puede resumir de la siguiente manera:

3.8.3. Ventajas y desventajas de las variedades multilneas

VENTAJAS

La resistencia poblacional de una mezcla de lneas (variedad multilineal), con diferentes


genes de resistencia reducen la tasa de propagacin del patgeno en la parcela, retardando
as la ocurrencia de la enfermedad. Como la roya se desarrolla en el campo de acuerdo a la
frmula de inters compuesto, se ha encontrado por Browning & Frey,17 que la tasa de
inters del incremento de las pstulas por tallo de avena fue de 0,5 por da en una lnea
pura y de 0,42 en las plantas susceptibles de una mezcla, 1R:1S la cual retard el tiempo
para el desarrollo de la enfermedad en cuatro das lo que producira un aumento simulado
del 20 %.

En este estudio se muestra la produccin acumulativa estacional de esporas de la roya


de la corona de la avena (Puccinia coronata avenae) en una lnea pura y en una variedad
multilineal inoculadas con la raza 264 y con una mezcla de seis razas. En esta lnea pura la
produccin acumulativa de esporas mostr el efecto asinttico lo que signific que la
enfermedad haba completado su curso y que haba ocurrido la muerte prematura de los
tejidos de las plantas; sin embargo, tal efecto no tuvo lugar en la variedad multilineal en el
mismo periodo; el desarrollo de la roya se termin antes de la maduracin de la planta.

Si por otra parte la regin estuviera sembrada con una lnea pura susceptible a la raza
que va a aparecer, entonces la propagacin es rpida, se desarrolla una epidemia y las

110
consecuencias pueden adquirir categora de desastre. Si por el contrario, los agricultores
siembran variedades con resistencia a las diferentes razas de royas, entonces slo aquellos
que hayan usado las variedades susceptibles sufren las consecuencias, pero a nivel regional
la prdida ser mucho menor. Los agricultores no se arriesgaran a sembrar una variedad
potencialmente susceptible a la raza que pueda incidir en las futuras siembras, sobre todo,
sabiendo que hay variedades resistentes a tal raza. De este modo, para proteger a la
agricultura, lo deseable es que todos los agricultores cuenten con heterogeneidad gentica a
nivel de sus parcelas; es decir, que siembren variedades resistentes, dentro de lo posible, a
todas las razas que comnmente puedan prevalecer en la regin. Sin embargo, por la gran
cantidad de razas existentes y el carcter polignico de la resistencia a su ataque, se hacen
esfuerzos para que en una sola variedad llegue a conjugarse los genes necesarios para
garantizar una resistencia contra ellas.

Si tal tipo de poblaciones se cultivaran en la regin, la principal ventaja a largo plazo es


que en promedio la poblacin resistente, tenga una vida til mayor que la lnea pura
cultivada. Cuando ste ltimo es el caso, la aparicin de nuevas razas limita enormemente
la vida til de las variedades homogneas las que deben ser sustituidas de inmediato por
nuevas variedades resistentes a las nuevas razas; por la naturaleza genticas de stas, en lo
que concierne a la resistencia, es bastante probable que con el uso de lneas se desarrollen
explosivamente epidemias que echen abajo todo el trabajo invertido en la consecucin
continuada de las nuevas variedades, establecindose as una carrera entre el fitomejorador
y los patgenos que parece interminable, pudiendose llamar a este hecho como un crculo
vicioso.

DESVENTAJAS

La estrategia de las multilneas tiene importantes desventajas:

a) El procedimiento es de mediano y largo plazo. El procedimiento de retrocruza requiere


de tres a seis aos. El nivel de rendimiento y otros caracteres del padre recurrente
puede compararse desfavorablemente con el rendimiento de los cultivares
convencionales que son sembrados cuando la multilnea esta formada.

La multilnea de avena Tumult ilustra este punto. La multilnea esta basada en el


cultivar Tadorna, este cultivar fue popular de 1966 a 1976. Tuvo un excelente
potencial de rendimiento. La compaa de mejoramiento Zelder liber Tumult en
1980, el potencial de rendimiento de los cultivares convencionales en ese tiempo
haban incrementado tanto que el nivel de rendimiento de Tadorna (y por lo tanto el
nivel Tumult) no fue de mayor inters.

En 1967 el nivel de rendimiento de Tadorna fue de 110 % en suelos arcillosos y


114 % en suelos arenosos (la media de rendimiento de todos los cultivares de esa
poca se estableci como el 100 %). En 1980 el rendimiento relativo de Tumult fue de
102 % y 100 % en suelos arenosos y suelos arcillosos respectivamente.

b) El procedimiento es muy laborioso y complicado debido a que se necesita de


retrocruzas y repetidas pruebas con razas apropiadas. Tambin el mantenimiento y
multiplicacin es ms complicado que con cultivares convencionales. Los marcadores
moleculares podran ayudar a acelerar el proceso de retrocruzas.

111
c) En el Per, la presente legislacin (derecho de mejoradores, registros) no incluye el
procedimiento en multilneas. Despus de un nmero limitado de retrocruzas
(generalmente de tres a cinco), los componentes no son suficientemente idnticos para
formar un cultivar que sea tan puro como debera requerir la ley. En tales casos cada
componente necesita ser registrado en forma individual lo que es costoso y
complicado.

Posiblemente debido a estas desventajas las multilneas nunca lleguen a ser populares.
Actualmente difcilmente son sembradas en forma comercial. Adems, mucha
investigacin se est realizando para estudiar si las multilneas promueven la formacin y
multiplicacin de razas complejas.

Posteriormente a estos trabajos en trigo, se han desarrollado programas de resistencia a


enfermedades de arroz (Oriza sativa L.) empleando marcadores moleculares.

3.9. Mejoramiento por caracteres mltiples

3.9.1 Seleccin gamtica

Fue inicialmente teorizado por Stadler91 al trabajar con el maz. Luego, Hallauer en 1970
evalu este tipo de seleccin para obtener hbridos en maz y concluy que este mtodo
puede ser utilizado con xito en el mejoramiento de este cultivo. Stadler propuso este
mtodo de hibridacin para la identificacin de lneas de alta Aptitud Combinatoria
Especifica (ACE), desde el principio del proceso de autofecundacin. Se cruzan una serie
de gametos de una poblacin heterognea con una lnea endogmica superior o lite. Si
la frecuencia de cigotes superiores de dicha fuente es q2, la frecuencia de gametos que dan
lugar a dichos cigotes ser q, como q > q2 entonces sera ms fcil identificar gametos
superiores que cigotes superiores. Por ejemplo si q2, es igual a 0,64, q ser igual a 0,8.
Desde luego esto es ms evidente conforme q es ms pequeo.

La cruza de la lnea lite por la fuente de gametos se hace utilizando la lnea como
hembra y la fuente como macho (Figura 2.25 y 2.26). Se usa una muestra al azar de polen
de la fuente y dado que la lnea es endogmica las diferencias entre las plantas F 1 que se
obtengan se debern exclusivamente a las diferencias entre el contenido gamtico de los
granos de polen, es decir a los gametos. Las plantas F1 se autofecundan (con la esperanza
de recuperar el gameto sobresaliente) y se cruzan simultneamente con un probador
adecuado. La lnea A es una lnea lite, y se puede usar como probador de la Cruza simple
(Cs) (C x D) que es la otra Cs de la Cruza doble (Cd) [(A x B) x (C x D)]. En la Figura
2.27 se muestra el esquema de la seleccin gamtica en Phaseolus.

112
Lnea lite A () x Fuente de gametos ()

F1 x Probador Cs (CxD)

F2 Cruza Probadora
(Mestizo)

Figura 2.25. Esquema gentico de la seleccin gamtica de Stadler (1944). La lnea A


es una lnea lite y se puede usar como probador de la Cruza simple (Cs) (CxD) que
es la otra Cruza simple de la Cruza doble (Cd) [(AxB) x (CxD)].

Lnea A 344 X Fuente de gametos (Pobl. Morris 13)


aaBBccddEEff Aa Bb Cc Dd EE FF

AaBbCcDdEEFf F1 x Probador Cs (C X D)
AaBBccddEEFf

(Recupera los genes en


los gametos favorables)

1 x HS
2 x HS
3 x HS Mestizos (Evaluacin para determinar las mejores cruzas)
4 x HS
5 x HS

HS= Hbrido simple

Figura 2.26. Esquema de la seleccin gamtica de Stadler.91

113
Se tiene los siguientes parentales con excelentes caracteres propios que se desean
incorporar en una sola planta autgama haciendo cruzas mltiples.

Figura 2.27. Esquema de la seleccin gamtica para mejorar en forma simultnea por
varios atributos genticos en el frijol comn (Phaseolus vulgaris L.).

Sobre este mtodo de hibridacin se ha sealado que lo que se busca en la hibridacin no


son gametos superiores sino lneas superiores y que en todo caso se requiere que dichos
gametos o lneas sean superiores, no slo en combinaciones hbridas con lneas lite, sino
con derivadas de poblaciones en las que se est interesado.

*Guiados por la metodologa de Stadler, en lo referente a la seleccin gamtica, se


realiz trabajos similares pero aplicados al cultivo de autgamas como es el caso
especfico de frijol comn, y luego se investig para resistencia a enfermedades utilizando
el mismo mtodo con algunas variantes, pero en frijol.

114
Utilizacin de la seleccin gamtica en leguminosas del genero Phaseolus

El xito de un programa de mejoramiento gentico de plantas depende de la habilidad del


mejorador y el genetista de crear, identificar y seleccionar efectiva y eficientemente
recombinantes genotpicos con un mximo nmero de caractersticas en un corto tiempo
posible. En este caso la seleccin gamtica constituye un mtodo alternativo de
recombinacin gentica y de seleccin. La seleccin gamtica esta basada en las siguientes
premisas:

- Es necesario la utilizacin de varios progenitores para la ejecucin de cruzas mltiples para


el mejoramiento simultneo de nmerosos caracteres.

- Los progenitores machos al final de la cruza deben ser heterocigotos y heterogamticos.

- Cada semilla cigtica es producto de un evento separado y fertilizacin independiente.

- Las recombinaciones cromosmicas y gnicas estn limitadas al material gnico contenido


dentro del cigote inicial.

- Es parte esencial de la metodologia que en generaciones tempranas (F1, F2, F3 y F4) se


efecten las pruebas y seleccin.

Las polinizaciones deben ser hechas en pares de planta a planta entre el progenitor lite
femenino y el padre heterogamtico, (seleccionado a priori por sus alelos deseables
dominantes y codominantes), seguida por cosecha y siembra resultante de semillas hbridas
de cada hibridacin en parcelas separadas para obtener derivados de familias F1. Estos son
consecuentemente evaluados separadamente en viveros convenientemente replicados para
obtener por produccin de semilla y otros caracteres agronmicos, incluyendo reaccin a
plagas y enfermedades, baja fertilidad del suelo y/o sequa. Esto permite identificar
poblaciones y familias promisorias dentro de poblaciones que poseen genes con caracteres
mltiples deseables en generaciones tempranas para evaluaciones adicionales, seleccin y
desarrollo de cultivos mejorados.

La metodologa de la seleccin gamtica propuesta por Singh en 1994 para el


mejoramiento simultneo de varios atributos en el frijol comn (Phaseolus vulgaris L.) se
describe en la Tabla 2.16 y se grafica en las Figuras 2.28 y 2.29. En la Figura 2.30 se
resume el caso de un procedimiento alternativo de seleccin gamtica.

115
Tabla 2.16. La metodologa de la seleccin gamtica para el mejoramiento simultneo
de varios atributos en el frijol comn.

Generacin Actividades
Progenitores Seleccin de progenitores contrastantes, determinar las
combinaciones de cruzas y ejecucin de cruzas simples
Progenitores y Ejecucin de cruzas de tres vas, dobles y otros tipos de cruzas
cruzamientos usando la hibridacin en pares, de planta a planta
Progenitores y Eleccin por sus alelos deseables dominantes y codominantes en los
cruzamientos progenitores heterogamticos para la produccin final de cruzas de
progenitores mltiples, usando hibridacin pareada de planta a
planta
F1 Eleccin por alelos deseables dominantes y codominantes y cultivo
de la semilla F1 recurrente de cada hibridacin pareada en hill plots1
separados. Tomar los datos necesarios. Cosecha de la semilla de
cada planta F1 sobreviviente de los hill plots en bolsas separadas.
F2 Ensayos de rendimientos con replicaciones en localidades, en
ambientes contrastantes de familias F2 derivadas de F1 en grupos al
azar con tres o ms familias. Identificacin de poblaciones de alto
rendimiento y descarte de las no deseables, alternativamente
sembrar surcos planta-progenie o en hill plots en viveros
convenientemente separados bajo presin uniforme y adecuada por
factores contrastantes (Ejm: antracnosis, mancha angular, bateriosis
comn y empoasca). Cosecha en bulk de todas las plantas restantes
dentro de familias seleccionadas.
F3 Evaluacin de familias restantes F3 derivadas de F1 de poblaciones
seleccionadas separadas, vivero complementario replicado para cada
atributo deseable. Descarte de familias con bajo rendimiento y
susceptibles. Cosecha en bulk de plantas resistentes dentro de
familias seleccionadas.
F4 Repeticin de las evaluaciones de familias F4 derivadas de F1 en
ensayos de rendimiento con repeticiones en ambiente de produccin
contrastantes. Cosecha en Bulk de plantas resistentes de familias de
alta produccin que poseen otros atributos deseables.
F5 Plantas espaciadas y cosecha de un mximo nmero de plantas de
familias seleccionadas. Descarte de plantas morfolgicamente
indeseables, semillas y atributos de adaptacin.
F6 Siembra en surcos planta-progenie, chequeo por uniformidad de
color de flor, hbito de crecimiento, maduracin y atributos de
semilla. Cosecha en bulk de plantas de familias seleccionadas y
uniformes.
F7 Siembra separada de viveros complementarios de cada atributo
deseable. Descarte de material susceptible, indeseable y lneas
inferiores.
F8 F10 Evaluacin en ensayos de rendimientos replicados bajo presin de
factores biticos y abiticos en ambientes contrastantes para
identificar nuevos cultivares.
1
hill plots= parcelas de un golpe

116
Se tiene los siguientes parentales con excelentes caracteres propios que se desean
incorporar en una sola planta autgama haciendo cruzas mlitples.

( ) ( )

( )( )

( ) [( )( )]

///////

117
Siembra espaciada en hill plots
xxxxxxx xxxx
xxxxxxx xxxx Seleccin individual por caracteres dominantes y
F1 xxx xxxxx xx x codominantes.

Familias F1.2, evaluadas con repeticiones en ambientes


A1 R1 contrastantes (A) agrupando hasta 4 familias F1:2
R2 diferentes por parcela. Cosecha individual en bulk, la
F2 produccin de los 4 surcos por parcela es utilizada para
estimar la media. Se identifican las poblaciones o cruzas
R1 superiores en base al rendimiento de grano y otras
A2 caractersticas, descartndose las inferiores, i entre
R2
poblaciones = 30 a 50 % de descarte (i = intensidad de
seleccin).

Familias F1.3 de poblaciones superiores evaluadas en


ensayos repetidos para identificar familias superiores,
F3 cada parcela est constituida por una nica familia F1.3.
Las parcelas son cosechadas en bulk.

Familias F1.4, se seleccionan las familias superiores en


F4 base al rendimiento de grano y otras caractersticas
agronmicas.

Familias F1.5, siembra espaciada y seleccin del mayor


nmero de plantas F1.5 individualmente. Aqu se
xxxxxxx xxxx
F5 xxxxxxx xxxx identifican lneas para explorar la variabilidad gentica
xxx xxxxx xx x dentro de cada familia. Las familias F1.5 aqu son
altamente homocigticas y heterognas. Se descartan
individuos con caracteres morfolgicos indeseables.

Prueba de progenie con plantas seleccionadas en F5. Se


F6 descartan las progenies F5.6 inferiores y los segregantes.

Evaluacin de progenies F5.7 seleccionadas para


F7 multiplicacin de semillas.

F8-10 Evaluacin de rendimiento y adaptacin de lneas


seleccionadas antes del lanzamiento de algn genotipo
superior.

Fuente: Modificado de Singh en 1994.

Figura 2.29. Mtodo de Seleccin Gamtica.

118
Seleccin visual de las mejores poblaciones los mejores
cruzamientos y dentro de estos las mejores familias. Se escogen
F1.2 de 5 a 10 plantas superiores que son cosechadas en bulk y
utilizadas para constituir las familias F 1:3.

Familias F1:3 sembradas en surcos individuales. Seleccin de


las mejores familias cosechadas en bulk, que darn suficientes
F1.3 semillas para una evaluacin de rendimiento con repeticin en
la generacin F4.

Seleccin de familias superiores y dentro de estas las plantas


F4 individuales.

xxxxxxxx Plantas cosechadas individualmente F1:5 son sometidas a


F1.5 xxxxxxxx prueba de progenies F6.
xxxxxxxx

Los surcos F5:6 uniformes y superiores son cosechadas en bulk.

F6

F7 Multiplicacin de semilla en viveros de observacin.

Familias F5:8 evaluadas en pruebas de rendimiento en parcelas


F8 de 4 surcos.

Las familias seleccionadas son nuevamente evaluadas en un


F9 ensayo similar a la generacin anterior, pero con mayor rigor
estadstico con repeticiones conducidas en ms de una localidad.

F5:10 Las lneas promisorias son reevaluadas de forma ms exigente y


las superiores lanzadas como nuevas variedades.

Fuente: Modificado de Singh en 1994.


Figura 2.30. Procedimiento alternativo de la seleccin gamtica.

En el caso de la simbologa de las generaciones (F) donde se indica por ejemplo que F6
trata de la generacin 6 de segregacin o autofecundacin, pero F5-6 indica que se trata de
la generacin F6 proveniente de la misma familia F5.

119
La aplicacin de esta metodologa se efectu en el Centro Internacional de Agricultura
Tropical (CIAT), donde Singh et al.,90 utiliza cinco progenitores: EMP
250///carioca/A429//FEB200/ ANT159. Los progenitores para este cruzamiento fueron
seleccionados con el objeto de obtener una variedad de frijol con las caractersticas
siguientes: grano tipo carioca; resistencia a la mancha angular, a la antracnosis, a la roya, a
la bacteriosis comn, al mosaico dorado y a la cigarrita verde; ciclo precoz, porte erecto y
de alta productividad. La variedad EMP250 es una lnea mejorada, con granos tipo carioca,
resistente a la cigarrita verde, de porte erecto y perteneciente a la raza Mesoamrica. La
variedad Carioca es agronmicamente superior y presenta tolerancia a la baja fertilidad de
los suelos. La lnea A429 es resistente al mosaico dorado y pertenece a la raza Durango.
Perteneciente a la raza Mesoamrica, la lnea FEB200 presenta granos tipo carioca, hbito
de crecimiento tipo II, porte erecto y resistencia mltiple a la antracnosis, mancha angular
y roya. La lnea XANT159, de la raza Nueva Granada, es resistente a la bacteriosis comn,
hbito de crecimiento tipo I y de porte erecto. Estos progenitores tienen genes de inters,
que juntados en un nico individuo, pueden resultar en una variedad muy interesante.11 El
programa de cruzamiento de este ejemplo se resume en la Figura 2.29 y el procedimiento
seguido para este caso se presenta en la Figura 2.31.

Las cruzas mltiples son frecuentemente necesarias cuando los progenitores potenciales
no renen todas las caractersticas deseables de la nueva variedad. En estos casos, las
cruzas mltiples comprendiendo varios progenitores son esenciales para que se combinen
los caracteres deseables en una nica poblacin.

Singh88-89 realiz la seleccin de gametos en frijol carioca con resistencia a cinco


enfermedades: Mancha angular de la hoja (ALS), causado por Phaeisariposis griseola
(Sacc.) Ferrari., Antracnosis (ANT), causado por Colletotrichum lindemuthianum (Sacc. &
agnus) Scrib. Mosaico comn del frijol (BCM) que es una enfermedad viral, Quemadura
comn bacteriana (CBB), causada por el Xanthomonas campestris pv. Phaseoli (Smith)
Dye; Mosaico dorado del frijol (BGM), causado por un virus y trasmitidos por Leafhopper
(LHP) Empoasca kraemeri Ross & Moore.
Cosecha de las semillas de la F1 y siembra del remanente una semilla por golpe.
Autofecundacion de c/u de las plantas.

Ensayos de rendimiento en varios ambientes para la obtencin de familias F2 (lneas) y


agrupamiento de 2,3 o 4 familias formando cada grupo una poblacin F 2, identificando y
separando la que tienen buen rendimiento y los caracteres de resistencia buscados.

Evaluacin de los descendientes de la poblacin F2 en forma individual y descarte de las


familias no resistentes y bajo rendimiento.

Seguir seleccionando en ensayos de rendimiento en diferentes ambientes las mejores


lneas de familias hasta lograr individuos que tengan los caracteres deseables de
resistencia, hasta identificar los nuevos cultivares ya sea en el F8 o F10.

Figura 2.31. Proceso de Seleccin en frjol comn (Phaseolus vulgaris) desarrollado por CIAT.

120
En resumen el desarrollo de la poblacin es:

1. Desarrollo de cruces simples, dobles, y mltiples, usando polinizaciones planta a


planta, entre parejas hembras y machos en Palmira (Colombia).

2. Desarrollo de las familias F2 derivados de F1 (F1.2).

3. Plantacin espaciada de la cruza F1 final (BZ9780G X 9792) en Palmira.

4. Cosecha separada en cada planta F1.

5. Seleccin de familias promisorias.

6. Evaluacin de F1.2 para ALS y CBB en Quilichao.

7. Evaluacin de F1.3 para la ANT en Popayn y LHP en Palmira.

8. Seleccin de la segregacin de F1.3 para resistencia a ALS, ANT, CBB, y LHP.


Seleccin para tipo de semilla de carioca.

9. Evaluacin de F1.4 para BGM bajo condiciones de invernadero en Palmira y para


ANT en Popayn.

10. Seleccin de F1.4 que segrega para ALS, ANT, BGM, CBB, y LHP.

11. Desarrollo de la lnea e incremento de la semilla.

12. Plantaciones espaciadas de F1.5 en Palmira.

13. Cosecha separada de cada planta que posee las semillas tipo carioca.

14. Cultivo de la descendencia de plantas de lneas F5.6 en Popayn bajo la presin de


la ANT.

15. Cosecha en Bulk de las lneas uniformes resistentes a ANT, color de la flor, hbito
de crecimiento, madurez y tipo de la semilla.

16. Incremento de semilla de F5.7 en Quilichao y F5.8 en Palmira.

17. Evaluacin de las lneas de F5.9.

18. Separacin de semilleros para BCM, BGM. ALS, ANT, CBB y LHP.

19. Seleccin de 86 lneas que poseen resistencia a BCM, ANT y CBB.

20. Replicacin de las pruebas de rendimiento en siete ambientes.

121
3.9.2. Seleccin recurente en autgamas

El genetista responsable del mejoramiento de una especie autgama se encuentra con la


dificultad de la limitada variabilidad del material vegetal que tiene como funcin de
mejorar. En general, las especies autgamas tienen en realidad una organizacin floral
adaptada a un rgimen de reproduccin en autogamia ms o menos estricta. As, durante el
curso de las generaciones segregantes avanzadas, la estructura gentica de tales especies se
estabiliza a un nivel de homocigosis elevado. Esto significa que las poblaciones de
especies autgamas presentan generalmente una variabilidad gentica poco importante.
Ante este hecho, lo que puede hacer el mejorador es explorar esta variabilidad existente,
generalmente poco importante, o crear una variabilidad ms amplia y mejor adaptada a la
obtencin de los objetivos.4

Si se quiere limitar a explotar solamente a la variabilidad existente, se podran utilizar


algunas tcnicas, tal como la seleccin masal o la seleccin individual. Estos mtodos
permiten mejorar solamente ciertos caracteres, de aportar ciertas ganancias, pero sobre
todo que ellos estn limitados por la heredabilidad de las caractersticas en estudio. Estos
son mtodos simples pero relativamente importantes que se resumen en los siguientes
criterios: a) un nmero limitado de caracteres, con una buena correlacin positiva con el
rendimiento y b) que posean una alta heredabilidad (variacin genotpica muy prxima a la
variacin fenotpica).

Estos tipos de seleccin se tornan totalmente ineficaces si se aplica simultneamente a


caracteres con correlacin negativa. Si al contrario, se desea crear una variabilidad ms
amplia se podra entonces utilizar, la mutacin artificial, las retrocruzas (back cross), las
recombinaciones despus de hibridacin y ltimamente la biotecnologa.

Estos mtodos clsicos utilizados en especies autgamas, pueden en cierta medida


recombinar ligamientos de genes existentes en las formas parentales y establecer as
nuevos balances cromosmicos. Pero de una manera general, las hibridaciones
interespecficas sirven sobre todo para ampliar la variabilidad de las segregaciones,
ofreciendo al seleccionador la posibilidad de seleccin entre los numerosos fenotipos,
muchas veces inesperados. Estos fenotipos exteriorizan frecuentemente caracteres
interesantes pero asociados a caracteres desfavorables. Para romper esta desventaja es
necesario favorecer los crossing over. A partir de la F2 una fraccin importante de los
crossing over son ineficaces puesto que ellos ocurren en la fraccin ya homocigota: 50 %
en la F2, 75 % en la F3, 87,5 % F4 y as sucesivamente.

Todos los genetistas saben bien que es bastante difcil de transferir un carcter, as sea
monofactorial, de una especie a otra, por retrocruzamientos sucesivos sin modificar
ligeramente una parte de las otras caractersticas del genotipo receptor. Por ejemplo, los
genes opaco 2 (o2) y floury2 (fl2) en el maz, los genes g12 y g13 en algodn. Es igualmente
frecuente, que luego de hibridaciones entre parentales genticamente alejados, se constata
en la F2 un retorno anormal a las formas parentales.

Una informacin que puede ser til al genetista para evaluar un mtodo de seleccin,
consiste en conocer la importancia con la que los ligamentos genticos puedan ser rotos si
un conjunto de genes son conservados en un estado de heterocigosis durante un cierto
nmero de generaciones. Esta informacin es particularmente til para un genetista

122
interesado en el mejoramiento de una especie autgama donde las hibridaciones en todo
sentido son difciles y costosos.

Es necesario entonces identificar nuevas formas que permitan originar las


recombinaciones durante un gran nmero de generaciones. Una de estas vas es la
seleccin recurrente simple o seleccin acumulativa aplicada a las plantas autgamas.
El investigador Richmond,83 dentro su programa de mejoramiento interespecfico del
algodn, propone el sistema de seleccin donde se favorece la realizacin de los crossing-
over capaces de romper los ligamientos estrechos existentes a veces entre ciertos genes
favorables y otros dainos que les avecinan.La seleccin recurrente en su sentido amplio
es un mtodo de seleccin de varias caractersticas pero basado en ciclos sucesivos
aumentando sus efectos presentes en los individuos de una poblacin, en las lneas o en la
descendencia de hbridos. La tcnica propuesta por Richmond se aproxima al mtodo de
seleccin recurrente simple o acumulativa.

Fisher,37 Bennett8 y Hanson44-45 estudiando el comportamiento de los cromosomas y su


fragmentacin durante su transmisin, demuestran que es muy difcil romper los
segmentos de cromosomas con genes de poca longitud relativa de separacin.

La Seleccin Recurrente (SR) es un proceso sistemtico de seleccin de individuos o


progenies, dentro de una poblacin de base genticamente variable, seguido de su
recombinacin para formar una nueva poblacin; sta a su vez, se puede utilizar como
poblacin base para iniciar un nuevo ciclo de seleccin. La SR es un proceso dinmico y
continuo, y se puede representar de manera esquemtica en la Figura 2.32, donde C1,
C2,..Cn son los ciclos sucesivos de S.R. a partir de una poblacin inicial (C0). El lmite
para la seleccin est impuesto por el agotamiento de la variabilidad gentica.

Figura 2.32. Ciclo continuo de Seleccin Recurrente (S.R.) simple. C1, C2,..Cn = son
los ciclos sucesivos de S.R.; C0 = Poblacin inicial.

123
La seleccin recurrente en el mejoramiento de las plantas autgamas con alogamia
parcial

Los trabajos de gentica cuantitativa mostraron un agotamiento de la variabilidad gentica


en las poblaciones de donde se extraan lneas para la obtencin de hbridos. Se demostr
luego la importancia de usar la SR con el objetivo de mejorar las poblaciones y en
consecuencia la seleccin de lneas. En resumen, un programa de mejoramiento de estas
especies algamas se puede caracterizar por las siguientes etapas:

- Formacin de poblaciones bsicas.


- Seleccin recurrente.
- Obtencin de lneas mediante autofecundacin.
- Fijacin de genotipos superiores en los hbridos.

Las ventajas de la S.R. en el caso de plantas algamas son las siguientes:

a. Obtencin de mayor variabilidad gentica por el intercruzamiento de mltiples


progenitores.
b. Mayor oportunidad para la recombinacin, debido a los cruzamientos sucesivos.
c. Mayor eficiencia en el aumento de la frecuencia de genes favorables, debido al
proceso repetitivo y acumulativo de seleccin.
d. Mayor facilidad para incorporar germoplasma extico en la poblacin.

En autgamas tales como el sorgo, tabaco, frjol comn.

El mejoramiento empez con la seleccin de lneas puras, basada en la variabilidad natural


existente; posteriormente evolucion hacia los cruzamientos, en su mayora biparentales, a
partir de la generacin F2, las poblaciones se llevan a la homocigosis de donde se
seleccionan las lneas puras. Con el transcurso de los aos hubo un estancamiento en el
mejoramiento, porque los materiales genticamente superiores estaban muy emparentados
(base gentica estrecha) y en 1970 se propone el uso de la SR.

En resumen, un programa de mejoramiento de estas especies se puede caracterizar por


las siguientes etapas:

- Cruzamiento entre progenitores mltiples, includos materiales exticos.

- Seleccin recurrente.

- Obtencin de lneas mediante endogamia.

- Seleccin de genotipos superiores.

La mayor limitacin en algunas especies autgamas es la dificultad para realizar


intercruzamiento (frijol, soya, etc). El proceso de SR requiere de la alogamia en la fase de
recombinacin, siendo necesario un mecanismo viable de cruzamientos al azar, adems
presenta la ventaja de que se puede utilizar lneas puras como cultivares, lo que no es
posible en las especies originalmente algamas.

124
En el caso de la SR fenotpica o masal, los individuos se seleccionan, sobre la base de
caractersticas agronmicas que se pueden identificar visualmente. Las semillas cosechadas
de estos individuos constituyen la poblacin mejorada, siempre que se asegure la
reproduccin y el cruzamiento al azar entre ellos. En la SR basada en la evaluacin de
progenies, el proceso involucra tres fases:

a) Obtencin de las progenies (medios hermanos, hermanos completos, S1, S2, etc.).

b) Evaluacin experimental de las progenies y seleccin de las superiores.

c) Recombinacin de las progenies seleccionadas.

El proceso de recombinacin es mediante:

- Cruzamientos manuales.

- Uso del gen de androesterilidad, e.g. mutante de IR36, gen nuclear recesivo ms; en su
condicin homocigota: msms causa esterilidad del grano de polen.

- Utilizacin de una especie silvestre como fuente. Por ejemplo Phaseolus coccineus wild x
P. vulgaris.

Mtodo de la seleccin acumulativa en autgamas

Este mtodo, tambin llamado mtodo de mejoramiento de poblaciones donde se utiliza


la misma metodologa de la seleccin recurrente en algamas, comprende varios ciclos de
recombinacin destinados a generar, durante el proceso del trabajo, una poblacin cada vez
nueva, heterognea y acumulando progresivamente factores muy ventajosos. Es un mtodo
muy eficaz para la introduccin de numerosos caracteres deseables en el material
cultivado, sobre todo si estos caracteres son de determinismo polignico y si el efecto de
aditividad de los genes concernientes es importante. El xito de este mtodo est por
supuesto condicionado por la posibilidad de realizar muchas cruzas en cada ciclo y poder
crear as, rpidamente, poblaciones polimrficas donde la frecuencia de crosing-over es
importante.51

Anteriormente vimos que en muchas leguminosas alimenticias (por ejemplo en especies


del genero Phaseolus), que las hibridaciones artificiales requieren, de parte de los
ejecutores, de tiempo y de habilidad. La presencia de la esterilidad masculina facilita
ciertamente la adopcin de este esquema de seleccin, pero otras dos condiciones deberan
ser reunidas para un aprovechamiento eficaz de esta esterilidad: la seguridad de un
porcentaje elevado de polinizacin cruzada por insectos y una heredabilidad monognica
simple de la esterilidad. Esta ltima condicin es necesaria para que una gran parte de la
poblacin segregue por el factor de esterilidad, porque este factor se expresa fcilmente y
porque se elimina tambin fcilmente al final del ciclo de seleccin luego que el objetivo
de crear lneas puras se haya cumplido.32

Otra forma de inducir a la alogamia de cultivos predominantente autgamas, para


utilizar la seleccin acumulativa, es el cruzamiento interespecfico, tal es el caso por

125
ejemplo de la cruza [(Phaseolus coccineus wild x P. vulgaris) x P. coccineus], donde la
especie P. coccineus wild tiene cierto porcentaje de alogamia que al cruzar con P. vulgaris
y la retrocruza con P. coccineus, es donde las progenies de estas cruzas adquieren el
carcter de alogamia que permite aplicar en este caso la seleccin acumulativa.18, 19

La aplicabilidad de la seleccin acumulativa puede tambin depender del sistema de


reproduccin especfica de la especie: algunas leguminosas alimenticias, como el pallar,
frijol ayocote (Phaseolus coccineus L.), frijol de palo (Cajanus cajan (L) Millsp.); y haba
(Vicia faba L.) entre otros, se caracterizan por la tasa de alogamia elevada. Se pueden
instalar en los bloques de cruzas alternado, en el tiempo y en el espacio, las lneas
algamas que tienen los caracteres complementarios. Tambin este sistema nos permite
utilizar la obtencin de hbridos y explotar as el fenmeno del vigor hbrido en autgamas.

Se puede citar, tambin el desarrollo de un esquema original para el pallar, llamado


dual populatin scheme. Este esquema consiste en sembrar en el terreno en forma alterna
dos poblaciones, donde una de ellas posee un carcter recesivo caracterstico y la otra
poblacin tiene el carcter dominante. Los hbridos naturales son de fcil identificacin en
cada generacin gracias a la presencia de buenos marcadores genticos (pigmentacin del
hipocotilo, hbito de crecimiento, etc.). En un inicio el material es seleccionado
principalmente por sus caracteres cualitativos; en seguida, la seleccin ser por sus
caracteres cuantitativos. Este mtodo de trabajo se utiliz en Nigeria para transferir genes
de resistencia al mosaico dorado del cultigrupo Big Lima en el pallar hacia otras formas
cultivadas de la especie, pertenecientes a los cultigrupos sieva y papa.32

Utilizacin del diseo cnico o esquema en piramide con dos o ms etapas

El diseo cnico con dos o tres etapas se viene utilizando en el mejoramiento gentico del
frijol comn por instituciones como el INRA de Francia, la FUSAGBlgica y el Programa
de Leguminosas de Grano de la UNALM.

El mtodo de seleccin acumulativa o recurrente simple para el mejoramiento de


especies del gnero Phaseolus consiste en cruzar los mejores individuos resultantes del
primer ciclo de seleccin para generar el material que ser integrado en el ciclo de
seleccin siguiente.

Este mtodo de seleccin se caracteriza por un amplio incremento de la variabilidad


gentica, es importante el aumento de la diversidad pero manteniendo la heredibilidad de
los caracteres por la que fueron seleccionados, ello conduce tambin al aumento de los
alelos favorables o al de uno de los alelos favorables.

Para generar y mantener la variabilidad gentica, el punto de partida es reunir un


nmero importante de genotipos muy diversos y en la etapa siguiente obtener
recombinaciones favorables de los cruzamientos entre los mejores genotipos; lo que se
obtiene al cruzar los mejores individuos resultantes del primer ciclo de seleccin para
generar el material que ser integrado en el ciclo de seleccin siguiente. La ventaja de este
sistema es que el tope est determinado no por el genotipo de una planta fundacional, sino
por la combinacin ms favorable de genes contenida en un grupo de plantas
fundacionales. De esta forma se estara aumentando la probabilidad de obtener individuos
superiores en comparacin con la seleccin dentro de las lneas obtenidas por

126
autofecundacin o por consanguinidad ya que existen ms oportunidades para la
recombinacin.

Para favorecer las recombinaciones, es necesario cruzar los individuos altamente


heterocigotas. Los cruzamientos se realizan utilizando el esquema cnico o en pirmide
con dos y tres etapas (Figuras 2.33 y 2.34). En este ejemplo se parte de la utilizacin de
ocho progenitores. En la primera etapa se cruzan estos ocho progenitores de dos en dos,
obteniendo as la F1. En la segunda etapa se hacen las cruzas amplias para obtener las F'1 y
en la tercera etapa se hacen igualmente las cruzas amplias obteniendo las F''1 . Estas F''1 se
someten a autofecundaciones en casa de mallas o con el embolsado de las inflorescencias
de plantas en el campo y se sigue luego el proceso de seleccin.

Para romper el ligamiento entre alelos favorables y desfavorables, el seleccionador debe


manejar tres poblaciones:

a) Se forma una poblacin con el objetivo de mantener la variabilidad gentica, llamada


poblacin base, la intensidad de seleccin debe ser muy dbil al interior del material.

b) En la otra poblacin se ejerce una presin de seleccin ms intensa, llamada tambin


poblacin de desarrollo de variedades, investigndose para la maximizacin de la
expresin de los caracteres deseables.

c) Poblacin buffer o tampn, es muy importante porque en esta poblacin se prepara y


adapta el material extico, antes de proceder a la introduccin del nuevo material en la
poblacin base. La descendencia proviene del cruzamiento entre los individuos exticos
y los individuos de la poblacin base; al interior de esta poblacin se eliminan las
caractersticas no deseadas de una relativa alta heredabilidad, de preferencia adoptando
una seleccin de tipo genealgico.

Un ciclo de seleccin toma tres aos (S0, S1 y S2), como en la Figura 2.33. haciendo
necesario tres condiciones:

a) Mantenimiento de la variabilidad gentica durante el proceso de seleccin.

b) Efectuar una seleccin temprana con el fin de reducir la duracin de cada ciclo y de
hecho acrecentar el nmero de ciclos de seleccin por unidad de tiempo. Los nuevos
cruzamientos pueden ser juzgados valiosos para seleccin en la F'1 y F''1.

c) Introducir regularmente nuevas fuentes de variabilidad sin reducir el comportamiento


promedio de la poblacin base.

En frijol, la mayor dificultad que se presenta es el bajo coeficiente de multiplicacin


que nos impide tener un nmero suficiente de semillas en etapas tempranas de seleccin.
Esta deficiencia, se puede compensar tambin con una mayor poblacin de plantas por
unidad de rea y un manejo agronmico adecuado.4

127
Figura 2.33. Sistemas de cruzas en pirmide de dos etapas y su evaluacin
en condiciones de campo.

128
Figura 2.34. Organizacin de una seleccin recurrente para frijoles.

129
FORMACIN DE POBLACIONES COMPLEJAS SUPERIORES DE CRUCES
INTERESPECFICOS DEL GNERO PHASEOLUS Y SU COMPORTAMIENTO
AGRONMICO PARA LAS ZONAS ALTOANDINAS DEL PER1

El frijol comn (Phaseolus vulgaris L.) es cultivado bsicamente por pequeos agricultores
de las zonas altoandinas y templadas del Per y de Amrica Latina. En esta regin los
rendimientos son bajos debido bsicamente a la presencia de enfermedades endmicas como
la mancha de la ascochita ocasionada por Phoma exigua var. diversispora, (GTM, KEN &
RWA), adems de las heladas y la sequa, suelos pobres y deficiencias en el manejo
agronmico. Ante este problema en estudios previos se determin que las especies P.
coccineus L. y P. polyanthus Greenm prximos filogenticamente a P. vulgaris, tienen genes
favorables para ser incorporados al frijol comn a travs de introgresiones mediante las cruzas
interespecficas.70

Las poblaciones segregantes de estas cruzas son inestables debido especialmente a su


retorno hacia P. vulgaris, cuando es utilizado ste como progenitor femenino. Sin
embargo, las cruzas recprocas utilizando P. coccineus o P. polyanthus como progenitor
femenino atena este retorno hacia P. vulgaris permitiendo de esta manera incrementar la
frecuencia de recombinacin tales como la tolerancia a Phoma en P. polyanthus y P.
coccineus; con la fertilidad y calidad de grano en P. vulgaris. La tasa de recombinacin es
favorecida por la presencia de insectos del gnero Bombus sp dado el carcter algama de
estas poblaciones hbridas.

Por otra parte las condiciones agronmicas a que es sometido el cultivo del frijol comn,
requiere que las poblaciones mejoradas estn constituidas por un complejo de genes
superiores de manera que la diversidad de ambientes a que son sometidas para su cultivo
permita una produccin sostenida. Los mtodos de seleccin adecuados para mejorar estas
poblaciones son las sugeridas para las plantas algamas basadas en la seleccin familial, la
formacin de poblaciones bulk y la seleccin acumulativa, entre otros. Estas poblaciones
obtenidas deben ser evaluadas luego en las condiciones de manejo agronmico a que son
sometidas por los agricultores y en otros sistemas potenciales.20-21

El objetivo del presente estudio, en primer lugar es la formacin de poblaciones lites


complejas, producto de cruzas interespecficas que recombinan caracteres de P. polyanthus y
de P. coccineus con aquellos de P. vulgaris; en segundo lugar, comprende la evaluacin
agronmica en diferentes sistemas de cultivo de estas poblaciones.

1
Investigacin efectuada dentro del Convenio de colaboracin para el Mejoramiento de especies del gnero Phaseolus
entre la Facult des Sciences Agronomiques de Gembloux, Blgica y la Universidad Nacional Agraria La Molina, Per.
El equipo de investigacin ha sido conformada por Flix Camarena M., Amelia Huaringa J., Luis Chiappe V., Elvia
Mostacero N., miembros de Programa de Leguminosas de la Universidad Nacional Agraria La Molina, y Jean Pierre
Baudoin y Guy Mergeai, miembros de lUnit de Phytotechnie Tropical de la Facult Universitaire des Sciences
Agronomiques de Gembloux-Belgique.

130
Material gentico

El material gentico inicial constituy familias en diferentes generaciones de segregacin y


diferentes combinaciones de cruzas interespecficas del gnero Phaseolus, evaluadas en
diferentes localidades del Callejn de Huaylas, ncash; durante tres campaas agrcolas
sucesivas de los primeros aos de la dcada del 90 (Tabla 2.17).

Dicho material proviene de cruzas realizadas en el Centro Internacional de Agricultura


Tropical (CIAT) en Cali-Colombia, en la Facult Universitaire des Sciences Agronomiques
de Gembloux, Blgica y en la Universidad Nacional Agraria La Molina (UNALM).

Tabla 2.17. Material gentico evaluado durante tres campaas agrcolas sucesivas en las
localidades de Chiquin y Tingua (Callejn de Huaylas).

Tipo de cruza Nmero de Generacin Procedencia


familias segregante
Evaluadas
(Cw x V) x C 250 F4, F5, F6 CIAT, Gembloux
[(Cw x V) x V] x C 150 F3, F4, F5 CIAT, Gembloux
VxPyVxC 39 F3, F4, F5 CIAT, UNALM
Cw = P. coccineus wild, C = P. Coccineus, P = P. polyanthus, V = P. Vulgaris

El presente trabajo, se efectu mayormente en la localidad de Chiquin (ncash), situado a 10


09 latitud Sur, 77 09 longitud oeste y 3300 msnm. Fisiogrficamente es una estrecha
cuenca interandina del ro Pativilca. La temperatura durante el perodo de cultivo del frijol
comn flucta de 3,0 C a 18 C, humedad relativa de 61 a 82 % y una precipitacin media
durante todo el perodo de cultivo de 750 mm. El suelo es franco arenoso, de mediana
fertilidad. Las condiciones ambientales de Tingua y Marcar (Callejn de Huaylas) son
similares a las de Chiquin.51

En la Figura 2.35, se presenta el proceso seguido para la obtencin de poblaciones Bulk


superiores.

Etapas del estudio, comprendre tres etapas

1 etapa: Evaluacin y seleccin del material gentico segregante de cruzas interespecficas.

2 etapa: Formacin de las poblaciones bulk.

3 etapa: Incremento de las poblaciones "bulk" superiores en ncleos aislados de semilla


bsica y su evaluacin agronmica.

131
Etapas N de Plantel de crianza
campaas segregante de cruzas
agrcolas interespecficas

Evaluacin y
Seleccin
1 3

Formacin de
Poblaciones bulk
2 2

Evaluacin Incremento en
Agronmica Ncleos aislados
3 2

Agricultor

Figura 2.35. Proceso seguido para la obtencin de poblaciones bulk superiores.

PRIMERA ETAPA

A. Evaluacin de caracteres cualitativos y seleccin del material gentico segregante


procedente de las cruzas interespecficas.

- Disposicin experimental. La poblacin segregante se dispuso en parcelas de observacin


de un surco por entrada cuya longitud fue de 6 m y 0,80 m entre surcos, la siembra se hizo
entre golpes a 0.50 m con tres semillas por golpe, quedando 1 2 plantas por golpe. Cada 10
entradas se instal la variedad local, de frijol comn Anc 034 como testigo.

- Manejo agronmico de campo. Como son plantas con hbito de crecimiento


indeterminado, se utiliz tutores por cada planta para observar el potencial de produccin en
cada una de ellas. Igualmente para mantener la identidad gentica de la planta se embols las
inflorescencias con papel glycine y se procedi a la autofecundacin evitando as el
cruzamiento por insectos y el viento. Para poder observar en condiciones de campo la
respuesta a los agentes fitopatgenos, no se hizo aplicacin de productos qumicos para el
control de plagas y enfermedades y tampoco se utiliz fertilizantes qumicos. El resto de
labores de campo fue el mismo que se utiliza para el frijol comn en la zona altoandina del
Per.

- Evaluacin morfo-agronmica. Se distinguen dos tipos de evaluaciones:

132
a) Evaluacin de caracteres cualitativos

Color de grano: utilizando metodologa del IBPGR.52-53

Enfermedades: Para el cual se tom en cuenta dos parmetros: intensidad, que es el porcentaje
de la poblacin de plantas que son afectadas por una determinada enfermedad y, severidad
que es la cuantificacin promedia del rea foliar atacada de una planta. Se utiliz la escala
propuesta por Guoging,42 en evaluaciones de germoplasma de haba (Vicia faba L.).

b) Evaluacin de caracteres cuantitativos

Nmero de plantas por parcela, contado al momento de la cosecha.

Das a floracin, es el nmero de das transcurridos a partir de la siembra, hasta que un


50% de las plantas de la parcela presenten una primera flor.

Das a madurez fisiolgica, nmero de das transcurridos desde la siembra hasta la fecha
en la cual el 90 % de las vainas han cambiado del color verde a un color intermedio.

Rendimiento y sus componentes: Rendimiento en grano seco por parcela y por planta,
corregido al 14 % de humedad de grano y expresado en kg/ha.

Nmero de vainas por planta, es el nmero promedio de vainas de 10 plantas competitivas


tomadas al azar de cada entrada.

Nmero de granos por vaina, es el nmero promedio de granos por vaina de 10 plantas
tomadas al azar por cada genotipo. Peso de 100 semillas en gramos, tomados al azar de
cada genotipo.

Como resultados de las evaluaciones durante tres campaas agrcolas en dos localidades, se
observ un rango de variacin bastante amplio para las diferentes caractersticas en
comparacin al testigo P. vulgaris local, tal como se muestra en la Tabla 2.18.

Tabla 2.18. Rango medio de variacin de algunas caractersticas observadas del plantel
segregante de cruzas interespecficas en comparacin al testigo Phaseolus vulgaris local.

Caracter Rango de variacin de material P. vulgaris


segregante Anc 034
Tipo de germinacin E - H E
Das a floracin 72 - 140 99
Das a madurez fisiolgica 150 - 240 180
N de granos/vaina 1,8 - 4,2 4,5
N de vaina/planta 8,0 - 90,0 30,0
Longitud de vainas (cm) 9,1 - 13,5 12,0
Peso 100 semillas (g) 45,0 - 94,0 50,0
Rendimiento g/planta 5,75 - 109,70 70,0
Antracnosis 0,0 - 9,0 9,0
Ascochyta 0,0 - 9,0 9,0
Oidiosis 3,0 - 9,0 9,0
Cigarrita (Empoasca) 5,0 - 9,0 9,0
E = Epigea, H = Hipogea
0,0 = No presenta dao 9,0 = Mximo dao

133
Se observaron familias que son ms precoces que el testigo Anc 034, igualmente hay aquellas
con buen rendimiento y resistentes a ciertas enfermedades que prevalecen en las zonas
altoandinas como antracnosis y ascochyta.

B. SELECCIN

En cada campaa agrcola y en cada localidad se efectu la seleccin masal negativa entre
familias y dentro de familias, eliminando tanto a nivel de campo como de laboratorio
aquellas plantas que presentaron caracteres indeseables, tomando como referencia al
testigo Anc 034; tales como, la susceptibilidad a Phoma y a Colletotrichum (antracnosis),
plantas fuera de tipo, pobre adaptacin y otros caracteres agronmicos indeseables.
Tambin se efectu la seleccin individual de plantas superiores en cada familia. En cada
una de las tres campaas y localidades se hizo la seleccin masal negativa realizada
durante la dcada del 90, tal como se resume en la Tabla 2.19.

Tabla 2.19. Nmero de familias evaluadas y nmero de selecciones por cada campaa
agrcola, efectuadas durante la dcada del 90.

Campaa agrcola Nmero de familias Nmero de selecciones en cada


evaluadas campaa agrcola
1 Campaa 156 61
2 Campaa 148 80
3 Campaa 135 125

Los materiales sobresalientes corresponden a la cruza (Cw x V) x C de los siguientes


genotipos (NI 889 x D 145) x NI16 y de la cruza (NI889 x D145) x NI15 que alcanzan
rendimientos de 4 t/ha y de das a madurez fisiolgica de 150 a 147 das frente al testigo
Anc 034, que alcanz 2,17 t/ha con 180 das a madurez fisiolgica.

SEGUNDA ETAPA

Formacin de las poblaciones "bulk".

Se procedi a formar las poblaciones "bulk" que es la mezcla en igual proporcin de las
familias seleccionadas para lo cual se tom en cuenta las siguientes restricciones:

Caracteres cualitativos: tipo de cruza, hbito de crecimiento, color de grano, tolerancia a


Phoma y Antracnosis.

Caracteres cuantitativos: das a floracin y de madurez de cosecha, componentes de


rendimiento (nmero de granos por vaina, nmero de vainas por planta, tamao de
grano).

Como resultado de evaluaciones y de la seleccin masal en las localidades de Chiquin y


Tingua, Callejn de Huaylas- ncash se formaron 11 poblaciones, tal como se presenta en la
Tabla 2.20. Aqu podemos observar que las poblaciones Bulk 1H y Bulk 2H estn formadas
por el mayor nmero de familias y una cantidad mayor de semilla inicial en comparacin al
resto de poblaciones, lo cual es una ventaja debido a que se cuenta con un mayor nmero de
plantas que permitir incrementar la posibilidad de recombinacin y una estabilidad gentica

134
en la poblacin. Las poblaciones que predominan son las de tipo de cruza (CwxV) x C con
germinacin hipogea, grano de color blanco, negro y lila, de tipo de crecimiento IV, en la
generacin F6 que son las ms avanzadas. Le siguen las cruzas [(CwxV) x V]x C con
germinacin epigea, grano de color bayo y finalmente la cruza (VxP) con grano de tamao
chico, de color bayo tipo IV y germinacin epigea. En general son de grano grande, hbito
de crecimiento tipo IV, en generaciones F5 F6. El color del grano vara de blanco a negro,
de bayo o lila.

2.20. Caracteres morfolgicos de cada una de las poblaciones "bulk".

Denominacin Tipo de Generaciones Numero de Tamao Color Tipo de


Cruza de familias por grano grano germinacin
segregacin poblacin
Bulk 1H (CwxV) x C F4,F5,F6 18 M Bl H
Bulk 2H (CwxV) x C F4,F5,F6 25 G N H
Bulk 3H [(CwxV)xV)]xC F3,F4,F5 06 G CJ E
Bulk 4H (CwxV)xC F4,F5,F6 07 G LJ H
Bulk 5H (CwxV)xC F4,F5,F6 09 M L H
Bulk 6H [(CwxV)xV]xC F3,F4,F5 08 G B E
Bulk 7H VxP y VxC F3,F4,F5 05 C B E
Bulk 8H [(CwxV)xV]xC F3,F4,F5 06 C BJL E
Bulk 9H (CwxV)xC F4,F5,F6 10 G LMN H
Bulk 10H (CwxV)xC F4,F5,F6 12 G LC H
Bulk 11H (CwxV)xC F4,F5,F6 06 M LO H

Color de grano: Bl = blanco, B = bayo, CJ = crema jaspeado, BJL = bayo jaspeado lila, LC = lila claro, L =
lila, LJ = lila jaspeado, LMN = lila manchas negras, LO = lila oscuro, N = negro; Tamao grano: M =
mediano, G = grande, C = chico; Tipo germinacin: E = epigea, H = hipogea

TERCERA ETAPA

Incremento y evaluacin agronmica.

A. INCREMENTO DE LAS POBLACIONES BULK SUPERIORES EN NCLEOS


AISLADOS DE SEMILLA BSICA.

Luego de formadas las poblaciones Bulk constituidas por genes favorables en relacin al
testigo Anc 034, se procedi a su incremento bajo dos modalidades: a) en ncleos aislados
distanciados en no menos de 100 m de otro cultivo de frijol comn y b) con embolsado de las
inflorescencias.

El incremento de las 11 poblaciones bulk se hizo bajo dos modalidades: en lotes


aislados y con el embolsado de las inflorescencias. Algunas poblaciones se incrementaron en
una cantidad inicial bastante baja, originando por lo tanto baja cantidad de plantas, limitando
en consecuencia el proceso de recombinacin durante la meiosis por el proceso de
autogamia. Las poblaciones se formaron con elevado nmero de plantas de manera que se
logre un proceso elevado de intercruzamientos permitiendo un flujo elevado de genes en
equilibrio dentro de una poblacin genticamente variable.

En cuanto a la segregacin de granos de otros colores, varan desde el 5 % en el Bulk 7H


hasta en 44 % el Bulk 10H. Las familias Bulk-1H y Bulk-2H tienen una segregacin del 15 y

135
11 % respectivamente, valores intermedios de segregacin de todas las poblaciones. Durante
las observaciones y evaluaciones de estos experimentos se determin una asociacin entre el
color de pigmentacin de la planta con su color de grano, ejemplo, plantas con pigmentos de
color violeta oscuro tienen grano de color negro y plantas sin pigmentacin tienen el grano
blanco. Este caso que puede ser debido a una pleitropia se utiliz para las selecciones de
planta segn color de grano antes de la floracin.

A travs de estos ensayos se ha llegado a determinar dos poblaciones superiores: Bulk


1H de grano de color blanco y Bulk 2H de grano de color negro, ambas de tamao grande.
El Bulk 1H que tom la denominacin comercial de UNAGEM-1 en honor al convenio
UNALM y Gembloux, se viene incrementando en la localidad de Caracancha, Matucana a
2800 msnm y a 80 km de Lima. En esta zona no se cultiva el frijol comn por tanto no hay
posibilidad de cruzamiento con otras variedades de frijol. El Bulk 2H que tom la
denominacin de UNAGEM-2 se increment en la localidad de Obrajes-Chiquin, tomando
la precaucin de estar aislado a una distancia no menor de 100 m de otro cultivo de frijol
comn. En la Figura 2.36 se presenta las cruzas interespecficas realizadas para la obtencin
de las dos variedades UNAGEM1 y UNAGEM2.

Estos lotes aislados que son de incremento y recombinacin son favorecidos por la
presencia de insectos del gnero Bombus sp. Este proceso de recombinacin evita que las
plantas de las nuevas poblaciones retornen hacia el carcter de uno de sus progenitores
originales. Aqu se mantiene la heterogeneidad y la heterocigosis de la poblacin evitando la
aparicin de caracteres negativos por endocra, carcter que todava puede haber quedado en
el proceso de seleccin.

En estas poblaciones se pueden ir eliminando todava las plantas indeseables y las


segregantes por granos de otros colores; esta eliminacin, es de preferencia antes de la
floracin. Tambin se puede ir incorporando selecciones nuevas que pueden ir mejorando
estas poblaciones.

Los rendimientos ms altos se obtuvieron con UNAGEM-2, luego con UNAGEM-1


conducidos en los ensayos en monocultivo con tutores que llegaron a 2970 y 1470 kg/ha
respectivamente. En segundo lugar se obtiene altos rendimientos en los ensayos conducidos
sin tutor y finalmente en asociacin con maz. Sin embargo, como el sistema de cultivo que
se utiliza en la zona altoandina es con maz se viene realizando ensayos adicionales
estudiando la oportunidad de siembra de frijol y de maz, y la modalidad de siembra,
tratando de reducir el efecto competitivo de ambas especies tendiendo a un efecto
complementario de ellas.

Igualmente en la Tabla 2.21, se observa que estas nuevas variedades son ms precoces
que el frijol local y el tamao de granos es mayor que el testigo. En cuanto al aspecto
sanitario se observ que son tolerantes a la ascochyta y a la antracnosis, de fecundacin
alogama y de perodo vegetativo perenne.

136
X

Phaseolus coccineus Phaesolus vulgaris


Wild

F1 X

Phaseolus coccineus

UNAGEM 1 UNAGEM 2

Figura 2.36. Secuencia de cruzas en la obtencin de las variedades UNAGEM1 y


UNAGEM2.79

B. Evaluacin agronmica en condiciones de campo

Para la evaluacin agronmica a nivel de campo de estas poblaciones Bulk se utiliz


aquellas poblaciones que tenan la cantidad de semillas necesarias para los ensayos en
diferentes localidades: Chiquin, Marcar (Callejn de Huaylas), Matucana (Provincia de
Lima) y Cajamarca, se utiliz el diseo experimental de bloques completamente
randomizados con tres repeticiones, cuatro surcos por parcelas de 6 m de largo y 0,80 m entre
surcos; 0,50 m entre golpes con tres semillas por golpe. Como variedad testigo se utiliz el
Canario local Anc 034 de tipo indeterminado.

Durante las campaas agrcolas de 1993 hasta 2000, se hizo los anlisis comparativos de
rendimiento y de manejo agronmico en diferentes modalidades de cultivo en cuanto al uso
de tutores.

De las 11 poblaciones "bulk" evaluadas, llegaron a destacar las poblaciones Bulk 1H y


Bulk 2H que se denominaron como variedades UNAGEM-1 y UNAGEM-2. En la Tabla
2.21, se presenta el comportamiento agronmico de estas nuevas variedades en comparacin
al testigo Anc 034.

137
Tabla 2.21. Resultados promedios de ensayos agronmicos realizados durante los aos
1993 a 2000 con las variedades UNAGEM-1 y UNAGEM-2.

Ensayo en monocultivo sin tutor

Variedad N de das Rendimiento Porcentaje Peso de


a floracin (kg/ha) sobre el 100
testigo granos (g)
UNAGEM-1 94 984 235 71
UNAGEM-2 94 1 712 408 78
Anc 034(T) 124 419 100 47

Ensayo en monocultivo con tutores

Variedad N de das Rendimiento Porcentaje Peso de


a floracin (kg/ha) sobre el 100
testigo granos (g)
UNAGEM-1 90 1470 176 75
UNAGEM-2 96 2970 356 76
Anc 034(T) 122 835 100 46

Ensayo conducido en asociacin con maz

Variedad N de das Rendimiento Porcentaje


a floracin (kg/ha) sobre el
testigo
UNAGEM-1 67 255 130
UNAGEM-2 62 343 175
Anc 034(T) 85 195 100

El coeficiente de correlacin del rendimiento y sus respectivos componentes nos indican que
el nmero de vainas por planta es uno de los ms importantes, seguido del tamao de grano.
Igualmente nos indica que la precocidad, medida en das a floracin y madurez fisiolgica es
importante para un mayor rendimiento (Tabla 2.22).

Tabla 2.22. Coeficiente de correlacin simple entre el rendimiento de grano seco y


sus componentes.

Parmetros r
N vainas/planta 0,81 **
N semillas/vaina - 0,47
Peso 100 granos 0,57*
Das a 1ra flor - 0,75**
Das a madurez -0,62*
fisiolgica

138
En la Tabla 2.23, se observa que la antracnosis persiste en las variedades UNAGEM-1 y
UNAGEM-2, sin embargo es bastante menor que en la variedad testigo Anc 034. Esto es
debido a que en el proceso de seleccin se va eliminando plantas con genes mayores,
permitiendo as la acumulacin de genes menores. Este proceso nos permite obtener
variedades con una resistencia duradera mayor en comparacin a la incorporacin de genes
mayores.

Tabla 2.23. Respuesta en Porcentaje de UNAGEM-1 y UNAGEM-2 a tres


enfermedades del frijol.

Ascochyta Antracnosis Roya


Variedad S I S I S I
UNAGEM-1 0,0 0,0 2,6 100 0,0 0,0
UNAGEM-2 0,0 0,0 2,4 100 0,0 0,0
ANC 034 (T) 55,0 18,0 62,0 100 68,0 100,0

S = severidad, I = intensidad, 0 = sin ataque, 100= fuerte ataque

En la Tabla 2.24, se expone los resultados del anlisis de variancia del ensayo conducido
con o sin tutor ejecutado en Chiquin durante la dcada del 90. Observamos que el uso de
tutor es altamente significativo, frente a la no utilizacin en las cinco caractersticas. Esto
es importante para la obtencin de semillas de buena calidad por su buena sanidad y libre
de pudriciones por la humedad del suelo en comparacin a la no utilizacin de tutores. En
la Tabla 2.24, tambin se observa una respuesta significativa a la interaccin uso de tutores
por genotipo, es decir que nuestro material gentico responde diferentemente al uso de
tutores.

Tabla 2.24. Anlisis de Variancia de Rendimiento de grano seco y sus componentes


del ensayo conducido en Chiquin.

Fuente de G.L DMF Peso de100 NV/PT G/V Rendimiento


Variacin semillas1
Tutor (T) 1 0,144 ** 387,05** 0,143** 0,025** 3360,34**
Block/T 4 0,009 42,31 0,008 0,007 49,47
Genotipo (G) 6 1,291 ** 2627,73** 0,065** 0,l05** 3217,66**
TxG 6 0,019 * 101,41* 0,021* 0,007* 113,79*

G.L. = Grados de libertad, DMF = Das a madurez fisiolgica, 1Peso de 100 semillas en gramos,
NV/PT = N de vainas por planta, G/V = N de granos por vaina, * Significativo al 5 %, **
Significativo al 1 %.

Por otra parte, en estudios citolgicos, de caracterizacin molecular y de taxonoma


numrica de estas nuevas variedades (UNAGEM-1 y UNAGEM-2) se determin que el
nmero de cromosomas no vara respecto al de sus padres (2n = 22) debido a la
compatibilidad gentica entre sus padres. La tcnica RAPD's permiti determinar que estos
hbridos presentan un mayor aporte gentico de los parentales P. vulgaris DOR145 y
BAT1274 confirmado con el anlisis de similitud taxonmica. La seleccin realizada para
la identificacin de los hbridos interespecficos permiti conservar la variabilidad presente
en el pool gentico de los parentales.85

139
En conclusin, se obtuvieron dos nuevas variedades de frijol UNAGEM-1 y UNAGEM-2
dentro del convenio de colaboracin entre la Facult Universitaire des Sciences
Agronomiques de Gembloux, Blgica (FUSAGX) y la Universidad Nacional Agraria La
Molina (UNALM) para el mejoramiento gentico de especies del gnero Phaseolus. Estas
variedades fueron resultado de cruzas interespecficas entre (Phaeolus coccineus wild x P.
vulgaris) x P. coccineus y de cruzas P. Polyanthus y P. vulgaris que presentaron las
siguientes caractersticas:

- Resistencia elevada a las enfermedades endmicas de las zonas altoandinas tales como
la mancha de la ascochyta y la antracnosis, no requiriendo por tanto de la aplicacin de
insumos qumicos, as como tolerancia a la sequa y a las bajas temperaturas.
- Mediante la tcnica RAPD'S y de similitud taxonmica se determin que los parentales
DOR145 y BAT1274 tienen un mayor aporte gentico en los hbridos UNAGEM-1
UNAGEM-2.66,85
- Precocidad con 90 das al inicio de floracin frente a 120 das del testigo ANC 034.
Tambin estos hbridos tienden a ser perennes, caracterstica de P. coccineus y P.
polyanthus cuyo ciclo vegetativo puede llegar a 3 4 campaas agrcolas dependiendo
de la sanidad. La caracterstica de precocidad fue heredada de P. vulgaris y el tipo
perenne de P. coccineus y P. polyanthus.
- Alto potencial de produccin: UNAGEM-1 de grano blanco tamao mediano con
rendimiento de 2 t/n asociado con maz y 2,5 t/ha con tutores. UNAGEM-1 de
grano negro, tamao grande con rendimiento de 2 t/ha asociadas con maz y 3 t/ha
con tutores.
- Los granos son grandes de color blanco (UNAGEM-1) y negro (UNAGEM-2) de
mucha perspectiva para el consumo interno y la exportacin. Se vienen elaborando los
precocidos, para reducir el tiempo de coccin.30
- Ante factores externos como sequa, heladas y daos de animales e insectos, la parte
vegetativa tiene poder de recuperacin por su tipo de raz pivotante, vigorosas,
profundas y abundantes con capacidad de almacenar reservas; este carcter ha sido
heredado de P. coccineus y P. polyanthus.
- La fecundacin es algama permitiendo la recombinacin constante de genes positivos
en las poblaciones.
- Capacidad de explorar suelos pobres por las mismas caractersticas enumeradas
anteriormente.
- Consumo de grano en verde y en seco y si el clima es favorable la produccin es
continua durante todo el ao.
- Vegetacin abundante, que puede ser incorporada al suelo.
- Es de produccin sostenible con proteccin del ambiente.

Como estas variedades lite estn en proceso de recombinacin con genes favorables, se
contina haciendo seleccin utilizando la metodologa de Anillos Hexagonales (Honey
Comb Design) con trabajos de investigacin de Alegra2 y Porta;78 adems de otros trabajos
agronmicos y de evolucin como son Retegui,82 Maldonado,64 Pinchi,77 entre otros.

140
3.9.10. Mejoramiento por resistencia cuantitativa o duradera a patgenos

Caracteres generales

La mayora de los patgenos que afectan los cultivos son del tipo especializado que se
caracterizan por tener una gama limitada de hospederos. La resistencia a un patgeno
especializado casi siempre es eficaz slo contra ese patgeno. Los problemas que
obstaculizan la obtencin de resistencia duradera son causados principalmente por
bacterias y hongos especializados que atacan a sus hospederos en forma biotrfica o hemi-
biotrfica, es decir, que parasitan clulas vivas.

La resistencia a patgenos especializados puede clasificarse en dos tipos: 1) Resistencia


de hipersensibilidad, que por lo general es especfica a una raza del patgeno, no duradera
y conferida por genes mayores, y 2) Resistencia de no hipersensibilidad, que suele ser
cuantitativa, ms duradera y conferida por varios genes que tienen pequeos efectos.

Se toma como ejemplo el patosistema cebada-roya de la hoja (Puccinia hordei), en el


que son frecuentes ambos tipos de resistencia, en especial el segundo. Los genes que
controlan la resistencia de hipersensibilidad son genes mayores, especfica de la raza y no
duraderos. Estos genes entran en operacin despus de que se forman los haustorios, o sea
que son un mecanismo post-haustorial. La resistencia parcial es controlada por muchos
genes (poligenes), es muy duradera y entra en operacin antes de que se formen los
haustorios, o sea que es un mecanismo pre-haustorial. No es difcil seleccionar para
obtener resistencia parcial. Incluso una seleccin moderada contra la susceptibilidad
result sorprendentemente eficaz. Se han obtenido, mediante la acumulacin de poligenes,
niveles muy altos de resistencia parcial que es eficaz en todas las zonas productoras de
cebada. La que sigue, es una recomendacin general respecto a la seleccin para obtener
resistencia duradera. En poblaciones genticamente heterogneas, la seleccin debe
orientarse a eliminar los genotipos ms susceptibles (seleccin contra la susceptibilidad) y
aquellos que no muestran enfermedad. Estos ltimos, pueden ser portadores de genes
mayores y, por lo tanto, no deben seleccionarse. El resto de los genotipos se seleccionan
para otras caractersticas agronmicas deseables. Si esto se hace en forma continua, genes
menores se acumularn en el programa de seleccin por resistencia.

Todas las especies vegetales y por lo tanto todos nuestros cultivos poseen mecanismos
de defensa que les permiten resistir el ataque de patgenos y plagas. Estos mecanismos
estn dirigidos a combatir una gran diversidad de parsitos, o sea que son de resistencia
amplia. Las fito-alexinas que producen casi todas las especies vegetales, brindan este tipo
de proteccin. Cada especie produce sus propias fito-alexinas; por ejemplo, el frijol
produce faseolina, la arveja produce pisatina, etc. Algunos patgenos han vencido las
resistencias amplias gracias a que se han especializado en una especie que tiene un
mecanismo de resistencia especfica. Por ejemplo, la Faseolina del frijol no afecta la roya
del frijol (Uromyces phaseoli), y es degradada y/o tolerada por Colletotrichum
lindemuthianum y Fusarium solani f. sp. Phaseoli.

La mayora de nuestros patgenos importantes son del tipo especializado que se


caracteriza por tener un rango muy limitado de hospederos. Son especialistas tpicos, la
roya de la hoja de la cebada. (Puccinia hordei), y Phytophthora phasseoli, que son
patgenos de la cebada cultivada y la silvestre y de habas, respectivamente. Son ejemplos

141
de patgenos no especializados o generalistas; Phytophothora cinnamoni, que causa la
pudricin de raz, en mas de 100 especies leosas de familias completamente distintas y
Sclerotinia sclerotiorum, que afecta a cientos de especies pertenecientes a ms de 60
familias. Los problemas con la durabilidad o falta de durabilidad, surgen, en su mayora, en
las resistencias a patgenos especializados, sobre todo los hongos biotrficos y hemi-
biotrficos. Dado que las enfermedades ms importantes que afectan nuestros cultivos son
provocadas por patgenos especialistas, la mayor parte del mejoramiento para obtener
resistencia, se centra en ellos.

Terminologa:

Puesto que muchos trminos son usados en la relacin de la planta husped con el parsito,
el significado de varios de estos trminos se presenta a continuacin:
- Resistencia: Son mecanismos que operan despus que el parsito ha establecido
contacto con el hospedante y que interfieren y por tanto reducen el
crecimiento y/o desarrollo del parsito.
- Resistencia cuantitativa: Ocurre cuando los hospedantes muestran un rango de
variacin contina de resistencia, de extremadamente susceptible a muy resistente.
- Resistencia parcial: Equivale a la resistencia cuantitativa.
- Resistencia de raza no especfica: Resistencia que opera para todas las razas,
patotipos o aislamientos del patgeno. No existe interaccin de cultivar x raza.
- Resistencia de raza especfica: Resistencia que opera para ciertas razas o
patotipos del patgeno. Existe interaccin de cultivar x raza.
- Resistencia duradera: Resistencia que permanece efectiva por largos perodos de
tiempo cuando es expuesta a patgenos en gran escala bajo condiciones de
crecimiento prevalentes.
- Resistencia estable: Resistencia que se expresa bajo amplio rango de condiciones.
- Resistencia a patgeno especfico: Resistencia que opera para algunas especies de
patgeno pero no para otras. La resistencia en arveja para Ascochyta pisi no
opera para Ascochyta pinoides.
- Resistencia amplia: Resistencia efectiva para todos los grupos de patgenos.
Ejemplos; taninos en frijol y otros cultivos, terpenos en rboles de pino.
- Patogenicidad: Es la habilidad del patgeno para crecer y explotar su hospedante.
- Virulencia: La habilidad de una raza a ser patognica solamente en ciertos
genotipos del hospedante.
- Patgenos especializados: Patgenos que tienen un estrecho rango de
hospedantes, Puccinia hordei es slo patognico en cebada.
- Patgenos generalistas: Patgenos que tienen un amplio rango de hospedantes
incluyendo especies de varias familias. Ejemplos son Rhizoctonia solani y
Sclerotinia sclerotiorum.

Resistencia durable a patgenos: gentica y mejoramiento

Mecansmos de defensa

Las plantas son explotadas por un gran nmero y variedad de organismos. La forma en que
estos organismos usan las plantas vara enormemente, de una relacin parastica ntima a
herbvoros accidentales. Las plantas han desarrollado un amplio rango de mecanismos de
defensa:

142
Mecanismos de escape: tales como olor o sabor desagradable, pubescencia,
espinas, cutculas gruesas, etc., son especialmente usados en contra de parsitos
animales con habilidades sensoriales.
Mecanismos de resistencia: reducen el crecimiento y/o desarrollo del parsito, son
casi siempre de naturaleza bioqumica. Es universalmente usado por todas las
plantas para casi todos los parsitos. En contra de patgenos, la estrategia de
resistencia es predominantemente de defensa.

Con los patgenos, la resistencia debera de ser usada para restringir el dao ocasionado
por estos. Pero cuando los mejoradores comenzaron a usar la resistencia, ellos
experimentaron rpidamente que la resistencia introducida fue vencida. La poblacin del
patgeno fue capaz de adaptarse a muchas resistencias usadas por el mejorador. Sin
embargo, hubo grandes diferencias en los niveles de las resistencias vencidas.

Medida de Resistencia

Normalmente no es posible medir la cantidad de patgeno presente en un determinado


momento comparado con la cantidad presente en un cultivar testigo extremadamente
susceptible. Normalmente no es posible medir la cantidad de patgenos debido a que el
patgeno no es visible o es slo parcialmente visible. Sin embargo, se puede medir los
efectos directos o indirectos del patgeno sobre el hospedante, si el patgeno no es visible.
Los patgenos pueden ser clasificados en tres tipos:

1. Patgenos parcialmente visibles: Tales como los ectoparsitos. Ejemplo:


patgenos causantes de la oidiosis, de la royas y los carbones.
2. Patgenos cuyos efectos directos pueden ser medidos: El patgeno no es
visible pero su presencia es reconocible por la decoloracin del tejido. Ejemplo:
tizn tardo de la papa.
3. La cantidad de patgeno puede ser medida a travs de los efectos indirectos
sobre el huesped: Medicin sobre el sntoma de la enfermedad. Es as que se
define como efecto directo al tejido invadido por el patgeno que muestra signo y
efecto indirecto a los sntomas de la enfermedad.

Por la experiencia se ha aprendido que, midiendo la cantidad de tejido afectado por los
patgenos del grupo 1 y 2 en papa se tiene un buen estimado de la cantidad de patgeno
presente. Por otro lado, la evaluacin de los verdaderos sntomas de la enfermedad, los
efectos indirectos, causados por patgenos como virus, es la forma menos confiable de
medir la cantidad de patgeno presente.

Factores que interfieren en la cantidad de patgeno presente

i. Interferencia entre parcelas: La evaluacin para resistencia se realiza generalmente en


pequeas parcelas adyacentes. Una entrada muy resistente puede recibir abundante inculo
si tiene como vecino un cultivar altamente susceptible. La cantidad de patgeno en la
entrada altamente resistente puede ser incrementada considerablemente con patgenos
presentes en el aire, esto da como resultado una subestimacin del nivel de resistencia de
esta entrada. En el caso de roya de la hoja de cebada donde el rea de la hoja afectada
consiste de pequeas infecciones de esporulacin, la interferencia entre parcelas es muy
pronunciada. En parcelas adyacentes, con interferencia entre parcelas, el rango de

143
interferencia se increment slo en 16 veces. En parcelas aisladas sin interferencia de
parcelas el rango se increment en 1000 veces. Sin embargo no todos los patgenos
presentes en el aire causan interferencia entre parcelas.
ii. Precocidad: Si las entradas difieren considerablemente en precocidad, el periodo de
exposicin del patgeno vara considerablemente si la evaluacin de todas las entradas se
realiza generalmente al mismo tiempo.

iii. Densidad de inculo: Puede ocultar pequeas pero reales diferencias en resistencias si
altas densidades de inculo son usados. A densidades muy bajas, los escapes pueden ser
confundidos con resistencia.

iv. Hbito de crecimiento: Puede afectar la evaluacin de la enfermedad. Cultivos densos y


plantas pequeas tienden a incrementar la cantidad de tejido afectado, mientras que
cultivos ralos y plantas altas tienden a decrecer.

v. Efecto del sistema de labranza sobre la durabilidad de la resistencia: Mientras ms


inculo del patgeno est presente, mayor es la posibilidad que puedan aparecer nuevas
razas del patgeno. En Europa Oriental el virus de la papa se ha mantenido a un nivel
razonablemente bajo debido a un buen control en el sistema de produccin de semilla de
papa. Los genes de resistencia de raza especifica a los virus A, X e Y no muestran ningn
signo de prdida de la efectividad. El buen control de los niveles de virus probablemente
contribuyeron a la durabilidad de estos genes de resistencia porque no hay variabilidad
patognica como en la regin andina.

vi. Efecto del patgeno sobre la durabilidad de la resistencia: Los patgenos pueden ser
agrupados de varias formas, basado en lo siguiente: taxonomia, formas de vida del
parsito, grado de especializacin, formas de dispersin, etc. Existe una relacin entre
estos aspectos y la frecuencia con que ocurre la resistencia no durable: patgenos donde
se desarrollan fcilmente nuevas razas (grupo 1); patgenos donde slo se conocen unas
pocas razas, la resistencia vencida no es comn o no ocurre todava (grupo 2); y
patgenos donde no existen razas conocidas y no hay reportes sobre resistencia vencida
(grupo 3).

vii. Resistencia durable: La resistencia de genes mayores, de raza especifica, durable y la no


durable pueden presentarse juntas o por separado. La resistencia polignica a patgenos
especializados aparentemente va junto con pequeos efectos de raza especfica sin afectar
la durabilidad de esta resistencia. No se ha reportado que existe erosin de resistencia
cuantitativa. La resistencia cuantitativa no es sinnimo de resistencia general, muestra
pequeos efectos de raza especfica y es siempre hacia un patgeno especfico.

Tipos de resistencia a patgenos especializados

En la literatura encontramos una amplia coleccin de trminos como por ejemplo,


resistencia en plntula, en planta adulta, en tejido maduro, global, en campo, completa,
parcial, cuantitativa, general, especfica a la raza, no especfica a la raza y duradera, lo cual
sugiere que existen muchos tipos de resistencias. Los estudios realizados con la cebada y
Puccina hordei, indican que este cereal utiliza por lo menos, dos mecanismos claramente
diferentes contra este patgeno:

144
Resistencia de hipersensibilidad, como consecuencia a la muerte rpida de las
clulas invadidas y de sus vecinas, lo cual provoca una lesin necrtica.
Resistencia de no hipersensibilidad, puesto que no hay necrosis rpida.

El patosistema cebada-Puccinia hordei

El patgeno Puccinia hordei es un patgeno tpico, pues parasita slo algunas especies de
Hordeum y la cepa que ataca la cebada cultivada puede atacar la cebada silvestre, pero no a
otras especies de Hordeum. Las cepas que se usan como hospedero de otras especies de
Ornithogalum, slo son importantes en el Cercano Oriente, el sureste de Australia y,
posiblemente, el Norte de frica. La recombinacin sexual no ocurre en las otras regiones
y, por consiguiente, la evolucin gentica del patgeno depende de la mutacin. En otras
regiones, su importancia suele ser entre muy poca y regular. Se han reconocido dos tipos
de resistencia, la de hipersensibilidad y la de no hipersensibilidad.

A. Resistencia de hipersensibilidad

Este tipo de resistencia es controlado por genes mayores (genes Pa); caracterstica de la
variedad de cebada Sundace; sin embargo, son diferentes de los nueve genes mayores de
resistencia, pues la resistencia es especifica a la raza, dado que ninguno de los genes otorga
proteccin contra todas las razas y definitivamente no es duradera. Cuando se utiliz una
variedad comercial con un gen mayor de resistencia, el factor de virulencia
correspondiente a este gen apareci rpidamente en el patgeno. La raza ms dominante a
nivel mundial posee virulencia a seis de los nueve genes conocidos de resistencia.72 Se ha
registrado virulencia a stos nueve genes.

Los genes de la hipersensibilidad entran en operacin despus de la penetracin a las


clulas que sern parasitadas. La penetracin a travs de los estomas, la formacin de las
vesculas debajo de los estomas, la formacin de las hifas de infeccin primaria y de las
clulas madres del haustorio son iguales tanto en el caso de variedades que tienen genes Pa
eficaces, como en el caso de los que no los tienen. La diferencia entre un hospedero
susceptible y uno resistente se vuelve evidente slo despus de la penetracin de las clulas
hospederas por un filamento producido por la clula madre del haustorio y la formacin de
ste dentro de la clula hospedera.

En un hospedero resistente, la clula que ha sido penetrada, junto con sus vecinas,
comienzan a desintegrarse y a volverse necrticas. Las hojas de la cebada muestran
pequeas lesiones necrticas debido a la presencia de genes Pa en la planta (Pa1, Pa2, Pa3 y
Pa4). Todos estos genes Pa, pueden clasificarse como de resistencia global, especfica a la
raza y no duradera.

B. Resistencia de no hipersensibilidad

Este tipo de resistencia a menudo es descrito como resistencia parcial, que es una forma de
resistencia cuantitativa. Se expresa en forma de reaccin susceptible a la infeccin en las
plantas en todos los estados de su desarrollo. Los urediosporos son ms pequeos, ocurren
en menor nmero, aparecen ms tarde y esporulan durante un perodo ms breve
(componentes de la resistencia parcial) y no se observa la reaccin caracterstica de
hipersensibilidad (necrosis).

145
Una epifitia es el resultado colectivo de los mismos elementos que intervienen en las
enfermedades de las plantas: plantas hospedantes susceptibles, un patgeno virulento y
condiciones ambientales favorables durante un perodo bastante, aunque estos no
contribuyen por igual a su desarrollo. El nmero de soros (pstulas) y en especial el
perodo de latencia, determinan la rapidez con la que se desarrolla la epifitia, ya que las
primeras esporas producidas por una pstula recin formada son de mucha mayor
importancia para el desarrollo epiftico que las generadas por esa misma pstula una o dos
semanas despus. Por ejemplo, en el caso del genotipo susceptible L94, este desarrollo
tarda entre cuatro y seis semanas, lo cual corresponde de tres a cinco ciclos de produccin
del patgeno, dado que el perodo de latencia dura entre siete y nueve das. En ese mismo
perodo, el genotipo Vada, de resistencia parcial, permite que ocurran slo dos o tres ciclos
y esto, junto con el hecho de que hay menos pstulas que producen menos esporas, da por
resultado la gran diferencia en la severidad de la enfermedad observada en las dos
variedades.

La resistencia parcial es de herencia polignica porque su componente principal


tambin se hereda polignicamente.71,74 Parlevliet & van Ommeren,76 tambin mostraron
que los dos componentes ms importantes de la resistencia parcial, el nmero de soros por
unidad de rea (densidad de infeccin o frecuencia de infeccin) y el periodo de latencia
son controlados por los mismos poligenes. Esto significa que la resistencia parcial es
conferida principalmente por los poligenes que controlan el periodo de latencia y la
densidad de infeccin.

Desde un punto de vista histolgico, la resistencia parcial es claramente diferente de la


resistencia de hipersensibilidad. Al comparar variedades parcialmente resistentes con otras
extremadamente susceptibles, no existe diferencia en el desarrollo de las unidades de
infeccin (colonias fungosas que se originan en esporas individuales) hasta la formacin de
las clulas madres de haustorio. Sin embargo, despus de esta etapa se presentan
diferencias claras, pues en las variedades parcialmente resistentes, una porcin bastante
grande de las clulas madres no sern penetradas porque estas producen un engrosamiento
de la pared celular para evitar la penetracin. Dado que una proporcin considerable de los
intentos de penetrar las clulas hospederas fracasa, se reduce el nmero de colonias que se
establecen y forman pstulas visibles, en tanto que el tiempo requerido para que estas
pstulas aparezcan aumenta como resultado del poco crecimiento, lo cual causa perodos
de latencia ms largos.

La resistencia parcial puede describirse como resistencia pre-haustorial y la de


hipersensibilidad como resistencia post-haustorial, lo cual indica que hay diferencias claras
en los mecanismos que las gobiernan.

La resistencia parcial a la roya de la hoja en la cebada es muy duradera. No hay


indicaciones de que esta resistencia se erosione;71 las evaluaciones realizadas basadas en
las listas holandesas de variedades corroboran este hecho. Las variedades con resistencia
parcial, como Hasso, con un nivel de resistencia comparable a la de Julia, conservan su
resistencia a travs de los aos. En la actualidad, Vada, que recibira un calificativo de
ocho, si se incluyera en la lista de variedades, es tan resistente como lo era en el momento
de su introduccin hace 40 aos. Ya no se cultiva, pero sus genes de resistencia parcial
estn presentes en muchas variedades de cebada europea;75 esto muchas veces, se aduce
como razn para no seleccionar, para obtener resistencia cuantitativa, pero esta razn no es
vlida, como se mostrar mas adelante.

146
A menudo se ha sugerido que los tipos cuantitativos y polignicos de resistencia no son
especficos a la raza. Sin embargo, la resistencia parcial a la roya de la hoja en la cebada no
es ni especfica ni no especfica a la raza. Parlevliet75 demostr que hay pequeas
interacciones diferenciales para la resistencia parcial en los aislamientos de roya de la hoja
de cebada. Si fuese el caso de la no especificidad a la raza, la severidad de la enfermedad
en la variedad Julia en respuesta a la raza 18, debera haber sido del 3 %; sin embargo, el
valor observado fue demasiado alto y causado por un perodo de latencia que, en Julia y
para esa raza, fue muy corto.75 Esto sugiere que uno de los poligenes que confieren un
perodo de latencia ms largo fue neutralizado por esta raza. La severidad de la enfermedad
que se observ en la variedad Berac en respuesta a la Raza 22, tambin fue demasiado alta,
pero no significativa. Este valor excesivamente alto se observ otra vez en experimentos
similares efectuados en l979 y l980, lo cual demuestra que esta interaccin diferencial
tambin fue pequea.73

La ocurrencia de pequeas interacciones diferenciales no se limita de ninguna manera a


este patosistema, pues al parecer, se observan en muchos otros.71 Por tanto, esta resistencia
parcial, aunque polignica y duradera, no puede ser clasificada como no especfica a la
raza. Sin embargo, como las interacciones son demasiado pequeas para permitir
identificar las razas, no puede decirse que esta resistencia sea especfica a la raza.

C. Resistencia especfica al patgeno

Ambos tipos de resistencia son altamente especficos al patgeno. Los genes Pa y tambin
los de la resistencia parcial son eficaces slo contra aislamientos de Puccina hordei, y no
contra otros patgenos, ni siquiera patgenos afines como los que causan la roya amarilla.
La variedad Vada, con su alto grado de resistencia parcial a Puccina hordei, es muy
susceptible a Puccina striiformis, la roya amarilla. En este respecto, la roya de la hoja de
la cebada no es distinta de los otros patgenos especializados. La resistencia a patgenos
con un rango limitado de hospederos es casi siempre especfica al patgeno,
independientemente del tipo de resistencia que se trate.

Seleccin

Como ya se mencion, muchos mejoradores piensan que la seleccin para obtener


resistencia a una enfermedad polignica es difcil y toma demasiado tiempo y, por lo tanto
sta les resulta menos atractiva que la resistencia monognica.

El patosistema cebada-Puccinia hordei es un buen ejemplo para ilustrar lo anterior. Es


posible seleccionar para obtener resistencia parcial en todos los estadios de las plantas: en
el estadio de plntula en invernadero y en el de planta adulta en invernadero y en campo.
En el campo, la seleccin de plantas individuales y la realizada en pequeas parcelas es
muy eficaz.76 En todas estas situaciones, se logr un avance considerable. La seleccin en
invernadero para obtener un perodo de latencia ms prolongado despus de cruzar Vada
con Cebada Capa (ambas con un grado considerable de resistencia parcial), condujo a la
formacin de lneas con un perodo de latencia y resistencia parcial que superaron por
mucho a los de Vada.76 Una de esas lneas, 17-5-16, casi no se ve afectada en el campo y,
an en zonas donde la roya de la hoja de la cebada es muy severa, no muestra un nivel
significativo de enfermedad.

147
En el campo, la seleccin recurrente para obtener resistencia parcial funcion muy bien.
En dos poblaciones no emparentadas y genticamente muy variables, al principio la
seleccin se realiz en plantas individuales y despus entre las progenies (lneas) de las
plantas seleccionadas. En cada una de las dos poblaciones, las mejores lneas fueron
cruzadas entre s, en todas las direcciones. A continuacin se realiz la seleccin de las
plantas F2 y lneas F3. Las mejores lneas de cada poblacin fueron cruzadas entre
poblaciones y luego se seleccionaron una vez ms las plantas F2 y lneas F3,. En cada
etapa, la seleccin consisti en eliminar el 30 % de las plantas o lneas ms afectadas, lo
cual constituye una seleccin muy moderada.74 La seleccin en realidad fue contra la
susceptibilidad, ms que para la resistencia a roya de la hoja; fue posible seleccionar al
mismo tiempo otros caracteres agronmicos.74 La seleccin contra la susceptibilidad fue
muy eficaz. El nivel promedio de susceptibilidad de ambas poblaciones al principio era
comparable al nivel entre las variedades Sultn y Zephyr. Al final del programa de
seleccin se obtuvieron varias lneas que eran significativamente ms resistente que la
variedad Vada, pues mostraron una severidad de enfermedad de menos del 0,05 % en la
escala.

Seleccin para obtener resistencia duradera

Existen varios ejemplos de seleccin que dieron por resultado resistencia duradera. Las
variedades de trigo seleccionadas en Europa Occidental a principios de siglo, parecan
poseer resistencia duradera a roya amarilla. Las variedades Wilhelmina y Julia, una hija de
Wilhelmina, se sembraron ampliamente durante 20 y 30 aos, respectivamente. Cuando se
dej de sembrar Julia, su nivel de resistencia (ocho en las listas holandesas de variedades)
era tan alto como cuando fue introducida 20 aos antes en l930. Las variedades de trigo
generadas a fines de los aos 50 y principios de los 60, tambin posean en su mayor parte
resistencia duradera a roya amarilla. En ambos casos, la resistencia duradera se perdi
cuando se increment la intensidad de seleccin. Al hacer esto, los mejoradores iniciaron
la fase de la resistencia no duradera, monognica y especfica a la raza. Wilcox97 describi
una situacin semejante en la soya en Estados Unidos. El tizn bacteriano causado por
Pseudomonas glycinea ocurre en todas las zonas productoras de ese cultivo. Se ha
informado de la existencia de resistencia de genes mayores y la presencia de ocho razas del
patgeno. Aunque los mejoradores de roya estadounidenses nunca han puesto mucho
nfasis en lograr un alto nivel de resistencia a este patgeno, han eliminado continuamente
las lneas muy susceptibles en el proceso de mejoramiento. Como resultado, las variedades
estadounidenses actuales permanecen relativamente libres de tizn durante la mayor parte
del ciclo de cultivo, mientras que las accesiones extranjeras no sometidas a seleccin, muy
a menudo son infectadas en los viveros de esos mismos mejoradores.

Estos tres casos tienen en comn un mismo aspecto: la intensidad de seleccin fue leve
y contra la susceptibilidad y no se orient a lograr un alto nivel de resistencia. Por tanto,
forma la base de la recomendacin, anotada a continuacin, respecto a la seleccin dirigida
a obtener resistencia de tipo duradero.

En una poblacin genticamente heterognea (despus del cruzamiento), la seleccin


consiste en eliminar las lneas ms susceptibles (seleccin contra la susceptibilidad), no se
seleccionan aquellas que no presentan ningn signo de enfermedad. Estas ltimas pueden
ser portadoras de genes mayores y deben descartarse. Se realiza la seleccin de otras

148
caractersticas agronmicas deseables en las lneas restantes. Si esto se lleva a cabo en
forma continua en el programa de seleccin, se acumula resistencia del tipo conferido por
genes menores. Frecuentemente la resistencia horizontal se ve enmascarada por la accin
de los genes mayores de resistencia vertical (efecto vertifolia).

Estrategia de seleccin para obtener resistencia a enfermedades en trigo y


cebada

De acuerdo al esquema de mejoramiento en cada experimento se utilizan diferentes diseos


experimentales como Latices y Bloques Completos Randomizados en base al nmero de
entradas con que se cuenta por experimento. Los criterios utilizados en la seleccin son:
altura y arquetipo de planta, precocidad, resistencia a enfermedades, color de grano,
textura, rendimiento y calidad industrial.

Las tcnicas de inoculacin y ensayos en invernaderos no son viables para nuestras


condiciones econmicas, por lo que se hace uso de agroambientes con mayor inoculo de
enfermedades en los que se efecta una mayor presin de seleccin en las primeras
generaciones del material gentico en prueba.

La mayor fuente de resistencia con que se cuenta, son los progenitores que el Centro
Internacional de Mejoramiento de Maz y Trigo (CIMMYT), hace uso para efectuar las
cruzas con la finalidad de distribuir a todos los pases cooperantes. Los materiales
segregantes y lneas avanzadas se distribuyen por medio de los ensayos internacionales, en
los cuales se pueden identificar y seleccionar en cada pas o regin, lneas como fuentes de
resistencia.

Otras fuentes de resistencia con que se cuenta, son las variedades tradicionales con
resistencia a las royas, que pese a tener otras caractersticas agronmicas no deseables, son
fuentes de resistencia potencialmente aceptables.

Para promover el cultivo del trigo y la cebada, la investigacin participativa en campo


de agricultores es norma dentro de un programa de mejoramiento para evaluar las lneas
promisorias, parcelas demostrativas, parcelas de comprobacin y otros evaluados en red-
regional, con los cuales a su vez se hacen la transferencia de tecnologas adecuadas y la
promocin de nuevas variedades.

Estrategias Moleculares

Chen et al.,23 mapearon genes para resistencia a la roya amarilla raza 24 (Puccinia
striiformis f. sp. Hordei). Su objetivo era usar la seleccin asistida por marcadores para
rpidamente, introgresar la resistencia en el germoplasma susceptible de cebada. Como
parte de su estrategia se realiz primero el mapeo de los genes de resistencia en una F1
derivado de una poblacin doble haploide, usando marcadores RFLP; para luego convertir
los marcadores flanqueantes de los genes de resistencia en marcadores de seleccin para
facilitar la transferencia del gen. Dentro de sus resultados, estos investigadores obtuvieron
asociacin de los marcadores con la resistencia; ellos tambin generaron seis marcadores
que flanqueaban un locus de resistencia sobre el cromosoma 7. Por otro lado, ellos afirman
que los QTL (Quantitative trait loci) de resistencia, suman el 50 % de la variacin del
carcter.

149
Hayes50 plantea el modelo de QTLs en cebada. Este era un proyecto del mapeo del
genoma de la cebada de Norte Amrica, teniendo objetivos en la aplicacin de los QTLs
como:

Seleccin y validacin de los QTL del extracto de malta y produccin.

Desarrollo de un catlogo de mapa de genes para la resistencia a la roya amarilla en


cebada.

Mapeo de los componentes de la resistencia al fro. Adems, en relacin a la roya


amarilla que es al mismo tiempo una oportunidad, se plantea una estrategia para el manejo
de esta enfermedad basado en el uso de genes de resistencia mltiple.

Jahor y Fischbeck.55 desarrollaron y usaron marcadores RFLP para la identificacin de la


resistencia al mildiu en cebada. En las variedades Clerice, Golf, Jana, Jockey y Vada que
posean el gen de resistencia al mildiu fueron analizados en orden con el patrn RFLP para
detectar resistencia, identificndose los mismos RFLPs en todas las variedades. Teulat et
al.,94 encontraron algunos QTLs para algunos parmetros de la tolerancia a la sequa en
cebada, donde se estudiaron muchos caracteres adaptativos morfolgicos. Se encontraron
QTLs involucrados en el contenido de agua relativa (RWC), la cantidad de cloroplastos, la
variacin en el nmero de hojas y otros datos obtenidos de campo; los cuales fueron
localizados en el mapa; dos de los tres QTLs involucrados en la variacin del RWC fueron
mapeados en loci similares a los componentes de los QTLs de rendimiento. Jones38 mape
los QTLs de resistencia para el mildiu (Sclerospora graminicola) en Penisetum glaucum.

Hayes et al.,49 mencionan que el proyecto del mapeo del genoma de cebada de Norte
Amrica (NABGMP) se ha avocado a la construccin de mapas en germoplasma lite, para
facilitar la aplicacin directa de esos mapas en el mejoramiento gentico.

Experiencia de trabajos con resistencia duradera en el Per.

Una de las variedades de trigo en el Per con resistencia duradera, es la variedad


OLLANTA que es un trigo harinero con mayor plasticidad adaptativa a las diversas
razas de Roya Amarilla, precocidad y su calidad para consumo en potajes tpicos para
los que ha sido creado. Pese a que tiene slo una regular calidad panadera, durante muchos
aos se utiliz en panificacin.

La variedad Ollanta, tiene su origen en la cruza de los trigos NARIO 59 x FONTANA


KENIA 58 NEWTHATCH 11-50-16; hecha en la Estacin Experimental Agrcola La
Molina en 1952 y fue liberada como variedad en 1968 (Programa Nacional de
Investigacin en Cereales, 1985-1992).81

Su caracterstica de resistente se expresa por su resistencia a Puccinia striiformis f. sp.


Tritici, tolerancia a Puccinia graminis f. sp. Tritici, Puccinia recndita f. sp. Tritici y
Fusarium spp. En la actualidad sigue manteniendo su potencial de rendimiento como en
sus primeros aos.

150
Otra experiencia es con la variedad EL GAVILN que tiene su origen en la lnea
Pavn f76 procedente del CIMMYT-Mxico que fue liberada como variedad en l982. El
trigo Gaviln es un trigo harinero de textura semidura, con buena calidad panadera y de
amplia adaptacin en la costa y la sierra peruana, por su tolerancia a la roya amarilla,
roya del tallo y la hoja. Sin embargo, desde 1990 est disminuyendo su cultivo por
tornarse susceptible a las royas del tallo y la hoja en la costa y roya amarilla en la
mayora de zonas endmicas de la sierra.

Experiencias con variedades con resistencia no duradera no se tiene en la actualidad. Si


ahora no se continan cultivando muchas variedades, no es por su susceptibilidad a las
enfermedades, sino ms bien por su baja calidad industrial.

151
4. REFERENCIAS BIBLIOGRFICAS

1. Akerman A. and Mackey J. The breeding of self- fertilized plants by crossing. In:
Akerman, A. Tedin, O. & Frier, K. (eds) Svalf, 1886-1946. Lund, Sweden: Carl
Bloms Boktryckeri. 1948.

2. Alegra MO. Formacin de poblaciones elites en variedades procedentes de cruzas


interespecificas del genero Phaseolus: (Phaseolus coccineus Wild x Phaseolus
vulgaris L. x Phaseolus coccineus) en las zonas altoandinas del departamento de
ncash. Tesis M Sc. Mejoramiento Gentico de Plantas. UNALM. 1995. 80 p.

3. Allard RW. Principles of Plant Breeding Jhon Willey & Sons, Inc N. Y. 1999. 254
p.

4. Baudoin JP, Camarena MF, Lobo M, et al. Broadening The Genetic Base of Crop
Production. Breeding Phaseolus for Inter cap combinations in Andean Highlands.
CABI publishing, FAO, IPGRI. 2001. Pp. 373-384.

5. Bautista SAM. Seleccin por precocidad y rendimiento en frijol de palo (Cajanus


cajan (L) Millsp), cv Guayaquil en el valle de Chancay. Tesis Ing. Agr.
Universidad Nacional Agraria La Molina, 1995. 76 p.

6. Bautista SAM. Seleccin por precocidad y rendimiento en frijol de palo (Cajanus


cajan (L) Millsp) en dos ambientes de la costa central. Tesis Mg. Sc. en
Mejoramiento Gentico de Plantas, Universidad Nacional Agraria La Molina,
1996. 92 p.

7. Bedoya JV. Incorporacin del gen I de Resistencia al Virus del Mosaico Comn
(BCMV) en frijol (Phaseolus vulgaris L.) Var. Canario Camanejo. Tesis M Sc. en
Mejoramiento Gentico de Plantas, Universidad Nacional Agraria La Molina. 1996.
91 p.

8. Bennett JL. Junctions in inbreeding. Gentica 1953. 26: 393 406.

9. Bernard S. In vitro androgenesis in hexaploid triticale: determination of physical


conditions increasing embryoid and green plant production. Z. Pflazenzucht.1980.
85: 308-321.

10. Bernardo R. Prediction of maize single cross performance using RFLPs and
information from related hybrids. Crop Sci., 1994. 34:20-25.

11. Borem A. Melhoramento de plantas. Editora UFV. 2 edicin. Viosa. 1998. 453 p.

12. Borojevic S. Principles and Methods of Plant Breeding. ELSEVIER New York,
1990. 368 p.

13. Bos L & Caligari P. Selection Methods in Plant Breeding Chapman & Hall.
London. 1995. 347 p.

152
14. Bret SA. Multilines: Safety in numbers. CIMMYT today N 4 CIMMYT. El Batn,
Texcoco, Mxico. 1976.

15. Briggs FN & Allard RW. The current status of the backcross methods of plant
breeding. Agrom. J. 1953. 45: 131-38.

16. Brim CA. A modified pedigree method of selection in soybean. Crop Sc., 1966. 6:
220.

17. Browning JA. & Frey KL. Multiline cultivars as a means of disease control. Ann.
Rev. Phytopathology. 1969. 7: 355-382.

18. Camarena MF. Etude de la transmission des caracteres de Phaseolus polyanthus


Greenm dans Phaseolus vulgaris L. au travers de lutilization du cytoplasme P.
polyanthus. These Doctorado FUSAGX, Blgica. 1988. 237 p.

19. Camarena MF, Huaringa JA, Chiappe VL, Mostacero NE, Baudoin JP, Mergeai G.
Formacin de Poblaciones Complejas superiores de Cruces Interespecificos del
Gnero Phaseolus y su comportamiento agronmico para zonas altoandinas del
Per y de Amrica latina. En: Symposium Sociedad Peruana de Gentica.
Gentica- Per. No 3, 2002. pp. 169-203.

20. Camarena MF, Huaringa JA, Mostacero NE. Mejoramiento gentico de especies del
gnero Phaseolus mediante metodologas convencionales e innovadoras con el fin de
incrementar la produccin y la oferta exportable del frijol comn (Phaseolus vulgaris
L.). Primera Edicin. Universidad Nacional Agraria la Molina - Consejo Nacional de
Ciencia, Tecnologa e Innovacin Tecnolgica. 2010. 270 p.

21. Camarena MF, Sevilla PR, Huaringa JA, Mostacero de Bustillos E, Huaringa JB.
Simposio de Mejoramiento de los Cultivos Subutilizados. UNALM - Biodiversity
International, 2012. 114 p.

22. Centro Internacional de la Papa. Necesidades de Investigacin para Detener la


Rpida Diseminacin de las Variedades del Tizn Tardo. Informe Anual 1995.
Lima. Per. 1995.

23. Chen F, Prelm Q D, Mulrooney D, et al. Mapping Genes for Resistance to Barley
Stripe Rust Race 24 (Puccinia striiformis f. sp. Hordei). Plant and Animal Genome.
1992.

24. CIAT (Centro Internacional de Agricultura Tropical). Cruzamiento de frijol. Gua


de estudio para ser usado como complemento de la unidad audotutorial sobre el
mismo tema. CIAT, Cali. 1982. 36 p.

25. CIMMYT. Mtodos para registrar genealogas. Curso: Fitomejoramiento II.


Cruzamiento. Boletn de Difusin. 1971. 6 p.

26. CIMMYT. Informe del CIMMYT 1980. Centro Internacional de Mejoramiento de


Maz y Trigo. Mxico, 1980. 121 p.

153
27. Cox TS, GL Lookhart, De Walker, et al. Genetic relationship among hard red
winter wheat cultivars as evaluated by pedigree analysis and polyacrilamide gel
electrophoresis pattern. Crop Sci., 1985. 25:1058-1063.

28. Cregan PB & Bush RH. Early generation bulk hybrid yield testing of adapted hard
redwinter wheet crosses. Crop Sci., 1977. 17: 887 891.

29. Darwin C. On the origin of species by natural selection. London: Murray. l859.

30. Delgado IP. Efecto de los tratamientos combinados de maceracin coccin con
soluciones alcalinas sobre la aceptabilidad y digestibilidad de dos variedades de
frijol hbrido. Tesis M Sc. en Industrias Alimentarias. Universidad Nacional
Agraria La Molina, 2000. 80 p.

31. De Wit. Plant-Fungus Interactions and the Application of Avirulence Genes in


Control of Plant Pathogens. Annual Review of Phytopathology 30, 1992. pp. 391-
418.

32. Demol J Amlioration des plants. Application aux principales espces cultives en
rgions tropicales . Les Presses Agronomiques de Gembloux. Belgique. 2002. 581
pp.

33. Dudley JW. A method of identifying line for use in improving parents of simple
cross. Crop Sci., 1984. 24: 355-357.

34. Dudley JW. Modification of methods for identifying inbred lines useful for
improving parents of elite single crosses. Crop Sci., 1987. 27: 944-947.

35. Empig LT & Fehr WR. Evaluation of methods for generation advance in bulk
hybrid soybean populations Crop. Sci. 1971.11: 51-54.

36. Fehr WR. 1978. Breeding In: NORMA, A.G. (ed) Soybean physiology agronomy
and utilization. New York: Academic Press, p, 119-155.

37. Fisher RA. A quantitative theory of genetic recombination and chiasma formation.
Biometrics. 1984. 4, 1-13.

38. Florell UH. Bulked- population method of handling cereal hybrids. J. Am. Soc.
Agron. 1929. 21: 718-724.

39. Frey KJ, Browning JA & Grindeland RL. Implementation of oat multiline cultivar
breeding. In: Mutation Breeding for Disease Resistance. International Atomic
Energy Agency. Vienna, 1971. pp. 159-169.

40. Frey KJ & Browning JA. Breeding crop plants for disease resistance. In: Mutation
breeding for Disease Resistance. International Atomic Energy Agency. Vienna
1971. pp. 45-54.

154
41. Goulden CH. Problems in plant selection. In: Burnett, RC. (ed.) International
Genetics Congress, 7, 1939, Edinburg. Proceedings. Edimburg: Cambridge
University Press 1939. pp.132 133.

42. Gouging D. Evaluation and screening of Faba Bean Germplasm in China.


ICARDA, Fabis Newsletter, 1993. 32:8-10.

43. Hallauer AR. Zygote selection for the development of single cross hybrids in
maize. Adv, Front. Plant Sci. 1970. 25:75-81.

44. Hanson WD. Average recombination per chromosome. Genetics, 1962. 47: 407
445.

45. Hanson WD. The break-up of initial linkage blocks under selected mating systems.
Genetics 44, 1959. p. 857-868.

46. Harlan JR & Martini ML. Problems and results in barley breeding. Washington:
USDA, 1937. pp. 303-306.

47. Harlan JR, Martini ML & Harlan SA study of methods in barley breeding.
Washinton: USDA. 1940.

48. Harrington JB. The mass-pedigree method in the hybridization improvement of


cereals. J. Amer. Soc. Agron. 1937. 29: 379-384.

49. Hayes PF, Chen A, Leinhols A, et al. Barley Genome Mapping and its applications
in: P:P: Jauhar (ed.) Methods of Genome Analisis Plants. CRC Prees. Boca Raton.
USA. 1996.

50. Hayes PM. Barley and Model QTL sistems. Plant and Animal Genome II. 1994.

51. Huaytalla IG. Seleccin por Resistencia a la Ascochyta Phoma exigua var.
Diversispora (GTM, KEN &RWA) y otras caractersticas agronmicas en
poblaciones segregantes F4 y F5 de cruzas en el gnero Phaseolus sp. Tesis Ms. Sc.
Mejoramiento Gentico de Plantas. UNALM. 1993. pp. 93.

52. IBPGR. Descriptors for Phaseolus vulgaris. 32 p. International Board for Plant
Genetic Resources, Secretariat, Rome, Italy. 1982.

53. IBPGR. Phaseolus coccineus descriptors. IBPGR, Secretariat Rome. 1983. 34 p.

54. Immer FR. Relation between yielding hability and homocigosity in barley crosses.
J. Am. Soc. Agron, 1941. 33: 200-206.

55. Jahor A & Fischbeck. Lehrstuhl fur Pflanzenbau and Pflanzenzuchtung, Freising-
Weihenstephan. Development and Use of RFLP markers for indication of mildiu
Resistance in Baley. Plant and Animal Genome II. 1992.

155
56. Jennigs PR & Aquino RC. Studies on competition in rice. III The mecanism of
competition among phenotypes. Evolution, 1968. 22: 529- 542.

57. Jensen NF. Intra-varietal diversification in oat breeding. Agron. J. 1952. 44:30-34.

58. Jones MJ. Pointers to profitable wheat. S. I. England Imperial Chemical. 1978. pp.
1-17.

59. Kasha KJ, Simion E, Oro R, et al. An improved in vitro technique for isolated
microspora culture of barley. Euphytica, 2001. 120: 379-385.

60. Kasperbauer M & Collins G. Reconstitution of diploids from leaf tissue of anther
derived haploid in tobacco. Crop Sci. 1972. 12: 98-101.

61. Kaufmann MLA. Proposed method of oat breeding for Central Alberta. Cereal
News, 1961. 6: 15-18.

62. Lupton FGG & Whitehouse RNH. Studies on the breeding of self-pollinating
cereals. I. Selection methods in breeding for yield. Euphytica, 1957. 6 : 169-125.

63. Mackey J. The 75 years development of swedish plant breeding. Hodowla Roslin,
Aklimatyzacja I Nasiennictwo, 1962. pp. 437 467.

64. Maldonado TRI. Comportamiento Agronmico de tres hbridos interespecficos del


gnero Phaseolus bajo distintas modalidades de siembra. Tesis Ing. Agrnomo.
UNALM 1997. 106 p.

65. Mrquez SF. Genotecnia Vegetal. Tomo II. AGTESA. Mxico. 1988. 563 p.

66. Mergeai G. Caracterizacin de las variedades de frijol UNAGEM-1 y UNAGEM-2


provenientes de cruzas interespecficas del genero Phaseolus y sus parentales
mediante la tcnica de polimorfismo de fragmentos de longitudes amplificadas,
AFLP. Convenio UNALM-FUSAGX. 2005.

67. Metz G. Probability of net gain of favorable alleles for improving an elite single
cross. Crop Sci., 1994. 34:668-672.

68. Nitsch C. Pollen culture: A new technique for mass production of haploid and
monozygous plants. En: Kasha, K. J. (ed). Haploids in higher plants: Advances and
potential. University of Guelph, Ontario. Canad. 1974. pp. 123-135.

69. Oliveira AB. Estimativas de heredabilidade e de correlaces em linhages de soja


(Glycine max L. Merril) derivadas pelo teste de generaco precoce. Viosa UFV.
Impr. Univ. 1985. 98 p.

70. Obando RL. Contribution a letude de lascochytse du haricot Phaseolus vulgaris


L. Tesis Doctorado FUSAGX, Blgica, 1989. 135 p.

156
71. Parlevliet JE. Resistance of the non-race-specific type. In: The cereal rusts. II.
Diseases, distribution, epidemiology and control. Eds. A.P. Roelfs and W.R.
Bushnell, 501-525. Academia Press, Orlando, Florida, USA. 1985.

72. Parlevliet JE. What is durable resistance, a general outline. In: Durability of disease
resistance, Eds. Th Jacobs and J.E. Parlevliet, 23-39. Kluwer Academic Publishers,
Dordrecht, The Netherlands. 1993.

73. Parlevliet JE & A van Ommeren. Recurrent selection for grain yield in early
generations of two barley populations. Euphytica 1988. 38: 175-184.

74. Parlevliet JE & A van Ommeren. Accumulation of partial resistance in barley leaf
and power mildew through recurrent selection against susceptibility. Euphytica
1998. 37: 261-274.

75. Parlevliet JE, Evidence of differential interaction in the polygenic Hourdeum


vulgare-Puccinia hordei relation during epidemia development. Phytopathology,
1997. 67: 776-778.

76. Parlevliet JE, WH Lindhout A Van Ommeren, et al. Level of partial resistance to
leaf rust, Puccinia hordei, in West European barley and how to select for it.
Euphytica 1980. 29: 1-8.

77. Pinchi M. Formacin de Poblaciones complejas superiores de cruzas


interespecficas del gnero Phaseolus y su comportamiento para las zonas
altoandinas del Per. 2009.

78. Porta ChR. Seleccin de genotipos de frijol provenientes de cruzas interespecficas


(Phaseolus coccineus Wild x Phaseolus vulgaris) x (Phaseolus coccineus). Tesis M
Sc. Mejoramiento Gentico de Plantas. UNALM. 2008. 124 p.

79. PLGO (Programa de Investigacin en Leguminosas de Grano). Memoria anual


2001. Programa de Investigacin de Leguminosas de Grano y Oleaginosas.
Universidad Nacional Agraria La Molina. 2001. 50 p.

80. PLGO (Programa de Investigacin en Leguminosas de Grano). Memoria anual


2005. Programa de Investigacin de Leguminosas de Grano y Oleaginosas.
Universidad Nacional Agraria La Molina. 2005. 60 p.

81. Programa Nacional de Investigacin en Cereales. Informes anuales a nivel


nacional, 1985-1992. EEA Andenes INIAA, Cuzco Per, 1992.

82. Retegui BT. Evaluacin agronmica y taxonmica de dos hbridos interespecficos


de frijol en condiciones del Callejn de Huaylas, Ancash. Tesis Ing. Agrnomo,
UNALM. 2001. 80 p.

83. Richmond TR. Recurrent selection in a three species cotton hybrid. Proc. 5th
Annual Convention of the Association of Agricultural Workers. Dallas, Texas, Feb
1-3, 1954. 204 p.

157
84. Ross H. Potato Breeding: Problems and perspectives. En. Berlin (Germany). Verlag
Paul Parey. Advances in Plant Breeding. No. 13, 1986.132 p.

85. Santos BK. caracterizacin molecular de las variedades UNAGEM-1 y UNAGEM-


2 procedente de cruzas interespecficas del gnero Phaseolus. Tesis Mg. Sc. en
Mejoramiento Gentico de Plantas. UNALM. 2002. 60 p.

86. Seilleur P. Ameloration Generale des plantes. Sylabus previsoire. Facult


Universitaire des Sciences Agronomiques de Gembloux. Blgica. 1985. 187 pp.

87. Singh SP. Gamete selection for simultaneaus improvement of multiple traits in
common bean. Crop Sci. 1994. 34:352-355.

88. Singh SP. Gamete selection for Uprigh Carioca Bean with Resistance to Five
Diseases and a Leafhopper. International Center for Tropical Agriculture (CIAT)
A.A. 6713 Cali - Colombia Published in Crop Sc. 1998a. 38:666-672.

89. Singh SP. Uso de marcadores y seleccin de gametos para el mejoramiento


simultneo de caracteres mltiples de frijol (Phaseolus vulgaris L.) para
mesoamrica y el Caribe. Agron. 1998b. 9: 1-9.

90. Singh SR, C Cardona, FJ, Morales MA. Pastor-Corrales and O Voysest. Gamete
selection for upright carioca bean with resistance to five diseases and leaf hopper
Crop Sci. 1998. 38: 666-672.

91. Stadler LJ. Gamete selection in corn breeding J. Am. Soc. Agron., 1944. 36: 988-
989.

92. Staskawcz BJ, Ausubel FM, Baker BJ, et al. Molecular genetics of plant disease
resistance. Science,1995. 268, 661-7.

93. Suneson, C. A. An evolutionary plant breeding method. Agrom. J. 1956. 48: 188-
191.

94. Teulat B, TC. Borries I, Souyris C, et al. QTLs for some Drought Tolerance
parameters in Barley. Plant and Animal Genome II. 1997.

95. Valentine J. Accelerate pedigree selection: an alternative to individual plant


selection in the normal pedigree method in the self - pollinated cereals. 1984.
Euphytica, 33: 943-951.

96. Van Der Kley FK. The efficiency of some methods in populations resulting from
crosses between self- fertilizing plants. 1955. Euphytica, 4: 58-66.

97. Wang C, Chu Z, Sun C, et al. Studies on the albino pollen plantlets of rice. En: Poc.
Symp. Plant Tissue Cultura, Pekn Press, 1978. pp. 149-160.

98. Wilcox JR. Breeding soybeans resistant to diseases. Plant Breeding Review 1983.
1: 183-235.

158
TERCERA PARTE
MEJORAMIENTO GENTICO DE PLANTAS ALGAMAS

159
1. INTRODUCCIN

Entre los cultivos de plantas algamas tenemos el maz, caa de azcar, esprrago, cebolla,
girasol, camote, pimienta, etc. representados por diversos variedades, ecotipos, cultivares y
hbridos sembrados en extensas reas a nivel comercial.

Para realizar en forma exitosa el mejoramiento de cualquier cultivo el fitomejorador no


slo debe manejar tcnicas cuidadosas y precisas de cruzamiento y seleccin, sino aplicar
mtodos adecuados para obtener la variedad mejorada. Y esto est ntimamente ligado con
la labor que debe de realizar un programa de mejoramiento. El fitomejorador debe tener un
conocimiento adecuado del cultivo principalmente en lo referente a su forma de
reproduccin asexual o sexual.

Las plantas algamas son muy heterogneas debido a su forma de polinizacin cruzada.
En una poblacin de plantas algamas se pueden seleccionar individuos superiores de alta
produccin y caractersticas agronmicas deseables, sin embargo, estos no pueden
mantener constante de generacin a generacin estas caractersticas, debido a que
comienzan a segregar, porque son polinizadas por plantas no seleccionadas de la misma
poblacin.

El mejoramiento en poblaciones de plantas algamas se realiza bsicamente de dos formas;


primero se debe de mejorar la poblacin, es decir en forma intrapobacional hasta agotar
toda su variabilidad y posteriormente aplicar el mejoramiento interpoblacional. Para lograr
esto se usa principalmente la seleccin recurrente o cclica que consiste en seleccionar los
mejores individuos dentro de una poblacin, posteriormente evaluarlos, despus
recombinar los mejores individuos y formar la nueva poblacin mejorada y a partir de ella
nuevamente seleccionar los nuevos individuos superiores, evaluarlos y recombinar los
mejores individuos para tener la nueva poblacin mejorada y as se realiza sucesivamente
hasta agotar toda la variabilidad gentica.

Debido a que en el mejormaiento gentico de plantas algamas se usa una gama diversa de
materiales genticos (lneas, sintticos, hbrido simple, hbrido doble, familia, poblacin,
variedad mejorada, variedad nativa accesingenotipo) se usar en el texto la palabra
material como genrico de todos ellos.

2. METODOS PARA RECOMBINAR INDIVIDUOS SELECCIONADOS

Existen diversos mtodos para la formacin de poblaciones a travs de los cuales se


recombinan los diferentes materiales genticos (plantas individuales, familias de medios
hermanos, familias de hermanos completos o progenies autofecundadas) seleccionados.
Estos mtodos muchas veces dependen fundamentalmente del criterio de los mejoradores
de plantas. Sin embargo, se deben basar en los objetivos planeados, en la disponibilidad de
recursos fsicos, econmicos y humanos con los que cuente el programa. Los mtodos ms
comunes usados en plantas algamas, para recombinar son:

a) Lotes aislados que utilizan compuestos balanceados (mezcla de igual nmero de


semillas de cada uno de los materiales implicados).

160
b) Lotes aislados en donde se despanojan plantas (surcos hembra).

c) Cruzas posibles (diallico).

2.1. Lote aislado cuando se utiliza un compuesto balanceado (CB)

Consiste en sembrar, aislada de otras poblaciones de la misma especie, el CB que se


recombinar y dar origen a la nueva poblacin recombinada genticamente. El rea
necesaria estar en funcin del tamao del CB. Por ejemplo, si queremos recombinar 25
lneas seleccionadas de maz, de cada lnea se toma 200 semillas y con ella se formar el
CB que estar constituido por 5000 semillas, el cual se sembrar a libre polinizacin en el
campo, a un distanciamiento adecuado entre surcos y entre plantas.

2.2. Lote aislado cuando se utiliza despanojamiento

En este caso, se siembra todos los materiales genticos en parcelas de un surco, en forma
progresiva, alternando por cada cuatro surcos de hembra dos de macho. El CB estar
formado por todos los materiales implicados (surcos hembra).

En este caso si queremos recombinar las 25 lneas seleccionadas por este mtodo, primero
contamos 100 semillas de cada lnea para formar el CB, que estar formado por 2500
semillas y que actuar como macho. De igual manera se contar 50 semillas de cada una de
las 25 lneas, las que se sembrarn en forma individual y actuarn de hembra. Se siembran
en surcos alternos las semillas que actan como macho y hembra en la proporcin
indicada; los surcos que actan como hembra se despanojan y los surcos machos
constituirn la semilla recombinada.

2.3. Cruzas simples posibles (diallico)

En este mtodo se usa un diallico, con el cual tericamente se logra la mejor


combinacin, ya que en este caso se cruzan los materiales, todos contra todos.

Nmero de cruzas simples posibles (CSP)

n(n 1)
CSP
2

Donde: n = nmero de lneas progenitoras.

Si quisiramos recombinar 10 lneas seleccionadas se tendra que realizar 45 cruzamientos


simples. Para ello en el campo se debe de sembrar 2 a 4 surcos de la lnea 1 que actuar
como macho y un surco de las lneas 2, 3, 4, 5, 6, 7, 8, 9, 10 que actuarn como hembras;
posteriormente se sembrar nuevamente 2 a 4 surcos de la lnea 2 que actuar como macho
y un surco de las lneas 3, 4, 5, 6, 7, 8, 9, 10 que actuarn como hembras. Se repite esta
secuencia hasta llegar a sembrar un surco de la lnea 9 que actuar como macho y un surco
de la lnea 10 que actuar como hembra. A la cosecha, por cada cruza se seleccionan entre
200 a 300 semillas para formar un compuesto balanceado que ser el material
recombinado.

161
Los arreglos que se hagan en el campo para realizar los cruzamientos en campo son
denominados lotes de polinizacin artificial; cuando se tiene diferentes lneas para llevar a
cabo los procedimientos anteriores, es importante saber los das a la floracin de los
materiales genticos para sembrarlos de tal manera que coincida la floracin en ambos y
efectuar as los cruzamientos; los progenitores masculinos se pueden sembrar en por lo
menos dos fechas, antes de la siembra de las hembras, junto con las hembras y despus de
la siembra de las hembras.

3. FORMACION DE POBLACIONES PARA LA SELECCIN

Para la mayora de los mtodos de mejoramiento poblacional, una poblacin debe estar
formada por un amplio nmero de genotipos que pueden ser homocigotas o heterocigotas,
factor que genera variabilidad en las poblaciones.

Las poblaciones heterogneas se pueden obtener en forma natural o artificial. En forma


natural al mantener la segregacin de todos los individuos heterocigotas de la poblacin.
En forma artificial se hace una mezcla mecnica de semilla de individuos homocigotas o
heterocigotas.

A la vez, las poblaciones de acuerdo a su fenotipo y genotipo son homogneas


homocigotas como una lnea, homogneas heterocigotas como un hbrido, heterogneas
homocigotas como una multilnea, y heterogneas heterocigotas como una variedad de
polinizacin libre. De estas poblaciones, a excepcin de la multilnea, se pueden formar
nuevas poblaciones para seleccin por entrecruzamiento al azar. Los tipos de poblaciones
ms comunes utilizadas en el mejoramiento de plantas son las que estn formadas por:

Dos padres (cruza simple).

Las de polinizacin libre (entrecruzamiento al azar).

3.1. Poblaciones de dos padres

Las poblaciones de dos padres o lneas se forman cruzando dos de ellas. Los padres o
lneas son materiales en general homocigotas, tales como las lneas altamente endocriadas.
La cruza tiene como fin formar un hbrido llamado F1; las plantas F1 de la cruza entre dos
progenitores homocigotes sern idnticas y heterocigotas para los loci en los cuales los
padres tienen alelos diferentes en cada loci.

162
P1 x P2
AABBccDD aabbCCdd ( )

F1 AaBbCcDd (Plantas idnticas y heterocigotas)

F2
BBCCDDaabbccdd (Individuos diferentes)

3.2. Poblaciones de libre polinizacin

Una poblacin de polinizacin libre (entrecruzamiento al azar) se obtiene al cruzar


primero, cierto nmero de poblaciones de dos padres y despus las progenies del hbrido
por una o ms generaciones. Por ejemplo, si consideramos ocho genotipos (cuatro AA y
cuatro aa).

Primer apareamiento:

AA x aa AA x aa AA x AA aa x aa

F1 Aa Aa AA aa

L M N P

Segundo apareamiento

Frecuencias Genotpicas
LxM Aa x Aa 1AA 2Aa 1aa
Composicin
LxN Aa x AA 2AA 2Aa gentica de la
LxP Aa x aa 2Aa 2aa poblacin del
MxN Aa x AA 2AA 2Aa segundo
MxP Aa x aa 2Aa 2aa apareamiento
NxP AA x aa 4Aa
Total 5AA 14Aa 5aa

163
Tercer apareamiento:


5 AA 14 Aa 5 aa
5 AA 25 AA 35 AA 35 Aa 25 Aa

14 Aa 35 AA 35 Aa 49 AA 98 Aa 49 aa 35 Aa 35 aa

5 aa 25 Aa 35 Aa 35 aa 25 aa

La composicin gentica de la poblacin despus del tercer apareamiento es: 144 AA 288
Aa 144 aa; al simplificar el resultado anterior se obtiene 1AA 2Aa 1aa. Por lo tanto, la
proporcin de genotipos en la poblacin despus del tercer apareamiento es la misma que
para la poblacin F2 de una cruza de dos padres (1AA: 2Aa: 1aa). Esto demuestra que una
poblacin F2 de dos padres es igual en promedio a una de varios padres en el tercer
apareamiento.

4. BASES GENTICAS

El mejoramiento gentico que ms interesa al hombre es el de los caracteres cuantitativos,


mtricos o polignicos. Estas caractersticas tienen las siguientes cualidades:

Son determinadas por muchos genes.


Los genes que gobiernan los caracteres cuantitativos son de efecto aditivo.
Su efecto individual es pequeo comparado con el efecto total.
Son altamente influenciados por el medio ambiente.

El mejoramiento de plantas se divide en dos grandes reas de acuerdo a los efectos gnicos
que se aprovechan: la seleccin y la hibridacin. La primera utiliza los efectos gnicos
aditivos y la segunda los no aditivos; la aditividad se refiere tanto a los efectos dentro del
locus gnico (intra locus), como entre loci gnicos (inter loci). La no aditividad a nivel de
locus simple es la dominancia, es decir, cuando el valor genotpico del heterocigote es
diferente a la suma de los efectos gnicos de los alelos, o sea:

Vg (Aa) eg (A) + eg(a)

donde :

Vg (Aa) = Valor genotpico del heterocigota (Aa)


eg (A) = Efecto gnico de A
eg (a) = Efecto gnico de a

164
En la escala genotpica se tiene

aa PM Aa AA Genotipo
0 Z Z+u Z+ u + au Z + 2u

-u 0 au = h u Valor
Genotpico
au

u u

PM = (aa + AA)/2 = (2 + Z + 2u)/2 = Z + u

Valor genotpico del homocigota dominante (AA) = Vg (AA) = u


Valor genotpico del heterocigota (Aa) = Vg (Aa) = au = h
Valor genotpico del homocigota recesivo (aa) = Vg (aa) = -u

Valores genotpicos en diferentes escalas.

Genotipo
Escala Autor aa Aa AA
Y Cockerham Y11 Y12 Y22
X Comstock y Robinson -u au u
W Fisher (Falconer) -a d a
M Mather -d h d
Z S. Wright 1s 1 ks 1

Puede verse que si hubiera aditividad la Vg (Aa) = u u = 0 o bien que el grado de


dominancia (a) es cero. Los casos posibles de dominancia positiva (aunque tambin puede
haber dominancia negativa) son los siguientes:

Tipo de accin gnica Escala


X W M Z
Sobre dominancia a>1 d>a h>d k<0
Dominancia completa a=1 d=a h=d k=0
Dominancia parcial 0< a <1 0<d<a 0<h<d 0 < k<
Aditividad o dominancia intermedia a=0 d=0 h=0 k=

La interaccin interloci es cuando el valor de un genotipo conjunto es diferente a la suma


de sus genotipos parciales a esta interaccin se le llama tambin epistasis; por ejemplo:

Vg (AABB) Vg (AA) + Vg (BB)

Media y variancia de una poblacin genotpica

Una poblacin est hecha de genotipos (en el caso de dos alelos los genotipos. AA, Aa y
aa) y estos se encuentran dentro de ella en determinadas proporciones o frecuencias
genotpicas.

165
Frecuencia (AA) = P

Frecuencia (Aa) = 2H P+2H+Q= 1

Frecuencia (aa) = Q

Los genotipos a su vez, estn constituidos por genes que tambin se encuentran en
determinadas proporciones en la poblacin:

Frecuencia (A) = P + H = p
p + q = P + 2H + Q = 1
Frecuencia (a) = Q + H = q.

Si en la poblacin todos y cada uno de los individuos se pueden aparear con cualquier otro
e inclusive consigo entonces la poblacin se encuentra en panmixia o apareamiento
aleatorio. La ley de Hardy-Weinberg dice que en una poblacin suficientemente grande en
apareamiento aleatorio las frecuencias gnicas y genotpicas permanecen constante de
generacin a generacin obtenindose el equilibrio gentico en la primera generacin; esto
en ausencia de seleccin, mutacin y migracin. Esta poblacin debe ser grande.

Si en la generacin inicial o generacin cero, la frecuencia gnica es p bajo apareamiento


aleatorio, el arreglo gnico o gamtico es (q = 1 p); pA + qa = 1.

Al aparearse aleatoriamente los individuos de la poblacin, entonces el arreglo genotpico


se obtiene elevando al cuadrado el arreglo gamtico, o sea:

(pA +qa)2 = p2AA +2pqAa + q2 aa

De manera que ahora

p2 =P
2pq = 2H
q2 =Q

Siendo la frecuencia gnica en la primera generacin de apareamiento aleatorio

Frecuencia (A) = P + H = p2 + pq = p(p + q) = p

Frecuencia (a) = Q + H = q2 + pq = q(q + p) = q

Frecuencias que son las mismas que las de la generacin cero. Por induccin se demuestra
que en la generacin 2 suceder lo mismo que en la 1, y as en las siguientes generaciones.
Cuando se consideran dos o ms loci el equilibrio se obtiene ms lentamente y esto es ms
lento an cuando los genes estn ligados. Se demuestra sin embargo, que a la larga, bajo
continuo apareamiento aleatorio, los genes, an cuando estn fsicamente ligados, se van
comportando cada vez ms como si fueran independientes; esto es importante en el
mejoramiento del maz.

166
Entonces tendremos lo siguiente:

(i) Genotipo Frecuencia Valor genotpico


genotpica (fi) (gi)
2 AA p2 u
1 Aa 2pq h
0 aa q2 -u

La media de la poblacin genotpica es entonces:

= p2u + 2pqh +q2(-u)


= (p q)u + 2pqh

La variancia es:

( )

=p2u2 + 2pqh2 + q2(-u)2 [(p-q)u + 2pqh]2

La variancia gentica total ( ) se descompone a su vez en la variancia de los efectos


gnicos aditivos y la variancia de los efectos gnicos no aditivos. Esto es importante para
la seleccin y la hibridacin.

Variancia gentica

Para que sea posible hacer mejoramiento en una poblacin es indispensable que sea
variable a fin de escoger los mejores genotipos de entre todos los posibles; dicho en otras
palabras, es necesario que exista la variacin gentica ( ).

Ahora, en la seleccin y con relacin a la composicin de la variancia gentica se tiene el


efecto medio de sustitucin de un gene que se simboliza con la letra griega alfa (). Si
partimos de que los genes dominantes (A), son los favorables, entonces interesa ver que
cambio ocurre al pasar del genotipo aa al Aa, y del Aa al AA en la poblacin genotpica, lo
cual causar un cambio de la media que ser el resultado de la seleccin, o respuesta a la
seleccin, a la cual volveremos despus. Por lo pronto, el cambio de los valores
genotpicos por sustitucin de un gene es = u + (q p)h; puede verse que si h = 0,
entonces = u, es decir, el cambio es totalmente aditivo, o sea:

aa Aa AA
-u 0 u

Sucediendo lo mismo cuando p = q =1/2 an cuando h sea diferente de cero.

167
Precisamente mide la cantidad de linealidad en la variancia gentica total, o sea la
variancia debida a regresin lineal (Figura 3.1). En este contexto la variancia gentica total
se equipara con la variancia total cuando existe una relacin de causa (x) a efecto (y) entre
dos variables: x es la causa del efecto y. En gentica x es el nmero de genes favorables (0
del genotipo aa, 1 del genotipo Aa y 2 del genotipo AA) que causan los efectos que son: -u,
h y u, respectivamente. La variancia lineal, debida a regresin, es entonces la variancia
aditiva y se calcula como:

[ ( )]

= 2pq2 = 2pq[u + (q-p)h]2

Mientras que la variancia no aditiva es la causada por las desviaciones de regresin debidas
a la dominancia, razn por la cual se le llama variancia de dominancia y es:

( )

Pudiendo verse que si h = 0 no hay variancia de dominancia, y entonces el modelo es


totalmente aditivo como se vio atrs; tenemos entonces, para el caso de un locus:

gi

=2q
D2
(AA) u

(Aa) h

D1

=(q-p)
(1-X)


(PM) 0
X0 X1 X12
(aa) (Aa) (AA)

Xi
= -2p

D0

(aa) -u

Figura 3.1. Variancia debida a regresin lineal.

168
Cuando son varios los loci que determinan el carcter, entonces las variancias conjuntas
(total, aditiva, y dominante) son iguales a las respectivas sumas de las de todos los loci; sin
embargo, aqu hay que tener presente que puede existir epistasis o interaccin inter loci,
razn por la cual, se tiene entonces:

En donde:

Modelo Fenotpico

En la realidad, los elementos de la poblacin genotpica son afectados por el medio


ambiente; esto no ocurre en la misma forma para cada genotipo, sino que depende de cmo
interacciona ste con aqul; de esta forma el valor fenotpico de una planta es:

fij = u + gi + ej + (ge)ij
fij= u +gi + ej + ij

Siendo:
fij = valor fenotpico del individuo con genotipo i (gi) en el ambiente j (ej), y (ge)ij =
ij = interaccin entre gi y ej.

En este modelo el smbolo gi lleva implcito al genotipo conjunto determinado por varios
loci.

Variancia fenotpica

A partir del modelo anterior, se tiene:

Y como se conoce la constitucin de entonces:

169
Se llama heredabilidad a la proporcin (expresada como porcentaje) de la variancia
gentica aditiva en relacin a la variancia fenotpica, en sentido restringido, o sea:

Del valor de h2 depender el xito de la seleccin.

Respuesta a la seleccin (R G)

Se llama respuesta a la seleccin a la diferencia entre la media de la variedad original


(VO), o sea la que se va a mejorar, y la media de la variedad mejorada suponiendo que se
evalan en el mismo medio ambiente. Tambin se le conoce como ganancia gentica o
progreso gentico.

Unidad de seleccin (US)

Es la unidad que se toma de la poblacin para hacer la seleccin. Puede ser la planta
individual como en la seleccin masal, la familia como en la seleccin familiar, la planta y
la familia como en la seleccin combinada, o lneas de diferente grado de autofecundacin
en la seleccin sinttica, seleccin de lneas para hacer sintticos.

Presin de seleccin (P)

Es el porcentaje de la poblacin que se selecciona en la variedad original para ser usada


como progenitores de la siguiente generacin (Figura 3.2).

Figura 3.2. Diferencial de Seleccin y Respuesta a la Seleccin.

170
Diferencial de seleccin (D)
Es la diferencia entre la media de la variedad original y la media de los individuos
seleccionados, o sea s - f.

Intensidad de seleccin (i)


Es el diferencial de seleccin estandarizado, o sea, dividido entre la desviacin estndar
fenotpica D/f. Tambin se calcula tericamente como la ordenada en el punto de
truncamiento dividido por la presin de seleccin, es decir:

Las presiones de seleccin ms comunes son de 5, 10 y 20 %. A continuacin se tienen


valores de presin de seleccin (P) e intensidad de seleccin (i).

P (%) i
1 2,665
5 2,063
10 1,755
15 1,554
20 1,400
25 1,271

Como puede observarse, los valores de las intensidades de seleccin son inversos a los de
la presin de seleccin, es decir corresponden a mayores valores de las abscisas a partir de
la media f en el diferencial de seleccin (D) una vez que se estandarizan (figura 3.2); por
eso algunas veces se le llama a la presin de seleccin, exigencia de la seleccin;
denotando que mientras ms pequea es la presin de seleccin (P) se es ms exigente en
la seleccin de la unidad de seleccin (US).

Respuesta a la seleccin (R)

Es la diferencia entre la media de la variedad original (f) y la media de la progenie de las


unidades de seleccin (H), o sea = H - f. frecuentemente se expresa como por ciento de
la variedad original, o sea:

Clculo de la respuesta esperada o terica.

nicamente ejemplificaremos con la seleccin individual (SI). A partir de sta


deduciremos la respuesta a la seleccin masal (SM) que es el caso comn en maz. En la
seleccin individual las unidades de seleccin son los dos individuos de cada pareja de
progenitores seleccionados, es decir, sus valores fenotpicos se miden antes de que se
hayan cruzado o apareado; esto desde luego no ocurre en la seleccin masal en donde el
carcter rendimiento de grano se mide despus de que ocurre el cruzamiento por
polinizacin libre (PL) y en uno solo de los progenitores (el femenino). Esta claro entonces
que la seleccin individual estrictamente hablando es ms efectiva en caracteres que
pueden medirse antes o un poco antes de la floracin, como son en los casos de la altura de
planta o de mazorca y en algunos casos la resistencia a enfermedades.

171
La frmula general de la respuesta a la seleccin es:

Donde:

p = es el cambio de la frecuencia gnica ocasionada por el diferencial de seleccin.

/ derivada del valor de la media gentica (como funcin de p) con respecto a p.

La frmula se explica como sigue. Se supone que hay una relacin lineal de causaefecto
entre dos magnitudes de las US que se expresan como diferencia con respecto a sus
correspondientes medias. La causa de la respuesta a la seleccin es el diferencial de
seleccin (cuya media es cero de acuerdo a su definicin).

El efecto es el cambio entre la frecuencia gnica en la poblacin p, siendo su media la


frecuencia gnica de la variedad original, y el nuevo valor de esta (despus de la seleccin)
que es ps de manera que:

p = ps p

Ahora, lo que en realidad se hace es escoger valores fenotpicos de las US los cuales tienen
frecuencias gnicas correspondientes a sus respectivos genotipos. En el caso de dos alelos
del ejemplo, las frecuencias gnicas de las US: AA, Aa y aa, suponiendo al gene
dominante favorable, son 1, y 0, respectivamente.

Como esta relacin causa-efecto es lineal estar medida por un coeficiente de regresin
pf. del cambio de la frecuencia gnica p (simbolizado en por p) sobre el diferencial de
seleccin D (simbolizado por f), de manera que:

De donde:

Ahora pf se calcula como la covariancia entre p y f dividida por variancia de f, o sea

( )

Donde:

COV (p, f) = COV (p, + g + e + )


= COV (p, ) + COV (p, g) + COV (p, e) + COV (p, )
= COV (p, g)

172
Ya que los otros trminos valen cero: COV (p, ) porque es la covariancia de una variable
con una constante, y COV (p, e) y COV (p, ) porque son dos variables que no estn
correlacionadas, es decir, las frecuencias gnicas de los genotipos se asignan al azar a los
ambientes por lo que la covariancia (o la correlacin) esperada es cero.

De esta forma, y de acuerdo al siguiente cuadro se calcula la covariancia entre las


frecuencias gnicas y los valores fenotpicos como la covariancia entre las frecuencias
gnicas y sus respetivos valores genotpicos, o sea:

( ) ( ) ( ) ( )

Genotipos Frecuencia Valor genotpico (gi) Frecuencias gnicas


genotpica (fi) (p)
AA p2 U 1
Aa 2pq H
aa q2 -u 0

La media de ya la conocemos, la media de se calcula usando la misma frmula, o


sea:

( ) ( ) ( )
( )

De manera que:

( ) [( ) ]
( ) ( ) ( )
( ) ( ) [ ( ) ]
( )

ya que 1 2p = q - p

De esta forma, volviendo a la frmula de pf se tiene:

De suerte que:

Por otra parte, una vez que hemos determinado el cambio de la frecuencia gnica se espera
que haya un cambio de la media gentica; se tiene nuevamente una relacin causa-efecto,
en la que la causa es la frecuencia gnica de la poblacin y el efecto la media (o mejor
dicho, el cambio en la media).

173
Para esto derivamos a , puesta exclusivamente como funcin de p, o sea f(p), con
respecto a p, tendremos entonces:

( ) ( ) ( )
( ) ( )
( ) [ ( ) ]

De esta manera, utilizando los valores p y / en la frmula de la respuesta, se


tiene:

Pero como , entonces:

Ecuacin (1)
O bien multiplicando y dividiendo por f, se tiene:

Pero como , entonces:

Ecuacin (2)

En las dos ecuaciones nos damos cuenta que la respuesta R es funcin directa de i, es decir,
mientras mayor es sta se tendr una mayor respuesta; sin embargo, la presin de seleccin
no puede ser tan alta al grado de que slo se seleccionen unos cuantos individuos, pues
entonces se tendr el fenmeno de la endogamia que se suscita por la homocigosis,
resultado del apareamiento de progenitores en muestras pequeas. En la prctica se ha
determinado que el nmero mnimo de plantas a seleccionar es de 200, pudiendo oscilar
entre 200 a 500, independientemente de la US que se emplee.

Por otra parte; en la ecuacin 1 podemos ver que R es directamente proporcional a (de
ah su importancia en saber su significado) e inversamente proporcional a , lo cual se
refleja en forma conjunta en la ecuacin 2 a travs de la heredabilidad; sin embargo, en
esta ecuacin aparentemente R es tambin funcin directa de lo cual es engaoso pues
parecera que para una cantidad fija de (o mas exactamente, para una cantidad fija
de ), la respuesta se incrementara aumentando esencialmente la variancia ambiental
y la de interaccin gentico-ambiental, ( ), lo cual sera contradictorio ya que la
seleccin se apoya precisamente en lo opuesto, o sea en la existencia de
(especficamente ); esto se resuelve desglosando a h2 en sus componentes y de
manera que al incrementarse en la ecuacin 2 tambin se est incrementando y h2 ,
por lo tanto se disminuye sta, lo cual se ve en la ecuacin 1.

174
La frmula general de la respuesta a la seleccin:

Se puede entender considerando los dos factores que la constituyen:

p y / . El primero, aunque aparentemente es un factor genotpico (puesto que se


trata de la frecuencia gnica) como es en efecto, en realidad es una conjuncin de un
elemento gentico ( ) que es la materia prima de que disponemos para hacer la
seleccin, y un elemento fenotpico, o ms bien ambiental si consideramos que (ms
bien ) es fija (desde luego sin considerar a i, cuya influencia ya hemos discutido).

El segundo factor si es propiamente un elemento exclusivamente gentico: Para


entender esto, y dando por sentado que ya sabemos el origen y significado de p, podemos
suponer que la variacin fuera exclusivamente gentica, entonces la respuesta realmente se
obtendr del segundo factor de la frmula general de la respuesta, o sea: ( )

Entonces tendramos que abstraernos e imaginar que conocemos p y dp (el cambio operado
en la frecuencia gnica) y por consiguiente, y Obviamente, como se trata de clculo
diferencial dp es infinitamente pequeo, pero para propsitos de ilustracin podemos usar
el siguiente ejemplo.

Supongamos que hay dominancia completa (h = u ), p=q = 0,5 y que dp = 0,01; entonces,
la media de la VO es:

( ) ( )( )

( )

La media, despus de la seleccin es:

( ) ( )( )

Y la respuesta a la seleccin sera:

y dp = 0,51 - 0,50 =0,01

Como se haba dicho; de manera que:

Que es aproximadamente igual a

175
5. MTODOS DE MEJORAMIENTO

El mtodo de mejoramiento a aplicarse depende de si se va mejorar dentro de una


poblacin o entre pobaciones. Las diferentes metodologas que se presentan en cada uno de
los mtodos que se describen son referidos al cultivo de maz, las cuales tambin se pueden
aplicar en forma similar en otros cultivos, con ciertas diferencias que van a depender
principalmente de las caractersticas del cultivo.

5.1. Introduccion de germoplasma

La introduccin de germoplasma se puede considerar como un mtodo indirecto de


mejoramiento de plantas. A donde quiera que ha ido el hombre siempre ha llevado consigo
sus semillas o plantas, y este transporte de materiales genticos ha sido fundamental en el
desarrollo de la agricultura mundial. Casi la totalidad de las variedades introducidas por los
colonizadores e inmigrantes fueron muy heterogneas, caracterstica que les proporcionaba
una gran flexibilidad de adaptacin.

Las variedades comerciales a partir de estas introducciones se pueden originar de tres


formas diferentes:

a) Directamente por medio de la multiplicacin en masa del material


introducido.
b) Mediante selecciones realizadas en las introducciones.
c) Por hibridacin de dichas introducciones con variedades ya adaptadas.

El destino de la mayor parte de las introducciones no ha sido su produccin a gran escala,


sino su inclusin en los almacenes de variedades de plantas conocidas con el nombre de
colecciones mundiales.

Asimismo, los inmensos avances logrados en las tcnicas genticas, citogenticas y


citolgicas para los estudios taxonmicos, han proporcionado una base firme para juzgar el
valor potencial de las especies o variedades exticas.

Una vez que se ha recibido una nueva planta, se debe examinar en lo referente a su
resistencia o susceptibilidad a plagas o enfermedades e identificarla antes de comenzar las
etapas de propagacin, ensayos de adaptacin y distribucin. La introduccin original, ya
sea por semilla o clones, generalmente es una cantidad reducida; por lo tanto, se debe
multiplicar antes de empezar a trabajar con ella.

Las colecciones mundiales de los diferentes cultivos representan grandes riquezas de


variabilidad gentica, cuya exploracin en beneficio de la agricultura se encuentra todava
sin aprovechar.

La domesticacin de especies silvestres es una manera de utilizar ciertos genes en el


mejoramiento de plantas. Es un mtodo de mejoramiento, ya que proporciona cuando se
lleva a cabo con xito, tipos domsticos que algunas veces son superiores a los que se
tenan.

176
5.2. Mejoramiento poblacional

Mejoramiento poblacional. Consiste en formar nuevas poblaciones a partir de una


variedad original, en donde se incremente la media del rendimiento despus de cada ciclo
de seleccin. Este incremento en la media se debe a que los individuos seleccionados
poseen genes superiores, que al recombinarse al azar producen nuevos genotipos de mayor
produccin, por lo tanto se espera que la poblacin mejorada sea ms rendidora en
promedio que la anterior. El incremento que se logre en cada ciclo de seleccin estar en
funcin de la variabilidad gentica de la poblacin bajo mejoramiento.

Seleccin recurrente o seleccin cclica. Es aquella en la cual de manera sistemtica se


escogen las plantas deseables de una poblacin, se hace la evaluacin de las plantas
seleccionadas y posteriormente son recombinadas las mismas para formar una nueva
poblacin. Tiene por objetivo incrementar la frecuencia de genes deseables en las
poblaciones variables, al seleccionar y recombinar generacin tras generacin las plantas
que llevan estos genes. La efectividad de dicha seleccin depende de:

La variabilidad gentica.
Las frecuencias gnicas de la poblacin.
La heredabilidad de las caractersticas bajo seleccin.
La existencia de genes deseables en la poblacin original.
La efectividad del procedimiento de seleccin.
El grado de recombinacin.
El nmero de ciclos de seleccin.

La seleccin recurrente se divide en:

a) Fenotpica. Cuando la seleccin se basa en el fenotipo de la planta (seleccin


masal).
b) Genotpica. Cuando las plantas se seleccionan con base en el comportamiento de su
progenie (seleccin de familias de medios hermanos (MH), hermanos completos
(HC), progenies autofecundadas, etc.).

El mejoramiento poblacional por seleccin recurrente se divide en:

a) Mejoramiento intrapoblacional. Es usado para mejorar una poblacin per se e


incluye seleccin dentro de una poblacin. La poblacin mejorada se puede usar
como una nueva variedad, o bien se pueden derivar lneas para explotarlas como
variedades homocigotas, o para el uso en recombinaciones hbridas.
b) Mejoramiento interpoblacional. Se aplica cuando se mejoran al mismo tiempo dos o
ms poblaciones no emparentadas genticamente. En este caso, una de ellas sirve
como probador de la otra y viceversa, o bien ambas pueden tener un probador
comn. Las poblaciones mejoradas per se se podrn emplear para este propsito o
para la extraccin de lneas y usarlas en recombinaciones hbridas.

177
En teora, el mejoramiento intrapoblacional se considera de mayor utilidad para caracteres
controlados por el tipo de accin gnica aditiva con dominancia parcial o completa, como
por ejemplo, la seleccin para adaptabilidad de una poblacin en particular. El
mejoramiento interpoblacional es de mayor utilidad cuando es ms deseable la
heterocigosidad o sobredominancia que la homocigosidad para los loci que controlan un
carcter, por ejemplo cuando se necesita mejorar cruzas poblacionales.

La decisin de qu mtodo utilizar depende de las caractersticas bajo seleccin, de los


objetivos de la misma y de los recursos fsicos, econmicos y humanos con que cuenta el
programa de mejoramiento.

Unidades de seleccin de recombinacin y control parental. Las diferencias entre


los mtodos de seleccin recurrente estn en funcin de las unidades de seleccin, de
recombinacin y del control parental.

La unidad de seleccin. Es el material que se utiliza (plantas individuales o familias)


para identificar y seleccionar los genotipos superiores. En seleccin masal la unidad de
seleccin es una sola planta, en seleccin de familias de medios hermanos es la semilla de
stas.

Unidad de recombinacin. Es el material que se utiliza para recombinar los genotipos


seleccionados. En seleccin masal, dicha unidad es la semilla de la misma planta usada
como unidad de seleccin, en la seleccin de familias de medios hermanos puede ser la
semilla de stas o la obtenida de los machos autofecundados progenitores de las familias
seleccionadas.

El control Parental. En un programa de seleccin recurrente intrapoblacional, se


define como la relacin existente entre la unidad de seleccin y la unidad de
recombinacin, es decir, se refiere al material en que se basa la seleccin (plantas
individuales o familias) y la semilla que se utiliza para recombinar (remanente de plantas
o familias seleccionadas o bien semilla autofecundada de progenitores machos de familias
seleccionadas) para el siguiente ciclo de seleccin. Son posibles tres valores de control
parental: , 1 y 2, siendo la unidad de seleccin y de la recombinacin la misma en los dos
primeros.

Control parental de cuando la seleccin se realiza despus de la polinizacin. En


este caso slo se controla al progenitor femenino; por tal razn, los genotipos
seleccionados que se utilizarn en la siguiente generacin fueran polinizados por
los seleccionados y los no seleccionados (seleccin masal).
Control parental de 1, cuando los genotipos se polinizan por ellos mismos o por
otros individuos seleccionados.
Control parental 2, cuando la unidad de seleccin es una y la unidad de
recombinacin es otra, es decir, no son la misma.

Para los mtodos de seleccin masal y de mazorca por surco modificado (mtodo
Lonnquist) el control parental es , debido a que la seleccin se efecta despus de la
polinizacin; por eso la semilla de las plantas seleccionadas que se utilizarn en la
siguiente generacin son polinizadas por plantas seleccionadas y no seleccionadas.

178
El control parental es 1 para los siguientes mtodos:
En seleccin masal, cuando la seleccin se efecta antes de la polinizacin
(recombinacin). Es cuando se selecciona una caracterstica que se expresa antes de
la polinizacin, permitiendo eliminar todas las plantas que no presentan la
caracterstica, antes de la floracin (en el maz en el despanojamiento).
En seleccin de familias de medios hermanos, cuando se utiliza la semilla
remanente de los medios hermanos seleccionados para recombinar.
En seleccin de familias de hermanos completos y en seleccin entre progenies S 1,
cuando se utiliza la semilla remanente de los hermanos completos y de las lneas S 1
seleccionadas para recombinar.
Una caracterstica comn entre los mtodos anteriores es que la unidad de seleccin (una
planta, semilla de medios hermanos, hermanos completos, o lneas S1) se usa a la vez como
unidad de recombinacin.
El control parental es 2 para los siguientes mtodos:

1) Familias de medios hermanos: progenie de una mazorca.


2) Mezcla de cruzamiento de varias plantas de una lnea por el polen de una sola
planta

La seleccin de familias de medios hermanos cuando la semilla autofecundada de los


progenitores masculinos de las familias de medios hermanos seleccionados se usa para
la recombinacin. En este caso, la unidad de seleccin utilizada para evaluar es la
semilla de medios hermanos y la unidad de recombinacin es la semilla autofecundada
de los progenitores masculinos de las familias seleccionadas.

5.3. Mejoramiento intrapoblacional


El mejoramiento intrapoblacional se refiere al mejoramiento que se aplica a una poblacin
dentro de ella, mediante diversos mtodos de mejoramiento que se diferencian por la
importancia que tiene la que existen para ello basados en la seleccin, en relacin a la
variancia gentica aditiva que es la que se hereda en la descendencia. Los mtodos ms
comunes son seleccin masal, seleccin masal estratificada, seleccin de familias de
medios hermanos, de hermanos completos, etc.

Seleccin masal
Es uno de los mtodos ms sencillo y simple de efectuar. Consiste en seleccionar
fenotpicamente los mejores individuos dentro de una poblacin con la finalidad de formar
una poblacin superior a la original.

La seleccin masal es el mtodo ms antiguo y sencillo en el mejoramiento de plantas. Sin


embargo, debido a que no se efecta un control adecuado de otros factores que inciden en
los individuos que van a ser seleccionadas no es efectivo este mtodo, principalmente para
caracteres cuantitativos que tienen una baja heredabilidad, en cambio, se tiene una alta
efectividad para caracteres cualitativos y que tengan una alta heredabilidad. El componente
gentico del rendimiento de cada planta se confunde con otras fuentes de variacin tales
como heterogeneidad del suelo, competencia por el espacio entre planta y planta, prcticas
de manejo del cultivo, etc.

179
Ventajas y desventajas de la seleccin masal.

Dentro de las ventajas tenemos:

Es sencilla de realizar, cualquier persona puede efectuarla una vez que haya
aprendido los procedimientos, ya que en el campo es fcil de identificar las mejores
plantas dentro de una poblacin y recolectar de estas las semillas individualmente
en la cosecha.
Se puede utilizar un mayor nmero de plantas para ser seleccionadas y aplicar una
mayor presin de seleccin.
Se requiere un mnimo esfuerzo de trabajo y conocimiento cientfico del cultivo.
No se requiere de una inversin econmicamente grande.
Un ciclo se completa en una generacin.

La principal limitante de este mtodo es no poder diferenciar si los rendimientos de las


plantas individuales se deben a su potencial gentico, o bien a efectos del medio ambiente
en donde se desarrolla el cultivo.

Para utilizar la seleccin masal debemos partir de una poblacin con amplia base gentica
(heterognea heterocigota); por lo general el comportamiento de los individuos de este
tipo de poblaciones tiene una distribucin normal. Por tal razn, el propsito de la
seleccin es la eleccin de los individuos superiores, es decir, aquellos que caigan en el
extremo positivo de la curva, los cuales se sembrarn despus en un lote aislado para su
recombinacin; por ejemplo para caractersticas como rendimiento que deben ser
superiores; si buscamos para caractersticas como individuos de menor porte
seleccionaremos los individuos que caigan en el extremo negativo de la distribucin del
carcter altura de planta.

En la seleccin masal de plantas algamas, la seleccin se dirige a la eleccin de


individuos de mayor produccin y valor agronmico. Se tiene mayor xito cuando se trata
de caracteres que actan en forma aditiva y que se acumulan y no pierden su accin al
segregar, es decir se adicionan ciclo tras ciclo los genes deseables, en cada generacin se
recorre la media hasta alcanzar la mxima respuesta. Esto depende principalmente de la
variabilidad gentica de la poblacin.

Cuando la poblacin es muy variable, la presin de seleccin no debe ser alta desde un
comienzo para dar oportunidad a que una alta proporcin de individuos lleguen a formar
parte de la poblacin superior. Despus de varios ciclos de seleccin recin se puede
estrechar la poblacin usando una alta presin de seleccin y as obtener individuos
superiores. Si utilizamos al inicio una alta presin de seleccin la variabilidad se agota
rpidamente y es posible que no encontremos a los individuos superiores deseados por
eliminarlos rpidamente. El diferencial de seleccin aumenta o disminuye de acuerdo a la
variabilidad gentica existente en la poblacin. Si en una poblacin la variabilidad es
amplia, el diferencial de seleccin es mayor y si hay una variabilidad reducida en la
poblacin el diferencial de seleccin es pequeo.

La efectividad de la seleccin masal depende entre otros factores de los caracteres en


estudio, el tipo de herencia y de la heredabilidad que tengan estos. Es ms efectiva para
aquellas caractersticas de alta heredabilidad (genes mayores), como las siguientes: altura

180
de planta, resistencia a enfermedades (resistencia vertical), precocidad (ciclo vegetativo
corto), prolificidad (plantas con dos o ms mazorcas), capacidad de expansin del grano
(maz reventn), alto contenido de protena, etc.

Por otra parte, dicha seleccin es poco efectiva para caractersticas de baja heredabilidad,
como rendimiento, acame, resistencia a insectos, etc.

Dado que el ambiente afecta mucho a las caractersticas de baja heredabilidad, la ganancia
obtenida de la seleccin es pequea. Por lo tanto, la seleccin masal es eficiente para
caractersticas que muestren una alta correlacin entre fenotipo y genotipo. La
heredabilidad es el grado en que el fenotipo refleja al genotipo en sentido amplio; en
sentido restringido o estrecho es la porcin de la variancia gentica debida a efectos
aditivos expresada como porcentaje de la variancia fenotpica.

La respuesta o ganancia en la seleccin masal est en funcin de la heredabilidad, de la


variancia fenotpica y del medio ambiente.

La seleccin masal aprovecha solamente la variancia aditiva. Por ello, a medida que la
seleccin aumenta, la variancia aditiva disminuye, esto es debido a que la variancia aditiva
est en funcin de las frecuencias gnicas. El xito de la seleccin masal se debe a los
siguientes factores tcnicas adecuadas de campo, alta heredabilidad y amplia variabilidad
gentica.

El propsito principal de la seleccin masal es incrementar la frecuencia de genes


favorables en las poblaciones, es decir, a mayor frecuencia de las combinaciones de los
genes deseables, mayor ser la posibilidad de encontrar plantas con buenos caracteres
agronmicos.

Metodologa

1. Sembrar 3000 a 5000 plantas en un lote aislado utilizando un cordel sembrador.


2. Seleccionar 300 a 500 plantas que sean competitivas por aspecto y productividad.
3. Cosechar las plantas seleccionadas y escoger 300 mazorcas.
4. Mezclar igual nmero de semillas de cada mazorca (Compuesto Balanceado).
5. Sembrar el compuesto balanceado para el siguiente ciclo.

Seleccin masal estratificada.

Metodologa

Se siembra las plantas en un lote aislado a cordel a una determinada densidad de plantas
por hectrea (distanciamiento entre surcos, entre plantas y nmero de plantas por golpe).
Las prcticas de manejo agronmico deben ser muy uniformes (abonamiento, riegos
control de malezas, enfermedades y plagas, etc.). A la cosecha se debe de estratificar el
campo en parcelas pequeas (subparcelas), eliminado las plantas del bordo en los cuatro
lados del campo (Figura 3.3).

181
El rea de seleccin se divide en subparcelas ms pequeas, dentro de las cuales la
variacin edfica y otras variables ambientales se reducen al mnimo y las diferencias son
solo debidas a causas genticas. Se debe de seleccionar solo plantas competitivas dentro de
cada subparcela. Se debe de sembrar un mayor nmero de semillas por cada golpe y luego
realizar un raleo, para asegurar una densidad de plantas perfecta, que provea de una
competencia entre plantas uniforme. Este sistema ha sido muy efectivo en el mejoramiento
de numerosos cultivos, incluyendo rboles.

Procedimiento

1. Sembrar 3000 a 5000 plantas en un lote aislado utilizando un cordel sembrador.


2. Dividir el lote en 30 a 40 sublotes que vienen a ser las parcelas con
aproximadamente 100 plantas cada uno.
3. Seleccionar ms o menos 20 plantas en cada parcela.
4. A la cosecha seleccionar ms o menos 10 mazorcas en cada parcela.
5. Mezclar igual nmero de semillas de cada mazorca seleccionada (Compuesto
Balanceado).
6. Sembrar el compuesto balanceado para el siguiente ciclo.

(1) No de surcos por parcela


(2) No de golpes de 2 plantas por surco

Figura 3.3. Estratificacin del campo en subparcelas.


Seleccin masal convergente-divergente

182
Seleccin convergente-divergente. Mtodo de fitomejoramiento gentico que
bsicamente consiste en tomar muestras de semillas de varias localidades, despus formar
un compuesto balanceado, bajo polinizacin libre y enviar estas semillas segregantes
genotpicamente a cada una de las localidades para su seleccin (divergente) y
posteriormente recombinar la semilla proveniente de todas las localidades para su
recombinacin (convergencia) para de esta manera tener la variedad mejorada. Se
requieren varios ciclos de convergencia y divergencia del germoplasma.

Seleccin de familias

Tipos de familias. La familia es la progenie obtenida de un apareamiento no aleatorio,


cuya descendencia guarda una relacin, De acuerdo a esta relacin se agrupan en: familia
de medios hermanos (FMH) donde slo uno de los progenitores es conocido, sea el padre o
la madre y la familia de hermanos completos (FHC) en donde ambos progenitores de
distintas plantas se conocen. Las familias provenientes de la autofecundacin de plantas
son lneas S.

Seleccin de familias de medios hermanos

Mazorca por surco

Este mtodo se inici en Illinois en 1896, segn las descripciones de Hopkins7 y


Montgomery.17 Consiste en sembrar y evaluar la poblacin a ser mejorada en surcos de
familias de medios hermanos (FMH). Las mazorcas de las mejores plantas de las mejores
familias son elegidas y sembradas mazorca por surco el prximo ciclo de seleccin. Este
mtodo se realiza en una generacin por ciclo y el control parental es igual a 1/2.

Metodologa

1. Sembrar 3000 a 5000 plantas en un lote aislado utilizando un cordel sembrador.


2. Seleccionar unas 300 mazorcas.
3. Se desgranan por separado 50 a 100 mazorcas fenotpicamente deseables, parte de
la semilla de cada una de ellas se siembra en mazorca por surco para su evaluacin
en una sola localidad y sin repeticiones, el resto se guarda como remanente.
4. Cada surco se registra y evala para rendimiento y caractersticas agronmicas
deseables, y se seleccionan los mejores.
5. Con la semilla remanente de los mejores 10 o 20 familias se forma un compuesto
balanceado para sembrarse en un lote al ao siguiente. De este se escogen de nuevo
mazorcas para iniciar el segundo ciclo de seleccin y se repite el procedimiento, o
bien este compuesto se incrementa para siembras comerciales.

Es muy eficiente este mtodo para caractersticas de alta heredabilidad tales como
contenido de protena y aceite, pero no para rendimiento que posee baja heredabilidad

183
Mazorca por surco modificado (MSM)

Este mtodo fue descrito por Lonquist;14 consiste en la evaluacin de progenies en


mltiples localidades (puede ser una sola repeticin por ambiente), as como de un vivero
aislado para la recombinacin. En este vivero, cada familia MH o progenies de una misma
mazorca se siembra en surcos individuales o surcos hembra, los que antes de florecer son
despanojados. Un compuesto balanceado de la semilla de todas las familias MH se usa
para los surcos macho, que se siembran intercalados entre los surcos hembra. La seleccin
entre familias de MH se hace en base a su rendimiento promedio a travs de todas las
localidades. Tambin se efecta una seleccin visual para otros caracteres como resistencia
a enfermedades o aspecto de la mazorca entre las plantas de una misma familia. La
evaluacin del rendimiento se puede hacer simultneamente con la recombinacin, lo que
permite acortar la duracin de cada ciclo a solo una estacin de crecimiento. Este mtodo
se realiza en una generacin por ciclo y el control parental es igual a 1/2.

Metodologa

1. Sembrar de 3000 a 5000 plantas en un lote aislado con cordel sembrador.


2. Seleccionar 300 mazorcas de la variedad a seleccionar, por aspecto y sanidad.
3. Sembrar la progenie de las mazorcas seleccionadas (Familia de Medios Hermanos)
en ensayos de rendimiento en 3-4 localidades con dos o tres repeticiones.
Sembrar un lote de recombinacin con las 300 mazorcas, primero se siembra los
surcos hembras con las semillas con la semilla de la familia de Medios Hermanos,
cuatro surcos como hembras y un surco como macho. Esto permite seleccionar las
familias por aspecto dentro de un espacio pequeo (4 surcos). Despus se siembra
el macho polinizador con la semilla del compuesto balanceado de todas las
hembras.
4. Basndose en los ensayos de rendimiento, se seleccionan las mejores familias (40-
60) y se selecciona mazorcas nicamente de las familias seleccionadas que pueden
ser cinco por familia.
5. Las mazorcas seleccionadas 200 a 250 (Familias de Medios Hermanos) constituyen
el siguiente ciclo de seleccin.
6. Campaa o dos ciclos por campaa en lugares donde se puede sembrar dos vecs por
ao.

Modificacin de mazorca por surco modificado

Fue sugerido por Compton y Comstock2. Se basa en una evaluacin y seleccin como en el
procedimiento de Lonnquist14. Sin embargo, la recombinacin se efecta en la siguiente
campaa, solo las familias de medios hermanos seleccionadas se siembran como hembras
en lotes aislados, y son incluidos en el compuesto balanceado que se usa para los surcos
machos. Generalmente, este sistema requiere dos aos por ciclo. Este mtodo se realiza en
dos generaciones por ciclo y el control parental es igual a 1. La ventaja de esta
modificacin es que la recombinacin se hace con las mejores familias.

Metodologa

1. Sembrar de 3 000 a 5 000 plantas en un lote aislado con cordel sembrador.


2. Seleccionar las mejores 300 mazorcas por planta.

184
3. Sembrar la progenie de las mazorcas seleccionadas (Familia de Medios Hermanos)
en ensayos de rendimiento en 3-4 localidades con dos o tres repeticiones.
4. Sembrar un lote de recombinacin con las mejores 4050 familias de medios
hermanos basados en los ensayos de rendimiento como hembras. Despanojar todas
las hembras. Los surcos polinizadores sern sembrados con el compuesto
balanceado de todas las hembras.
5. Se seleccionan dentro de las mejores 40-50 familias cinco mazorcas (plantas).
6. Las mazorcas seleccionadas 200 a 250 (Familias de Medios Hermanos) constituyen
el siguiente ciclo de seleccin.
7. Se puede completar un ciclo de seleccin por campaa.

Como se dijo anteriormente, esta metodologa difiere de la anterior en que primero se


evalan las familias en ensayos de rendimiento y luego las mejores familias seleccionadas
se recombinan en un lote aislado.

Familias de medios hermanos

Fue descrita por Jenkins12. Comienza con la obtencin de familias de medios hermanos
(FMH) en un lote de recombinacin, generalmente, de polinizacin abierta. Seguidamente,
se evala el rendimiento de estas FMH con repeticiones y, preferentemente, en dos o ms
ambientes. Las FMH seleccionadas se recombinan en la siguiente campaa (ya sea
mediante el uso de surcos hembras y machos o bien polinizadas a mano con una muestra
aleatoria del polen de la misma poblacin). Luego de esta primera recombinacin, un
compuesto balanceado con la semilla de cada familia se siembra en un lote de
recombinacin, con lo que se comienza un nuevo ciclo de seleccin. El sistema requiere
tres campaas que pueden reducirse a dos si una de ellas no es la principal. Las fases de
recombinacin y produccin de nuevas progenies a veces se combinan en la misma
campaa,3 lo cual puede reducir la duracin de cada ciclo a dos campaas (un ao). Una de
las ventajas del uso de FMH es que, en cada ciclo de seleccin, se pueden obtener
estimados de la variancia gentica aditiva y de heredabilidad de los caracteres bajo
seleccin.

Metodologa

1. Sembrar 3000 a 5000 plantas en un lote aislado con cordel sembrador.


2. Seleccionar 300 mazorcas (plantas).
3. Desgranar las mazorcas individualmente.
4. Evaluar cada familia de medios hermanos en ensayos de rendimiento con
repeticiones y en varias localidades.
5. Seleccionar las mejores 20-30 familias en base a los datos del ensayo de
rendimiento.
6. Recombinar las familias seleccionadas. Para esto, usar mezcla balanceada (semilla
remanente) de las familias seleccionadas y sembrar el lote de recombinacin.

Seleccin de familias de hermanos completos (SFHC)

Segn Moll y Robinson,23 la evaluacin y seleccin de familias de hermanos completos


(FHC), consiste en la evaluacin del rendimiento de progenies originadas por cruzas
intrapoblacionales entre pares de plantas (planta a planta). En un lote de recombinacin se

185
efectan cruzas planta a planta para obtener FHC, cuyas progenies son evaluadas en
ensayos de rendimiento en la campaa siguiente usando, en lo posible, numerosas
localidades con ms de una repeticin por localidad. Las FHC seleccionadas se
recombinan durante la tercera campaa. Luego de la cosecha se hace un compuesto con las
cruzas hechas en cada FHC, tomando igual cantidad de semilla de cada FHC se siembra el
lote de recombinacin, con lo que se inicia un nuevo ciclo de seleccin. Cada ciclo
requiere tres campaas, por lo que se puede completar en dos aos, si se usa dos campaas
por ao.

Metodologa

1. Sembrar 3000 a 5000 plantas en un lote aislado con un cordel sembrador.


2. Hacer cruzas planta a planta (P a P) ms o menos 500 cruzas para producir familias
de hermanos completos (H.C.).
3. Seleccionar las mejores 200-250 cruzas (H.C.).
4. Evaluar los H.C. en ensayos con repeticiones en varias localidades (Ltice 14x14 o
16x16).
5. En base a datos del ensayo de rendimiento seleccionar las mejores 20-30 familias
de H.C.
6. Hacer cruzas P a P entre las 20-30 familias de H.C. seleccionadas para generar el
siguiente ciclo de H.C.

Seleccin de familias S1

Evaluacin de familias S1 per se

Esta metodologa consiste en la evaluacin del rendimiento de progenies producidas


mediante la autofecundacin de un nmero de plantas de una poblacin. La evaluacin del
rendimiento, as como la recombinacin de los genotipos selectos, se realiza del mismo
modo ya descrito para otros mtodos de mejoramiento usando familias. Una vez que la
poblacin se ha recombinado, se autofecunda un compuesto balanceado de la misma para
obtener un nuevo grupo de familias S1 (FS1). Se requieren tres campaas para cada ciclo de
seleccin, que se puede completar tambin en dos aos, si se puede sembrar dos campaas
por ao.

Metodologa

1. Sembrar 3000 a 5000 plantas en un lote aislado con un cordel sembrador.


2. Autofecundar ms o menos unas 600 plantas.
3. Seleccionar las mejores 200-250 mazorcas autofecundadas (S1).
4. Evaluar las S1 en ensayos de rendimiento con repeticiones y en varias localidades.
5. Seleccionar las mejores 20-30 S1 basndose en los datos de los ensayos de
rendimiento.
6. Recombinar las S1 seleccionadas.
7. Se requieren tres campaas para completar un ciclo.

186
Evaluacin de medios hermanos para aptitud combinatoria general

Este mtodo fue descrito por Jenkins en 1940. Consiste en autofecundar plantas
individuales de una poblacin y, simultneamente, cruzarlas con una muestra aleatoria de
plantas de una poblacin de amplia base gentica, que se usa como probador. De estas
cruzas se obtienen familias de medios hermanos (FMH) para cada planta. Estas FMH son
evaluados en ensayos de rendimiento. Las familias S1 relacionadas a las mejores FMH se
recombinan para iniciar un nuevo ciclo de seleccin. Se requieren tres campaas por cada
ciclo de seleccin, el cual puede completarse en dos aos.

Metodologa

1. Autofecundar 200-250 plantas y tambin cruzarlas con un probador (variedad).


Plantas S1.
2. Evaluar las cruzas de prueba en ensayos con repeticiones y en varias localidades.
3. Seleccionar las mejores 20-30 S1 usando los datos de los ensayos.
4. Recombinar las mejores 20-30 S1 usando semilla remanente.
5. Se requieren tres campaas para completar un ciclo.

Evaluacin de hermanos completos para aptitud combinatoria especfica (S1-HC)

Este mtodo es similar al anterior: se autofecundan plantas individuales las que tambin
son cruzadas, en este caso, con una lnea endocriada usada como probador.10-11 Una vez
obtenidas las familias de hermanos completos (FHC), son evaluadas en ensayos de
rendimiento. Como en el caso anterior, las FS1 relacionadas con las mejores familias de
hermanos completos son las que se usan en la recombinacin para iniciar un nuevo ciclo de
seleccin. Al igual que en los casos anteriores, se requieren tres campaas para cada ciclo,
el cual puede completarse en dos aos. Este mtodo ha sido muy efectivo en distintos
proyectos de mejoramiento poblacional.8,20,21 Originalmente fue propuesto para el
desarrollo de poblaciones fuente de donde extraer lneas para formar hbridos con una
determinada lnea lite.

Metodologa

1. Autofecundar 200-250 plantas y tambin cruzarlas con un probador cruza de prueba


de plantas S1 de una lnea.
2. Evaluar las cruzas de prueba en ensayos con repeticiones y en varias localidades.
3. Seleccionar las mejores 20-30 S1 usando los datos de los ensayos de rendimiento.
4. Recombinar las mejores 20-30 S1 usando semilla remanente.
5. Se requieren tres semestres para completar un ciclo.

Seleccin de familias S2

Evaluacin de familias S2 per se

Consiste en dos generaciones de autofecundaciones, con o sin seleccin en la S1.9 Las


familias S2 (FS2) son evaluadas y las mejores seleccionadas para su posterior
recombinacin, tal como se hace en otros mtodos de seleccin de familias. Este mtodo

187
requiere cuatro estaciones de crecimiento por ciclo, el que puede completarse en dos
campaas por ao si se usan viveros para la obtencin de las FS2 y para la
recombinacin. Este sistema no ha sido usado muy extensivamente debido, probablemente,
a los importantes efectos de interaccin genotipo x ambiente, y a las dificultades en la
evaluacin de FS2 de maz per se.

Metodologa

1. Sembrar 3000 a 5000 plantas en un lote aislado con un cordel sembrador.


2. Autofecundar mas o menos 600 plantas.
3. Seleccionar las mejores 200-250 mazorcas autofecundadas (S1).
4. Evaluar las S1 en ensayos de rendimiento con repeticiones y en varias localidades
(Ltice, 2 repeticiones).
5. Seleccionar las mejores 20-30 S1 basndose en los datos de los ensayos de
rendimiento.
6. Autofecundar las mejores 5-6 plantas en cada S1 seleccionadas y generar S2.
7. Evaluar 200-250 S2 en varias localidades con repeticiones, ltice, 2 repeticiones.
8. Seleccionar las mejores 20-30 S2 basndose en datos de los ensayos de rendimiento.
9. Recombinar las S2 seleccionadas.
10. Se requieren cinco semestres para completar un ciclo.

Evaluacin de hermanos completos para aptitud combinatoria especfica

Es similar al mtodo S1-HC. Una vez producidos las familias S1 (FS1) son estas las que
simultneamente se cruzan con la lnea lite usada como probador y se autofecundan para
obtener familias S2. Se considera que la evaluacin an se hace sobre las familias de
hermanos completos (FHC), ya que se trata de cruzas entre una lnea homocigota y la
progenie S1 de una planta individual de la poblacin. La recombinacin se realiza entre
familias S2 relacionadas a las mejores FHC de acuerdo a la evaluacin del rendimiento de
las mismas. Esta modificacin aumenta a cuatro el nmero de campaas requeridas para
cada ciclo. Se puede completar un ciclo de dos aos, si se usa viveros tanto para la
produccin de las familias FS2 y las cruzas FHC con la lnea lite como para la
recombinacin de las FS2 selectas. Sin embargo, es recomendable la seleccin de plantas
entre y dentro de FS1 para ser cruzadas y autofecundadas en la obtencin de las FHC y
FS2, respectivamente. Esto se realiza en forma ms apropiada bajo los ambientes
objetivo, lo que excluye el uso de viveros y, por lo tanto, alargara la duracin de cada
ciclo de tres aos.

Metodologa

1. Autofecundar 200-250 plantas y tambin cruzarlas con un probador. Cruzas de


prueba de planta S1 por una lnea.
2. Evaluar las cruzas de prueba en ensayos con repeticiones y en varias localidades.
3. Seleccionar las mejores 20-30 S1 usando los datos de los ensayos de rendimiento.
4. Recombinar las mejores 20-30 S1 usando semilla remanente.
5. Se requieren tres campaas para completar un ciclo.

188
Descendencia de una sola semilla

Seleccin y evaluacin de lneas endocriadas

Envuelve el rpido desarrollo de lneas endocriadas (generacin Sn) mediante el mtodo de


descendencia de una sola semilla.1 Las familias se evalan en ensayos de rendimiento, y
las mejores son recombinadas. El tiempo requerido por este mtodo depende del nmero
de generaciones de endocria deseado y del tiempo que cada generacin demanda. Este
mtodo ha sido empleado principalmente en especies autgamas.

5.4. Mejoramiento interpoblacional

El mejoramiento interpoblacional se realiza despus de haberse agotado la variabilidad en


una poblacin, en este caso se trabaja con dos poblaciones en forma conjunta. Se utiliza
toda la variabilidad gentica para utilizar el mtodo de mejoramiento.

Seleccin recurrente recproca de medios hermanos

Seleccin recurrente de familias S1 (SR-S1)

Comstock et al.,5 la sugirieron como un sistema de mejoramiento que podra permitir el


uso de todos los efectos genticos para aumentar la heterosis en la cruza entre dos
poblaciones dadas (A y B). Plantas individuales de la poblacin A son autofecundadas y,
simultneamente, cruzadas con una muestra aleatoria de plantas de la poblacin
recproca B. De igual manera, plantas individuales de la poblacin B son, al mismo
tiempo, autofecundadas y cruzadas con una muestra al azar de plantas de la poblacin A.
De las mazorcas de todas las cruzas de un determinado progenitor se hace un compuesto
balanceado, que constituye una FMH. Todas estas FMH son evaluadas, para cada
poblacin en forma separada, en ensayos con varias repeticiones y en varios ambientes.
Las FS1 relacionadas con las mejores FMH son recombinadas dentro de cada poblacin,
para constituir un nuevo ciclo de seleccin para cada una de estas poblaciones recprocas.

El sistema requiere tres estaciones de crecimiento (dos aos si se usan viveros) para
completar cada ciclo.

Paterniani19 sugiri un sistema que tiende a solucionar algunos de los principales


inconvenientes de este mtodo tales como: 1) el excesivo requerimiento de mano de obra y
alto costo para hacer las cruzas necesarias; y, 2) un muestreo inadecuado de la poblacin
recproca que acta como probador, ya que solo se usan entre 6 y 10 planta. En este nuevo
sistema, las plantas de cada poblacin son autofecundadas. Las FS1 de la poblacin A se
siembran (en parcelas aisladas) en surcos hembra individuales, mientras que los surcos
machos se siembran con un compuesto balanceado de las familias de la poblacin B. Las
FS1 de la poblacin A (surcos hembra) son despanojadas y dejadas para que se polinicen
libremente con una mezcla de polen proveniente de la poblacin recproca B. De esta
forma se obtiene, de cada FS1 de la poblacin A, las FMH que son posteriormente
evaluadas en ensayos de rendimiento. Las FS1 relacionadas a las mejores FMH son,
posteriormente, recombinadas para iniciar un nuevo ciclo de seleccin. Paralelamente, se
hace lo mismo con las FS1 de la poblacin B, pero usando como surcos machos un
compuesto balanceado de la poblacin A. Si bien este sistema requiere una estacin extra
de crecimiento, se puede todava completar en dos aos, mediante viveros de invierno.

189
Metodologa

Se requieren dos Poblaciones heterticas A y B.


Se cruzar la Poblacin A con la Poblacin B como probador.
Se cruzar la Poblacin B con la Poblacin A como probador.

Para cada Poblacin

Campaa I
1. Sembrar 3000 a 5000 plantas.
2. Autofecundar 600 plantas S1.
3. Seleccionar 150-250 mazorcas (Familias S1).

Campaa II
4. Establecer lotes de cruzamiento.
Pob. A 150-250 S1 como hembras.
Pob. B como macho (Cruzas de prueba).
Pob. B 150-250 S1 como hembras.
Pob. A como macho (Cruzas de prueba).
5. Cosechar cada cruza de prueba por separado.

Campaa III
6. Evaluar cruzas de prueba de cada poblacin en ensayos de rendimiento con
repeticiones y en varias localidades.
7. Seleccionar las mejores 20-30 cruzas de prueba de cada poblacin.

Campaa IV
8. Recombinar las S1 correspondientes a las cruzas de prueba seleccionadas
(Semilla remanente).
9. Iniciar siguiente ciclo de seleccin.

Seleccin rcurrente de medios hermanos (SR-MH)

Tambin sugerida por Paterniani,18 consiste en la siembra, cada progenie en una parcela
aislada, de progenies de FMH de cada poblacin como surcos hembras las que, al ser
despanojadas, son polinizadas solo por los surcos machos que son sembrados con un
compuesto balanceado de las familias de la poblacin recproca respectiva. Los
cruzamientos entre las FMH de cada poblacin y sus probadores (poblacin recproca) b
son evaluados en ensayos de rendimiento y las FMH relacionadas a las mejores cruzas, son
recombinadas para iniciar un nuevo ciclo de seleccin. La recombinacin se hace de
manera similar en surcos hembras a las cruzas con la poblacin recproca: cada FMH se
siembra en surcos hembras, las que al momento de la floracin son despanojadas. Como
surco macho se siembra un compuesto balanceado de todas las FMH pero de la misma
poblacin. Este sistema requiere solo tres estaciones de crecimiento por ciclo, el que
puede completarse en dos aos mediante el uso de viveros de invierno.

190
Seleccin recurrente de familias de medios hermanos usando plantas prolficas

Originalmente sugerida por Paterniani,18 para reducir los ciclos de seleccin a dos
estaciones de crecimiento, por lo que se requiere solo de un ao por ciclo. En cada
poblacin recproca se requieren plantas con, por lo menos, dos mazorcas. Tambin se
necesitan, al igual que los mtodos arriba mencionados, dos parcelas aisladas (1 y 2). En la
parcela 1 se siembran los surcos hembras con las familias de la poblacin A, y surcos
machos con un compuesto balanceado de la poblacin B. En la parcela 2, los surcos
hembras son de la poblacin B y los machos de la poblacin A. Al momento de la
floracin, los surcos hembras son despanojados y la mazorca inferior es cubierta para
prevenir la polinizacin libre. Cuando los estigmas de las mazorcas cubiertas emergen, se
polinizan con polen provenientes de 50 o ms plantas prolficas de la misma poblacin. Si
se trata de la poblacin A, polen de la misma solo se hallar en la parcela 2, donde esta
poblacin fue sembrada en los surcos machos. De la misma manera, plantas prolficas de
los surcos machos de la parcela 1 (poblacin B), se usan para polinizar las mazorcas
cubiertas en los surcos hembras de la parcela 2 (tambin poblacin B). Las mazorcas
superiores, que fueron dejadas para ser polinizadas libremente, producen las FMH
interpoblacionales que son evaluadas en los ensayos de rendimiento. Las segundas
mazorcas, polinizadas a mano, constituyen las FMH intrapoblacionales, que quedan
disponibles para su recombinacin y, simultneamente, pueden usarse en la formacin de
nuevas familias intra o Inter.-MH, con lo que se inicia un nuevo ciclo de seleccin. A pesar
que, usando viveros de invierno cada ciclo toma un ao, este sistema tiene el problema de
demandar mucha mano de obra.

Seleccin recurrente recproca de hermanos completos

Seleccin de familias S1 basadas en cruzas recprocas planta por planta

Hay diversas referencias con esta metodologa (Lonquist y Williams,15 Hallauer y


Eberhart,6 Jones et al.,13). Requiere el uso de plantas prolficas de por lo menos dos
mazorcas. Una de las mazorcas de cada planta de la poblacin A es polinizada con polen
de una planta individual de la poblacin B y, de ser posible, tambin se hace la cruza
recproca. La segunda mazorca en las plantas que han sido cruzadas en ambas poblaciones
se autofecunda. La seleccin se basa en el comportamiento en ensayos de rendimiento de
los cruzamientos (FHC), mientras que las FS1 de las cruzas selectas son las que se usan la
siguiente estacin de crecimiento, para la recombinacin dentro de cada una de las
poblaciones recprocas. La recombinacin se hace, comnmente, mediante la siembra y
posterior despanojado de cada FS1 en surcos hembras, los que son polinizados por los
surcos machos sembrados con un compuesto balanceado de las mismas FS1. El nuevo ciclo
de seleccin se forma con un compuesto balanceado de la semilla de cada familia obtenida
de esta manera. Se requieren, entonces, tres estaciones de crecimiento para cada ciclo, que
puede completarse en dos aos.

Metodologa

1. Dos poblaciones heterticas A y B.


2. Sembrar 1000 plantas de cada poblacin a baja densidad con el objeto de tener dos
mazorcas por planta.

191
3. Hacer cruzas Planta a Planta entre poblaciones y sus recprocos (generando
Hermanos Completos).
4. Autofecundar la segunda mazorca.
5. Con esto, generamos:
150-250 Hermanos Completos (Poblacin A x Poblacin B); (Poblacin B x
Poblacin A).
150-250 autofecundaciones Poblacin A (S1).
150-250 autofecundaciones Poblacin B (S1).
6. Evaluar Hermanos Completos en 4-6 localidades con dos repeticiones por
localidad.
7. Seleccionar los mejores 20-30 Hermanos Completos.
8. Recombinar S1 usando semilla remanente de cada poblacin involucrada en los
mejores 20-30 Hermanos Completos.

Usando Seleccin Recproca Recurrente de Hermanos Completos, es necesario solo un


ensayo de rendimiento.

Seleccin de familias S1 basada en cruzas recprocas S1 x S1

Este procedimiento alternativo consiste en producir primeramente, las FS1 de cada


poblacin para hacer luego cruzamientos apareados entre FS1 de poblaciones opuestas.
Estas cruzas S1 x S1 son equivalentes a cruzas entre dos plantas no endocriadas como en el
esquema arriba descrito, pero sin la necesidad de prolificidad. Estas cruzas, que podemos
llamar de hermanos completos son evaluadas y las FS1 relacionadas a las mejores FHC
son usadas posteriormente en la recombinacin para obtener un nuevo ciclo de seleccin.
Esto alarga un tanto la duracin de cada ciclo, pero estos se pueden an completar en dos
aos, si se hacen las cruzas y la recombinacin en viveros.

Seleccin de familias S1 basada en cruzamientos de prueba con lneas endocriadas


recprocas

Russel y Eberhart21 sugirieron este procedimiento de seleccin recurrente recproca de


FHC modificada, en la cual plantas no endocriadas (So) de la poblacin A son
autofecundadas y, al mismo tiempo, cruzadas con una lnea endocriada de la poblacin B
que fueran derivadas de un previo ciclo de seleccin. De la misma manera, plantas no
endocriadas de la poblacin B son autofecundadas y cruzadas con una lnea endocriada de
la poblacin A. El criterio de seleccin es el comportamiento de las cruzas/prueba, en base
al cual se seleccionan las FS1 a ser recombinadas. Alternativamente, se pueden usar dos
lneas endocriadas que producen excelentes hbridos como probadores para mejorar las dos
poblaciones, as como sus cruzas interpoblacionales. Los probadores para cada poblacin
pueden elegirse de acuerdo con sus respuestas heterticas en las cruzas poblacin x
probador. Debido a que las lneas probadoras son homocigotas, y que no cambian en los
sucesivos ciclos de seleccin, habr mayor variabilidad gentica entre los cruzamientos
prueba con estas lneas que con las poblaciones, por lo que el uso de lneas como
probadores debera proveer un mayor progreso en la seleccin. Sin embargo, Comstock4
present argumentos tericos indicando que para acumular alelos favorables que mejoren
el comportamiento de las cruzas entre dos poblaciones, el uso de las poblaciones como
probadores seria ligeramente ms efectivo que el de lneas endocriadas.

192
6. VARIEDADES SINTTICAS

Poblacin de polinizacin libre, sintetizada por hibridacin en todas las combinaciones


posibles de un nmero de genotipos seleccionados (lneas endocriadas o clones), elegidos
por su aptitud combinatoria general.

Se forma mezclando equilibradamente varias lneas parentales o las F1 entre ellas,


dejandolas que se interpolinicen libremente en aislamiento. Son de menor heterogeneidad,
mejor adaptacin y bajo costo de la semilla que la poblacin original.

Obtencin de variedades sintticas:

1) Obtencin de los progenitores.


2) Seleccin preliminar.
3) Seleccin por habilidad combinatoria general.
4) Cruzamiento entre los progenitores seleccionados.

Problemas al formar una variedad sinttica

Evaluacin de las lneas parentales.


Nmero ptimo de lneas fundadoras.

Evaluacin de lneas parentales

El carcter esencial es la habilidad combinatoria general de las lneas parentales, que


puede conocerse mediante un cruzamiento con un probador o con un policruzamiento.

Nmero ptimo de parentales

Se forma la variedad sintica con las n lneas de valores ms alto de habilidad


combinatoria general, mezclndolas en un campo aislado, generacin F1 para que se
crucen libremente entre s.

La generacin F1 se deja en polinizacin abierta en aislamiento.

La siguiente generacin, F2 es el resultado del cruzamiento en todas direcciones de


todas las combinaciones hbridas posibles. La F2 es pues, una poblacin panmctica en
equilibrio en tanto no hagamos seleccin en ella.

Todas las generaciones siguientes sern idnticas a ellas, pues las frecuencias gnicas
se mantendrn constantes.

Se supone que las lneas parentales no se autofecundan o lo hacen en proporcin


despreciable, esto es, estamos en estrictas condiciones de alogamia.

Una vez que sepamos la produccin de dicha generacin F2 sabremos cual va a ser la
de todas las generaciones sucesivas.

193
Es esta generacin la que utilizamos para averiguar el nmero n ptimo. Para ello se
debe emplear la llamada frmula de Wright.

F2 = F1 (F1 Pn)/n

F2 es el rendimiento esperado de la F2; F1 es el valor promedio de los i hbridos


formados entre las n lneas parentales [i = n (n 1)/2] que van a formar la variedad
sinttica; Pn es el valor promedio de las lneas parentales.

Obsrvese que F1 es el valor mximo que puede alcanzar la variedad sinttica, pues el
valor medio de las lneas parentales, Pn ser como mximo igual al valor medio de los
hbridos F1. La productividad de una variedad sinttica depende del nmero de lneas
que la componen, la produccin media de las lneas y la produccin media de los n (n -
1)/2 hbridos posibles

Mantenimiento de una variedad sinttica

Evitar mezclas mecnicas.


Lote aislado.
Progenitores por separado.
Reconstitucin de la variedad sinttica.
Generacin adecuada.
Tamao adecuado de la poblacin.

7. FORMACIN DE UNA VARIEDAD COMPUESTA

Una variedad compuesta se define en maz, como la generacin avanzada y en equilibrio


obtenido a partir de la recombinacin gentica de un conjunto de poblaciones (variedades,
sintticos, accesiones, hbridos, lneas, compuestos, etc.).

Una poblacin compuesta resulta del apareamiento aleatorio de todas las posibles cruzas
entre un grupo de variedades heterogneas (poblaciones o razas). Las variedades
compuestas han sido ampliamente utilizadas como poblaciones de mejoramiento desde que
se espera que tengan amplia variabilidad gentica por haberse combinado poblaciones de
diversos orgenes. Para su formacin en campo se lleva a cabo tal como se explic en
mtodos para recombinar individuos seleccionados.

Tambin ha sido encontrada que la heterosis entre cruzas intervarietales muestra un valor
relativamente alto; cuando un compuesto es formado el rendimiento promedio de la nueva
poblacin es esperado que sea mayor que el promedio de las variedades parentales.

La seleccin entre las variedades utilizadas como progenitores puede dar lugar a un
compuesto de comportamiento superior, al descartarse variedades de pobre
comportamiento. La eleccin de las variedades para ser usadas como progenitores se
basar en el anlisis de un cruzamiento diallico Inter-varietal, de un experimento repetido
en que se evalan todas las cruzas posibles entre n variedades y las n variedades
parentales: n(n -1)/2 genotipos. Las medias de estos n(n-1)/2 genotipos son utilizados para
predecir las medias esperadas de los compuestos posibles de formarse.

194
Vencovsky y Miranda22 dan la siguiente expresin: N comp. = 2n (n+1), donde n es el
nmero de variedades a incluir en el compuesto. As, si n=10, entonces N comp. = 210
(10+1) = 1013 compuestos diferentes para el caso en que cada variedad parental contribuye
con igual proporcin de germoplasma (contribuye con igual nmero de cruzas).

La media esperada del compuesto puede ser predecido mediante la siguiente frmula:

Y Comp Y C Y C Y V n

Donde:

Y Comp Representa la media esperada, Y C es el promedio observado de todas las cruzas


inter.-varietales con los n parentales, Y V es el promedio observado de todas las cruzas.

195
8. REFERENCIAS BIBLIOGRFICAS

1. Brim CA. A modified pedigree method of selection in soybeans. Crop Science. 1966.
6: 220.

2. Compton SA. and Comstock RE. More on modified ear to row selecction in corn.
Crop Science . 1976. 16: 122.

3. Compton WA. and Lonnquist JH. A multiplicative selection index applied to four
cycles of full-sib recurrent selection in maize. Crop Sci. 1982. 22, 981-983.

4. Comstock RE. Inbred lines versus the populations as testers n reciprocal recurrent
selection. Crop Science. 1979. 19: 881-886.

5. Comstock RE, Robinson HF and Harvey PH. A breeding procedure designed to


make maximun use, of general and especific combining ability. Agron. Jour. 1949.
41: 360-367.

6. Hallauer AR and Eberhart SA. Reciprocal full sib selecction. Crop Science. 1970.
10: 315-316.

7. Hopkins CG. Improvement in the chemical composition of the corn kernel. AMER.
Chem. Soc. 21. 1899: 1039-1057.

8. Horner ES, Lundy HW, Lutrick MC, et al. Relative efficiencies of recurrent selection
for specific and for general combining ability in corn. Crop Sci, 1963. 3, 63-66.

9. Horner ES, lundy WH, Lutrick MC, et al. Comparison of three methods of recurrent
selection in maize. Crop Science. 1973. 13: 485-489.

10. Hull FH. Recurrent selection and specific combining ability in corn. J. Am. Soc.
Agron., 1945. 37: 134-145.

11. Hull HF. Recurrent selection and overdominance. p. 451-473. In: Heterosis J. W.
Gowen (ed.). Iowa State College Press, Ames. 1952.

12. Jenkins MT. The segregation of genes affecting yield of grain in maize. Agron.
Journ. 1940. 32: 55-63.

13. Jones LP, Compton WA and Gardner CO. Comparisons of full-sib and half-sib
reciprocal recurrent selection. Theor. Appl. Genet. 1971. 41: 36-39.

14. Lonnquist JH. A modification of the ear to row procedure for the improvement of
maize populations. Crop Science. 1964. 4: 227-228.

15. Lonquist JH and Williams MF. Development of maize hybrids through selection
Among full-sib families. Crop Science. 1967. 7: 369-370.

196
16. Moll RH and Robinson HF. Observed and Expected Response in Four Selection
Experiments in Maize. Crop Sci. 1966. 6, 319-324.

17. Montgomery EG. Experiments with corn. Univ. of Nebr. Agric. Exp. Sta. Bull. 1909.
112 p.

18. Paterniani E. Esquemas modificados de seleo recorrente reciproca. Rel. Cient.


Inst. Genet. (ESALQ-USP). 1970. 4: 83.

19. Paterniani E. Maize breeding in the tropics. Crit. Rev. Plant Sci., 1990. 9: 125-154.

20. Russell WA, Eberhart SA and Vega UA. Recurrent selection for specific combining
ability for yield in two maize populations. Crop Science. 1973. 13:257-261.

21. Russel WA, and Eberhart SA. Hybrid performance of selected maize lines from
reciprocal recurrent and testcross selection programs. Crop Science. 1975. 15: 1-4.

22. Vencovsky R, and JB Miranda. Determinaco do nmero de possveis compostos e


pares de compostos. Rel. Cient.Inst. Gent. (ESALQ-USP). 1972. 6:120-23.

197
CUARTA PARTE
BIOTECNOLOGA VEGETAL

198
1. INTRODUCCIN

La historia humana se sustenta en el aprovechamiento de especies vegetales y animales, en


la domesticacin, cultivo, y mejoramiento gentico. La civilizacin y la agricultura se
encuentran indisolublemente relacionados; no se concibe una sin la otra, ya que no se
hubiera podido desenvolver ni subsistir sin un adecuado abastecimiento de alimentos. La
supervivencia del hombre antes de la invencin de la agricultura debe haber sido precaria,
debido a su incapacidad para asegurar el sustento diario. Bajo estas circunstancias, tal
escasez limitaba automticamente el crecimiento de la poblacin humana. Luego el
hombre se convierte en agricultor y pastor, lo que a su vez dio origen a la especializacin
del trabajo y al desenvolvimiento de la vida en comunidades.

Desde el comienzo del desarrollo de la agricultura (10 000 aos A. C.) el hombre se ha
entregado a la domesticacin, cuidado, seleccin y mejoramiento de cultivo para conservar
o perfeccionar determinados caracteres de las plantas que le son de importancia
nutricional, ornamental, econmica o religiosa.

Esta es la base a partir de la cual se desarroll la industria agropecuaria moderna y, todas


las civilizaciones subsiguientes. La invencin de la agricultura no libr permanentemente
al hombre del temor de la escasez de alimentos, ni del hambre y la inanicin. Si bien es
cierto que la revolucin verde dio unas luces a favor en esta lucha contra el hambre a los
finales de la dcada de 1960. El gran progreso en la produccin alimentaria fue
bsicamente gracias a los mtodos tradicionales de cruzar y seleccionar distintas plantas,
tomando como base el proceso natural de mezclar genes, cuyo propsito fundamental es
obtener y producir genotipos superiores que brindan productos de alta calidad por unidad
de rea cultivada, caracterizados por su resistencia y/o tolerancia a especies patgenas,
capaces de soportar condiciones adversas; e implementar sistemas de produccin eficientes
en funcin de las necesidades particulares del agricultor y del consumidor.

Sin embargo hasta la actualidad, la lucha entre estas fuerzas opuestas, la fuerza cientfica
de la produccin de alimentos y el poder biolgico de la reproduccin humana no se ha
solucionado. As lo seala el informe de la FAO: 826 millones de personas siguen sin tener
suficientes alimentos en 83 pases en vias de desarrollo; de los cuales 53 millones
corresponden a Amrica Latina y el Caribe, afectando al 55 % de su poblacion rural. En la
cumbre mundial sobre la alimentacin celebrada en 1996, dirigentes de numerosos pases
se comprometieron a reducir el nmero de personas subalimentadas a 400 millones para el
ao 2015. Sin un esfuerzo ms decisivo para acelerar el avance, esa meta no se alcanzar
antes del ao 2030. Hace falta una reduccin anual por lo menos de 20 millones de ahora al
ao 2015 para alcanzar la meta de la Cumbre. En el decenio de 1990 el ndice de
disminucin del nmero de personas con hambre result a todas luces inadecuado: poco
menos de ocho millones al ao.11 Lamentablemente, este esfuerzo no ha reducido la
inseguridad alimentaria, las cifras de pobreza siguen parecidas como fue hace 14 aos.15
Por lo tanto, el desafo es producir mas comida en menos tierra, con menos agua y de
forma sostenible. Paralelamente, mejorar las redes de proteccin social y un aumento de la
inversin en la agricultura, tanto para hacer frente a las necesidades inmediatas como para
respaldar progresos a ms largo plazo.

Entonces se proyecta que los rendimientos medios por hectrea se debern de incrementar
en un 53 % para el ao 2025. Esto es prioritario ya que la seguridad alimentaria es

199
condicin preliminar y obligatoria para el desarrollo econmico y social de un pas. En este
contexto la "Biotecnologa" da esperanzas de obtener un enorme surtido de plantas
mejoradas.

La biotecnologa puede definirse como el uso integrado de la gentica molecular,


bioqumica, microbiologa y tecnologa de procesos, con el fin de suministrar bienes y
servicios. Es el uso de microorganismos, clulas, partes de la clula o tejidos de
organismos superiores para generar productos nuevos o existentes con mayor eficiencia.

El Convenio sobre la diversidad biolgica (CDB) define la biotecnologa como: "toda


aplicacin tecnolgica que utilice sistemas biolgicos y organismos vivos o sus derivados
para la creacin o modificacin de productos o procesos para usos especficos".

La biotecnologa, en complemento y no en reemplazo al fitomejoramiento tradicional, es


necesario para elevar el rendimiento de los cultivos. Se espera que las aplicaciones de las
tcnicas de cultivo de tejidos, la manipulacin y transferencia de genes, tipificacin del
DNA, seleccin asistida por marcadores moleculares, seleccin y clonacin de plantas
proporcione nuevos mtodos para mejorar las plantas, otorgndoles resistencia a plagas, a
enfermedades y a los peligros naturales, sin los efectos secundarios perjudiciales que
acarrean muchos pesticidas y fertilizantes, adems de incorporarles caractersticas
deseables en algunos cultivos (valor nutritivo, mayor rendimiento, produccin de
metabolitos secundarios, etc.). La rapidez con que se pueden mejorar las plantas a travs de
la biotecnologa es mucho mayor que cuando se aplican mtodos tradicionales.

A causa de los cambios ambientales y el desgaste de los recursos energticos, la capacidad


de adaptacin de los recursos vivientes ser sumamente importante para la supervivencia.
La adaptacin acelerada a travs del cambio gentico es el medio por el que el mejorador
ha logrado sus objetivos en el pasado. Hoy en da nuevas tcnicas de ingeniera gentica y
mutaciones dirigidas ofrecen al mejorador la posibilidad de acelerar la adaptacin hasta un
punto que antes era considerado imposible. Este nuevo poder traer riesgos como cualquier
tecnologa nueva, pero podra ser la nica manera de escapar a los peligros venideros.

1.1. Etapas de biotecnologa

Las etapas de la biotecnologa no son lapsos con resultados terminales, completos y


finales, que luego hayan dado paso a nuevos desarrollos. Son parte de un proceso al cual se
van agregando etapas innovativas. Estas pueden ser resumidas arbitrariamente en tres:

El acopio, domesticacin y seleccin de especies vegetales tiles para el hombre

El proceso de la domesticacin integra plantas, medio ambiente y hombre. La relacin


entre el hombre y las plantas se ha acentuado desde las primeras civilizaciones
(aproximadamente hace 10,000-12,000 aos). Esta no es una relacin esttica, pues el
hombre sigue domesticando especies silvestres o intensificando el uso de las cultivadas.
As tenemos cultivos nuevos domesticados en el siglo pasado: Caf robusta, palma de
aceite, macadamia, hevea, numerosas forrajeras tropicales, etc.

Las diferencias estructurales o biolgicas entre especies silvestres y cultivadas, resultan de


la seleccin hecha por el hombre; estas diferencias son ms acentuadas en los cultivos

200
sometidos a seleccin larga e intensa. En ciertos casos afectan solamente a partes de la
planta, en otras a toda la planta. Ellas representan cambios en los procesos biolgicos:
maduracin, latencia, respuesta a fotopeodo, inmunidad a enfermedades y otros.

Harland,13 indica que el hombre ha estado 2 millones de aos aproximadamente en la


superficie terrestre. Durante el 99 % de este lapso ha vivido como recolector-cazador. Hace
10 mil aos comenz a domesticar plantas y animales; y alcanza algo menos de 200 aos la
organizacin de una sociedad industrial. Simultneamente tambien utilizaban
microorganismos para fermentar bebidas (7000 a.c.) y preparar alimentos como la
panificacin (4000 a.c.).

La hibridacin y seleccin

Esta etapa se basa en la comprensin del sexo en las plantas, trabajos sobre origen de las
especies y seleccin natural de Darwin en 1859, descubrimiento de las leyes de la herencia
por Mendel en 1866, el conocimiento de la division celular, y la comprobacin de que los
factores (genes) estn en cromosomas y se encuentran en el ncleo de la clula.

En consecuencia la hibridacin y seleccin es el manipuleo sistemtico de las bases


genticas de la herencia, con aprovechamiento de los beneficios de la hibridacin o
cruzamiento, por medio del cual se combinan caracteres deseables de diferentes plantas en
nuevos individuos que en la generacin siguiente reproducen esas combinaciones. Un
producto de este proceso fue la llamada Revolucin verde que produjo aumento en la
produccin de los principales cereales alimenticios. Sin embargo, a pesar de tales xitos,
son bien reconocidos las limitaciones de este fitomejoramiento convencional. Las
transferencias sexuales interespecficas e intergenricas de genes son laboriosas y exigen
muchos aos de trabajo; adems en muchas ocasiones resulta muy dificl separar y
eliminar genes no deseables y con ellos caractersticas inconvenientes que afectan la
calidad, el rendimiento o la adaptacin de los cultivos. As, por ejemplo, despus de seis
generaciones de retrocruce, en el proceso de una transferencia intraespecfica de genes, el
proceso natural de recombinacin no separa, con frecuencia genes ligados fuertemente.

La ingeniera gentica

Suprime las limitaciones de la segunda etapa, ya que permite trabajar a los niveles celular y
molecular, volvindose la ingeniera gentica ms precisa. Para ello se basa en los
siguientes hechos:

Muchos aos se consider que los genes eran protenas, en razn de que stas
participan en todo proceso qumico dentro de un organismo, sin embargo Beadle &
Tatum2 proponen un vnculo directo entre los genes y las reacciones enzimticas
conocida como la hiptesis Un gen, una enzima,
confirmacin de que el DNA es el material gentico,1
el conocimiento de la estructura de DNA y su funcion biolgico,28
se descifra el cdigo gentico completo del DNA (1966),
se crea la primera molcula de DNA recombinante en el laboratorio (1972) y
se desarrollan las primeras tcnicas para secuenciar DNA (1977).

201
El primer salto en la manipulacin de genes in vitro se produjo en los inicios de la dcada
de 1970, gracias al desarrollo de mtodos en forma simultnea para:

Transformar genticamente Escherichia coli.


Cortar y unir las molculas de DNA.
Manejar las reacciones de digestin y ligacin.

Las tcnicas de base

Si los fragmentos de DNA no pueden replicarse en los hospederos en forma independiente,


la solucin es unirlos a un replicn apropiado. Los replicones utilizados para este fin son
denominados vectores o vectores de clonamiento. Los vectores ms apropiados son los
pequeos plsmidos o bacterifagos por que son replicones naturales, que su persistencia
no necesita que se integren en el genoma del hospedero y que su DNA puede ser
fcilmente aislado bajo la forma intacta. Los primeros plsmidos y fagos utilizables como
vectores provinieron todos de E. coli.

Una consecuencia importante de la utilizacin de un vector para transportar el DNA es que


los mtodos simples desarrollados para purificar el vector permitieron automticamente
purificar el inserto de DNA clonado, a partir de clulas hospederas transformadas. En
consecuencia, el vector no proporciona solamente la capacidad de replicacin; permite
tambin preparar grandes cantidades de una secuencia de DNA extrao, sin contaminacin
con el DNA de la clula hospedera.

Las molculas compuestas productos de la insercin de un DNA extrao en un vector son a


veces llamados las quimeras de DNA por analoga con la quimera de la mitologa. La
construccin de estas molculas compuestas o DNA recombinante artificial es llamado
ingeniera gentica o manipulacin gentica en razn de su potencial de crear nuevas
combinaciones genticas por la via bioqumica. El procedimiento es tambin conocido
como clonamiento molecular o clonamiento de genes por que una lnea de organismos
genticamente idnticos que contiene toda la molcula compuesta pueden ser propagada
y cultivada en grandes cantidades, amplificando (multiplicando) la molcula compuesta y
todo el producto que dirige la sntesis.

Conceptualmente el clonamiento de un fragmento de DNA extrao, DNA pasajero o DNA


blanco en un vector, requiere efectuar las siguientes operaciones:

El DNA vector debe ser purificado y cortado.


El DNA blanco debe ser insertado en el DNA vector para crear la recombinacin
artificial.
Se debe supervisar el progreso de las reacciones de corte y la ligacin.
Finalmente, las molculas de DNA recombinante deben ser introducidos por
transformacin en E. coli o en otra clula hospedera.

Esto permiti en el ao 1984 la creacin de las primeras plantas transgnicas. La diferencia


fundamental de la nueva biotecnologa, comparada con la tradicional reside, por lo tanto,
en que esta ltima trabaja con el organismo en su totalidad, combinando el conjunto de
genes de dos plantas o animales, mientras que la primera trabaja a nivel celular y molecular
haciendo posible la transferencia de cantidades muy pequeas de informacin gentica,
hasta permitir agregar o suprimir un solo gen identificado.

202
2. CULTIVO DE TEJIDOS EN MEJORAMIENTO DE PLANTAS

Consiste en colocar un trozo de tejido, rgano o embrin, llamado explante, en medios


artificiales y en condiciones ambientales determinadas para regenerar un individuo
completo. Es una reproduccin vegetativa, pero utilizando minsculos propgulos
(idealmente una sola clula) en lugar de esquejes, estacas, rizomas, yemas injertadas, entre
otras; y tcnicas propias de la microbiologa en vez de las tradicionales en agricultura.
Entonces cultivo in vitro, se define como el cultivo sobre un medio nutritivo, en
condiciones estriles, de plantas, semillas, embriones, rganos, tejidos, clulas y
protoplastos de plantas. A diferencia de las tcnicas tradicionales de cultivo, esta poderosa
herramienta permite la propagacin de grandes volmenes de plantas en menor tiempo y su
manejo en espacios reducidos. Por otro lado, la tcnica es de gran utilidad en la obtencin
de plantas libres de patgenos; de plantas homocigotas, en la produccin de plantas en
peligro de extincin, en estudios de ingeniera gentica y de genmica.

La teora de totipotencia planteado por Schwann & Schleiden, fue de hecho el ncleo del
que naci el cultivo de tejidos y clulas. Los primeros intentos hechos por Haberlandt en
1902, sobre cultivo de tejidos fracasaron, debido a que utiliz un medio de cultivo
relativamente simple y por otra parte, tejidos vegetales demasiado diferenciados. En 1939
consiguieron el primer cultivo de tejidos autntico. Despus de la segunda guerra mundial
el desarrollo en este campo ha sido muy rpido.23

El cultivo de tejidos es importante no solo por que es el rea de la biotecnologa que tiene
actualmente mayor aplicacin prctica en la agricultura, sino por ser una herramienta
verstil para el estudio de los problemas bsicos y aplicados de la biologa de las plantas;
constituye, en efecto el puente necesario para llevar las manipulaciones genticas desde el
laboratorio hasta el campo. Las tcnicas de cultivos aspticos han contribuido no slo a un
mejor entendimiento de los eventos de la diferenciacin celular, sino a un mejor
aprovechamiento de tales eventos en la explotacin ms eficiente de las plantas. Estas
tcnicas estn fundamentadas por una serie de principios como la totipotencialidad celular
y la hiptesis del balance hormonal.

2.1. Principio de cultivo in vitro

Aislar una parte de la planta (explante).


Trabajar en condiciones aspticas.
Proporcionar al explante un medio ambiente apropiado:

1. Medio de cultivo adecuado: macronutrientes, micronutrientes, hormonas,


vitaminas,
2. condiciones fsicas propias de la especie.

203
2.2. Caractersticas de cultivo in vitro

Se realiza a micro-escala, sobre una superficie relativamente pequea.


Se optimizan las condiciones ambientales, en lo que se refiere a los factores fsicos,
nutricionales y hormonales.
Se excluyen todos los microorganismos (hongos, bacterias y virus), y plagas (insectos y
nemtodes).
La capacidad de cultivar protoplastos o clulas individuales permite manipulaciones que
antes eran imposibles.
el nombre de cultivo in vitro (quiere decir en vidrio), por que al inicio se usaron
recipientes de vidrio para el cultivo.

2.3. Usos de las tcnicas del cultivo in vitro

Los principales usos de cultivo in vitro son en:


Micropropagacin,
estudios bsicos de fisiologa, gentica, bioqumica y ciencias afines,
bioconversin y produccin de compuestos tiles,
incremento de la variabilidad gentica,
obtencin de plantas libres de patgenos,
propagacin de plantas,
conservacin y intercambio de germoplasma,
mejoramiento gentico y
transferencia de genes.

2.4. Tcnicas de cultivo in vitro

Todos los cultivos se inician a partir de un explante que puede ser un fragmento de tejido u
rgano de cualquier parte de la planta (hoja, tallo, raz, yemas, captulos florales, anteras,
etc). Los explantes se tratan con alcohol e hipoclorito de sodio o calcio y se lavan
exhaustivamente con agua estril para eliminar los microorganismos que se encuentren en
su superficie. Una vez desinfectados se incuban en un frasco de cultivo adecuado (tubos de
ensayo, matraces Erlenmeyer, caja de petri, frascos, cajas magenta, etc) que contiene el
medio de cultivo lquido o semislido adicionado con agar del que se nutrirn las clulas.
A partir de este momento las clulas o tejidos se comportarn de diferentes formas,
dependiendo de los factores fsicos, pero principalmente, del tipo de nutrientes y de las
concentraciones de los reguladores de crecimiento, auxinas y citoquininas presentes en el
medio (Figura 4.1).

204
Cultivo de Discos foliares
meristemos

Embriognesis Formacin de
directa callos

Medio de
formacin de
tallos

Medio de
formacin de
raices

Figura 4.1. Diferentes alternativas de propagacin de plantas a partir de cultivo de


tejidos.

Cultivo de clulas

Se logra colocando las clulas bajo condiciones apropiadas de luz, temperatura y


nutrientes. Los callos pueden ser transferidos a un medio lquido con agitacin en donde
las clulas se disgregan dando lugar a un cultivo de clulas en suspensin que pueden
mantenerse en este estadio resembrndolas peridicamente. Cuando las clulas del
explante, callo o cultivo en suspensin son tratadas con enzimas celulolticas y/o
pectinolticas, la rgida pared celular es digerida, liberando los protoplastos o clulas
desnudas, delimitadas exclusivamente por su membrana plasmtica. Estos protoplastos,
cultivados bajo condiciones especficas, pueden regenerar la pared celular y convertirse de
nuevo en clulas que al dividirse volvern a formar callos.

Organognesis

La generacin de nuevas formas y estructuras a partir de explantes, donde no las haba, se


denomina morfognesis, organognesis o embriognesis.14 Cuando un callo es cultivado
bajo condiciones adecuadas de luz, temperatura y nutrientes, pero sobre todo cuando el
cociente de citoquinina/auxina es elevado, algunas clulas inician una divisin ordenada
(promeristemos) para dar lugar a un brote que se desarrolla en un tallo (caulognesis).

205
Al transferirse a un medio fresco con un cociente menor de citoquinina/auxina, en muchos
casos, carente de citoquininas, se induce la formacin de races en la base de los tallos
(rizognesis). A elevadas concentraciones de auxina los callos forman races directamente,
pero stas son incapaces de formar tallos al transferirlas a un medio con elevada
citoquinina.

Si los brotes son transplantados a medios con citoquinina en lugar de hacerlo a un medio
de enraizamiento, es posible inducir la formacin de nuevos brotes adventicios en su base.
Los brotes pueden separarse y resembrarse nuevamente para formar ms brotes
adventicios. Este proceso de multiplicacin puede repetirse indefinidamente antes de
transferirlos a medio de enraizamiento.

Las plntulas as formadas son transplantadas a bandejas con tierra, u otros sustratos
sintticos en donde completan su desarrollo. Para facilitar su adaptacin se les mantiene en
atmsferas con muy elevada humedad relativa, elevada intensidad luminosa y regadas con
soluciones nutritivas. Posteriormente, las plntulas se llevan a viveros o directamente al
campo.

Embriognesis

En ocasiones las clulas cultivadas in vitro dan origen a estructuras con una organizacin
bipolar, muy semejante a la de los embriones producto de desarrollo del vulo fertilizado;
para diferenciarlo de la embriognesis sexual este proceso se denomina embriognesis
somtica.

Cuando los embriones se forman directamente de las clulas del explante (por ejemplo,
clulas epidrmicas) se le denomina embriognesis directa; cuando se forman a partir de
callo se denomina embriognesis indirecta. Los embriones somticos germinan
desarrollndose en plntulas completas con tallo y raz que son entonces transferidas a
tierra. Otra alternativa es encapsularlos en matrices gelatinosas para formar lo que se
conoce como semillas artificiales.

Semillas sintticas

Corresponde a embriones generados por tcnicas de embriognesis somtica que a partir de


cierto grado de desarrollo, son encapsulados en compuestos gelificantes que les aportan
nutrientes y proteccin al desecamiento y de factores negativos biticos/abiticos. Estas
semillas pueden tratarse posteriormente como semillas naturales, procedindose a una
siembra con desarrollo de plntulas en condiciones de vivero o de campo. Las cubiertas
gelificantes se refieren principalmente a alginatos, que corresponde a cido algnico
derivado de algas (cidos manurnico y cido glucurnico), en forma de sal de sodio. Las
soluciones de alginato gelifican posterior aplicacin de iones calcio, protegiendo al
embrin. En esta fase de gelificacin, es posible incorporar diversos productos
fitosanitarios y/o nutrientes que estimulan el crecimiento durante la germinacin. Bajo
condiciones ptimas, la tcnica permite el almacenaje de material seleccionado por
perodos de tiempo considerables sin que exista prdida de viabilidad; ello de acuerdo a las
caractersticas genticas y metablicas de la especie vegetal usada. Las semillas sintticas
tambin tienen la propiedad de proporcionar un sistema rpido, barato y universal para

206
propagar material lite. Con igual objetivo ha sido tambin posible la encapsulacin con
alginatos de pices caulinares de varias especies que se mantienen viables por perodos
prolongados, utilizando para ello bajas temperaturas. Con este propsito, la encapsulacin
puede ser complementada con posterior criopreservacin en N2 lquido.

Cultivo de meristemos

El cultivo de yemas axilares y principalmente de yemas apicales es de gran importancia


por dos razones; la primera, porque siendo tejidos ya organizados presentan una gran
estabilidad gentica. La segunda es, que los meristemos apicales se encuentran por lo
general libres de patgenos. Los meristemos son extremadamente pequeos (0.8 mm) y su
aislamiento de la planta madre debe realizarse bajo el microscopio, lo cual requiere de gran
cuidado y habilidad para remover los primordios foliares sin maltratar el pice. Los
meristemos se desarrollan directamente en tallos. El desarrollo de los meristemos no es un
proceso de novo pues se trata de un tejido ya organizado.
En algunos casos, los meristemos se injertan directamente a un patrn tierno, por lo general
el brote de una semilla germinada in vitro que es decapitado para recibir un nuevo pice.
Este proceso denominado microinjertacin es de gran importancia para el cultivo de
algunas especies arbreas.

Micropropagacin

Consiste en la propagacin vegetativa en masa para la obtencin de material genticamente


homogneo (clones). Los procesos ms comnmente empleados son:

1) el cultivo de meristemos seguido de multiplicacin por brotes adventicios,


2) la embriognesis directa a partir de algn tejido somtico.

En ambos casos se obtienen frecuencias de multiplicacin elevadas que hacen muy


eficiente el proceso y con una gran estabilidad gentica, ya que se evita el paso por fases
con tejidos desorganizados o desdiferenciados (callos).

En teora es posible producir cientos de miles de individuos clonales a partir de una sola
planta madre en cuestin de meses. Sin embargo, es muy importante tomar en cuenta que
esto requiere de gran cantidad de mano de obra y que el costo de produccin de
micropropgulos es muy superior al de las plntulas producidos por metodologas
tradicionales. Debido a esto, la micropropagacin comercial se ha desarrollado con
especies de alto valor agregado principalmente ornamentales como flores de corte y follaje
o de algunas hortalizas.

Cultivo de anteras y produccin de plantas doble haploides

Los mtodos ms ampliamente usados para la creacin de haploides duplicados son: la


hibridacin interespecfica o intergenrica y el cultivo de gametos (masculinos o
femeninos). La produccin de plantas haploides a partir de clulas gamticas y el
subsecuente doblaje de cromosomas permite al mejorador de plantas obtener lneas
homocigotas estables de un hbrido en un solo paso. El cultivo de anteras "in vitro" es la
tcnica ms ampliamente usada para la induccin de doble haploides. La habilidad de
regenerar plantas a partir de microsporas es de importancia tanto en la investigacin
bsica como en la aplicada.

207
Con el cultivo de anteras se acelera el proceso de homocigosis; prcticamente de la
generacin F1 se pasa directamente al nivel de homocigosis de generacin F7, adems se
requiere de un menor nmero de plantas para detectar las combinaciones deseadas.

Mtodos de produccin de haploides

Se puede realizar por tres vias:

Via andrognesis ( cultivo de anteras y cultivo de microsporas aisladas).


Via ginognesis (cultivo de ovario y vulo).
Cruzas amplias (cigote/embrin, eliminacin de cromosomas).
Genotipos inductores de haploides.

Mediante esta tcnica, las anteras inmaduras que contienen polen en una etapa especfica
de desarrollo se colocan en medios para inducir la formacin de callos. Transferidos estos
a medios de regeneracin, se forman plantas. En la mayora de los casos se forman plantas
haploides estriles, en donde es necesario diploidizarlas, pero en algunas especies ocurre
una duplicacin espontnea de los cromosomas en las etapas de desarrollo de callo y de
regeneracin de la planta. Esto incrementa la frecuencia de determinados genes, lo cual
magnifica la variabilidad gentica dando la oportunidad a los fitomejoradores de acelerar el
proceso de seleccin de plantas superiores o con resistencia a factores biticos o abiticos.
El cultivo de anteras se ha extendido a ms de 150 especies (arroz, cebada, trigo, papa,
tabaco, etc), siendo limitado para muchos otros, debido a la poca capacidad de
regeneracin de las plantas y los bajos rendimientos de las plantas haploides lo que ha
ocasionado el lento desarrollo del mejoramiento gentico mediante el cultivo de anteras.

Cuando los gametos, polen u vulos son empleados como explante inicial el resultado es
una planta que posee la mitad del nmero cromosmico de la especie. Una divisin
desorganizada de las clulas gamticas origina un callo haploide, pero si se emplea el
balance correcto de reguladores se produce un desarrollo organizado desde las primeras
divisiones que origina embriones. El aspecto tcnico ms importante de esta metodologa
es que los gametos deben encontrarse en el estadio correcto para ser embriognicos. El
cultivo de clulas haploides tiene grandes aplicaciones ya que pueden ser modificadas
genticamente antes de inducir de nuevo su diploidizacin por mtodos qumicos
(tratamiento con colchicina). El resultado es la generacin de plantas dihaploides
(diploides homocigotas) que expresan un solo alelo para todas sus caractersticas y que son
de enorme valor para los programas de fitomejoramiento. En consecuencia, la generacin
de haploides, tiene gran importancia en el mejoramiento gentico de plantas por que:

Permite, usar directamente la planta de caractersticas haploides, a travs de la


variacin gametoclonal (ejemplo patrones de injerto enanizantes),
permite hallar caracteres genticos que pueden estar enmascarados en cruzamientos
normales dada la incompatibilidad que se presenta en algunas especies,
permite diploidizar tejidos o partes de la planta, obteniendo homocigotos diploides,
con lo cual se pueden seleccionar directamente pares de genes dominantes o
recesivos en una sola generacin, haciendo posible emplear este material en
cruzamientos posteriores,
permite realizar mutaciones en clulas haploides, con lo cual se puede generar
diversos materiales con propiedades genticas de importancia.

208
Produccin de plantas libre de virus

Las virosis son enfermedades bastante frecuentes en vegetales. Aunque por semillas se
trasmiten solamente un 5 % de ellas, los problemas por contaminacin son muy
importantes en especies que se propagan vegetativamente. El uso de bulbos, tubrculos,
rizomas, estacas y otros materiales posible de multiplicar, derivados de plantas
contaminadas, conllevan dichas infecciones. En algunos casos, el uso de la propagacin
vegetativa es ineludible, puesto que un cultivo determinado corresponde a variedades y
clones cuya homogeneidad gentica se perdera por uso de semillas. Por otro lado, el
empleo de semillas derivadas de polinizacin cruzada, por la variabilidad que expresan, no
sera idnea para efectos de mantener la homogeneidad y/o productividad de un cultivo.
Frente a cada caso, debe considerarse que para muchas comunidades agrcolas las
metodologas ancestrales de cultivo son mantenidas todava por tradicin y que cambios
por modernizacin, sera socialmente poco viables al haber hecho uso del mismo recurso
especfico por generaciones. La propagacin vegetativa conlleva dichos riesgos, con lo
cual una atencin especial debe ser dedicada a la mantencin de la calidad clonal y el
control fitosanitario de las plantas madres y descendencia. Al mismo tiempo, la posibilidad
de erradicar contaminantes de material de alto valor cultural debe ser una constante con
este propsito.

Las infecciones de tipo viral son transmitidas principalmente a la planta por insectos ya sea
de tipo picador-chupador (fidos) o nemtodos a nivel del suelo, que llevan los patgenos
en su sistema digestivo, adquirindolo de otras plantas contaminadas. A medida que la
planta va completando sus fases de desarrollo y durante toda su ontogenia, la infeccin
trasmitida puede incrementarse en los tejidos. Aparte de eso, nuevos focos de infeccin,
con la misma u otras virosis, puede aparecer con el tiempo.

Para obtener plantas libres de virus, viroides y/o fitoplasmas, una alternativa es el cultivo
in vitro de meristemos. Cuando una planta regenerada a partir de meristemos presenta una
pequea concentracin de partculas virales luego de haber sido sometida a cualquiera de
las pruebas de deteccin de virus, es conveniente combinar el aislamiento de meristemas
con tratamientos de termoterapia o quimioterapia. En el caso de arboles frutales, uno de
los mtodos de saneamiento lo constituye la microinjertacin usada en frutales como
manzano, ctricos, durazno.

Los tejidos meristemticos en activo crecimiento se encuentran generalmente libres de


diferentes tipos de patgenos, an en plantas contaminadas. Dicho potencial es explotable
puesto que, de ser posible su cultivo y conduccin a respuestas morfognicas, se puede
generar plantas idnticas sanas. Esta condicin esta dada porque el movimiento
transcelular de patgenos, a travs de las vas simplsticas (ms frecuentes en clulas
jvenes de tejidos meristemticos), aparece como temporalmente demorado con respecto
a la velocidad de crecimiento de zonas apicales. De all que en las zonas de activa divisin
(y elogacin) ms distales, pueden encontrarse temporalmente libres de contaminacin.
Otra causa posible es la competitividad de sntesis de protenas y cidos nucleicos entre
patgenos y tejido meristemtico, competitividad que no ocurre en clulas ms adultas en
fase de diferenciacin. Finalmente, se postula que la auxina es una hormona determinante
que inicia la sntesis de muchas protenas, entre ellas las que otorgaran caractersticas de
resistencia a algunos virus.

209
El meristema es un centro principal de sntesis de auxina para la planta. A fin de lograr por
tanto el escape, es comn mantener plantas a altas temperaturas, segn su grado de
tolerancia (30 - 40 C, por das o semanas, con alta humedad relativa en el ambiente), lo
cual promueve gran actividad meristemtica y crecimiento. Conjuntamente, puede darse la
condicin de oscuridad, la cual promueve la etiolacin del eje central y el crecimiento de
las plantas en su regin de elongacin celular, localizada debajo del meristema.

Con el aislamiento y cultivo in vitro de estos tejidos, se puede obtener plantas totalmente
libres de patgenos. La tcnica consiste en aislar y extraer el conjunto de clulas o tejidos
que conforman exclusivamente la regin meristemtica, del orden de 0.1 mm de dimetro.
Ello implica un trabajo lento, muchas veces se cultivan los pices enteros (con mayor
riesgo de contaminacin/menor erradicacin de patgenos), pero se emplean
posteriormente tcnicas de deteccin rigurosa para evaluar la calidad fitosanitaria del
explante; por ejemplo, ELISA (Enzyme-Linked Immuno Sorbent Assay), de sensibilidad
mil veces mayor en comparacin con tcnicas convencionales (por ejemplo, Latex). El
grado de confianza de usar esta metodologa, est dado tambin por el hecho de que en
algunos casos, la multiplicacin de patgenos en los tejidos mantenido in vitro se ve
inhibida con el tiempo y que explantes de mayor tamao virtualmente contaminados,
aparecen igualmente libres despus de un perodo largo de cultivo. Existen estudios
especficos realizados en meristemas y callos (tejidos no organizados), que demuestran una
reduccin de patgenos en el tiempo, bajo condiciones in vitro. Varios trabajos en tejidos
meristemticos han empleado compuestos de posible accin antiviral con respuestas
diversas. Entre ellas, bases anlogas (por ejemplo, 8-azaguanina, 2-tiouracilo), se han
mostrado eficientes en el control de virus Y (PVY) de la papa, o verde malaquita
(diaminotrifetilmetano), etc; especialmente Virazole ha mostrado en el tiempo, tener efecto
antiviral en una serie de especies. La ventaja de su empleo e inclusin in vitro, es que se
trata de un producto estable a altas temperaturas (autoclave) y que posee escasa toxicidad
en los tejidos. Las tcnicas anteriores contemplan igualmente la termoterapia. Con ella es
posible eliminar la presencia de un viroide de la papa (PSTV) y lograr la obtencin de
explantes potencialmente libres de patgenos.

Produccin de hbridos

Fusin de protoplastos

Un mtodo para la produccin de hbridos lo constituye la fusin de protoplastos entre


especies no relacionadas y especies afines que en forma natural no se pueden cruzar.
Permite obtener combinaciones de genes nucleares y citoplasmticos que no se pueden
obtener a travs del mejoramiento convencional (Figura 4.2). Esta tcnica es importante
para incorporar caractersticas como resistencia a herbicidas y caractersticas que dependen
de la esterilidad citoplasmtica.

Corresponde a clulas vegetales aisladas bajo condiciones de cultivo, que se encuentran


temporalmente desprovistas de su pared celular. La posibilidad de obtener, mantener y
cultivar protoplastos parti en la poca de los aos 1960 y en la dcada siguiente, ya
estaban establecidos grandes avances sobre aspectos bsicos de aislamiento y cultivo. 6 La
viabilidad de protoplastos reside mayormente en las condiciones del medio de cultivo, su

210
tonicidad y composicin. La delgada membrana plasmtica unitaria, bajo condiciones
ptimas, mantiene la integridad de los organelos que contiene; as como de sus funciones
metablicas. Los protoplastos pueden regenerar su pared si parte de sus componentes
nutritivos estn presentes o pueden ser resintetizados; por ejemplo, en presencia de un
conjunto de pentosas.

La importancia de los protoplastos es doble; por un lado, son una evidencia adicional de la
totipotencia celular, pues virtualmente pueden regenerarse plantas a partir de cada
protoplasto en particular, por lo que se les ha designado como protoclones. En segundo
lugar, posibilidad de usarlos como mtodo para lograr recombinacin gentica, algunas no
ocurrentes en la naturaleza por incompatibilidad gentica. Ms all, est la posibilidad de
recombinar genes pertenecientes a otras variedades, especies y plantas de otro gnero o
familia (fusiones interespecficas). La forma final aleatoria de recombinacin gentica,
determina el producto de fusin alcanzado.

Los productos de fusin, cuando ms cercanos en parentesco, tienen mayor probabilidad de


expresarse como clulas totipotentes, y emprender respuestas morfognicas conducentes a
plantas. Sin embargo, es frecuente la inestabilidad cariotpica de los productos de fusin.

Dado que es tcnicamente factible juntar dos protoplastos y fusionar estos, lo que implica
la mantencin de las estructuras y propiedades contenidas en el citoplasma incluyendo
mitocondrias y otros plastidios, se crean fusiones con productos diferentes a las fusiones
gamticas; stas se denominan fusiones somticas. Cabe destacar que en las fusiones
gamticas solo el vulo participa con su contenido citoplasmtico; en fusin somticas el
aporte es de ambas clulas. De mayor importancia an es la situacin de protoplastos
haploides, los cuales sirven como excelentes herramientas para inducir mutaciones con o
sin fusin de otro material recombinante.

El aislamiento de protoplastos se logra a partir de tejidos en activo crecimiento, siendo


igualmente importante contar con material que provea de protoplastos de tamao
homogneo. Otro factor a considerar es la presencia de ciertas caractersticas como tamao
o pigmentacin, como por ejemplo las antocianinas; su presencia es prctica ya que pueden
servir como indicador al fusionar con protoplastos derivados de otras plantas. El tejido u
rgano elegido, primero se desinfecta y se coloca en solucin estril, en presencia de
agentes osmticos (manitol, sacarosa) en alta concentracin. El tratamiento consiste en
lograr plasmolizar el protoplasma, contrayendo la plasmalema y separndola de la pared
celular. Bajo estas condiciones, se procede a subcultivar los tejidos en un medio similar,
pero que contiene las enzimas celulasa, pectinasa y en algunos casos hemicelulasas. En
cuanto a sus concentraciones, combinaciones de uso y tiempo de accin ptimos, junto a
temperaturas y tipos de explantes a tratar, son todas variables que deben ser evaluadas.
Existen diferencias a considerar segn sea el material; por ejemplo, en gramneas, a
diferencia de dicotiledneas donde las paredes contienen adems glucoarabinoxilanos, las
mezclas de celulasas con xilanasas y pectiliasas son ms eficientes para varios cultivos. La
incubacin con enzimas resulta en la degradacin de la pared, cuyos restos son eliminados
mediante centrifugacin; as como posteriormente los remanentes de enzimas mediante
varios subcultivos.

211
Con el objeto de efectuar la fusin y obtencin de recombinantes intraespecficos, se
procede en forma paralela para los protoplastos de la otra especie o planta, a combinar.
Finalizada esta etapa, se subcultivan ambas alcuotas en forma separada, con un osmtico
en menor concentracin. Esto permite regenerar la forma globular de los protoplastos, a
niveles de turgencia que pueden ser muy exactos, para as impedir la ruptura celular por
ingreso excesivo de agua y ruptura de la plasmalema. Finalmente, se mezclan los medios
fusionantes con los protoplastos, pudiendo aplicar las siguientes tecnologas poblacionales
o especficas para inducir su fusin:

Electroporacin y electrofusin, con la cual se descarga temporalmente la negativa


interna debajo de la membrana, la cual impide la fusin natural.
Agregando CaCl2, polietilenglicol (PEG) Ca(NO3)2 con lo cual se logra
agregacin celular y fusin al azar.
Mediante mtodos ms especficos como microinyeccin; que inmovilizan un
protoplasto por su superficie, se procede a inyectar DNA, organelos o ncleos de
clulas deseadas, a travs de la plasmalema, bajo observacin microscpica.

La regeneracin a partir de protoplastos, procede en primer lugar, con la formacin de la


pared celular antes de que ocurra una primera mitosis, e independientemente de que se
haya procedido a la modificacin del genotipo mediante insercin de genes o cromosomas.
Sin embargo, dicha capacidad depende de las compatibilidades derivadas del proceso de
arreglos y reintegracin cromosomal y de la capacidad de su expresin posterior.

Es conocido el fenmeno que cuanto ms distante es el parentesco del material a fusionar,


existir una menor probabilidad de viabilidad y respuestas morfognicas. En algunos
casos, como lo han sido cruzamientos entre especies del mismo gnero incompatibles
sexualmente, la fusin de protoplastos permite la formacin de estructuras globulares
semejante a embriones, pero que no son capaces de continuar su desarrollo. En caso de que
no existan limitaciones morfognicas, la regeneracin a plantas completas puede proceder.
Lo ms usual es a travs de organognesis expresada en un conjunto celular o callo.

Tambin es posible la generacin de hbridos en los cuales la recombinacin de


protoplastos no slo logra recombinar material nuclear, sino tambin posibilita la
incorporacin del DNA de cloroplastos y/o mitocondrias de una o de las dos clulas
recombinantes. La incorporacin de DNA de organelos como cloroplastos o mitocondrias,
hace factible manejar la expresin de dichos genes insertos en ellos. Por ejemplo, la
obtencin de esterilidad masculina, factor importante en programas de mejoramiento en
maz; resulta del control de un gen ubicado en mitocondrias. A travs del cultivo de
protoplastos haploides derivados de plantas haploides, es posible tambin inducir
mutaciones, las cuales pueden derivar en plantas homocigotos (2n) en una sola generacin.
Protoplastos y clulas haploides tambin pueden ser usados en procesos de seleccin in
vitro para determinar tolerancia a toxinas de algunos microorganismos o frente a metales
pesados y derivados de productos qumicos.

212
+* x# x
+ * ++ * + * x# x#x x#
+* +* x# x#
++ ++ xx # xx
+* +* +* Fusin x# x#x x#
++ * x#
Especie 1 Especie 2
+*
x# x*
+# +*
* x #
+x ++
#* +*
+#*
Heterocarionte

+* +* +* +x
x# x* x# x* x x* x# x*
+# +* +# +* ** +* xx +*
+ x * x # ++ + x * x # ++ + x * x x ++ + x * x * *+
#* +* #* +* * +* #* +*
+#* +#* +** +#*
Cbridos (segregacin de Hbridos somticos
ncleos) (segregacin de organelos)

Figura 4.2. Fusin de protoplastos (+, *, x, # representan componentes del citoplasma).

Rescate y cultivo de embriones

El cultivo de embriones ha sido utilizado principalmente para rescatar embriones hbridos


que se hayan derivado de cruzamientos interespecficos o intergenricos. El cultivo de
vulos intactos se ha empleado para el rescate de embriones mediante la polinizacin y
fertilizacin in vitro.

La falta de nutricin del cigoto por parte del endospermo, provoca su desintegracin o
aborto. Entonces, el desarrollo de embriones se puede lograr extrayendo los ovarios de las
flores, despues de unos pocos das de ocurrida la fertilizacin y cultivarlos en un medio
estril que contenga los nutrientes esenciales; en este medio los embriones se pueden
desarrollar normalmente y germinar. Esta operacin permite retirar los factores inhibidores
presentes en el tejido placental materno, presente en los primeros estadios de su
ontogenia.14 En los prximos aos se espera superar problemas de incompatibilidad en
cruces interespecficos e intergenricos, incorporando caractersticas como resistencia a
factores biticos (resistencia a enfermedades) y abiticos (por ejemplo resistencia a bajas
temperaturas) en donde los hbridos productos de los cruzamientos presentan problemas de
aborto de los embriones.

Polinizacin in vitro

En la naturaleza un estigma recibe una variedad de granos de polen, pero no todos los que
llegan al estigma logran efectuar la fertilizacin. El estigma y el estilo estn equipados con
sistemas que permiten que el polen de solo el tipo correcto de apareamiento funcione
normalmente; otros son descartados. Consecuentemente, en programas de hibridacin que
transfieren polen viable desde un progenitor al estigma receptor del otro progenitor, no
siempre conduce a la formacin de semilla; para superar esto se hace fertilizacin in vitro.

213
Entre las barreras barreras pre-cigoticas tenemos:

- Incapacidad del polen para germinar en estigmas forneos,


- fallas del tubo polnico para alcanzar el vulo debido a la excesiva longitud del
estilo o lento crecimiento del tubo polnico, el cual falla al alcanzar la base del
estilo antes que el ovario se abra.

En otros casos la barreras son post- fertilizacin; la fertilizacin podra ocurrir


normalmente, pero el embrin hbrido no puede alcanzar la madurez debido a la
incompatibilidad embrin endospermo o por un pobre desarrollo del endospermo.

Etapas
- Coleccin de los granos de polen.
- Retiro de ptalos y spalos.
- Esterilizacin del gineceo.
- Eliminacin del estigma y estilo.
- Apertura del ovario.
- Diseccin de vulos con /sin placenta.
- Esparcido del polen.

Ventajas

Se usan en programas de mejoramiento e hibridacin cuando la zona de incompatibilidad


yace en el estigma, estilo u ovario. La polinizacin in vitro ha probado ser til en al menos
tres reas:

- Para superar la autoincompatibilidad,


- para superar la incompatibilidad cruzada y
- produccin de haploides por partenogenesis.

Induccin de mutaciones in vitro

La induccin de mutaciones se puede realizar por medio de sustancias qumicas


(etilmetanosulfunato, colchicina) o agentes mutagnicos fsicos (rayos X, gamma). El
mtodo ms usado es la irradiacin o exposicin a radiaciones ionizantes. Si se irradian
semillas, porciones de plantas con yema, plantas enteras, se obtienen con frecuencia
quimeras. Esto se debe a que el meristemo irradiado, que contiene clulas mutadas y no
mutadas, mantiene su integridad y las plantas no se originan a partir de una nica clula
mutada. Para conseguir mutantes completos despus de la induccin de la mutacin, se
debe obtener el desarrollo de brotes adventicios, ya que estos generalmente se originan a
partir de una nica clula.

La induccin de mutaciones in vitro es una herramienta til para el mejorador, ya que se


pueden obtener con frecuencia micromutaciones que efectan el tamao de la planta, color
de flor, etc, mientras otras caracteristicas deseables se mantienen.

214
Variacin somaclonal

Son modificaciones genticas en las clulas y los tejidos cultivados in vitro. Muchas de
estas modificaciones se manifiestan como mutaciones heredables en las progenies de las
plantas regeneradas. La variacin puede causar tanto una variacin gentica, como la
variacin temporal (epigentica) y no se transmiten meiticamente.

Es una tcnica que aprovecha las variaciones somticas que se originan en cultivo de
tejidos, especialmente tejidos desorganizados (callos). Generalmente esas variantes slo
pueden ser reconocidas y seleccionadas posteriormente a la regeneracin a partir de clulas
de las cuales se forman los somaclones. En Amrica Latina el uso de variantes
somaclonales comenz a intensificarse para la obtencin, por ejemplo, de plantas
resistentes a la roya y al virus del mosaico de la caa de azcar.

No se sabe con certeza si esta variacin existe ya por acumulacin de mutaciones


somticas en las clulas vegetativas y slo se pone de manifiesto cuando stas son
cultivadas in vitro o si algunas caractersticas de los medios de cultivo, por ejemplo,
elevadas concentraciones de 2,4-D, sean la causa de la alta incidencia de mutantes. Muy
posiblemente ambas causas operen, lo cierto es que la variacin somaclonal generada o
manifestada in vitro puede ser empleada en la obtencin de una gran cantidad de variantes
genticas de cultivos establecidos.

Origen de la variacin

Reordenamiento cromosmico (poliploida, aneuploida).


Duplicaciones, delecciones, translocaciones y otros intercambios cromosmicos.
Mutaciones puntuales (gnica).
Entrecruce somtico (crossing over).
Alteracin de los nucletidos por metilacin.
Perturbaciones de la replicacin del DNA por depsito de nucletidos alterados.
Silenciamiento o activacin de genes por mutaciones ocurridas en regiones no
codificadas.

Ventajas de la variacin somaclonal

1) Produce nuevos tipos de variantes no detectadas previamente en programas de


fitomejoramiento por mutagnesis.
2) Permite un proceso doble de seleccin in vitro e in vivo.
3) Produce lneas clonales derivadas de una clula por lo que no se generan mosaicos
genticos.
4) Pese a su elevada frecuencia, las nuevas variantes generalmente no son acompaadas de
otras mutaciones indeseables, como ocurre por efecto de agentes mutagnicos. Esto
permite obtener nuevas caractersticas deseables en cultivos probados de alto rendimiento
sin riesgo de perder las ventajas ya existentes.

Varias caractersticas agronmicas importantes han sido seleccionadas en variantes


somaclonales y sin duda este mtodo contribuir de manera importante en los programas
de fitomejoramiento de muchos cultivos.

215
Seleccin in vivo versus seleccin in vitro

La principal ventaja que ofrece la biotecnologa vegetal en la generacin de lneas o


plantas mutantes es la posibilidad de seleccin de nuevas caractersticas in vitro. En el tubo
de ensayo cada clula se convierte en un individuo y es por lo tanto posible, muestrear
millones de ellos en un tiempo y espacio limitados. En el laboratorio bastan unos cuantos
das en una incubadora mientras que a nivel de campo o invernadero se requeriran meses y
una meticulosa observacin de miles de plantas sembradas en varias hectreas de tierra.

En condiciones in vitro es posible adems, controlar con precisin las presiones de


seleccin tales como los factores de estrs ambiental, microorganismos patgenos o sus
fitotoxinas, etc. Al igual que en la seleccin de cepas mutantes bacterianas, el crecimiento
bajo condiciones limitantes fsicas o qumicas es indicio de tolerancia o resistencia a dicho
factor.

Conservacin de germoplasma

La conservacin de los recursos fitogenticos mediante los mtodos del cultivo in vitro se
logra haciendo cambios en el ambiente de cultivo para desacelerar o suprimir totalmente el
crecimiento de las clulas y de los tejidos. El objetivo es aumentar al mximo el perodo de
transferencia del cultivo o extenderlo indefinidamente. Se han propuesto dos tipos de
conservacin in vitro de los bancos genticos:

El banco gentico in vitro activo, donde los cultivos se mantienen en crecimiento


lento,
el banco gentico in vitro bsico, donde los cultivos son crioconservados a largo plazo.

Criopreservacin

Se refiere a la posibilidad de preservar en el tiempo el germoplasma existente en la forma


de clulas u rganos a baja temperatura. El trmino criopreservacin se refiere
mayormente a temperaturas cercanas a -196 C. Esta metodologa consiste en transferir
material biolgico a almacenamiento en nitrgeno lquido, temperatura a la cual todo el
metabolismo es suspendido.

En la criopreservacin existe la ventaja de poder conservar material de alto valor, de


manera que los gastos operacionales in vivo e in vitro pueden ser omitidos por perodos
prolongados. Esto es relevante en programas de mejoramiento gentico de especies
arbreas o material forestal, donde se requiere superar un perodo de larga juvenilidad y/o
esperar la expresin de caractersticas fenotpicas de las plantas sujetas a su conservacin y
propagacin sexual programada. Otro inters de esta tcnica consiste en la posibilidad de
conservar material en inminente peligro de extincin, esto es especialmente relevante en
reas poco exploradas cientficamente, donde la explotacin desmedida, por ejemplo, en
vastas regiones de bosques tropicales, y donde la maquinaria avanza ms rpidamente que
la descripcin taxonmica, se sacrifica la existencia de especies sin siquiera ser descritas o
ser conocida su importancia para el hombre y cuya eliminacin las har irrecuperable para
la humanidad.

216
La tcnica de criopreservacin es igualmente de utilidad, puesto que bajo algunas
condiciones in vitro, se produce variabilidad por inestabilidad gentica; como ocurre por
variacin somaclonal, otros tipos de alteraciones en callo, o suspensiones celulares de
carcter endgeno o producido por algunos factores (ejemplo 2,4D). Por criopreservacin
se puede mantener el material original invariable a lo largo del tiempo. En trminos
prcticos, la ventaja tambin reside en poder conservar y usar material o germoplasma que
es altamente heterocigoto y donde, por causa de la propagacin por semillas, pueden ser
perdidas las combinaciones deseables de genes. Igualmente, es importante para aquellas
semillas de especies que son poco tolerantes a las condiciones ambientales, de escasa
viabilidad y en peligro de extincin. La conservacin de polen es una de las alternativas
afines posibles para conservar dicha biodiversidad, al contar solamente con un
representante de cada cromosoma maximizando su estabilidad gentica y tiempo de
almacenamiento. Salvo algunas excepciones, especialmente en el caso de semillas o yemas
en condicin de dormancia, donde se coloca directamente el material a temperaturas
criognicas, el proceso es comnmente gradual y requiere satisfacer ciertas etapas. Una de
ellas es el acondicionamiento previo, que puede inducirse mediante el cultivo de explantes
en presencia de altos niveles de osmticos y el uso de crioprotectores. Los primeros, estn
indicados para reducir el contenido de agua intracelular de los explantes; los segundos,
para impedir la formacin de cristales de agua que puedan daar la estructura celular.

Este proceso de desecacin permite reducir gradualmente la temperatura del explante por
debajo del punto de congelacin sin mayor dao. En seguida, el proceso puede ser ms
rpido colocndose el material ya protegido directamente en el N2 lquido. En algunos
casos, se ha procedido a una interfase de desecacin previa mediante encapsulado de
material en alginato de Ca. La crioproteccin puede lograrse con combinacin de varios
compuestos; por ejemplo, dimetilsulfoxido (DMSO) al 0,5 M hasta 15 %, en presencia de
glicerol o con combinaciones que pueden incluir uno o varios de los siguientes
compuestos: polietilenglicol (PEG) 10 %, sorbitol 0,4-0,5 M, etilenglicol 10-15 %,
sacarosa 2-3 %, glucosa 6-10 %, prolina 0,5 %. Bajo estas condiciones comnmente se
baja la temperatura a razn de 0,5-1,0 C por minuto hasta -40 C; para sumergir luego
directamente en nitrgeno lquido. Alternativamente, la descongelacin puede ser ms bien
rpida hasta aproximadamente -40 C para luego, en presencia de algunos
criopreservantes, ascender gradualmente hasta el punto de congelacin. A continuacin, se
transfiere el material a medios sin criopreservantes y se establece la temperatura usual de
cultivo (por ejemplo 20-25 C). En esta fase, varias modificaciones especficas han
contribuido a mejorar la eficiencia en algunos cultivos; por ejemplo, la substitucin de
nitrato por amonio y el empleo de carbn activado. Detalles sobre metodologas para
criopreservar diferentes rganos de plantas, callos y suspensiones celulares, test de
viabilidad de los explantes y aspectos de estudio bajo microscopia electrnica, estn
igualmente descritos.

2.5. Ventajas y desventajas de cultivo in vitro

Ventajas

Es el nico mtodo conocido actualmente para erradicar virus, viroides, fitoplasmas y


otros patgenos a partir de material enfermo.
Propagacin clonal masiva de plantas libres de enfermedades en el corto tiempo.
Mantiene el cultivo libre de plagas y enfermedades, por ser una tcnica que requiere de
mucha asepsia.

217
Reduce costos de labores agronmicas en el mantenimiento de grandes colecciones de
germoplasma en el campo.
Los clones pueden ser propagados en cualquier poca del ao, mientras que por
mtodos convencionales, depende de condiciones propicias (pocas de siembra etc.).
Facilita el intercambio de material gentico e introduccin cuarentenaria.
Reduce el riesgo de prdidas genticas, al evitar la mezcla de material por cruzamiento.
Por medio de esta tcnica es posible cultivar polen y anteras, mediante los cuales se
producen plantas haploides, doble haploides.
Cultivo y fusin de protoplastos para recombinar genes, para la obtencin de nuevos
genotipos. Igualmente, el cultivo de callos y cultivo de suspensin de clulas, facilitan
la realizacin de trabajos para la obtencin de plantas de constitucin gentica diferente.
Permite realizar estudios de interaccin hospedero-parsito y estudios de pruebas a
estrs de salinidad y temperatura.
Produccin y extraccin de productos qumicos valiosos en mayor cantidad que de la
planta crecida y cosechada en campo.

Desventajas

Requiere de personal especializado: bilogos, fisilogos, fitomejoradores o


fitopatlogos.
Requiere de infraestructura y de equipamientos especiales.
La adquisicin de productos qumicos es costosa y difcil especialmente en pases en
vas de desarrollo con pocos recursos econmicos.
Difcil de instalar laboratorios in vitro donde no existe fluido elctrico o se presenten
interrupciones peridicas de electricidad, porque se malogran los cultivos.

3. TRANSFORMACIN GENTICA DE LAS PLANTAS

Durante la dcada de los setenta surgi la aplicacin masiva de los conocimientos de la


biologa molecular. Esto fue debido al avance cientfico de la gentica, bioqumica,
biologa celular, qumica y fsica que convergieron en la aparicin de la tecnologa del
DNA recombinante. De esta forma, genes especficos fueron aislados (lo que se conoce
como clonamiento) y manipulados de forma tal, de hacerlos funcionales fuera de su fuente
de origen, lo que se lograba generalmente en esa poca en las bacterias. Un gen es una
unidad de informacin dentro del genoma, que contiene todos los elementos necesarios
para su expresin de manera regulada (Figura 4.3).

Figura 4.3. Estructura bsica de un gen eucaritico.

218
Clonamiento de un gen

Los genomas contienen una cantidad enorme de DNA. Consecuentemente, cada gen
contenido dentro de un genoma representa solamente una fraccin pequesima del
genoma. Todas las estrategias tradicionales de clonamiento de DNA estan compuestos de
cuatro partes: la generacin de fragmentos de DNA extrao, la insercin de DNA extrao
dentro de un vector, la transformacin de la molcula de DNA recombinante dentro de una
clula hospedera en la que puede replicarse, y un mtodo de seleccin o tamizado de
clones para identificar aquellos que contienen el recombinante particular que estamos
interesados. Una biblioteca de DNA es simplemente una coleccin de fragmentos de DNA.

Hay algunos diferentes tipos de bibliotecas que vamos a considerar aqu. Las bibliotecas de
los fragmentos de DNA designan tanto a las bibliotecas de DNA genmico o bibliotecas de
cDNA. La mayora de los mtodos ms tradicionales de construccin de bibliotecas
involucran el clonamiento fsico de varios fragmentos de ADN en un vector adecuado. Sin
embargo, fragmentos de DNA no clonados (e.g. aquellos derivados de productos de PCR)
se estn volvindo cada vez ms importantes en los experimentos de ingeniera gentica.

Una biblioteca de DNA genmico debe contener copias representativas de todo el material
gentico de un organismo individual. Las bibliotecas son as organismo especfico. Es
decir, una biblioteca construida a partir de cualquier tejido dentro de un solo organismo
debe contener los mismos fragmentos de DNA como aquellos derivados de cualquier otro
tejido. Sin embargo, bibliotecas generadas a partir de diferentes organismos, como por
ejemplo, aquellas derivadas de ratn y rata, deben ser diferentes. Las bibliotecas de DNA
genmico deben contener todo el material gentico, aun si el material es expresado en un
tipo de tejido particular o estado de desarrollo o no es expresado. Por lo tanto, las
bibliotecas de DNA genmico contendrn toda las secuencias de DNA: genes expresados,
genes no expresados, exones e intrones, regiones promotoras y terminadores y secuencias
de DNA intergnicas (Figura 4.3).

Las bibliotecas de cDNA se construyen por la conversin de mRNA de una muestra de


tejido particular en fragmentos de DNA, los que pueden ser clonados en un vector
apropiado. Por lo tanto, las bibliotecas de cDNA no sern los mismos de un tejido a otro en
un mismo organismo.

Promotores utilizados para la expresin de secuencias clonadas de E. coli

El promotor1 es la regin de DNA con la que interacciona el aparato transcripcional (la


RNA-polimerasa ms factores auxiliares) para iniciar la transcripcin de la secuencia
contigua. En bacterias, el promotor es la seal que primero interviene en el largo proceso
de la expresin gnica y el elemento ms determinante de su eficacia y regulacin.

Muchos de los promotores presentes en el genoma bacteriano pueden ser identificados y


aislados utilizando vectores especialmente construidos para ello. Una mezcla compleja de
fragmentos de DNA (resultado, por ejemplo, de la rotura inespecfica del DNA total
celular) es clonada en un vector, en un sitio anterior a una secuencia que codifique un

1
Promotor es un segmento de DNA donde la RNA polimerasa se une y puede iniciar su transcripcin del
gen. Usualmente se ubica corriente arriba de un gen (5).

219
fenotipo seleccionable (por ejemplo, la resistencia a un antibitico) pero sin su promotor.
La seleccin de los recombinantes permite aislar aquellos que han incorporado secuencias
promotoras. Los lmites de la regin promotora se definen recortando el inserto y
repitiendo la seleccin. Esta estrategia ha sido, y sigue siendo, muy vlida para el
aislamiento de promotores de diferentes sistemas celulares o virales utilizados en la
construccin de vectores.

La actuacin del promotor como seal reconocida por la holoenzima de la RNA-


polimerasa exige una estructura particular y especfica que en el nivel primario, se
manifiesta en una cierta conservacin de bases nitrogenadas en determinadas posiciones.
Es importante recordar que en el cromosoma bacteriano existen varios tipos de promotores,
respectivamente reconocidos por la RNA-polimerasa asociada a diferentes factores 1.

En E. coli, hoy se conocen varios cientos de promotores dependientes del factor , de


fuerza muy variable y estructura ms o menos parecida a una estructura consenso con
secuencia TTGACA en la caja -35 y TATAAT en la caja-10, y separadas por 17 pares de
bases2. Este promotor consenso muestra una gran actividad cuando se ensaya delante de un
gen testigo. La mayora de los promotores activos en E. coli (cromosmicos, plasmdicos o
de fagos) se alejan algo, bastante o mucho del promotor consenso; parece que la evolucin
hubiera seleccionado seales no muy fuertes para un mejor control de su actividad. Por
otro lado, existen otros factores, adems de las cajas mencionadas que son importantes en
la eficacia de la transcripcin, tales como ciertas secuencias adyacentes a las cajas
conservadas o incluso el contexto gentico en que se encuentren, por lo que con frecuencia
se prefiere hablar de regiones promotora y no de promotor.

A la hora de expresar una secuencia clonada, el promotor es uno de los elementos


esenciales. Los fines productivos aconsejan el uso de promotores fuertes; la sensibilidad de
la clula hospedadora hacia el producto expresado requiere en muchos casos el empleo de
promotores muy bien regulados.

La fuerza del promotor es uno de los factores que ms afectan al rendimiento de la


expresin gnica. Se basa en su afinidad por la RNA-polimerasa o capacidad para
interaccionar con ella de manera rpida y eficaz provocando una alta tasa de sntesis de
molculas de transcrito. La fuerza de un promotor puede medirse experimentalmente
insertndolo en un vector de clonaje, justo delante de una secuencia que codifique una
protena cuya actividad pueda ser valorada (gen testigo). El gen lacZ y la actividad -
galactosidasa de la enzima que codifica son el sistema clsico de medida de la fuerza de un
promotor; ms recientemente se estn utilizando otros sistemas basados en la actividad de
galactoquinasa, en la de cloranfenicol acetil-transferasa (cat) o en la produccin de
fluorescencia por el producto del gen GFP, la protena fluorescente verde (Green
fluorescente protein).

Un segundo aspecto del promotor a tener en cuenta, tanto o ms que su fuerza, es su


integracin en un mecanismo de regulacin. In vivo, la iniciacin de la transcripcin es la
etapa en la que mayoritariamente se basa el control de la expresin gnica bacteriana.
Existen diferentes mecanismo, no excluyentes, que influyen en la interaccin de la RNA-
1
Subunidad de RNA polimerasa que reconoce la secuencia especfica en el promotor para anclarse e iniciar
la transcripcin.
2
Pares de bases (pb)

220
polimerasa1 con los distintos promotores bacterianos. Existen diferentes mecanismos, no
excluyentes, que influyen en la interaccin de la RNA-polimerasa con los distintos
promotores bacterianos (superestructura de la regin promotora, unin de protenas
reguladoras del operador, etc).

Si esta regulacin resulta esencial para el control del metabolismo celular, es igualmente
importante cuando el promotor se utiliza, fuera de su contexto nativo, como seal directora
para la expresin de secuencias in vivo. Un promotor fuerte puede colaborar a la sntesis
rpida de una gran cantidad de molculas de una misma protena; en experimentos de
expresin en cultivos bacterianos, se puede conseguir que entre un 20 y un 40 % de toda la
protena celular sea la codificada por el gen clonado. En la fase exponencial de
crecimiento, esto puede suponer una exigencia energtica excesiva y frenara
sustancialmente el crecimiento de esa clula, que podra ser reemplazada en el cultivo por
algn mutante con expresin reducida o nula del gen clonado. Caso ms grave es cuando
el producto proteico expresado presenta una actividad con cierto grado de toxicidad para la
clula hospedera, efecto siempre ms notable cuanto mayor sea la concentracin de la
protena en el citoplasma celular. Es, por tanto, muy interesante disponer de un sistema de
expresin que pueda permanecer cerrado hasta el momento en que interesa que funcione;
por eso los promotores usados en vectores, sobre todo para la hiperexpresin de protenas
con fines productivos, son promotores muy bien regulados.

Entre los muchos promotores conocidos, solo unos pocos se utilizan en vectores de
expresin, ofreciendo sistemas de regulacin muy variados; los de uso ms frecuente se
relacionan a continuacin.

Promotor Plac
Controla la transcripcin del opern lac en el cromosoma de E. coli.
Es medianamente fuerte.
Esta regulado negativamente por el represor Lac, cuya unin al operador impide a
la RNA-polimerasa iniciar la transcripcin. El sistema se induce por alolactosa
(inductor natural), lactosa o IPTG (anlogo no metabolizable de la lactosa), que se
asocian al represor hacindolo inactivo para su unin al DNA.
El represor permite un nivel de expresin basal considerable (aunque est activo, se
da algo de transcripcin; se dice que el sistema tiene escape), que puede reducirse
aumentando el nmero de copias del gen que lo codifica (el gen lacI) mediante su
incorporacin en el vector de clonaje o utilizando un mutante (lacIq) que produce
mayor cantidad de molculas de represor.
En la misma regin promotora, upstream y contiguo al promotor, est el sitio de
unin de la protena CRP, regulador positivo del sistema y activo en presencia de
cAMP, por lo que la presencia de glucosa (que reduce los niveles celulares de
cAMP) cierra este promotor, que se dice sometido a represin catablica. La
expresin a partir de Plac requiere el crecimiento en un medio sin glucosa.

Promotor P lacUV5
Es un mutante del promotor Plac.
Es ms fuerte que Plac (su caja-10 es idntica a la consenso).

1
Enzima responsable de la transcripcin

221
Su mecanismo de regulacin es parecido al de Plac aunque es insensible a represin
catablica (contiene mutaciones que afectan al sitio de unin de la protena CRP,
CRP b.s.).

Promotor P trp
Es el promotor que regula la transcripcin del opern trp de E. coli.
Tiene una fuerza superior a Plac (la secuencia de su caja-35 es igual a la consenso).
Regulado negativamente por el represor Trp, que se activa en presencia del
aminocido triptfano; es reprimible por triptfano e inducible por acido 3-
indolacrlico.

Promotor P tac
Es un promotor hbrido formado por la regin-35 de Ptrp y la regin-10 de P PlacUV5
construdo artificialmente mediante la unin in vitro de ambas mitades.
Es un promotor muy fuerte.
Regulado por el represor Lac e inducible por IPTG, ya que contiene el operador lac.

Promotor P trc
Otro promotor sinttico, formado por la caja-35 de Ptrp y la -10 de PlacUV5; se
diferencia del anterior en la distancia entre ambas cajas, que aqu es de 17 pb y en P
tac de 16 pb.
Es un promotor muy fuerte.
Regulado negativamente por el represor Lac e inducible por IPTG, como Plac y Ptac.

Promotor PL
Es el promotor izquierdo (left) de los genes tempranos.
Implicado en un mecanismo de regulacin negativa por el represor cI.
El mutante cIts857 produce un represor termosensible, inactivo a 42 C; su uso
permite un control trmico de la expresin a partir de P L : a 28-30 C el represor es
funcional y bloquea la transcripcin, pero a 42 C el represor es inactivo y el
promotor queda abierto para la RNA-polimerasa.

Promotor P 10 o P 17
Es el promotor que precede al gen 10 del bacterifago T7.
No es reconocido por la RNA-polimerasa bacteriana (su estructura no se parece a la
del promotor consenso de E. coli).
Es reconocido especficamente por la RNA-polimerasa del fago, que tiene gran
afinidad por l: es un promotor fuerte.
Incorporado a un vector, la transcripcin de una secuencia clonada detrs de l
depende de la presencia de la RNA-polimerasa del fago en la clula hospedadora,
cuyos niveles pueden controlarse por ms de una va:

- Se han construido estirpes de E. coli, por ejemplo E. coli BL21 (DE3), lisgenas
del gen 1 de T7, codificador de la RNA-polimerasa del fago, colocado detrs del
promotor PlacUV5. La induccin con IPTG produce la expresin de la polimerasa
que, a su vez, transcribe el gen clonado tras Pt7.

222
- El sistema anterior tiene un cierto escape en ausencia de IPTG. Si se quiere
reducir a cero la expresin de la secuencia clonada tras este promotor, se puede
trabajar con estirpes de E. coli no lisgenas y, llegado el momento, infectarlas
con fago T7 o con un derivado de 1 que lleve el gen 1 de T7. La aparicin de un
gran nmero de molculas de la RNA-polimerasa del fago dispara la expresin
del gen clonado a niveles muy altos.

El control de la expresin a partir de este promotor se ha hecho ms verstil al


insertar tras el operador lac, lo que se ha hecho inducible por IPTG.

Relacin entre el nmero de copias del promotor y los niveles de represor2

La regulacin de los promotores utilizados para la expresin en vivo de secuencia clonada


se basa, en muchos casos, en la intervencin de molculas represoras que se unen a sitios
especficos, prximos al promotor o en su interior, impidiendo la iniciacin de la
transcripcin. Es fcil entender que la relacin entre el nmero de molculas del represor y
el nmero de copias del promotor es un factor importante a tener en cuenta. Dado que con
mucha frecuencia, el promotor va colocado en un vector plasmdico o viral, presente en
alta concentracin en el citoplasma hospedador, la eficacia del mecanismo de control de la
expresin del gen clonado depende del nivel de expresin del gen que codifica al represor.

Terminadores de la transcripcin

El terminador es la seal que determina el final de la transcripcin. En una primera


aproximacin, su incorporacin al recombinante, en una posicin corriente abajo
(downstream) y prxima a la secuencia clonada, no parece esencial, dado que el hecho de
que el transcripto sea ms o menos largo no afecta a la regin codificadora del producto,
definida por los codones de inicio y parada (stop) de su marco abierto de lectura (Open
Reading Frame-ORF) y, puesto que el propio vector contiene varios genes, siempre habr
un terminador que detenga el proceso de transcripcin de la secuencia clonada.

Sin embargo, en muchas ocasiones, la detencin de la transcripcin de la secuencia a


expresar resulta muy beneficiosa. Si el promotor es potente, la sntesis de largos transcritos
innecesarios sera una carga energtica para la clula que soporta la expresin. Adems, el
tamao del RNA transcrito puede afectar a su estabilidad o a su calidad como molde de la
traduccin. Finalmente, la transcripcin no detenida tras el inserto puede alcanzar a la
regin ori (punto de origen de replicacin) e interferir con la replicacin del plsmido. Por
ello, la mayora de los vectores de expresin contienen terminadores procariotas de la
transcripcin ms all del sitio de clonaje.

Adems, es posible que en alguna ocasin el gen clonado resulte transcrito de forma no
prevista, como parte de una unidad transcripcional plasmdica anterior al sitio de clonaje,
produciendo as una expresin no deseada. Para evitarlo, muchos vectores contienen
tambin terminadores de transcripcin antes del sitio de clonaje. Entre los terminadores
ms utilizados se encuentran:

1
Virus fago lambda = fago
2
Represor es una protena que se une a la regin del operador o promotor de un gen y evita la transcripcin
bloqueando el anclaje de la RNA polimerasa.

223
- Los terminadores T1 y T2 del gen rrnB que codifica al rRNA 5S de E. coli.
- Los terminadores tL y tR de los genes tempranos.
- El terminador T del fago T7.
- Otros terminadores de fagos (fd, etc.).

La aparicin de la tecnologa del DNA recombinante, permiti ya en 1980, describir y


clonar los primeros genes de plantas. Poco despus, se comenzaron a entender las bases
moleculares de la interaccin entre bacterias como Agrobacterium tumefaciens y algunos
de sus hospederos vegetales (plantas que lo alojan), interacciones hasta entonces ignoradas.
La disposicin de genes aislados, su manipulacin y el entendimiento del sistema de
infeccin por A. tumefaciens, permitieron que en 1983 se genere la primera planta
transformada genticamente, la que expres un gen de resistencia a un antibitico.

La ingeniera gentica es un conjunto de tcnicas que permite identificar, aislar, modificar


y reintroducir genes a un organismo original, o transferirlos a otro diferente. Significa
alterar la heredabilidad del DNA de una clula viva de manera tal, que la clula pueda
producir ms o diferentes productos o realizar por completo funciones nuevas. Una tcnica
principal en ingeniera gentica es la del DNA recombinante, la cual consiste en unir trozos
de DNA de diferentes organismos para producir una molcula de ADN hbrida. Las plantas
transgnicas se han construido sobre la base de introducir al sistema gentico de la planta
receptora informacin gentica adicional proveniente de otro organismo donante.
Generalmente es un gen que se codifica por una particular caracterstica: resistencia a
herbicidas, a determinados insectos, a enfermedades causadas por hongos, bacterias, virus,
o al fro. Otra aplicacin interesante de las plantas transgnicas, es que permiten el estudio
de la organizacin, funcionamiento y expresin molecular de genes vegetales de inters
para la industria agrcola. Esta manipulacin tiene dos ventajas:

1. Se tiene ms control sobre los tipos de organismos que se manipula genticamente.


2. Se puede introducir copias de material gentico a especies no relacionadas, lo que
ha sido imposible de lograr con tcnicas tradicionales.

Sin embargo, la transformacin gentica de plantas mediante ingeniera gentica todava es


un arte, an hay muchas incgnitas por resolver. Tal vez, la verdadera importancia de este
trabajo es el de obtener un producto que se conoce en gran medida pero el procedimiento
para obtenerlo es todava ms parecido a un arte.

La capacidad para introducir y expresar genes forneos en plantas, fue primero descrita
para tabaco en 1984, y ha sido extendida a ms de 50 especies (entre las principales: soya,
maz, trigo, papa, algodn, caa, tomate, meln, papaya). En el ao 2013, plantas
transgnicas se cultivaban a nivel mundial en alrededor de 175 millones de hectareas.5

3.1. Sistemas de transformacin de plantas

Para obtener estas nuevas variedades de plantas transgnicas se utiliza, entre otros
mtodos, el plsmido Ti de Agrobacterium tumefaciens, o el Ri de A. rhizogenes, a los
cuales se les reemplazan los genes inductores tumorales por la caracterstica seleccionada a
transferir. A. tumefaciens es un patgeno vegetal que causa enfermedad en plantas
suceptibles mediante la transferencia de parte de su propio DNA, cuyos genes son
conducidos en el plsmido. Al introducirse a la planta, el DNA bacteriano se inserta en el

224
DNA vegetal logrando la transformacin gentica, lo que en la planta se traduce en una
hiperplasia con una posterior hipertrofia (tumor). Si se reemplazan los genes inductores
tumorales (Ti Ri) por otras caractersticas genticas (genes deseables), hay posibilidades
de que las plantas expresen estas caractersticas transferidas.

Si bien es cierto que la transformacin utilizando A. tumefaciens ofreca una gran


herramienta para la introduccin de genes en plantas, su accin se limitaba, en esa poca,
al rango de plantas hospederas al que la bacteria naturalmente podra transferir su DNA a
la planta, es decir, infectar. Debido a esto, diversas tcnicas se desarrollaron desde
mediados de la dcada de 1980. Entre ellas, la que ms destac fue una en que los genes a
introducir son depositados sobre partculas metlicas microscpicas, las que son dirigidas a
una alta velocidad para implantar las clulas blanco (objetivo). Este sistema de
transformacin se llam gene-gun, pistola gnica o sistema de biobalstica. En las clulas
que sobreviven al impacto, el DNA puesto en la superficie de las partculas llega al ncleo
celular y se incorpora a su genoma. De esta forma, a comienzos de la dcada de 1990, ya
se poda postular que se contaba con sistemas de transformacin gentica de
potencialmente todas las plantas de inters agronmico y de forma cotidiana, de plantas
consideradas como modelo para la expresin y estudios de las secuencias externas
introducidas, como lo son tabaco y Arabidopsis thaliana.

Agrobacterium tumefaciens

Es una bacteria del suelo causante de la enfermedad de la agalla de la corona (o del cuello).
El estudio a un nivel molecular de la interacin planta-Agrobacterium, permiti determinar
que entre los numerosos eventos que ocurren en esta interaccin, uno de los pasos ms
importantes es la transformacin de un trozo de DNA desde la bacteria hacia el ncleo de
las clulas vegetales que son infectadas.

El A. tumefaciens posee un plsmido gigante, si se compara con el de bacterias utilizadas


en la tecnologa del DNA recombinante (E. coli). Este DNA plasmidial se denomina
plsmido Ti, por inductor de tumores (tumor inducing) y contiene todos los genes
responsables de la enfermedad de la corona de agallas, de su fenotipo y de este proceso de
transferencia de un trozo de DNA a la planta. Sin embargo, slo una pequea porcin de
DNA del plsmido Ti es transferido a la planta, ste es llamado DNA de transferencia o
simplemente T-DNA.

Gracias al plsmido Ti, la bacteria puede sintetizar compuestos aminoacdicos derivados de


arginina, que le permiten una mejor interaccin con la planta. Estos compuestos se llaman
genricamente opinas, las que se pueden clasificar en: nopalina, octopina y agropina. Cada
plsmido Ti contiene los genes de sntesis para una clase de opina. Por lo tanto existen
plsmidos Ti con los genes para la sntesis de nopalinas, otros para la sntesis de octopinas
y otros para la sntesis de agropinas. De este modo, la idea de Agrobacterium en su proceso
de infeccin natural de plantas, es sintetizar las opinas que le son tiles para su desarrollo y
esto ocurre en convivencia plena con la planta infectada. De ello, se deduce que los genes
de sntesis de opinas estn ubicadas en el T-DNA y son naturalmente transferidos a la
planta, de forma de asegurar la convivencia de esta interaccin planta-patgeno
(Figura 4.4).

225
Otra regin de gran importancia dentro del plsmido Ti, es la que contiene los genes que
otorgan la virulencia o infectividad de la bacteria; sta se denomina regin vir y contiene
los genes virA, virB, virC, virD, virE y virG. Estos genes estn involucrados
especficamente en el mecanismo de activacin de la infeccin bacteriana y de la
transferencia de T-DNA a la clula hospedera (o infectada). Los genes vir representan la
base de la maquinaria de infeccin de la bacteria, siendo fundamentales en promover la
transferencia del T-DNA hacia la planta.

Existe una variante de la enfermedad de la corona de agalla: la generacin de pelos


radiculares; que es causada por otra clase de Agrobacterium, el A. rhizogenes. A.
rhizogenes posee un plsmido denominado plsmido Ri (por root inducing), cuyos genes
tambin producen opinas, preferentemente del tipo agropinas y tambin posee un sistema
de transferencia de DNA a la clula husped, generando pelillos en la mayora de las
infecciones resultantes, aunque tambin se han visto ejemplos en que este tipo de
Agrobacterium causa agallas del cuello.

Figura 4.4. Modo de infeccion de Agrobacterium.

Mecanismos biolgicos involucrados en la transformacin por A. tumafaciens.

El proceso de activacin y transferencia del T-DNA


Uno de los aspectos ms interesantes de la transformacin gentica se relaciona con los
procesos biolgicos involucrados en la transferencia e incorporacin del DNA exgeno a la
clula vegetal. Como se mencion anteriormente, Agrobacterium tumefaciens posee en su
plsmido Ti un opern (conjunto de genes) denominado vir. Este es conjunto de seis
grupos de genes que codifican para todos los productos requeridos en las distintas etapas
de la infeccin: i) activacin de la bacteria, ii) generacin del T-DNA apropiado para ser
transferido (formacin del complejo T), iii) traspaso del complejo T, iv) ingreso a la
clula hospedera y finalmente su integracin al genoma de ella.

El proceso comienza cuando la bacteria detecta ciertas seales en su medioambiente y


transmite esta informacin hacia su interior. Este paso de informacin se conoce como
transduccin de seales y en general, utiliza dos componente moleculares, una protena
sensora en la superficie de la bacteria y una protena que modula o traduce de la
respuesta hacia adentro. En Agrobacterium, virA y virG, son las protenas sensora y
moduladora, respectivamente. De esta forma, cuando se produce una herida o dao

226
mecnico en la pared celular vegetal (requisito mnimo para la induccin), se liberan
compuestos fenlicos con un esqueleto carbonado de un tamao especfico, por ejemplo la
acetosiringona sera clave. Esta molcula es detectada y sensada en la bacteria, lo que hace
que ella se ligue frreamente a la clula vegetal utilizando protenas ubicadas en su
membrana (como las protenas ChvA, ChvB, PscA y Att entre otras propuestas) y por
contraparte, reconociendo los ligandos de la clula vegetal, los que quedan expuestos por
la herida producida. Los ligandos1 de la clula vegetal se denominan compuestos smiles
de la vitronectina, por su estructura similar a este compuesto conocido en mamferos. La
acetosiringona generada por el vegetal induce en el receptor VirA una reaccin
denominada de autofosforilacin (reaccin tpica de sistemas de la transduccin de seales
biolgicas), la que hace que un grupo fosfato se transfiera luego a la protena VirG. VirG
es un factor transcripcional, es decir, que estimula la transcripcin de un gen a travs de su
unin a una zona promotora. As, los promotores del opern vir en el plsmido Ti son
activados, generando la transcripcin del resto de los genes vir. Al sintetizarse
(transcribirse y traducirse) las protenas vir D2 y vir D1 (productos de la familia de genes
virD), ms virC1 (producto de la familia virC), cortan una sola hebra del T-DNA y
comienzan a separarla de su hebra complementaria, unindose covalentemente a sus
extremos. Al mismo tiempo que se produce la separacin y desplazamiento de la hebra
simple de T-DNA, se replica y reemplaza una nueva hebra en el plsmido Ti, quedando
ste intacto hacia el final del proceso de formacin del T-DNA hebra simple (T-DNAss).
El T-DNAss que se va generando, es rpidamente cubierto y protegido por mltiples
unidades de la protena virE2, de manera de evitar su degradacin ocasional. Esta hebra de
T-DNA recubierta con virE2, se conoce como complejo T. Durante todo el proceso,
virD2 permanece unida covalentemente al extremo 5 del T-DNA, sirviendo de maquina de
conduccin, ayudada adems por virE1, para el paso del complejo a travs de un canal
intercelular que une a Agrobacterium con la clula vegetal que va a ser transformada. Este
canal est conformado principalmente por protenas de la familia virB (virB4 y virB11) y
virD4.

Una de las caractersticas ms importantes del T-DNA es que est flanqueado por dos
zonas nucleotdicas especficas, que son secuencias repetidas y directas. Es precisamente
gracias a estas zonas, comnmente denominadas brazo izquierdo (ubicado en el extremo3)
y brazo derecho (ubicado en el extremo 5), que las protenas virD2 y virD1 reconocen
donde cortar el T-DNA para comenzar a formar el complejo T. Uno de los aspectos ms
interesantes en la transferencia del T-DNA, es que la virD2 permanece siempre ligada al
extremo 5 del complejo T, haciendo que el brazo derecho del T-DNA sea la zona que se
ve integrada en un 100 % de las plantas transformadas. Por el contrario, existe variada
evidencia de que el brazo izquierdo del T-DNA no es tan perfectamente integrado en el
genoma de las plantas infectadas. Pese a esta falta de perfeccin en la integracin del
extremo izquierdo, la correcta expresin de los genes que se desea introducir a una planta
especfica no se ha visto alterada.

El paso del T-DNA hacia la clula vegetal


Hasta el presente, no est claro qu protenas acompaan al T-DNA en su viaje a la clula
vegetal y finalmente al ncleo. Como se mencion lneas arriba, un modelo an vlido es
que el complejo T (compuesto por T-DNA, virD2 y virE2) viaja por el canal guiado por

1
Son molculas que se unen al centro activo de la protena para que sta pueda realizar su funcin biologica
correspondiente

227
virD2. El rol de virE2 es menos claro, aunque es claro que puede unirse a T-DNA hebra
simple y protegerlo. Existen numerosos experimentos que han demostrado que el T-DNA
slo necesitara ir unido a virD2 y que podra pasar en forma separada de virE2 hacia la
clula vegetal. En este sentido, la transferencia del T-DNA hacia la clula vegetal, sera un
proceso bastante parecido a lo que es la conjugacin bacteriana, donde la transferencia de
DNA desnudo entre bacterias a travs de un pili1, permite al mismo tiempo la regeneracin
del material gentico en la bacteria del origen, lo que ocurrira fsicamente cerca del pili.
Existe una tercera protena que tambin pasara hacia la clula vegetal que est siendo
infectada: virF, su funcin especulativa sera interactuar con otras protenas de la clula
vegetal, para inducir la divisin celular de sta, en conjunto con las fitohormonas
producidas por los genes acarreados en el mismo T-DNA. Este es un evento sumamente
necesario en los primeros estados de desarrollo de la infeccin, generando as el fenotipo
de la corona de la agalla. Como puede inferirse, esto es tambin fundamental para la
transformacin con fines biotecnolgicos.

Integracin al genoma vegetal


El proceso de integracin del T-DNA al genoma vegetal es un ejemplo especfico de un
proceso biolgico en el cual las hebras de DNA dentro de un ncleo, son intercambiadas o
recombinadas; debido a esto, el proceso se llama recombinacin del DNA. La
recombinacin forma parte de procesos tan importantes como la mantencin y divisin
celular.

Sin duda que la supervivencia de las especies est influenciada por factores tales como una
cuidadosa replicacin del DNA, la reparacin del mismo y su variabilidad. La
recombinacin gentica tiene un rol muy importante en la evolucin de las especies,
debido al proceso de reordenamiento en las secuencias del DNA para generar nuevas
combinaciones de genes. Estos nuevos genes permitiran generar nuevos mRNAs y
protenas, y por lo tanto, nuevos y probablemente mejores fenotipos. Una etapa muy activa
en cuanto a recombinaciones, ocurre en la meiosis (etapa del crossing over), donde la
recombinacin del DNA puede resultar en gametos genticamentes distintos, que permiten
la produccin de genotipos variados que pueden ser ms adecuados a un medio ambiente
cambiante. Un aspecto relevante es el rol inmediato que significa la recombinacin del
DNA en las clulas: la reparacin de segmentos daados. Gracias a la recombinacin, una
hebra de DNA (o las dos) que ha sido daada (en algn segmento del genoma de cualquier
organismo), por ejemplo por radiacin UV, ser rpidamente detectada y reemplazada por
una hebra completamente nueva. Este sistema es conocido como de recombinacin
reparacin del DNA.

El T-DNA en plantas, se integra al genoma de plantas transformadas a traves de la


recombinacin ilegtima. El proceso de integracion del T-DNA a la planta tiene sus bases
en las protenas de Agrobacterium VirD2 y VirE2, las que en algunos sectores de su
secuencia poseen sitios que sirven como seales para que se dirijan al ncleo, y con ello
llevar al T-DNA unido. Se postula que el mecanismo de trfico al ncleo vegetal estara
mediado por la interaccin de estas dos proteinas bacterianas, proceso que sera apoyado
por las protenas de la planta.
1
Pili son flagelos o pelos que se encuentran en la superficie de muchas bacterias, interconecta dos bacterias
construyendo un puente entre ambos citoplasmas. Esto permite la transferencia de plsmidos entre las
bacterias.

228
Plsmidos binarios
Debido a su gran tamao, el plsmido Ti es inmanejable en el laboratorio y difcilmente
podra utilizarse para clonar directamente genes en l. As, para transformar una planta
mediante A. tumefaciens, se utilizan plsmidos desarmados tipos Ti. Esto da origen,
generalmente a un sistema en el que dos plsmidos complementan sus funciones, uno
aportando con el opern vir y el otro aportando el cassette1 con el gen de inters. De esta
forma, ambos plsmidos en conjunto, complementan las funciones de un plsmido Ti
normal. Estos plsmidos con funciones complementarias se llaman plsmidos binarios. El
plsmido que lleva los elementos relacionados con el T-DNA, no posee los grupos de
genes encargados de la sntesis de opinas ni los de la sntesis de fitohormonas (citoquininas
y auxinas). En l se han reemplazado estos, por cassettes de expresin de los genes de
inters. Como se ve, existe un proceso de complementacin de funciones entre ambos
plsmidos binarios, los que en su conjunto equivalen a tener un plsmido Ti funcional (sin
formar el tumor) y con la ventaja de hacerlos ms pequeos en tamao, de forma de poder
manipularlos adecuadamente en el laboratorio. Esta estrategia ha permitido disear cepas
comerciales de A. tumefaciens que traen incorporada el plsmido que contiene las
funciones de virulencia (vir), como ocurre con la cepa LBA4404, la ms conocida y
utilizada hasta hoy para transformacin de plantas. Esta bacteria posee el plsmido
denominado pAL4404 (al que se llama, plsmido Ti residente), con todos los genes vir
necesarios para activar una eventual T-DNA que pudiera ser incorporado a la bacteria. El
T-DNA es aportado entonces por otro plsmido, el que adems posee elementos que le
permiten funcionar como plsmido lanzadera, es decir, que funciona tanto en A.
tumefaciens como en E. coli. Esta caracterstica, permite que todas las operaciones de
clonamiento de un gen de inters y su manipulacin para que se exprese correctamente en
la planta, son posibles de realizar en estos plsmidos utilizando bacterias tipo E. coli, tal
como si fuera un plsmido pequeo y con todas las herramientas que se pueden aplicar con
la tecnologa del DNA recombinante. Dentro de las seales necesarias para este vector
binario lanzadera, se encuentran los cassettes de seleccin para antibiticos y secuencias
que permiten que dicho plsmido se pueda replicar, tanto en bacterias tipo E. coli como en
bacterias tipo A. tumefaciens. Tambin en este plsmido, se suele incluir el cassette de
seleccin para el proceso de transformacin propiamente tal, es decir, la seleccin de las
clulas que efectivamente se han transformado.

Un sistema similar, pero menos usado en la actualidad, es el denominado de plsmidos


integrativos. Este sistema explota tambin un sistema dual de plsmidos, con las funciones
separadas de la misma forma que el anterior. La diferencia con el sistema binario radica en
que esta vez se busca reconstruir un plsmidos Ti dentro de Agrobacterium, a travs de la
recombinacin de secuencias homlogas entre el plsmido que porta la zona T-DNA y el
plsmido que tiene la zona vir.

Genes reporteros2 y marcadores


Cuando se realizan experimentos de transformacin, los explantes (o tejido que se

1
Cassette de expresin es el conjunto de seales necesarias en una hebra de DNA sea capaz de expresar
correctamente una enzima o protena especifica. Contiene todos los elementos promotores y terminadores de
la transcripcin para que esto ocurra.
2
Gen reportero es un gen que codifica un producto que puede ser fcilmente detectado y medido. Es un gen
que los investigadores vinculan a una secuencia regulatoria de otro gen de inters. Los genes reporteros son
usualmente usados para indicar si un determinado gen ha sido tomado o expresado en la clula, rgano o
tejido.

229
transforma) que son sujetos al evento, se conforman por clulas que han sido efectivamente
transformadas (las menos) y clulas que no se transformaron eficientemente. Esto ltimo
puede deberse a muchas razones, tales como que en efecto no son clulas transformadas o
como clulas que a pesar de ser transformadas, es decir que el DNA entr a su interior,
nunca ingresar a su ncleo ni ser incorporado definitivamente a su genoma.

Existen eventos de transformacin en los que los genes son ingresados al ncleo, pero
estos nunca sern integrados en el genoma. En este tipo de ensayos, los genes includos en
los cassettes de transformacin, son expresados de manera temporal, denominndose
eventos de expresin transitoria y que generalmente duran slo unos pocos das (por
ejemplo, hasta nueve das) para ser finalmente eliminados de la clula, generalmente por
maquinarias de degradacin de cidos nucleicos que le resulten extraos.

Cuando se busca generar una nueva variedad de plantas a travs de transgenia, se busca un
evento de transformacin permanente, es decir, la transformacin estable del tejido blanco.
Una forma de aumentar la certeza de que se ha obtenido clulas establemente
transformadas, es el crecimiento selectivo de las clulas sometidas a transformacin. Este
proceso de seleccin obliga a la utilizacin de cassettes adicionales al de inters, que
expresan genes que confieren alguna carcterstica metablica a la planta, lo que hace que
ella pueda crecer en medios selectivos. Estos cassettes para los genes de seleccin, slo
deben permitir la expresin de dichos genes en la clula blanco (eucariote) y no en
microorganismos contaminantes, como el mismo A. tumefaciens, u otros que pudieran estar
presentes en la transformacin ex profeso o casualmente.

Los marcadores de seleccin, son genes que confieren un fenotipo dominante a las clulas
transformadas en comparacin a aquellas que no lo poseen. Los marcadores de seleccin
pueden agruparse en dos grandes tipos:

a) Aquellos que confieren ya sea viabilidad o letalidad en presencia de un agente


selectivo en el medio de cultivo (medio de seleccin),
b) aquellos que no tienen un efecto evidente en la supervivencia celular, pero
confieren alguna caracterstica fsica distinguible a las clulas transformadas.

a. Marcadores que confieren viabilidad o letalidad a las clulas transformadas

i. Genes de resistencia a antibiticos o herbicidas

Una de las caractersticas ms empleadas es la resistencia a antibiticos (por ejemplo


kanamicina e higromicina), herbicidas (por ejemplo Basta) u otras fitotoxina. En general,
la resistencia conferida a la clula por este tipo de genes de seleccin, se debe a la
codificacin de una enzima que permite la destoxificacin por modificacin qumica del
txico, a la sntesis de un agente blanco del txico que sea menos sensible que el silvestre o
a la sobre expresin de la protena blanco, haciendo poco significativo el efecto del txico
en el medio. El proceso de seleccin de las plantas efectivamente transformadas, consiste
simplemente en hacer crecer los explantes transformados en medios conteniendo estos
agentes selectivos (txicos para clulas normales) en concentraciones adecuadas. En la
actualidad, la utilizacin de genes de resistencia a antibiticos es muy discutida, debido a
los posibles efectos secundarios que estos genes pueden producir al ser ingeridos en
alimentos que utilizan como materia prima a cultivos transgnicos. Esto ha llevado a la
bsqueda y utilizacin de nuevos genes y estrategias.

230
ii. Marcadores de letalidad

Ms que en aplicaciones biotecnolgicas, el uso de este tipo de marcadores corresponde a


ciencias bsicas. Un ejemplo de esto puede ser utilizar un gen que codifique para una
protena txica bajo las rdenes de un promotor que sea activado slo bajo ciertas
condiciones. De esta forma, al darse dicha condicin fisiolgica o estmulo externo, se
producir la muerte celular. Este tipo de marcadores ha permitido establecer la tecnologa
terminator, en la que expresando el gen de la barnasa (una ribonucleasa inductora de
macho esterilidad, originalmente existente en Bacillus amyloliquefaciens) en clulas
transformadas,8 la planta transgnica genere una progenie infrtil, eliminando la
posibilidad de escapes, flujo gnico e incluso de la formacin de progenie.

b. Marcadores visibles

Marcadores histolgicos. Ellos confieren un fenotipo visible en presencia de un


sustrato aplicado exgenamente. Esto ha dado origen a la utilizacin de los llamados genes
reporteros, los cuales al expresarse dentro de la planta transgnica, expresan una actividad
biolgica que es fcilmente evaluable e incluso cuantificable. Dos son las principales
protenas utilizadas; la primera de ellas es la enzima -glucuronidasa (GUS), que utiliza un
sustrato llamado -glucurnido que es incoloro y lo transforma a un producto coloreado
azul, que precipita sobre la misma enzima. La desventaja de utilizar la deteccin de GUS,
es debido a que se debe destruir el tejido transformado, perdiendo el evento transgnico.
En los ltimos doce a quince aos, ha aparecido un segundo gen, cuya ms importante
caracterstica es no requerir esta destruccin del tejido transformado. ste codifica para la
denominada protena verde fluorescente (green fluorescent protein, GFP), que se aisl de
Aquorea victoria y que tiene la particularidad de emitir una luz verde nen cuando es
excitada con luz ultravioleta. La utilizacin de GFP ha permitido generar incluso
procedimientos de obtencin de plantas transgnicas sin la utilizacin de genes de
seleccin metablica o resistencia a antibiticos, como los anteriormente mencionados.

Marcadores morfolgicos. Corresponden a genes que codifican para protenas que


generan, en las clulas transformadas, un cambio fenotpico fcilmente evaluable. Si estos
marcadores se ubican bajo las rdenes de un promotor que responde a un estmulo qumico
del medio (un agente inductor), la aplicacin de este agente permitir la seleccin de las
clulas transformadas. Este inductor puede ser luego quitado y as las clulas seleccionadas
pueden recobrar su morfologa normal. Actualmente, estos sistemas son de amplio uso
biotecnolgico y se conocen con el nombre de MAT (del ingls multi-
autotransformation). Son sistemas que utilizan los genes metablicos que permiten
seleccionar positivamente las clulas o el tejido transformado. Los sistemas MAT de uso
cada vez ms popular.9,10 Se pueden agrupar segn el tipo de enzima o elemento
metablico de seleccin: a) aquellos que usan el gen de la enzima isopentenil transferesa
(ipt)16 y b) aquellos que usan los genes rol A, B y C de A. rhizogenes.15 Al ser
transformadas con ipt, las clulas que incorporan el gen entran en una activa proliferacin,
debido a que la enzima cataliza la sntesis de citoquininas, por otro lado, las clulas
transformadas con los genes rol, son capaces de inducir la formacin de pelillos radicales
areos, debido a un aumento en la sensibilidad a auxinas. De esta forma, ambas plantas o
clulas transformadas, podrn ser distinguidas fenotpicamente de sus contrapartes no
transformadas. Los sistemas MAT poseen adems, elementos que permiten su escisin del
genoma de las clulas o plantas transformadas.

231
3.2. Biobalstica

La interaccin natural entre Agrobacterium y las plantas inicialmente se crey limitada al


espectro de las dicotiledneas. Debido a esto, estas partculas se recubren con genes
quimricos, de forma que ellos lleguen al ncleo y se incorporen al genoma de la clula. Se
asume que las partculas, una vez ingresadas a la clula, desprenden el DNA que se ha
depositado sobre su superficie, debido a la accin de los lquidos intracelulares. Este
proceso esencialmente fsico, permiti superar el inicial impedimento prctico de
transformar especies monocotiledneas en un laboratorio.

Una de las ventajas del sistema de biobalstica, es que prcticamente se puede utilizar en
cualquier sistema vegetal, quedando as abierta la posibilidad de transformacin in situ de
clulas diferenciadas, sin necesidad de un cultivo in vitro previo o de regeneracin
posterior como lo requiere la metodologa a travs de A. tumefaciens. Esto ha permitido,
por ejemplo, la transformacin de clulas meristemticas apicales con una eficiencia
aceptable (0,007 a 0,003 %). Sin embargo, esta eficiencia se puede aumentar (por ejemplo
hasta 1 %) a travs de la introduccin del proceso de organognesis en la regin
transformada, mediante la utilizacin de citoquininas (por ejemplo bencilaminopurina)
para generar multibrotacin.

3.3. Metodologas de transformacin

Transformacin mediada por Agrobacterium tumefaciens.

Como se mencion anteriormente, la factibilidad de instaurar sistemas de transformacin


utilizando A. tumefaciens generalmente involucran un gran esfuerzo en desarrollar lneas
celulares con alta capacidad de regeneracin. Una vez obtenida una lnea celular
especfica, se desarrollan los experimentos de transformacin, los que en trminos
generales constan de tres etapas bsicas.

i. Infeccin
Se ponen en contacto los explantes celulares con la solucin de bacteria. Esta etapa es de
una duracin variable en la que se procura el reconocimiento entre las protenas receptoras
de la bacteria y los ligandos de la pared celular vegetal. Para la infeccin se pueden
requerir tiempos breves de slo algunos segundos (como por ejemplo para tabaco), tiempos
intermedios de un par de minutos (como por ejemplo para vides) o tiempos bastante
prolongados (como por ejemplo para durazno). De la misma forma, la concentracin
ptima de bacteria (medida como OD600) vara entre 0,1 y 1,0. Una vez realizada la
infeccin, los explantes son extrados de las solucin bacteriana y el exceso de bacterias es
eliminado cuidadosamente mediante un papel filtro. Entonces ya se puede dar paso a la
segunda etapa.

ii. Co-cultivo
Es la etapa que implica todos los eventos de generacin del complejo-T y traslado a la
clula vegetal. El tiempo suficiente para el co-cultivo es dependiente del modelo de
trabajo, encontrndose generalmente suficiente unas 48 horas en medios propicios para que
ambos componentes, bacterias y explante, interacten efectivamente generando la
transformacin.

232
iii. Seleccin y regeneracin del explante transformado

Esta es la etapa ms larga de todo el proceso de transformacin, pudiendo durar tantos


meses como el sistema de regeneracin de la clula vegetal disponga. Una vez pasado el
tiempo de co-cultivo, ya no interesa ms la presencia de Agrobacterium en el mismo medio
en que estn las clulas transfomadas. Para eliminarlo se utilizan antibiticos (usualmente
cefotaxime), aplicndolos por un determinado tiempo hasta que ya no existen evidencias
de la bacteria en el medio de seleccin y regeneracin. Como este nombre lo indica,
tambin es un medio de seleccin, por ello, junto con eliminar al Agrobacterium, se
pretende no estimular la multiplicacin y regeneracin de clulas no transformadas. Hasta
la fecha, los agentes de seleccin ms utilizados lo constituyen antibiticos como la
kanamicina, cuyo efecto final es precisamente eliminar todas las clulas vegetales que no
hayan incorporado los genes deseados desde el plsmido. Sin embargo, la aparicin de
nuevos agentes de seleccin, como la misma GFP (protena fluorescente verde) o genes
que confieren caractersticas metablicas especficas a la planta, han permitido la
generacin de nuevos vectores de transformacin en los que se excluyen genes de
resistencia a antibiticos, cuya utilizacin se ha cuestionado debido a sus posibles efectos
en el humano.

Transformacin mediada por biobalstica

El sistema de biobalstica consta esencialmente de una cmara de vaco y un sistema de


acumulacin de presin, para el que se utiliza un gas inerte para las clulas (por ejemplo
helio). Esta presin ser la que impulsar las partculas que han sido recubiertas con el
plsmido o cassette de inters. Las etapas ms importantes en el proceso de biobalstica
son:

i. Preparacin de las partculas: donde se precipita el DNA de inters en introducir a


la planta, utilizando para ello CaCl2, espermidina y etanol. Todos estos elementos
corresponden en esencia, a elementos que desplazan agua desde las hebras de DNA
produciendo as la precipitacin sobre la superficie de las partculas.
ii. Preparacin de las membranas portadoras: stas son membranas circulares de
aproximadamente 1,5 cm de dimetro sobre las que se deposita una cantidad adecuada de
partculas preparadas con DNA en su superficie. El material de estas membranas es
extremadamente resistente.
iii. Preparacin del dispositivo porta membrana: que corresponde a un anillo que
tiene como objetivo retener a la membrana portadora, de manera invertida (exponiendo las
partculas hacia abajo y adaptarla al sistema de inyeccin de gas.

iv. Armado del sistema de retensin: tras ubicar las membranas portadoras del DNA,
a una distancia que puede variar entre 0,5 a 1,5 cm, se ubica una rejilla de parada para la
membrana portadora. La idea es que, tras el impulso dado por la presin de gas, la
membrana portadora acelere esta distancia y se detenga sbitamente. De este modo, la
membrana ser retenida por la rejilla de parada y las partculas seguirn su viaje hasta
impactar con el tejido blanco.

v. Produccin de la onda de impulso: Para esto se utiliza un gas considerado inerte


para la clula, el helio. Para generar la presin de gas, ste se acumula en un cilindro en el
que uno de sus extremos est abierto y habilitado para poner membranas de ruptura. La

233
funcin de estas membranas de ruptura es retener la presin deseada de trabajo y luego, al
inducir su ruptura por accin mecnica (por ejemplo con una aguja), liberarla generando la
onda expansiva necesaria para impulsar las membranas portadoras.

Existen numerosos sistemas y variantes comercialmente disponibles en cuanto a


biobalstica. El costo tambien es variable segn su origen y automatizacin.

3.4. Eliminacin de los genes indeseados

La mayora de las tcnicas de transformacin introducen un gen de seleccin que confiere


resistencia a antibiticos, junto con el gen de inters. Una de las metas ms deseadas en el
camino del mejoramiento de plantas mediado por transgenia, es la obtencin de nuevos
cultivos con un mnimo de modificacin de su fondo gentico, siendo en efecto sta una de
las grandes ventajas de la transgenia en comparacin con los cultivos mejorados
sexualmente (mejoramiento convencional por hibridacin).

En casi todos los casos, el gen de resistencia incorporado en forma accesoria ya no es til
una vez que se ha superado la etapa de seleccin de los clones transformados, siendo
deseable eliminarlo desde las plantas transformadas y seleccionadas. En el caso de los
genes insertados en el genoma nuclear de las plantas se han ideado varias aproximaciones
para retirar estos genes de resistencia al antibitico. Entre ellas, a traves de la co-
transformacin, recombinacin sitio-especfica y sistema de elementos transposables.
Todos estos sistemas tratan de remover los genes de seleccin utilizados. Sin embargo,
como contrapartida, se han generado tambin sistemas que utilizan la incorporacin de un
marcador metablico positivo.

3.5. Plantas transgnicas de primera generacin


Las pasadas dcadas han marcado un hito en la aplicacin de la ingeniera gentica de
plantas y en la agricultura. La primera generacin de plantas obtenidas por biotecnologa,
se concentr en la incorporacin de genes de resistencia a insectos y genes de tolerancia a
herbicidas. Estos rasgos incorporados, han permitido la reduccin de prdidas por
aparicin de malezas y de pestes, as como una disminucin en la cantidad de qumicos
utilizados en su prevencin. En 1994, la empresa Calgene comercializ el tomate Flavr
Savr, con maduracin retardada debido a la introduccin, en forma antisentido, del gen de
la poligalacturonasa, enzima encargada del metabolismo de la pared celular. Ya en 1995,
se haban otorgado nueve concesiones para la comercializacin de estos cultivos, siendo
Canad y Estados Unidos los principales pases en aprobarlas. El xito de estos cultivos
genticamente modificados (GM) ha sido tal, que ya en el ao 2007 se super los 114
millones de hectreas, teniendo como pases ms importantes, por su rea total sembrada:
Estados Unidos, Argentina, Brasil, Canad, India y China.4

En el caso de las plantas con tolerancia al herbicida glufosinato de amonio (Basta), destaca
como cultivo la soya, representando ms de la mitad del total de cultivos GM sembrados
en el mundo hacia fines de la dcada pasada. Con este mismo carcter, le siguieron colza y
maz en este mismo perodo de tiempo. Casi todos los eventos disponibles o
comercializados con este rasgo en la actualidad, utilizan como fuente de resistencia el gen
pat, de la bacteria Streptomyces viridochromogenes cepa Tu494, que codifica para la
enzima fosfinotricin-acetil transferasa (protena PAT). Al estar presente en las plantas,
PAT permite que stas desactiven a la fosfinotricina, principio activo de los herbicidas de
este tipo.

234
Hacia fines de la dcada de 1990 destac el conocido maz Bt, que utiliza diferentes genes
de la familia cry de Bacillus thuringiensis subsp kurstaki cepa HD-1, para expresar la
protena CRY que confiere resistencia aumentada a insectos. El mecanismo de accin de
esta protena es formar agrupaciones cristalinas en los aparatos digestivos de lepidpteros,
es decir, verdaderos canales o perforaciones al tracto digestivo de los insectos, generando
su muerte. Este tipo de cultivo lleg a ser un 25 por ciento del total de los transgnicos
sembrados en el mundo en ese perodo.

Un tercer cultivo de importancia por su volumen de rea sembrada para comercializacin


ha sido la produccin masiva de algodn GM, el que se ha modificado con ambas
caractersticas, es decir, resistencia a insectos y a herbicidas. Actualmente se esta
incrementando, en forma comercial, la siembra de otros cultivos genticamente
modificados como las plantas ornamentales, frutales (papaya) etc.

3.6. Plantas transgnicas de segunda generacin y perspectivas

Plantas con contenido nutricional mejorado

Uno de los hitos en el desarrollo de las plantas genticamente modificadas lo constituy el


denominado arroz dorado. En 1990, un grupo de investigadores, liderados por Ingo
Potrykus (ETH-Zurich, Suiza), propuso a la fundacin Rockefeller y a su Programa de
Biotecnologa en Nueva York, desarrollar un proyecto para introducir una va metablica
que permitiera la produccin de provitamina A en el endosperma del grano del arroz. Se
sabe que la deficiencia de vitamina A en dietas de pases de escasos recursos, incide en
enfermedades como la ceguera nocturna, xeroftalmia y Keratomalacia, pudiendo generar
finalmente ceguera total. Fue as que este proyecto, a pesar de ser concebido como de
difcil viabilidad tcnica, comenz su ejecucin mediante la fusin de ncleos de
cientficos con variadas habilidades. Un grupo que estaba trabajando en la va del
metabolismo de los terpenos en endosperma de arroz (grupo de Meter Beyer, University of
Freiburg, Alemania), se uni con otro grupo de gran dominio en la ingeniera gentica
(grupo de Ingo Potrikus, ETH-Zurich, Suiza). Estudios preliminares permitieron a este
ncleo de investigadores determinar que, gracias a la fundacin de cuatro enzimas: fitoeno
sintetasa, fitoeno desaturasa, -caroteno desaturasa y licopeno -ciclasa; se podra en
teora, producir -caroteno, o provitamina A. La metodologa de obtencin de esta nueva
variedad de arroz, consisti en la co-transformacin con dos cepas de A. tumefaciens
portando todos los genes necesarios para la ruta metablica ms el cassette con el gen de
seleccin. Un plsmido binario que contena los genes necesarios para la produccin de
licopeno en los plastidios del endosperma de arroz: el gen de la fitoeno sintetasa de narciso
(Narcissus pseudonarcissus) y el gen de la fitoeno desaturasa de una bacteria (Erwinia
uredovora). El otro plsmido contena otros dos genes: el de la licopeno -ciclasa de
narciso y el cassette para resistencia a higromicina. De esta forma, el segundo plsmido
permitira la sntesis completa hasta -caroteno. Como se habr notado, se utilizaron slo
tres de los cuatro genes anteriormente mencionados como necesarios en la ruta sinttica
completa. Esto debido a que el uso de una caroteno desaturasa de origen bacteriano,
permiti prescindir del uso de las desaturasas vegetales, las que en su conjunto tienen el
mismo rol que la enzima bacteriana. As tras ocho aos de trabajo, se obtuvo una planta de
arroz, fenotpicamente normal, frtil y con buen contenido de -caroteno en su endosperma
(1,6mg/g).

235
Plantas como agentes productores de vacunas

Durante la dcada de 1980, el avance en el conocimiento de aspectos moleculares


genticos del sistema inmune y su aplicacin a la patologa humana, permitieron sentar las
bases para nuevos sistemas de elaboracin de anticuerpos (como lo es la produccin de
anticuerpos monoclonales) o generacin de vacunas. De esta forma, la posibilidad de
expresar en plantas determinadas secuencias nucleotdicas con capacidad de expresar
pptidos claves que son capaces de inducir una respuesta inmune, ha sido de gran inters.
Estos pptidos reciben el nombre de epitopes o determinantes antignicos. Siendo una
cadena lineal de entre 7 y 15 aminocidos especficas el agente infeccioso.

Uno de los aspectos ms atractivos del uso de plantas transgnicas que expresan eptopes
especficos o plantas productoras de vacunas, es que, a diferencia de los sistemas animales
utilizados para este mismo fin, en las plantas slo se requiere agua, luz solar y sales
minerales para su mantencin, siendo un sistema mucho ms barato. Adems, la
produccin de este tipo de pptidos en plantas se ofrece como un sistema ms limpio que el
animal, si se piensa en los diversos contaminantes biolgicos que acompaan a estos
ltimos (especialmente otros patgenos asociados al animal productor). Tambin resalta
que, por sus caractersticas de produccin, las plantas proveen anticuerpos estables a
temperatura ambiente y, finalmente la produccin de vacunas en plantas, facilita la
obtencin de productos administrables por va oral.25

El xito de la produccin de vacunas en plantas implica desarrollar un producto que sea


capaz de inducir una respuesta inmune a nivel de la mucosa gstrica. Una vez en el tracto
digestivo, el antgeno suministrado por va oral ser reconocido por las clulas M de la
mucosa linftica del tracto. Estas clulas dirigirn el antgeno hacia otro tipo de clulas,
denominadas clulas presentadoras del antgeno (del ingls antigen presenting cell-APS).
stas internalizarn, procesarn y finalmente mostrarn en su membrana plasmtica, los
eptopes especficos asociados a dicho patgeno para que los linfocitos T de ayuda
(linfocitos T helper del sistema inmune celular) activen a los linfocitos B (del sistema
inmune humoral, productor de anticuerpos). As, estos migrarn hacia los ndulos
linfticos mesentricos, donde madurarn a clulas plasmticas que migrarn a la mucosa
gstrica para producir anticuerpos del tipo inmunoglobulina A (IgA), especficos contra el
antgeno.

Uno de los primeros ejemplos de vacunas en plantas fue desarrollado en 1990, la expresin
de una protena de superficie de Streptococcus mutans en tabaco. La inclusin de estas
plantas de tabaco en la dieta de ratones, demostr que efectivamente estos produjeron IgA
anti- S. mutans, aunque los animales vacunados no se sometieron a experimentos de
desafo con la bacteria. Posteriormente, han existido algunos ejemplos, siendo la expresin
de molculas llamada antgenos de superficie correspondientes al virus de la hepatitis B,
uno de los ms recurrentes. Los primeros experimentos con este patgeno expresando estos
antgenos en papas, mostraron una dbil respuesta inmune en ratones alimentados con
tubrculos crudos de papas transgnicas. Sin embargo, estos resultados han mejorado
recientemente, cuando en el ao 2001, se transform papas con un plsmido binario
multicomponente, es decir, que contena los cassettes de expresin para dos antgenos de
la toxina del clera (antgenos de las toxinas B y A2), un antgeno de la enterotoxina
fimbrial de E. coli enterotoxignico y un antgeno de la enterotoxina de rotavirus. Los
ratones alimentados con los tubrculos de estas papas mostraron inducir no slo buenos

236
niveles de IgA y recuperarse ms rpido de los efectos de la exposicin a rotavirus, sino
tambin, ser capaces de presentar una respuesta inmune ms generalizada mediante la
sntesis de interleuquinas, (molculas potenciadoras de la respuesta inmune celular). Se ha
observado una respuesta interesante, cuando una camada de ratones que se aliment de
leche de madres que fueron alimentadas con estas papas, tambin mostr recuperarse ms
rpido de los efectos del rotavirus.

Hasta la fecha, los datos obtenidos en este mbito no permiten observar un buen grado de
proteccin inmune, debido a que muchas veces el animal utilizado como modelo no es
susceptible al patgeno o porque las normativas de manipulacin de estos patgenos en el
laboratorio son tan estrictas, que no hacen fcil la instauracin en experimentos de prueba.

Una de las principales preocupaciones de los investigadores es como aumentar la expresin


de los genes utilizados como determinantes antignicos en este tipo de alimentos - vacuna.
Esto ha dado paso a la idea de modificar los genes o secuencias nativas de los pptidos
antignicos, generando genes sintticos ms potentes en su expresin, debido a que las
modificaciones introducidas han aumentado su estabilidad, tanto en la planta como tras ser
ingeridos por los animales modelos. En 1997, se prob la primera prueba biolgica en
humanos de una vacuna de planta transgnica. Esto consisti en utilizar como alimento en
un grupo de voluntarios, papas que constitutivamente expresaban una sub-unidad sinttica
(modificada) de la toxina B del E. coli enteropatgeno. Cada uno de los 11 voluntarios
recibi como alimento, una mezcla de cubos de papas transgnicas y no transformadas, en
una cantidad de entre 50 y 100 gramos de papa cruda. En 10 de los 11 participantes hubo
un aumento en anticuerpos anti-toxina B. Esta respuesta inmune fue similar a la observada
cuando a una persona se le desafa con un milln de bacterias E. coli enterotoxignico. A la
fecha, se estn desarrollando ensayos similares de evaluacin en humanos, para vacunas
orales contra la hepatitis B.

Plantas como biofarmacuticos

Los productos biofarmacuticos (insulina, hormona de crecimiento, etc) se han obtenido a


travs de organismos genticamente modificados, utilizando para ello bacterias, levaduras
y clulas mamferas en cultivo. Sin duda que la demanda creciente de este tipo de
compuestos genera un punto de colapso en trminos de suplir la necesidad por ellos,
repercutiendo esto en el costo que los pacientes deben soportar por sus tratamientos. La
produccin de protenas con capacidad teraputica en plantas, se vislumbra como una
posibilidad real, de costos realmente inferiores a los de los actuales sistemas de produccin
y generadora de productos libres de contaminantes patgenos.

Dos aproximaciones de transformacin de plantas se utilizan comnmente en los sistemas


de produccin de biofarmacuticos en planta: a) la ya conocida y detallada transformacin
por A. tumefaciens o biobalstica y b) la utilizacin de virus vegetales recombinantes. En el
ltimo caso, la estrategia consiste en utilizar virus que infectan plantas y de los que se
conoce completamente su genoma y funcionamiento molecular in vivo. As, se puede
reemplazar partes prescindibles del genoma de estos virus por los cassettes de expresin
del pptido con actividad farmacutica. Con esto, solo bastar la infeccin con este virus
recombinante para que dicho pptido sea producido in planta. Desafortunadamente, el uso
de virus recombinantes se limita al conocimiento biolgico del virus utilizando y a su
rango de hospederos, lo que ha limitado mucho su utilizacin masiva. De esta forma, los

237
virus ms corrientemente utilizados son el virus del mosaico del tabaco y el virus del
mosaico de la haba. Ejemplos en donde se han utilizado plantas infectadas con virus
recombinantes son tabaco y tomates que expresan el pptido inhibidor de la enzima
convertidora de angiotensina -1 y el pptido inhibidor de la replicacin viral del virus de la
inmunodeficiencia humana (a-tricosantina) en la hierba Nicotiana benthamiana. Ejemplo
de sistemas de investigacin en donde se ha aplicado transformacin gentica son la
expresin de encefalinas en canola (Brassica napus), seroalbmina humana en papa y
tabaco, glucocerebrosidasa en tabaco y factor estimulador de colonias de granulocitos y
macrfagos en tabaco. En 1998, se comenzaron pruebas en humanos para la utilizacin de
arroz transgnico que expresa la protena -1-antitripsina; de gran potencial teraputico en
el tratamiento de enfermedades hepticas, de hemorragias y de fibrosis qustica. Otro
ejemplo de la utilizacin a una escala ms avanzada de esta estrategia proviene de la
expresin de hirudina, un compuesto natural con actividad antitrombosis. Canola y tabaco
han sido los cultivos transgnicos utilizados para la expresin de este pptido que, en sus
fases iniciales mostr problemas desde la planta. Sin embargo trabajos fusionando el gen
de hirudina a genes de oleosinas, componentes que habitualmente se encuentran en los
aceites de canola, han permitido soslayar estos problemas y ha permitido la siembra en
campos comerciales en Canad de estos cultivos, para la produccin masiva del compuesto
antitrombtico.18

Tranformacin de organelos

Una de las tcnicas de mayor proyeccin en la transformacin gentica vegetal es la


transformacin especfica de organelos, con especial relevancia a la ingeniera gentica de
cloroplastos. Las plantas transgnicas que poseen el transgn insertado en el genoma
cloroplstico se denominan plantas transplastmicas. La ventaja de este tipo de alternativa
en la transformacin de plantas reside en que sta es precisamente una de las formas de
eliminar el fenmeno denominado flujo gnico entre cultivos genticamente modificados y
parientes silvestres o cultivados. As, la produccin de plantas transplastmicas es de gran
inters en especies con alto potencial de cruzamiento intra- e inter-especfico. Del mismo
modo, el flujo de polen y su efecto no deseado frente a insectos no blanco, por ejemplo en
el caso de los cultivos Bt, es tambin eliminado utilizando este tipo de estrategia. Estas
ventajas provienen del hecho de que, aunque el polen de algunas pocas plantas pueda
contener plastidios metablicamente activos, el DNA de estos es perdido durante su
proceso de maduracin, impidiendo su transmisin a la prxima generacin de plantas. A
manera de ejemplo, se ha visto que an cuando plantas transplastmicas para el gen cry
llegaron a poseer un 47 % de protena CRY del total de protenas solubles, sta no se
encontr en el polen de estas plantas.

La transformacin de cloroplastos tiene su base en un proceso totalmente distinto a la


recombinacin ilcita que explotan los plastidios binarios: la recombinacin homloga.
Como se mencion, la recombinacin homloga es un sistema normal de las plantas
mediante el cual secuencias que son idnticas entre s son recombinadas, generando el
reemplazo de una hebra de DNA por otra idntica, con el fin de reparar hebras daadas de
DNA o de generar simplemente variabilidad gentica. Para procurar recombinacin
homloga en el cloroplasto, entonces, se debe tener conocimiento del genoma en dnde se
desea insertar el o los cassettes de expresin de los genes de inters. De esta forma, los
plsmidos utilizados en la transformacin de cloroplastos no tienen los elementos descritos
anteriormente para los plsmidos binarios desde el punto de vista de los bordes T, sino que,

238
en adicin a los cassettes normales de expresin, poseen segmentos bastante
significativos (desde 400 pares de bases a varios kilobases) de genes plastidiales, los que al
ser homlogos al genoma cloroplstico, son reconocidos por las maquinarias internas de
recombinacin y reparacin del DNA en la clula de la planta, llevando a la insercin de
los cassettes de inters entre dicha secuencias, pero en el genoma plastidial.

El tamao de los genomas plastidiales vara entre 120 y 160 kilobases y codificadas para
los genes involucrados en la mantencin del propio plstido y en la fotosntesis. Adems
de su rol en la fotosntesis, los plastidios sirven como compartimientos para la biosntesis
de aminocidos y lpidos, siendo la mayora o todos los genes involucrados, sintetizados en
el ncleo.

Como en una clula vegetal existen muchos cloroplastos, los sistemas de seleccin deben
propiciar la obtencin de clulas con todos sus plastidios transformados. Para esto, los
sistemas de seleccin deben tambin estar dirigidos al cloroplasto. Inicialmente, la
seleccin de plantas transplastmicas utiliz una mutante en el RNA ribosomal 16S, que
no una el antibitico espectinomicina y as confera resistencia a ste. Posteriormente, se
ha utilizado el gen de la aminoglicsido 3-adenil transferasa (aad), enzima que inactiva
este mismo antibitico mediante la transferencia de la porcin adenil del trifosfato de
adenosina (ATP), hacia la espectinomicina o su smil estreptomicina. Desafortunadamente,
estos antibiticos tambin controlan las infecciones bacterianas en humanos y en animales,
por lo que la posibilidad terica de transferencia de este gen de resistencia hacia bacterias
en los tractos digestivos, aunque remota, est abierta a discusin. Recientemente, se han
desarrollado sistemas metablicos de seleccin, como los descritos anteriormente para
eliminar el uso de genes reporteros que confieren resistencia a antibiticos. En el caso de la
transformacin de plastidios, se ha utilizado el gen de la enzima betana aldehido
deshidrogenasa (BADH) de espinaca. Esta enzima esta presente slo en los cloroplastos de
un nmero muy reducido de especies con alta resistencia a sequedad y salinidad, por lo que
al introducirla en plantas transplastmicas, permite la seleccin de plantas en medios con el
agente toxico betana-aldehdo (BA), las que gracias a la BADH, lo transforman en
glicinabetana, compuesto que es adems, un reconocido metabolito osmoprotector.

Una caracterstica adicional observada tras el uso de BADH-BA como sistema de seleccin
de plantas transplastmicas, es la rpida regeneracin de los explantes que lo utilizan. En
lneas generales, se ha visto que este sistema permite una regeneracin casi tres veces ms
veloz que el uso del sistema de antibiticos espectinomicina-estreptomicina.

En teora, la seleccin utilizando BA se muestra como una herramienta muy poderosa y de


amplio espectro de aplicacin, siempre que los cultivos o especies a transformar no posean
este sistema expresado en muy altos niveles, como por ejemplo la familia de las
Chenopodiaceae y Poaceae.

Cisgnesis

La cisgnesis es la modificacin gentica de un organismo receptor de un gen natural que


proviene de otro organismo sexualmente compatible. Estos organismos contienen genes
aislados de la misma especie, incluyen secuencias nativas de los genes, intactos, con sus
secuencias reguladoras, exones e intrones, en el sentido sense. En la cisgnesis, se
recurre a un pool gentico perfectamente disponible a un mejorador convencional.

239
Difiere de la transgnesis en la medida que no se hacen modificaciones o inserciones de
genes entre organismos no sexualmente compatibles. En ambos casos, se utilizan tcnicas
de biologa molecular para realizar el ensamblaje y transferencia de genes. Es lgico
pensar que el proceso de aprobacin de las plantas cisgnicas podra ser ms breve que
aqul para plantas transgnicas.

3.7. Percepcin pblica

El avance de las nuevas tecnologas es hoy en da de muy difcil asimilacin para cualquier
persona, aunque sta est vinculada a la ciencia. Sin embargo, se ha generado el debate
sobre la incorporacin y uso masivo de los cultivos genticamente modificados en el
mundo. Generalmente, esta discusin ha sido controversial y manejado de una forma
visceral ms que tcnica y cientfica. Principalmente, los movimientos pblicos, conocidos
como grupos verdes o ecologistas son los que han propiciado estas discusiones. Aqu,
podemos distinguir varios estratos o tendencias, bsicamente agrupables en dos: a)
aquellos que buscan alcanzar una moratoria del desarrollo de cultivos GM hasta que los
hechos tcnicos demuestren una total certeza de su seguridad y b) aquellos grupos que
requieren incluso detener su desarrollo, bajo este mismo argumento de riesgo cero.

En conclusion los cultivos transgnicos no resolvern los problemas de seguridad


alimentaria en el mundo, sin embargo tienen el potencial de aumentar la productividad, de
reducir la malnutricin y la pobreza, y de promover el uso sostenible de los recursos
naturales. El campo de aplicacin de estos mtodos es enorme, las perspectivas que ellos
abren dejan soar a todos. Segn el nivel de comprensin de estas tcnicas, y los
temperamentos individuales, ellos suscitan la admiracin, horror o sentimientos
encontrados. Pensamos que ni el triunfalismo cientfico, ni el pnico irracional son
admisibles, pero es necesario la reflexin objetiva a los usos posibles de estas nuevas
herramientas.

4. MARCADORES GENTICOS Y MEJORAMIENTO DE PLANTAS

Los daos causados por micro-organismos e insectos son extremadamente costosos para la
humanidad. En Estados Unidos se ha estimado prdidas causadas por enfermedades
microbiales por un valor de US$ 9.1 billones por cada ao, mientras que US$ 7.7 billones
de prdida es causada por insectos. Por otro lado en muchos cultivos de pases
desarrollados, las prdidas por enfermedades y plagas representan aproximadamente el
20% en pre-cosecha. Estas prdidas en pases en desarrollo son frecuentemente cercanas a
30-45 %. Las prdidas por sanidad pueden ser ms que la capacidad financiera; en ciertas
ocasiones y lugares, ellas llevan la amenaza de hambre crnico y hambruna. Frente a estos
desafios, la gente por muchos siglos practic mejoramiento gentico de plantas y
mejoramiento agronmico con la finalidad de reducir prdidas por enfermedades y plagas.

La biologia molecular es una herramienta poderosa, que puede acelerar la obtencin de


nuevos genotipos ms resistentes, con mayor calidad alimenticia y con altos rendimientos.
Consecuentemente, ayudar en la reduccin de plagas y enfermedades de cultivos,
convirtiendo a la agricultura ms productiva y eficiente.

240
4.1. Fitomejoramiento y marcadores

El fitomejoramiento tradicional involucra el cruzamiento repetido de grandes nmeros


de plantas con caractersticas deseables (rendimiento, resistencia a enfermedades y
plagas, tolerancia a sequa, etc.), confiando que tales caractersticas puedan ser
combinadas de manera estable en un solo germoplasma. Emplea rasgos o marcadores
fenotpicos, morfolgicos o fenolgicos para efectuar la seleccin de individuos, lneas
o cultivares. Sin embargo, no existe con frecuencia una relacin clara entre el genotipo
y el fenotipo. Tal desventaja puede eludirse mediante el uso de marcadores bioqumicos
y moleculares; puesto que poseen un control gentico mendeliano, permiten evaluar la
variacin gentica (en funcin de la mutacin, la seleccin o la deriva gentica), y
representan una muestra de la variacin a nivel del DNA, con lo que se obvia el efecto
ambiental.

4.2. Clases de marcadores existentes

Un marcador es considerado como un carcter cuyo patrn de herencia puede definirse


en un nivel morfolgico o fenotpico, bioqumico o molecular. Se le utiliza para
obtener, aunque de manera indirecta, informacin con respecto de las bases genticas
de los caracteres o rasgos de inters en el organismo sujeto a estudio. Strictu sensu, se
asocian marcadores con caracteres.

Las investigaciones iniciales de la herencia de caracteres se condujeron en funcin de


caracteres morfolgicos, los cuales son profundamente afectados por fluctuaciones
ambientales y por las etapas de desarrollo de la planta. En general existe variacin en
los caracteres morfolgicos lo que obliga a analizar un vasto nmero de individuos.
As, surgi la idea de utilizar marcadores genticos para esclarecer la relacin entre un
locus gentico y un carcter determinado.

Los primeros sistemas de marcadores (no fenotpicos) disponibles en plantas fueron


aquellos desarrollados a partir de la electroforesis de polipptidos: isoenzimas o
aloenzimas, y protenas de reserva de semilla.

Marcadores morfolgicos y cariolgicos

Las fluctuaciones ambientales y las etapas de desarrollo de la planta afectan el fenotipo,


debido a que los marcadores morfolgicos son efecto combinado de muchos genes y el
ambiente. Sin embargo, caracteres morfolgicos son los ms antiguos y ampliamente
usados en la gestin de germoplasma y mejoramiento gentico de plantas.

Por otro lado, tambin se utiliza ampliamente caracteres citomorfolgicos, particularmente


el nmero cromosmico. Este carcter se utiliza en cultivos poliploides, donde ha sido un
importante herramienta para la elucidacin de la sistemtica y evolucin. Por ejemplo
cambios en el cariotipo como translocaciones no es posible describir por modelos
alelo/locus. Estos son altamente heredable y polimrficos.

241
Marcadores bioqumicos

Los primeros sistemas de marcadores (no fenotpicos) disponibles en plantas fueron aquellos
desarrollados a partir de la electroforesis de polipptidos: isoenzimas o aloenzimas, y protenas
de reserva de semilla. Se define como isoenzima a las multiples formas moleculares de una
enzima que comparten un sustrato y actividad idntica o muy similar, las cuales presentan un
comportamiento electrofortico distinto (diferentes formas moleculares). Este tipo de enzimas
difieren en su estructura qumica y, en consecuencia, en algunas de sus propiedades, pues se
encuentran codificadas por distintos genes que pueden ubicarse en diferentes loci o por
diferentes alelos en un mismo locus; aquellas isoenzimas que se originan a partir de las
mutaciones en el mismo locus se denominan aleloenzimas o aloenzimas. Se identifican a las
isoezimas como marcadores bioqumicos por su naturaleza protenica, pero pueden
considerarse como marcadores genotpicos si se trabaja bajo condiciones estandarizadas; estos
permiten comprender ciertos procesos genticos (e.g. la transformacin de un gen en otro); la
regulacin de la expresin de genes, el impacto bioqumico de las modificaciones sobre las
rutas metablicas en diferentes tejidos, y la asociacin de la codificacin de un determinado
polipptido con ciertos caracteres fenotpicos. Han sido ampliamente usadas en la
caracterizacin de germoplasma, en el estudio de la variacin protenica e isoenzimtica, en la
evalucin de la variacin gentica en poblaciones; y en la filogenia entre las especies.

Si bien los estudios isoenzimticos han sido tiles en el anlisis molecular vegetal, existen
varias restricciones con respecto de su uso: el escrutinio de un nmero limitado de loci;
imposibilidad de establecer con acuciosidad la variacin cuantitativa de un locus determinado;
y la existencia de una alta especificidad de los datos obtenidos en cuanto a tejido y etapa de
desarrollo de la planta.

Marcadores moleculares

Las tecnologas de anlisis molecular de la variabilidad a nivel de DNA permiten


determinar puntos de referencia en los cromosomas, tcnicamente denominados
marcadores moleculares (MM). Los marcadores moleculares o marcadores del DNA se
entienden como regiones o segmentos del DNA cuya funcin codificadora
generalmente se desconoce, pudindose ubicar en las inmediaciones de un gen y
determinar un carcter de inters agronmico que pueda evaluarse en cruzas genticas.
Al asociar un marcador con un determinado locus es posible verificar con gran precisin
la segregacin de los alelos que se ubican en tal locus.

La distribucin uniforme de estos marcadores a todo lo largo del genoma ha permitido


su uso en estimaciones de la contribucin gentica de cada progenitor a cada miembro
de una poblacin segregante. De tal manera, ha sido posible emplear los polimorfismos
de secuencia entre individuos para el mapa gentico. Consecuentemente, se han
transformado de manera radical el estudio y la prctica de la gentica.

En general, las ventajas relativas de los marcadores moleculares sobre los marcadores
morfolgicos para la mayora de las aplicaciones genticas y de mejoramiento son:

1. La mayora de los marcadores morfolgicos slo pueden evaluarse en el nivel


del conjunto de la planta (frecuentemente, en fase de maduracin). En cambio,
con los marcadores moleculares slo se necesitan muestras celulares o tisulares
para el anlisis de los genotipos.

242
2. Con marcadores morfolgicos es posible verificar alelos mediante la induccin o
aplicacin de mutgenos exgenos. Para la mayora de las especies vegetales,
diversos alelos que aparecen de manera natural pueden identificarse en la
mayora de los loci marcados molecularmente.
3. Usualmente no existe asociacin alguna de efectos dainos con alelos de
marcadores moleculares. Tal no acontece con los marcadores morfolgicos, los
cuales estn acompaados de efectos fenotpicos indeseados.
4. Las interacciones de dominancia-recesividad entre alelos, impiden con
regularidad discernir todos los genotipos asociados con los caracteres
morfolgicos. Los alelos en la casi totalidad de los loci marcados
molecularmente se comportan de una manera codominante, lo que permite
identificar todos los posibles genotipos en cualquier generacin en segregacin.
5. En cuanto a los marcadores morfolgicos, las interacciones epistticas
desfavorables a menudo aparecen entre los alelos que codifican para los
caracteres marcados morfolgicamente y limitan en gran medida el nmero de
marcadores en segregacin que pueden monitorearse en una sola poblacin. La
amplia mayora de los marcadores moleculares parecen estar libres de efectos
epistticos; por lo tanto, el nmero de loci a evaluar en una sola poblacin es
tericamente ilimitado.

Requerimientos de los marcadores para las aplicaciones en fitomejoramiento. Los


parmetros a considerar para la evaluacin y eleccin del marcador molecular ms
apropiado para la investigacin y manipulacin de caracteres cuantitativos, son:

Base molecular. Los eventos moleculares responsables de los polimorfismos


observados son considerados como la base molecular. La simplicidad o
complejidad de la modificacin de sta se encuentra en funcin de los cambios
en el nivel de la secuencia de nucletidos y del nmero de eventos moleculares.
Polimorfismo. Los marcadores tiles e informativos son aquellos marcadores
que registran el mayor nmero de alelos por locus.
Distribucin genmica. El sistema de marcadores deber detectar el mayor
nmero de loci o de grupos de ligamiento a todo lo largo del genoma.
Mapa. La asociacin y segregacin de dos (o ms) marcadores permite la
construccin de un mapa de ligamiento.
Estabilidad ambiental y experimental. Las fluctuaciones ambientales no
afectan tericamente el anlisis de marcadores moleculares de manera
significativa. La estabilidad experimental y reproducibilidad son
fundamentales para contar con la plena certeza de que las diferencias
observadas son en realidad genticas.
Factibilidad. El anlisis sobre un gran nmero de individuos o lneas requiere
que los mtodos de marcadores moleculares sean rpidos, eficaces y lo menos
costoso posible.

La utilidad relativa y las limitaciones de las diferentes tcnicas de marcadores


moleculares en el fitomejoramiento, mapeo gentico, mapeo comparativa, anlisis de
la diversidad vegetal, estudios de evolucin vegetal, caracterizacin de genealoga o
clonacin de genes, depender del nmero de marcadores disponibles, la
disponibilidad de equipo e instalaciones, las restricciones de los recursos econmicos; y

243
del sistema biolgico a estudiar, la naturaleza del (los) carcter(es), el tipo de poblacin
a generar, el nmero de individuos a examinar, el tipo de segregacin a analizar, etc.

La metodologa de una gran cantidad de marcadores moleculares, utiliza la reaccin


en cadena de la polimerasa (Polymerase Chain Reaction-PCR, en ingls). Para
comprender la naturaleza de los anlisis actuales con tales marcadores, es de
importancia revisar el concepto terico y ciertas consideraciones tcnicas de la PCR,
herramienta que ha significado una revolucin en la manera de concebir a la biologa y
la gentica molecular.

El desarrollo tecnolgico en el rea de MM ha sido extremadamente rpido. La tecnologa


de DNA recombinante y la amplificacin de segmentos de DNA via PCR, abrieron el
camino del cambio en el paradigma gentico bsico: de la inferencia del genotipo a partir
del fenotipo, donde Mendel fue el pionero, para el anlisis gentico directo de la variacin
en la secuencia de DNA. Este cambio de enfoque de la gentica directa1 a la gentica
inversa2 es la transicin de la gentica mendeliana para la gentica genmica. Las
tecnologas de anlisis molecular ms eficientes y accesibles son constantemente puestas
en marcha. Tambien se desarrollan mtodos de anlisis estadstico que permiten manipular
enormes cantidades de datos. La mejora aportada por los marcadores de DNA ha sido
crucial para que se conviertan en una herramienta muy potente para el anlisis gentico y
sus aplicaciones.

Marcadores genticos

Los caracteres que se han utilizado para observar y detectar la variabilidad presente en los
seres vivos son numerosos. Los marcadores genticos son una clase de estos; y con ellos se
espera que reflejen la variabilidad debida principalmente a los genes.

Nosotros tomaremos el trmino marcador en el sentido gentico, es decir un marcador ser


siempre sinnimo de un locus marcador. Un locus marcador es un locus polimrfico que
informa:

Sobre el genotipo del individuo que lo porta; gracias a esto los marcadores son
utilizados en genetica de las poblaciones.
Sobre el genotipo de un locus vecino (os); las aplicaciones aqui van de clonacin
posicional a la seleccin asistida.

Los marcadores genticos mas corrientes son los morfolgicos, moleculares (a nivel de
DNA) y bioqumicos (isoenzimas, proteinas). Este ultimo trmino, lamentablemente es
ambiguo, ya que en otros contextos es designado como molcula, donde su presencia
indica un estado de diferenciacion o un estado fisiolgico. Entonces, un marcador es
considerado como un carcter cuyo patrn de herencia puede definirse en un nivel
morfolgico, bioqumico o molecular.

1
Gentica directa: El punto de partida es el carcter y el de destino el gen, el objetivo es identificar el gen
que lo codifica.
2
Gentica inversa: Se trata de ir del gen al fenotipo, es decir mutar una secuencia conocida, observar el
fenotipo alterado que debe dar pistas sobre su funcin.

244
Se le utiliza para obtener, aunque de manera indirecta, informacin con respecto de las
bases genticas de otros caracteres o rasgos de inters en los organismos sujetos a estudios.
Se asocian marcadores con caracteres, para esclarecer la probabilidad de relacin entre un
locus genticos y un carcter determinado.

Caractersticas principales de un marcador gentico

Un marcador gentico ideal es:

Polimrfico (idealmente alto polimorfismo).


Codominantes (el heterocigota presenta simultaneamente los caracteres de los
parentales homocigotas, entonces puede ser diferenciado de los homocigotas
parentales); es decir hay ausencia de interaccin intralocus.
No espistticos (su genotipo puede ser leido a partir de su fenotipo, al margen de
cualquiera sea el genotipo de otros locus); es decir hay ausencia de interaccion
interlocus.
Neutro, las sustituciones allicas o locus marcador no tienen otros efectos fenotpicos
que aquello que permite de determinar su genotipo.
Insensible al medio ambiente, su expresin fenotpica no es afectado por variabilidad
ambiental o interaccin genotipo-ambiente, es decir el genotipo puede ser inferido a
apartir del fenotipo cualquiera sea el ambiente (alta heredabilidad).
Reproducibles.
Herencia simple, idealmente son genes mendelianos simples con alelos codominantes.
Facilidad de evaluacin.
Deteccin en las primeras etapas de ciclo de vida (embrional).
Ensayos baratos y manejables a gran escala.
Inocuos para el hombre e idealmente para todos los organismos.

Los marcadores morfolgicos responden mal a la mayora de estos criterios, poco


polimorfismo, en general dominantes, ellos interaccionan frecuentemente con otros
caracteres, y pueden ser influenciados por el medio.

Por el contrario los marcadores bioqumicos y moleculares tienen, en la mayora de los


casos las propiedades sealadas. Las limitaciones mayores de los isoenzimas son el bajo
nmero de locus suceptible de ser revelados (raramente mas de 30 a 40 locus en arroz,
maiz, y todos no son siempre polimrficos), hay una cierta especificidad de rganos, todas
las enzimas no estn presentes o activas en todos los rganos. Por el contrario, los
marcadores al nivel de DNA son en nmero casi ilimitado y son independientes del estado
o del rgano analizado, ya que el DNA es siempre el mismo en todos los tejidos. Ademas,
ellos tienen la ventaja de ser mas directamente utilisables para las aplicaciones posteriores
en biologa molecular.7

Interpretacin gentica

El resultado observable del desarrollo de cualquier tipo de marcadores es un patrn de


bandas o de picos cuando se obtiene con secuenciadores automticos. Cada banda
corresponde a la posicin de un fragmento de DNA separado previamente en funcin de su
tamao por medio de la electroforesis en una matriz porosa, habitualmente un gel de

245
agarosa o acrilamida. La hiptesis de partida es que cada banda corresponde a un alelo de
un locus determinado. Si el marcador estudiado es codominante, cada individuo
heterocigoto tiene otro alelo situado en otra posicin del gel, es decir, correspondiente
generalmente a un fragmento de DNA con un nmero de bases distinto. Si el marcador es
dominante, solamente existen dos fenotipos: el que presenta una banda y el que no la tiene.
La presencia de banda es lgicamente dominante sobre su ausencia.

La interpretacin gentica de estos patrones de bandas requiere el estudio de su


segregacin en una o varias poblaciones. Aunque pueden realizarse algunas inferencias
genticas a partir del anlisis de una muestra de individuos no relacionados, sta es
siempre incompleta y provisional. Los estudio de herencia son siempre ms simples
cuando el nmero de loci detectados por sonda (en este caso de los RFLPs o derivados de
la reaccin PCR) es de uno o dos loci. La interpretacin suele complicarse cuando aumenta
el nmero de bandas de un patrn determinado porque, aunque algunos loci puedan ser
codominantes, es muy difcil identificar con certeza los alelos y distinguirlos de los otros
loci, particularmente de los que estn ligados entre s. Por ello, es preferible optar en estos
casos por un anlisis de presencia o ausencia de banda, que a veces, despus del anlisis
del ligamiento puede permitir la deteccin de marcadores de herencia codominante.

Aspecto importante al momento de elegir un marcador son: el objetivo del estudio y la


disponibilidad tcnica y financiera del laboratorio. Es necesario saber muy bien el objetivo
que se quiere alcanzar y el perodo del tiempo disponible para lograrlo.

4.3. Reaccin en Cadena de la Polimerasa (PCR, )

Los componentes de amplificacin para la reaccin PCR

Los componentes de la reaccin de PCR son (Figura 4.5):

a. Dos iniciadores sintticos, que son regiones complementarias a las cadenas opuestas que
flanquean a la regin de DNA blanco que se desea amplificar.
b. Una secuencia blanco en una muestra de DNA que este entre el par de primers, la cual
puede ser de 100 a 5 000 pares de bases.
c. Una enzima, la DNA Polimerasa termoestable que pueda resistir altas temperaturas de
calentamiento (95C a ms).
d. Los cuatro deoxiribonucletidos (dNTPs).
e. Un buffer para darle las condiciones adecuadas al sistema en conjunto.

246
DNA blanco

Iniciadores

Nucletidos A G C T

Polimerasa

Figura 4.5. Componentes bsicos para la reaccin PCR.

Fundamento terico

La reaccin en cadena de la polimerasa es una reaccin cclica dirigida


enzimticamente que permite la amplificacin in vitro de una regin del cido
desoxirribonuclico (DNA), localizada entre dos regiones de secuencia conocida.
Utiliza dos oligonucletidos que funcionan como "iniciadores", que se hibridan a las
cadenas opuestas de DNA de secuencia complementaria, flanqueando a la secuencia de
inters. Los iniciadores, toman diferentes denominaciones, tales como oligonucletidos,
cebadores, primadores, amplmeros, detonadores o primers. Los iniciadores son
molculas de DNA de cadena individual y longitud corta (10-30 nucletidos), se
hibridan complementariamente a las partes terminales o flancos de una secuencia
especfica de la cadena sencilla del DNA patrn, se efecta la amplificacin (extensin)
por la DNA polimerasa, la enzima que cataliza la sntesis de cadenas largas de
polinucletidos. La sntesis se dirige incorporando monmeros de trifosfato de
desoxinuclesido al grupo libre 3'-hidroxilo del iniciador en direccin 5'>3', la
polimerizacin se efecta siempre del -fosfato 5' del trifosfato de desoxinuclesido
al grupo hidroxilo terminal 3' de la cadena creciente de DNA. Esto resulta en la
sntesis de nuevas cadenas de DNA complementarias a las cadenas patrn iniciales
(Figura 4.5).

En cada ciclo de amplificacin, las cadenas de DNA sintetizadas se convierten en un


patrn (o substrato) para cualquier nuevo ciclo; idealmente, la secuencia de DNA
"objetivo" o DNA blanco se amplificar de manera selectiva ciclo tras ciclo.

Tericamente, los productos de amplificacin (amplicones) del primer ciclo seran


el resultado de la sntesis de DNA del patrn original, de longitud indefinida. La
polimerasa del DNA sintetizara nuevas molculas (a partir de tales moldes o
patrones) hasta que fuese interrumpida por el inicio del siguiente ciclo. A partir del
tercer ciclo, los productos de amplificacin poseeran una longitud definida, pues
nicamente se sintetizan los fragmentos de la secuencia "objetivo", cuya longitud
correspondiera a las posiciones de alineamiento (anillamiento, ensamblaje) de los
iniciadores con el patrn original. En lo consecutivo, la secuencia "objetivo" se
amplificar exponencialmente. Concretamente la amplificacin entendida como el
nmero final de copias de la secuencia "objetivo", se expresa por la frmula:

247
(2n -2n) x x (2n)

Donde:
n = nmero de ciclos
2n = primer producto obtenido despus del ciclo 1, y productos
obtenidos despus del ciclo 2
2n = productos amplificados que contienen la secuencia objetivo y
salientes en los extremos (no corresponden exactamente a la region
objetivo)
x = nmero de copias del patrn original.

Parmetros de la PCR

La PCR es un evento bioqumico relativamente complicado, donde las cambiantes


interacciones cinticas entre los componentes determina la calidad de los productos a
obtener.17 A pesar de ser extremadamente eficaz, la amplificacin exponencial de los
amplicones no es un proceso infinito. Un gran nmero de factores actan en contra del
proceso, siendo pronunciado su efecto en ciclos posteriores de la PCR.

Ciclos trmicos

Los parmetros de los ciclos de temperatura son considerablemente importantes para


una PCR ptima. Los pasos ms importantes en los perfiles del tiempo y temperatura a
considerar, son:

Etapas del ciclo de amplificacin

Un proceso tpico de PCR, requiere de un nmero de ciclos para amplificar una secuencia
de DNA, cada ciclo tiene generalmente tres pasos :

Desnaturalizacin. La temperatura entre 90-96 C provoca una desnaturalizacin


completa del DNA genmico para permitir el ensamblaje posterior de los iniciadores.
El dao trmico del DNA conduce a un ndice creciente de mala incorporacin de los
nucletidos, por lo que debe evitarse manejar temperaturas muy altas, y/o
desnaturalizar por perodos prolongados. Limitar la exposicin ayuda tambin a
mantener la actividad mxima de la polimerasa. Sin embargo, existen molculas de
DNA de grandes proporciones o desmedidamente complejas (como plsmidos de DNA
superenrrollado) que son ms difciles de desnaturalizar y que requieren mayor energa
trmica, por lo que se sugiere la inmersin de los tubos de reaccin en agua hirviendo
por algunos minutos o un hot Start (predesnaturalizacin). Por el contrario, el
calentamiento insuficiente deviene en un completo fracaso de la PCR. Tpicamente la
temperatura de desnaturalizacin es entre 92 y 94 C.

Ensamblaje. Perodo trmico que define el ensamblaje (alineamiento, anillamiento,


anclaje) o hibridacin de los iniciadores a la secuencia complementaria; tpicamente,
entre 36 y 70 C. Se calcula en funcin de la longitud y contenido de guanina y citosina
de los iniciadores.

248
Extensin. La extensin, propiamente la amplificacin o polimerizacin, se efecta
generalmente a 70-85 C, temperatura ptima de actividad para las polimerasas
termoestables. La duracin de los pasos de extensin puede incrementarse si se
polimerizan amplicones de gran longitud, aun cuando la mayor parte de los tiempos de
PCR se restringen a 2 minutos (1 minuto/1000 pb de secuencia "objetivo" o substrato).
A menudo, el tiempo de extensin del ciclo final es mayor (hasta 10 minutos) con la
finalidad de asegurar la total extensin de las molculas. La temperatura de extensin
ptima en los PCR es 72 C, donde la Taq polimerasa tiene su mayor actividad
cataltica.

Nmero de ciclos. Usualmente son 25 a 35. El aumento en el nmero de ciclos


ocasiona un incremento en el nmero de productos no deseados, sin impacto alguno
en el rendimiento del producto de eleccin. As, es poco comn encontrar
protocolos experimentales con ms de 40 ciclos.

Tiempos de declive. Son perodos en los que se realizan los cambios de una
temperatura a la siguiente dentro del termociclador.

DNA patrn

Estas secuencias pueden ser DNA genmico, DNA clonado (a partir de clones
individuales o bancos genmicos: lambda, csmidos o vectores BAC o YAC), y/o
bancos de cDNA (derivado de RNA total, RNA poli(A)+ RNAm). Secuencias patrn,
tambin son conocidos como DNA sustrato, blanco, objetivo o molde.

La muestra de PCR puede ser de una o dos cadenas de DNA o RNA, no siendo
generalmente el tamao del DNA un factor fundamental. De utilizarse DNA genmico
de alto peso molecular, se mejora la amplificacin si se digiere previamente con
enzimas de restriccin. De no conocerse la concentracin de la secuencia "objetivo", se
recomienda optimizar la reaccin con controles positivos de ADN; normalmente, se
utilizan subnanogramos de un patrn clonado y submicrogramos de ADN genmico.

Potencialmente, la PCR puede realizar la amplificacin de una sola molcula de DNA


en grandes nmeros, es factible amplificar una secuencia a partir de cantidades del
orden de picogramos, por lo que debe extremarse el cuidado en el manejo de reactivos
y muestras, as como reducir al mnimo cualquier posibilidad de contaminacin.

Concentracin de enzimas

La introduccin de las polimerasas termoestables del DNA posibilit la automatizacin


de la PCR, pues slo se incorporan al inicio del proceso de amplificacin. La primera
polimerasa del DNA termoestable utilizada fue la Taq polimerasa.

Los resultados obtenidos, en trminos de amplificaciones de alto rendimiento, de uno o


varios fragmentos, o de fragmentos de gran longitud reportan el uso de cantidades
considerables de la enzima (1-4 U/100 l). Utilizar mayores cantidades puede resultar
en la produccin de productos no especficos y/o en la reduccin del rendimiento del
amplicn "objetivo". La concentracin tpica de la enzima usada es de 2U/100 l de
volumen de reaccin.20 Normalmente, la cantidad de la enzima se torna limitante luego
de 25 a 30 ciclos de PCR, debido a un exceso molar de la secuencia "objetivo".

249
Para el desarrollo de la reaccin, la enzima polimerasa del DNA requiere mnimo 1 mM
de magnesio libre, lo que significa que las concentraciones de magnesio debern ser 1
mM mayores que la concentracin total de los dNTPs (ya que secuestran magnesio).
Esto es, la cantidad de Mg2+ libre disponible para la polimerasa Taq del DNA resulta de
la sustraccin de la concentracin total de dNTPs de la concentracin total de MgCl2.

La concentracin de MgCl2 tiene un efecto fuerte sobre la especificidad y rendimiento


de la PCR. La concentracin ptima de MgCl 2 en la mezcla final de reaccin puede
variar dentro del intervalo de 1.0- 2 mM, pero en ciertas ocasiones se ensayan diferentes
concentraciones de Mg2+ (considerando una cantidad individual de dNTP del orden de
200 uM). Los iones Mg2+ estimulan la actividad de la polimerasa e incrementan la
temperatura de fusin (Tm) del DNA de doble hlice, as como la interaccin
iniciador/secuencia patrn. La concentracin insuficiente de Mg2+ deviene en bajos
rendimientos; en tanto que el exceso, en la acumulacin de productos no especficos e
inhibicin de la actividad de la enzima.

Iniciadores

a. Diseo

Para el diseo y seleccin de iniciadores de PCR se deben considerar los siguientes


parmetros esenciales:

a. La hibridacin estable de un iniciador con el sitio especfico en la regin


"objetivo" del DNA patrn o substrato para el cual fue diseado,
b. la estabilidad interna del iniciador,
c. la ausencia de complementaridad interna en el iniciador,
d. la ausencia de complementaridad con otro iniciador,
e. contenido de G + C entre 40-60 %,
f. no deben ser palindrmicos.

La estabilidad del iniciador puede medirse por la longitud (en pares de bases) del duplo
DNA-iniciador, el cociente GC/AT, la energa libre del duplo (kcal/mol), o por la
temperatura de fusin (en C). Para realizar con exactitud los clculos, se deben
considerar varios parmetros termodinmicos, cuestin que se facilita con el uso de
programas computacionales. stos permiten calcular la estabilidad del dplex DNA-
iniciador, la composicin y porcentaje de desoxinucletidos; analizar las posibles
interacciones del par ms cercano, las regiones de complementariedad del DNA, los
sitios de formacin de dmeros de iniciador, o la longitud de amplicones; adems de
contemplar cuestiones como la estructura secundaria, la formacin de palndromas, etc.
En general, los iniciadores utilizados en la PCR constan de 10 a 30 nucletidos de
longitud, lo que permite utilizar altas temperaturas de ensamblaje e incrementar la
especificidad de la reaccin. Cuanto menor sea la longitud de los iniciadores, menor
ser la especificidad de hibridacin con la secuencia patrn. De ser posible, los
iniciadores deben elaborarse con un nmero aproximadamente igual de cada una de las
cuatro bases, evitando regiones de secuencia anormal; i.e. tramos de polipurinas,
polipirimidinas, o patrones de repeticin; y secuencias con estructura secundaria.

250
b. Estabilidad interna

Los iniciadores que mejor desempeo exhiben en la PCR y en la secuenciacin del DNA
son aquellos que son estables en la extremidad 5' y relativamente inestables en la 3'. Un
iniciador con baja estabilidad en el extremo 3' funcionar bien en la PCR porque el
alineamiento de esa zona con sitios no especficos no es lo suficientemente estable
como para que se inicie la polimerizacin. Por ende, el extremo 5' y la parte central del
iniciador debern formar un duplo con el sitio "objetivo" del DNA para lograr un
ensamblaje eficiente. En contraposicin, la polimerizacin de los oligonucletidos con
extremos 3' de alto contenido de GC, resulta (en muchas ocasiones) en amplicones no
especficos: el ensamblaje se realiza slo por esas zonas y no por la totalidad del
iniciador, pudindose efectuar la PCR con regiones que no sean iguales a la secuencia
"objetivo".

Los iniciadores no deben tener nter o intra complementariedad con las extremidades 3',
pues se reducen considerablemente las posibilidades de formacin de dmeros de
iniciador (primer dimers). stos son el resultado de un evento de amplificacin cuando
se elonga un iniciador sobre el otro (o a s mismo), sea por aproximacin de las
porciones 3' de los iniciadores, complementariedad de secuencia y/o ventaja cintica.

c. Temperatura de fusin (melting temperature, Tm)

La Tm puede calcularse para un iniciador empleando algunas ecuaciones, siendo


indicado para cada reaccin de amplificacin considerar a los iniciadores como un par,
donde cada uno posee una Tm similar; o bien, puede determinarse la Tm de acuerdo con
valores termodinmicos de energa libre entre combinaciones sucesivas de los
nucletidos. La frmula ms ampliamente usada es:

Tm = [(nmero de A+T) (2 C) + (nmero de G+C) (4 C)]

Originalmente calculada en una concentracin salina 1M para pruebas de hibridacin


de oligonucletidos. Sin embargo, es inexacta con iniciadores mayores de 20
nucletidos (nt) y requiere de correcciones para la concentracin salina.

d. Clculo de la concentracin

Las concentraciones ptimas de los iniciadores varan en gran medida segn las
secuencias de los iniciadores, de la complejidad de la secuencia "objetivo" en la muestra de
DNA, y del nmero de DNAs "objetivo" presentes en la muestra. Para la mayor part e de
las secuencias "objetivo" genmicas, la concentracin del iniciador debe ubicarse en el
intervalo de 0.1-1.0 M para obtener mejores resultados. La relacin entre las altas
concentraciones de los iniciadores con respecto de las bajas concentraciones de las cadenas
producto supone una ventaja cintica al equilibrio, las ltimas podran rehibridarse unas
con otras y desplazar a los iniciadores. Tal ventaja puede perderse si, en el preciso instante
posterior a la hibridacin de los iniciadores, no existe suficiente enzima.

251
El coeficiente de extincin molar es equivalente a la densidad ptica a 260 nm (A260) de una
solucin 1M de un iniciador. La densidad ptica de una solucin del iniciador, entonces, se
mide a 260 nm (si el iniciador no est purificado, se diluye 50 veces). Dividiendo la A 260
de la solucin stock del iniciador entre el coeficiente de extincin molar, se obtendr la
concentracin molar del iniciador. Los iniciadores pueden ser diluidos a concentraciones
variables (2,5-20 M) para una "solucin de trabajo", segn las necesidades.

e. Marcaje

Los productos de la PCR pueden marcarse va los iniciadores utilizados durante o despus
de la amplificacin:

Marcaje enzimtico con 32P por incubacin con [-32] ATP y por la cinasa del
polinucletido T4. El producto puede detectarse fcilmente y usarse despus en
secuenciacin directa, en "footprinting" o en el anlisis del polimorfismo de
conformacin de una cadena (single-strand conformation polymorphism, SSCP).
Bionitilacin con fosforamiditas de biotina en sus porciones 5'. La deteccin y
cuantificacin de los amplicones se efecta por captura con avidina o
estreptoavidina, seguida de una desnaturalizacin para su uso en secuenciacin de
cadenas sencillas.
Adicin de grupos fluorescentes. Por el marcaje en diferentes sitios sobre un par
especfico de iniciadores, es posible detectar las secuencias "objetivo" en una sola
reaccin de PCR y utilizarles como sondas para RFLP. La fluorescena es
aadida directamente al iniciador durante la sntesis usando fosforamidita de
fluorescena. Otros tintes fluorescentes (como los esteres activos) se unen
qumicamente al iniciador despus de la sntesis va un grupo 5'-amino.
Quimioluminiscencia. Tcnica altamente sensible, se compone de los siguientes
pasos: marcaje de los trifosfatos de nuclesidos con digoxigenina (esferoide
proveniente de Digitalis, spp.), deteccin con un conjugado anticuerpo-enzima
(antidigoxgenina-fosfatasa alcalina), deteccin mediante un substrato
quimioluminiscente (AMPD, CSPD o Lumi-Phos), y exposicin a una pelcula de
rayos X.

Trifosfatos de desoxinuclesidos (dNTPs)

De cada uno de los dNT'P, se requiere una concentracin de 50-200 M para sintetizar
6.5-25 ng/l de DNA, respectivamente. Una concentracin mayor tendera a
promover la incorporacin errnea por la polimerasa del DNA. Pueden manejarse
soluciones ya sea individualmente o en mezcla de los cuatro dNTPs. Normalmente, se
encuentran a un pH de 7.5 por NaOH. La concentracin ptima de los dNTPs determina:

La concentracin de MgCl2 y de la enzima (puesto que los dNTPs forman un


complejo soluble con los iones Mg2+, esencial para la incorporacin de nucletidos al
amplicn),
la longitud del producto amplificado, y
el nmero de ciclos de PCR.

252
Promotores e inhibidores de la PCR
Diferentes substancias inhiben o promueven la PCR, dependiendo de la naturaleza de los
especmenes biolgicos nativos, y de los mtodos y reactivos usados para la extraccin del
DNA. Los especmenes biolgicos usados en la PCR a considerar engloban tejidos
animales, muestras bacterianas, material forense y arqueolgico, y tejido vegetal.

Deben usarse con precision y cuidado a los detergentes inicos (p.e., dodecilsulfato de
sodio, SDS) en los mtodos de extraccin de DNA, pues es muy probable que inhiban los
efectos de la enzima polimerasa. Las trazas de solventes tales como el fenol, cuando
utilizado en la purificacin del DNA, deben removerse por extraccin por
cloroformo:alcohol iso-amlico (49:1) o por precipitacin etanlica. En adicin, es
recomendable evitar el uso de la proteinasa K, pues es una proteasa que digiere protenas
desnaturalizadas, y podra afectar a la polimerasa del DNA. En el caso de que se efecte
una RT-PCR, es fundamental remover la totalidad de DNA; viceversa, la presencia de
RNA puede interferir en las PCR donde se use DNA como substrato.

Aparatos
Hasta el momento, dos mtodos rigen la automatizacin de la PCR:

Termocicladores. Diversos diseos tecnolgicos se han elaborado para los


instrumentos de ciclaje trmico, manufacturados por diversas compaas
comerciales, con paquetes de programacin fciles de usar y con controles trmicos
confiables:

i. Calentamiento y enfriamiento por fludos.


ii. Calentamiento por resistencia elctrica y enfriamiento por
semiconductores.
iii. Calentamiento por luz de superficies de metal y enfriamiento por aire.
iv. Calentamiento por resistencia elctrica y enfriamiento por fluido o
circulacin de refrigerante.

El termociclador es un tipo de termopar, es decir, un aparato trmico en el que el calor


se absorbe en la unin de dos metales dismiles caliente y se expulsa por otra fra,
siendo la diferencia trmica convertida en energa elctrica y viceversa (i.e. procesos de
calentamiento y enfriamiento); con la particularidad de contar con programacin
electrnica que permite regular la temperatura y el tiempo de los ciclos requeridos para
una PCR.

Una delgada capa de aceite mineral (o, aceite, silicn o gemas de cera), sobrepuesta a la
mezcla de PCR, es necesaria para prevenir la evaporacin de sta, antes de colocar los
tubos de reaccin en aquellos termocicladores que no calienten la tapa del tubo de
reaccin.

Robot. Instrumentacin que requiere de programas computacionales y de unidades


mecnicas, la rebtica se utiliza para definir las cantidades precisas de cada uno de
los reactivos, controlar el brazo mecnico que distribuye los reactivos, y transferir
las muestras a diferentes bloques trmicos. La automatizacin de la PCR permite el
anlisis rpido de grandes nmeros de muestras (del orden de miles) en un corto
tiempo, en condiciones estndar, libre de errores humanos, en lo relativo al manejo
y pipeteo de los reactivos.

253
En efecto, la PCR ha significado una revolucin conceptual y experimental de impacto
en mltiples disciplinas. Las innovaciones en tecnologa y reactivos utilizados en la
PCR continan avanzando de manera tal que, seguramente, en el futuro cercano se
contar con nuevos mtodos de anlisis y diagnstico que permitirn acelerar la
generacin de conocimientos biolgicos, qumicos, termodinmicos y genticos.

5 - Secuencia objetivo CGTCAATGGT -3


3- Newly Made DNASecuencia objetivo
ATTCCAGAGC -5 Fragmento de DNA para la amplificacin

5 - Secuencia objetivo CGTCAATGGT -3


Denaturacin (94C)

3- Newly Made DNASecuencia objetivo


ATTCCAGAGC -5

5 - Secuencia objetivo CGTCAATGGT -3 Primer ciclo


3- GCAGTTACCA -5
Anclaje de iniciadores de PCR
TAAGGTCTCG
(40-60C)
5 - -3
3- Newly Made DNASecuencia objetivo
ATTCCAGAGC
-5

5 - Secuencia objetivo CGTCAATGGT -3


3- GCAGTTACCA -5 Polimerizacin (72C)

TAAGGTCTCG
5 - -3
3- Newly Made DNASecuencia objetivo
ATTCCAGAGC
-5

Segundo
ciclo de
PCR

2 Fragmentos
4 Fragmentos

Figura 4.6. Proceso de la reaccin PCR.

4.4. Enzimas de restriccin

Es necesario recordar, que antes de 1970, no exista ningn mtodo para cortar una
molcula bicaternaria de DNA en fragmentos discontinuos, lo cual limita la bioqumica del
DNA. Cuando se descubri que en la restriccin intervienen endonucleasas especficas, se
hizo evidente que los fenmenos relacionados de la restriccin y la modificacin podan
conducir a una solucin del problema. El organismo favorito de los bilogos moleculares,
E. coli K12, fue el primero que se estudi en este sentido, pero la eleccin result
desafortunada. Su endonucleasa tiene un comportamiento demasiado complicado. Por fin,
en 1970 se produjo un avance inesperado con el descubrimiento en Haemophilus
influenzae de una enzima que tiene un comportamiento ms sencillo. En la actualidad, la
tecnologa del DNA depende totalmente de nuestra capacidad para cortar molculas de
DNA por puntos especficos con endonucleasas de restriccin.

254
Las enzimas de restriccin son de origen bacteriano. Ellas tienen la particularidad de cortar
las moleculas de DNA bicatenario (o llamado tambin doble hebra) en los sitios
especficos de la secuencia: son las endonucleasas. Cada enzima de restriccin reconoce y
corta una secuencia nucleotidica dada. El nombre de las enzimas de restriccin provienen
del nombre, del gnero y de la especie de la bacteria de la que fueron aisladas.

Existe tres tipos de enzimas de restriccin. Los tipos I y III son proteinas complejas que
cortan el DNA de doble hebra fuera de los sitios de reconocimiento. Las enzimas de
restriccin de tipo II son las herramientas indispensables en ingeniera gentica. Ellas
reconocen una secuencia especfica de 4, 6, 8 o 10 pb y cortan al interior de esta secuencia,
llamada sitio de restriccion. Una particularidad de estos sitios es que ellos son
palindrmicos, es decir que tienen la misma secuencia sobre las dos hebras, pero en sentido
inversa.

Hay numerosas enzimas de restriccin disponibles en el comercio. Ellas son generalmente


proporcionadas con su tampn de reaccin y la temperatura ptima de funcionamiento
(indicada en los catlogos de los productos). Es posible digerir un mismo fragmento de
DNA por dos enzimas de restriccin diferentes. Si ellas funcionan en las condiciones
anlogas (concentracin en sal, pH, temperatura), las dos digestiones se desarrollan
simultaneamente. Sino, el fragmento de DNA debe ser digerido por las dos enzimas
sucesivamente, cambiando entre cada reaccin enzimtica las condiciones de reaccin. Las
enzimas de restriccin utilizadas cortan las secuencias de dos modos:

Cortada franca: se obtienen las extremidades francas por la cortada en el mismo


sitio en las dos hebras. Ejemplo : La enzima Hae III aislada de Haemophilus
aegyptius corta el DNA de doble hebra en la secuencia GC/CC.
Cortada desfazada: Se generan extremidades monocatenarias (simple hebra) que
presentan secuencias complementarias llamadas extremidades cohesivas o
terminales colantes. Ejemplos: La enzima de restriccin EcoRI aislada de la
bacteria Escherichia coli corta el ADN de doble hebra en la secuencia
palindrmica G/AATTC; y la enzima de restriccin Pst I aislada de la bacteria
Providencia stuarti corta el ADN de doble hebra en la secuencia palindrmica
CTGCA/G

Nomenclatura

El descubrimiento de un gran nmero de enzimas de restriccin exiga una nomenclatura


uniforme. En gran parte se ha seguido un sistema propuesto por Smith & Nathans.21 Las
propuestas son las siguientes:

1. La especie del organismo receptor se identifica por la primera letra del nombre
genrico y las dos primeras letras del nombre especfico, formndose as una
abreviatura de tres letras en cursiva. Por ejemplo, Escherichia coli = Eco; Hae-
mophilus influenzae = Hin.

2. Cuando una estirpe husped o serotipo (d) tiene varios sistemas diferentes de
restriccin y modificacin, stos se identifican mediante nmeros romanos. As, los
sistemas de la estirpe de H. influenzae seran: Hind I, Hind II, Hind III, etc.; estos
numerales romanos no deberan ser confundidos con los de la clasificacin de las
enzimas de restriccin en tipo I, II, etc.

255
3. Todas las enzimas de restriccin tienen el nombre general de endonucleasas R,
pero adems llevan el nombre del sistema. Por ejemplo: R. Hind IlI. De manera
similar, las enzimas de modificacin se denominan metilasa M seguido por el
nombre del sistema. La enzima de modificacin de H. influenzae Rd correspon-
diente a la endonucleasa R. Hind III sera la metilasa M. Hind III.19 (Roberts et al.,
2005).

Secuencias de corte

Aunque no todas, la inmensa mayora de las endonucleasas de restriccin del tipo II


reconocen y rompen el DNA en secuencias concretas de tetra-, penta-, hexa o
heptanucletidos, que tengan un eje de simetra de rotacin. Estas secuencias se llaman a
veces palindrmicas, por analoga con las palabras que se leen al derecho y al revs. Sin
embargo, este trmino se ha aplicado tambin a secuencias tales como que son
palindrmicas en cada cadena, pero no tienen un eje de simetra de rotacin. Si la
secuencia se modifica por metilacin, de modo que se encuentran residuos de 6-
metiladenina en una o en las dos posiciones, entonces la secuencia es resistente a la
endonucleasa R. EcoRI. La resistencia de la secuencia semimetilada protege al DNA
propio de las bacterias hospedadoras contra el ataque, inmediatamente despus de la
replicacin semiconservativa de la secuencia totalmente metilada, hasta que la metilasa de
modificacin puede de nuevo restaurar las cadenas hijas bicatenarias al estado
totalmente metilado.

Existen adems varios ejemplos conocidos de enzimas de diversos orgenes que reconocen
el mismo objetivo. Se les llama isoesquizmeros. Algunos pares de isoesquizmeros cortan
a la secuencia-diana por puntos diferentes (por ejemplo, SmaI, Xma I). Las enzimas Hpa II
y MspI son isoesquizmeros cuya secuencia-diana es CCGG.

Union de moleculas de DNA

Habiendo descrito los mtodos existentes para cortar molculas de DNA, debemos
considerar los modos con que se pueden unir los fragmentos de DNA, para crear molculas
recombinantes artificiales. Existen en la actualidad tres mtodos para unir fragmentos de
DNA in vitro. El primero de ellos se basa en la capacidad de la DNA-ligasa para unir
covalentemente los extremos cohesivos producidos por ciertas enzimas de restriccin. El
segundo se basa en la capacidad de la DNA-ligasa de E. coli infectada por el fago T4, para
catalizar la formacin de enlaces fosfodister entre fragmentos de extremos romos. El
tercero emplea la enzima desoxinucleotidiltransferasa terminal, para sintetizar colas
homopolimricas de un solo filamentos en los extremos de los fragmentos.

DNA-ligasa

E. coli y el fago T4 producen una enzima, la DNA-ligasa, que sella las roturas (falta de
enlace fosfodiester) existentes entre nucletidos adyacentes en las cadenas sencillas del
DNA bicatenario. Aunque las reacciones catalizadas por las enzimas de E. coli sin infectar

256
y las de E. coli infectado por T4, son muy similares, se diferencian en los cofactores que
necesitan. La enzima de T4 necesita ATP, mientras que la de E. coli necesita NAD+. En
ambos casos, el cofactor se descompone y se forma un complejo enzima-AMPo. El
complejo se adhiere a la parte rota, que debe presentar un grupo 5-fosfato y un 3-OH, y
establece un enlace covalente en la cadena fosfodister.

Adaptadores

Puede suceder que las enzimas de restriccin utilizadas para generar los extremos
cohesivos en el ligador corten el DNA exgeno en posiciones internas. En esta situacin el
DNA exgeno ser donado como dos o tres sub fragmentos. Una solucin de este
problema es escoger otra enzima de restriccin, pero puede no haber una eleccin
adecuada si el DNA exgeno es grande y tiene sitios para varias enzimas de restriccin.
Otra solucin es metilar posiciones internas de restriccin con las metilasas de
modificacin adecuadas. Alternativamente una solucin general al problema es
proporcionada por molculas adaptadoras sintetizadas qumicamente que poseen extremos
cohesivos preformados. Consideremos un DNA exgeno de extremos romos conteniendo
una secuencia interna Bam HI, que va a ser donado en un vector cortado con Bam HI. La
molcula adaptadora Bam tiene un extremo romo que lleva un grupo 5-fosfato y un
extremo Bam cohesivo que no est fosforilado. El adaptador puede ser ligado a los
extremos del DNA exgeno sin riesgo de autopolimerizacin. El DNA exgeno ms los
adaptadores aadidos es posteriormente fosforilado en los extremos 5' y ligado en la
posicin Bam HI del vector. Si el DNA exgeno fuera a ser recuperado de la molcula
recombinante con Bam HI se obtendra en dos fragmentos. Sin embargo, el adaptador est
diseado para contener dos sitios de restriccin ms (Smla I, Hpa II) que puedan permitir
recobrar intacto el DNA exgeno.

4.5. Electroforesis

Es el movimiento de una partcula cargada (ion) en un campo elctrico. El movimiento se


realiza en medio lquido que est sostenida por sustancia slida inerte, como papel o gel
semislido. La separacin de las partculas o fragmentos de DNA depende de su tamao,
es decir fragmentos ms grandes encuentran mayor resistencia en el gel que los pequeos,
de modo que su migracion ser ms lenta, y por el contrario los fragmentos ms pequeos
migrarn rpidamente, separndose de los grandes. En consecuencia, electroforesis es una
tcnica usado para separar y a veces purificar macromolculas especialmente protenas y
cidos nucleicos, que difieren en tamao, carga o conformacin. Como tal, es una de las
tcnicas ms ampliamente utilizadas en bioqumica y biologa molecular. Cuando las
molculas cargadas son colocadas en un campo elctrico, ellas migran hacia los polos, al
positivo (nodo) o al negativo (ctodo) segn sus cargas. En contraste con las protenas,
que pueden tener una carga negativa o positiva neta, los cidos nucleicos tienen una carga
negativa constante impartida por su espina dorsal (el fosfato), y migran hacia el nodo
(Figura 4.7).

257
Pozos para el Migracin de los
cargado de fragmentos del DNA
DNA - Ctodo
amplificado

Fragmento
Gel grande

Fragmento
pequeo

+ nodo
Corriente elctrica

Figura 4.7. Electroforesis en gel de agarosa.

Las protenas y los cidos nucleicos son separados dentro de una matriz o de un "gel". El
gel se prepara de forma rectangular y de espesor fino (aproximadamente 1 cm de espesor),
con los pozos para cargar la muestra. El gel se sumerge dentro de un buffer de
electroforesis que proporciona los iones para llevar una corriente y un cierto tipo de buffer
para mantener el pH en un valor relativamente constante. El gel puede ser de agarosa o del
poliacrilamida, cada uno de los cuales tiene cualidades convenientes para las tareas
particulares.

La agarosa es un polisacrido extrado de alga marina. Se utiliza tpicamente en las


concentraciones de 0.5 a 2 %. Los geles de agarosa son muy fciles de preparar: se mezcla
simplemente el polvo de agarosa con la solucin tampn (buffer), se derrite calentando, y
luego se vierte el gel. Este gel no es txico. Los geles de agarosa tienen un rango grande de
la separacin, pero el poder de resolucin es relativamente baja. Variando la concentracin
de agarosa, los fragmentos del DNA de cerca de 200 a 50000 pb se pueden separar usando
tcnicas electroforeticas estndares.

La poliacrilamida es un polmero reticulado de la acrilamida. La longitud de las cadenas


del polmero es determinada por la concentracin de la acrilamida usada, que est
tpicamente entre 3.5 y el 20 %. Los geles de poliacrilamida son considerablemente ms
tediosos para la preparacion que los geles de agarosa. Como el oxgeno inhibe el proceso
de la polimerizacin, deben ser vertidos entre las placas de cristal o los cilindros.

La acrilamida es una neurotoxina potente y debe ser manipulada con cuidado. Se


recomienda usar guantes descartables al manejar soluciones de la acrilamida, y una
mscara al pesar el polvo. La poliacrilamida se considera como no txico, pero los geles de
poliacrilamida se deben tambin manejar con los guantes debido a la presencia posible de
la acrilamida libre.

258
Los geles de poliacrilamida tienen un rango de separacin algo pequea, pero el poder de
resolucin es muy alto. En el caso de DNA, la poliacrilamida se utiliza para separar
fragmentos menores de 500 pb. Sin embargo, bajo condiciones apropiadas, los fragmentos
de DNA diferenciados en su longitud por un solo pb se resuelven fcilmente. En contraste
con la agarosa, los geles de poliacrilamida se utilizan extensivamente para separar y
caracterizar mezclas de protenas.

4.6. Tcnicas de marcadores moleculares

Diversas tcnicas de biologa molecular estn disponibles para la deteccin de variabilidad


a nivel de secuencias de DNA (polimorfismo gentico). El uso efectivo de marcadores
moleculares aunados a las prcticas tradicionales, permitir logros y avances significativos
en las estrategias de fitomejoramiento, seleccin vegetal, gentica cuantitativa, as como en
estudios de la diversidad gentica.

Fuentes de origen de MM

1. DNA cromosmico (genmico)


DNA codificante
DNA no codificante
DNA altamente repetido
2. DNA extracromosmico
DNA mitocondrial
DNA de cloroplastos

Procedimientos generales en el uso de MM.

1. Extraccin de DNA
2. Generacin de polimorfismo
Enzimas de restriccin
Reaccin PCR
Combinacin de los 2 anteriores (enzimas de restriccin y PCR)
3. Electroforesis (horizontal, y/o vertical)
4. Deteccin de los fragmentos
Sondas marcadas
Bromuro de etidio, UV
Quimiluminiscencia
Tincin en plata
5. Autoradiografa y/o fotografia
6. Evaluacin de los fragmentos
7. Anlisis estadstico

Extraccin de DNA

El aislamiento de molculas como el DNA que se encuentra dentro de las clulas, puede
realizarse a travs de diferentes mtodos, los cuales deben tomar en cuenta la fragilidad de
dicha molcula y adems de las diferentes barreras que se deben de vencer para poder
aislarlo de los dems componentes celulares tales como organlos, sustancias

259
polipeptdicas, carbohidratos, etc. que son caractersticos para cada especie vegetal. El
mtodo que generalmente se utiliza implica el uso de la fuerza mecnica, variaciones
trmicas y fuerzas de gravedad, todos estos combinados con detergentes, solventes
orgnicos y sustancias qumicas, dan como resultado final el aislamiento del DNA.

El uso de sustancias qumicas tales como el CTAB (bromuro de hexadecil-trimetil-amonio)


sirven para poder disolver las membranas polipeptdicas que son las que forman
compartimentos dentro de las clulas de tal manera que el DNA pueda ser liberado de su
interior. Sustancias como el EDTA y PVP sirven para inactivar (quelar) las enzimas
conocidas como DNAasas que se encuentran en gran nmero dentro de la clula y que
pueden degradar el DNA. Sustancias tales como el TRIS son tampones (buffers) que sirven
para mantener regulado el pH del medio en el que se encuentra el DNA. Sales como el
NaCl permiten la precipitacin de carbohidratos, el acetato de amonio y acetato de sodio
permiten la captacin de algunos iones contaminantes que rodean a la molcula. Una
combinacin de solventes orgnicos como cloroformo: alcohol isoamlico (24:1) permiten
la separacin y precipitacin de protenas. El uso de alcoholes, tales como etanol absoluto
o isopropanol, permiten la precipitacin del DNA, librndolo de la solucin de solventes,
de sales y otras impurezas.

Protocolos de extraccin de DNA

Existe un elevado nmero de protocolos para la extraccin de DNA que presentan


diferencias dependiendo del tipo de organismo, del tejido de partida o de la calidad final
deseada del DNA.

La metodologa clsica consiste en una primera homogenizacin mecnica del tejido en un


tampn de extraccin. Este tampn est generalmente compuesto por TRIS, que
proporciona las propiedades tamponadoras, un quelante EDTA (ethylenediamine
tetraacetic acid) para inhibir la accin de DNAasas, una sal (normalmente cloruro sdico) y
un detergente que facilite la ruptura de las membranas celulares y nucleares. El DNA
puede separarse de las protenas y restos celulares mediante precipitacin de las protenas
facilitada por la presencia de dodecil sulfato sdico (SDS) y acetato potsico (el DNA
permanece en suspensin tras la precipitacin por centrifugacin), o alternativamente,
utilizando cloroformo para separar las protenas de la fase acuosa, donde permanece el
DNA. La extraccin con cloroformo permite obtener un DNA ms puro y mejor sensible a
degradacin, aunque tiene el inconveniente del manejo de disolventes orgnicos.

El DNA en disolucin puede ser concentrado y purificado por precipitacin con etanol o
isopropanol para posteriormente resuspender en un volumen apropiado de tampn TE o
agua. La pureza del DNA puede mejorarse siguiendo diversos protocolos que se discutirn
a continuacin.

Los tejidos vegetales presentan dos caractersticas especficas que hay que tener en cuenta
a la hora de poner a punto un protocolo de extraccin de DNA:

a. Contenido en fenoles. Al homogenizar el material se liberan fenoles que se oxidan


rpidamente y pueden provocar la prdida del DNA. Para evitarlo se aaden al tampn
de extraccin compuestos antioxidantes como el beta-mercaptoetanol o el bisulfito
sdico (este ltimo ms recomendable ya que el primero es voltil y txico).

260
b. Contenido en polisacridos. Las paredes de las membranas celulares vegetales estn
compuestas fundamentalmente por celulosa y otros polisacridos, que son muy
solubles y precipitan con el DNA, por lo que son contaminantes muy difciles de evitar.
Como consecuencia, el precipitado final de DNA adquiere una consistencia gelatinosa,
lo que dificulta el pipeteo e incluso puede inhibir la digestin del DNA con enzimas de
restriccin. Para intentar reducir esta contaminacin de polisacridos se utilizan
compuestos como el bromuro de hexadecil-trimetil-amonio (CTAB), aunque su
eficacia suele ser baja. Una estrategia mejor es la recoleccin de tejido joven,
proveniente de tejidos apicales en fase de crecimiento y evitar tomar muestras de tejido
adulto.

El protocolo a elegir depende del uso al que se va a destinar el DNA y del material de
extraccin de partida. Atendiendo a estos criterios, podemos eligir diferentes protocolos de
extraccin de DNA.

Tcnicas de marcadores moleculares


Diferentes tcnicas de marcadores moleculares han sido empleadas con xito para revelar
distintas clases de MM. Para el uso eficaz de estos marcadores en estudios genticos y en
el mejoramiento la plantas, debe considerarse:

La base gentica del polimorfismo revelado por el MM.


Los aspectos tcnicos de los mtodos que definen.
Las ventajas y limitaciones de cada clase.

Los MM poseen caractersticas especficas y varan en requerimientos tcnicos y


experimentales segn la tcnica utilizada. Entre tales tcnicas ms comunes utilizadas
tenemos: RFLPs, RAPDs, SSR, AFLPs, SCAR, CAPs y SNP.

Marcadores RFLP (Restriction Fragment Length Polymorphisms - Fragmentos de


Restriccin Polimrficos)

Los primeros marcadores basados en la variabilidad del DNA, los RFLPs, se desarrollaron
a principios de la dcada de los 80. Esta tcnica se vale de la capacidad que tienen las
enzimas de restriccin para poder reconocer secuencias especificas a lo largo del genoma,
de modo que una mutacin puntual dentro del sitio de restriccin resultar en la prdida o
ganancia de una secuencia de reconocimiento, dando origen a un fragmento de restriccin
de diferente longitud a la del original. Las mutaciones causadas por una insercin,
deleccin o inversiones en el DNA tambin llevan a variacin en la longitud de los
fragmentos de restriccin. Los fragmentos del genoma generados por las enzimas de
restriccin son separados en un gel de agarosa para luego ser transferidos a un soporte
slido que puede ser una membrana de nylon o nitrocelulosa. La transferencia de los
fragmentos de DNA desde la matriz de agarosa hasta la membrana se realiza por
capilaridad. Una vez que se encuentran en el soporte slido, el DNA digerido y separado,
puede ser hibridizado con una sonda (DNA de una sola hebra) que debe estar marcada para
su fcil deteccin. La sonda se hibridar en el lugar donde encuentre la zona
complementaria a su secuencia. Para hacer visible el lugar donde se ha hibridado la sonda,
sta debe tener algn tipo de seal (el procedimiento para hacer visible la seal es llamado
marcaje de la sonda); el marcaje de la sonda puede realizarse de diferentes maneras ya sea
radiactiva o no radiactiva basado en la quimioluminescencia.

261
Southern Blot

Es el procedimiento por el cual se transfiere el DNA que ha sido digerido y corrido en un


gel de agarosa (0,8 %), hacia una matriz slida tal como es una membrana de nylon. El
DNA se encuentra incluido dentro de toda la matriz porosa de agarosa. El DNA se
encuentra en forma de fragmentos de doble cadena que son muy cortos (100 pb) y otros
muy grandes (15000 pb), por lo que el gel es sometido a determinadas soluciones para que
los fragmentos puedan ser transferidos hacia la matriz slida en forma de cadenas simples.
El sistema se deja armado por toda la noche. El southern blot termina al da siguiente con
el desarmado del sistema y sometiendo la membrana a un proceso de fijacin a travs de
energa ionizante (UV) y calor. La unin del DNA a la membrana se logra a travs del
proceso de capilaridad; estando el DNA denaturado y con carga negativa, se une
fcilmente a la membrana, que esta cargada positivamente, es as que las uniones son de
tipo electrostticas por lo que la radiacin UV (proceso denominado linker) permite la
formacin de enlaces covalentes entre el DNA y las molculas de la membrana. Otro
camino para la fijacin es el uso de la energa en forma de calor a 80 C (Figura 4.8). Esta
tcnica est en desuso, debido a su laboriosidad en el procedimiento y la construccin de la
sonda especfica.

DNA genmico

+ Enzimas de restriccin = digestin

Papel tohalla
Electroforesis en
geles de agarosa Membrana
Gel
Esponja

Southern Blot

Membrana con DNA


transferido
Hibridacin
Perfil de
con sonda
polimorfismo
obtenido

Figura 4.8. Diagrama de obtencion de los marcadores RFLPs. Adaptado de


CIMMYT.3

262
Marcadores RAPDs (Random Amplified Polymorphic DNA - Fragmentos
polimrficos de DNA Amplificados al Azar)

La tcnica de RAPD, detecta polimorfismo de la secuencia de los nucletidos en una


prueba basada sobre la amplificacin de DNA usando iniciadores sintticos cortos
(generalmente de 10 bases). En esta reaccin, se utiliza un nico iniciador, y este se ancla
al DNA genmico en 2 sitios diferentes sobre las hebras opuestas del DNA molde. Si estos
sitios de cebo (anclaje) estn dentro de una distancia amplificable entre los dos sitios de
anclaje, un producto de DNA discreto se produce a travs de amplificacin termocclica.
La presencia de cada producto de amplificacin identifica homologa completa o parcial de
la secuencia de nucletidos, entre el DNA genmico y el oligonucletido iniciador en cada
final (terminal) del producto amplificado. Fragmentos amplificados (0.5 - 5 kb) son
separados por electroforesis en geles de agarosa y el polimorfismo es detectado como la
presencia o ausencia de fragmentos de un tamao particular (Figura 4.9).

El polimorfismo RAPD es el resultado de un cambio de una base de nucletido que altera


el sitio de anclaje del iniciador, o una insercin o delecin dentro de la regin amplificada.
Polimorfismos son usualmente evidenciados por la presencia o ausencia de un producto de
amplificacin de un solo locus, esto significa que la tcnica RAPD tiende a proveer
solamente marcadores dominantes (Figura 4.10). Las ventajas de marcadores RAPDs son
que ellos pueden ser ms polimrficos que RFLPs, ofrecen alcance genmico equivalente
al de RFLPs, bastante simple provisto de una metodologa rigurosamente estandarizada
con los controles necesariamente adheridos. El ensayo es no radioactivo, requiriendo
solamente cantidades nanogramos de DNA, y es aplicable a un amplio rango de especies.
Las desventajas incluyen informacin limitada acerca de la estabilidad ambiental del
polimorfismo y las bases moleculares de RAPDs.

263
Figura 4.9. Diagrama de obtencin de los marcadores RAPDs.

264
A Individuo 1
A 1 2 3

A a AA
Individuo 2 Aa aa
Los genotipos
AA y Aa
presentan la
misma banda

a Individuo 3 a

Figura 4.10. carcter codominante de los marcadores RAPD.

Marcadores AFLPs (Amplified Fragment Length Polymorphism - Fragmentos


Polimrficos de DNA Amplificados)

AFLPs son fragmentos de DNA (80 - 500 pb) obtenidos por restriccin con endonucleasas
y amplificados por PCR. La tcnica involucra tres etapas: (i) restriccin del DNA y
ligacin de los oligonucletidos adaptadores; (ii) amplificacin selectiva de los grupos de
los fragmentos de restriccin; (iii) anlisis de gel de los fragmentos amplificados.
Amplificacin PCR de los fragmentos de restriccin se logra usando el adaptador y
secuencias de sitios de restriccin como sitios blancos para el anclaje del iniciador. La
amplificacin selectiva se logra por el uso de iniciadores que se extienden dentro de los
fragmentos de restriccin, amplificando solamente estos fragmentos flanqueados. Usando
este mtodo, grupos de los fragmentos de restriccin pueden ser visualizados por PCR sin
conocer la secuencia de nucletidos. El mtodo permite la co-amplificacin especfica de
nmeros altos de los fragmentos de restriccin. Generalmente tamao de 50 - 500 pb
fragmentos de restriccin son amplificados y detectados sobre geles de poliacrilamida
(Figura 4.11).24

265
Polimorfismo obtenido con
la tcnica AFLP en el
cultivo de arracacha.

N= representa cualquier
nucleotido (A, T, G y C)

Figura 4.11. Principio de la tcnica AFLP (adaptado de De Vienne, 1998).

Marcadores microsatlites (Simple sequence Repeats, SRR - Secuencias simples


repetidas)

Los microsatlites, tambin conocidos como SSRs (Simple Sequence Repeats) o STRs
(Short Tandem Repeats), fueron descritos por Tautz22 como secuencias cortas de DNA
constituidas por motivos de 1 a 6 nucletidos repetidos en tndem. Esta clase de secuencias

266
simples de DNA se encuentran de forma abundante y uniforme en los genomas de la
mayora de organismos eucariotas. Estas secuencias no se transcriben a RNA y entre la
amplia variedad de funciones que se les atribuye se incluyen la regulacin gentica y la de
actuar como seales para la conversin gentica y la recombinacin.

Generalmente, las repeticiones de dinucletidos constituyen los microsatlites ms


comunes, que pueden ser de tres tipos: perfectos [ejemplo (CAn)], imperfectos [ejemplo
(CA)n-CCA-(CA)m] y compuestos [ejemplo (CA)n (TG)m], donde n y m son el nmero
de repeticiones del motivo. Los tri y tetranucletidos son menos habituales. En particular,
se conoce que la repeticin (GT)n representa el 0,5 % del genoma humano, siendo la ms
extendida en genomas vegetales el dinucletido (AT)n, aunque existen particularidades
segn la especie vegetal. As, se ha encontrado que en cebada y en arroz el microsatlite
ms abundante es el (GA)n.

El nmero de repeticiones es variable y , en general, el grado de polimorfismo aumenta


con la longitud total del microsatlite, que no suele superar las 0,1 Kb. El mecanismo
mediante el cual los microsatlites mutan es poco conocido. Se han propuesto dos
mecanismos principales no excluyentes: 1) el sobrecruzamiento desigual durante la meiosis
y 2) el deslizamiento (disociacin y reasociacin incorrecta) de la cadena que est siendo
sintetizada durante la replicacin del DNA, siendo este ltimo el que se cree tiene una
mayor importancia con relacin a la hipersensibilidad de los microsatlites.

El diseo de iniciadores especficos para las secuencias nicas que flanquean el motivo
repetido, frecuentemente ms conservadas, permite la amplificacin por PCR de la regin
repetitiva y la visualizacin de todos los alelos posibles para un locus microsatlite, debido
a la frecuente variacin en el nmero de repeticiones del motivo.

Los microsatlites son marcadores codominantes y altamente reproducibles. Generalmente


detectan un solo locus. De modo que los individuos heterocigotos muestran patrones
simples de 2 bandas cada una de ellas heredada por uno de sus progenitores, mientras que
los individuos homocigotos muestran solo una banda (Figura 12).

DNA individuo 1 AT12


ATATATATATATATATATATATAT

Regin
Regin
conservada
Conservada
Iniciador 1
Iniciador 2

ATATATATATATATATAT
DNA individuo 2 AT9
PCR
Electroforesis

Alelo a1
Alelo a2

Figura 4.12. Desarrollo de marcadores SSR. Adaptado de CIMMYT3

267
Marcadores SCAR (Sequence Characterized Amplified Region- Caracterizacin de
producto de amplificacin)

Fragmento de DNA genmica amplificada por PCR con los iniciadores especficos (14-20
bases). Estos iniciadores son definidos gracias al conocimiento de la secuencia de un
fragmento RFLP, RAPD, AFLP de inters particular, el que es aislado de un gel, clonado y
secuenciado. Luego por un PCR simple, usando dos iniciadores elaborados segn la
secuenciacion para ambos extremos, se genera banda simple, de fcil lectura y especfico.
Estos marcadores especficos son cada vez ms utilizados, entre otros, en los programas de
mejoramiento gentico de plantas e identificacin de sexo en las plantas, ya que permiten
discriminar fcilmente, especialmente si estn muy ligado al gen o son parte del gen
(Figura 4.13).

p1 RAPD p1

PCR

1 2 3
Gel de
RAPD
PCR

Clonar la banda
polimrfica en un
Bandas vector
Polimrficas
Secuenciar el fragmento y
disear nuevos cebadores
para amplificar nicamente
la banda de inters.
PCR
SCAR
P2 P3

Despus de la PCR con los nuevos


iniciadores, el resultado es un patrn 1 2 3
de bandas ms fcil de interpretar. Banda Polimrfica

Figura 4.13. Generacin de marcadores tipo SCAR. P1 es el iniciador usado para la


tcnica RAPD, P2 y P3 son iniciadores diseados luego del
secuenciamiento del fragmento para la tcnica SCAR.

268
Marcadores CAPS (Cleaved Amplified Polimorphic Squense - Digestin de producto
de amplificacin)

Un fragmento de DNA genmico amplificado (STS o SCAR) es digerido por las enzimas
de restriccin, luego el polimorfismo del tamao de los fragmentos generados es revelado
por electroforesis. Un problema relacionado con la conversin de RAPDs, RFLPs o AFLPs
a SCARs es que a veces el resultado de la amplificacin especfica no produce
polimorfismos. Esto ocurre frecuentemente cuando se parte de un clon de RFLP, porque a
menudo el polimorfismo de tipo RFLP se produce fuera de la regin del DNA usado como
sonda. Existen varios mtodos para detectar polimorfismo despus de una amplificacin de
PCR: uno de ellos consiste en digerir los fragmentos amplificados con diversas enzimas de
restriccin hasta encontrar una enzima que produzcan un polimorfismo de digestin. El
marcador obtenido as, se conoce como CAPS (Figura 4.12). Habitualmente se usan unos
10-15 enzimas de restriccin con diana (sitio) de reconocimiento de 4 pb, para aumentar la
probabilidad de encontrar sitios de corte. Se usan normalmente 8 l de producto de PCR
(previamente purificado con cualquier kit de purificacin para productos de PCR), 1 l de
tampn x 10 de enzima de restriccin y 2,5 U (unidades) de la enzima de restriccin. La
digestin se incuba 1-2 h a la temperatura de corte de la enzima (normalmente 37 C) y se
separa mediante electroforesis en un gel de agarosa del 2-3 %, segn el tamao del
fragmento original sin digerir (Figura 14).Tambin, ste marcador es ampliamente usado,
sobretodo tras la conversin de otros tipos de marcadores en marcadores de PCR.

1 2 3 4 1 2 3 4

Perfil sin digestin (monomrfico) Perfil luego de la digestin (polimrfico)

Figura 4.14. Generacion de marcadores tipo CAPS.

SNPs (Single-Nucleotide Polymorphisms- Polimorfismo de nucletidos nicos)

Los SNPs son diferencias entre individuos a nivel de un par de nucletidos, cuando stos
son comparados en el mismo sector del genoma; esto significa anlisis de polimorfismo de
alta resolucin (Figura 4.15). Se trata de sustituciones nucleticas que ocurren con una
frecuencia relativamente alta a lo largo del genoma y que son muy tiles en la confeccin
de mapas fsicos. La existencia de grandes colecciones de SNPs son de elevado inters
para estudios en gentica animal y vegetal, ya que es posible correlacionar el ligamiento
entre SNPs y enfermedades genticas.

269
El desarrollo de los marcadores de tipo SNP se basa en la secuenciacin extensiva del
genoma, por lo que su utilizacin a gran escala est por ahora restringida a iniciativas de la
envargadura del proyecto de genomas. Adems de la secuenciacin, otros mtodos de
deteccin de SNPs incluyen otras tcnicas, como la PCR alelo-especfica y los SSCP
(Single strand Conformation profile) entre otras. Cabe destacar que muchos de los
polimorfismos detectados por otros tipos de marcadores, tienen su orgen en SNPs. En
decir, muchos tipos de marcadores son sencillamente distintas metodologas para detectar
una mutacin puntual o polimorfismo en el genoma, es decir, un SNP.

Pero la utilidad de los SNPs reside en su uso a gran escala, lo que hace que los mtodos
usados para detectarlos sean poco apropiados. Los SNPs son muy abundantes en el genoma
humano, y se estima que hay uno por cada kb de ADN aproximadamente. Actualmente
existen numerosos kits de casas comerciales para la deteccin de SNPs, aunque en estos
casos no se pretende localizar nuevos SNPs sino centrarse en un SNP determinado
previamente descrito y detectarlo de la manera ms rpida, sencilla y eficiente en un mayor
nmero de individuos.

ATGGTAAGCCTGAGCTGACTTAGCGT-ATCGATC Individuo 1
ATGGTAAACCTGAGTTGACTTAGCGTGATCGATC Individuo 2

snp snp indel

Figura 4.15. Comparacin de una secuencia dada del genoma en dos individuos.
indel= se refiere a la insercin o delecin en esa ubicacin.

4.7. Aplicaciones de marcadores moleculares en el mejoramiento de plantas

En general, los marcadores moleculares son utilizados en estudios de enfermedades


genticas, pruebas de paternidad y parentesco, tambin como herramientas en la seleccin
de plantas o animales, en programas de mejoramiento y finalmente, en estudios de
caracterizacin cuya finalidad son estudios sobre taxonoma, evolucin y conservacin.

Identificacin de origen parental y tests de paternidad.


Identificacin y proteccin de variedades.
Atribucin de lineas a grupos heterticos.
Certificacin de pureza gentica de lineas y hibridos.
Control de fecundacin cruzada y autofecundacin en plantones de semillas forestales.
Evaluacin de germoplasma y poblaciones de mejoramiento (variabilidad, diversidad,
clasificacin, distancia gentica y filogenia).
Construccin de colecciones nucleares (core collections) en bancos de germoplasma a
partir de estudios sobre diversidad y distancia gentica.
Construccin de mapas genticos de ligamiento.
Mapeamiento gentico de QTL y/o ETL (Quantitative y Economic Trait Loci),
controladores de caractersticas cuantitativas y/o de importancia econmica.

270
Anlisis de la arquitectura de caractersticas cuantitativas (nmero, posicin, accin
gentica, magnitud de efecto e interacciones de QTLs).
Deteccin de loci homlogos en otras especies o generos a travs de mapas
comparativos (Comparative o Synteny mapping).
Introgresin de caractersticas por retrocuzamiento asistido por marcadores.
seleccin y recombinacin dirigida de genotipos superiores.
seleccin durante el desarrollo de lineas endgamas.
Prediccin de fenotipos esperados.
Seleccin indirecta para caractersticas de difcil evaluacin (resistencia a factores
biticos y abioticos, o para caractersticas industriales).
Seleccin precoz en cultivos perennes.

Aplicacin para estudios de caracterizacin

Los MM tienen un alto poder de discriminacin, no presentan interaccin con el ambiente,


producen resultados equivalentes entre distintos laboratorios, permiten el clculo de
distancias entre genotipos en forma consistente con otros caracteres, como informacin de
pedigree. Preferentemente, debe conocerse el control gentico de los descriptores, y ser
posible su localizacin cromosmica. Adems, la metodologa de anlisis de los perfiles
generados, debe ser capaz de traducirlos e interpretarlos. Entre las principales tcnicas de
marcadores moleculares, la ms adecuada a esos parmetros es la de 0microsatlites.
Actualmente, este tipo de estudio tiene un gran impacto, pues son apuntadas como las
herramientas ms poderosas para identificacin y caracterizacin de variedades, dando
soporte a la propiedad intelectual de las mismas.

Aplicaciones de los marcadores moleculares en programas de mejoramiento

En programas de mejoramiento, los marcadores moleculares pueden ser utilizados con


finalidad de identificacin de individuos, anlisis de diversidad gnica, mapeo gentico,
mapeo de caractersticas cualitativas o cuantitativas heredadas, mapeo comparativo entre
distintas especies, estudios de evolucin, caracterizacin gentica de especies, gentica de
poblaciones y clonaje de genes.

La aplicacin de marcadores moleculares para identificacin gentica permite la


optimizacin de bancos de germoplasma y colecciones nucleares para programas de
mejoramiento. Ese tipo de anlisis asociado a evaluacin en software adecuados, conduce a
los estudios de diversidad gentica que permiten al fitomejorador una base para la eleccin
de individuos como progenitores, pues analiza la proximidad o divergencia gentica de los
progenitores. De esa manera, el fitomejorador puede optimizar los cruzamientos y alcanzar
individuos hbridos con caractersticas mejoradas en tiempo ms corto.

El mapeo gentico es un estudio importante en programas de mejoramiento, pues es


necesario, en un momento dado, saber en cual cromosoma est la caracterstica de inters y
como sta segrega en la poblacin. El mapeo gentico que se consigue por medio de
trabajos con marcadores moleculares, tambin puede ser utilizado para ubicar en el
genoma de una planta transgnica, el gen que otorg la caracterstica introducida a travs
de la transformacin.

271
La utilizacin de los marcadores moleculares para mapeo de caractersticas cuantitativas
(Quantitative Trait Loci, QTL), es muy til. Rasgos tales como resistencia a enfermedades
o produccin, son caractersticas que dependen de ms de un gen y as son de difcil
evaluacin. Por eso, hacer seleccin asistida con marcadores moleculares para fragmentos
relacionados con QTL, tiene un gran impacto. Adems de eso, tambin se puede hacer el
mapeo de caractersticas heredadas que sean cualitativas. En esos casos, la tcnica de
SCAR es muy til para hacer seleccin asistida. La seleccin asistida fue sealada como
una tcnica que disminuye el costo de un programa de mejoramiento. La seleccin asistida
puede tambin ser utilizada para reconocimiento de individuos en una progenie que
contiene un gen introducido por transformacin gentica de plantas.

Los marcadores moleculares ya permitieron el clonaje de un gran nmero de genes (Map-


based cloning). As, la tcnica de los marcadores moleculares puede tambin relacionarse
con las del DNA recombinante y transformacin gentica de plantas.

Es conveniente indicar que el estudio utilizando marcadores moleculares en programas de


mejoramiento con objetivo de anlisis de diversidad gentica, mapeo de caractersticas
cualitativas o cuantitativas o an mapeo gentico, necesita no slo conocimiento tcnico de
esas metodologas, sino tambin conocimientos para anlisis estadsticos en las progenies
utilizando mtodos biomtricos de evaluacin.

Actualmente, en el rea de la genmica, los estudios de secuenciacin conducen al


conocimiento de diversas secuencias gnicas nuevas. La caracterizacin de nuevos genes,
asociados a alguna caracterstica de inters, puede ser una herramienta muy poderosa para
dar soporte a los programas de mejoramiento y estn asociadas al anlisis con marcadores
moleculares. Por medio del conocimiento de sus secuencias, se pueden hacer diseos con
iniciadores especficos y as hacer amplificacin especfica de los genes ms importantes
que se quieren fijar en una poblacin y analizar su segregacin en sta. An ms. Se puede
estudiar su presencia gentica (homocigosis o heterocigosis). El mapeo gentico de
organismos utilizando los marcadores moleculares tambin da soporte a los trabajos de
secuenciacin completa de genomas.

Seleccin asistida por marcadores moleculares (MAS)

Los trabajos de ligamiento se realizan con la finalidad de encontrar marcadores asociados a


ciertos genes de inters, como resistencia a una enfermedad, rendimiento, entre otros.

Para ello se identifican padres muy diferentes para ese gen, por ejemplo uno debe ser
susceptible y el otro resistente. Estos se hibridan y se genera la F1. Luego se hace
generalmente la F2 (por autofecundacin) para observar la segregacin. Este material
(poblacin segregante y junto con los padres) debe ser evaluado con cualquiera de las
tcnicas moleculares, como por ejemplo AFLP, y a la vez se debe evaluar este material
para su respuesta genotpica. Esta comparacin nos lleva a la asociacin de ciertos
fragmentos de DNA (conocidos como marcadores), ya que solo estarn en un parental, por
ejemplo resistente. Este marcador asociado a la resistencia, cuanto ms cerca est al gen,
se considera mejor marcador para la seleccin asistida (MAS) o facilitada por marcadores
moleculares. Se considera mucho mejor cuando es parte del mismo gen, esto significa que
puede ser del promotor, o de la parte estructural del gen (intron o exon).

272
Luego de encontrar marcadores ligados con el gen de inters, se puede utilizar esos
marcadores para una seleccin en los programas de mejoramiento gentico. Este marcador
ligado, obtenido ya sea por RAPD, AFLP, se debe convertir en especifico, usando la
tecnica SCAR o CAPs. Para facilitar su lectura, se obtiene uno o pocos fragmentos.

En general la presencia de esta banda en el genotipo nos indicaria que ese genotipo es
resistente. Pero esto no necesariamente ser as. Entonces para evitar eso, hay que verificar
su respuesta fenotpica en todos aquellos que presentan ese fragmento de resistencia. Puede
ser que genotipos susceptibles tambien tengan ese marcador, esto significaria por ejemplo
que ese genotipo tiene el gen, pero seria como pseudogene.

273
5. REFERENCIAS BIBLIOGRFICAS

1. Avery OT, MacLeod CM, & McCarty M. Studies on the chemical nature of the
substance inducing transformation of pneumococcal types: Induction of transformation
desoxyribonucleic acid fraction isolated from pneumococcus type III. Journal of
Experimental Medicine, 1944. 79: 137157.

2. Beadle G & E Tatum. Genetic control of biochemical reactions in Neurospora. Proc.


Nat. Acad. Sci. 1941. 27: 499-506.

3. CIMMYT (Centro Internacional de Mejoramiento de Maz y Trigo). Molecular Marker


Applications to Plant Breeding. Applied Molecular Genetics Laboratory, El Batan,
Mxico. 1996.

4. Clives J. Global status of commercialized transgenic crops: International Service for


the Acquisition of Agribiotech Applications, Ithaca, N.Y., USA ISAA Briefs. 2008.
Disponible en: http://www.biotech.info.net/global_status_2007.html

5. Clives J. Global status of commercialized transgenic crops: International Service for


the Acquisition of Agribiotech Applications, Ithaca, N.Y., USA ISAA Briefs. 2013.
Disponible en: http://www.biotech.info.net/global_status_2013.html

6. Cocking E. A method for the isolation of plant protoplast s and vacuoles. Nature 1960.
187: 927-929.

7. De Vienne D. Les Marqueurs molculaires en gntique et biotechnologies vgtales.


INRA editions. Paris, 1998.195p.

8. Denis M, Delourme R, Gourret J, et al. Expression of engineering nuclear male sterility


in Brassica napus. Genetics, morphology, cytology, and sensitivity to temperature.
Plant Physiol. 1993. 10:1295-1304.

9. Ebinuma H, Sugita K, Matsunaga E, et al. Systems for the removal of a selection


maker and their combination with a positive maker. Plant Cell Rep. 2001. 20:383-392.

10. Endo S, Sugita K, Sakai M, et al. Single step transformation for generating marker-
free transgenic rice using the ipt-type MAT vector system. Plant J. 2002. 30:115-122.

11. FAO. Estado de inseguridad alimentaria en el mundo. Roma, Italia. 2000.

12. FAO. Estado de inseguridad alimentaria en el mundo 2013. Las mltiples dimensiones
de la seguridad alimentaria. Roma, Italia. 2013.

13. Harlan JR. 1975. Crops and Man. American Society of Agronomy, Madison,
Wisconsin. 295 p.

14. Jordan M. Estadios de cultivo de tejidos. En: Biotecnologa Vegetal. Coleccin libros,
INIA, Chile (15) 2005. 55-98.

274
15. Kiyokawa S, Kobayashi K, Kikuchi Y, et al. Root-inducing region of mikimopine
type Ri plasmid pRi724. Plant Physiol. Transferase as high-eficiency marker for plant
transformation. Nat. Biotechnol. 1994. 17:916-919.

16. Kunkel T, Niu Q,Can Y & Chua N. Inducible isopentenil transferase as high-eficiency
marker for plant transformation. Nat. Biotechnol. 1999. 17:916-919.

17. Mullis KF, Faloona F, Scharf S, et al. Specific enzymatic amplification of DNA in
vitro: The polymerase chain reaction. Cold Spring Harbor Symposium in Quantitative
Biology, 1986. 51:263-273.

18. Prieto H, Jordan M, Barrueto LP, et al. Biotecnologia Vegetal. Coleccin libros INIA
No. 5, Santiago de Chile. 2005. 217 p.

19. Roberts RJ, Vincze T, Posfai J, et al. REBASE: Restriction enzymes and DNA
methyltransferases. Nucleic Acids Research, 2005. Vol.33: 230-232.

20. Saiki R, Gelfand D, Stoffel S, et al. Primer-directed enzymatic amplification of DNA


with termostable DNA polymerase.Science, 1989. 239,487-491.

21. Smith HO & Nathans DA. suggested nomenclature for bacterial host modification and
restriction system and their enzymes. J. Mol. Biol. 1973. 81: 419-423.

22. Tautz D. Hypervariability of simple sequences as a general source for polymorphic


DNA markers. Nucleic Acids Res 1989. 17: 6463-6471.

23. Thorpe TA. History of plant tissue culture. Molecular Biotechnology, 2007. 37
(2):169-180.

24. Vos P, Hogers R, Bleeker M, et al. AFLP: a new technique for DNA
fingerprinting.Nucleic Acids Res 1995. 23(21):44074414.

25. Walmsley A and Arntzen C. Plants for delivery of edible vaccines. Curr. Opinion
Biotechnol., 2000. 11: 126-129.

26. Watson JD. & Crick FHC. A Structure for Deoxyribose Nucleic Acid. Nature, 1953.
171:737-738.

275
TABLA DE CONTENIDO

PRIMERA PARTE ............................................................................................................ 1


INTRODUCCIN AL MEJORAMIENTO GENTICO DE PLANTAS.................... 1
1. MEJORAMIENTO GENTICO DE PLANTAS ....................................................... 2
1.1. Historia del mejoramiento gentico ......................................................................... 2
1.2. Importancia social y econmica del mejoramiento. ................................................. 5
1.3. Logros recientes del mejoramiento gentico en Per y Amrica Latina .................. 8
1.4. Importancia de la semilla de las variedades mejoradas en el desarrollo agrcola ... 11
2. EL MEJORAMIENTO GENTICO Y LA AGRICULTURA SOSTENIBLE ..... 11
2.1. El mejoramiento en la agricultura moderna ............................................................ 12
2.2. El mejoramiento y la sostenibilidad del sistema productivo .................................. 12
2.3. La sostenibilidad en el Per .................................................................................... 14
2.4. Factibilidad del mejoramiento para la sostenibilidad ............................................. 14
3. REFERENCIAS BIBLIOGRFICAS ....................................................................... 16

SEGUNDA PARTE .......................................................................................................... 18


MEJORAMIENTO GENTICO DE PLANTAS AUTGAMAS .............................. 18
1. SELECCIN EN EL MEJORAMIENTO GENTICO DE PLANTAS
AUTGAMAS .................................................................................................................. 19
1.1. Introduccin ............................................................................................................ 19
1.2. Proceso de seleccin ............................................................................................... 20
2. BASES GENTICAS DEL MEJORAMIENTO EN PLANTAS AUTGAMAS . 21
2.1. Cambios de la frecuencia genotpica de una poblacin en autogamia ................... 21
2.2. Poblacin de base.................................................................................................... 21
2.3. Estimacin de la variancia genetica y sus componentes......................................... 26
2.4. Composicin gentica de un cultivar ...................................................................... 30
2.5. Eleccin de progenitores ......................................................................................... 32
2.6. Mtodos de seleccin de progenitores .................................................................... 33
3. MTODOS DE MEJORAMIENTO EN PLANTAS AUTGAMAS ................... 37
3.1. Seleccin masal....................................................................................................... 37
3.2. Seleccin individual genealogica......................................................................... 42
3.3. Mtodo de poblaciones hbridas bulk population ................................................ 59
3.4. Mtodo de descendencia nica de semilla o Single Seed Descent (SSD) .............. 64
3.5. Prueba de generacin precoz .................................................................................. 68
3.6. Produccion de dobles haploides o di-haploides ...................................................... 71
3.7. Mejoramiento por retrocruzamiento (BACK CROSS) ........................................... 87
3.8. Variedades multilneas .......................................................................................... 100
3.9. Mejoramiento por caracteres multiples................................................................. 112
3.10. Mejoramiento por resistencia cuantitativa o duradera a patgenos .................... 141
4. REFERENCIAS BIBLIOGRFICAS ..................................................................... 152

TERCERA PARTE ..........................................................Error! Marcador no definido.


MEJORAMIENTO GENTICO DE PLANTAS ALGAMAS ............................... 159
1. INTRODUCCIN ...................................................................................................... 160
2. METODOS PARA RECOMBINAR INDIVIDUOS SELECCIONADOS ........... 160
2.1. Lote aislado cuando se utiliza un compuesto balanceado (CB) ............................ 161
2.2. Lote aislado cuando se utiliza despanojamiento ................................................... 161
2.3. Cruzas simples posibles (dialelico)....................................................................... 161

276
3. FORMACION DE POBLACIONES PARA LA SELECCIN ............................. 162
3.1. Poblaciones de dos padres .................................................................................... 162
3.2. Poblaciones de libre polinizacin ......................................................................... 163
4. BASES GENTICAS ................................................................................................. 164
5. MTODOS DE MEJORAMIENTO ....................................................................... 176
5.1. Introduccion de germoplasma ............................................................................... 176
5.2. Mejoramiento poblacional ................................................................................... 177
5.3. Mejoramiento intrapoblacional ............................................................................. 179
5.4. Mejoramiento interpoblacional ............................................................................. 189
6. VARIEDAD SINTTICA........................................................................................ 193
7. FORMACIN DE UNAVARIEDAD COMPUESTA ........................................... 194
8. REFERENCIAS BIBLIOGRFICAS ..................................................................... 196

CUARTA PARTE .......................................................................................................... 198


BIOTECNOLOGA VEGETAL ...............................Error! Marcador no definido.198
1. INTRODUCCIN ...................................................................................................... 199
1.1. Etapas de biotecnologa ........................................................................................ 200
2. CULTIVO DE TEJIDOS EN MEJORAMIENTO DE PLANTAS ....................... 203
2.1. Principio de cultivo in vitro .................................................................................. 203
2.2. Caractersticas de cultivo in vitro ......................................................................... 204
2.3. Usos de las tcnicas del cultivo in vitro ................................................................ 204
2.4. Tcnicas de cultivo in vitro ................................................................................... 204
2.5. Ventajas y desventajas de cultivo in vitro ............................................................ 217
3. TRANSFORMACIN GENTICA DE LAS PLANTAS ...................................... 218
3.1. Sistemas de transformacin de plantas ................................................................. 224
3.2. Biobalstica ........................................................................................................... 232
3.3. Metodologas de transformacin .......................................................................... 232
3.4. Eliminacin de los genes indeseados .................................................................... 234
3.5. Plantas transgnicas de primera generacin ......................................................... 234
3.6. Plantas transgnicas de segunda generacin y perspectivas ................................. 235
3.7. Percepcin pblica ................................................................................................ 240
4. MARCADORES GENTICOS Y MEJORAMIENTO DE PLANTAS ............... 240
4.1. Fitomejoramiento y marcadores ........................................................................... 241
4.2. Clases de marcadores existentes ........................................................................... 241
4.3. Reaccin en cadena de la polimerasa (pcr) ........................................................... 246
4.4. Enzimas de restriccin .......................................................................................... 254
4.5. Electroforesis ........................................................................................................ 257
4.6. Tcnicas de marcadores moleculares .................................................................... 259
4.7. Aplicaciones de marcadores moleculares en el mejoramiento de plantas ............ 270
5. REFERENCIAS BIBLIOGRFICAS ..................................................................... 274

277
278
MEJORAMIENTO GENTICO Y BIOTECNOLGICO DE PLANTAS
Mejoramiento gentico y
biotecnolgico de plantas