Vous êtes sur la page 1sur 51

Mmoire de projet de fin dtudes

Pour lobtention du diplme de:


Master en Biotechnologie Mdicale
Sous le Thme:

Analyse dun gne candidat de


lautisme, Neuroligin 3 dans un
groupe de patients marocains.

Prsent et soutenu par:


ROUAHI El Yazid
Le 26/07/2016
Jury:
Pr. IBRAHIMY Azeddine Prsident
Pr. BENSAID Mounia Encadrante
Pr. EL JAOUDI Rachid Examinateur

Anne universitaire 2015/2016


Ddicace
A celle qui a attendu avec patience les fruits de sa bonne ducation...

A ma Mre.

A celui qui ma indiqu la bonne voie en me rappelant que la volont fait


toujours les grands hommes...

A mon pre.

A ceux qui nous ont soutenu durant toute notre formation

A nos frres et surs.

A tous nos amis qui nous soulvent quand nos ailes n'arrivent plus se
rappeler comment voler...

Que Dieu vous garde.

1
Remerciements
En prambule ce mmoire, je souhaiterais adresser mes
remerciements les plus sincres aux personnes qui m'ont apport leur
aide et qui ont contribu llaboration de ce projet au sein du
laboratoire de Biotechnologie mdicale (MedBiotech) de la FMPR.
Tout dabord je remercie Madame Mounia BENSAID, qui s'est
toujours montre l'coute et trs disponible tout au long de la
ralisation de ce mmoire, ainsi pour l'inspiration, l'aide et le temps
qu'elle a bien voulu me consacrer et sans qui ce mmoire n'aurait
jamais vu le jour.

Je remercie galement notre cher professeur, Mr. Azeddine


IBRAHIMI, coordonateur du master, un modle en tant que personne
et en tant que professionnel, pour son soutien et son encouragement
prodigu tout au long de la formation.

Sans rater loccasion de remercier les thsards de notre


laboratoire, spcialement Arrouchi Housna pour avoir t toujours l,
tous les enseignants du Master qui ont contribu forger nos
connaissances et assister notre formation, et mes collgues, pour le
climat chaleureux, je vous souhaite un avenir merveilleux.

Je n'oublie pas mes parents et ma famille pour leur contribution,


leur soutien et leur patience.

Merci toutes et tous.

2
Sommaire
Ddicace ------------------------------------------------------------ 1
Remerciements ----------------------------------------------------- 2

Liste des Abrviations ---------------------------------------------- 5


Liste des Figures ---------------------------------------------------- 6
Liste des Tableaux --------------------------------------------------- 7

Rsum ------------------------------------------------------------- 8

Partie Bibliographique
I. Introduction
1. Revue Bibliographique -------------------------------------- 10
a) Historique ------------------------------------------------------------------------------- 10
b) Dfinition de lAutisme --------------------------------------------------------------- 11
c) Signes cliniques --------------------------------------------------------------------- 12
d) Epidmiologie ------------------------------------------------------------- 14
e) Causes ----------------------------------------------------------------------- 16
i. Facteurs Environnementaux --------------------------------------- 16
ii. Facteurs Gntiques ------------------------------------------------- 18
iii. Approche gne candidat de lautisme ----------------------------- 19
f) Les Neuroligines ---------------------------------------------------------- 23
2. Problmatique ---------------------------------------------------------- 24
3. Objectif du travail ------------------------------------------------------- 24

3
Partie exprimentale
II. Matriel et Mthodes
1. Recrutement des familles -------------------------------------- 26
2. Prlvement de sang -------------------------------------------- 26
3. Extraction dADN gnomique partir du sang total ------- 26
a) Principe ---------------------------------------------------------- 26
b) Procdure -------------------------------------------------------- 27
4. Dosage de lADN ----------------------------------------------- 28
5. Gne de la Neuroligin 3 ----------------------------------------- 29
6. Choix des amorces ---------------------------------------------- 29
7. PCR classique -------------------------------------------------- 29
8. Electrophorse sur gel dAgarose ----------------------------- 31
9. Squenage ------------------------------------------------------ 32
III. Rsultats
1. Extractions et Dosage ------------------------------------------ 32
2. PCR -------------------------------------------------------------- 35
3. Squenage ------------------------------------------------------ 40
IV. Discussion -------------------------------------------------- 41
V. Conclusion et Perspectives -------------------------------- 42
Annexe ----------------------------------------------------------- 43
Rfrences Bibliographiques ---------------------------------- 46

4
Liste des abrviations :
TSA : Troubles de Spectre Autistique
TED : Troubles envahissants du Dveloppement
DSM: Diagnostic and Statistical Manual of Mental Disorders.
CARS: Childhood Autism Rating Scale
ADI-R : Autism Diagnostic Interview-Revised
ADOS : Autism Diagnostic Observation Schedule-Generic
IRM : Imagerie par rsonance magntique
ADN : Acide dsoxyribonuclique
EEG : Electrncphalographie
ADDM : The Autism and Developmental Disabilities Monitoring
MZ : Monozygotes
DZ : Dizygotes
IMGSAC : International molecular genetics study of autism consortium
PARIS study : Paris autism research international sibpair study
FMR : fragile X mental retardation
MCP : methyl CpG binding protein
SNP: Single-nucleotide polymorphism
3'UTR : Three prime untranslated region
GABA : Gammaaminobutyric acid
NLGN : Neuroligine
EDTA : Ethylenediaminetetraacetic acid
PCR : Polymerase chain reaction
DO : Densit Optique

5
Liste des figures
Figure 1: Rgions de susceptibilit lautisme rpliques dans plusieurs tudes.
Figure 2: Structure 3D de la protine NLGN3.
Figure 3: Localisation chromosomique Xq13.1.
Figure 4 : ADN prcipit lEthanol.
Figure 5 : Exemple dElectrophorse sur gel dAgarose Exon1.
Figure 6 : Exemple d'Electrophorse pour Exon 2.
Figure 7 : Exemple d'Electrophorse Exon 3.
Figure 8 : Exemple d'Electrophorse Exon 4.
Figure 9 : Exemple d'Electrophorse pour Exon 5.
Figure 10 : Exemple d'Electrophorse Exon 6.
Figure 11 : Exemple d'Electrophorse Exon 7.
Figure 12 : Rsultat de squenage de l'exon 5F du patient 37.
Figure 13 : Blast de la squence de lexon 5F du patient 37.

6
Liste des tableaux
Tableau 1 : Liste des gnes associs lautisme et leur fonction.
Tableau 2 : Mise au point des conditions damplification de chaque couple
damorce.
Tableau 3: Amorces des exons du gne NLGN3.
Tableau 4 : Concentrations du gel d'agarose selon la taille des exons.
Tableau 5 : Rsultat des extractions et des Dosages des Densits Optiques.
Tableau 6: Rsultat des PCR aprs confirmation par Electrophorse.

7
Rsum
Lautisme est un syndrome neuro-dveloppemental impliquant
des facteurs gntiques. Notre travail a consist rechercher
des mutations au niveau des exons dun gne candidat de cette
pathologie dans un groupe de patients marocains.
Dans notre groupe de patients qui est au nombre de 36, nous
avons squenc tous les exons de la NLGN3 pour 13 patients
jusqu prsent , dans lesquels nous navons retrouv aucune
mutation.

Mots cls : autisme, dficience mentale, NLGN3, TSA.

8
Partie Bibliographique

9
I- Introduction :

De par le monde, lautisme est dsormais considr comme un problme grave de sant
publique impliquant la ncessit dune mise en place, par les Etats, dune vritable politique
de traitement et de prise en charge de cette pathologie.[1]

Les tudes gntiques des formes monogniques de TSA (troubles du spectre autistique)
ont identifi la fonction synaptique comme l'une des voies molculaires des troubles
neurodveloppementaux sous-jacentes. [2]

Parmi les gnes de sensibilit les plus tudis, les neuroligines, protines d'adhsion
postsynaptiques des cellules impliques dans la maturation, la spcification et la plasticit des
rseaux neuronaux travers l'interaction avec neurexines prsynaptiques.[3]

Le Maroc possde actuellement des centres de diagnostic de l'autisme Sal et Casa,


mais aucun plan pour le traitement de lautisme, aucun centre dintervention prcoce, aucun
centre de formation professionnelle que ce soit dans le domaine de la Mdecine, de
lEducation ou de la thrapie spcifique cette pathologie, quand la Recherche, nous
sommes dans limmobilisme total.

1. Revue Bibliographique

a) Historique
Le mot autiste vient de la racine grecque autos qui signifie soi-mme . Il a t employ
pour la premire fois en 1911 par le psychiatre suisse Eugen Bleuler, lorsquil a dcrit les
symptmes de patients schizophrnes replis sur eux mmes.

Par la suite, en 1943, Leo Kanner psychiatre amricain dorigine allemande a rutilis ce
concept dautisme pour caractriser le comportement de 11 enfants. Ces enfants prsentaient
un ensemble de symptmes particuliers que Kanner a regroup en sept caractristiques
essentielles: la solitude, les obsessions pour des routines, une mmoire extraordinaire,
lcholalie, une sensibilit aux stimuli, une gamme dintrts limite, une intelligence
normale.[4]

10
Au cours des 65 dernires annes, les concepts de ce trouble au sein de la psychiatrie ont
considrablement chang en parallle avec le dveloppement du concept que les troubles de la
cognition et le comportement ont, une tiologie organique du cerveau. Dans les annes 1960
et 1970, l'autisme a t essentiellement considr comme une forme de psychose semblable
la schizophrnie de l'enfance, et la sagesse conventionnelle qui a prvalu, il pourrait tre en
grande partie li aux styles parentaux. La reconnaissance prcoce qu'un certain nombre de
conditions gntiques ou biomdicales rares, par exemple, la phnylctonurie [5] pourrait
conduire l'autisme aurait suggr que ces troubles ne sont pas causs par une mauvaise
ducation, comme cela a t dmontr par la suite. [6]

Cependant, ces formes syndromiques de l'autisme ont t considres comme une


exception. Il a fallu attendre le dbut des annes 1980 pour que l'autisme soit class comme
un trouble du dveloppement et largement accepte comme ayant une origine biomdicale.
Que tout ce temps devait passer est ironique, la lumire des dclarations de clture de
Kanner [7] dcrivant l'autisme comme une incapacit inne former l'habitude,
biologiquement fournie du contact affectif. analogue d'autres handicaps physiques ou
intellectuells innes. "La conceptualisation moderne de l'autisme comme un trouble
biomdical a t en grande partie alimente par la dmonstration que lautisme tait hritable
[8][9]et associ une varit de syndromes gntiques. [10][11]

Bien que des mesures et des catgories de diagnostic ont chang au cours des trois
dernires dcennies, lautisme ou troubles autistiques ont t classs dans la catgorie de
diagnostic des Troubles envahissants du Dveloppement (TED) accompagn du syndrome
dAsperger, le trouble dsintgratif de l'enfance (TDE),le syndrome de Rett et le trouble
envahissant du dveloppement non spcifi (PDD-NOS) dans le Diagnostic and Statistical
Manual of Mental Disorders IV.[12]

b) Dfinition de lAutisme

L'autisme est un trouble neurodveloppemental caractris par des altrations de la


communication verbale et non verbale, du contact et des relations sociales ainsi que des
comportements et activits rptitifs et restreints.[13] . Ces symptmes apparaissent avant
lge de 3 ans et sont regroups sous lappellation triade autistique . Plus prcisment des
anomalies de comportement sont constates envers les objets ou les personnes et dans certains

11
secteurs du dveloppement tel que le langage, la motricit, les capacits sensorielles et
cognitives, la comprhension et lexpression des motions. La communaut scientifique
internationale met laccent sur lhtrognit de lautisme en le dfinissant comme
Troubles du Spectre Autistique (TSA).

c) Signes cliniques

Lenfant autiste tablit rarement le contact et semble mme lviter, lvitement du regard est
caractristique. Le langage expressif est absent ou retard, certaines particularits telles que
les cholalies sont frquemment observes. La communication non verbale par les gestes ou
les mimiques reste limite. Lactivit est pauvre, rptitive et strotype comme par exemple
aligner un nombre dtermin de jouets toujours dans le mme ordre. On peut observer certains
troubles sensoriels notamment au niveau auditif, ils peuvent se traduire par une hyper ou une
hypo sensibilit aux bruits. On rencontre par ailleurs des perturbations du traitement des
informations sensorielles, caractrises par une ractivit particulire aux stimulations
visuelles (fascination pour certaines lumires), auditives (intolrance au bruit et certaines
frquences), ou encore au toucher (dveloppement daversion ou dattirance pour certains
tissus). Les enfants autistes peuvent avoir des ractions dangoisse, de colre ou dagressivit
disproportionnes face au changement de leur environnement quotidien. Par ailleurs, des
troubles du sommeil, insomnies ou rveils nocturnes sont frquents chez ces enfants.

La macrocphalie ou circonfrence de la tte au-dessus du 98e percentile est observe dans


~20% des enfants autistes la mi-enfance [14], et la macrocphalie elle-mme est un facteur
de risque pour les TSA [15].

Plusieurs tudes indpendantes ont observ une diminution des cellules de Purkinje du
cervelet dans les TSA[16]. Des tudes plus rcentes suggrent galement des anomalies
gnralises dans le cortex crbral, le plus en vidence, les zones d'association dordres
suprieurs tels que le cortex frontal et cortex antrieur temporal.

La plupart des enfants autistes prsentent un retard mental associ, leur quotient de
dveloppement est infrieur 70.[17] De mme, une pilepsie est observe chez 12 39% des
patients autistes.[18]

Diagnostic et instruments dvaluation:

12
Depuis la premire dfinition de lautisme par Kanner en 1943 et jusqu' nos jours, les
spcialistes nont eu de cesser, daffiner et damliorer leurs critres de diagnostic afin
dtablir une classification consensuelle qui puisse tre utilise par toute la communaut
scientifique et mdicale. Actuellement, le diagnostic de l'autisme repose sur lchelle de
classification DSM-IV (Diagnostic and Statistical Manual of Mental Disorders, 4th edition )
bases sur une description comportementale des troubles puisquil nexiste ce jour aucun
marqueur biologique, molculaire ou cellulaire.

Critres diagnostiques du trouble autistique selon le DSM-IV(American Psychiatric


Association, 2000)

Critres diagnostiques du trouble autistique selon le DSM-IV(American Psychiatric


Association, 2000)

1- Altration qualitative des interactions sociales, comme en tmoignent au moins deux des
lments suivants :

Altration marque dans lutilisation, pour la rgulation des interactions sociales, de


comportements non verbaux multiples, tels que le contact oculaire, la mimique faciale, les
postures corporelles, les gestes ;

Incapacit tablir des relations avec les pairs correspondant au niveau du dveloppement ;

Le sujet ne cherche pas spontanment partager ses plaisirs, ses intrts ou ses russites
avec dautres personnes (par exemple ne cherche pas montrer, dsigner du doigt ou
apporter les objets qui lintressent) ;

Manque de rciprocit sociale ou motionnelle.

2- Altration qualitative de la communication, comme en tmoigne au moins 1 des lments


suivants :

Retard ou absence totale de dveloppement du langage parl (sans tentative de


compensation par dautres modes de communication, comme le geste ou la mimique) ;

.chez les sujets matrisant suffisamment le langage, incapacit marque engager ou soutenir
une conversation avec autrui ;

Usage strotyp et rptitif du langage, ou langage idiosyncrasique ;

13
Absence de jeu de faire semblant vari et spontan, ou dun jeu dimitation sociale
correspondant au niveau de dveloppement.

3- Caractre restreint, rptitif et strotyp des comportements, des intrts et des activits,
comme en tmoigne au moins un des lments suivants :

Proccupation circonscrite un ou plusieurs centres dintrts strotyps et restreints,


anormale soit dans son intensit, soit dans son orientation ;

Adhsion apparemment inflexible des habitudes ou des rituels spcifiques et non


fonctionnels ;

Manirismes moteurs strotyps et rptitifs (par exemple battement ou torsion des mains
ou des doigts, mouvements complexes de tout le corps) ;

Proccupations persistantes pour certaines parties des objets.

Les principaux instruments de diagnostic et dvaluation clinique de lautisme sont la CARS


(Childhood Autism Rating Scale),[19] qui est une chelle dobservation, lADI (Autism
Diagnostic Interview) et lADI-R (Autism Diagnostic Interview-Revised) [20]qui sont des
outils dentretien semi-structur avec les parents contenant une centaine de question et
lADOS (Autism Diagnostic Observation Schedule-Generic) [21] qui est un outil
dobservation semi-structur interactive de jeux et dentretiens avec lenfant, adapte au
niveau de langage et de dveloppement.

Le bilan diagnostique doit galement comprendre la recherche de pathologies associes, par


un examen visuel et auditif, une consultation neuropdiatrique et une consultation gntique,
qui peuvent donner lieu des examens complmentaires (caryotype, recherche de
remaniements gnomiques par puce ADN, recherche dX-fragile, bilan mtabolique, EEG,
IRM) (Haute Autorit de Sant, 2010).

d) Epidmiologie

Les premires tudes de la prvalence de l'autisme ont t publies dans les annes 1960
et 1970, quand on pensait que l'autisme tait une condition trs svre, gnralement

14
accompagne d'une dficience intellectuelle. [22] Ces tudes ont rapport que la prvalence
est environ quatre cinq cas pour 10.000 enfants. L'autisme a t distingu comme un
diagnostic clinique unique par l'American Psychiatric Association, avec la publication en
1980 de la troisime dition du Manuel diagnostique et statistique des troubles mentaux
(DSM-III)[23]
Des augmentations considrables de la prvalence estime des TSA aux tats-Unis ont
t rapports depuis les annes 1990. Deux tudes menes la fin des annes 1980 qui ont
utilis des critres de dpistage et de diagnostic du DSM-III pour trouble envahissant du
dveloppement, la prvalence est de 3,3 cas pour 10.000 enfants gs de 3-18 ans [24] et de
3,6 cas pour 10.000 enfants gs de 8-12 ans [25]
Pour 2012, la prvalence combine estime de TSA parmi les 11 sites de lADDM (The
Autism and Developmental Disabilities Monitoring) Network tait de 14,6 par 1.000 (1pour
68) enfants gs de 8 ans. La prvalence estime tait significativement plus leve chez les
garons de 8 ans (23,6 pour 1000) que chez les filles ges de 8 ans (5,3 pour 1000). La
prvalence des TSA estime tait significativement plus leve chez les enfants non-
hispaniques blancs gs de 8 ans (15,5 pour 1000) par rapport aux enfants non-hispaniques
noirs (13,2 pour 1000), et hispaniques (10,1 pour 1000) les enfants gs de 8 ans.
Lestimation de la prvalence variait considrablement parmi les 11 sites de lADDM
Network, allant de 8,2 pour 1000 enfants gs de 8 ans (dans la rgion du site Maryland o
seuls les dossiers de soins de sant ont t examins) 24,6 pour 1.000 enfants gs de 8 ans
(dans le New Jersey, o l'ducation et les dossiers de soins de sant ont t examins).
Lestimation de la prvalence tait plus leve dans les sites de surveillance o les dossiers
d'ducation et les dossiers mdicaux ont t examins compars aux sites o seul les dossiers
de sant ont t examins (17,1 pour 1000 et 10,7 pour 1000 enfants gs de 8 ans,
respectivement; p <0,05)[26]
Depuis lors, l'augmentation de la prvalence des TSA estime ont t mesurs, en
utilisant les donnes de l'ducation spciale et d'autres documents administratifs,[27][28] et
enqutes amricaines. [29][30]

Influence du sexe:

Le sex-ratio a peu chang depuis les premires tudes pidmiologiques, il est de 3 4


garons pour une fille. Le sex-ratio est moins lev lorsquil y a un retard mental modr

15
svre associ (2 garons pour 1 fille). En revanche, en absence de retard mental, le sex ratio
est plus lev (6 garons pour 1 fille).[31]

La proportion dautres enfants atteints dans les fratries avec un enfant dj atteint est plus
importante que dans la population gnrale (environ 22 fois plus).[32] [33] Les risques de
rcurrence sont respectivement de 4% et 7% si lenfant affect est un garon ou une fille.[34]

e) Causes
Les tiologies du syndrome autistique restent en grande partie inconnues. Nanmoins,
plusiers tudes ont montr limplication des facteurs gntiques et environnementaux

i. Facteurs Environnementaux :

De nombreux facteurs environnementaux ont t proposs comme facteurs de risque


dautisme ; peu dentre eux ont t valids de manire concluante. Les facteurs de risque
documents ce jour sont :

- les notions de souffrances nonatales : hypoxie, traumatisme, ictre, anmie, complications


obsttricales, incompatibilit rhsus foeto-maternelle, ainsi que les naissances multiples et le
faible poids par rapport lge gestationnel mme si les tudes sont parfois discordantes sur
limpact individuel de chacun de ces facteurs.[35]

- parmi les expositions toxiques : lexposition prnatale au thalidomide et au valproate,


auxquels peuvent sajouter les antidpresseurs.[36]

- parmi les expositions infectieuses : les infections virales prnatales ou prinatales par le
virus de la rubole ou le cytomgalovirus.[37]

Lapport maternel lev de certains lments nutritifs et de supplments a t associe une


rduction du risque de TSA, avec une forte vidence pour les supplments d'acide folique
priconceptionnelle. Bien que de nombreuses tudes aient suggr aucun impact du tabagisme
maternel et la consommation d'alcool sur les TSA, une valuation de l'exposition plus
rigoureuse est ncessaire. Un certain nombre d'tudes ont dmontr une augmentation
significative du risque de TSA avec l'exposition estime la pollution de l'air pendant la
priode prnatale, en particulier pour les mtaux lourds et les matires particulaires. Peu de

16
recherches ont valu d'autres polluants organiques persistants et non persistants en
association avec lautisme.[38]

ii. Facteurs Gntiques :

En 1977, Folstein et Rutter ont publi la premire tude sur des jumeaux autistes. Ils ont
montr que le taux de concordance tait beaucoup plus lev chez les jumeaux monozygotes
(MZ) que chez les jumeaux dizygotes (DZ). Cette constatation a t reproduite dans plusieurs
tudes pidmiologiques o il a t mis en vidence que lorsque lun des enfants est atteint
dautisme dans les couples MZ, la probabilit pour que le deuxime soit lui aussi autiste est
proche de 90% contrairement celle des couples de jumeaux dizygotes qui avoisine les 10%
de concordance. [39] [40] [41]

Paralllement aux tudes de jumeaux, les tudes familiales ont mis en vidence un risque
lev de rcurrence dans les fratries denfants atteints : l tude de Constantino et al. (2010)
[42]portant sur plus de 1000 familles comportant au moins un enfant atteint de TSA montrait
un risque de 10,9% davoir un second enfant atteint (soit un risque 15 fois suprieur la
population gnrale), et un risque de 20% davoir un enfant non autiste mais prsentant un
retard de langage.

Ainsi, Lhypothse gntique de lautisme jouit depuis plusieurs annes dun large soutien
des institutions, des associations de parents denfants autistes et des chercheurs. Les
investissements financiers ont t trs importants.

LInternational molecular genetics study of autism consortium (IMGSAC) a t fond en


1994 : 300 familles multiplex (familles avec deux sujets atteints ou plus) et 150 familles
simplex (un seul sujet autiste et ses deux parents) ont fait lobjet de recherches approfondies.
Des gnes candidats sur les chromosomes 2, 7 et 16 ont t plus particulirement tudis.
[43]

Le projet Paris autism research international sibpair study (PARIS study) a dbut en 1992.
En 2003 ont t identifis les gnes de la neuroligine 3 et de la neuroligine 4 associs
lautisme et au syndrome dAsperger dans deux familles.[44].

17
Plusieurs maladies gntiques rares sont associes des manifestations autistiques. Parmi ces
syndromes figurent celui de lX fragile (gne FMR1 : fragile X mental retardation 1), la
sclrose tubreuse de Bourneville (gnes TSC1 : tuberous sclerosis 1 ou TSC2), le syndrome
de Rett (mutation du gne MCP2 : methyl CpG binding protein 2), les syndromes
dAngelman et de Prader-Willi (dltion 15q11-q13, gne UBE3A : ubiquitin protein ligase
E3A), de Smith-Lemli-Opitz (anomalie du mtabolisme du cholestrol, gne DHCR7 : 7-
dehydrocholesterol [7-DHC] reductase), de Smith-Magenis (microdltion 17q11.2) ; on
trouve aussi la phnylctonurie non traite, la neurofibromatose, les syndromes de Sotos, de
Cowden et de Bannayan-Riley-Ruvalcab, de Cornelia de Lange, les maladies de San Filippo.
Dautres pathologies gntiques rares peuvent tre associes lautisme : le syndrome de
Turner, la trisomie 21, les syndromes de Williams, de Joubert, de Moebius, de Cohen (COH1
gene), de Lujan-Fryns, dAarskog, lhypomlanose dIto, la dystrophie myotonique de
Steiner, certaines maladies mitochondriales, le syndrome de Charge, le syndrome de Phelan
McDermid (microdltion 22q13) et le dficit en adnylo-succinate lyase (anomalie de la
synthse des purines).[45][46][47]

Les analyses gntiques montrent une liaison suggestive entre la rgion Xq13-q21 et
lautisme[48] et plusieurs anomalies chromosomiques affectent le bras court du chromosome
X, et plus particulirement la rgion Xp22. [49][50] Ces deux rgions candidates sur le
chromosome X, lune sur le bras court et lautre sur le bras long, pourraient expliquer la
diffrence de proportions observe entre les garons et les filles autistes. En outre, on constate
une augmentation de lincidence de lautisme chez les filles ayant un syndrome de Turner
(45,X), essentiellement lorsque le chromosome X unique est dorigine maternel. [51]

Ces observations ont permis de supposer la prsence, sur le chromosome X, dun gne soumis
empreinte parentale et impliqu dans la cognition sociale, qui pourrait galement tre
responsable de la prdisposition masculine lautisme.

iii. Approche gne candidat de lautisme :

Lapproche gne candidat se dfinit par la recherche de limplication d'un gne prcis dans
une pathologie. Pour cela, des hypothses par rapport au rle de certains gnes dans
ltiologie de la maladie sont formules, notamment si ces gnes sont situs dans une rgion
de liaison la pathologie o sils interviennent dans une voie de signalisation associe la
maladie. Le choix des gnes se fait galement par rapport leur niveau dexpression dans
certaines rgions crbrales d'intrt.

18
Durant les dix dernires annes, une centaine de gnes ont ainsi t associs lautisme,
cependant pour la majorit dentre eux, aucune association claire ni contribution vidente na
pu tre dmontre. Bien souvent les rsultats apparaissent contradictoires et lorsquune
association significative est rapporte, elle nest, la plupart du temps, pas reproduite dans une
autre population.

Malgr tout, une association positive a t rapporte pour 16 gnes dans plusieurs tudes
avec, certes, des rsultats contradictoires pour certains dentre eux, notamment pour le 76 me
gne du transporteur de la srotonine. Ces gnes peuvent tre classs en diffrentes catgories
suivant les processus biologiques dans lesquels ils interviennent. (Tableau1 )

Tableau 1 : Liste des gnes associs lautisme et leur fonction.

Gnes Fonction Observations dans l'autisme Rfrences


Structure de la chromatine et la rgulation de gne
EN2 Facteur de Diffrents allles de deux SNP ont t [52];[53];[54];[55]

transcription associ dans plusieurs tudes


homobox

HOXA1 Facteur de Une seule tude d'association positive


transcription pour un variant SNP. Une
deuxime tude a rapport des rsultats
contradictoires, cette tude a associ un
gnotype particulier avec une [56]
augmentation du primtre cranien chez
un sous groupe d' autistes.
WNT2 Facteur de Sur trois tudes ralises, une seule a
transcription montr une association avec un
variant SNP localis en 3'UTR

PTEN Supresseur de tumeur, Mutations htrozygotes observes chez [57];[58];[59]

prolifration cellulaire,
des individus autistes, macrocphales ou
maintient structure de la
avec retard mental
chromatine

19
Protine de structure de la synapse

SHANK3 Induction des Un tude rapporte : des mutations avec dcalage [60];[61];
du cadre de lecture chez deux frre d'une mme
dendrites [62]
famille, dans une deuxime famille une dltion
chez 1 patient, dans une troisime famille un
enfant non autiste avec une dltion du gne et un
enfant autiste avec une copie supplmentaire. Une
deuxime tude a dtect une mutation et deux
dltion du gne. Les mutations de ce gne restent
rares.

Rcepteurs et transporteurs
Glur6 Sous unit du 3 tudes sur des populations [63];[64]
(GRIK2) rcepteur kainate au indpendantes avec une association
glutamate positive (plusieurs SNP ou alllles)
GABA-R Sous unit du Association d'un marqueur microsatellite de [65]
l'intron 3 du gne GABRB3 dans 3 tudes, mais 4
rcepteur
autres tudes n'ont pas observes d'association. 3
GABAergique
autres tudes ont rapportes une association avec
diffrents haplotypes, SNP ou microsatellites
situs proches des gnes GABRB3 et GABRG3
(15q
11-13). l'association la plus puissante a t
rapporte pour un SNP localis au niveau du gne
GABRA4 (4p). Plusieurs anomalies
chromosomiques observes dans la rgion 15q11-
13.
SLC25A12 Transporteur Etudes Cas-contrles et TDT : 2 tudes [66]
mithochondrial
d'association positive (lvation du
glutamate/aspartate
facteur de risque pour un haplotype GG),
calcium dpendant
2 tudes ngatives
MET Rcepteur tyrosine Variant fonctionnel dans le promoteur, [67];[68]; [69]
kinase plusieurs SNP et allles, mutations rares.
Diminution de la protine dans le cerveau
post-mortem d'autistes.

20
SLC6A4 Transporteur de la Beaucoup d'tudes contradictoires. Plusieurs [70]; [71]
srotonine associations ont t rapportes pour diffrents
polymorphismes, dont un polymorphisme
fonctionnel situ dans le promoteur (5-
HTTLPR) et un polymorphisme VNTR
localis dans l'intron 2. Une augmentation des
comportements obsessionnels compulsifs est
rapporte associe un gnotype du VNTR et
pour 2 polymorphismes SNP.

OXTR Rcepteur 3 tudes sur des populations [72];[73]; [74]


l'ocytocine indpendantes avec une association
positive (SNP et haplotype)

Molcules dadhsion cellulaire


NLGN4 Mutations de ces deux gnes dans deux paires de [75];[76];
frres autistes dans une tude. Mutations avec
NLGN3 Synaptognse [77]
dltion de 2pb dans le gne NLGN4 dans une
famille comprenant des individus autistes et
retards mentaux. Une mutation dans le promoteur
NLGN4 avec effet fonctionnel a t rapporte
chez un patient autiste. Deux autres tudes ont
rapport des mutations faux sens ou exonique dans
le gne NLGN4 chez des autistes. Une tude relate
une mutation ponctuelle du gne NLGN3. Les
mutations de ces gnes sont rares, plusieurs tudes
rapportent des donnes non significatives
CNTNAP2 Migration neuronale Expression prfrentielle de la protine au [78];[79];
niveau des lobes frontal et
temporal [80]
antrieurs, Mutation reponsable d'un dcalage
du cadre de lecture (exon 22) observe dans
une population d'autistes de la communaut
Amish. Transmission d'un allle SNP
particulier de l'intron situ entre les exons 2 et
3. Plusieurs variants rares ont t mis en

21
vidence chez des autistes. Des variants ont
t associs un index de retard de langage.
Protines secrtes
RELN Migration 3 tudes ont associ une rptition de [81];[82];
neuronale, trinuclotides en 5'UTR avec l'autisme, 5 [83]
synaptognse autres tudes n'ont pas montr
d'association
LAMB1 Migration Association avec des variants fonctionnels [84]; [85]
cellulaire, rares dans 2 tudes (mutation nonsens
croissance des dans exon 30, 2 SNP dans intron 25)
neurites
[86]

Figure 1 : Rgions de susceptibilit lautisme (en rouge : tudes de liaison), (en jaune : tudes dassociation sur
gnome entier), (en vert : CNV), (en bleu : gnes candidats), rpliques dans plusieurs tudes.[87]

22
f) Les Neuroligines :
Les Neuroligines sont des molcules d'adhsion cellulaire situes du ct postsynaptique du
synapse. Les Neuroligines interagissent avec les b-neurexines et cette interaction est
implique dans la formation des synapses fonctionnelles.[88]
Les neuroligines ont une taille variable suivant le rsultat de l'pissage alternatif allant d'une
centaine plus de 1000 acides amins.[89]

De nombreuses espces (au moins 39 recenses ce jour sur NCBI/protein) expriment les
neuroligines.
La famille des Neuroligines chez lhomme compte 5 membres [90] :
- Neuroligin-1
- Neuroligin-2
- Neuroligin-3 : Protine membranaire implique dans les interactions cellule-cellule par
l'intermdiaire de ses interactions avec les membres de la famille des neurexines . Joue un rle
dans le fonctionnement des synapses et la transmission du signal synaptique, et peut arbitrer
ses effets en regroupant d'autres protines synaptiques. Peut favoriser la formation initiale des
synapses, mais nest pas indispensable pour cela. Peut aussi jouer un rle dans la glie-glie ou
interactions glie-neurones dans le systme nerveux priphrique en dveloppement (par
similitude). [91]

Figure 2 : Structure 3D de la protine NLGN3.

23
Figure 3 : Localisation chromosomique Xq13.1.

Le gne NLGN3 est localis dans la partie 13.1 du bras long du chromosome X.
- Neuroligin-4 X-linked
- Neuroligin-4 Y-linked

2. Problmatique :
La prvalence de lautisme est devenue trs leve, cependant, au Maroc, les gnes candidats
de lautisme ne sont pas encore connus, la recherche est dans limmobilisme total.

3. Objectifs du travail :

Lobjectif de ce travail est de rechercher des mutations dans les exons du gne de la
Neuroligine 3 (NLGN 3) dans notre groupe de patients marocains.

24
Partie exprimentale

25
II. Matriel et Mthodes :

1. Recrutement des familles

Nous avons reu un avis favorable du Comit d'Ethique de la Facult de Mdecine et de


Pharmacie de Rabat pour que cette tude sur la recherche des gnes responsables de l'autisme,
soit mise en uvre et ralise. Des familles ayant au moins un enfant autiste ont t vues en
consultation pdopsychiatrique par lquipe du Pr Hassan KISRA (Centre de
Pdopsychiatrie, hpital Arrazi de Sal). Une chelle de diagnostic reconnue de l'autisme,
ADI-R (Autism Diagnostic Interview Revised) [92] a t utilise pour le diagnostic et
l'valuation de l'autisme. Il sagit dun entretien semi-structur dorigine anglo-saxon. Il est
destin obtenir des descriptions dtailles des comportements qui sont ncessaires au
diagnostic de lautisme et des autres troubles envahissants du dveloppement partir de 18
mois. Il est rempli avec les parents ou la personne qui soccupe principalement de lenfant.
Lentretien cible principalement les caractristiques diagnostiques cls, savoir les
anomalies des interactions sociales rciproques, la communication et les comportements et
intrts restreints et strotyps. Les informations recueillies permettent de poser un
diagnostic par un algorithme avec des niveaux de sensibilit et de spcificit levs
suprieurs. Ces familles ont t recrutes aprs avoir obtenu leurs consentements clairs pour
participer cette tude. Des prlvements sanguins ont t effectus.

2. Prlvement de sang:
Le prlvement de sang a t effectu pour les parents et les enfants atteints, le sang a t
recueilli dans un tube contenant lEDTA comme anti-coagulant.

3. Extraction dADN gnomique partir du sang total :


Lextraction dADN gnomique a t effectue partir du sang total en utilisant la mthode
phnol chlorophorme (voir protocole dtaill en annexe). 104 chantillons des trios
autistiques dont 36 enfants autistes, on t faites .

a) Principe:

L'extraction de l'ADN est une technique permettant d'isoler l'ADN de cellules ou de tissus.
L'ADN ainsi extrait peut ensuite tre utilis pour des recherches de biologie molculaire,

26
telles que le squenage, la PCR ou le clonage. Il existe diffrents protocoles pour extraire
l'ADN, qui suivent approximativement le mme schma de principe :

Lyse des cellules


Elimination des protines
Concentration de l'ADN par prcipitation l'alcool

b) Procdure:
Lyse des globules rouges
Nous avons pris 1 ml du sang total pralablement extrait, nous avons ajout 4 ml de
Tris/EDTA 20/5mM, puis nous avons centrifug 10-15 min 4500RPM.
On observe la sdimentation dun culot contenant les globules blancs, la phase suprieure
contient les globules rouges lyses dont on se dbarasse par la suite.
Lopration a t rpete jusqu apparition dun culot clair ou dune phase suprieure
claire.
Lyse des globules blancs
Une fois le culot clair obtenu, nous lavons transfr sur un tube eppendorf de 2ml, nous
lui avons rajout 300l de tampon dextraction qui contient le SDS (Sodium Dodcyl
Sulfate : permet de dsagrger les membranes cellulaires et de librer le contenu
cytoplasmique et nuclaire) ensuite nous avons ajout 20 l de Protinase K (10mg/ ml)
qui a pour effet de librer lADN dans le milieu et de digrer les protines associes.
Ensuite nous avons incub 50C dans un bain marie pendant toute la nuit.
Elimination des protines non digres
Cette tape a t ralise par un phnol-chloroforme, le phnol est un dprotinisant dans
lequel les acides nucliques ne sont pas solubles. Lextraction phnolique est utilise
chaque fois que les acides nucliques doivent tre dbarrasses des protines (purification
de lADN partir des cellules).
Aprs avoir incub toute la nuit, nous avons obtenu une solution claire, on ajoute 300l de
phnol satur au Tris, ensuite on centrifuge 7000rpm pendant 15 min.
Aprs centifugation, on observe 2 phases, la phase surnageant qui contient les acides
nucliques en solution, la phase organique infrieure qui contient le Phnol et les lipides,
dans lintephase se trouvent les protines prcipites.
On rcupre le surnageant tout en vitant de prendre les protines interphasiques, on rpte
cette opration deux fois avant de passer llimination du Phnol.

27
Elimination des traces de Phnol
Aprs avoir recueilli la phase suprieure, nous avons procd lajout du chloroforme
isoamylique,ce dernier permet dliminer les traces de phnol qui auraient pu tre
emportes avec la phase aqueuse et qui sont inhibitrices des ractions enzymatiques.
Aprs centrifugation, nous avons rcupr nouveau la phase suprieure contenant
lADN en solution, la phase organique contenant le reste du phnol, de protines et de
lipides reste au fond du tube.

Prcipitation lalcool de lADN

LADN est prcipit par lalcool Ethylique absolu froid (-20C), il prcipite sous forme de
filaments visibles lil nu, qui sont rcuprs par centrifugation 10000rpm pendant
environ un quart dheure.

Figure 4 : ADN prcipit lEthanol.

4. Dosage de lADN.
La quantit ainsi que la puret de lADN extrait sont values par lecture de la DO (densit
optique) laide du spectrophotomtre Nanovue de Cytochrom, nous avons pris 2l de la
solution dADN gnomique extrait auparavant.

28
La puret dun chantillon dADN est indique par labsorbance du ratio 260/280. LADN
Pur prsente un ratio 260/280 compris entre 1.8 et 2.

5. Gne de la neuroligine 3.
La squence du gne humain de la neuroligine3 a t obtenue en utilisant la base de donnes
ensembl genome (www.ensembl.org). Ce gne comporte 7 exons de diffrente taille.

6. Choix des amorces.


Le choix des amorces est une tape cruciale pour la russite de la PCR. Nous avons donc
utilis le logiciel Primer 3 pour obtenir des amorces permettant damplifier chaque exon du
gne. Un certain nombre de paramtres ont t vrifis par le logiciel pour le choix des
amorces :
-Absence de dimres et pingles cheveux damorces
-Pourcentage de GC entre 40 et 60%
-Compatibilit des amorces sens et antisens (la diffrence des Tm des amorces ne doit pas
exceder 2 3 C

Ensuite nous avons effectu un blast pour vrifier la spcificit des amorces. Les squences
des amorces slctionnes sont reprsentes dans le tableau 3 .

7. PCR classique.
La PCR (polymerase chain reaction) est une mthode de biologie molculaire d'amplification
gnique in vitro, qui permet de dupliquer en grand nombre une squence dADN.
Avant de procder la pr-PCR des dilutions de 25ng/l ont t faites pour chaque
chantillon dADN. La mise au point des conditions damplifications de chaque couple
damorce a t dabord ralis. (tableau 3)
La raction de PCR est ralise dans un volume final de 50l contenant:
- 5 l dADN (en total 125 ng dADN)
- 2 l dAmorce forward (5pmol./ l) de lexon amplifier
- 2 l dAmorce Reverse (5pmol/ l) de lexon dsirant amplifier
- 25 l de MixTaq Bioline contenant les ingrdients ncessaires la PCR (dNTP, Mgcl2,
tampon et la Taq Polymrase active 95C.
- 16 l deau strile DNase free RNase free.

29
Les tubes sont places dans un thermocycleur. Aprs 3 minutes de dnaturation 94C, le
mlange ractionnel a t soumis 35 cycles damplification (dnaturation 94C pendant
30s, hybridation une temprature variant de 58C 60C selon le couple damocre pendant
30s, et longation 72C pendant 30s) suivie dune longation finale 72C pendant 5mn.

Tableau 2 : Mise au point des conditions damplification de chaque couple


damorce.

Amorces Taille de Tm Nombre de


lamplicon Cycles
Couple amorce exon 1 284 58C 35
Couple amorce exon 2 851 60C 35
Couple amorce exon 3 256 58C 35
Couple amorce exon 4 358 60C 35
Couple amorce exon 5 382 58C 35
Couple amorce exon 6 963 58C 35
Couple amorce exon 7 991 58C 35
Tableau 3: Amorces des exons du gne NLGN3.

Tm Taille du
Nom de lamorce Squence 5 -> 3 (C) produit de
PCR (pb)
NLGN3 Exon1F TGGCACAAAAGGAGTTAATGG 58C 284
NLGN3 Exon1R AGTGGAGGAGCCTGGGATT
NLGN3 Exon2F CTGGGCATGTGAAACCTCTC 60C 851

30
NLGN3 Exon2R CATGCAAGCCACAAACACAG
NLGN3 Exon3F CTGCAGTCATGCTGTTTTTGA 58C 256
NLGN3 Exon3R GGAACAGAAACACACCAACG
NLGN3 Exon4F CACCTGGGATAGCTTTGCTG 60C 358
NLGN3 Exon4R GCACCAGCTAGAGAAGCAAG
NLGN3 Exon5F TATTCCCACCTCCCCTGTTG 58C 382
NLGN3 Exon5R AAGAGAGCTGGCCGATTCC
NLGN3 Exon6F CAGCCTCAGTGACAAAGGAA 58C 963
NLGN3 Exon6R GGAAGGGATATGATGGAAGAGG
NLGN3 Exon7F AGGTTTGGCTGTCAGAGGAA 58C 991
NLGN3 Exon7R TGCATGTGTTCCTGGATCTG

8. Electrophorse sur Gel dAgarose.


Afin de vrifier la qualit de lamplification, une migration sur gel dagarose a t faite. Pour
les exons de petite taille, nous avons migr dans un gel de 2%, pour ceux de grande taille, un
gel de 1% a t utilis.

Tableau 4 : Concentrations du gel d'agarose selon la taille des exons.

N de lexon Taille Concentration du gel


dagarose (g/100ml)
1 284 2%
2 851 1%
3 256 2%
4 358 2%
5 382 2%
6 963 1%
7 991 1%

31
Prparation du gel dagarose:

A 100 ml du TBE 1X sont ajouts 2g ou 1g (selon lexon) dagarose, le mlange est port
bullition au four micro-ondes. 5l du BET sont ajouts et le mlange est coul dans le
portoir gel puis a t laiss polymriser.

Migration:

Le gel est plac dans la cuve lectrophorse contenant du TBE 1X. 8l dADN et 3l du
tampon de charge sont mlangs puis dposs dans les puits du gel. 5 l du marqueur de
poids molculaire de 100pb jusqu 1000pb sont galement dposs dans un puit.
Llectrophorse est ralise voltage constant de 100V, amprage de 100mA pendant 45
min. Le gel est visualis ensuite sous lumire UV.

9. Squenage.
Nous avons envoy nos produits de PCR la division UATRS du CNRST pour raliser le
squenage.

VI. Rsultats

1. Extraction dADN et Dosage :

Les ADN de 104 chantillons ont t extraits, la DO du Ratio 260/280 est suprieure
1.6 pour 39 chantillons (37,5%), comprise entre 1.5 et 1.6 pour 38 chantillons
(36,5%), et pour 27 la DO est infrieure 1.5 (26%) (Voir Tableau 6). Partant de ce
tableau rcapitulatif, Nous avons refait les extractions des ADNs pour les chantillons
dont labsorbance du ratio tait infrieur 1.5 afin dobtenir des ADN de bonne
qualit.

Tableau 5 : Rsultat des extractions et des Dosages des Densits Optiques.

Date Numro Concentration ng/ul Ratio 260/280


03/03/2016 150 790 1,6
03/03/2016 250 764 1,6
03/03/2016 350 878 1,6
03/03/2016 152 288 1,54
03/03/2016 252 490,5 1,587

32
03/03/2016 352 456 1,8
09/03/2016 17 1032 1,351
09/03/2016 27 2611 1,354
09/03/2016 37 417 1,258
09/03/2016 18 1066 1,366
09/03/2016 28 966,5 1,328
09/03/2016 38 1070 1,367
09/03/2016 127 727,5 1,29
09/03/2016 227 989,5 1,36
09/03/2016 327 602,5 1,26
09/03/2016 130 803 1,306
09/03/2016 230 2163 1,315
09/03/2016 330 5392 1,317
10/03/2016 151 334 1,59
10/03/2016 251 1707 1,646
10/03/2016 351 3069 1,72
10/03/2016 125 1620 1,783
10/03/2016 225 992 1,724
10/03/2016 325 543,5 1,601
10/03/2016 129 1635 1,739
10/03/2016 229 560 1,729
10/03/2016 329 977,5 1,699
10/03/2016 152 288 1,54
10/03/2016 252 490,5 1,587
11/03/2016 132 438 1,724
11/03/2016 232 185 1,504
11/03/2016 332 347 1,532
11/03/2016 133 293,5 1,553
11/03/2016 233 478 1,572
11/03/2016 333 83,5 1,546
11/03/2016 135 200 1,493
11/03/2016 235 220 1,497
11/03/2016 335 82 1,491
11/03/2016 136 216 1,516
11/03/2016 236 120 1,481
11/03/2016 336 374,5 1,513
15/03/2016 17 177,5 1,766
15/03/2016 27 746,5 1,75
15/03/2016 37 118 1,628
15/03/2016 18 132,5 1,559
15/03/2016 28 80 1,649
15/03/2016 38 218 1,541
15/03/2016 127 294,5 1,601

33
15/03/2016 227 236 1,568
15/03/2016 327 754,5 1,788
15/03/2016 130 139,5 1,55
15/03/2016 230 202,5 1,633
15/03/2016 330 154,5 1,569
15/03/2016 135 156 1,617
15/03/2016 235 155,5 1,563
15/03/2016 335 202,5 1,594
16/03/2016 430 103,5 1,739
16/03/2016 134 248,5 1,506
16/03/2016 234 74,5 1,568
16/03/2016 334 144 1,8
16/03/2016 138 39,5 1,549
16/03/2016 238 10,7 1,466
16/03/2016 338 13,5 1,517
16/03/2016 139 90,5 1,676
16/03/2016 239 47 1,679
16/03/2016 339 143,5 1,761
16/03/2016 439 112,5 1,563
17/03/2016 131 187.5 1.488
17/03/2016 231 27.5 1.447
17/03/2016 331 200 1.439
17/03/2016 137 201.5 1.550
17/03/2016 237 463 1.470
17/03/2016 337 266 1.396
17/03/2016 142 244 1.600
17/03/2016 242 528.5 1.665
17/03/2016 342 1098 1.559
17/03/2016 141 107.5 1.433
17/03/2016 341 221.5 1.424
18/03/2016 155 306 1.744
18/03/2016 255 410.5 1.632
18/03/2016 355 615 1.633
22/03/2016 131 260,5 1,565
22/03/2016 231 247 1,79
22/03/2016 331 80 1,649
22/03/2016 337 802,5 1,603
22/03/2016 141 134 1,644
22/03/2016 341 379,5 1,506
22/03/2016 144 26,5 1,906
22/03/2016 244 58 1,589
22/03/2016 154 215 1,552
22/03/2016 254 99 1,559

34
22/03/2016 354 739 1,424
22/03/2016 143 13,4 1,669
22/03/2016 243 29,5 1,595
22/03/2016 343 143,5 1,739
22/03/2016 156 12,2 1,855
22/03/2016 256 36,5 1,553
22/03/2016 356 929,5 1,45
23/03/2016 140 31 1,59
23/03/2016 240 58,5 1,539
23/03/2016 340 258,5 1,548
23/03/2016 128 151,5 1,562
23/03/2016 228 134 1,481
23/03/2016 328 130 1,503

2. PCR
Jai amplifi les 7 exons du gne de la Neuroligine 3 par PCR classique en utilisant les
ADNs extraits des enfants autistes qui sont au nombre de 36. Jai donc effectu 252
ractions de PCR, ensuite jai effectu des lectrophorses sur gel dagarose pour
vrifier mes amplifications pour chaque chantillon et chaque exon. La figure 5
reprsente des exemples des rsultats de PCR

Le tableau 7 rcapitule les rsultats des PCR aprs confirmation avec lElectrophorse
Parmi 252 raction de PCR qui ont t faites, 173 ont march. (Voir Tableau 7)

Tableau 6: Rsultat des PCR aprs confirmation par Electrophorse.

Exon 1 Exon 2 Exon 3 Exon 4 Exon 5 Exon 6 Exon7 Nombre


325 x x 2
329 x x 2
350 x x 2
351 x x 5
352 x x x x x 3
332 x x x 2
333 x x x 3
37 x x x x x x x 7
38 x x x x x x x 7

35
327 x x x x x x 6
330 x x x x x x 6
335 x x x x x x 6
334 x x x x x x 6
328 x x x x 4
333 x x x x 4
337
339 x x x x 4
439 x x x x x 5
341
342 x x x x 4
336 x x x x 4
340 x x x x x x 6
343 x x x x x 5
354 x x x x x x 6
355 x x x x x x 6
356 x x x 3
430 X x x x x x 6
31 X X X x x 5
37 X X X x x X 6
38 X X X x x X 6
39 X X X x x X 6
310 X X X x x X 6
311 X X X x x X 6
312 X X X x x X 6
313 X X X x x X 6
317 X X X x x X 6
322 X X X x x X 6
Total 32 32 24 16 20 28 21 173

36
Figure 5 : Exemple dElectrophorse sur gel dAgarose Exon1.

Figure 6 : Exemple d'Electrophorse pour Exon 2.

37
Figure 7 : Exemple d'Electrophorse Exon 3.

Figure 8 : Exemple d'Electrophorse Exon 4.

38
Figure 9 : Exemple d'Electrophorse pour Exon 5.

Figure 10 : Exemple d'Electrophorse Exon 6.

39
Figure 11 : Exemple d'Electrophorse Exon 7.

3. Squenage
Nous avons eu les rsultats de squenage de 13 patients pour les 7 exons du gne de
la neuroligine 3. Nous avons analys les donnes de squences par le logiciel Chromas
lite (Figure 12) ensuite nous avons effectu un blast pour faire un alignement de nos
squences avec la squence de rfrence de la neuroligin 3 prsente dans les bases de
donnes (Figure 13). Aucune mutation na t retrouve chez ces patients.

Figure 12 : Rsultat de squenage de l'exon 5 du patient 37 analys par le logiciel


Chromas lite.

40
Figure 13 : Blast de la squence de lexon 5 du patient 37.

VII. Discussion
Le but de mon travail tait de caractriser limplication du gne candidat de la
neuroligine 3 (NLGN3) chez les patients autistes marocains. Plusieurs tudes ont
montr quil est possible de dtecter certaines mutations dans le gne NLGN3. Dans
une famille sudoise avec deux frres touchs, l'un avec l'autisme typique et l'autre
avec syndrome dasperger, Jamain et al. ont identifi une transition C T de la
NLGN3 hrite de la mre qui par consquent change un rsidu arginine hautement
conserve en cystine (R451C) dans le domaine estrase de la molcule [93]. Un
modle animal chez la souris portant la mutation R451C a t gnr. Ces souris
mutes prsentent une altration des interactions sociales et un comportement
autistique. [94] Des expriences de Ylisaukko-oja et al. ont permis de trouver la
variante de 222C>T NLGN3comme seule variante identifie.[95]. Jindan et al. ont
identifi dans une cohorte Chinoise, une variante intronique commune, rs4844285 SNP
dans le gne NLGN3 et son association avec le TSA.[96]. Blasi et al. Ont montr une
absence des mutations dans les rgions codantes de NLGN3 dans une tude sur 124
males de lInternational Molecular Genetic Study of Autism Consortium
(IMGSAC).[97]. Nos rsultats prliminaires de squenage des 13 patients autistes ont

41
montr une absence de mutations dans le gne NLGN3. Nous devrons complter nos
rsultats par le squenage des autres patients pour dterminer la prsence ou non des
mutations chez nos patients.
Jai amplifi les 7 exons de NLGN3 pour 36 patients ce qui correspond 252
ractions de PCR effectues, 173 ont bien march et nous avons obtenu des bandes
uniques de produit de PCR des tailles attendues. Nous avons dj refait des PCR
pour quelques chantillons qui nont pas march mais nous navons pas eu
damplification. On suppose quil aurait probablement une mutation ou une dltion
lendroit des amorces ce qui probablement empcherait lhybridation. Pour vrifier
cette hypothse nous envisageons choisir dautres amorces des endroits diffrents et
refaire les amplifications pour ces chantillons.

VIII. Conclusion et Perspectives


Nous avons ralis une tude pilote sur limplication du gne candidat de la neuroligin
3 chez nos patients autistes et nous avons eu des rsultats prliminaires qui seront
complts par le squenage des autres patients.
Notre quipe est entrain de dvelopper un programme de recherche sur lidentification
des caractristiques gntiques de lautisme dans la population Marocaine afin de
dpister cette maladie le plus prcocement possible et de rduire son impact sur la
sant publique. Dautre part, nous dsirons dfinir des phnotypes comportementaux
ou syndromiques prcis correspondant aux anomalies molculaires qui auront t
identifies. En effet, la confrontation des donnes cliniques (pdopsychiatriques,
neuropdiatriques) et gntiques permettra de dfinir des phnotypes autistiques
particuliers ce qui permettra dorienter, dans lavenir, les explorations tiologiques des
enfants.

42
Annexe :

Protocole dextraction dADN:

- Prlever 1 ml de sang dans un tube de 5 ml.

-Ajouter 4 ml de Tris/EDTA 20/5 mM.

- Centrifuger 10-15 min 4500 RPM 4C.

-Enlever le surnageant.

- Ajouter du Tris/EDTA 20/5 mM.

- Centrifuger et rpter jusqu lobtention dun culot clair.

- Rcuprer le culot et ajouter 300 l de tampon dextraction contenant le SDS


dans un tube Eppendorf de 2 ml ou 1,5ml.

- Ajouter 20 l de Protinase K (10 mg/ml)

- Incuber toute la nuit 42 ou 50C.

- Aprs lobtention dune solution claire, ajouter 300 l de Phnol satur au Tris.

- Centrifuger 7000 RPM pendant 15min.

- Rcuprer le surnageant.

- Ajouter au surnageant 300l de Phnol.

-Centrifuger 7000 RPM pendant 15 min.

- Rcuprer le surnageant.

- Ajouter au surnageant 300l de Chloroforme isoamylique.

- Centrifuger 7000 RPM pendant 15 min.

- Rcuprer le surnageant.

43
- Ajouter 2V (600l) dEthanol absolu -20C.

- Bien agiter la main jusqu obtention de la mduse.

- Rcuprer la mduse par la micropipette ou par centrifugation.

-Ajouter 100l deau ultra pure.

- Congeler -20C.

Prparation des solutions:

- Tris 20mM pH 8, EDTA 5mM, (40ml Tris 1 M pH 8, 20 ml EDTA 0,5 M pH


8, H20 qsp 2000 ml).

- Protinase K (10 mg/ ml) dans H20 (Dnase free, MilliQ autoclave), aliquote
et garge congele -20C.

- Tampon de lyse ou dextraction : Tris 10 mM pH 8, EDTA 100 mM, SDS


0,5%, ( 1 ml Tris 1M pH 8, 20 ml EDTA 0,5 M pH 8, 2,5 ml SDS 20%, H20 qsp
100 ml ).

- Tris 1 mM pH 8, EDTA 1 mM, ( 10 ml Tris 1 M pH 8, 2 ml EDTA 0,5 M pH


8, H20 qsp 1000ml).

- Phnol satur au Tris.

- Chlorophorme Isoamylique.

44
Rfrences bibliographiques :

1. SAJIDI, M.H.,2009. RAPPORT - LA SITUATION DE L'AUTISME AU MAROC.


2. Pinto D., Delaby E., Merico D., Barbosa M., Merikangas A., Klei L., Thiruvahindrapuram B., Xu
X., Ziman R., Wang Z., et al. 2014. Convergence of genes and cellular pathways dysregulated
in autism spectrum disorders. Am. J. Hum. Genet. ;94:677694. doi:
10.1016/j.ajhg.2014.03.018.
3. Sdhof T.C. 2008. Neuroligins and neurexins link synaptic function to cognitive disease.
Nature. ;455:903911. doi: 10.1038/nature07456.
4. Kanner, L., 1968. Autistic disturbances of affective contact. Acta Paedopsychiatrica, 35(4): p.
100-36.
5. Friedman E. 1969 The autistic syndrome and phenylketonuria. Schizophrenia

6. Cantwell, D.P., L. Baker, and M. Rutter, Families of autistic and dysphasic children. I. Family
life and interaction patterns. Arch Gen Psychiatry, 1979. 36(6): p. 682-7.
7. Kanner, L.,1968. Autistic disturbances of affective contact. Acta Paedopsychiatrica, 35(4): p.
100-36.
8. Folstein S, Rutter M. 1977. Infantile autism: a genetic study of 21 twin pairs. J. Child Psychol.
Psychiatry 18:297321
9. Ritvo ER, Freeman BJ, Mason-Brothers A, et al. 1985. Concordance for the syndrome of
autism in 40 pairs of afflicted twins. Am. J. Psychiatry 142:7477
10. Gillberg C, Wahlstr om J. 1985. Chromosome abnormalities in infantile autism and other
childhood psychoses: a population study of 66 cases. Dev. Med. Child Neurol. 27:293304
11. Wahlstr om J, Gillberg C, Gustavson KH, et al. 1986. Infantile autism and the fragile X. A
Swedish multicenter study. Am. J. Med. Genet. 23:4038
12. American Psychiatric Association. 2000. Diagnostic and Statistical Manual of Mental
Disorders.Washington, DC: Am. Psychiatr. Assoc.
13. Geschwind, D.H., 2009. Advances in Autism. Annual Review of Medicine,
14. Hazlett HC, Poe M, Gerig G, et al. 2005. Magnetic resonance imaging and head circumference
study of brain size in autism: birth through age 2 years. Arch. Gen. Psychiatry 62:136676
15. Fombonne E, Roge B, Claverie J, et al. 1999. Microcephaly and macrocephaly in autism. J.
Autism Dev. Disord. 29:11319
16. Geschwind DH, Levitt P., 2007. Autism spectrum disorders: developmental disconnection
syndromes. Curr. Opin. Neurobiol. 17:10311
17. Volkmar FR, Pauls D., 2003. Autism. Lancet 362:1133-1141
18. Hara H., 2007. Autism and epilepsy: a retrospective follow-up study. Brain Dev 29:486-490
19. Schopler E, Reichler RJ, DeVellis RF, Daly K., 1980. Toward objective classification of
childhood autism: Childhood Autism rating Scale (CARS). J Autism Dev Disord 10:91-103
20. Lord C, Rutter M, Le Couteur A., 1994. Autism Diagnostic Interview-Revised: a revised version
of a diagnostic interview for caregivers of individuals with possible pervasive developmental
disorders. J Autism Dev Disord 24:659-685
21. Lord C, Risi S, Lambrecht L, Cook EH, Jr., Leventhal BL, DiLavore PC, Pickles A, Rutter M.,
2000. The autism diagnostic observation schedule-generic: a standard measure of social and
communication deficits associated with the spectrum of autism. J Autism Dev Disord 30:205-
223
22. Gillberg, C. and L. Wing, 1999. Autism: not an extremely rare disorder. Acta Psychiatr Scand,
99(6): p. 399-406.
23. American Psychiatric Association. Diagnostic and statistical manual of mental disorders. 3rd
ed. Washington, DC: American Psychiatric Association;.

45
24. Burd L, Fisher W, Kerbeshian J. 1987. A prevalence study of pervasive developmental
disorders in North Dakota. J Am Acad Child Adolesc Psychiatry;26:7003.
25. Ritvo ER, Freeman BJ, Pingree C, et al. 1989. The UCLA-University of Utah epidemiologic
survey of autism: prevalence. Am J Psychiatry;146:1949.
26. Christensen DL, Baio J, Braun KV, et al.2012. Prevalence and Characteristics of Autism
Spectrum Disorder Among Children Aged 8 Years Autism and Developmental Disabilities
Monitoring Network, 11 Sites, United States, MMWR Surveill Summ 2016;65(No. SS-3)(No.
SS-3):123. DOI: http://dx.doi.org/10.15585/mmwr.ss6503a1
27. Croen LA, Grether JK, Hoogstrate J, Selvin S. 2002. The changing prevalence of autism in
California. J Autism Dev Disord;32:20715.
28. California Department of Developmental Services. 2003. Autistic spectrum disorders:
changes in the California caseload, an update: 1999 through 2002. Sacramento, CA: California
Health and Human Services Agency, Department of Developmental Services.
29. Blumberg SJ, Bramlett MD, Kogan MD, Schieve LA, Jones JR, Lu MC.2013. Changes in
prevalence of parent-reported autism spectrum disorder in school-aged U.S. children:2007 to
20112012. Natl Health Stat Report ;65:111.
30. Schieve LA, Rice C, Yeargin-Allsopp M, et al. 2012. Parent-reported prevalence of autism
spectrum disorders in US-born children: an assessment of changes within birth cohorts from
the 2003 to the 2007 National Survey of Childrens Health. Matern Child Health J;16(Suppl
1):S1517.
31. Fombonne E., 2003. The prevalence of autism. Jama 289:87-89
32. Schaefer GB, Mendelsohn NJ., 2008. Clinical genetics evaluation in identifying the etiology of
autism spectrum disorders. Genet Med 10:301-305
33. Lauritsen MB, Als TD, Dahl HA, Flint TJ, Wang AG, Vang M, Kruse TA, Ewald H, Mors O., 2006.
A genome-wide search for alleles and haplotypes associated with autism and related
pervasive developmental disorders on the Faroe Islands. Mol Psychiatry 11:37-46
34. Jorde LB, Hasstedt SJ, Ritvo ER, Mason-Brothers A, Freeman BJ, Pingree C, McMahon WM,
Petersen B, Jenson WR, Mo A., 1991. Complex segregation analysis of autism. Am J Hum
Genet 49:932-938
35. GARDENER, H., SPIEGELMAN, D. & BUKA, S. L. 2011. Perinatal and neonatal risk factors for
autism: a comprehensive meta-analysis. Pediatrics, 128, 344-55.
36. CROEN, L. A., GRETHER, J. K., YOSHIDA, C. K., ODOULI, R. & HENDRICK, V. 2011.
Antidepressant use during pregnancy and childhood autism spectrum disorders. Arch Gen
Psychiatry, 68, 1104-12.
37. CROEN, L. A., GRETHER, J. K., YOSHIDA, C. K., ODOULI, R. & HENDRICK, V. 2011.
Antidepressant use during pregnancy and childhood autism spectrum disorders. Arch Gen
Psychiatry, 68, 1104-12.
38. Lyall, K., R.J. Schmidt, and I. Hertz-Picciotto, 2014. Maternal lifestyle and environmental risk
factors for autism spectrum disorders. Int J Epidemiol, 43(2): p. 443-64.
39. Bailey A, Le Couteur A, Gottesman I, Bolton P, Simonoff E, Yuzda E, Rutter M., 1995. Autism
as a strongly genetic disorder: evidence from a British twin study. Psychol Med 25:63-77
40. Steffenburg S, Gillberg C, Hellgren L, Andersson L, Gillberg IC, Jakobsson G, Bohman M., 1989.
A twin study of autism in Denmark, Finland, Iceland, Norway and Sweden. J Child Psychol
Psychiatry 30:405-416
41. Ritvo ER, Freeman BJ, Mason-Brothers A, Mo A, Ritvo AM., 1985. Concordance for the
syndrome of autism in 40 pairs of afflicted twins. Am J Psychiatry 142:74-77
42. Constantino JN, Zhang Y, Frazier T, Abbacchi AM, Law P., 2010. Sibling recurrence and the
genetic epidemiology of autism. Am J Psychiatry 167:1349-1356
43. IMGSAC. 2001. A genomewide screen for autism: strong evidence for linkage to
chromosomes 2q, 7q, and 16p. Am J Hum Genet ; 69 : 570-81.
44. Jamain S, Quach H, Betancour C, et al. 2003. Mutations of the X-linked genes encoding
neuroligins NLGN3 and NLGN4 are associated with autism. Nat Genet ; 34 : 27-9.

46
45. Jamain S, Betancour C, Giros B, et al. 2003. La gntique de lautisme. Med Sci (Paris) ; 19 :
1081-90.
46. Paris Study : http://www.gs-im3.fr/autism/newsletter2006.pdf
47. Cohen D, Pichard N, Tordjman S, et al. 2005. Specific genetic disorders and autism: clinical
contribution towards their identification. J Autism Dev Disord ; 35 : 103-16.
48. Liu J, Nyholt DR, Magnussen P, et al. 2001. A genomewide screen for autism susceptibility
loci. Am J Hum Genet ; 69: 327-40.
49. Ishikawa-Brush Y, Powell JF, Bolton P, et al. 1997. Autism and multiple exostoses associated
with an X;8 translocation occurring within the GRPR gene and 3 to the SDC2 gene. Hum Mol
Genet ; 6: 1241-50.
50. Thomas NS. 1999. Xp deletions associated with autism in three females. Lancet; 353: 541-5.
51. Skuse DH, James RS, Bishop DV, et al. 1997. Evidence from Turners syndrome of an
imprinted X-linked locus affecting cognitive function. Nature ; 387: 705-8.
52. Petit E, Herault J, Martineau J, Perrot A, Barthelemy C, Hameury L, Sauvage D, Lelord G, Muh
JP., 1995. Association study with two markers of a human homeogene in infantile autism. J
Med Genet 32:269-274
53. Brune CW, Korvatska E, Allen-Brady K, Cook EH, Jr., Dawson G, Devlin B, Estes A, Hennelly M,
Hyman SL, McMahon WM, Munson J, Rodier PM, Schellenberg GD, Stodgell CJ, Coon H.,
2008. Heterogeneous association between engrailed-2 and autism in the CPEA network. Am J
Med Genet B Neuropsychiatr Genet 147B:187-193
54. Wang L, Jia M, Yue W, Tang F, Qu M, Ruan Y, Lu T, Zhang H, Yan H, Liu J, Guo Y, Zhang J, Yang
X, Zhang D., 2008. Association of the ENGRAILED 2 (EN2) gene with autism in Chinese Han
population. Am J Med Genet B Neuropsychiatr Genet 147B:434-438
55. Yang P, Lung FW, Jong YJ, Hsieh HY, Liang CL, Juo SH., 2008. Association of the homeobox
transcription factor gene ENGRAILED 2 with autistic disorder in Chinese children.
Neuropsychobiology 57:3-8
56. Freitag CM., 2007. The genetics of autistic disorders and its clinical relevance: a review of the
literature. Mol Psychiatry 12:2-22
57. Butler MG, Dasouki MJ, Zhou XP, Talebizadeh Z, Brown M, Takahashi TN, Miles JH, Wang CH,
Stratton R, Pilarski R, Eng C., 2005. Subset of individuals with autism spectrum disorders and
extreme macrocephaly associated with germline PTEN tumour suppressor gene mutations. J
Med Genet 42:318-321
58. Herman GE, Butter E, Enrile B, Pastore M, Prior TW, Sommer A., 2007. Increasing knowledge
of PTEN germline mutations: Two additional patients with autism and macrocephaly. Am J
Med Genet A 143:589-593
59. Varga EA, Pastore M, Prior T, Herman GE, McBride KL., 2009. The prevalence of PTEN
mutations in a clinical pediatric cohort with autism spectrum disorders, developmental delay,
and macrocephaly. Genet Med 11:111-117
60. Durand CM, Betancur C, Boeckers TM, Bockmann J, Chaste P, Fauchereau F, Nygren G,
Rastam M, Gillberg IC, Anckarsater H, Sponheim E, Goubran-Botros H, Delorme R, Chabane
N, Mouren-Simeoni MC, de Mas P, Bieth E, Roge B, Heron D, Burglen L, Gillberg C, Leboyer
M, Bourgeron T., 2007. Mutations in the gene encoding the synaptic scaffolding protein
SHANK3 are associated with autism spectrum disorders. Nat Genet 39:25-27
61. Gauthier J, Spiegelman D, Piton A, Lafreniere RG, Laurent S, St-Onge J, Lapointe L, Hamdan
FF, Cossette P, Mottron L, Fombonne E, Joober R, Marineau C, Drapeau P, Rouleau GA., 2009.
Novel de novo SHANK3 mutation in autistic patients. Am J Med Genet B Neuropsychiatr
Genet 150B:421-424
62. Moessner R, Marshall CR, Sutcliffe JS, Skaug J, Pinto D, Vincent J, Zwaigenbaum L, Fernandez
B, Roberts W, Szatmari P, Scherer SW., 2007. Contribution of SHANK3 mutations to autism
spectrum disorder. Am J Hum Genet 81:1289-1297

47
63. Jamain S, Betancur C, Quach H, Philippe A, Fellous M, Giros B, Gillberg C, Leboyer M,
Bourgeron T., 2002. Linkage and association of the glutamate receptor 6 gene with autism.
Mol Psychiatry 7:302-310
64. Shuang M, Liu J, Jia MX, Yang JZ, Wu SP, Gong XH, Ling YS, Ruan Y, Yang XL, Zhang D., 2004.
Family-based association study between autism and glutamate receptor 6 gene in Chinese
Han trios. Am J Med Genet B Neuropsychiatr Genet 131B:48-50
65. Vincent JB, Horike SI, Choufani S, Paterson AD, Roberts W, Szatmari P, Weksberg R,
Fernandez B, Scherer SW., 2006. An inversion inv(4)(p12-p15.3) in autistic siblings implicates
the 4p GABA receptor gene cluster. J Med Genet 43:429-434
66. Silverman JM, Buxbaum JD, Ramoz N, Schmeidler J, Reichenberg A, Hollander E, Angelo G,
Smith CJ, Kryzak LA., 2008. Autism-related routines and rituals associated with a
mitochondrial aspartate/glutamate carrier SLC25A12 polymorphism. Am J Med Genet B
Neuropsychiatr Genet 147:408-410
67. Campbell DB, Buie TM, Winter H, Bauman M, Sutcliffe JS, Perrin JM, Levitt P., 2009. Distinct
genetic risk based on association of MET in families with co-occurring autism and
gastrointestinal conditions. Pediatrics 123:1018-1024
68. Campbell DB, Sutcliffe JS, Ebert PJ, Militerni R, Bravaccio C, Trillo S, Elia M, Schneider C,
Melmed R, Sacco R, Persico AM, Levitt P., 2006. A genetic variant that disrupts MET
transcription is associated with autism. Proc Natl Acad Sci U S A 103:16834-16839
69. Sousa I, Clark TG, Toma C, Kobayashi K, Choma M, Holt R, Sykes NH, Lamb JA, Bailey AJ,
Battaglia A, Maestrini E, Monaco AP., 2009. MET and autism susceptibility: family and case-
control studies. Eur J Hum Genet 17:749-758
70. Devlin B, Cook EH, Jr., Coon H, Dawson G, Grigorenko EL, McMahon W, Minshew N, Pauls D,
Smith M, Spence MA, Rodier PM, Stodgell C, Schellenberg GD., 2005. Autism and the
serotonin transporter: the long and short of it. Mol Psychiatry 10:1110-1116
71. Freitag CM., 2007. The genetics of autistic disorders and its clinical relevance: a review of the
literature. Mol Psychiatry 12:2-22
72. Jacob S, Brune CW, Carter CS, Leventhal BL, Lord C, Cook EH, Jr. 2007. Association of the
oxytocin receptor gene (OXTR) in Caucasian children and adolescents with autism. Neurosci
Lett 417:6-9
73. Jacob S, Brune CW, Carter CS, Leventhal BL, Lord C, Cook EH, Jr. 2007. Association of the
oxytocin receptor gene (OXTR) in Caucasian children and adolescents with autism. Neurosci
Lett 417:6-9
74. Wu S, Jia M, Ruan Y, Liu J, Guo Y, Shuang M, Gong X, Zhang Y, Yang X, Zhang D., 2005.
Positive association of the oxytocin receptor gene (OXTR) with autism in the Chinese Han
population. Biol Psychiatry 58:74-77
75. Jamain S, Quach H, Betancur C, Rastam M, Colineaux C, Gillberg IC, Soderstrom H, Giros B,
Leboyer M, Gillberg C, Bourgeron T., 2003. Mutations of the X-linked genes encoding
neuroligins NLGN3 and NLGN4 are associated with autism. Nat Genet 34:27-29
76. Laumonnier F, Bonnet-Brilhault F, Gomot M, Blanc R, David A, Moizard MP, Raynaud M,
Ronce N, Lemonnier E, Calvas P, Laudier B, Chelly J, Fryns JP, Ropers HH, Hamel BC, Andres C,
Barthelemy C, Moraine C, Briault S., 2004. X-linked mental retardation and autism are
associated with a mutation in the NLGN4 gene, a member of the neuroligin family. Am J Hum
Genet 74:552-557
77. Daoud H, Bonnet-Brilhault F, Vedrine S, Demattei MV, Vourc'h P, Bayou N, Andres CR,
Barthelemy C, Laumonnier F, Briault S., 2009. Autism and nonsyndromic mental retardation
associated with a de novo mutation in the NLGN4X gene promoter causing an increased
expression level. Biol Psychiatry 66:906-910
78. Arking DE, Cutler DJ, Brune CW, Teslovich TM, West K, Ikeda M, Rea A, Guy M, Lin S, Cook EH,
Chakravarti A., 2008. A common genetic variant in the neurexin superfamily member
CNTNAP2 increases familial risk of autism. Am J Hum Genet 82:160-164

48
79. Bakkaloglu B, O'Roak BJ, Louvi A, Gupta AR, Abelson JF, Morgan TM, Chawarska K, Klin A,
Ercan-Sencicek AG, Stillman AA, Tanriover G, Abrahams BS, Duvall JA, Robbins EM,
Geschwind DH, Biederer T, Gunel M, Lifton RP, State MW., 2008. Molecular cytogenetic
analysis and resequencing of contactin associated protein-like 2 in autism spectrum
disorders. Am J Hum Genet 82:165-173
80. Alarcon M, Abrahams BS, Stone JL, Duvall JA, Perederiy JV, Bomar JM, Sebat J, Wigler M,
Martin CL, Ledbetter DH, Nelson SF, Cantor RM, Geschwind DH., 2008. Linkage, association,
and gene-expression analyses identify CNTNAP2 as an autism-susceptibility gene. Am J Hum
Genet 82:150-159
81. Persico AM, D'Agruma L, Maiorano N, Totaro A, Militerni R, Bravaccio C, Wassink TH,
Schneider C, Melmed R, Trillo S, Montecchi F, Palermo M, Pascucci T, Puglisi-Allegra S,
Reichelt KL, Conciatori M, Marino R, Quattrocchi CC, Baldi A, Zelante L, Gasparini P, Keller F,.
2001. Reelin gene alleles and haplotypes as a factor predisposing to autistic disorder. Mol
Psychiatry 6:150-159
82. Serajee FJ, Zhong H, Mahbubul Huq AH., 2006. Association of Reelin gene polymorphisms
with autism. Genomics 87:75-83
83. Skaar DA, Shao Y, Haines JL, Stenger JE, Jaworski J, Martin ER, DeLong GR, Moore JH,
McCauley JL, Sutcliffe JS, Ashley-Koch AE, Cuccaro ML, Folstein SE, Gilbert JR, Pericak-Vance
MA. 2005. Analysis of the RELN gene as a genetic risk factor for autism. Mol Psychiatry
10:563-571
84. Lamb JA, Barnby G, Bonora E, Sykes N, Bacchelli E, Blasi F, Maestrini E, Broxholme J, Tzenova
J, Weeks D, Bailey AJ, Monaco AP., 2005. Analysis of IMGSAC autism susceptibility loci:
evidence for sex limited and parent of origin specific effects. J Med Genet 42:132-137
85. Hutcheson HB, Olson LM, Bradford Y, Folstein SE, Santangelo SL, Sutcliffe JS, Haines JL., 2004.
Examination of NRCAM, LRRN3, KIAA0716, and LAMB1 as autism candidate genes. BMC Med
Genet 5:12
86. Sylviane Marouillat. 2011. Etudes des variations structurales chromosomiques dans lautisme
et la dficience mentale.
87. Freitag CM, Staal W, Klauck SM, Duketis E, Waltes R., 2010. Genetics of autistic disorders:
review and clinical implications. Eur Child Adolesc Psychiatry 19:169-178
88. Ylisaukko-oja T et al. Analysis of four neuroligin genes as candidates for autism. Eur J Human
Genetics, 2005; 13: 1285-1292.
89. Ann Marie Craig, Yunhee Kang, 2007. Neurexinneuroligin signaling in synapse development,
Curr Opin Neurobiol., vol. 17, no 1, , p. 43-52 (PMID 17275284, PMCID 2820508, DOI
10.1016/j.conb.2007.01.011)
90.
uniprot.org/uniprot/?query=neuroligin&fil=organism%3A%22Homo+sapiens+%28Hu
man%29+%5B9606%5D%22&desc=no&sort=organism
91. uniprot.org/uniprot/Q9NZ94
92. Lord C, Rutter M, Le Couteur A., 1994. Autism Diagnostic Interview-Revised: a revised
version of a diagnostic interview for caregivers of individuals with possible pervasive
developmental disorders. J Autism Dev Disord 24:659-685
93. Jamain S, Quach H, Betancur C, et al. 2003; Mutations of the X-linked genes encoding
neuroligins NLGN3 and NLGN4 are associated with autism. Nature Genetics.34(1):27-29.
doi:10.1038/ng1136.
94. Speed HE, Masiulis I, Gibson JR, Powell CM.2015. Increased Cortical Inhibition in Autism-
Linked Neuroligin-3R451C Mice Is Due in Part to Loss of Endocannabinoid Signaling. Fox MA,
ed. PLoS ONE. 10(10):e0140638. doi:10.1371/journal.pone.0140638.
95. Ylisaukko-oja T, Rehnstrom K, Auranen M, Vanhala R, Alen R, Kempas E, Ellonen P, Turunen
JA, Makkonen I, Riikonen R, et al. 2005. Analysis of four neuroligin genes as candidates for
autism. Eur J Hum Genet 13:12851292.

49
96. Jindan Yu et al. 2011. Behavioral and Brain Functions. A sex-specific association of common
variants of neuroligin genes (NLGN3 and NLGN4X) with autism spectrum disorders in a
Chinese Han cohort 7 (1), p.13 doi:10.1186/1744-9081-7-13
97. Blasi, F., Bacchelli, E., Pesaresi, G., Carone, S., Bailey, A. J. and Maestrini, E. 2006. Absence of
coding mutations in the X-linked genes neuroligin 3 and neuroligin 4 in individuals with
autism from the IMGSAC collection. Am. J. Med. Genet., 141B: 220221. doi:
10.1002/ajmg.b.30287

50