ADN : Es encargado de almacenar , mantener y expresar la

programación que constituye la bioquímica y el fenotipo de un
individuo.

Molecularmente esta constituido por : C,H,O,N,F.

Monómero: nucleótidos

ADN O DNA(Acido desoxirribonucleico)

BASES NITOGENADAS

Puricas( ADENINA , GUANINA)
Pirimidas(TIMINA, CITOCINA , URACILO)

COMPLEMENTAN
A=T ; C= G

AZUCAR :PENTOSA
MOLECULA DE FOSFATO

Características:
Forma de doble alfa hélice , dextrógira
Forma enlaces en forma horizontal ( enlaces de hidrogeno)
Vertical ( enlaces fosfodiester)

Donde se encuentra ADN
 Núcleo eucarionte
 Nucleoide procarionte
 Plásmidos
 Mitocondrias y cloroplastos
Un poco de historia
Levene quien caracterizó la estructura del nucleótido (pentosa + fosfato + base
nitrogenada).
En 1930 Levene y Kossel probaron que la nucleína era un acido desoxirribonucleico
formado por cuatro bases nitrogenadas diferentes, unidas por su grupo fosfato.

Chargaff propuso la ley de equimolecularidad, que establece que el número de bases
pirimídicas presentes en el DNA es igual al número de bases púricas, en base a la ley de
complementariedad de bases (A=T y C=G).

El experimento de Griffith

Watson y Crick
Por medio de difracción de rayos x
Identificarlos que
era doble hélice anti paralelas
5`-3`; 3`-5`

Replicación del DNA
A través del experimento de Meselson y Stahl se pudo
concluir que el proceso de replicación del DNA seguía un
esquema semiconservativo.

Dogma central de la biología

DNA RNA PROTEINA
Proceso de replicación
Requiere :

 Hebra molde de DNA
 Conjunto de enzimas

proceso que consta de 3 etapas
: Iniciación, Elongación y Terminación.

INICIO ELONGACION 1
HEBRA
LA HELICASA CONTINUA:
ROMPE LOS ENLACES DE HIDROGENO
LA RNA PRIMASA SINTETIZA
LAS SSBP ESTABILIZAN LAS HEBRAS UN PRIMER OBETENIDAS
MONOCATENARIAS O RNA CEBADOR (O
PARTIDOR) RNA DE 10 NUCELOTIDOS QUE SE UNE DE MANERA
COMPLEMENTARIA A LA CADENA MOLDE .
DESDE ESTE PUNTO LA TOPOISMOMERASA II COMIENZA LA
REPLICACION EN SENTIDO 5`-3`HASTA LLEGAR A LA ZONA DE
TERMINO ,
MIENTRAS LA TOPOISOMERASA I RETIRA EL CEBADOR Y SINTETIZA
EN SU LUGAR .
LA DNA LIGASA SELLA LAS UNIONES DE ESTOS FRAGMENTOS DE
DNA Y LA DNA POLIMERASA II BUSCA ERRORES DE REPLICACION
RNA mensajero (RNAm)

POSEE 5`UN NUCLEOTIDO ESPECIAL CAP (7METIL GUANOSINA )
IDENTIFICACION POR PARTE DEL RIBOSOMA CAMUFLAJE A LAS RNAsas.
EN EXTREMO 3´POSEE SECUENCIA REPETITIVAS DE ADENINAS CUYA
FUNCION ES PROTEGER DE RNAsas ( enzimas que degradan ADN en
citoplasma)

ELONGACION 2
HEBRA DISCONTINUA 3`5`
LA RNA PRIMASA GENERA UNA SERIE DE PRIMERS (APARIENCIA
FRAGMENTADA Ó FRAGMENTOS DE OKAZAKI)
LA DNA POLIMERASA I LLEGA A LOS ESPACIOS ENTRE LOS
FRAGMENTOS Y LA POLIMERASA II REVISA Y CORRIGUE LOS
ERRORES .

TERMINACION
LIBERACION Y SALIDA DE RNA MENSAJERO MADURO A TRADUCION
FUERA DEL NUCLEO

Rna ribosomal

Subunidad menor Formada de RNAr de 18s .+ proteinas
Función : identificar el sitio de unión de la
traducción.

Subunidad mayor: formada por RNAr de 5s, 5.8, y 28s posee cámaras
especiales del ancho de un codón para la traducción .
Arn de trasferencia
(RNAt) Es un RNA pequeño que posee una estructura en hoja de trébol, teniendo tres
brazos diferentes (más uno pequeño variable). El detalle de 5’ a 3’ es el siguiente:

Brazo TψC: Posee el nucleótido extraño Pseudouridina. o
Loop pequeño variable
Brazo anticodón: Posee una secuencia complementaria a
un codón específico de un RNA mensajero.
Brazo D: Posee el nucleótido extraño D-Hidrouracilo.

Extremo 3’: Posee la secuencia ACC, donde existe un
OH- libre, en el cual puede crearse el enlace aminoacil-
RNAt en base a la enzima aminoacil-RNAtsintetasa
(existen 20, una para cada aminoácido). En pocas
palabras, es el lugar donde se une el aminoácido
correspondiente al RNAt..

Código genético:
Def:Alfabeto genético para formar proteínas

Codón : 3 nucleotidos.

Características:
Posibilidades apareamientos 43 =64 posibles conbinaciones
Degenerado: mas de un codón puede formar la misma proteína.
codón de inicio: AUG
codón de termino : UAA, UAG, UGA.

RIBOSOMA

Traducción:
INICIO
INICIO:
SUBUNIDAD MENOR RECONOCE RNAm maduro
Se empieza la lectura con el codón AUG y el anticodon del ARN t

ELONAGACION:
La peptidil trasferasa crea un enlace peptídico y el ribosoma avanza en sentido 5
´-3´ una distancia equivalente a un codón , desplazando el metionil – RNAt de la
camara A la b
TERMINACION:

Al leer algún codón de termino se sintetiza una proteína llamada factor de
liberación a la cámara a y hace que se desacople el ribosoma

EJERCICIOS DE EXPRESION DE GENES

1. Se tiene el siguiente gen que se desea expresar: 5’-
GCCCTCAGTATTAACAGCACACTACGTTCAGTCAGTTCTGCGCCTACAACCATTC
ACT-3’
a) ¿Cómo sería el RNA mensajero de aquel gen, sabiendo que la TATA box es “TATTAA”
y el promotor corresponde a CAG?

R: Se debe hacer una secuencia complementaria a la secuencia que viene después del
promotor, sin olvidar que estamos haciendo RNA, por lo que en vez de timina utilizamos
uracilo.
5’-CAP-GUGUGAUGCAAGUCAGUCAAGACGCGGAUGUUGGUAAGUGA-
AAAAAAAAAAAAAA-3’
b) ¿Cómo sería el polipéptido primario producto de la traducción de aquél RNAm?
R: Identificar el primer codón AUG en sentido 5’3’ y separar los codones, buscando uno
de los codones de detención. Luego es muy simple: Buscar en la tabla del código genético a
que aminoácido corresponde el codón.
5’-CAP-GUGUGAUGCAAGUCAGUCAAGACGCGGAUGUUGGUAAGUGA-
AAAAAAAAAAAAAA-3’

|AUG|CAA|GUC|AGU|CAA|GAC|GCG|GAU|GUU|GGU|AAG|UGA|
Met-Gln-Val-Ser-Gln-Asp-Ala-Asp-Val-Gli-Lis
Aug-cug
leu
Glicina -serina-cysteina-glicina-fenilalalina-Fin-

Sign up to vote on this title
UsefulNot useful