ADN : Es encargado de almacenar , mantener y expresar la

programación que constituye la bioquímica y el fenotipo de un
individuo.

Molecularmente esta constituido por : C,H,O,N,F.

Monómero: nucleótidos

ADN O DNA(Acido desoxirribonucleico)

BASES NITOGENADAS

Puricas( ADENINA , GUANINA)
Pirimidas(TIMINA, CITOCINA , URACILO)

COMPLEMENTAN
A=T ; C= G

AZUCAR :PENTOSA
MOLECULA DE FOSFATO

Características:
Forma de doble alfa hélice , dextrógira
Forma enlaces en forma horizontal ( enlaces de hidrogeno)
Vertical ( enlaces fosfodiester)

Donde se encuentra ADN
 Núcleo eucarionte
 Nucleoide procarionte
 Plásmidos
 Mitocondrias y cloroplastos

Un poco de historia Levene quien caracterizó la estructura del nucleótido (pentosa + fosfato + base nitrogenada). El experimento de Griffith Watson y Crick . En 1930 Levene y Kossel probaron que la nucleína era un acido desoxirribonucleico formado por cuatro bases nitrogenadas diferentes. Chargaff propuso la ley de equimolecularidad. que establece que el número de bases pirimídicas presentes en el DNA es igual al número de bases púricas. unidas por su grupo fosfato. en base a la ley de complementariedad de bases (A=T y C=G).

3`-5` Replicación del DNA A través del experimento de Meselson y Stahl se pudo concluir que el proceso de replicación del DNA seguía un esquema semiconservativo. Dogma central de la biología DNA RNA PROTEINA .Por medio de difracción de rayos x Identificarlos que era doble hélice anti paralelas 5`-3`.

DESDE ESTE PUNTO LA TOPOISMOMERASA II COMIENZA LA REPLICACION EN SENTIDO 5`-3`HASTA LLEGAR A LA ZONA DE TERMINO .Proceso de replicación Requiere :  Hebra molde de DNA  Conjunto de enzimas proceso que consta de 3 etapas : Iniciación. INICIO ELONGACION 1 HEBRA LA HELICASA CONTINUA: ROMPE LOS ENLACES DE HIDROGENO LA RNA PRIMASA SINTETIZA LAS SSBP ESTABILIZAN LAS HEBRAS UN PRIMER OBETENIDAS MONOCATENARIAS O RNA CEBADOR (O PARTIDOR) RNA DE 10 NUCELOTIDOS QUE SE UNE DE MANERA COMPLEMENTARIA A LA CADENA MOLDE . Elongación y Terminación. MIENTRAS LA TOPOISOMERASA I RETIRA EL CEBADOR Y SINTETIZA EN SU LUGAR . LA DNA LIGASA SELLA LAS UNIONES DE ESTOS FRAGMENTOS DE DNA Y LA DNA POLIMERASA II BUSCA ERRORES DE REPLICACION .

+ proteinas Función : identificar el sitio de unión de la traducción.8. EN EXTREMO 3´POSEE SECUENCIA REPETITIVAS DE ADENINAS CUYA FUNCION ES PROTEGER DE RNAsas ( enzimas que degradan ADN en citoplasma) ELONGACION 2 HEBRA DISCONTINUA 3`5` LA RNA PRIMASA GENERA UNA SERIE DE PRIMERS (APARIENCIA FRAGMENTADA Ó FRAGMENTOS DE OKAZAKI) LA DNA POLIMERASA I LLEGA A LOS ESPACIOS ENTRE LOS FRAGMENTOS Y LA POLIMERASA II REVISA Y CORRIGUE LOS ERRORES . Subunidad mayor: formada por RNAr de 5s.RNA mensajero (RNAm) POSEE 5`UN NUCLEOTIDO ESPECIAL CAP (7METIL GUANOSINA ) IDENTIFICACION POR PARTE DEL RIBOSOMA CAMUFLAJE A LAS RNAsas. . 5. y 28s posee cámaras especiales del ancho de un codón para la traducción . TERMINACION LIBERACION Y SALIDA DE RNA MENSAJERO MADURO A TRADUCION FUERA DEL NUCLEO Rna ribosomal Subunidad menor Formada de RNAr de 18s .

donde existe un OH. . En pocas palabras. es el lugar donde se une el aminoácido correspondiente al RNAt. una para cada aminoácido). Brazo D: Posee el nucleótido extraño D-Hidrouracilo. Código genético: Def:Alfabeto genético para formar proteínas Codón : 3 nucleotidos. El detalle de 5’ a 3’ es el siguiente: Brazo TψC: Posee el nucleótido extraño Pseudouridina. Características: Posibilidades apareamientos 43 =64 posibles conbinaciones Degenerado: mas de un codón puede formar la misma proteína..libre.Arn de trasferencia (RNAt) Es un RNA pequeño que posee una estructura en hoja de trébol. teniendo tres brazos diferentes (más uno pequeño variable). en el cual puede crearse el enlace aminoacil- RNAt en base a la enzima aminoacil-RNAtsintetasa (existen 20. Extremo 3’: Posee la secuencia ACC. o Loop pequeño variable Brazo anticodón: Posee una secuencia complementaria a un codón específico de un RNA mensajero.

UGA. UAG. codón de inicio: AUG codón de termino : UAA. RIBOSOMA Traducción: INICIO INICIO: SUBUNIDAD MENOR RECONOCE RNAm maduro Se empieza la lectura con el codón AUG y el anticodon del ARN t ELONAGACION: La peptidil trasferasa crea un enlace peptídico y el ribosoma avanza en sentido 5 ´-3´ una distancia equivalente a un codón . desplazando el metionil – RNAt de la camara A la b .

TERMINACION: Al leer algún codón de termino se sintetiza una proteína llamada factor de liberación a la cámara a y hace que se desacople el ribosoma EJERCICIOS DE EXPRESION DE GENES 1. sin olvidar que estamos haciendo RNA. buscando uno de los codones de detención. sabiendo que la TATA box es “TATTAA” y el promotor corresponde a CAG? R: Se debe hacer una secuencia complementaria a la secuencia que viene después del promotor. Luego es muy simple: Buscar en la tabla del código genético a que aminoácido corresponde el codón. 5’-CAP-GUGUGAUGCAAGUCAGUCAAGACGCGGAUGUUGGUAAGUGA- AAAAAAAAAAAAAA-3’ |AUG|CAA|GUC|AGU|CAA|GAC|GCG|GAU|GUU|GGU|AAG|UGA| Met-Gln-Val-Ser-Gln-Asp-Ala-Asp-Val-Gli-Lis . 5’-CAP-GUGUGAUGCAAGUCAGUCAAGACGCGGAUGUUGGUAAGUGA- AAAAAAAAAAAAAA-3’ b) ¿Cómo sería el polipéptido primario producto de la traducción de aquél RNAm? R: Identificar el primer codón AUG en sentido 5’3’ y separar los codones. por lo que en vez de timina utilizamos uracilo. Se tiene el siguiente gen que se desea expresar: 5’- GCCCTCAGTATTAACAGCACACTACGTTCAGTCAGTTCTGCGCCTACAACCATTC ACT-3’ a) ¿Cómo sería el RNA mensajero de aquel gen.

Aug-cug leu .

Glicina -serina-cysteina-glicina-fenilalalina-Fin- .

Sign up to vote on this title
UsefulNot useful