ADN : Es encargado de almacenar , mantener y expresar la

programación que constituye la bioquímica y el fenotipo de un
individuo.

Molecularmente esta constituido por : C,H,O,N,F.

Monómero: nucleótidos

ADN O DNA(Acido desoxirribonucleico)

BASES NITOGENADAS

Puricas( ADENINA , GUANINA)
Pirimidas(TIMINA, CITOCINA , URACILO)

COMPLEMENTAN
A=T ; C= G

AZUCAR :PENTOSA
MOLECULA DE FOSFATO

Características:
Forma de doble alfa hélice , dextrógira
Forma enlaces en forma horizontal ( enlaces de hidrogeno)
Vertical ( enlaces fosfodiester)

Donde se encuentra ADN
 Núcleo eucarionte
 Nucleoide procarionte
 Plásmidos
 Mitocondrias y cloroplastos

En 1930 Levene y Kossel probaron que la nucleína era un acido desoxirribonucleico formado por cuatro bases nitrogenadas diferentes. El experimento de Griffith Watson y Crick . que establece que el número de bases pirimídicas presentes en el DNA es igual al número de bases púricas. Chargaff propuso la ley de equimolecularidad. en base a la ley de complementariedad de bases (A=T y C=G).Un poco de historia Levene quien caracterizó la estructura del nucleótido (pentosa + fosfato + base nitrogenada). unidas por su grupo fosfato.

Por medio de difracción de rayos x Identificarlos que era doble hélice anti paralelas 5`-3`. 3`-5` Replicación del DNA A través del experimento de Meselson y Stahl se pudo concluir que el proceso de replicación del DNA seguía un esquema semiconservativo. Dogma central de la biología DNA RNA PROTEINA .

Elongación y Terminación. LA DNA LIGASA SELLA LAS UNIONES DE ESTOS FRAGMENTOS DE DNA Y LA DNA POLIMERASA II BUSCA ERRORES DE REPLICACION . INICIO ELONGACION 1 HEBRA LA HELICASA CONTINUA: ROMPE LOS ENLACES DE HIDROGENO LA RNA PRIMASA SINTETIZA LAS SSBP ESTABILIZAN LAS HEBRAS UN PRIMER OBETENIDAS MONOCATENARIAS O RNA CEBADOR (O PARTIDOR) RNA DE 10 NUCELOTIDOS QUE SE UNE DE MANERA COMPLEMENTARIA A LA CADENA MOLDE .Proceso de replicación Requiere :  Hebra molde de DNA  Conjunto de enzimas proceso que consta de 3 etapas : Iniciación. DESDE ESTE PUNTO LA TOPOISMOMERASA II COMIENZA LA REPLICACION EN SENTIDO 5`-3`HASTA LLEGAR A LA ZONA DE TERMINO . MIENTRAS LA TOPOISOMERASA I RETIRA EL CEBADOR Y SINTETIZA EN SU LUGAR .

5. y 28s posee cámaras especiales del ancho de un codón para la traducción .8.RNA mensajero (RNAm) POSEE 5`UN NUCLEOTIDO ESPECIAL CAP (7METIL GUANOSINA ) IDENTIFICACION POR PARTE DEL RIBOSOMA CAMUFLAJE A LAS RNAsas. EN EXTREMO 3´POSEE SECUENCIA REPETITIVAS DE ADENINAS CUYA FUNCION ES PROTEGER DE RNAsas ( enzimas que degradan ADN en citoplasma) ELONGACION 2 HEBRA DISCONTINUA 3`5` LA RNA PRIMASA GENERA UNA SERIE DE PRIMERS (APARIENCIA FRAGMENTADA Ó FRAGMENTOS DE OKAZAKI) LA DNA POLIMERASA I LLEGA A LOS ESPACIOS ENTRE LOS FRAGMENTOS Y LA POLIMERASA II REVISA Y CORRIGUE LOS ERRORES .+ proteinas Función : identificar el sitio de unión de la traducción. . Subunidad mayor: formada por RNAr de 5s. TERMINACION LIBERACION Y SALIDA DE RNA MENSAJERO MADURO A TRADUCION FUERA DEL NUCLEO Rna ribosomal Subunidad menor Formada de RNAr de 18s .

En pocas palabras. Brazo D: Posee el nucleótido extraño D-Hidrouracilo.Arn de trasferencia (RNAt) Es un RNA pequeño que posee una estructura en hoja de trébol. en el cual puede crearse el enlace aminoacil- RNAt en base a la enzima aminoacil-RNAtsintetasa (existen 20. teniendo tres brazos diferentes (más uno pequeño variable). donde existe un OH. una para cada aminoácido).libre. o Loop pequeño variable Brazo anticodón: Posee una secuencia complementaria a un codón específico de un RNA mensajero. . Extremo 3’: Posee la secuencia ACC. es el lugar donde se une el aminoácido correspondiente al RNAt. El detalle de 5’ a 3’ es el siguiente: Brazo TψC: Posee el nucleótido extraño Pseudouridina. Código genético: Def:Alfabeto genético para formar proteínas Codón : 3 nucleotidos. Características: Posibilidades apareamientos 43 =64 posibles conbinaciones Degenerado: mas de un codón puede formar la misma proteína..

desplazando el metionil – RNAt de la camara A la b . UGA. codón de inicio: AUG codón de termino : UAA. RIBOSOMA Traducción: INICIO INICIO: SUBUNIDAD MENOR RECONOCE RNAm maduro Se empieza la lectura con el codón AUG y el anticodon del ARN t ELONAGACION: La peptidil trasferasa crea un enlace peptídico y el ribosoma avanza en sentido 5 ´-3´ una distancia equivalente a un codón . UAG.

Se tiene el siguiente gen que se desea expresar: 5’- GCCCTCAGTATTAACAGCACACTACGTTCAGTCAGTTCTGCGCCTACAACCATTC ACT-3’ a) ¿Cómo sería el RNA mensajero de aquel gen. Luego es muy simple: Buscar en la tabla del código genético a que aminoácido corresponde el codón. 5’-CAP-GUGUGAUGCAAGUCAGUCAAGACGCGGAUGUUGGUAAGUGA- AAAAAAAAAAAAAA-3’ |AUG|CAA|GUC|AGU|CAA|GAC|GCG|GAU|GUU|GGU|AAG|UGA| Met-Gln-Val-Ser-Gln-Asp-Ala-Asp-Val-Gli-Lis . 5’-CAP-GUGUGAUGCAAGUCAGUCAAGACGCGGAUGUUGGUAAGUGA- AAAAAAAAAAAAAA-3’ b) ¿Cómo sería el polipéptido primario producto de la traducción de aquél RNAm? R: Identificar el primer codón AUG en sentido 5’3’ y separar los codones. sin olvidar que estamos haciendo RNA. TERMINACION: Al leer algún codón de termino se sintetiza una proteína llamada factor de liberación a la cámara a y hace que se desacople el ribosoma EJERCICIOS DE EXPRESION DE GENES 1. buscando uno de los codones de detención. sabiendo que la TATA box es “TATTAA” y el promotor corresponde a CAG? R: Se debe hacer una secuencia complementaria a la secuencia que viene después del promotor. por lo que en vez de timina utilizamos uracilo.

Aug-cug leu .

Glicina -serina-cysteina-glicina-fenilalalina-Fin- .

Sign up to vote on this title
UsefulNot useful