ADN : Es encargado de almacenar , mantener y expresar la

programación que constituye la bioquímica y el fenotipo de un

Molecularmente esta constituido por : C,H,O,N,F.

Monómero: nucleótidos

ADN O DNA(Acido desoxirribonucleico)



A=T ; C= G


Forma de doble alfa hélice , dextrógira
Forma enlaces en forma horizontal ( enlaces de hidrogeno)
Vertical ( enlaces fosfodiester)

Donde se encuentra ADN
 Núcleo eucarionte
 Nucleoide procarionte
 Plásmidos
 Mitocondrias y cloroplastos

en base a la ley de complementariedad de bases (A=T y C=G).Un poco de historia Levene quien caracterizó la estructura del nucleótido (pentosa + fosfato + base nitrogenada). que establece que el número de bases pirimídicas presentes en el DNA es igual al número de bases púricas. unidas por su grupo fosfato. En 1930 Levene y Kossel probaron que la nucleína era un acido desoxirribonucleico formado por cuatro bases nitrogenadas diferentes. El experimento de Griffith Watson y Crick . Chargaff propuso la ley de equimolecularidad.

Por medio de difracción de rayos x Identificarlos que era doble hélice anti paralelas 5`-3`. 3`-5` Replicación del DNA A través del experimento de Meselson y Stahl se pudo concluir que el proceso de replicación del DNA seguía un esquema semiconservativo. Dogma central de la biología DNA RNA PROTEINA .



Extremo 3’: Posee la secuencia ACC. es el lugar donde se une el aminoácido correspondiente al RNAt. En pocas palabras. o Loop pequeño variable Brazo anticodón: Posee una secuencia complementaria a un codón específico de un RNA mensajero.Arn de trasferencia (RNAt) Es un RNA pequeño que posee una estructura en hoja de trébol. donde existe un OH. El detalle de 5’ a 3’ es el siguiente: Brazo TψC: Posee el nucleótido extraño Pseudouridina. una para cada aminoácido).libre. Código genético: Def:Alfabeto genético para formar proteínas Codón : 3 nucleotidos. Brazo D: Posee el nucleótido extraño D-Hidrouracilo. Características: Posibilidades apareamientos 43 =64 posibles conbinaciones Degenerado: mas de un codón puede formar la misma proteína. teniendo tres brazos diferentes (más uno pequeño variable). en el cual puede crearse el enlace aminoacil- RNAt en base a la enzima aminoacil-RNAtsintetasa (existen 20. ..

UGA. codón de inicio: AUG codón de termino : UAA. desplazando el metionil – RNAt de la camara A la b . UAG. RIBOSOMA Traducción: INICIO INICIO: SUBUNIDAD MENOR RECONOCE RNAm maduro Se empieza la lectura con el codón AUG y el anticodon del ARN t ELONAGACION: La peptidil trasferasa crea un enlace peptídico y el ribosoma avanza en sentido 5 ´-3´ una distancia equivalente a un codón .

sin olvidar que estamos haciendo RNA. Se tiene el siguiente gen que se desea expresar: 5’- GCCCTCAGTATTAACAGCACACTACGTTCAGTCAGTTCTGCGCCTACAACCATTC ACT-3’ a) ¿Cómo sería el RNA mensajero de aquel gen. por lo que en vez de timina utilizamos uracilo. Luego es muy simple: Buscar en la tabla del código genético a que aminoácido corresponde el codón. 5’-CAP-GUGUGAUGCAAGUCAGUCAAGACGCGGAUGUUGGUAAGUGA- AAAAAAAAAAAAAA-3’ |AUG|CAA|GUC|AGU|CAA|GAC|GCG|GAU|GUU|GGU|AAG|UGA| Met-Gln-Val-Ser-Gln-Asp-Ala-Asp-Val-Gli-Lis . sabiendo que la TATA box es “TATTAA” y el promotor corresponde a CAG? R: Se debe hacer una secuencia complementaria a la secuencia que viene después del promotor. TERMINACION: Al leer algún codón de termino se sintetiza una proteína llamada factor de liberación a la cámara a y hace que se desacople el ribosoma EJERCICIOS DE EXPRESION DE GENES 1. 5’-CAP-GUGUGAUGCAAGUCAGUCAAGACGCGGAUGUUGGUAAGUGA- AAAAAAAAAAAAAA-3’ b) ¿Cómo sería el polipéptido primario producto de la traducción de aquél RNAm? R: Identificar el primer codón AUG en sentido 5’3’ y separar los codones. buscando uno de los codones de detención.

Aug-cug leu .

Glicina -serina-cysteina-glicina-fenilalalina-Fin- .