MEC844.

fm Page 155 Monday, January 24, 2000 10:08 AM

Molecular Ecology (2000) 9, 155 164

Genetic diversity and gene flow among southeastern

Blackwell Science, Ltd

Queensland koalas (Phascolarctos cinereus)

E . V. F O W L E R , * B . A . H O U L D E N , P. H O E B E N * and P. T I M M S *
*Centre for Molecular Biotechnology, School of Life Science, Queensland University of Technology, Brisbane, Qld, 4001, Zoological
Parks Board of New South Wales, PO Box 20, Mosman, NSW, 2088, School of Biological Science, University of New South Wales,
Kensington, NSW, 2052, Australia

Abstract
Habitat fragmentation and destruction associated with the rapid urban and rural development
of southeast Queensland presents an immediate threat to the survival of koala popula-
tions within this region. A sensitive method combining heteroduplex analysis (HDA)
with temperature gradient gel electrophoresis (TGGE) was optimized to detect within-
species variation in a mitochondrial DNA (mtDNA) control-region fragment, 670 bp
in length, from the koala. Eight different haplotypes were characterized in koalas, of which
four were novel. Analysis of mtDNA diversity in 96 koalas from five populations in south-
east Queensland revealed that the number of haplotypes in a single population ranged
from one to five, with an average within-population haplotype diversity of 0.379 0.016,
and nucleotide diversity of 0.22 0.001%. Nucleotide divergence between populations
averaged 0.09 0.001% and ranged from 0.00 to 0.14%. Significant genetic heterogeneity
was observed among most populations, suggesting that koala populations may be spatially
structured along matrilines, although this may not be universal. The limited distribution
of the central phylogenetic haplotype suggested the possibility of historical population
bottlenecks north of the Gold Coast, while the presence of two highly divergent haplo-
types at the Moreton site may indicate the occurrence of one or more undocumented
translocation events into this area.
Keywords: control region, gene flow, Koala, mtDNA, Phascolarctos cinereus, population
Received 14 November 1998; revision received 16 September 1999; accepted 16 September 1999

Introduction fewer than 20 000 koalas in Australia and that only 10 000
koalas remained in Queensland (Phillips 1990; Patterson
Reports on the distribution of koalas in Queensland prior
1996). Historical reports of koala distribution in Queens-
to the early 1900s are limited. Koalas were thought to be
land suggest that populations were concentrated in the
particularly abundant in the southeast, with populations
southeastern corner of the state, and this region is believed
becoming less abundant towards the fringes of their
to support the greatest concentration of koalas in Australia
range in the far western and northern boundaries of the
today (Phillips 1990; Patterson 1996). Although there
state (Phillips 1990). The final years of koala hunting in
is some suggestion of koala population expansions and
the early 1900s yielded several million skins for the fur
contractions in Queensland, few examples cite a specific
trade, which is indicative of the abundance of koalas
location where these events may have occurred (Gordon
during this period (Sharp 1995). Following the last open
& McGreevy 1978). As a result, information relating to
season on koalas in 1927, it was estimated that there were
koala population history in this region is limited to a few
recent studies (Gordon et al. 1990a; White & Kunst 1990).
Correspondence: Elizabeth Fowler. Present address: Queens-
Several surveys of koala distribution in Queensland
land Institute of Medical Research, 300 Herston Rd, Herston,
Queensland 4029, Australia. Fax: +61-7-3362-0105, E-mail:
(1929, 1967, 1977, 198689) have indicated that a range
bethF@qimr.edu.au contraction of 50% may have occurred since human settle-
Present address: W3audit.com, Boerlagelaan 1, 1421 TX ment in this state, and that populations have become
Uithoorn, the Netherlands. increasingly fragmented (Herbert & Mayo 1929; Phillips

2000 Blackwell Science Ltd

MEC844.fm Page 156 Monday, January 24, 2000 10:08 AM
156 E . V. F O W L E R E T A L .
1990; Patterson 1996). This decline has been largely attrib-
uted to the disappearance of suitable koala habitat as a
result of rapidly expanding human settlement in Queens-
land, although several other factors (i.e. road accidents,
dog attacks, disease and bushfire) may have also contrib-
uted to this outcome (Phillips 1990; Patterson 1996). Cur-
rently, over 60% of Queenslands human population live
in the southeast region surrounding the states capital,
Brisbane, and this is one of the fastest growing regions
in Australia (Brown 1996; Salt 1998). The expansion of
human settlement and the subsequent rapid urban develop-
ment of the Brisbane region represents the most immediate
threat to koala populations in this region. Contemporary
processes, which threaten koala populations, include
habitat loss and fragmentation, as well as an increased
number of koala road accidents and incidence of dog
attacks (Sharp 1995; Nattrass & Fiedler 1996; Patterson
1996). Assessment of the level of genetic diversity and
gene flow among koala populations in this region will
provide useful information for their future management
and may offer an insight into various population processes
that may have affected them in the past.
Previous genetic studies of koalas in Queensland have
shown only moderately low levels of mitochondrial DNA
(mtDNA) and minisatellite DNA variability within popu-
lations, and high levels of mtDNA variation among popu-
lations (Timms et al. 1993; Worthington-Wilmer et al. 1993;
Houlden et al. 1999). Strong geographical structuring was
observed among populations separated by 75600 km
(Worthington-Wilmer et al. 1993; Houlden et al. 1999).
Additionally, geographical structuring was observed
among koala populations by recent random amplified
polymorphic DNA (RAPD) and microsatellite studies,
which detected moderate to high levels of within- and
among-population differentiation over similar distances
(Houlden et al. 1996; Fowler et al. 1998). The results suggest
that gene flow among koala populations over relatively
large distances may be limited. Some behavioural studies
have suggested that female koalas (especially older
animals) are more likely to be sedentary than males
(Mitchell & Martin 1990). However, many juvenile koalas
(both male and female) disperse from their natal site
(Mitchell & Martin 1990), so it is possible that female
koalas may also contribute to gene flow, at least on a local
scale. Analysis of genetic diversity among local koala
populations using a maternally inherited marker may
reveal the extent of female-mediated gene flow at this
level of scale.
Animal mtDNA is a small molecule that lacks recombina-
tion and is generally maternally inherited (Avise et al.
1987). The rate of animal mtDNA evolution is faster than
most nuclear genes owing to a high rate of base substitu-
tion (especially in the control region) and a smaller effect-
ive population size (Avise et al. 1987). This accelerates the
effects of random genetic drift on mtDNA diversity and
makes this molecule particularly useful for population
genetic analyses (Moritz 1994). Investigation of variation
in the control region of mtDNA has proved highly inform-
ative for the analysis of genetic diversity and gene flow
among several marsupial species (Taylor et al. 1994; Pope
et al. 1996; Moritz et al. 1997). Populations can be screened
rapidly for DNA sequence variants (i.e. in the mtDNA
control region) by combining heteroduplex analysis (HDA)
and temperature gradient gel electrophoresis (TGGE),
which generally reduces the amount of sequencing required
to characterize all the variants (Lessa & Applebaum 1993;
Campbell et al. 1995).
The vulnerability of the koala in southeast Queensland
prompted us to evaluate genetic diversity and gene flow
among koala populations within this region. We invest-
igated mtDNA haplotype diversity in koalas by optimiz-
ing the sensitive HDA/TGGE technique to assess genetic
diversity and gene flow among southeastern Queensland
populations. We analysed five koala populations within a
radius of 100 km of Brisbane city. The average geograph-
ical distance between adjacent study sites was 52 4 km.
Genetic analysis of koala populations on this geographical
scale has not previously been described.
Materials and methods
Study sites and DNA extraction
To investigate mtDNA diversity among southeastern
Queensland koalas, several sampling locations were
selected, based on the following criteria: (i) located within
a 100-km radius of Brisbane city; (ii) at least 20 km to
the nearest adjacent sampling location; and (iii) koala
populations were present in selected areas. Ten sites were
chosen based on these criteria (Fig. 1) where the geographical
distance between adjacent locations ranged from 20 to
Fig. 1 Map showing: (A) the location of the study region in
southeast Australia; and (B) the location of selected sample sites
within the study region. *Sites that were excluded from detailed
analyses owing to insufficient samples.
2000 Blackwell Science Ltd, Molecular Ecology, 9, 155 164
MEC844.fm Page 157 Monday, January 24, 2000 10:08 AM
K O A L A G E N E F L O W I N S O U T H E A S T Q U E E N S L A N D 157
57 km (X = 45 12 km). For this analysis, we planned to
sample 30 koalas from each location, but in all instances
(except the Moreton site) this was not possible with some
sites only providing one or two individuals. As a result,
most analyses were restricted to only five locations where
the number of individuals sampled was 10 or greater.
Individuals from the remaining sites were typed,
however, to determine if unique mtDNA haplotypes
were present at these sites.
Blood samples were collected from 106 koalas at nine
locations in southeast Queensland: Gold Coast (2756S,
15321E; n = 19), Beaudesert (2743S, 15302E; n = 4),
Redland Bay (2732S, 15312E; n = 22), North Strad-
broke Island (2732S, 15312E; n = 1), Moreton (2738S,
15240E; n = 34), Pine Rivers (2710S, 15255E; n =
11), Kilcoy (2657S, 15235E; n = 2), Buderim (2640S,
15301E; n = 1), Noosa (2624S, 15303E; n = 2); and at
one location in northeast New South Wales: Round
Mountain (2822S, 15334E; n = 10). The northeast New
South Wales population of Round Mountain is located
less than 25 km south of the Queensland border and in
this study was referred to as a southeast Queensland popu-
lation, for convenience. In the case of mother/offspring
pairs, only the mother was sampled.
From each koala, two to four drops of whole blood
were collected into 1 mL of 70% ethanol and stored at
room temperature until extraction. Total genomic DNA
was prepared using a method modified from Campbell
et al. (1995). Blood samples were centrifuged at 12 000 g
for 1 min and the ethanol was removed. The pellet was
resuspended in 0.5 mL of fresh 70% ethanol and incub-
ated at 55 C for 30 min. The centrifugation step was then
repeated and the ethanol again removed. The pellet was
digested with 20 L of proteinase K solution (10 mg/mL)
in 0.5 mL of buffer (100 mm NaCl, 50 mm Tris-HCl
pH 8.5, 10 mm EDTA, 0.5% sodium dodecyl sulphate
[SDS] ), with constant mixing, at 55 C for 2 h. Proteins
were extracted with an equal volume of phenol:chloroform
(1:1), followed by extraction with absolute chloroform.
DNA was precipitated with 0.1 volume of 3 m sodium
acetate and 2 volumes of absolute ethanol at 20 C
for 30 min, followed by centrifugation at 12 000 g for
5 min and then washed with 70% ethanol. After drying,
the pellet was resuspended in 100 L of sterile water and
stored at 4 C.
Amplification of the koala mtDNA control region
Polymerase chain reaction (PCR) amplification of the
mtDNA control region was carried out in 25-L reaction
volumes containing: 1.25 U of AmpliTaq DNA polymerase
(Perkin-Elmer/Cetus), 0.5 mm each of dATP, dTTP, dCTP
and dGTP (Boehringer Mannheim), 4 mm MgCl2, 2.5 L
of Perkin-Elmer 10 PCR buffer, 0.1 m each of the light
2000 Blackwell Science Ltd, Molecular Ecology, 9, 155164
Table 1 Koala mitochondrial DNA (mtDNA) control-region
primer sequences
Primer 5 3 Sequence
MT15996L CTCCACCATCAGCACCCAAAGC
MT16502H TTTGATGGCCCTGAAGTAAGAACCA
KmtL1 CACCCTACACATACCATTT
KmtL2 GCACCCAAAGCTGACATTC
KmtL3 ACCACTAGCATATAAGAATG
KmtH2 GAACCAGTAGCCAGTTAAAG
KmtH3 GTCTATGTACGCCAACAG
KmtH4 CATTCTTATATGCTAGTGGT
(L) and heavy (H) strand primers (Table 1) and 25 50 ng
of koala DNA. Reactions were subjected to an initial
denaturation step at 95 C for 5 min, followed by 30
cycles at 94 C for 1 min (denaturation), 50 C for 1 min
(annealing) and 72 C for 2 min (extension), with an
additional 8 min at 72 C in the final cycle. The PCR pro-
ducts generated with MT15996L and MT16502H primers
(Elphinstone & Baverstock 1997) of three individuals
were cloned into the p-GEM-T PCR cloning vector
(Promega) and sequenced twice using M13 universal
forward and reverse primers. Sequences were aligned
using clustal-w (Thompson et al. 1994). Koala-specific
primers (KmtL1, L2, L3, H2, H3, H4) were designed from
these sequences (Table 1) and all subsequent PCR reactions
used a combination of these primers.
HDA/TGGE analysis and sequencing
The melting characteristics of the cloned fragment in a
temperature gradient gel was simulated using POLAND
(QIAGEN GmbH) (Poland 1974) and observed experi-
mentally using perpendicular TGGE (temperature gradient
perpendicular to direction of DNA migration) as described
by Elphinstone & Baverstock (1997). This confirmed the
observation of Houlden et al. (1999) that the fragment
contains three melting domains. HDA using parallel
TGGE (temperature gradient parallel to direction of
DNA migration) was performed as described previ-
ously (Campbell et al. 1995; Elphinstone & Baverstock
1997). Final conditions for TGGE were determined from
the results of a perpendicular TGGE and a parallel travel
schedule TGGE (Campbell et al. 1995; Elphinstone &
Baverstock 1997) of two control-region fragments. A
temperature gradient of 1449 C was chosen for
heteroduplex analysis of the koala mtDNA samples.
Heteroduplexes were produced by mixing equal quantities
of the sample PCR product and a reference PCR product
(a koala from French Island, Victoria) in sample buffer
(20 mm MOPS, 1 mm EDTA, 0.005% Bromophenol blue,
0.005% xylene cyanol FF; pH 8.0) and 4 m urea (final
MEC844.fm Page 158 Monday, January 24, 2000 10:08 AM
158 E . V. F O W L E R E T A L .
template concentration 20 30 ng). Samples were denatured
at 95 C for 5 min, followed by incubation for 15 min at
50 C to allow the formation of heteroduplexes. Samples
were then loaded onto a 5% polyacrylamide gel
(37.5 : 1 acrylamide : bis-acrylamide, 8 m urea, 2% glycerol,
1 MOPS/EDTA [ME]) and electrophoresed for 250 min
at a constant 300 V in 1 ME running buffer. DNA was
visualized by silver staining of the gel, according to the
manufacturers instructions (Qiagen GmbH).
PCR products from two representatives of each haplo-
type were purified for sequencing using the Wizard PCR
preps DNA purification system (Promega). Sequencing
was carried out using the ABI Dye Terminator Cycle
Sequencing kit with AmpliTaq on an Applied Biosystems
373 A DNA sequencer (Perkin Elmer-Cetus) using the
primers KmtL2, KmtH2, KmtL3 and KmtH4 (Table 1).
Sequences for each haplotype were edited and aligned
using the GCG Fragment Assembly program group (Staden
1980; Genetics Computer Group 1994), while the final align-
ment of all haplotypes was performed using clustal-w
(Thompson et al. 1994). Sequences have been deposited
in GenBank/EMBL (accession nos: AJ012057 to AJ012064).
Statistical analyses
Phylogenetic trees were constructed from sequence data
using Tamuras distance and the neighbour-joining
method (Saitou & Nei 1987), implemented using the
Molecular Evolutionary Genetics Analysis (mega) pro-
gram (Kumar et al. 1993). The statistical confidence of
each node was estimated by 1000 random bootstrap
samplings of the data using the branch-and-bound option
(Felsenstein 1985). Maximum parsimony and maximum
likelihood analysis were conducted using the dnapars,
dnaml, seqboot and consens programs of phylip 3.57
(Felsenstein 1995). Phylogenetic relationships among
nucleotide sequences were also described from a min-
imum spanning network of the unique haplotypes using
minspnet (Excoffier & Smouse 1994), as described by
OCorry-Crowe et al. (1997).
Distance values between pairwise comparisons of
haplotype sequences were calculated by the method of
Tamura (1992), using the mega program (Kumar et al.
1993). Estimates of haplotype diversity and nucleotide
diversity (the average number of pairwise differences per
site) within populations and nucleotide divergence be-
tween populations were calculated as described by Nei
(1987) using reap 4.0, where a population was defined as
a group of individuals from a single sampling location.
A clustering tree of populations was created with the
resulting divergence matrix, using the neighbour-joining
algorithm (Saitou & Nei 1987) in mega. Genetic hetero-
geneity among populations was assessed by contingency
2-tests of haplotype frequencies. Values were compared
to distributions obtained by randomizing individuals
among populations using Monte-Carlo resampling (Roff
& Bentzen 1989), as implemented in reap 4.0. Significant
genetic heterogeneity was reported when the probability
(P) indicated that a given 2 value exceeded the original
data by chance alone (i.e. P < 0.05). Sequential Bonferroni
corrections were carried out to determine whether indi-
vidual pairwise tests were significant (i.e. P < 0.05/n,
where n = number of pairwise comparisons). The inclu-
sion of ties (i.e. that a given 2 value equals or exceeds the
original by chance alone) was also considered because of
the small size of some populations. The distribution of
sequence variation among populations was determined
using winamova 1.5 (Excoffier et al. 1992), and analysis
of molecular variance (amova) was then used to estimate
variance components within and among populations.
Nonparametric permutational procedures were used to
compute the significance of variance component estimates.
Results
Optimization of the koala mtDNA control-region
HDA/TGGE analysis
Primers located in the tRNA proline gene (MT15996L)
and the central conserved domain (MT16502H) were
used to amplify 900 bp of the 5 end of the mtDNA con-
trol region in the koala. Nonspecific PCR products were
also observed in many individuals using these primers
and therefore the 900-bp product from three individuals
was cloned and sequenced. From this sequence, koala-
specific primers adjacent to the original primers were
designed (KmtL2 and KmtH2, Table 1), to produce a
single PCR product of 890 bp. The melting character-
istics of this fragment in a temperature gradient gel were
simulated using POLAND (Poland 1974), which demon-
strated that the fragment contained at least three melting
domains, as suggested previously by Houlden et al. (1999).
The domain structure was confirmed by perpendicular
TGGE of one sample. Maximum resolution of variation
with TGGE, however, is generally obtained when the
fragment contains only two melting domains. The most
variation in the 890-bp control-region fragment was
previously detected in the 220705-bp region (Houlden
et al. 1999). To reduce the number of melting domains
to two, while minimizing the loss of detectable variation,
two additional primers (KmtL1 and KmtH3) were designed
to produce two smaller fragments that comprised 1700 bp
(KmtL2, KmtH3) and 190890 bp (KmtL1, KmtH2) of the
original 890-bp fragment. Both fragments were subject
to perpendicular TGGE to establish optimal conditions
for parallel TGGE and were observed to contain only two
melting domains. Heteroduplex parallel TGGE (HDA/
TGGE) analysis of both fragments for 28 individuals
2000 Blackwell Science Ltd, Molecular Ecology, 9, 155 164
MEC844.fm Page 159 Monday, January 24, 2000 10:08 AM

K O A L A G E N E F L O W I N S O U T H E A S T Q U E E N S L A N D 159

Table 2 Sequence variation within eight southeastern Queensland koala mitochondrial DNA (mtDNA) haplotypes

Nucleotide position

1 2 2 2 2 3 3 3 3 3 5 6
1 2 7 9 4 7 7 8 9 0 0 6 7 9 2 6
Haplotype 2 2 4 9 5 0 9 7 8 6 9 6 9 2 7 8

Q1 C T C C C T A A T T A A T C A T
Q2 . C . . . . . . . . . . . . . .
Q3 . . . . . . G . . . . . . . . .
Q4 . . . . . C . . . . . . . . . .
Q5 . . . . . C . . . C . . . . . .
Q6 . . . . . . . G C . . . . . . .
Q7 . . T T T . . . . C . G . T . C
Q8 T . T T . . . . . C G . C T G C

Only variable sites are shown.

Dots denote identity with the sequence Q1, and letters indicate base substitutions.

from various study sites revealed no variation in the first

1 700-bp fragment, while variation in the 190890-bp frag-
ment was observed and characterized in further analyses.

Relationship of control-region haplotypes

Eight distinct mtDNA control-region haplotypes (Q1
Q8) were identified by HDA/TGGE analysis of the
700-bp PCR fragment amplified using KmtL1 and KmtH2
primers. Two representatives of each haplotype were
sequenced and no within-haplotype sequence variation
was observed. Sequence analysis of each TGGE haplo-
type identified nucleotide substitutions at 16 positions
(2.4%), where all substitutions were transitions (Table 2).
Haplotypes varied from only a single substitution in the
entire 670-bp fragment, to a maximum of 11 substitutions
between Q6 and Q8 (Table 2). The evolutionary relation-
ships among the eight mtDNA haplotype sequences was
illustrated using a minimum spanning tree (network of
unique haplotypes), rather than a single bifurcating tree
(Fig. 2). This analysis revealed a radiating phylogeny
supporting the genetic inter-relatedness of these haplotypes,
most of which varied by only 1 2 bp. The central haplotype
Fig. 2 Minimum spanning network based on the number of
in the network was Q1, which was not detected north
nucleotide differences observed among eight mitochondrial DNA
of Gold Coast. Two haplotypes, Q7 and Q8, varied by (mtDNA) haplotypes. Nodes were scaled based on frequency.
6 bp, and were highly divergent from the remaining six The only alternative connection (and length) was 5 7 (7).
haplotypes, differing by 7 9 bp and 911 bp, respectively.
Construction of phylogenetic trees, using Tamuras distance,
among the eight haplotypes with the neighbour-joining
method and bootstrap analysis, strongly supported two parsimonious trees (data not shown). At the five additional
clusters of sequences: (1) Q1 to Q6 and (2) Q7 and Q8. sites (where insufficient samples were obtained), six of
However, there was no clear phylogeographical pattern the eight haplotypes were observed, i.e. Q2 and Q3 at
among haplotypes (data not shown). Maximum likelihood Beaudesert (n = 4), Q4 and Q8 at Noosa (n = 2), Q5 at
analysis produced similar results (data not shown), while Buderim (n = 1), and Q6 at Kilcoy (n = 2) and North
maximum parsimony analysis resulted in 39 most- Stradbroke Island (n = 1).

2000 Blackwell Science Ltd, Molecular Ecology, 9, 155164

MEC844.fm Page 160 Monday, January 24, 2000 10:08 AM

160 E . V. F O W L E R E T A L .

Fig. 3 Distribution of eight mitochondrial

DNA (mtDNA) control-region haplotypes
among southeastern Queensland koala
populations.

Table 3 Within-population haplotype diversity (H) and

Distribution of mtDNA control-region variation among nucleotide diversity (), as calculated in reap
populations
Population n H (%)
The distribution of the eight mtDNA haplotypes (among
sampling sites where n 10) indicated that no haplotype Round Mountain 10 0.000 0.000 0.00
was common to all sites studied (Fig. 3). The most widely Gold Coast 19 0.194 0.079 0.03
distributed haplotype, Q4, was detected at Pine Rivers, Redland Bay 22 0.444 0.053 0.14
Moreton, Redland Bay and Gold Coast. Three haplotypes Moreton 34 0.581 0.060 0.64
were observed at adjacent sites, i.e. Q1 at Gold Coast and Pine Rivers 11 0.675 0.063 0.31
Round Mountain, Q3 and Q6 at Pine Rivers and Moreton;
n, no. of individuals with a particular haplotype.
while the four remaining haplotypes were unique to a
particular location, i.e. Q2 at Redland Bay, Q5 at Pine
Rivers, and Q7 and Q8 at Moreton. Koalas at each loca-
tion shared at least one common haplotype with koalas diversity ( = 0.22 0.001%) and haplotype diversity
at an adjacent site. (H = 0.379 0.016) were calculated. Gold Coast and
Round Mountain had lower estimates of within-
population haplotype and nucleotide diversity compared
Variation within and among populations
with other populations sampled. Pairwise comparisons
Sequence variation in 670 bp of the koala mtDNA between populations revealed an average nucleotide
control region was summarized as haplotype diversity divergence of 0.09 0.001%, ranging from 0.00 to 0.14%.
(H) and nucleotide diversity () within populations A neighbour-joining tree was created from the nucleotide
(Table 3), and nucleotide divergence among popula- divergence matrix to illustrate the genetic relationship
tions. Values for average within-population nucleotide between populations (Fig. 4).

2000 Blackwell Science Ltd, Molecular Ecology, 9, 155 164

MEC844.fm Page 161 Monday, January 24, 2000 10:08 AM
K O A L A G E N E F L O W I N S O U T H E A S T Q U E E N S L A N D 161
Fig. 4 Neighbour-joining tree of nucleotide divergence among
koala populations in southeast Queensland (estimated using
reap).
Analysis of haplotype frequencies using Monte Carlo
simulations revealed significant geographical hetero-
geneity in population haplotype frequency distributions
( 2 = 194.77, P < 0.001). Similar analysis of haplotype fre-
quencies was conducted for five pairwise comparisons
between adjacent populations listed in an approximate
south to north direction (i.e. Round Mountain Gold
Coast Redland Bay Moreton Pine Rivers; see
Fig. 1), including an additional comparison between Gold
Coast and Moreton. All populations were significantly
different from one another (P < 0.001), with the exception
of Round Mountain and Gold Coast ( 2 = 1.13, P = 0.13).
These results suggest that four genetically divergent
groups of koalas may occur within the study region
consisting of: (i) Gold Coast and Round Mountain;
(ii) Redland Bay; (iii) Moreton; and (iv) Pine Rivers. The
geographical distance between adjacent populations was
similar for all study sites (X = 52.5 4.1 km), indicating
that absolute distance may not be a good indicator of the
extent of gene flow among sites on a local scale in this
region.
amova within and among populations revealed that
76.7% of haplotypic diversity was present within popu-
lations (ST = 0.233, P < 0.001). Comparisons between
adjacent sites generated ST values ranging from 0.007
to 0.453, which were all significantly different (P < 0.05)
with the exception of Gold Coast and Round Mountain
(ST = 0.007, P = 0.594). Further analysis was conducted
by grouping sites together, as suggested by Monte Carlo
simulations. Four pairwise comparisons revealed that
all groupings were significantly different from each other
when Bonferroni corrections were applied (P < 0.0125)
with the exception of Moreton and Pine Rivers
(ST = 0.149, P = 0.049).
Discussion
This work represents the first regional genetic analysis
of koala populations in Queensland. The TGGE method
was optimized and detected twice the number of mtDNA
control-region variants (haplotypes) than has previously
been detected among Queensland koalas (Houlden et al.
1999). A number of individuals were common to both
2000 Blackwell Science Ltd, Molecular Ecology, 9, 155164
studies, and the four mtDNA haplotypes described by
Houlden et al. (1999) are equivalent to our Q1, Q2, Q4 and
Q8 haplotypes. Houlden et al. (1999) detected variation in
a fragment ( 890 bp in length) of the mtDNA control
region, which contained three melting domains. In the
current study, analysis of a smaller control-region frag-
ment ( 680 bp), containing two melting domains, proved
more informative, revealing four additional haplotypes
(Q3, Q5, Q6 and Q7). The removal of one melting domain
doubled the number of koala control-region variants
detected using the TGGE method, suggesting that the
third melting domain was probably obscuring some
variation in the koala mtDNA control region. The new
haplotypes detected by the optimized TGGE method
were observed only amongst individuals that were not
previously examined by Houlden et al. (1999), with the
exception of one Moreton individual.
Relationship of control-region haplotypes
Phylogenetic analysis of the eight haplotypes observed in
this study revealed a radiating network of inter-related
haplotypes that, with two exceptions, varied by only 1
2 bp. The distribution of these haplotypes among the
populations in this study has revealed interesting aspects
of koala life history in the southeastern region of Queens-
land. The widespread distribution of the Q4 haplotype
among the populations surveyed suggests that female-
mediated gene flow has occurred among these sites in
the past, or that populations were more extensive and
overlapped more widely. The limited distributions of the
remaining four haplotypes may indicate the development
of more recent barriers to gene flow among most sites.
Alternatively, these haplotypes may have arisen recently
and have not yet been widely dispersed. This is unlikely,
however, given that two haplotypes (Q7 and Q8) are
highly divergent in sequence. It is possible that rare
haplotypes (i.e. Q2, Q5 and Q8) also occur at other sites,
but were not detected owing to the small numbers of
individuals sampled at some sites. If this were true it
would suggest more extensive gene flow among sites.
The absence of the Q1 haplotype at any site north of the
Gold Coast, while present at high frequency in both Gold
Coast and Round Mountain populations, suggests that
female-mediated gene flow between these two regions
has been very low historically, possibly indicating a
barrier to gene flow between these two regions. The central
phylogenetic position of this haplotype suggests that it
may have once been more widespread throughout the
study region, and may have been lost owing to a histor-
ical population bottleneck north of the Gold Coast. How-
ever, the presence of the Q1 haplotype north of the Gold
Coast may not have been detected in our study. The
occurrence of this haplotype in Gold Coast and Round
MEC844.fm Page 162 Monday, January 24, 2000 10:08 AM
162 E . V. F O W L E R E T A L .
Mountain at similar frequencies is further evidence that
female-mediated gene flow between these two sites has
occurred. This is in direct contrast to all other sites in this
study.
The detection of two highly divergent haplotypes at the
Moreton site is hard to explain. Theory predicts a number
of possible explanations for their presence in some popu-
lations, including extensive population bottlenecking in
the past. Another possibility is that in recent times koalas
may have been translocated into the region from other
locations. Houlden et al. (1999) recently identified a single
haplotype at Springsure (n = 14) in central Queensland,
which is only 2 bp divergent from our Q8 haplotype. The
similarity between these two haplotypes and the large
distance between the two sites (i.e. greater than 500 km)
lends support to the suggestion that koala introductions
may have been made into the Moreton site in the past. It
is also possible, however, that intermediate haplotypes
have disappeared owing to the occurrence of historical
population bottlenecks.
Genetic diversity within populations
Several of the koala populations sampled showed within-
population variation in the 670-bp mtDNA control-region
fragment. Although mother/offspring pairs were not
sampled in this study, it is possible that relatives were
sampled within a site, which may result in the underestima-
tion of diversity levels. The level of within-population
nucleotide diversity observed in this study ( = 0.22%)
was similar to that reported for Queensland koalas in a
recent study ( = 0.25%) that utilized a similar approach
for detecting variation in the mtDNA D-loop region
(Houlden et al. 1999). This level of variation was approx-
imately four- to fivefold higher than reported by a previ-
ous restriction fragment length polymorphism (RFLP)
analysis of mtDNA in Queensland koalas ( = 0.05%)
(Worthington-Wilmer et al. 1993). This indicates that the
TGGE method provides increased sensitivity for detect-
ing changes within a target sequence because substitu-
tions can be detected wherever they occur along the
sequence being sampled, as opposed to only where re-
striction enzyme recognition sequences occur, as with
the RFLP method. The number of individuals examined
was also much larger than in previous studies and this
may also have affected the number of haplotypes
detected. The recent TGGE study by Houlden et al. (1999),
however, examined approximately twice as many Queens-
land individuals as previous studies, but observed five
times the level of within-population nucleotide diversity
(n = 49, = 0.25%). As our study examined approximately
twice the number of Queensland koalas as those
examined in Houldens study, but revealed a similar level
of within-population nucleotide diversity, it is probable
that the difference observed between the RFLP and TGGE
studies is not a result of sample size differences.
The level of within-population nucleotide diversity in
Queensland koala populations ( = 0.22%) was slightly
lower than reported for the southern hairy-nosed wombat
( = 0.36%) (Taylor 1995), and five- to sixfold lower than
observed in the yellow-footed rock wallaby ( = 1.03%)
(Pope et al. 1996) and the bilby ( = 1.36%) (Moritz et al.
1997). Average within-population haplotype diversity
in the koala (H = 0.38) was almost twofold higher than
previously reported within Queensland populations
(H = 0.20) (Houlden et al. 1999) and suggests that the
TGGE/HDA methodology is more sensitive than others
attempted in koalas. This increased sensitivity is prob-
ably the result of a sampling effect because a positive
correlation between sample size and average haplotype
diversity was observed for the two studies. Average haplo-
type diversity in the koala was intermediate between
the southern hairy-nosed wombat (H = 0.04) (Taylor 1995)
and the bilby (H = 0.95) (Moritz et al. 1997).
Genetic differentiation between populations
Significant genetic heterogeneity among most Queens-
land koala populations studied here and the maternal
inheritance of mtDNA suggest that these populations
are structured spatially along matrilines, even over rel-
atively small distances. This finding is consistent with
several reports which have proposed that female koala
dispersal from natal sites is more limited than male
dispersal (Gordon et al. 1990b; Mitchell & Martin 1990).
Koalas from two locations in this study (Gold Coast
and Moreton [also called Mutdapilly] ) have been sur-
veyed previously for microsatellite variation, and sig-
nificant differentiation in allelic diversity and average
heterozygosity was observed between the two sites
(Houlden et al. 1996). This confirms the results of the
current study, despite the difference in the different modes
of inheritance of the markers analysed in each study
(i.e. microsatellites = biparental, mtDNA = maternal).
Thus, the similarities observed between the two studies
can be explained by the limited female and male
contributions to gene flow among these sites. However,
male dispersal between sites is probably greater than
female dispersal, which is also consistent with observations
of higher male dispersal from natal sites reported in
earlier studies (Gordon et al. 1990b; Mitchell & Martin
1990). The lack of significant genetic heterogeneity
between the Round Mountain and Gold Coast sites
indicates that the two populations are not spatially
structured along matrilines, and thus female dispersal
will probably be high between these sites. However,
the small sample size of Round Mountain (n = 10) may
bias these results. Taken together, the results suggest that
2000 Blackwell Science Ltd, Molecular Ecology, 9, 155 164
MEC844.fm Page 163 Monday, January 24, 2000 10:08 AM
K O A L A G E N E F L O W I N S O U T H E A S T Q U E E N S L A N D 163
koalas from the five sites in this study probably belong to
four discrete populations based on mtDNA diversity:
(i) Gold Coast and Round Mountain; (ii) Redland Bay;
(iii) Moreton; and (iv) Pine Rivers. Results of the amova
demonstrate that although haplotype diversity among
populations was relatively low, most populations were
significantly differentiated (PT = 0.233, P < 0.001), with
Round Mountain and Gold Coast being the exception
(PT = 0.007, P < 0.594). The low proportion of haplotype
diversity among populations revealed by amova is in
direct contrast with the recent study by Houlden et al.
(1999) that showed a high proportion of haplotype
diversity among populations (PT = 0.733, P < 0.001). This
difference could be the result of a sampling effect or
possibly the different levels of scale surveyed in each
study.
Conclusion
This study has revealed evidence to suggest that female
dispersal is limited among koalas in the southeastern
region of Queensland. Further analysis of koala nuclear
genetic diversity among populations from this region will
establish if this is a general characteristic of koalas in the
wild. In addition, our results generally support the sug-
gestion that koala populations are spatially structured
along matrilines, although the absence of such structuring
was also observed. Furthermore, the incidence of histor-
ical population bottlenecks, barriers to gene flow and
translocations, were tentatively suggested based on data
generated from the populations studied. Documented
evidence of koala population history in the southeastern
region of Queensland is very limited prior to this century,
largely owing to recent colonization of the area by
nonindigenous humans in the early 1800s. This study is
the first to provide an insight into the type of historical
events that may have affected local koala populations
in this region. Further application of both nuclear and
maternal markers for the analysis of genetic diversity
among koala populations within this region will expand
our findings and perhaps lead to the development of
suitable management strategies for maintaining viable
koala populations in southeast Queensland and for
maintaining natural levels of genetic diversity in the wild.
Acknowledgements
The Australian Koala Foundation and Lone Pine Koala Sanctuary
funded this project. We thank Steve Phillips and John Callaghan
(Australian Koala Foundation), Jeff McKee and Rosie Booth (Cur-
rumbin Sanctuary), Rick Natrass and Peter Theilman (Queensland
National Parks and Wildlife Service), Graeme Lloyd, Anthony
Fowler and many other volunteers, for assistance in sample
collection. Neil White, Casper Pieters and Bill Sherwin provided
additional samples. Thanks also to Peter Baverstock and Martin
2000 Blackwell Science Ltd, Molecular Ecology, 9, 155164
Elphinstone for providing the original primers (MT15996L and
MT16502H) and for advice on the use of TGGE, Peter Mather
and Andrew Baker for access to TGGE equipment in Brisbane
and helpful advice, and to Nick Campbell and Rob Slade for
helpful suggestions.
References
Avise JC, Arnold J, Ball RM et al. (1987) Intraspecific phylogeo-
graphy: the mitochondrial DNA bridge between population
genetics and systematics. Annual Review of Ecology and System-
atics, 18, 489522.
Brown R (1996) Planning for koala habitat protection in fringe
areas: considerations and opportunities. In: Koalas Research
for Management, Proceedings of the Brisbane Koala Symposium,
22nd23rd September, 1990 (ed. Gordon G), pp. 175 177. World
Koala Research Incorporated, Brisbane.
Campbell NJH, Harriss FC, Elphinstone MS, Baverstock PR
(1995) Outgroup heteroduplex analysis using temperature gradi-
ent gel electrophoresis high resolution, large scale screening
of DNA variation in the mitochondrial control region. Molecular
Ecology, 4, 407418.
Elphinstone MS, Baverstock PR (1997) Detecting mitochondrial
genotypes by temperature gradient gel electrophoresis and
heteroduplex analysis. Biotechniques, 23, 982 986.
Excoffier L, Smouse PE (1994) Using allele frequencies and geo-
graphic subdivision to reconstruct gene trees within a species:
molecular variance parsimony. Genetics, 136, 343 359.
Excoffier L, Smouse PE, Quattro JM (1992) Analysis of molecular
variance inferred from metric distances among DNA haplo-
types: application to human mitochondrial DNA restriction
data. Genetics Society of America, 131, 479 491.
Felsenstein J (1985) Confidence limits on phylogenies: and
approach using the bootstrap. Evolution, 39, 783 791.
Felsenstein J (1995) PHYLIP (Phylogenetic Inference Package), Version
3.57. Department of Genetics, University of Washington,
Seattle.
Fowler EV, Hoeben P, Timms P (1998) Randomly amplified poly-
morphic DNA variation in populations of eastern Australian
koalas, Phascolarctos cinereus. Biochemical Genetics., 36, 381 393.
Genetics Computer Group (1994) Program Manual for the Wisconsin
Package, Version 8, August 1994. Genetics Computer Group,
575 Science Drive, Madison, Wisconsin, USA 53711.
Gordon G, McGreevy DG (1978) The status of the koala in
Queensland. In: The Koala: Proceedings of the Taronga Symposium
of Koala Biology, Management and Medicine, Sydney 11th and 12th
March 1976 (ed. Bergin TJ), pp. 125131. Zoological Parks
Board of NSW, Sydney.
Gordon G, McGreevy DG, Lawrie BC (1990a) Koala populations
in Queensland: major limiting factors. In: Biology of the Koala
(eds Lee AK, Handasyde KA, Sanson GD), pp. 85 95. Surrey
Beaty and Sons, Sydney.
Gordon G, McGreevy DG, Lawrie BC (1990b) Koala population
turnover and male social organization. In: Biology of the Koala
(eds Lee AK, Handasyde KA, Sanson GD), pp. 189192. Surrey
Beaty and Sons, Sydney.
Herbert DA, Mayo WM (1929) Annual report of the Nature
Lovers League subcommittee for the year ending 31st December,
1928. Queensland Naturalist, 7, 2427.
Houlden BA, England PR, Taylor AC, Greville WD, Sherwin WB
(1996) Low genetic variability of the koala Phascolarctos cinereus
MEC844.fm Page 164 Monday, January 24, 2000 10:08 AM
164 E . V. F O W L E R E T A L .
in south-eastern Australia following a severe population
bottleneck. Molecular Ecology, 5, 269 281.
Houlden BA, Costello BH, Sharkey D et al. (1999) Phylo-
geographic differentiation in the mitochondrial control region
in the koala, Phascolarctos cinereus (Goldfuss 1817). Molecular
Ecology., 8, 999 1012.
Kumar S, Tamura K, Nei M (1993) MEGA: Molecular Evolutionary
Genetic Analysis, Version 1.0. Pennsylvania State University,
Pennsylvania.
Lessa EP, Applebaum G (1993) Screening techniques for detect-
ing allelic variation in DNA sequences. Molecular Ecology., 2,
119 129.
Mitchell P, Martin R (1990) The structure and dynamics of koala
populations French Island in perspective. In: Biology of the
Koala (eds Lee AK, Handasyde KA, Sanson GD), pp. 97108.
Surrey Beaty and Sons, Sydney.
Moritz C (1994) Application of mitochondrial DNA analysis in
conservation: a critical review. Molecular Ecology, 3, 401411.
Moritz C, Heideman A, Geffen E, McRae P (1997) Genetic popula-
tion structure of the Greater Bilby Macrotis lagotis, a marsupial
in decline. Molecular Ecology, 6, 925936.
Nattrass AEO, Fiedler KB (1996) Koala rescue the perception and
the reality. In: Koalas Research for Management, Proceedings of the
Brisbane Koala Symposium, 22nd23rd September, 1990 (ed. Gordon
G), pp. 129 136. World Koala Research Incorporated, Brisbane.
Nei M (1987) Molecular Evolutionary Genetics. Columbia University
Press, New York.
OCorry-Crowe GM, Suydam RS, Rosenberg A, Frost JJ, Dizon
AE (1997) Phylogeography, population structure and dispersal
patterns of the beluga whale Delphinapterus leucas in the western
Nearctic revealed by mitochondrial DNA. Molecular Ecology, 6,
955 970.
Patterson R (1996) The distribution of koalas in Queensland
1986 89. In: Koalas Research for Management, Proceedings of
the Brisbane Koala Symposium, 22nd23rd September, 1990 (ed.
Gordon G), pp. 75 81. World Koala Research Incorporated,
Brisbane.
Phillips B (1990) Koalas: the Little Australians Wed All Hate to Lose.
Commonwealth of Australia, Canberra.
Poland D (1974) Recursion relation generation of probability
profiles for specific-sequence macromolecules with long range
correlations. Biopolymers, 13, 1859 1871.
Pope LC, Sharp A, Moritz C (1996) Population structure of the
yellow-footed rock-wallaby Petrogale xanthopus (Gray, 1854)
inferred from mtDNA sequences and microsatellite loci. Molecu-
lar Ecology, 5, 629640.
Roff FJ, Bentzen P (1989) The statistical analysis of mitochondrial
DNA polymorphisms: and the problem of small samples.
Molecular Biology and Evolution, 6, 539545.
Saitou N, Nei M (1987) The neighbour-joining method; a new
method for reconstructing phylogenetic trees. Molecular Biology
and Evolution, 4, 406425.
Salt B (1998) Population Growth Ranking in Australia and New
Zealand, 9th edn. KPMG Management Consulting, Melbourne.
Sharp A (1995) The Koala Book. Australian Koala Foundation,
David Bateman Ltd, Auckland.
Staden R (1980) Nucleic Acids Research, 8, 3673 3694.
Tamura K (1992) Estimation of the number of nucleotide sub-
stitutions when there are strong transition-transversion and
G + C content biases. Molecular Biology and Evolution, 9, 678687.
Taylor AC (1995) Molecular ecology of the endangered northern hairy
nosed wombat: application to conservation and management. PhD
Thesis, University of New South Wales, Sydney, Australia.
Taylor AC, Sherwin WB, Wayne RK (1994) Genetic variation
of microsatellite loci in a bottlenecked species: the northern
hairy-nosed wombat Lasiorhinus krefftii. Molecular Ecology, 3,
277290.
Thompson JD, Higgins DJ, Gibson TJ (1994) clustalw: improving
the sensitivity of progressive multiple sequence alignment
through sequence weighting, position specific gap penalties
and weight matrix choice. Nucleic Acid Research, 22, 4673 4680.
Timms P, Kato J, Maugeri M, White N (1993) DNA fingerprinting
analysis of a free-range koala population. Biochemical Genetics,
31, 361372.
White NA, Kunst ND (1990) Aspects of the ecology of the koala in
southeastern Queensland. In: Biology of the Koala (eds Lee AK,
Handasyde KA, Sanson GD), pp. 109 116. Surrey Beaty and
Sons, Sydney.
Worthington-Wilmer JM, Melzer A, Carrick F, Moritz C (1993)
Low genetic diversity and inbreeding depression in Queens-
land koalas. Wildlife Research, 20, 177188.
The authors are interested in the application of molecular
methods to investigate various aspects of koala biology and
conservation. This work is part of Elizabeth Fowlers PhD thesis
on the population genetics of koalas.
2000 Blackwell Science Ltd, Molecular Ecology, 9, 155 164