Vous êtes sur la page 1sur 27

ED Biologie molculaire

E. Turpin
J. Lehmann-Che
5-6 novembre 2007
PCR

1983: Kary Mullis

Amplification in vitro par une mthode enzymatique d'un fragmentd'ADN


en prsence de deux oligonuclotides spcifiques de la squence amplifier.

Succession de 20 40 cycles thermiques:


1/dnaturation
2/hybridation des oligonuclotides
3/extension par une Taq DNA polymrase
Dnaturation (95C)

ADN cible :1 copie


5 3
3 5
5 3

3 5
Hybridation (50 60 C)

3
Amorces 5
3 5
5 3
3 5'
5' 3

3 5

10 picomoles de chaque amorce: 10x10-12x6.02x1023

= 6.02x1012 molcules de chaque primer


Extension (68 72C)

ADN cible :2 copies


5 3

3 5

: ADN Polymrase A C G T: 4 dsoxyribonuclotides


5 3

Cycle 2 4 copies

3 5

5 3

Cycle 3 8 copies
Amplicon

3 5
Exercice: dessiner des amorces de PCR

La squence prsente est celle dune partie du gne de la globine humaine


comprenant le promoteur, lexon 1 et une partie de lintron 1. Sur cette
squence de 315 pb (paires de bases), le n 100 (A s ur le brin codant)
correspond au dbut de la transcription, de 150 153 est lATG initiateur de
la traduction et le n 241 est le G de fin de lexo n 1.

On veut amplifier par PCR le fragment commenant 36 et se terminant 302


suivant la numrotation indique au dessus du brin codant 5  3.
1) Quelles amorces seront utilises?
2) Quels sont les diffrents constituants ncessaires la raction de PCR?
3) Quelles sont les diffrentes tapes dune raction de PCR? A quoi servent-
elles?
4) Comment peut-on mettre en vidence le produit de PCR?
5) Quelle est la taille attendue pour le produit de PCR?
Rgion 5 du gne de la globine humaine

10 20 30 40 50
5-GTGGAGCCAC ACCCTAGGGT TGGCCAATCT ACTCCCAGGA GCAGGGAGGG
60 70 80 90 100
CAGGAGCCAG GGCTGGGCAT AAAAGTCAGG GCAGAGCCAT CTATTGCTTA
110 120 130 140 150
CATTTGCTTC TGACACAACT GTGTTCACTA GCAACCTCAA ACAGACACCA
160 170 180 190 200
TGGTGCACCT GACTCCTGAG GAGAGGTCTG CCGTTACTGC CCTGTGGGGC
210 220 230 240 250
AAGGTGAACG TGGATGAAGT TGGTGGTGAG GCCCTGGGCA GGTTGGTATC
260 270 280 290 300
AAGGTTACAA GACAGGTTTA AGGAGACCAA TAGAAACTGG GCATGTGGAG
310
ACAGAGAAGA CTCTT - 3
Correction

1/ Oligonuclotides commander:
Sens: 5 AGGA GCAGGGAGGG CAGGAG 3
Anti sens: 5 GTCTCCACATGCCCAGTTTC 3

5-AGGA GCAGGGAGGG CAGGAGCCAG


3-TCCT CGTCCCTCCC GTCCTCGGTC

GGCTGGGCAT AAAAGTCAGG GCAGAGCCAT CTATTGCTTA CATTTGCTTC TGACACAACT


CCGACCCGTA TTTTCAGTCC CGTCTCGGTA GATAACGAAT GTAAACGAAG ACTGTGTTGA

GTGTTCACTA GCAACCTCAA ACAGACACCA TGGTGCACCT GACTCCTGAG GAGAGGTCTG


CACAAGTGAT CGTTGGAGTT TGTCTGTGGT ACCACGTGGA CTGAGGACTC CTCTTCAGAC

CCGTTACTGC CCTGTGGGGC AAGGTGAACG TGGATGAAGT TGGTGGTGAG GCCCTGGGCA


GGCAATGACG GGACACCCCG TTCCACTTGC ACCTACTTCA ACCACCACTC CGGGACCCGT

GGTTGGTATC AAGGTTACAA GACAGGTTTA AGGAGACCAA TAGAAACTGG GCATGTGGAG


CCAACCATAG TTCCAATGTT CTGTCCAAAT TCCTCTGGTT ATCTTTGACC CGTACACCTC

AC - 3
TG - 5
Cintique de la PCR
Comparaison PCR en point final/ QPCR
Modes de dtection du produit damplification

SYBR Green Sondes marques

Sondes TaqMan Sondes dhybridation


(sondes dhydrolyse)
Principe du FRET

Sonde intacte: Q absorbe lnergie de


R qui nmet pas de fluorescence

Lors longation, activit 5


exonuclasique de la Taq
hydrolyse la sonde

Q ne peut plus absorber lnergie de R


qui met une fluorescence,
proportionnelle la quantit dADN
nouvellement synthtise.
Comment passer dune fluorescence un rsultat? (1)

1/ Dtermination des Ct

Ct= intersection
entre la courbe
damplification et la
barre de seuil

Bruit de fond Barre de seuil


Comment passer dune fluorescence un rsultat? (2)

2/ Comparaison des Ct

Quantification absolue Quantification relative

Rsultat: rapport entre Ct


Rsultat en nombre de copies  ou  par rapport au calibrateur
Ncessite une courbe standard Pas de standards mais
-un contrle endogne
-un calibrateur
Quantification absolue (1)

Y= (1+E)n X

Qt initiale de la cible
Qt de produits de PCR
Nbre de cycles
Doublement
Y= 2n X chaque cycle
Quantification absolue (2)
Quantification relative (1)

Contrle endogne:
reflet de la qt de matrice par puit
doit tre identique pour tous les chantillons analyss
permet de normaliser les qts de matrice indroduites

Si on met 2x plus de matriel quau dpart?


Quantification relative (2)

Les pentes des 2 gnes ne sont pas quivalentes

Ici, le CT nest pas constant quelque soit la


quantit de cDNA

retenir: les PCR des 2 gnes (dintrt et endogne) doivent avoir une efficience
proche (donc une pente quivalente) pour pouvoir calculer des CT
Erreur en fonction de lEfficacit de la
raction PCR

Efficacit
99% 95% 90% 85% 80% 75% 70%
1 1% 3% 5% 8% 11% 14% 18%
2 1% 5% 11% 17% 23% 31% 38%
3 2% 8% 17% 26% 37% 49% 63%
3,32 2% 9% 19% 30% 42% 56% 72%
4 2% 11% 23% 37% 52% 71% 92%
Ct

5 3% 13% 29% 48% 69% 95% 125%


6 3% 16% 36% 60% 88% 123% 165%
7 4% 19% 43% 73% 109% 155% 212%
8 4% 22% 51% 87% 132% 191% 267%
9 5% 26% 59% 102% 158% 233% 332%
10 5% 29% 67% 118% 187% 280% 408%

Efficience de 85%
pour une diffrence de 1CT, lerreur est de 8%
Quantification de lARNm dun gne: Q-RT-PCR

Transcription Traduction

ADN ARN protine


Gne messager

Prsence et
Amplifications gniques modifications localisation
dexpression
Q RT-PCR Immunohistochimie
Q PCR
analyse du transcriptome Tissue array
(microarray)
Amorces- sondes Anticorps

Reverse transcription des ARNm  cDNA


Reverse trancription d'un ARN messager
en ADN complmentaire
ARNm
5 AAAAAA
3
3 5

Hybride ARNm/ADNc 3
5 AAAAAA

: Reverse transciptase

Oligonuclotide: spcifique
hexamers
oligo(dt)12-20
PCR aprs RT
Hybride ARNm/ADNc 3
5 AAAAAA
3' 5
Dnaturation
5 3
AAAAAA

Hybridation

3' 5

Extension

3' 5
PCR classique
Exemples dapplication de la Q PCR ou Q-RTPCR

 Dtermination de la charge virale


ex: HIV-1 en suivi du SIDA
 Dtermination de lamplification dun gne  QPCR
ex: HER-2 dans le cancer du sein
 Dtermination de la surexpression dun gne  Q RT-PCR
ex: ER dans le cancer du sein
Exemples

Exemple 1:

-1/ Quel est lchantillon de cDNA le plus concentr et combien de fois?


- 2/ Quel organe exprime le plus dIL10 et combien de fois plus?
Correction 1

Question 1:
-Le CT du gne endogne est un reflet de la quantit de cDNA dans lchantillons
Ici le 18S rRNA est le gne endogne ou gne de mnage
Lchantillon le plus concentr est celui qui a le CT le plus petit donc le cerveau.
-Il existe une diffrence de 16 -14 = 2 cycles entre les 2 chantillons
 22 = 4 donc lchantillon du cerveau est 4 fois plus concentr que celui du foie

Question 2:
On compare les CT des 2 chantillons :

 lIL10 est plus exprim dans le foie que dans le cerveau

 Il existe une diffrence de 6 CT entre les 2 chantillons


donc lIL-10 est exprim 64 fois plus dans le foie
Exemples

Exemple 2:
Une culture cellulaire subit un traitement par une drogue. On compare
lexpression dun gne au cours du temps aprs traitement.

Quelle est laction de la drogue


sur lexpression du gne
dintrt, en fonction du temps?

Expression en 2 -CT
Correction 2

On calcule les CT pour chaque temps:


CTt0= 35-15 =20
CTt12= 30-15 =15
CTt24= 24-9 =15
CTt48= 34-14 =20

On compare par rapport au temps T0:


T12= CTt12-CTt0= -5  25=32
T24= 15-20= -5
T48= 20-20=0

Conclusion: la drogue active lexpression du gne dintrt dun facteur 32 entre


12 et 24h aprs administration. On constate un retour lexpression basale 48h
aprs traitement.