Académique Documents
Professionnel Documents
Culture Documents
7
0099-2240/11/$12.00 doi:10.1128/AEM.02149-10
Copyright 2011, American Society for Microbiology. All Rights Reserved.
Directly adding antimicrobial agents to food or into pack- ticles allow for better interaction with bacteria. Recent studies
aging materials during food processing is considered an effec- have shown that these nanoparticles have selective toxicity to
tive means of controlling microbial contaminants in food and bacteria but exhibit minimal effects on human cells (21). ZnO
extending the shelf life of fresh produce and meat. In recent nanoparticles have been shown to have a wide range of anti-
years, inorganic antimicrobial agents, such as metal oxides, bacterial activities against both Gram-positive and Gram-neg-
have received increasing attention in food applications because ative bacteria, including major foodborne pathogens like Esch-
they are not only stable under high temperatures and pressures erichia coli O157:H7, Salmonella, Listeria monocytogenes, and
that may occur in harsh food-processing conditions, but they Staphylococcus aureus (13, 14), but currently there is no infor-
are also generally regarded as safe for human beings and an- mation available on their antibacterial effect against species of
imals relative to organic substances (6, 24). Campylobacter. Campylobacter jejuni is a leading cause of mi-
Zinc oxide (ZnO) is listed as generally recognized as safe crobial foodborne illness worldwide. In fact, it has recently
(GRAS) by the U.S. Food and Drug Administration been shown that approximately 80% of poultry products are
(21CFR182.8991). As a food additive, it is the most commonly contaminated with this pathogen (11). Consumption of Cam-
used zinc source in the fortification of cereal-based foods. pylobacter-contaminated food and water usually causes a mild
Because of its antimicrobial properties, ZnO has been incor- to severe gastrointestinal infection in humans that can some-
porated into the linings of food cans in packages for meat, fish, times develop into a life-threatening disease called Guillain-
corn, and peas to preserve colors and to prevent spoilage. Barre syndrome (28). Therefore, it is important to focus on the
Nano-sized particles of ZnO have more pronounced antimi- use of ZnO particles as a potential food safety intervention
crobial activities than large particles, since the small size (less technology to effectively control Campylobacter and other mi-
than 100 nm) and high surface-to-volume ratio of nanopar- crobial contaminants in food.
To make better use of ZnO nanoparticles in food products
* Corresponding author. Mailing address for Yiping He: USDA- and to assist in the development of powerful, but nontoxic,
ARS-ERRC, 600 East Mermaid Lane, Wyndmoor, PA 19038. antimicrobial derivatives, it is necessary to understand the
Phone: (215) 233-6422. Fax: (215) 836-3742. E-mail: yiping.he@ars mechanism of action of ZnO nanoparticles against bacteria,
.usda.gov. Mailing address for Xianming Shi: Mail box 49, School of but to date, the process underlying their antibacterial effect is
Agriculture & Biology, Shanghai Jiao Tong University, 800
Dongchuan Road, Shanghai, China 200240. Phone and fax: 86-21-
not clear. However, a few studies have suggested that the
3420-6616. E-mail: xmshi@sjtu.edu.cn. primary cause of the antibacterial function might be from the
Published ahead of print on 4 February 2011. disruption of cell membrane activity (4). Another possibility
2325
2326 XIE ET AL. APPL. ENVIRON. MICROBIOL.
could be the induction of intercellular reactive oxygen species, plates to determine the bactericidal (bacteria-killing) or bacteriostatic (bacteria-
including hydrogen peroxide (H2O2), a strong oxidizing agent inhibiting) effect of ZnO nanoparticles. The MICs of ZnO nanoparticles for C.
jejuni, E. coli O157:H7, and Salmonella were determined using a broth microdi-
harmful to bacterial cells (13, 22). It has also been reported lution method reported previously (19). Briefly, serial 2-fold dilutions of nano-
that ZnO can be activated by UV and visible light to generate particles ranging from 0.00625 to 1.6 mg/ml were prepared in a 96-well microtiter
highly reactive oxygen species such as OH, H2O2, and O22. plate using MH or LB broth. Freshly grown bacterial cells were inoculated into
The negatively charged hydroxyl radicals and superoxides can- each well to give a final concentration of 104 CFU/ml. After the inocula were
incubated microaerobically for 24 h at 42C for C. jejuni or aerobically for 16 h
not penetrate into the cell membrane and are likely to remain
at 37C for E. coli O157:H7 and Salmonella, cell growth in each well was
on the cell surface, whereas H2O2 can penetrate into bacterial monitored and compared with that of the positive-control well to which no ZnO
cells (18). To better understand the nature of the inhibitory nanoparticles were added. The MIC was recorded as the lowest concentration of
and lethal effects of ZnO nanoparticles on bacteria, we used C. ZnO nanoparticles that completely inhibited cell growth.
jejuni as a model organism to investigate this mechanism. C. Examination of cell morphology by scanning electron microscope (SEM).
Mid-log-phase C. jejuni cultures were treated with 0.5 mg/ml of ZnO nanopar-
jejuni is a Gram-negative, spiral-shaped, highly motile, ther- ticles for 12 h under microaerobic conditions. Aliquots of 200 l of treated and
mophilic and microaerophilic bacterium that grows optimally untreated cell suspensions were deposited on glass coverslips. After being air
in a neutral pH and microaerobic environment at 42C. Unlike dried for 1 h, the coverslips were fixed with a primary fixative solution containing
other major foodborne pathogens, such as E. coli O157:H7, 2.5% glutaraldehyde and 0.1 M imidazole buffer solution (pH 7.2) for 2 h.
TABLE 1Continued
Gene function/protein encodeda Gene Primer Sequence (533)
Housekeeping genes
Gyrase subunit A gyrA Forward TGCTAAAGTGCGTGAAATCG
Reverse GCATTGGTGCGTTTTCCTAT
Elongation factor TS tsf Forward GAACTCCGCGAAAGTACAGG
Reverse TTGCCACAAAATCTGTTTCG
16S rRNA 16S rRNA gene Forward GCTCGTGTCGTGAGATGTTG
Reverse TCACCGTAGCATGGCTGAT
and Raman spectroscopy when cells were treated with ZnO stress response genes was either unchanged or downregulated.
nanoparticles (14). Because KatA is a single catalase enzyme whose expression
When extracellular environments change, bacteria adopt level increases in C. jejuni upon exposure to H2O2 (7), the
mechanisms that quickly regulate the synthesis of defensive 52-fold induction of KatA expression suggests a high probabil-
proteins in response to stress. In Campylobacter, a number of ity that more intercellular H2O2 is produced in response to the
genes/proteins that play critical roles in protecting cells from ZnO nanoparticles. From these experiments and the role of
different stresses, especially oxidative stress, have been identi- the oxidative stress regulatory system in Campylobacter, we can
fied (26). Most importantly, to eliminate reactive oxygen spe- conclude that the antibacterial mechanism of ZnO nanopar-
cies and to assist the organism in defense against oxidative ticles is very likely through increased levels of oxidative stress
stress, superoxide dismutase (SodB) breaks down O2 to H2O2 in bacterial cells. Furthermore, the expression of a number of
and O2, catalase (KatA) inactivates H2O2 and interrupts the virulence factors related to cell motility, toxin production, and
formation of toxic intermediates, and alkyl hydroperoxide re- adhesion to host cells was also examined in response to ZnO
ductase (AhpC) destroys toxic hydroperoxide intermediates nanoparticles. All of the analyzed virulence genes were found
and repairs damage to molecules caused by oxidation (3, 20). to be downregulated, suggesting decreased pathogenicity of
In addition to these oxidative stress response proteins, general the bacterium after treatment.
stress response proteins (DnaK, DnaJ, GroES, and GroEL), In summary, ZnO nanoparticles exhibited remarkable anti-
which act as molecular chaperones and play a critical role in bacterial activity and demonstrated a lethal effect against C.
preventing protein aggregation and refolding, are also impor- jejuni, even at low concentrations. ZnO nanoparticles induced
tant for cell survival (2). Analysis of ZnO nanoparticle-modu- significant morphological changes, measurable membrane
lated stress gene expression showed that the transcription lev- leakage, and substantial increases (up to 52-fold) in oxidative
els of two oxidative stress genes (ahpC and katA) and one stress gene expression in C. jejuni. Based on these phenomena
general stress response gene (dnaK) were significantly in- and cell responses, a plausible mechanism of ZnO inactivation
creased, up to 7- to 52-fold, while another 4 stress response of bacteria involves the direct interaction between ZnO nano-
genes (sodB, dps, groEL, and groES) were expressed at approx- particles and cell surfaces, which affects the permeability of
imately 2- to 3-times-higher levels. Expression of all other membranes where nanoparticles enter and induce oxidative
FIG. 4. Relative gene expression levels of ZnO nanoparticle-treated and untreated C. jejuni. C. jejuni cells in the late log phase of growth were
treated with 0 or 0.1 mg/ml of ZnO nanoparticles for 30 min. Transcripts of the selected genes were quantified by RT-qPCR, and data were
analyzed using the comparative critical threshold (CT) method. The relative expression ratio for each gene is presented as a log2 value in the
histogram. A ratio greater than zero (0) indicates upregulation of gene expression and a ratio below zero (0) indicates downregulation. Error
bars indicate standard deviations for three replicates.
VOL. 77, 2011 ANTIMICROBIAL MECHANISM OF ZnO NANOPARTICLES 2331
stress in bacterial cells, subsequently resulting in the inhibition 12. Jin, T., D. Sun, J. Y. Su, H. Zhang, and H. J. Sue. 2009. Antimicrobial
efficacy of zinc oxide quantum dots against Listeria monocytogenes, Salmo-
of cell growth and eventually in cell death. nella Enteritidis, and Escherichia coli O157:H7. J. Food Sci. 74:M46M52.
13. Jones, N., B. Ray, K. T. Ranjit, and A. C. Manna. 2008. Antibacterial activity
ACKNOWLEDGMENTS of ZnO nanoparticle suspensions on a broad spectrum of microorganisms.
FEMS Microbiol. Lett. 279:7176.
This research was jointly supported by the Agriculture Research
14. Liu, Y., et al. 2009. Antibacterial activities of zinc oxide nanoparticles against
Service, U.S. Department of Agriculture, the Ministry of Science and Escherichia coli O157:H7. J. Appl. Microbiol. 107:11931201.
Technology of China (2009BADB9B01 and 2009BAK43B31), and the 15. Livak, K. J., and T. D. Schmittgen. 2001. Analysis of relative gene expression
Science and Technology Commission of Shanghai Municipality data using real-time quantitative PCR and the 2CT method. Methods
(09DZ0503300). 25:402408.
We thank Guoping Bao of the Microscopy Imaging Facility of the 16. Nair, S., et al. 2009. Role of size scale of ZnO nanoparticles and micropar-
USDA, ARS, ERRC, for technical assistance in acquiring the SEM ticles on toxicity toward bacteria and osteoblast cancer cells. J. Mater. Sci.
images and George Paoli of the Molecular Characterization of Food- Mater. Med. 20(Suppl. 1):S235S241.
Borne Pathogens Research Unit of the USDA, ARS, ERRC, for 17. Nogva, H. K., S. M. Dromtorp, H. Nissen, and K. Rudi. 2003. Ethidium
providing the C. jejuni ATCC strains. monoazide for DNA-based differentiation of viable and dead bacteria by
5-nuclease PCR. Biotechniques 34:804813.
REFERENCES 18. Padmavathy, N., and R. Vijayaraghavan. 2008. Enhanced bioactivity of ZnO
1. Adams, B. L., T. C. Bates, and J. D. Oliver. 2003. Survival of Helicobacter nanoparticlesan antimicrobial study. Sci. Technol. Adv. Mater. 9:17.