Vous êtes sur la page 1sur 229

THESE

Pour lobtention du Grade de

DOCTEUR DE LUNIVERSIT DE POITIERS


(Facult Mdecine et Pharmacie)

(Diplme National - Arrt du 7 aot 2006)

cole Doctorale : Biologie-Sant N 524

Secteur de Recherche : Recherche clinique, innovation thrapeutique, sant publique

Prsente par :

Mohammed SEHNINE

Implication du rcepteur ST2 de lalarmine interleukin-33


dans le phnomne dischmie/reperfusion rnale : tude de
linfluence dun environnement hyperglycmique

Directeur de thse : Pr. Samy HADJADJ


Co-Directeur de thse : Dr. Andr HERBELIN

************************

Soutenue le 15 dcembre 2016 devant la Commission dExamen

************************

JURY

Pr. Ronan ROUSSEL PU-PH (HDR), Centre de recherche des Cordeliers / Bichat, PARIS Rapporteur
Pr. Pierre GOURDY PU-PH (HDR), CHU / IC2M, Toulouse Rapporteur
Pr. Vincent RIGALLEAU PU-PH (HDR), CHU Haut Leveque, Universit Bordeaux Examinateur
Pr. Jean-Marc GOMBERT PU-PH (HDR), INSERM U 1082, Universit Poitiers Examinateur
Pr. Samy HADJADJ PU-PH (HDR), INSERM U 1082, Universit Poitiers Directeur de thse
Dr. Andr HERBELIN Docteur Inserm, INSERM U 1082, Universit Poitiers Co-Directeur de thse
Remerciements

Remerciements

Je tiens tout dabord adresser mes plus sincres remerciements aux rapporteurs de ce travail :

Monsieur le Professeur Ronan ROUSSEL


PU-PH Centre de recherche des Cordeliers INSERM-UMR1138
Service dEndocrinologie Diabtologie Nutrition Hpital Bichat PARIS
&
Monsieur le Professeur Pierre GOURDY
PU-PH en Endocrinologie, Diabte et Maladies Mtaboliques IC2M
Facult de Mdecine Universit Toulouse 3

MERCI vous deux de mavoir accord de votre temps prcieux pour valuer ce travail et pour vous
rendre Poitiers afin dassister ma soutenance de thse. MERCI par avance pour les commentaires
aviss que vous ne manquerez pas dapporter ce travail, et qui, jen suis sr, contribueront
grandement son amlioration.

Je tiens remercier tout particulirement,

Monsieur le Professeur Vincent RIGALLEAU


PU-PH Endocrinologie-Nutrition, USN, hpital Haut-Lvque
Universit Bordeaux
&
Monsieur le Professeur Jean-Marc GOMBERT
PU-PH Service dimmunologie & U1082 - UFR mdecine - Pole Biologie Sant
Universit de Poitiers

Vous me faites le trs grand honneur de faire partie du jury de cette thse et de juger mon travail.
Veuillez recevoir lexpression de ma sincre gratitude et de mon profond respect.
Remerciements

Ce travail a t effectu au sein de laboratoire Inserm U1082 : Ischmie Reperfusion en


Transplantation dOrganes Mcanismes et innovations thrapeutiques, sous la direction du
professeur Samy HADJADJ, et docteur Nicolas CHATAURET dans un premier temps puis du docteur
Andr HERBELIN.

Monsieur le Professeur Thierry HAUET


Professeur des universits, Praticien Hospitalier
Directeur du laboratoire U1082

Je tiens vous tmoigner ma trs vive reconnaissance pour la confiance que vous mavez accorde
en maccueillant au sein de votre laboratoire. Je vous prie de croire en ma gratitude pour vos conseils
scientifiques clairs, votre disponibilit et lamour de la science que vous savez communiquer.

Monsieur le Professeur Samy HADJADJ


Professeur des universits, Praticien Hospitalier

Pour son encadrement tout au long de ces 3 annes et pour son soutien sans faille. Je tiens tout
particulirement texprimer ma profonde gratitude et mon admiration. Ta gentillesse, ta patience,
ta rigueur, et ton humanit sont autant de qualits rares dans le monde qui nous entoure. Grce toi
jai beaucoup appris tant sur les plans professionnels que personnel. MERCI Samy, Tu resteras un
exemple pour moi. Je garderai longtemps en mmoire nos longues discussions scientifiques qui
mont permis de mener bien ce projet. Cela a t pour moi un immense honneur de travailler avec
toi je te souhaite le meilleur et plus encore pour la suite.

Monsieur le Docteur Andr HERBELIN


Directeur Inserm
Service dimmunologie & U1082 - UFR mdecine - Pole Biologie Sant

Pour son encadrement tout au long de 2 annes de cette thse et pour ses conseils scientifiques
clairs chaque tape de la ralisation de ce travail. MERCI Andr, pour ta gentillesse, ta
disponibilit et tes innombrables relectures. Merci surtout davoir russi communiquer un peu de
ta rigueur scientifique et de tes capacits dorganisation, au thsard dsorganis et tourdi que
jtais, reois ici lexpression de ma sincre gratitude et de mon plus profond respect.

Monsieur le Docteur Nicolas CHATAURET


PhD

Pour son encadrement de la premire anne de cette thse et pour ces multiples comptences, son
bon humour, ses conseils techniques qui mont aid me familiariser avec la vie du laboratoire.
MERCI Nico, a t pour moi un norme plaisir et un immense honneur de travailler avec toi je te
souhaite le meilleur dans ta vie personnelle et professionnelle.
Remerciements

toute lquipe du laboratoire Inserm U1082, soyez tous remercis pour les annes enrichissantes
que jai pass vos cts.

mes collgues du bureau, Sbastien, Vivien, et Isabelle. Vous avez grav des moments inoubliables
dans ma mmoire. Merci pour votre disponibilit, la pertinence de vos conseils et surtout pour votre
humour toute preuve. Jai beaucoup aim tes blagues isabelle.

Pour mes voisins de lautre ct du mur, Frdric, pour tous les conseils et ta comptence
scientifique. Sofiane, tes un vritable frre. Je ne te remercie jamais assez pour tout ce que tu as fait
pour moi. Pour tes qualits. Souleymane, garde toujours ton beau sourire.

A Jacques pour sa bonne humeur et ce nest pas comme a. Merci pour ta disponibilit, ta
patience et tes conseils motivants, je garde notre amiti pour toujours. Patrick notre expert en bio-
informatique et modlisation, Merci pour ta gentillesse, et ta qualit humaine.

Je ne remercie jamais assez ma prfre, Sandrine. Merci pour ton aide prcieuse chaque tape
de mon travail, tes multiples comptences et surtout pour ta gentillesse. Sans oublier les
techniciennes Virginie, Mait et Ludovic, merci pour conseils techniques et pour les moments.
Christine, je remercie beaucoup ta patience et pour tout le travail que tu fais pour assurer le bon
droulement administratif de lunit.

Sans oublier lautre bout de couloir, Raphal, pour ces conseils, sa disponibilit et surtout pour tous
les bons moments quon a pass ensemble autour de la table de la cuisine. Sandra, pour sa rigueur
scientifique, son aide, et sa comptence. Merci Sandra. sylvain, jtais bluff par ta comptence,
merci pour ta gentillesse et tes conseils.

lquipe de RMN, Nadge de mavoir accompagn lurgence et tre l pour moi, Merci Nadge,
pour ta gentillesse. Delphine et Marianne, norme merci pour tous les moments quon a partag.

Lquipe du service de lanatomopathologie du CHU, au Professeur Jean-Michel Goujon, Julie et


Nathalie pour leur patience, leur disponibilit pour inclure, colorer et mavoir lu toutes ces lames
histologiques. Sihem, la spcialiste en western blot, je ne te remercie jamais assez pour le soutien,
laide technique et ta norme sympathie, je te souhaite le meilleur dans ta vie professionnelle et
personnelle ( Adam et Wassim).

Lquipe du PBS, Maroua merci pour ta sympathie et pour tous ces moments quon a pass
ensemble dans la salle de la chirurgie en oprant les souris, pour ta disponibilit et pour tes gteaux,
jattends toujours la baklawa. Aurlie merci beaucoup pour tes encouragements, pour ta
comptence technique et pour le temps quon a pass ensemble, A Sara pour sa disponibilit, Alice,
et Myriam.
Remerciements

Naturellement mes penses vont :

A mes parents, pour votre amour et votre soutien depuis toujours. Cest sans doute grce
vous que je fais ce travail. Que Dieu vous garde et vous protge

A mon frre Abdellah et sa petite famille, le futur pilote et larchitecte.


vis comme si tu pouvais mourir demain, travaille comme si tu pouvais vivre jamais

A mon frre Ibrahim, lavocat.

A mon frre Zakarya, lingnieur en aquaculture.

A mes grands-parents, jaurais aim que vous soyez l.

A mes amis de longue date, Ahmed N, Nassim D.Y, Ibrahim H. Djamel H.

A tous mes amis (es) qui mont soutenue dans cette thse
Table des matires

Table des matires


Rsum ........................................................................................................................................ 1
Abstract ....................................................................................................................................... 2
Liste des abrviations ................................................................................................................... 3
Liste des figures & tableaux .......................................................................................................... 5
INTRODUCTION .......................................................................................................................... 10
PREMIRE PARTIE : CONTEXTE CLINIQUE .......................................................................... 10
1. Etat des lieux : ........................................................................................................................... 11
1.1. Insuffisance rnale terminale : .......................................................................................... 11
1.2. Nphropathie diabtique : ................................................................................................ 11
1.3. Transplantation rnale : un traitement de choix .............................................................. 12
2. Choix des donneurs potentiels : ................................................................................................ 13
2.1. Donneur marginal :............................................................................................................ 14
2.2. Donneur diabtique : ........................................................................................................ 15
2.3. Receveur diabtique : ....................................................................................................... 16
DEUXIME PARTIE : DONNEES EXPERIMENTALES ET PHYSIOPATHOLOGIQUES ................... 17
CHAPITRE (1) : Physiopathologie de lischmie reperfusion rnale et rponse immunitaire ... 18
I. Syndrome dischmie reperfusion : ...................................................................................... 19
1. Dfinitions gnrales :............................................................................................................... 19
1.1. Lischmie : ........................................................................................................................ 20
1.2. La reperfusion :.................................................................................................................. 21
2. Consquence de lischmie reperfusion : ................................................................................. 21
2.1. Le no-reflow post-ischmique : ......................................................................................... 23
2.2. La production des espces ractives de loxygne (EROs) : .............................................. 25
3. Comportement de la cellule face lhypoxie : .......................................................................... 27
3.1. Ladaptation cellulaire la variation de lO2 : Facteur inductible par lhypoxie (HIFs) .... 28
3.2. Les systmes de dfense oxydants : ................................................................................. 34
3.3. Les mcanismes de la rparation : .................................................................................... 36
4. Lsions cyto-histopathologiques induites par lI/R rnale : ...................................................... 38
4.1. La mort cellulaire : ............................................................................................................. 38
4.2. La ncrose tubulaire aigu : .............................................................................................. 43
4.3. La fibrose rnale : .............................................................................................................. 45
Table des matires

II. Phnomnes immunitaires et inflammatoires lis lI/R: ..................................................... 48


1. Lsions dIR : systme immunitaire inn et adaptatif ............................................................... 48
1.1. La phase inflammatoire prcoce dans les lsions rnales dI/R :...................................... 49
1.2. La phase inflammatoire tardive dans les lsions rnales dI/R : ....................................... 63
1.3. La rparation des lsions tubulaires : ............................................................................... 66
2. Actions proinflammatoires et antiinflammatoires de HIFs : ..................................................... 69
2.1. HIFs et limmunit inne : ................................................................................................. 70
2.2. HIFs et limmunit adaptative : ......................................................................................... 72
3. Signaux de danger les alarmines dans un contexte ischmique : ....................................... 75
3.1. Signaux de danger endognes : ........................................................................................ 75
3.2. Interleukine-33 (gnralit): ............................................................................................. 76
3.3. Contribution dIL-33 dans les lsions rnales :.................................................................. 87
3.4. Relation entre lexpression de lIL-33 et HIFs : .................................................................. 91
CHAPITRE (2) : Phnomnes hypoxiques et immunitaires dans un contexte hyperglycmique
.................................................................................................................................................. 93
I. Hyperglycmie, la glycation et complications diabtiques :................................................... 94
1. Hyperglycmie et le stress oxydant : ........................................................................................ 95
1.1. Hyperglycmie aigu ou transitoire : ................................................................................ 96
1.2. Hyperglycmie chronique : ............................................................................................... 97
2. Produits de dgradation du glucose intracellulaire : .............................................................. 102
2.1. Glycation et formation des AGEs : .................................................................................. 102
2.2. Consquences molculaires et cellulaires de la glycation : ............................................ 106
2.3. Dfense cellulaire contre la glycation et les AGEs : ........................................................ 112
II. Hyperglycmie et les lsions dI/R rnales :........................................................................ 114
1. Phnomnes hypoxiques lis lhyperglycmie : ................................................................... 114
1.1. Pseudohypoxie hyperglycmique: .................................................................................. 114
1.2. Consommation de lO et complications vasculaires : .................................................... 115
1.3. Transport du glucose : ..................................................................................................... 117
1.4. Hyperglycmie et rgulation de HIF-1 : ........................................................................ 119
2. Susceptibilit des lsions dI/R lhyperglycmie .................................................................. 126
III. Hyperglycmie et la rponse immunitaire: ..................................................................... 130
1. Pathognie du diabte sucr : ................................................................................................ 130
1.1. Diabte type 1 : ............................................................................................................... 130
1.2. Diabte type 2 : ............................................................................................................... 130
1.3. Nphropathie diabtique (ND) :...................................................................................... 131
2. Influence de lhyperglycmie sur la rponse de limmunit inne : ....................................... 131
2. Influence de lhyperglycmie sur la rponse de limmunit adaptative : ............................... 135
Table des matires

2.1. Lymphocyte Th1: ............................................................................................................. 136


2.2. Lymphocyte Th2 : ............................................................................................................ 137
2.3. Lymphocyte Th17 : .......................................................................................................... 137
2.4. Lymphocyte T rgulatrice (T-reg) : .................................................................................. 138
2.5. Lymphocyte T cytotoxique (CD8): .................................................................................. 138
2.6. Lymphocyte B : ................................................................................................................ 139
3. Relation IL-33 et hyperglycmie :............................................................................................ 139
Objectifs................................................................................................................................... 141
Matriels & mthodes .............................................................................................................. 142
1. Le choix de lanesthsie : ........................................................................................................ 143
2. Le choix de labord chirurgical (dorsal vs ventral):................................................................. 146
3. Le choix de type dischmie (unilatral vs bilatral) : ............................................................. 152
4. La dure de lischmie chaude : .............................................................................................. 154
Article soumis........................................................................................................................... 156
Discussion gnrale .................................................................................................................. 182
Conclusions & Perspectives ....................................................................................................... 188
Rfrences bibliographiques ..................................................................................................... 190
Rsum

Rsum
1
La transplantation rnale (TR) est la stratgie thrapeutique de choix pour les
insuffisances rnales terminales. Lutilisation de greffons de donneurs critres
tendus, tels les sujets diabtiques, est devenue une ncessit face la pnurie de
greffons, malgr le risque accru de dysfonction du greffon. Lischmie/reperfusion
(I/R) est une tape inhrente la TR. Le diabte est un facteur de risque pour le
dveloppement de lsions rnales aigus mais les mcanismes daction mis en jeu
restent lucider. Il existe peu de donnes exprimentales sur les consquences
dltres du diabte sur les lsions dI/R rnales. Nous avons fait lhypothse que
lIL-33, en tant qualarmine, joue un rle cl au carrefour qui lie lhyperglycmie
lI/R.

Lobjectif de ce travail a t dtudier leffet de la dltion du rcepteur ST2 de


lIL-33 sur les lsions dI/R rnales dans un contexte hyperglycmique. Nous avons
utilis un modle dI/R rnale chez des souris transgniques dpourvues du
rcepteur ST2. Le diabte type 1 a t induit par la streptozotocine. Nous avons
dmontr que la dltion du rcepteur ST2 a un effet nphroprotecteur en situation
euglycmique, suggrant un effet exacerbateur de lIL-33 sur les lsions dI/R
rnales. Cette protection rnale a t perdue en condition hyperglycmique.
Lensemble de ces rsultats suggre que lIL-33, en tant qualarmine, a des effets
diffrentiels en fonction de lenvironnement hyperglycmique. Sur le plan clinique,
compte tenu de limpact nfaste du diabte sur le rein, nos rsultats conduisent
proposer dtudier la place de lIL-33 dans linflammation chronique associe au
diabte et de ses consquences sur la fonction rnale.

Mots cls : transplantation rnale, hyperglycmie, euglycmie, ischmie/reperfusion rnale,


axe IL-33/ST2, streptozotocine, alarmine, greffon.
Abstract

Abstract

2
Renal transplantation (RT) is the therapeutic strategy of choice for end-stage
renal failure. The use of graft from extended criteria donors, including patients with
diabetes, has become mandatory to cope with the shortage of grafts, despite an
increased risk of graft dysfunction. Ischemia reperfusion (I/R) is a key step in RT.
Diabetes is a risk-factor for the development of acute kidney injury (AKI), which
mecanisms are not fully elucidated. Moreover, there are few experimental data on
the deleterious effects of diabetes on ischemic AKI. We hypothesized that IL-33, as
an alarmin, plays a key role at the crossroads linking hyperglycemia to I/R injury.

The objective of this work was to study the effect of the deletion of the ST2
receptor of IL-33 on I/R injury in the context of hyperglycemic environment. We thus
used a renal I/R model in transgenic mice lacking the IL-33 receptor (ST2). Type 1
diabetes was induced by streptozotocin. We demonstrated that the deletion of ST2
has a renal protective effect in euglycemic conditions, suggesting an exacerbating
effect of IL-33 in renal I/R injury. The protective effect induced by the absence of ST2
was lost in hyperglycemic conditions. Taken together, these findings indicate that IL-
33 exerts differential effects depending on hyperglycemia. Clinically, given the
deleterious impact of diabetes on the kidney, our results lead to propose to further
study the place of IL-33 in chronic inflammation associated with diabetes and its
effects on renal function.

Key words: renal transplantation, hyperglycemic, euglycemic, renal ischemia/reperfusion, IL-33/ST2


axis, streptozotocin, alarmin, graft.
Abrviations

Liste des abrviations


Adora2a: Adnisine A2A GO: glyoxal
3

ADP: adnosine diphosphate GPx: glutathion peroxydases

AGEs: advanced glycation end product GST: glutathion s- transfrase

AKI: acute kidney injury HIF-1: hypoxia inducible factor 1 alpha

ATP: adenosine triphosphate HMGB1: high-mobility group B1

CAT: Catalase HRE: Hypoxia responsive element

CBP: CREB-binding protein I/R: Ischmie reperfusion

CHIP: Carboxyl terminus of Heat-shock protein ICAM: intercellular adhesion molecule


70Interacting Protein
IFN- : interfron gamma
Chre: Carbohydrate response element
IL-33 : interleukine 33
ChREBP: Carbohydrate response element
iNKT : invariant NKT
binding protein
IRT : insuffusance rnale terminale
CKD: Chronic kidney disease
LRCs: Label-retaining cells
CPA: Cellule prsentatrice de lantigne
M1: macrophage type 1
Crry : Complement receptor 1related protein y
M2: macrophage type 2
CTGF: connective tissue growth factor
MGO: methylglyoxal
DAMP: Danger Associated Molecular Pattern
MIP-2: macrophage inflammatory facteur 2
DC: Dendritic cells
mPTP : mitochondrial permeability transition
DFG: dbit de filtration glomrulaire
pore).
DT1: diabtes type 1
NAPDH: nicotinamide adnine dinuclotide
DT2: diabtes type 2 phosphate

EndoG: endonuclase-G ND : nphropathie diabtique

EPO: Erythropotine NF-kb: nuclear factor kappa B

EROs: Espces ractives de loxygne NKT: natural killer T

FIH: Factor inhibiting HIF NO: Oxyde nitrique


Abrviations

NTA: ncrose tubulaire aigu SOD: superoxyde distamase

O-GlcNAc: O-N-actylglucosaminylation ST2: suppression of tumorigenicity 2

OH : hme oxygnase STZ : Streptozotocine

OUU : obstruction urtrale unilatrale TCR : T cell receptor


4
PAMP: Pathogen Associated Molecular Pattern TGF-b: transforming growth factor-b

PECAM-1 (platelet endothelial cell adhesion Th1-2-17: lymphocytes T helper de Type 1-2-17
molecule 1)
TLRs: Toll-like receptors
PHDs: Prolyl hydroxylase domain-containing
TNF-: Tumor necrosis factor alpha
enzymes
TR : transplantation rnale
PKC: protine kinase C
T-reg : T rgulatrices
PLC: phospholipase C
VCAM: vascular cell adhesion molecule
RAGE: Receptor of advanced glycation end
products VEGF: vascular endothelial growth factor

S1P3: sphingosine 1 -phosphate3) VHL: von Hippel Lindau E

SGTLs: sodium glucose cotransporters


Liste des figures & tableaux

Liste des figures & tableaux


5
Liste des figures :

Figure 1. Schma des principaux mcanismes molculaires des lsions rnales aigues induites par
une squence dischmie reperfusion. ................................................................................................. 20

Figure 2. Schma plus dtaill des grands vnements pathologiques hmostatiques (No-reflow) et
inflammatoires induites par lischmie reperfusion et qui contribuent la mort cellulaire. ............... 22

Figure 3. Localisation histologique des pricytes et capacit de rgulation du dbit en aval des
artrioles : exemple sur le contrle de la circulation sanguine dans le systme vasculaire crbral. . 24

Figure 4. Gnration des EROs par la chaine respiratoire mitochondriale au niveau des complexes I et
III en tant que principaux gnrateurs des radicaux libres. .................................................................. 27

Figure 5. Schma de la structure protique des domaines qui composent HIF- (HIF-1, HIF-2, HIF-
3, IPAS) et HIF-1. ............................................................................................................................... 29

Figure 6. Rgulation des HIF- en normoxie par lhydroxylation des PHDs et FIH. .............................. 30

Figure 7. Schma dtaill sur la rgulation de HIF-1 dans les conditions normoxiques et hypoxiques.
............................................................................................................................................................... 31

Figure 8. Reprsentation schmatique du mcanisme dadaptation cellulaire face lhypoxie via la


stabilisation cytoplasmique de HIF-1, sa translocation nuclaire, et lactivit transcriptionnelle de
ses gnes effecteurs. ............................................................................................................................. 32

Figure 9. Schma des principaux gnes rguls directement par HIFs classs en groupes selon leurs
fonctions biologiques au niveau rnal. ................................................................................................. 33

Figure 10. Schma des principaux mcanismes de la mort cellulaire induite par lischmie reperfusion
: ncrose, ncroptose, apoptose et autophagie. .................................................................................. 38

Figure 11. Schma de la voie autophagique. ........................................................................................ 42

Figure 12. Mcanismes physiopathologiques de ncrose tubulaire aigu induite par ischmie rnale.
............................................................................................................................................................... 44
Liste des figures & tableaux

Figure 13. Angiotensine (Ang) II stimule l'expression endothliale du gne HIF-1 et favorise les
lsions rnales, lhypertension intra-rnale et la progression de la fibrose. ........................................ 47

Figure 14. Reprsentation schmatique du rle inflammatoire des leucocytes et des rnales dans les
lsions rnales aigus............................................................................................................................ 50
6
Figure 15. Adhrence et transmigration des leucocytes endothliales aprs lischmie reperfusion. 51

Figure 16. Trafic des monocytes dans les lsions dischmie reperfusion rnale chez la souris.......... 52

Figure 17. Comparaison entre un rein normal et un rein post-ischmique travers la prsence des
cellules inflammatoires dans le tissu. ................................................................................................... 54

Figure 18. Schma de linteraction entre les cellules dendritiques, les leucocytes
polymorphonuclaires (PMN) particulirement les neutrophiles, et les cellules NKT. ........................ 56

Figure 19. Schma du changement phnotypique des macrophages pendant la progression des
maladies rnales aigus. ....................................................................................................................... 58

Figure 20. Schma qui prsente la cellule iNKT (invariant natural killer T) et ses proprits typiques
des cellules du systme immunitaire inn. ........................................................................................... 61

Figure 21. Schma de la rponse inflammatoire mdie par les cellules iNKT aprs lI/R. .................. 62

Figure 22. Schma du rle des macrophages (M1 et M2) dans la rgulation de lquilibre des lsions
rnales, inflammation, la rparation tissulaire et la fibrose. ................................................................ 65

Figure 23. Diffrents types cellulaires impliques dans la rgnration tubulaire aprs la lsion
tissulaire. ............................................................................................................................................... 67

Figure 24. Laction proinflammatoire et antiinflammatoire de HIFs. ................................................... 70

Figure 25. Voie hypoxique et limmunit inne. ................................................................................... 71

Figure 26. Voie hypoxique et limmunit adaptative (Diffrenciation et fonction des cellules T). ...... 73

Figure 27. Diffrents stimuli sont lorigine des lsions cellules, telles que les cellules pithliales. . 76

Figure 28. Reprsentation schmatique de la protine IL-33............................................................... 78

Figure 29. Liaison de lIL-33 son rcepteur T1/ST2. ........................................................................... 81

Figure 30. Reprsentation des complexes de rcepteurs lIL-33. ...................................................... 82

Figure 31. Libration de lIL-33 et la signalisation via ST2L................................................................... 84


Liste des figures & tableaux

Figure 32. Structure des protines IL-33 humaine et murine. .............................................................. 86

Figure 33. Schma de la squence temporelle des vnements de lsion rnale aigu induite par
cisplatine. .............................................................................................................................................. 88

Figure 34. Caractristiques gnrales des lsions tissulaires induites par l'hyperglycmie................. 95 7

Figure 35. Linsulino-rsistance provoque une surproduction mitochondriale dEROs dans les cellules
endothliales macrovasculaires en augmentant le flux des acides gras libres (FFA) et loxydation. ... 98

Figure 36. Diffrentes voies du mtabolisme du glucose qui conduisent lactivation de la protine
kinase C (PKC) et du facteur de croissance (TGF-) .............................................................................. 99

Figure 37. Squence dvnements induite par les AGEs et le glucose. ............................................ 101

Figure 38. Voies biochimiques pour la formation AGEs...................................................................... 103

Figure 39. Raction de Maillard et la formation chimique des diffrents AGEs................................. 105

Figure 40. Mcanisme de signalisation intracellulaire de rcepteur RAGE activ par AGEs. ............. 109

Figure 41. Schma comparatif dun rein normal et diabtique. ......................................................... 116

Figure 42. Schma la rabsorption du sodium-glucose dans les cellules de lpithlium tubulaire
proximal. ............................................................................................................................................. 118

Figure 43. Reprsentation schmatique des modles proposs pour la rgulation ngative de HIF-1
dans des conditions diabtiques. ........................................................................................................ 123

Figure 44. Voie de signalisation implique dans la lipogense et la fibrose induite ChREBP dans les
cellules msangiales en glucose lev. ............................................................................................... 125

Figure 45. Cascade mtabolique liant ADAM17 et les gnes de fibrose au niveau glomrulaire, en
situation dhyperglycmie. .................................................................................................................. 125

Figure 46. Mcanisme d'amlioration de l'ischmie reperfusion rnale via la surexpression de la


glyoxalase I (Glo-I). .............................................................................................................................. 129

Figure 47. Squence des vnements dmontrant les lsions inflammatoires dans le rein lors de la
progression de la nphropathie diabtique........................................................................................ 133

Figure 48. Signalisation de TLR-2 et TLR-4 dans le rein diabtique. ................................................... 134

Figure 49. Plan exprimental gnral des diffrentes approches chirurgicales en I/R rnale. .......... 146
Liste des figures & tableaux

Figure 50. Lieux d'incision dorso-lombaire chez la souris. .................................................................. 148

Figure 51. Exposition des deux reins pour une ischmie bilatrale par voie dorso-lombaire chez la
souris. .................................................................................................................................................. 149

Figure 52. Exposition de rein droit par voie vontro-mdiane chez la souris. ..................................... 150
8
Figure 53. Etude comparative des abords (dorsal vs ventral) chez la souris C57BL/6 sauvage. ........ 151

Figure 54. Clampage bilatral via un abord dorsal. ............................................................................ 153

Figure 55. Clampage du pdicule rnal............................................................................................... 153

Figure 56. Etude comparative de type dischmie chaude (unilatrale vs Bilatrale) chez la souris
C57BL/6 sauvage. ................................................................................................................................ 153

Figure 57. Choix de la dure de lischmie chaude............................................................................. 155

Liste des tableaux :

Tableau 1. Classification internationale de Maastricht. .................................................................................... 13

Tableau 2. Espces (radicalaires et non-radicalaires) ractives de loxygne et de lazote dans les


organismes vivants........................................................................................................................................... 25

Tableau 3. Expression de l'IL-33 (transcrit et protine) dans les diffrentes cellulaires et tissus chez l'homme
et souris............................................................................................................................................................ 79
PARTIE (1) Contexte clinique

INTRODUCTION 10

PREMIRE PARTIE : CONTEXTE CLINIQUE

Cest sans doute parce que la mdecine a progress trs trs lentement pendant des
millnaires quon a bien d appeler les malades des patients

Philippe Geluck. Acteur


PARTIE (1) Contexte clinique

1. Etat des lieux :

1.1. Insuffisance rnale terminale :

Linsuffisance rnale terminale (IRT) est dfinie comme la consquence de 11


lvolution des maladies qui altrent la fonction rnale en dtruisant la structure
tissulaire des reins. Le rein ne peut alors plus assurer ses fonctions physiologiques
dpuration du sang systmique. Le dveloppement de cette maladie volue
progressivement (en gnral sur plusieurs annes) de linsuffisance rnale aigu
lapparition de lsions irrversibles et chroniques dans les reins. Linsuffisance rnale
chronique est dfinie par un dbit de filtration glomrulaire (DFG) infrieur
15mL/min/1.73m. Le recours un traitement de supplance est envisag par une
dialyse ou, si possible une transplantation rnale si la clairance de cratinine est
comprise entre 15 et 10 mL/min/1.73m. En France, 15470 patients taient inscrits
sur la liste nationale dattente dun greffe de rein en 2014 selon lagence de
biomdecine, soit une progression de 7 % par un an. Cependant, 4733 patients
taient en contre-indication temporaire en dbut de lanne 2015 2.

1.2. Nphropathie diabtique :

La nphropathie diabtique (ND) est la cause la plus frquente dIRT. Le


diabte, principalement de type 2 (DT2), est prsent chez 25-50 % des nouveaux
patients avec une IRT. Cependant, la qualit de la prise en charge du diabte et de
ses complications va directement influencer lapparition et lvolution dune
nphropathie diabtique. La premire tape de la nphropathie consiste en une
hyperfiltration glomrulaire laquelle sajoute une microalbuminurie. Au bout de cinq
ans dvolution en moyenne, cette microalbuminurie devient persistante et saggrave
en se transformant en protinurie. Avec le temps, cette protinurie devient svre et
est associe une insuffisance rnale chronique, qui volue vers lIRT. Dans la
plupart des cas, une insuffisance rnale chronique chez un patient diabtique est lie
une ND et ne ncessite pas de biopsie rnale pour confirmer le diagnostic. Les
atteintes histologiques principales retrouves sont une augmentation de la matrice
msangiale, un paississement de la membrane basale, une glomrulosclrose et
une fibrose tubulo-interstitielle 3.
PARTIE (1) Contexte clinique

1.3. Transplantation rnale : un traitement de choix

La transplantation rnale (TR), ou greffe de rein, est une intervention chirurgicale


prouve permettant de remplacer un rein non fonctionnel suite une maladie
12
chronique par un rein sain. Elle apporte au patient non seulement une meilleure
qualit de vie, mais aussi une prolongation de survie. Elle correspond lutilisation
dlments du corps humain titre exceptionnel dans lintrt thrapeutique
dautrui (article 16-3 du code civil).

La TR reste le choix thrapeutique de la maladie rnale chronique au stade V


(IRT). En France, parmi les 10799 patients arrivs au stade terminal de linsuffisance
rnale dans les 26 rgions franaises en 2014, il y a eu 3232 greffes rnales, dont
514 partir de donneurs vivants qui reprsentent ainsi 16 % du total des greffes
rnales 2. De plus, 4 % (428) ont bnfici dune greffe premptive rnale ralise
dans 39 % des cas partir dun donneur vivant 2. Les principales difficults
demeurent la pnurie dorganes au regard du nombre de patients en attente dune
TR, le nombre de pertes tardives de greffon et enfin, les complications infectieuses,
cardiovasculaires et tumorales. En 2014, lagence de biomdecine a enregistr 1058
arrts fonctionnels du greffon, ce qui reprsente 9 % des patients qui sont arrivs en
dialyse cette anne-l. Cependant, la survie mdiane des greffons est actuellement
de 14 ans 2.
Le nombre de greffes augmente de faon sensible chaque anne, mais le nombre
de patients inscrits durant une anne donne excdant le nombre de greffes, la
pnurie dorganes continue saggraver. La dure dattente sur la liste aprs laquelle
50 % de patients ont t greffs est de 27,6 mois pour les malades inscrits entre
2009 et 2014. La pnurie dorganes est la cause directe qui explique cette dure
4
relativement longue. Le Plan greffe 2012-2016 a dfini comme axe stratgique le
dveloppement de toutes les possibilits de prlvement, autant de sources de
greffons considrs comme complmentaires : donneurs dcds en tat de mort
encphalique, donneurs dcds aprs arrt cardiaque, donneurs dits critres
largis et donneurs vivants.
PARTIE (1) Contexte clinique

2. Choix des donneurs potentiels :

En France, la grande majorit des prlvements dorganes sont raliss sur des
patients en tat de mort encphalique. En cas de maladie incurable, et rapidement
mortelle, il est galement possible dans certains pays (dont la France) darrter les 13
traitements qui maintiennent artificiellement un patient en vie et de prlever ses
organes une fois le dcs par arrt circulatoire constat. Les donneurs sont classs
en 4 catgories, en prenant appui sur une classification mise en place lors dune
confrence internationale Maastricht en 1995 5 (Tab. 1).

 Maastricht I : survenue dun arrt cardiaque en dehors de tout secours


qualifi. Le prlvement dorganes ne peut tre envisag que si les gestes de
ranimation ont t commencs moins de 30 minutes aprs la survenue de
larrt cardiaque.

 Maastricht II : survenue dun arrt cardiaque en prsence de secours


qualifis aptes raliser une ranimation cardiorespiratoire efficace, mais qui
ne permet pas la rcupration dune activit circulatoire spontane.

 Maastricht III : survenue dun arrt cardiaque aprs une dcision darrt des
traitements en ranimation.

 Maastricht IV : survenue dun arrt cardiaque aprs le diagnostic de mort


encphalique.

Tableau 1. Classification internationale de Maastricht.


Les catgories I, II et IV correspondent aux donneurs dcds aprs arrt cardiaque
inopin, la catgorie III aux donneurs dcds aprs arrt circulatoire suite la
limitation ou larrt des traitements.
PARTIE (1) Contexte clinique

Malgr laugmentation significative du nombre de prlvements destins la TR


ralise en France au cours des dernires annes, il existe aujourdhui, du fait de la
prvalence leve de la maladie rnale chronique, une situation proccupante de
pnurie de greffons 2. En outre, cette situation ncessite un accroissement des 14
sources potentielles de greffons et ce titre le dveloppement dune recherche
exprimentale et clinique active qui permettre dvaluer et optimiser les diffrentes
stratgies qui visent laccroissement du pool de greffons. Parmi ces stratgies figure
lutilisation de greffons critre largi , en particulier provenant de donneurs dits
marginaux.

2.1. Donneur marginal :

Le donneur marginal est considr comme un donneur risque pour le


receveur. Ces risques peuvent tre caractriss par une reprise fonctionnelle tardive,
un rejet de greffon et non-fonction primaire, une diminution de survie du greffon et
une surmortalit postopratoire.

En 2002, Nyborg et coll., a identifi 4 facteurs associs de faon significative et


indpendante une diminution de la survie des greffons 6 :

 lge du donneur suprieur 40 ans ou infrieur 10 ans


 une fonction rnale dfinie par une cratinine suprieure 150 mol/l
 une hypertension artrielle
 un dcs par accident vasculaire crbral.

Les donneurs aux critres largis incluent tous les donneurs de 60 ans et plus et
ceux de 50 59 ans avec au moins deux facteurs de risque associs parmi les trois
suivants : un dcs de cause crbro-vasculaire, un antcdent dhypertension
artrielle et une cratinine suprieure 130 mol/l lors du prlvement 6.

Comparativement aux patients greffs avec un donneur optimal, ceux greffs


partir de reins marginaux ont une surmortalit postopratoire. Ils ont un gain
PARTIE (1) Contexte clinique

desprance de vie de 5 ans alors quil est de 14 ans avec un donneur optimal. Il a
aussi t montr que le risque de mortalit avec greffe partir dun greffon marginal
est diminu de 60 % par rapport au patient restant en liste dattente (en dialyse).
Cependant, la plupart des scores utiliss pour dfinir les donneurs marginaux
ngligent compltement les critres histologiques de lorgane du donneur tels quils 15
sont susceptibles dtre valus avant la transplantation. En 2006, Remuzzi et coll.,
ont propos un score histologique simple 7 qui repose sur lanalyse des
compartiments glomrulaire, tubulo-interstitiel et vasculaire pour prdire la survie du
greffon. Cette tude montre une meilleure survie 36 mois des patients dont le
greffon a t slectionn laide de biopsie 7.

2.2. Donneur diabtique :

La TR amliore durablement la qualit de vie des patients en IRT.


Malheureusement le nombre de greffons disponibles est insuffisant pour traiter tous
les patients inscrits en liste dattente de lagence de biomdecine. Le recours des
reins issus des donneurs diabtiques sera probablement une solution non exclue.
Il est bien admis que les changements mtaboliques lis au diabte
(lhyperglycmie) entranent, la fois, des complications macrovasculaires en
acclrant lathrosclrose, dont la coronaropathie, et des complications
microvasculaires lorigine de la rtinopathie, la nphropathie, et la neuropathie.
Les altrations fonctionnelles et les lsions tissulaires provoques par
lhyperglycmie seront aggraves par les phnomnes dischmie reperfusion lors
de la TR. Cette susceptibilit accrue du rein diabtique la squence ischmique a
t rapporte dans des modles exprimentaux de diabte et chez les humains
atteints de diabte 8-11. La qualit du greffon issu dun donneur diabtique affecte la
dure de vie du greffon, et augmente ainsi les chances de rejet, la non reprise
fonctionnelle ou encore la non reprise fonctionnelle tardive.
PARTIE (1) Contexte clinique

2.3. Receveur diabtique :

Pour les patients atteints de diabte et de maladie rnale chronique progressive,


la TR est la thrapie optimale de remplacement rnal, avec ou sans greffe de
16
pancras. Les autres avantages de la greffe de pancras sont devenus de plus en
plus vidents en raison des progrs dans les rsultats chirurgicaux et les traitements
immunosuppresseurs, et peuvent tre raisonnablement considrs comme
bnfiques non seulement chez les patients DT1 mais aussi chez les patients
souffrant de DT2.

Il a t dmontr que le contrle glycmique serr, obtenu grce la thrapie


intensive linsuline, ralentit la progression et rduit le risque de dvelopper les
12
complications micro et macrovasculaires observes au niveau du greffon rnal .
Malgr lutilisation des pompes insuline et linsulinothrapie intensive,
ladministration exogne de linsuline nest pas en mesure de maintenir la
normoglycmie aussi efficacement quun pancras fonctionnel. En tant que telle, la
transplantation allognique de pancras a t dveloppe pour atteindre la
normoglycmie et lindpendance de linsulinothrapie. La combinaison de
transplantations du pancras et du rein peut librer un receveur diabtique de
linsuline et de la dialyse avec une prvention dautres complications du diabte.

En gnral, la transplantation du pancras est associe des avantages de


survie long terme en dpit dune augmentation de la morbidit court terme et le
risque de mortalit. Cela est vrai avec une transplantation simultane du pancras et
du rein ou du pancras aprs transplantation rnale par rapport la transplantation
rnale seule, indpendamment du statut vivant ou dcd du donneur de rein.
Dautres facteurs comme la disponibilit des donneurs vivants, les comorbidits, et le
temps dattente doivent tre considrs lors du choix dune modalit de
transplantation, plutt que dun avantage vident dans la survie dune stratgie par
rapport dautres. Actuellement, plusieurs tudes ont t mises en place afin de
mieux comprendre les avantages et les inconvnients de chacune de ces stratgies
de transplantation isole ou combine de rein et de pancras chez les patients DT1
13
et DT2 14.
PARTIE (2) Physiopathologie de lischmie reperfusion et rponse immunitaire

17

DEUXIME PARTIE : DONNEES EXPERIMENTALES ET

PHYSIOPATHOLOGIQUES

Ce qui caractrise la sant, cest la possibilit de dpasser la norme qui dfinit le normal
momentan, la possibilit de tolrer les infractions la norme habituelle et dinstituer des
normes nouvelles dans les situations nouvelles .

Georges Canguilhem (Le normal et le pathologique, 1943)


PARTIE (2) Physiopathologie de lischmie reperfusion et rponse immunitaire

18

CHAPITRE (1) : Physiopathologie de lischmie

reperfusion rnale et rponse immunitaire


PARTIE (2) Physiopathologie de lischmie reperfusion et rponse immunitaire

I. Syndrome dischmie reperfusion :

1. Dfinitions gnrales :

Les lsions dischmie reperfusion (I/R) sont dfinies comme les dommages
cellulaires qui apparaissent aprs la reperfusion des tissus ischmiques 19
prcdemment viables. Sa pathognie est une interaction multifactorielle entre des
facteurs biochimiques, cellulaires, vasculaires, endothliaux et inflammatoires qui
constituent une tape caractristique commune 15.
Lhypoxie qui rsulte de lischmie, suivie ultrieurement par une reperfusion, est
associe une production accrue des espces ractives de loxygne (EROs) et un
dysfonctionnement du systme antioxydant. Ce stress cellulaire entraine, par la suite,
la mort des cellules tubulaires par ncrose ou apoptose. Des molcules, considres
comme de puissants activateurs de la rponse immunitaire inne (via la scrtion
des cytokines et chimiokines), telles que les ligands endognes DAMP (damage
associated molecular patterns) seront gnrs par les cellules stresses et
ncrotiques 16.
Linflammation lie la stimulation des rcepteurs des ligands DAMP, tel que les
rcepteurs TLRs (Toll-like receptor) et les rcepteurs RAGE induisent lactivation des
voies de signalisation intracellulaire. Ces dernires engendrent lactivation des
facteurs de transcription nuclaire tels que NF-kB ou AP-1 et la transcription des
gnes codant des molcules proinflammatoires telle que le TNF-, lIL-1, lIL-6,
lIL-12, les interfrons, des chimiokines (IP-10, IL-8, CCL-2) dont le rle principal est
dattirer des polynuclaires neutrophiles et activer des molcules dadhsions
(E-slectine) 16.
In fine, linflammation locale peut provoquer une ncrose tubulaire lorigine dune
insuffisance rnale aigu. Les dbris ncrotiques vont agir comme un signal de
danger et stimuler, de nouveau, la rponse inflammatoire dans un cercle vicieux
(Fig. 1). Ces phnomnes seront examins de faon plus dtaille dans les
prochaines sections.
PARTIE (2) Physiopathologie de lischmie reperfusion et rponse immunitaire

20

17
(rf. )
Figure 1. Schma des principaux mcanismes molculaires des lsions rnales
aigues induites par une squence dischmie reperfusion.

1.1. Lischmie :

Lischmie est dfinie comme la cessation de lapport sanguin au tissu ou


lorgane. Cette interruption des connexions vasculaires induit un arrt des apports en
nutriments et une chute de la pression partielle en O dans les territoires ischmis,
provoquant une altration du mtabolisme cellulaire. En consquence de cette
diminution des apports en O, la mitochondrie ne peut plus assurer la
phosphorylation oxydative ncessaire la production dadnosine triphosphate
(ATP) et la rgnration des cofacteurs ltat oxyd indispensables au
mtabolisme oxydatif. En rponse, la glycolyse est drive vers la voie anarobie qui
mne la rduction du pyruvate et la production de lactate permettant une
production rsiduelle dATP, qui ne couvre pas les besoins nergtiques de la
cellule.
Bien que le stress oxydant, qui est dfini par une surproduction despces
ractives de loxygne lors de la rintroduction de lO, il est maintenant tabli quil
puisse prendre son origine au moment de lischmie via laccumulation et
lchappement des lectrons vers lO rsiduel au niveau des complexes de la
chaine respiratoire mitochondriale. Des rponses adaptatives sont galement
engages lors de lischmie qui fait appel au facteur de transcription htrodimrique
HIF-1 (Hypoxia inducible factor-1) dont lactivation est sensible la pression partielle
tissulaire en O.
terme, la prolongation de lischmie est responsable de lsions et de
dstructurations cellulaires irrversibles.
PARTIE (2) Physiopathologie de lischmie reperfusion et rponse immunitaire

1.2. La reperfusion :

La reperfusion est dfinie comme la restauration de lapport sanguin au tissu


ou lorgane. Ce retour sanguin peut aggraver les effets dltres des cellules,
21
initis lors de la phase ischmique. Le dsquilibre de la balance stress oxydant et le
systme antioxydant cellulaire amne, par la suite, une production accrue des
EROs connues pour leurs proprits cytotoxiques.
De plus, la rintroduction rapide de lO permet la ractivation de la chane
respiratoire mitochondriale accompagne dune production insuffisante dATP. Ces
conditions favorisent leffondrement de la fonction mitochondriale en activant la voie
de signalisation pro-apoptotique.

2. Consquence de lischmie reperfusion :

Lune des consquences biologiques majeures de la variation des apports en O


est lendommagement cellulaire irrversible la fois structurel et fonctionnel. En
effet, au cours de lischmie, le mtabolisme anarobie prdomine, ce qui produit
une diminution de pH de la cellule. Pour tamponner cette accumulation dions
hydrogne, des transporteurs membranaires de Na/H excrtent ces ions
dhydrogne en excs lextrieur de la cellule, ce qui produit une accumulation de
18
flux des ions sodium en intracellulaire . Lischmie appauvrit galement la cellule
en ATP inactivant la pompe enzymatique ATPase (Na / K ATPase), ce qui rduit
activement lexportation de Ca lextrieur de la cellule. Dans ces conditions, le
rticulum endoplasmique (RE) se retrouve incapable de rabsorber le Ca
produisant ainsi une accumulation de Ca dans la cellule.
Ces modifications sont accompagnes par louverture des pores mPTP
(mitochondrial permeability transition pore), ce qui dissipe le potentiel de la
membrane mitochondriale et altre la production dATP. Il est admis que le degr de
lsion tissulaire varie selon ltendue et lampleur de la diminution de lirrigation
sanguine ainsi que la dure de la priode ischmique. Dautres vnements
biochimiques se produisent pendant lischmie qui ne contribue pas une lsion
ischmique en soi. Une fois la reperfusion est rtablie, lapport doxygne et des
PARTIE (2) Physiopathologie de lischmie reperfusion et rponse immunitaire

lments dans le sang dclenchent une cascade dvnements qui aggrave les
lsions des tissus.
En rsum, les mcanismes sous-jacents de la reperfusion sont complexes,
multifactoriels, et comportent : (1) la production des espces ractives de loxygne
(EROs) alimentes par la rintroduction de loxygne lorsque le flux sanguin est 22
rtabli, ces molcules cytotoxiques induites des lsions de lADN cellulaire et une
atteinte de la structure cellulaire (2) une accumulation cytoplasmique en calcium (3)
louverture des pores de permabilit mitochondriale (mPTP) (4) le
dysfonctionnement endothlial (5) lapparition dune cascade prothrombognique et
(6) lactivation de la rponse inflammatoire (Fig. 2).
Daprs ce quon a constat prcdemment, il est clair que ces consquences
cellulaires, prsentent une somme de dommages qui rsultent de lischmie et sont
aggravs par la phase de reperfusion qui exacerbe ltendue des lsions cellulaires
de manire irrversible.

19
(rf. )

Figure 2. Schma plus dtaill des grands vnements pathologiques hmostatiques (No-reflow) et
inflammatoires induites par lischmie reperfusion et qui contribuent la mort cellulaire.
PARTIE (2) Physiopathologie de lischmie reperfusion et rponse immunitaire

2.1. Le no-reflow post-ischmique :

Il est maintenant bien connu que la squence dI/R agit sur la densit capillaire
20
et accrot la permabilit vasculaire . Ces lments sont en faveur dune interaction 23
entre les cellules du parenchyme et les lments circulants, favorisant le
dveloppement dun phnomne no-reflow (Fig. 2). En effet, lorsque lirrigation
sanguine est rtablie dans le tissu, un grand nombre de capillaires nassure pas une
reperfusion totale de tissu. Cette perte de valeur nutritive de la perfusion se
produit aprs une priode post-ischmique dans diffrents organes tels que le
cerveau, les reins, le cur, lintestin grle et les muscles squelettiques 21.
Plusieurs hypothses ont t proposes pour expliquer ce phnomne. En
rponse lhypoxie ou lhypoxie-roxygnation, les cellules endothliales expriment
des molcules dadhsions favorisant lactivation des plaquettes et la fixation et des
cellules inflammatoires circulantes sur les cellules endothliales. Cette agrgation
plaquettaire est associe linduction de cascade de la coagulation, et finalement
une obstruction mcanique des vaisseaux sanguins de la rgion ischmique par des
micro-thrombi 22.
Dautres tudes suggrent que les neutrophiles activs jouent un rle important
dans le dveloppement du no-reflow post-ischmique. Une forte corrlation a t
mise en vidence entre le pourcentage des capillaires prsentant le no-reflow post-
ischmique et le nombre des leucocytes infiltrs dans ces capillaires des tissus
reperfuss. Aussi, limplication physique des neutrophiles dans les lumires des
capillaires a t galement propose comme un mcanisme de no-reflow pendant
lischmie. En effet, cette hypothse est base sur le fait que les neutrophiles sont
des cellules de taille importante (8 m de diamtre en moyenne), rigides, avec une
capacit importante de diapdse lentre et traverser les capillaires de plus petit
diamtre. En raison des pressions de reperfusion conduisant le flux form par des
lments du sang travers les capillaires, les neutrophiles sont les plus susceptibles
de sarrter dans les capillaires en bloquant la reperfusion dans ce territoire tissulaire
23
.
Un autre facteur important qui contribue la mise en place du no-reflow est la
rupture de la barrire de lendothlium microvasculaire. En consquence, la filtration
trans-microvasculaire des fluides et de protines sera augmente ce qui entranera
PARTIE (2) Physiopathologie de lischmie reperfusion et rponse immunitaire

un dme au sein du tissu. Cette accumulation de liquide dans les tissus


ischmiques augmente la pression interstitielle entourant les vaisseaux sanguins, un
effet qui est exacerb par le gonflement des cellules du parenchyme, provoquant
leffondrement des microvaisseaux prsentant la plus faible pression (les capillaires
et les post-veinules). Ce mcanisme de compression extravasculaire contribue 24
probablement au dveloppement de no-reflow. Il est particulirement important dans
les tissus qui ne peuvent pas stendre facilement aprs la formation de ldme,
car ils sont envelopps par des structures qui limitent lexpansion des tissus (tel que
le rein qui est entour par la capsule rnale) 19.
Dautres tudes ont suggr limplication des pricytes (des cellules contractiles
qui entourent presque tous les capillaires ainsi que les petites artrioles et veinules).
Ces cellules peuvent ventuellement affecter la fonction microvasculaire aprs une
24
lsion rnale aigu et influencer ainsi la reperfusion capillaire au cours de lI/R 25.
En effet, les pricytes ont t identifies comme tant la plus grande population de
cellules qui dtectent la pression partielle doxygne dans le sang et rpondent par la
26
production lrythropotine . De plus, ces cellules sont galement impliques dans
la rgulation du diamtre des capillaires pritubulaires qui entourent les nphrons au
niveau rnal 27. (Fig. 3)

28
(Rf. )
Figure 3. Localisation histologique des pricytes et capacit de rgulation du dbit en aval des
artrioles : exemple sur le contrle de la circulation sanguine dans le systme vasculaire crbral.

Des travaux ont montr que les pricytes capillaires se contractent peu aprs le
dbut de lischmie rtinienne ou crbrale et restent contracts lorsque le flux
sanguin est rtabli. En consquence, la contraction de ces cellules induit la fois
une rduction de diamtre de la lumire capillaire qui favorisera le phnomne de
no-reflow et aussi une production de peroxynitrite partir NO (molcule
vasodilatatrice) de lendothlium sous-jacent 29.
PARTIE (2) Physiopathologie de lischmie reperfusion et rponse immunitaire

2.2. La production des espces ractives de loxygne (EROs) :

Normalement, les mitochondries produisent une faible, mais constante quantit,


de radicaux libres comme des sous-produits de la respiration. Un radical libre est une 25
molcule chimique instable, caractrise par une existence indpendante et qui
contient un ou plusieurs lectrons non apparis sur sa couche externe. Les EROs
sont des molcules chimiques (radicaux libres) normalement produites par
lorganisme, elles rsultent du mtabolisme (rduction monovalente) de loxygne et
considres comme des acteurs majeurs dans la signalisation cellulaire la fois
basale et pathologique (processus nomm la signalisation redox). En gnral, EROs
est un terme collectif qui comprend la fois les drivs radicaux (superoxydes et
hydroxyles) et non-radicaux (peroxydes d'hydrogne) de loxygne. Cependant, il a
dj t dcrit lexistence dun certain nombre des EROs (radicaux et non-radicaux),
hors des trois formes cites prcdemment (Tab. 2).

30
(Rf. )

Tableau 2. Espces (radicalaires et non-radicalaires) ractives de loxygne et de


lazote dans les organismes vivants.

Plusieurs travaux ont tabli limportance primordiale de la production des EROs


31, 32
dans la physiopathologie des lsions dischmie-reperfusion . Lischmie
entrane des modifications des complexes de la chane respiratoire mitochondriale et
induit une diminution de lefficacit du systme antioxydant. Des squences
ischmiques de courte dure augmentent la fois llectrongativit des complexes
de la chane de transport dlectrons et la fuite dlectrons. En effet, si la squence
PARTIE (2) Physiopathologie de lischmie reperfusion et rponse immunitaire

dischmie est courte, elle peut ne pas tre suffisante pour modifier le systme
antioxydant et la production des EROs dans les mitochondries aprs la rintroduction
de lO. Dans certaines circonstances, telles que le prconditionnement ischmique,
la production des EROs dans les mitochondries aprs une brve priode dischmie
et de reperfusion peut tre bnfique dans la protection des cellules 16. En revanche, 26
lorsque la priode ischmique se prolonge, des changements plus profonds au sein
des mitochondries se produisent. Un temps dischmie prolong peut entraner une
diminution de lactivit des complexes de la chane du transport dlectrons comme
les complexes (I) et complexes (IV), entranant par la suite, une diminution de la
33
production dATP aprs la reperfusion . De plus, laltration des complexes de la
chane de transport dlectrons conduit galement la fuite des lectrons, et la
rduction de lO par les lectrons libres avec la formation des radicaux superoxydes.
Plusieurs sources gnratrices des EROs sont identifies, en particulier les
enzymes de la chane respiratoire mitochondriale et des enzymes pro-oxydantes.
Parmi ces dernires, on trouve la xanthine oxydase (catabolisme des bases
puriques), les cyclooxygnases et lipoxygnases (synthse des Prostaglandines
PGs et hydroperoxydes lipidiques LOOH ), NAPDH oxydases (NOXs), des
cytochromes P450 (mtabolisme des xnobiotiques), et les autres oxydases. Les
niveaux cellulaires des EROs sont rguls par la capacit du systme biologique
antioxydant neutraliser, dtoxifier et rparer les dommages cellulaires causs par
ceux-ci.
Dans les cellules vivantes, les principaux gnrateurs physiologiques des
radicaux libres sont les complexes enzymatiques (I) (NADH dshydrognase) et (III)
(ubiquinone-cytochrome C oxydorductase) situs au niveau de la chane du
transport des lectrons mitochondriale. Ces complexes contiennent plusieurs centres
redox (les flavines, les grappes fer-soufre, et ubisemiquinones) capables de
transfrer un lectron lO pour former O. La gnration des EROs par les
complexes (I) et (III) dpend du degr de rduction lectronique de ces gnrateurs.
Plus prcisment, lorsque le rapport NADH/NAD est augment (apport dnergie
lev), le degr de rduction lectronique du complexe (I) augmente, et la production
des EROs sera galement importante (Fig. 4). Comme la production des EROs
mitochondriale est trs sensible la force motrice de protons travers la membrane
interne, un lger dcouplage des mitochondries, via lexpression de protines
PARTIE (2) Physiopathologie de lischmie reperfusion et rponse immunitaire

dcouplantes UCPs (uncoupling proteins), pourra rduire fortement la gnration des


EROs 30.

27

30
(Rf. )
Figure 4. Gnration des EROs par la chaine respiratoire mitochondriale au niveau des complexes I et III
en tant que principaux gnrateurs des radicaux libres.

Le pourcentage du flux total des lectrons dans les mitochondries, destin la


production de radicaux, nest pas constant dans les diffrents tissus, et les
diffrentes conditions. En effet, larrive de sang oxygn dans le tissu ischmique
bien que ncessaire pour la restauration de la production arobie de lATP, se traduit
galement par la production accrue des EROs. En raison de leur nature hautement
ractive, les EROs gnres lors de la reperfusion peuvent modifier pratiquement
tous les types de biomolcules qui se trouvent dans les cellules.

3. Comportement de la cellule face lhypoxie :

La cellule utilise plusieurs systmes de dfense pour maintenir son intgrit


physiologique contre des stimuli extracellulaires et pour rtablir une homostasie
intracellulaire. Cette adaptation cellulaire lui permettra de lutter contre une baisse
accrue des taux dO interstitiel et intracellulaire, lors de lischmie, via la voie de
HIFs, et faire face aux radicaux libres cytotoxiques, lors de la reperfusion, qui
menacent sa survie laide dun systme antioxydant trs puissant. Lefficacit de
PARTIE (2) Physiopathologie de lischmie reperfusion et rponse immunitaire

ces systmes favorise la rparation des dgts survenus lors de lI/R au niveau
cellulaire.

3.1. Ladaptation cellulaire la variation de lO2 : Facteur inductible par


lhypoxie (HIFs) 28

Loxygne (O) est une molcule cruciale pour la fonction et la survie cellulaire.
Lorsque la demande en O est suprieure loffre, la voie de dtection de lO sera
centre sur un facteur qui joue un rle capital dans lhomostasie de lO
34
intracellulaire appel : Facteurs inductibles par lhypoxie (HIFs) . HIFs sont connus
comme facteur de transcription. Ils sont impliqus dans la coordination dun
programme de transcription tout en assurant une adaptation fonctionnelle,
mtabolique, et vasculaire en cas de pnurie en O (hypoxie) dans les cellules. Cette
adaptation cellulaire implique la rgulation, en particulier, des gnes de
langiogense, de lrythropose et de la glycolyse 35.
Le principal facteur de mdiation de cette rponse est HIF-1 (Hypoxia-inducible
factor-1). HIF-1 est constitu dune sous-unit HIF-1 exprime de manire
constitutive, et une sous-unit HIF-1 (de 120 kDa) rgule par lO (ou ses
paralogues HIF-2 et HIF-3) et exprime dans des diffrents tissus. En effet, la
stabilit et lactivit de HIF- est rgule par des modifications post-traductionnelles
telles que lhydroxylation, lubiquitination, lactylation et la phosphorylation.
HIF-1 a t dcouvert par lidentification dun lment de rponse lhypoxie
(HRE : Hypoxia response element : 5-RCGTG-3) dans les 3 activateurs du gne de
lrythropotine (EPO), une hormone qui stimule la prolifration des cellules
36
rythrocytaires . Des tudes ultrieures ont rvl que les protines qui se lient au
HRE dans les conditions hypoxiques forment un complexe htrodimrique compos
37
dune sous-unit HIF-1 et une sous-unit exprime HIF-1 . HIF-1 est galement
connu comme ARNT (aryl hydrocarbon receptor nuclear translocator) qui a t
identifi comme tant un partenaire de liaison au rcepteur dhydrocarbures aryliques
38
. Ces protines appartiennent la famille protique de bHLH-PAS (basic helix-loop-
helix-Per-ARNT-Sim). Les motifs bHLH et PAS sont ncessaire pour la formation les
complexes htrodimriques entre la sous-unit HIF- et une sous-unit HIF-1,
alors que la rgion en aval permet la liaison spcifique la squence HRE sur lADN
(Fig. 5). De plus, deux domaines de Trans-activation indpendants (stimulation de la
PARTIE (2) Physiopathologie de lischmie reperfusion et rponse immunitaire

transcription) ont t identifis pour HIF- (HIF-1 et HIF-2) les domaines N-


terminal (N-TAD) et C-terminal (C-TAD), alors que HIF-1 na quun seul domaine
39
TAD . En effet, il a t dj dmontr que C-TAD en particulier, est le domaine
40
dinteraction avec des co-activateurs de transcription, tels que CBP/p300 . En
outre, HIF-1, HIF-2, HIF-3 ont un domaine de dgradation dpendant de 29
loxygne (ODDD : Oxygen-dependent degradation domain). Ce domaine joue un
rle dans la dgradation de HIF- grce lhydroxylation de deux rsidus prolines
(P), et lactylation dune lysine (K) 41 (Fig. 5).

42
(Rf. )
Figure 5. Schma de la structure protique des domaines qui composent HIF- (HIF-1, HIF-2, HIF-3,
IPAS) et HIF-1.
Le nombre total d'acides amins de chaque sous-unit est marqu l'extrmit de la structure de
domaine.

HIF-2 galement appel protine PAS endothliale ou HLF (HIF-like factor),


HRF (HIF-related factor) et membre de la superfamille PAS 2 (MOP2). Cependant, il
se trouve que HIF-2 partage 48 % de squence en acides amins avec HIF-1. Par
consquent, HIF-2 prsente une similitude structurale et biochimique avec HIF-1
(par exemple : htrodimrisation avec HIF-1 et la liaison sur llment de rponse
dhypoxie HRE).
HIF-3, protine dcouverte plus tard, shtrodimrise galement avec HIF-1
et se lie HREs. En outre, un variant issu de lpissage de HIF-3, nomm IPAS
(PAS inhibitor) a t dcouvert par la suite. La protine IPAS ne possde pas
dactivit de transactivation endogne. Or, elle interagit avec la rgion amino-
terminale de HIF-1 et empche sa liaison lADN (IPAS agit par une rgulation
ngative dominante de HIF-1). Cependant, IPAS peut galement tre induite par
lhypoxie dans le cur et les poumons, contribuant une boucle de rgulation
43
rtroaction ngative pour lactivit de HIF-1 dans ces tissus . Les molcules HIF-1
PARTIE (2) Physiopathologie de lischmie reperfusion et rponse immunitaire

et HIF-2 ont t plus largement tudies, alors que la recherche sur HIF-3 et
dautres isoformes de HIF est relativement rare.

3.1.1. La rgulation de la stabilit HIFs :

30
La stabilit et lactivit de toutes les isoformes dHIF- sont rgules par deux
principales voies dpendantes de lO :
En prsence de lO (normoxie), HIF- a une demi-vie extrmement courte de
44
moins de cinq minutes tant continuellement synthtis et dgrad . La voie de la
dgradation protasomique est active et dpend de lhydroxylation de HIF-. Cette
hydroxylation est assure essentiellement par les PHDs (Prolyl hydroxylase domain-
containing enzymes) au niveau du domaine de dgradation ODDD (sur les
rsidus Proline-402 et Proline-564) (Fig. 6).
Les PHDs sont une famille de trois enzymes hydroxylase (PHD1-3) qui dpendent
de lO et du fer comme cofacteurs pour pouvoir aboutir une hydroxylation de
HIF-. Des tudes rcentes ont montr que PHD-2 est critique pour la dgradation
45, 46
protasomique dans des conditions normoxiques . Une fois les molcules
dHIF- hydroxyles, elles vont subir une polyubiquitination, au niveau des rsidus
hydroxyls, par des ligases VHL (von Hippel Lindau E3), marquant la dgradation
dHIF- par les protasomes.

47
(Rf. )
Figure 6. Rgulation des HIF- en normoxie par lhydroxylation des PHDs et FIH.
PARTIE (2) Physiopathologie de lischmie reperfusion et rponse immunitaire

De plus, FIH (Factor inhibiting HIF) hydroxyle HIF- au niveau du domaine


48
C-TAD (sur le rsidu asparagine 803) (Fig. 6). Il a t mis en vidence, par
immunohistochimie, que FIH est exprim dans les cellules pithliales tubulaires
rnales et dans le glomrule chez lhumain 49.
Or, lhydroxylation par FIH au niveau du rsidu Asparagine 803 ne conduit pas son 31
ubiquitination, mais un changement de conformation de HIF- au niveau nuclaire.
Ce changement de la structure de HIF-, induit par FIH, empche la formation de
lhtrodimre (HIF-/CBP/p300) et donc inhibe lactivit transcriptionnelle de HIF-
50
(Fig. 7).

Figure 7. Schma dtaill sur la rgulation de HIF-1 dans les conditions normoxiques et hypoxiques.
En normoxie, lhydroxylation par PHDs (P402 et P564) au niveau du N-TAD et FIH (N803) au niveau du C-TAD
induit la dgradation protasomique de HIF-1 via VHL et la suppression de son activit gnique en empchant
la fixation du complexe p300/CBP sur HIF-1. En revanche en hypoxie, HIF-1 est stabilis en raison de labsence
51
dhydroxylation par PHDs et lactivit transcriptionnelle est assure aprs linhibition de FIH (Rf. )

Cependant, en absence de lO (hypoxie), lactivit hydroxylase des PHDs et


FIH est inhibe et donc la voie de la dgradation protosomique galement 52. Ce qui
conduit une accumulation de HIF- dans cytoplasme (stabilisation de HIF- ), puis
une translocation nuclaire o elle va construire un complexe htrodimre en se
liant avec HIF-1 et recruter un complexe des facteurs de transcriptions P300/CBP.
Le complexe HIF-/HIF-1/P300/CBP se fixe sur llment de rponse dhypoxie
(HRE) qui va permettre dactiver la transcription de plus de 70 gnes effecteurs de
HIF- (Activit de HIF- ) 35 (Fig. 8).
PARTIE (2) Physiopathologie de lischmie reperfusion et rponse immunitaire

32

53
(Rf. )
Figure 8. Reprsentation schmatique du mcanisme dadaptation cellulaire face lhypoxie via la
stabilisation cytoplasmique de HIF-1, sa translocation nuclaire, et lactivit transcriptionnelle de ses
gnes effecteurs.

54
De plus, ltude mene par Jantsh et coll., a rvl une voie inflammatoire
oxygno-indpendante qui rgule la stabilit et lactivit de HIF-1. Cette voie est
induite par lactivation du rcepteur TLR et le recrutement de MyD88 et NF-kB.
Lactivation de NF-kB stabilise HIF-1 et induit la transcription des gnes
inflammatoires (Ptgs2 et Nos2) et mtaboliques (Glut1, Pgk1) effecteurs de HIF-1
54
.
3.1.2. Le rle des gnes effecteurs de HIFs :

La rponse lhypoxie est rgule principalement par le facteur inductible par


lhypoxie (HIFs). HIF est impliqu dans une grande varit de fonctions biologiques
telles que lrythropose, langiogense, le mtabolisme nergtique, la prolifration
et la migration cellulaire, la survie ou la mort cellulaire et la dfense contre le stress
oxydant. Ces fonctions sont impliques dans le maintien de lhomostasie biologique
de la cellule (Fig. 9).
PARTIE (2) Physiopathologie de lischmie reperfusion et rponse immunitaire

La liste des gnes rguls par HIFs (que ce soit directement ou indirectement)
sest rapidement allonge. Plus de 2000 squences HREs ont t identifies le long
du gnome de la souris dont plus de 200 gnes clairement contrls par HIFs 55, 56. Il
a t dmontr que certains facteurs, directement rguls par HIFs, ont un intrt
pour la pathogense des maladies rnales aigus et chroniques. Parmi ces 33
facteurs :le facteur de croissance vasculaire endothliale (VEGF), lactivateur du
plasminogne inhibiteur-1 (PAI-1), inhibiteur tissulaire de mtalloprotinase-1
(TIMP-1), le facteur de croissance du tissu conjonctif (CTGF), lrythropotine
(EPO), lendothline-1 (End-1), lhme oxygnase-1 (HO-1), et le suppresseur de
tumeur de Wilms (WT-1) 57.

58
(Rf. )
Figure 9. Schma des principaux gnes rguls directement par HIFs classs en groupes selon leurs
fonctions biologiques au niveau rnal.
(IC : interstitiel cell, RTEC : renal tubulair epithelial cell, EC : endothelial cell).

La rponse adaptative lenvironnement hypoxique est rgule la fois par


lactivation des gnes de la transcription mais aussi par la rgulation pigntique en
modifiant la conformation de la chromatine. En effet, des tudes rcentes ont montr
que la modulation pigntique telle que la mthylation des histones, actylation et
59
mthylation de lADN pourrait changer la rgulation de la rponse lhypoxie . Il
sagit dune autre voie dadaptation envisage par la cellule pour lutter contre les
lsions oxydatives en parallle avec la dfense antioxydante.
PARTIE (2) Physiopathologie de lischmie reperfusion et rponse immunitaire

3.2. Les systmes de dfense oxydants :

La vie cellulaire en arobie exige lexistence dune dfense antioxydante. Un


antioxydant est extrmement difficile dfinir. Cependant, une dfinition large a t
34
propose en qualifiant toute substance qui, lorsquelle est prsente des
concentrations faibles par rapport celles dun substrat oxydable, retarde ou
empche loxydation de ce substrat de faon significative. Plus prcisment, un
antioxydant ragit avec un oxydant ou gnre dautres molcules capables de ragir
avec loxydant pour le neutraliser 60.
La lsion oxydative est un terme gnral utilis pour couvrir lattaque des
radicaux libres contre les molcules biologiques. La protection cellulaire contre les
dommages oxydatifs comprend, la fois llimination des EROs et la rparation des
dommages par des antioxydants qui constituent la premire ligne de cette dfense.

Biochimiquement, les systmes antioxydants cellulaires comprennent des


antioxydants de faible poids molculaire (par exemple, lacide ascorbique, le
glutathion, des tocophrols, de lacide urique), et des enzymes antioxydantes telles
que le superoxyde dismutase (SOD), la glutathion peroxydases (GPx) et la catalase
(CAT). Ce systme de dfense contribue dans le maintien dune homostasie redox
intracellulaire. Certaines enzymes peuvent agir indirectement comme antioxydants :
telles que lhme-oxygnase qui rduit le stress oxydatif vasculaire dans le diabte,
en augmentant lexpression de la SOD extracellulaire (EC-SOD) et catalase. De plus,
il existe diffrents types de molcules endognes non enzymatiques qui cooprent
pour limiter le stress oxydatif cellulaire. On peut noter que lefficacit antioxydante
exige leur disponibilit dans le compartiment subcellulaire o les EROs sont
gnres.

3.2.1. Superoxyde dismutase (SOD) :

La SOD est une enzyme qui convertit le radical superoxyde (O) en oxygne
(O) et en peroxyde dhydrogne (HO). Chez lhomme, il existe trois diffrentes
formes de SODs dans les diffrents compartiments cellulaires. Elles sont rparties
selon le cofacteur mtallique quelles contiennent : la Mn-SOD (SOD2) dans la
matrice mitochondriale, le Cu/Zn-SOD (SOD1) dans le cytosol et lespace
intermembranaire, et des diffrents Cu/Zn-SOD (SOD3) dans le compartiment
PARTIE (2) Physiopathologie de lischmie reperfusion et rponse immunitaire

extracellulaire. Bien que la SOD limine les radicaux superoxydes, elle nassure pas
une dfense antioxydante complte parce quelle produit le HO, lui-mme
hautement ractif. La catalase (CAT) et la glutathion peroxydase (GPx) sont deux
enzymes diffrentes, mais cintiquement complmentaires qui peuvent liminer les
HO 30. 35

3.2.2. Catalase (CAT) :

La Catalase est exprime principalement dans les peroxysomes. Elle est lune
des enzymes les plus actives connues qui catalyse la dcomposition du HO en
HO et O. Toutefois, la CAT possde une faible affinit pour lHO, donc elle aura
besoin de fortes concentrations de HO pour fonctionner efficacement 30.

3.2.3. Glutathion peroxydase (GPx) :

linverse des SOD et CAT, les enzymes GPx ( la fois la forme slnium et
non-slnium dpendant) sont plus fonctionnelles de faibles concentrations de
peroxyde dhydrogne (HO). Elles possdent une affinit leve et un taux de
catalyse bas. Les GPx ont les mmes localisations cellulaires (cytosol et
mitochondrie) que la SOD, suggrant que GPx est la principale enzyme qui interagit
avec du HO produit par Cu/Zn-SOD dans le cytosol et Mn-SOD au niveau de la
mitochondrie. Il a t dmontr que les mutations du gne de GPx sont associes
une augmentation de lathrosclrose et le risque de diabte. De plus,
lexpression GPx-1 est altre dans le diabte. Elle est augmente dans le foie, les
reins, laorte, et le sang, alors que cette activit est rduite dans le cur et la rtine
30
.
3.2.4. Glutathion rductase et Glutathion S-transfrase (GST) :

Le glutathion sous sa forme rduite (GSH) fonctionne comme un capteur de


radicaux libres, et en tant que cofacteur de la glutathion peroxydase (GPx) et la
glutathion-S-transfrase (GST). GSH est reconnu comme un agent pigeur
endogne antioxydant et carbonyle, ce qui contribue au maintien du statut redox
cellulaire et protge les cellules contre le stress oxydatif. Le disulfure de glutathion
oxyd (GSSG) joue un rle important dans la rgulation de la fonction des protines,
la glutathion rductase est lenzyme responsable de la rduction du GSSG en GSH
utilisant la NADPH.
PARTIE (2) Physiopathologie de lischmie reperfusion et rponse immunitaire

La glutathion S-transfrase (GST) est une enzyme cytosolique qui catalyse la


conjugaison de GSH une varit de substrats, ce qui lui permet de neutraliser les
lipides peroxyds, des toxines et des xnobiotiques. La GST appartient une famille
denzymes multifonctionnelles, les iso-enzymes humains GST-A, GST-M et GST-P
jouent un rle (essentiellement GSTA4-4) dans la dtoxication dune varit de 36
composs carbonyles.

3.2.5. Hme oxygnase (HO) :

Hme oxygnase (HO) catalyse la dgradation de lhme, favorisant la


production de la biliverdine, le fer et le monoxyde de carbone. Deux isoformes de
lhme-oxygnase ont t dcrites : lhme-oxygnase-1 (HO-1), dont lexpression
est induite par le stress oxydatif, lhypoxie, et les cytokines; et lhme-oxygnase-2
(HO-2), qui est exprime de manire constitutive. Une troisime isoforme, lhme-
oxygnase-3 (HO-3) na pas apparemment dactivit catalytique et son rle demeure
inconnu. HO-1 est une enzyme cl dans les dfenses cellulaires. Elle protge la
fonction vasodilatatrice de lendothlium, inhibe linflammation et lapoptose des
cellules endothliales, et contribue un remodelage vasculaire, la novascularisation
et langiogense 61.

3.2.6. Thiordoxine:

La thiordoxine est une oxydorductase avec un site actif dithiol-disulfure. Elle


catalyse la rduction des protines par change thiol-disulfure. Les thioredoxines
sont exprimes de faon ubiquitaire et contribuent maintenir un tat
doxydorduction intracellulaire rduite dans les cellules de mammifres par la
rduction de thiols de la protine.

3.3. Les mcanismes de la rparation :

Malgr la multiplicit du systme de dfense antioxydant, les dommages induits


par loxydation se produisent toujours in vivo. Le niveau ultime de la protection
cellulaire contre le stress oxydatif est la rparation et/ou llimination des
macromolcules oxydatives endommages 60.
Afin dviter laccumulation progressive issue de loxydation des bases dADN et
de maintenir ainsi la stabilit gnomique, lADN endommag est rpar par un
certain nombre de mcanismes. Gnralement, les bases de lADN oxydes sont
PARTIE (2) Physiopathologie de lischmie reperfusion et rponse immunitaire

limines par des mcanismes dexcision de base. Ces dispositifs de correction


prsentent une fidlit leve. Cependant, les processus de rparation de lADN
saltrent avec lge. Ces altrations semblent plus importantes quand il sagit lADN
mitochondrial, o la rparation de lADN reste moins bien connue compare celle
au niveau nuclaire. Gnralement, la rparation de lADN est assure par les 37
enzymes ADN polymrase, qui ont un rle de vrification et de correction derreurs
qui peuvent apparatre sur lADN 62.
Les protines endommages, quant elles, peuvent tre soit rpares ou
dgrades. Par exemple, les rsidus mthionine des protines sont parmi les acides
amins les plus sensibles loxydation par les EROs. La sensibilit des protines au
stress oxydatif augmente en fonction de leurs nombres de rsidus de mthionine.
Loxydation des rsidus mthionine dans les protines gnre la mthionine
63
sulfoxyde, ce qui conduit la perte de leur activit biologique . La mthionine
sulfoxyde peut tre rpare par lenzyme mthionine sulfoxyde rductase, qui utilise
le pouvoir rducteur de la thiordoxine. Cependant, les mcanismes de rparation
des protines sont gnralement limits, et la plupart des protines oxydes sont
limines soit par protolyse, soit par dgradation lysosomiale ou par le protasome
64
.
La protection contre les lsions des membranes cellulaires est assure par un
systme plus complexe qui comprend trois mcanismes : la rparation des lipides, le
remplacement des lipides, et llimination des produits finaux drivs de la
peroxydation lipidique (LOO). Ces produits sont considrs comme tant le principal
mcanisme molculaire impliqu dans les lsions oxydatives des structures
cellulaires. Laction des antioxydants peut favoriser la production dhydroperoxydes
lipidiques (LOOHs). Ces derniers sont mtaboliss par les enzymes antioxydantes
GPx, qui agissent sur HO et galement sur hydroperoxydes dacides gras libres, en
les rduisant des alcools dacides gras. De plus, le remodelage lipidique
membranaire est un mcanisme important pour liminer les lipides peroxyds.
Certains antioxydants tels que le phospholipide hydroperoxyde glutathion
peroxydase (PHGPx) sont capables dliminer les chanes acyles dacides gras
peroxydes encore estrifies de la membrane de lipidique. Finalement, les drivs
des produits finaux de la peroxydation lipidique, rsultant des dommages oxydatifs
des lipides membranaires, peuvent tre dtoxifis par la glutathion S-transfrase.
PARTIE (2) Physiopathologie de lischmie reperfusion et rponse immunitaire

4. Lsions cyto-histopathologiques induites par lI/R rnale :

4.1. La mort cellulaire :

Pendant de nombreuses annes, la mort cellulaire, induite par lI/R, a t 38


considre comme le produit des facteurs extrinsques tels que la perte de
lapprovisionnement nergtique, llaboration de mdiateurs inflammatoires et des
molcules toxiques, et des lsions mcaniques. Ce modle de mort cellulaire a t
appel ncrose. Cependant, il est maintenant reconnu que les cellules peuvent
galement tre programmes pour mourir par des mcanismes de signalisation
cellulaire via les processus de ncroptose, lapoptose et lautophagie. Chacune de
ces formes distinctes de la mort cellulaire semble contribuer dune certaine manire
la pathogense des lsions dI/R. Nous fournissons un bref aperu sur les
mcanismes sous-jacents de chacune de ces modalits de mort cellulaire (Fig. 10).

19
(Rf. )

Figure 10. Schma des principaux mcanismes de la mort cellulaire induite par lischmie reperfusion :
ncrose, ncroptose, apoptose et autophagie.
PARTIE (2) Physiopathologie de lischmie reperfusion et rponse immunitaire

4.1.1. La ncrose et ncroptose :

Contrairement la nature programme de lapoptose et lautophagie, la


ncrose est cense se produire via des processus alatoires et non contrls. Ces
39
processus conduisent la mort accidentelle de la cellule en rponse un stress
irrsistible. Cependant, le concept de la ncrose programme, appel galement
19
ncroptose, est particulirement observ dans des conditions telles que lI/R .
Morphologiquement, la ncrose est caractrise par le gonflement des cellules et de
ces organites, un dysfonctionnement mitochondrial, une absence de fragmentation
nuclaire, une rupture de membrane cytoplasmique, et des fuites du contenu
intracellulaire. Il est maintenant connu que le stress cellulaire ou lactivation des
rcepteurs de la mort cellulaire vont induire un groupe de srine/thronine kinase
nomm RIPs (receptor interacting proteins). En particulier, RIP1 et RIP3 semblent
agir en coordination en tant que mdiateur de la ncrose entranant une
augmentation de la production des EROs en fonction du type cellulaire. Les EROs
sont gnres, soit par lactivation de la NADPH oxydase, ou par une augmentation
de la production doxydant mitochondrial.

Parmi les cibles potentielles de RIP qui mdient la ncrose, on trouve les pores
mitochondriaux mPTP. Les pores mPTP sont des canaux non spcifiques dans la
membrane mitochondriale interne. Le canal mPTP souvre en rponse une
production excessive des EROs et de laccumulation de Ca dans la matrice
mitochondriale. Ces deux phnomnes peuvent se rencontrer au cours de lI/R. Cette
augmentation soudaine de la permabilit de la membrane mitochondriale interne
permettra la perte du gradient lectrochimique de protons, et donc la dpltion de
lATP ainsi que la production des EROs, et finalement, le gonflement et la perte de
lintgrit mitochondriale.
PARTIE (2) Physiopathologie de lischmie reperfusion et rponse immunitaire

4.1.2. Lapoptose :

Contrairement la ncrose, qui constitue un cas de mort cellulaire accidentelle.


Lapoptose est la mort cellulaire programme qui dsigne une mort cellulaire
physiologique impliquant des processus actifs et sous le contrle dun programme
cod gntiquement par la cellule elle-mme. Les mcanismes apoptotiques sont 40
canoniquement diviss en deux voies : intrinsque et extrinsque. La voie
intrinsque implique lactivation des rcepteurs tels que le Fas, TNF- et les
rcepteurs TRAIL. Lactivation de ces rcepteurs entrane leur trimrisation qui,
son tour, recrute un certain nombre de protines contenant des domaines de la mort
cellulaire tels que FADD et TRADD ce complexe de rcepteur. La signalisation
activera une protase caspase-8 qui a pour rle de cliver et activer la caspase-3.
Cette dernire agit comme un bourreau de la cellule par une cascade de protolyse
et de clivage de nombreuses protines cellulaires 65.

En ce qui concerne la voie extrinsque, les stimuli cytotoxiques tels que lischmie
reperfusion, lirradiation UV, composs toxiques (toposide, staurosporine), ou un
stress oxydatif, sont impliqus. Ces stimuli vont induire la translocation et lintgration
des membres de la famille de la protine Bc12 (pro-mort) dans la membrane
mitochondriale externe. Ces protines, par un mcanisme qui reste encore
controvers, vont permabiliser la membrane cellulaire externe, permettant ainsi la
libration des protines pro-apoptotiques dans lespace intermembranaire
notamment le cytochrome C, Smac/DIABLO, Omi/HtrA2 et lendonuclase-G
(endoG). Le cytochrome C se lie la protine cytosolique apaf1 afin dactiver le
systme des protases caspase-9 et caspase-3. Smac/DIABLO et Omi/HtrA2
activent les caspases en squestrant des protines de caspase-inhibitrice,
respectivement. Alors que lendoG est implique dans la fragmentation de lADN
cellulaire 65.
PARTIE (2) Physiopathologie de lischmie reperfusion et rponse immunitaire

4.1.3. Autophagie :

Lautophagie est le principal mcanisme de la cellule pour llimination des


organites obsoltes ou endommags et des agrgats de protines, fournissant ainsi
une fonction de mnage. Lautophagie est galement un mcanisme de survie et
41
de rsistance cellulaire vis--vis les conditions de stress, telles que
lappauvrissement en nutriments, lhypoxie, le dysfonctionnement mitochondrial, et
linfection. Ce mcanisme de rsistance est bas sur la gnration des acides
amins et des acides gras pour le maintien de la structure et de la fonction cellulaire
en liminant des organites endommags ainsi que des agents pathognes
intracellulaires 66.
En fait, lautophagie est un mcanisme de survie cellulaire plutt quun processus
de mort cellulaire. Cependant, lautophagie incontrle mnera finalement la mort
de la cellule et peut contribuer aux lsions dischmie reperfusion.
Morphologiquement, lautophagie commence avec lexpansion dune membrane
disolement, ou phagophore, autour du compartiment cellulaire/organite traiter. Par
la suite, une structure double membrane entoure compltement les constituants
pour former lautophagosome vsiculaire, qui fusionne avec un lysosome, et les
matriaux squestrs sont dgrads par les hydrolases acides 19.

Les mcanismes molculaires de lautophagie sont initis grce un complexe


protique unc -51-like kinase (ULK1 et ULK2). Un orthologue mammifre dun gne
li lautophagie chez la levure (Atg1), est compos dune protine kinase Ulk1
Ser/Thr, Atg13 et FIP200 (homologue mammifre de lAtg17 chez la levure).
La phosphorylation de lAtg13 et FIP200 par Ulk1 est la premire tape
indispensable pour dclencher lautophagie. La formation des vsicules de
nuclation (phagophore) dpend de Beclin-1 (Agt6 dans la levure) et de la classe III
de phosphatidylinositol 3-kinase (PI3K). Pendant la formation de lautophagosome
(phase dallongement et de lexpansion de la membrane et la fermeture), deux
systmes de conjugaison ubiquitaires dpendants sont impliqus : Atg12 et LC3
(orthologue mammifre de Atg8 chez la levure). Le conjugu Atg12-Atg5 va
sassocier de manire non covalente avec Atg6 pour former le complexe Atg12-Atg5-
Atg6, qui contribue la stimulation et la localisation de la raction de
conjugaison LC3. Lisoforme cytosolique LC3 (LC3-1) est conjugue la
phosphatidylthanolamine par deux ractions conscutives dubiquitination qui sont
PARTIE (2) Physiopathologie de lischmie reperfusion et rponse immunitaire

catalyses par lenzyme E1-like Atg7 et lenzyme E2-lik Atg3 pour former LC3-II. Ce
dernier est reconnu comme un marqueur de lexistence dautophagosome dans la
cellule. Aprs formation, les autophagosomes fusionnent avec les vsicules
lysosomiales pour former les auto-lysosomes. Le mcanisme de fusion avec le
lysosome est assur par une protine p62, galement connue sous le nom de 42
squestosome 1 (SQSTM1) qui est lun des principaux substrats dautophagie. En
effet, p62 interagit avec LC3 via son domaine dinteraction LC3 et forme un
complexe p62-LC3 pour induire la dgradation lysosomiale et une digestion mdie
par des protases (cathepsine B et L). Finalement, le flux autophagique en acides
amins, acide gras et en phosphatidylinositol, est un indicateur que le processus de
lautophagie a t achev 66 (Fig. 11).

Figure 11. Schma de la voie autophagique.


Elle comprend quatre tapes : linitiation, nuclation, llongation et la fermeture. Lautophagie est initie par la
nuclation dune membrane disolement (phagophore). Le phagophore sallonge et se ferme sur lui-mme pour
former un autophagosome. La fusion dun autophagosome avec un lysosome forme un auto-lysosome o
67
lorganite va subir une dgradation par les acides hydrolases (Rf. )
.
PARTIE (2) Physiopathologie de lischmie reperfusion et rponse immunitaire

4.2. La ncrose tubulaire aigu :

Sur le plan terminologique, les lsions tubulaires, induites par lischmie, sont
gnralement appeles ncrose tubulaire aigu (NTA). En ralit le terme NTA est
trompeur, car seulement quelques cellules tubulaires sont ncrotiques, tandis que la 43
plupart sont vivantes (soit en bonne sant ou rpares), et certains sont
apoptotiques.

La ncrose tubulaire aigu est un phnomne par lequel lischmie et


lappauvrissement en oxygne induisent des lsions des cellules tubulaires via la
dpltion dATP et des modifications critiques dans le mtabolisme et lintgrit des
cellulaires 68(Fig. 12). Le changement du mtabolisme cellulaire induit la perturbation
du cytosquelette. En effet, lappauvrissement de lATP cellulaire conduit une
distribution rapide du cytosquelette dactine dans la partie apicale, et la redistribution
de lactine partir du domaine apical et de microvillosits vers le cytoplasme. Ces
modifications entranent une perte de jonctions serres cellulaires et de
microvillosits de la bordure en brosse dans la lumire tubulaire. Par consquent, la
fuite trans-tubulaire du filtrat glomrulaire et les cellules dtaches peuvent obstruer
les tubules en aval 69 (Fig. 12).

La dpltion de lATP active galement les protases et phospholipases


nuisibles qui, la reperfusion, provoquent les lsions oxydatives des cellules
tubulaires. Un endommagement similaire se produit dans les cellules endothliales
des capillaires pritubulaires, en particulier dans la mdullaire externe, qui est
marginalement oxygne dans des circonstances normales. Cette lsion oxydative,
avec un changement dans lquilibre des substances vasoactives par rapport aux
substances vasoconstrictrices telles que lendothline, aboutit la vasoconstriction,
68
la congestion, hypoperfusion, et lexpression des molcules dadhsion .
Lexpression de ces dernires dclenche une infiltration leucocytaire, augmente par
les cytokines pro-inflammatoires et chimiotactiques produites par les cellules
tubulaires ischmiques. Ces leucocytes obstruent la microcirculation (no-reflow) et
librent, leurs tours, des cytokines cytotoxiques, les EROs et des enzymes
protolytiques, qui endommagent les cellules tubulaires 68.
PARTIE (2) Physiopathologie de lischmie reperfusion et rponse immunitaire

44

Figure 12. Mcanismes physiopathologiques de ncrose tubulaire aigu induite par ischmie rnale.
Les lsions tubulaires sont la consquence directe des voies mtaboliques actives par lischmie, et
potentialise par la rponse inflammatoire. Lencadr de gauche montre linfiltrat leucocytaire au sein de
lendothlium, la destruction de la membrane basale, la desquamation des cellules ncrotiques et des dbris des
cellules apoptotiques dans la lumire tubulaire. Lencadr de droite montre lobstruction du tubule distal par les
69
cellules ncroses (Rf. )
.
Les deux tudes exprimentales murines et humaines indiquent que les cellules
pithliales tubulaires peuvent souffrir lun des trois diffrents destins en rponse
une squence ischmique. La majorit des cellules restent viables, ce qui suggre
quelles soient chappes entirement de la lsion ou lgrement lses qui
sorientent vers la rparation. Une autre population cellulaire de lpithlium tubulaire
affiche la mort cellulaire intgrale qui rsulte dau moins deux mcanismes
physiopathologiques, la ncrose ou lapoptose. Ces deux formes de mort cellulaire
peuvent coexister aprs une lsion rnale ischmique, le mode de mort cellulaire
dpend principalement de la svrit de lagression et la rsistance du type
cellulaire. La ncrose se produit gnralement aprs une lsion plus svre et dans
les segments de nphron plus sensibles, tandis que lapoptose prdomine aprs une
lsion moins svre et en particulier dans les segments distaux du nphron
dischmie-rsistantes. Lapoptose peut tre suivie par ncrose secondaire, en
particulier si les cellules apoptotiques ne sont pas limines rapidement.
PARTIE (2) Physiopathologie de lischmie reperfusion et rponse immunitaire

4.3. La fibrose rnale :

La fibrose rnale est caractrise par une atrophie des cellules tubulaires et une
accumulation de matrice extracellulaire 70
. Lactivation des fibroblastes devient 45
importante dans les zones environnantes des tubules atrophiques provoquant une
rarfaction des capillaires pritubulaires. Lhypoxie tubulo-interstitielle est donc la
71
voie finale commune dans les maladies rnales progressives . En fait, lhypoxie
supprime la croissance des cellules pithliales tubulaires et conduit une incapacit
72
du remodelage en facilitant la ddiffrenciation et lapoptose de ces cellules. De
plus, les facteurs profibrosants tels que le TGF-b (transforming growth factor-b)
induisent lactivation des fibroblastes, et le recrutement des leucocytes, qui sinfiltrent
dans les zones hypoxiques, contribuant la fibrose rnale chronique.

Lhypoxie pose un dfi important pour la fonction des cellules et des organes.
Elle joue un rle important dans la progression des maladies rnales chroniques vers
linsuffisance rnale terminale. En effet, une ischmie rnale bilatrale transitoire
chez la souris est associe une production accrue des EROs lors de la reperfusion,
73
contribuant la progression de la fibrose rnale chronique . De plus, une hypoxie
chronique acclre galement la progression de la fibrose rnale.

Rcemment, il a t dmontr que la fonction rnale est indpendante de


lexpression de HIF-1 dans les cellules endothliales aprs une lsion rnale aigu
74
ou chronique . Alors que la dpltion de la protine ligase pVHL, dans les tubules
proximaux chez des souris induit une stabilisation chronique de lexpression de
HIF-1 dans les conditions normoxiques. Le maintien de lexpression HIF-1 favorise
le dveloppement de la fibrose tubulo-interstitielle via laugmentation de lexpression
des gnes fibrogniques tels que la CTGF (connective tissue growth factor) et la
fibronectine aprs 60 semaines dge 75.

En outre, lhypoxie tubulo-interstitielle, rsultant aprs une glomrulosclrose et


la rarfaction vasculaire observes dans les maladies rnales chroniques, induit
galement la stabilisation de HIF-1 et la transcription des facteurs tels que PAI-1,
TIMP-1 et CTGF. Ces facteurs favorisent la transition pithlio-msenchymateuse et
PARTIE (2) Physiopathologie de lischmie reperfusion et rponse immunitaire

70
promeuvent la fibrose . Or, linhibition de lexpression de HIF-1 a amlior la
progression de la fibrose interstitielle dans un modle dobstruction urtrale
unilatrale chez la souris. Leffet inhibiteur dun agent anti-HIF-1 pourrait tre un
moyen utilis pour le traitement de la fibrose tubulo-interstitielle 75.

46
76
Trs rcemment, un mcanisme a t dvoil par Renna Luo et coll.,
expliquant la pathogense et la progression des maladies rnales chroniques
hypertensives (MRCH) (Fig. 13). Les auteurs ont constat que langiotensine II
provoque laugmentation de lexpression endothliale du gne HIF-1 via lactivation
du facteur nuclaire NF-kB. La rgulation en boucle rtroactive positive exerce
entre HIF-1 et NF-kB, favorise une vasoconstriction glomrulaire et la diminution du
dbit sanguin vers linterstitium tubulaire rnal. En consquence, cet environnement
hypoxique favorise, son tour, linstallation de la fibrose rnale et mne vers une
insuffisance rnale chronique terminale 76.

Cependant, les cellules rnales rsidentes sadaptent lenvironnement


hypoxique via une rgulation positive de HIFs. Les niveaux de HIFs sont diminus
dans les maladies rnales chroniques en raison de multiples facteurs. Ainsi, la
restauration de lactivit de HIFs pourrait contribuer lamlioration les pathologies
77, 78
rnales chroniques . Les tudes menes ce jour dans ce cadre ont rapport
que lactivation de HIFs rduit linflammation et le stress oxydatif et amliore les
79
lsions en diminuant lapoptose des cellules tubulaires et la restauration du rseau
capillaire pritubulaire. Les inhibiteurs PHDs activant spcifiquement HIFs sont
actuellement en cours dvaluation pour le traitement de lanmie de cause rnale et
seront peut-tre efficace pour le traitement de la maladie rnale chronique.
PARTIE (2) Physiopathologie de lischmie reperfusion et rponse immunitaire

47
ET-1 : endothline-1
ACE : enzyme de conversion de langiotensine
ECE : enzyme de conversion de lendothline
EDNRA : rcepteur de lendothline A
AT1R : rcepteur de langiotensine I

Figure 13. Angiotensine (Ang) II stimule l'expression endothliale du gne HIF-1 et favorise les lsions
rnales, lhypertension intra-rnale et la progression de la fibrose.
Lactivation de facteur NF-kB rgule lexpression HIF-1 en boucle rtroactive positive qui en rsulte dans
linduction des gnes codants pour des facteurs vasoactifs. Ces facteurs provoquent une vasoconstriction
glomrulaire, lhypoxie et la fibrose rnale impliques dans la progression de la maladie rnale chronique
76
hypertensive dans un modle murin (Rf. ).
PARTIE (2) Physiopathologie de lischmie reperfusion et rponse immunitaire

II. Phnomnes immunitaires et inflammatoires lis lI/R:

Le rein post-ischmique est une cible du systme immunitaire systmique, ainsi


quun site de linflammation locale (tubulo-interstitielle). La pathognie des lsions
dischmie-reperfusion reprsente une interaction complexe entre des facteurs 48
biochimiques, cellulaires, endothliaux vasculaires et tissulaires spcifiques, avec
15
une inflammation tant comme une caractristique commune . Cette inflammation
est mdie par lactivation des cellulaires de limmunit tels que les cellules
dendritiques (DCs : dendritic cells), les neutrophiles, les monocytes/macrophages,
80
les tueuses naturelles T (NKT : natural killer T), et les cellules lymphocytes T et B .
Le rle important de la rponse immunitaire inne et adaptative implique a t mis
en vidence dans les mcanismes pathogniques des lsions rnales post-
ischmiques.

1. Lsions dI/R : systme immunitaire inn et adaptatif

Limmunit inne comprend le bras non spcifique du systme immunitaire. Les


cellules immunitaires innes reconnaissent des motifs molculaires gnraux
associs linfection des agents pathognes nomms signaux pathogniques les
PAMP qui sont des motifs conservs, exprims par les microorganismes
pathognes. Cependant, linflammation nest pas toujours synonyme dinfection et
peut tre dclenche par dautres signaux regroups sous le terme de signaux de
danger tels que les DAMP : dlivrs par des cellules endommages. Les cellules
du systme immunitaire inn prsentatrices dantigne vont promouvoir, par la suite,
81
lactivation du systme immunitaire adaptatif . Il a dj t admis que la phase
prcoce de la rponse immunitaire inne induite par lI/R commence quelques
minutes aprs reperfusion, alors que la rponse immunitaire adaptative est une
phase tardive ncessitant quelques jours se manifester 82.
Selon le modle classique, lischmie aigu conduit la production de radicaux
libres doxygne, la scrtion des cytokines/chimiokines inflammatoires et
laugmentation de lexpression des molcules dadhsion sur les cellules
endothliales, et les rcepteurs TLRs sur les cellules pithliales tubulaires.
Lensemble de ces facteurs sont des initiateurs importants de la rponse immunitaire
inne qui conduisent lactivation des cellules endothliales et induisent les lsions
tissulaires 83.
PARTIE (2) Physiopathologie de lischmie reperfusion et rponse immunitaire

Les cellules polynuclaires sont les principaux leucocytes observs dans les
tissus ncrotiques aprs une ischmie. Le systme immunitaire inn est activ trs
tt de faon non spcifique lantigne. Ce type dimmunit est compos de
neutrophiles, monocytes/macrophages, DCs, NK (Natural killer) et NKT (Natural
killer T). Laccumulation de ces leucocytes avait t considre comme un mdiateur 49
cellulaire principal de lobstruction microvasculaire et la destruction tissulaire locale
84
dans les lsions dI/R . En revanche, le systme immunitaire adaptatif devient
sensible des antignes spcifiques (provenant des agents pathognes ou des
cellules apoptotiques et ncrotiques) au cours de plusieurs jours. Ce type dimmunit
comprend la maturation des DCs et la prsentation des antignes, la prolifration et
lactivation des lymphocytes T CD4 et CD8, et linteraction des lymphocytes T B.
Les leucocytes, tels que les DCs et les macrophages, jouent un rle cl dans les
deux types dimmunit par la production de cytokines proinflammatoires et la
prsentation de lantigne aux lymphocytes. Les deux cellules lymphocytaires T et B
constituent les principaux acteurs de la rponse immunitaire adaptative et ne
semblaient pas jouer un rle dans la phase aigu des lsions dI/R. Toutefois, des
donnes rcentes ont remis en question cette hypothse et dmontr le rle
83
modulateur important des lymphocytes T dans linstallation des lsions dI/R . En
outre, le rle du systme de complment dans les pathologies rnale a t bien
85
tabli , avec une activation partiellement dmontre travers une voie alternative
86
.

1.1. La phase inflammatoire prcoce dans les lsions rnales dI/R :

Au cours de la dernire dcennie, de nombreux nouveaux concepts


cellulaires et molculaires tudiant le rle de linflammation dans lsions rnales
aigus ont merg (Fig. 14). Le phnomne dischmie et/ou reperfusion initie des
changements dans les cellules endothliales vasculaires, les cellules tubulaires
pithliales (TEC : Tubular epithelial cells) et les cellules DCs rnales rsidentes ou
des cellules non rsidentes dorigine de la moelle osseuse. Ces changements
proinflammatoires provoquent une altration de lhomostasie du systme
immunitaire dans le rein. En consquence, de nombreux leucocytes
proinflammatoires sont attirs, et activs dans le rein post-ischmique, potentialisant
les dommages directs des cellules parenchymateuses rnales par lI/R. En outre, le
systme du complment, les rcepteurs TLRs et de nombreuses cytokines et
PARTIE (2) Physiopathologie de lischmie reperfusion et rponse immunitaire

chimiokines sont clairement impliqus dans lamplification de la rponse immunitaire


lors dune lsion rnale aigu.

50

Figure 14. Reprsentation schmatique du rle inflammatoire des leucocytes et des rnales dans les
lsions rnales aigus.
Lischmie reperfusion induit un changement dans les cellules leucocytaires, endothliales et pithliales
tubulaires qui rsultent de linflammation rnale et mdient les lsions rnales aigus. Cette interaction
cellulaire dmontre la nature complexe de linflammation associe des lsions rnales aigus. (dLN :
draining lymph node) (Rf. 87).

1.1.1. Endothlium vasculaire rnal :

Lun des premiers vnements rsultant de lI/R rnale est lactivation de


lendothlium. Cette activation conduit une augmentation de la permabilit
88
vasculaire favorisant lextravasation des leucocytes dans le rein . Les leucocytes
interagissent avec lendothlium vasculaire par lintermdiaire dune srie dtapes
distinctes, caractrises par le roulement (rolling) des leucocytes sur lendothlium
(1), ladhsion des leucocytes lendothlium (2), et la transmigration endothliale
(Diapdse) (3) (Fig. 15).
PARTIE (2) Physiopathologie de lischmie reperfusion et rponse immunitaire

51

89
(rf. )
Figure 15. Adhrence et transmigration des leucocytes endothliales aprs lischmie reperfusion.
Les leucocytes activs interagissent avec lendothlium vasculaire via une srie dtapes distinctes : le
rolling (tape dpendante de la slectine), ladhsion et diapdse (tape dpendante de lintgrine).

20
Brodsky et coll., ont montr que lI/R rnale provoque une perte des cellules
endothliales des artrioles affrentes et linterruption des contacts entre les cellules
endothliales 90. Ces changements dans lintgrit de la paroi endothliale vasculaire
rnale sont lorigine de laugmentation de lexpression des molcules dadhsion
facilitant les interactions cellulaires leucocyto-endothliales 91.

La premire tape induite par lI/R est caractrise par la scrtion de molcules
chimio-attractantes par les cellules endothliales actives. Ces chimiokines
participent lattraction des leucocytes la surface de la paroi de lendothlium.

Sur la base de l'expression diffrentielle des chimio-rcepteurs CCR2 et CX3CR1,


deux populations de monocytes, de monocytes inflammatoires (CCR2, CX3CR1low)
et de monocytes rsidents (CCR2, CX3CR1high) ont t caractrises par le
recrutement et la diffrenciation des monocytes en macrophages. La chimiokine
CX3CL1 (fractalkine) est un ligand du rcepteur CX3CR1 fortement exprim sur les
macrophages. Cette chimiokine est galement implique dans ladhsion et la
migration des leucocytes. Un prtraitement avec un anticorps spcifique anti-
92
CX3CR1 rduit la gravit de linsuffisance rnale aigu . Les cellules
PARTIE (2) Physiopathologie de lischmie reperfusion et rponse immunitaire

monocytes/macrophages, exprimant CX3CR1low et CCR2, sont recrutes, partir


de la moelle osseuse par les cellules endothliales et conduisent la production de
chimiokines mdiatrices de leur recrutement dans le rein endommag (Fig. 16).

52

Figure 16. Trafic des monocytes dans les lsions dischmie reperfusion rnale chez la souris.
Les prcurseurs monocytaires provenant de la moelle osseuse qui se trouvent dans la circulation sanguine sont
des CCR2 dpendantes. (a) les monocytes avec un CX3CR1high lev perdent lexpression de CCR2 et Ly6C. (b)
Ces cellules migrent rapidement vers le tissu rnal normal aprs leur libration dans la circulation gnrale et se
diffrencient en cellule dendritiques (DCs). (c) dautre part, certains monocytes continuent dexprimer le CCR2 et
lexpression supplmentaire de CX3CR1low au niveau sanguin. (d) les monocytes ragissent avec un gradient de
chimiokines (e) produites par lendothlium et le tissu rnal ls suite une squence dI/R, ces monocytes
sinfiltrent dans le rein o elles se diffrencient en macrophages produisant de grandes quantits de cytokines
proinflammatoires impliques dans les lsions tissulaires (rf. 93).

Par la suite, linitiation de lattachement cellulaire leucocyte endothlium est


facilite par laugmentation de lexpression de P-slectine sur la paroi endothliale
qui interagit avec son contre-rcepteur des leucocytes la PSGL-1 (P-selectin
glycoprotein ligand 1). Cette adhsion transitoire de faible intensit, dont le but est de
ralentir les leucocytes, est suivie par une deuxime tape dadhsion ferme des
leucocytes contre la paroi endothliale (Fig. 15). Les leucocytes expriment
lintgrine 2 telle que CD11/CD18 qui interagit avec des molcules dadhsion telles
que lICAM-1/2 (intracellular adhesion molecule) et VCAM-1 (vascular cell adhesion
molecule), exprimes sur les cellules endothliales. En effet, lexpression de ICAM-1
augmente 1 h aprs une squence dI/R rnale et les souris dpourvues dICAM-1
94
sont protgs contre les lsions dI/R rnale . Finalement, la transmigration des
PARTIE (2) Physiopathologie de lischmie reperfusion et rponse immunitaire

leucocytes dans le compartiment interstitiel pritubulaire ncessite lintervention des


molcules dadhsion ICAM-1, PECAM-1 (platelet endothelial cell adhesion molecule
1) et la cadhrine exprimes le long des jonctions intercellulaires.

Par consquent, lendothlium, qui sert dinterface entre les cellules 53


immunitaires et le parenchyme rnal, est un tissu trs ractif impliqu dans la phase
prcoce de linflammation et des lsions rnales en favorisant linfiltration des
leucocytes.

1.1.2. pithlium tubulaire rnal :

Les cellules de lpithlium tubulaire contribuent linflammation et linstallation


des lsions rnales prcoces aprs une squence dI/R. La rponse immunitaire est
dclenche dans les reins post-ischmiques suite un afflux rapide des cellules
immunitaires arrives au niveau de lendothlium perturb de la rgion
endommage. Il a t dmontr que lI/R rnale induit une augmentation de
lexpression des molcules dadhsions sur lendothlium et des rcepteurs TLRs sur
lpithlium tubulaire rnal. Dans la phase prcoce, les facteurs solubles y compris le
systme du complment et des cytokines jouent un rle important dans la
pathogense de lsions rnales. Cette phase prcoce est caractrise par
linfiltration des cellules effectrices de limmunit impliques dans le dveloppement
des lsions rnales. (Fig. 17).

La membrane basolatrale des cellules tubulaires proximales exprime


linhibiteur du complment Crry (complement receptor 1related protein y). Aprs une
I/R rnale, Crry est internalise permettant le dpt du composant du complment 3
(C3) sur lpithlium tubulaire 95. De plus, il existe une activation du complment et la
production des chimiokines proinflammatoires MIP-2 (macrophage inflammatory
facteur 2) et kratinocytaires drives de chimiokine (KC) 96. Ces chimiokines attirent
les neutrophiles et les macrophages au rein post-ischmique.
PARTIE (2) Physiopathologie de lischmie reperfusion et rponse immunitaire

54

97
(rf. )

Figure 17. Comparaison entre un rein normal et un rein post-ischmique travers la prsence des cellules
inflammatoires dans le tissu.
Dans le rein normal, des cellules immunitaires rsidentes sont prsentes de faon normale dans le sang et dans
linterstitium intertubulaire avec une expression normale des TLRs sur lpithlium tubulaire. Dans le rein post-
ischmique, la rponse immunitaire la fois inne et adaptative est dclenche par un afflux rapide des cellules
immunitaires au niveau des vaisseaux perturbs par lischmie. Lexpression accrue des molcules dadhsion
sur lendothlium et des TLRs sur lpithlium tubulaire induit lapparition du phnomne no-reflow et favorise
linfiltration des cellules effectrices, telles que les neutrophiles, macrophages et les cellules NK cytotoxique
impliques dans la pathogense des lsions rnales aprs lI/R et dans le processus de rparation tissulaire.

En outre, lexpression des TLR 2 et 4 est augmente dans les cellules


pithliales aprs I/R. Plus tard, des tudes ont dmontr que la dficience du
rcepteur TLR-4 exprim sur les cellules parenchymateuses rnales protge le rein
contre les lsions dI/R. En revanche, le dficit de ces rcepteurs sur les cellules
98
drives de la moelle osseuse na pas cet effet rnoprotecteur . De plus, la
dficience des rcepteurs TLR-4 attnue la production des cytokines et des
chimiokines proinflammatoires induites par lI/R et inhibe linfiltration des
macrophages et neutrophiles 99.
Les molcules telles que la protine de haute mobilit du groupe B1 (HMGB1 :
high-mobility group B1), les protines de choc thermique (HSPs), fragments
dhyaluronane, dADN, dARN, et biglycane, sont libres partir des tissus
100
endommags . Ces ligands, ou DAMP activent les rcepteurs TLRs et conduisent
lactivation en aval des facteurs de transcription qui rgulent lexpression des
PARTIE (2) Physiopathologie de lischmie reperfusion et rponse immunitaire

gnes de survie ou des cytokines proinflammatoires et des chimiokines. Les TLRs


exprims sur les cellules endothliales et les cellules pithliales sont impliqus dans
les lsions dI/R rnales via les deux voies MyD88-dpendantes et indpendantes
101
.

55
1.1.3. Cellules dendritiques rnales rsidentes:

Les cellules DCs immatures sont prsentes pratiquement dans tous les tissus et
participent la surveillance immunitaire. Les DCs sont au carrefour entre limmunit
inne et adaptative, et leur rle dans les lsions rnales aigus a seulement t
102
tudi rcemment . Physiologiquement, les DCs sont les leucocytes les plus
abondants dans le rein de souris normale suggrant un rle important dans
103, 104
limmunit et de linflammation rnale . En effet, lors de la stimulation, les DCs
se dveloppent en cellules dendritiques matures caractrises par une prsence
abondante de complexes majeurs dhistocompatibilit de classe II (CMH II) leur
surface et des molcules stimulatrices.

Les DCs matures sont spcialises pour lactivation des cellules T. En outre, les
DCs peuvent galement initier la rponse immunitaire inne via la libration des
facteurs proinflammatoires, interagissant avec les cellules NKT via CD40-CD40L et
prsentant des glycolipides endognes par la molcule CD1d pour activer les
105
cellules iNKT . Les DCs jouent un rle dans les lsions dI/R rnales. Aprs lI/R,
les DCs rnales produisent cytokines proinflammatoires/chimiokines telles que
bTNF-, IL-6, MCP-1 et Chemokine (C-C motif) ligand 2 et 5. La dpltion des DCs
avant une squence dI/R rduit de manire significative les niveaux de production
106
de TNF- . Dans une tude, il a t mis en vidence que les cellules dendritiques
saccumulent dans les ganglions lymphatiques rnaux en rponse une lsion
ischmique rnale. Laccumulation des DCs induit une prolifration des lymphocytes
T, ce qui suggre que les DCs du rein sont impliques dans la rponse immunitaire
adaptative induite par une lsion ischmique rnale 107.
En rponse une lsion dI/R, les cytokines IL-12 et lIL-23 sont principalement
produites partir des cellules DCs et macrophages intrarnaux activs. Leurs
cytokines, en aval, IFN-y et lIL-17, amplifient la rponse immunitaire par lactivation
des macrophages et le recrutement de neutrophiles au niveau du tissu rnal
endommag (Fig. 18).
PARTIE (2) Physiopathologie de lischmie reperfusion et rponse immunitaire

56

108
(Modifier partir rf. )

Figure 18. Schma de linteraction entre les cellules dendritiques, les leucocytes
polymorphonuclaires (PMN) particulirement les neutrophiles, et les cellules NKT.
Cette interaction est caractrise par lactivation des axes IL-12/IFN-y et IL-23/IL-17 dans la rponse
immunitaire inne induite par lI/R rnale. Les cellules DCs rsidentes au niveau rnal initient la rponse
immunitaire aprs lI/R rnale par la scrtion de lIL-12 et lIL-23. LIL-12 active les cellules NKT qui
produisent lIFN-y. LIFN-y produit par les NKT et lIL-23 secrte par les DCs induit linfiltration des PMN
qui secrtent leur tour IL-17. IL-17 recrute la fois les NKT et PMN afin de scrter lIFN-y qui
contribue aux lsions dischmie reperfusion rnale.

1.1.4. Cellules non rsidentes drives de moelle osseuse:

Les cellules non rsidentes sont des cellules drives de la moelle osseuse.
68, 109, 110 111, 112
Parmi ces cellules, on trouve les neutrophiles , macrophages , les
113, 114 115 105
cellules NK , les lymphocytes T et les cellules NKT . Pendant la
reperfusion, ces cellules infiltrent le rein rapidement, en rponse aux signaux
provenant des cellules rsidantes au niveau rnal et dans un profil temporel distinct
93
. Dans la partie suivante, un bref rsum explique le rle de ces leucocytes dans la
pathogense de lI/R rnale.

1.1.4.1. Neutrophiles :

Les neutrophiles sont des mdiateurs importants de limmunit inne, dots


dune rponse rapide lors des lsions inflammatoires. Les neutrophiles librent des
granules contenant protases et dautres enzymes qui gnrent des radicaux libres.
Dans les tats inflammatoires, la dgranulation des neutrophiles peut conduire une
autodestruction des cellules normales dans le tissu enflamm 87.
PARTIE (2) Physiopathologie de lischmie reperfusion et rponse immunitaire

Le recrutement et la migration trans-endothliale des neutrophiles dans les


veinules capillaires sont un vnement cl dans la rponse inflammatoire contre les
dommages des tissus. Linfiltration de ces leucocytes se produit dans les reins
82
ischmiques dans les quelques heures suivant la reperfusion . Ladhsion des 57
94
neutrophiles lendothlium vasculaire et leur infiltration dans le rein post-
ischmique sont des processus cruciaux dans linitiation des dommages tissulaires
105, 108
. IL-8 joue un rle important dans le recrutement des neutrophiles et linduction
des lsions tissulaires via des cytokines, des radicaux libres et des protases 116. Les
neutrophiles aggravent les lsions ischmiques par : (1) lobstruction des capillaires
(phnomne no-reflow) (2) la libration des cytokines inflammatoires, y compris
lIFN-g et IL-17, et (3) la perturbation des barrires endothliales et pithliales au
117
cours de leur transmigration dans le compartiment interstitiel . La dpltion des
neutrophiles, ainsi que le blocage de la transmigration des neutrophiles vers le rein,
94
peut amliorer la protection des tissus contre les lsions rnales aigus , bien que
certaines tudes aient chou dmontrer cet effet rnoprotecteur 82.

1.1.4.2. Macrophages :

118, 119
Dans le sang, les macrophages sont des drivs de monocytes et
dsigns par leur rle en tant que phagocytes. La diversit fonctionnelle des
macrophages a conduit plusieurs systmes de classification. Deux phnotypes
bien dfinis sont communment appels des macrophages comme classiquement
activs (macrophages M1). Ce phnotype est produit par lexposition aux LPS
(Lipopolysaccharides) lIFN- ou aux TNF-. Un autre phnotype des macrophages
alternativement activs (macrophages M2) est produit par des cytokines de Th2
(T auxiliaire 2) comme IL-4, IL-10 et IL-13 112, 120. la suite de lI/R, les macrophages
semblent participer aux stades prcoces des lsions, ainsi que dans le processus de
121
rparation plus tardivement . Les macrophages infiltrent le rein ls peu aprs
lischmie ( moins de 1 h de reperfusion), et cette infiltration est mdie par les
92, 93
voies de signalisation CCR2 et CX3CR1 . Des travaux ont montr que la
dpltion des macrophages des reins et de la rate, en utilisant du clodronate
liposomes (une molcule provoque lapoptose des macrophages) avant lischmie
rnale, a empch lapparition des lsions rnales aigus. Par contre, la
PARTIE (2) Physiopathologie de lischmie reperfusion et rponse immunitaire

reconstitution des stocks macrophagiques, chez des souris dpourvues de


115
macrophage induit ces lsions rnales aigus . Il a t rcemment rapport que
laccumulation de neutrophiles est contrle par les macrophages vasculaires
rsidents (CD169) aprs ischmie rnale 122.
Labondance accrue de lIFN-, produite partir les cellules NKT, les 58
neutrophiles et les cellules T effectrices (principalement Th1/17) stimule lactivation
des macrophages au dbut de lI/R 108, 112 (Fig. 19).

112
(rf. )

Figure 19. Schma du changement phnotypique des macrophages pendant la progression des
maladies rnales aigus.
La lsion rnale aigu dclenche le recrutement des neutrophiles et des cellules tueuses naturelles (NK)
en quelques heures aprs le dbut des lsions tissulaires. Les monocytes inflammatoires sinfiltrent sur le
site de lsion o ils se diffrencient en macrophages proinflammatoires (M1) et polariss par lIFN-y
libr par les neutrophiles, NK et les cellules lymphocytes T effectrices (Th1/17). Les macrophages M1
actives peuvent exacerber des lsions tissulaires importantes. Par la suite, les Th2 et T-reg sont
recrutes dans le rein et rgulent la rponse immunitaire. Induisant une orientation phnotypique des
macrophages proinflammatoires M1 vers des macrophages antiinflammatoires M2 qui prdominent ce
stade. Les M2 contribuent la rsolution de linflammation et la rparation des tissus. La fibrose peut se
produire, en fonction de la gravit des blessures et si les facteurs pathognes continuent sexprimer.

De plus, les macrophages produisent des cytokines proinflammatoires telles que


lIL-1, lIL-6, lIL-12, le MCP-1 et le TNF- qui peuvent stimuler lactivit dautres
93
leucocytes . Une tude a rvl lexpression protique de lIL-6 dans les
macrophages interstitiels de la mdullaire externe du rein 4 h aprs la reperfusion
123
. La cintique de lexpression gnique de lIL-6 a atteint un pic dexpression
prcoce 4 h aprs la reperfusion. Ce pic dIL-6 est suivi par lexpression de TNF-,
lIL-1 et de MCP-1 qui atteint un pic 24 h post-ischmie 124.
PARTIE (2) Physiopathologie de lischmie reperfusion et rponse immunitaire

1.1.4.3. Tueuses naturelles: Natural Killer (NK)

Rcemment, il a t montr que les cellules NK peuvent infiltrer le rein post-


113
ischmique aprs 4 heures de reperfusion . LI/R induit lexpression dun ligand
dactivation NK (Rae-1) sur les cellules pithliales tubulaires (TECs). Les tudes 59
in vitro ont dmontr que linteraction du rcepteur NKG2D sur les cellules NK avec
Rae-1 sur TECs provoque la lyse des cellules rnales cultives via la voie perforine-
dpendante. La dpltion de cellule NK est protectrice contre les lsions dI/R chez
les souris de type sauvage (WT). En revanche, le transfert des cellules NK dans des
souris dficientes en cellules T, B et NK, induit les lsions dI/R 113.

1.1.4.4. Lymphocytes (T et B) :

Les lymphocytes sont les principaux mdiateurs de limmunit adaptative. La


prsentation de lantigne par des cellules prsentatrices de lantigne (CPA), et en
prsence dune costimulation suffisante, provoque lexpansion et lactivation des
lymphocytes T avec un rcepteur de lymphocyte T (TCR) spcifique de lantigne
prsent. Les lymphocytes B ne ncessitent pas de prsentation de lantigne; au
contraire, ils reconnaissent les antignes solubles quils endocytent et prsentent aux
cellules T avec un TCR spcifique pour le mme antigne. Linteraction de la cellule
B et T stimule la cellule B pour produire des anticorps spcifiques. Certains
antignes peuvent nanmoins induire la production danticorps en labsence de
participation des lymphocytes T 125.
Il a t dmontr, dans un modle in vitro, que lexposition des cellules pithliales
tubulaires rnales 2 h dhypoxie suivie de 1 h de roxygnation augmente
ladhsion des cellules T de plus de deux fois. Cela suggre que les lymphocytes T
participent galement la lsion ischmique rnale. Ladhsion des lymphocytes T
des cellules tubulaires rnales est une tape critique qui reprsente un
dysfonctionnement tubulaire post-ischmique 126.
Le rle des lymphocytes T dans la pathogense des lsions dI/R rnales a t
tabli dans des modles diffrents de souris dficientes de certains types de
115, 127
lymphocytes . Il a t dmontr que les lsions dI/R, mesures par les taux de
cratinine srique et lhistologie rnale, ont t rduites chez les souris nu/nu
125
(dpourvues de cellules T CD4 et T CD8) et les souris avec une dpltion des
128
T CD4 (GK1.5 mAb) . Le transfert des cellules T CD4 seul (mais pas les cellules
PARTIE (2) Physiopathologie de lischmie reperfusion et rponse immunitaire

T CD8) des souris nu/nu, a restaur les lsions rnales aprs I/R. En outre, les
souris Knock-out (KO) en rcepteur Rag-1 (manquant la fois des cellules T et B)
129
sont galement protges contre les lsions dIR rnale , alors que dautres
130
tudes nont pas montr cette protection . La reconstitution des souris WT par des
lymphocytes T (CD4) restaure les lsions dI/R. Il est important de noter que le 60
transfert des lymphocytes T (CD4) des souris dficientes en IFN- na pas russi
115
protger contre les lsions rnales dans ce modle . Ces rsultats suggrent que
les lymphocytes T (CD4), et en particulier lIFN- produit par ces cellules, jouent un
rle dans la phase prcoce des lsions dI/R rnale.
Les lymphocytes sont galement importants pour la rparation tubulaire aprs
une lsion ischmique. Les cellules B migrent vers le rein ischmique et se
diffrencient en cellules plasmatiques, ce qui limite la rgnration tubulaire aprs
une lsion rnale aigu. Conformment ces donnes, les souris dficientes en
131
cellules B sont protges contre une lsion ischmique rnale . Cependant, le
transfert adoptif de lymphocytes B purifis dans ces souris ne rpare pas les lsions
rnales aprs une ischmie 132.

1.1.4.5. Invariantes tueuses naturelles T (iNKT) :

Les cellules T tueuses naturelles (NKT) prsentent les caractristiques des


cellules du systme immunitaire inn et adaptatif. Elles ont t initialement identifies
comme des cellules qui expriment des rcepteurs de surface et des proprits
fonctionnelles partages avec des cellules T CD4 conventionnelles et les cellules
133
NK . Les cellules NKT expriment le NK1.1 chez la souris (quivalent chez
134
lhomme : CD161) qui est un marqueur pour les cellules NK, une population
cellulaire implique dans limmunit inne. Les NKT expriment galement le
rcepteur (/) TCR pour les cellules T CD4, caractristique des cellules
immunitaires adaptatives.
Les cellules iNKT (NKT invariante) ou cellules NKT de type 1 expriment des
rcepteurs TCR avec une chane TCR- invariante encode par le
135
rarrangement V14-J18 . Cette chane TCR- est plus souvent coexprime
avec la chane TCR- : V8.2, V7, V2 chez la souris. Chez lhomme, le TCR des
cellules iNKT est un V24-J18 coexprime avec la chane TCR- : V11. Les
chanes TCR- invariantes humaine et murine sont des vritables homologues, ainsi
que la chane TCR- : V11 humaine et V8 de la souris. En consquence, la
PARTIE (2) Physiopathologie de lischmie reperfusion et rponse immunitaire

136
spcificit des cellules iNKT humaine et murine est hautement conserve .
Contrairement aux cellules T CD4 conventionnelles qui reconnaissent, via leur TCR,
des peptides lis des molcules du CMH-I et II, le TCR des cellules iNKT reconnat
les antignes glycolipidiques endognes, lis une molcule CD1d des cellules
prsentatrices dantigne (CPA) 135. 61
Aprs leur activation, les cellules iNKT sont capables de produire rapidement de
grandes quantits de granules cytotoxiques et de cytokines, orientant vers une
rponse immunitaire de type Th1 (IFN-, le TNF-) et de type Th2 (IL-4, IL-13), en
mme temps. Ces cytokines sont produites dans les 1-2 heures suivant lactivation
des cellules iNKT (Fig. 20).

Figure 20. Schma qui prsente la cellule iNKT (invariant natural killer T) et ses proprits
typiques des cellules du systme immunitaire inn.
En dpit du fait quelle exprime un rcepteur TCR des cellules T, elle a galement la fonction
137
cytotoxique des cellules NK (Rf. ).

Les cellules NKT de type II reconnaissent aussi le CD1d. Cependant, la chane


TCR- nest pas trs restreinte dans sa diversit. Par consquent, ce type de NKT a
t beaucoup moins tudi vu quils ne disposent pas dune seule spcificit 138.
Il a t dmontr que lactivation des cellules iNKT (type I), produisant lIFN-
105
dans le rein, est significativement augmente aprs 3 heures de reperfusion .
Linactivation des cellules NKT (par un anti-CD1d [mAbs]), la dpltion des cellules
NKT (avec un anticorps anti-NK1.1 [mAbs]) chez les souris WT, ou lutilisation de
souris dficientes en cellules iNKT (J18 -/-) inhibent la production de lIFN- et
linfiltration de neutrophiles. Ceux-ci protgent le rein contre les lsions dI/R 105.
En revanche, une autre investigation a montr que ltendue de lapoptose et la
ncrose tubulaire aigu tait majore chez les souris dficiente en iNKT (J18 -/-)
139
. Les deux tudes avaient appliqu 30 minutes dischmie suivie par une
reperfusion dans un modle dI/R rnale chez la souris. Ltendue de la lsion rnale
PARTIE (2) Physiopathologie de lischmie reperfusion et rponse immunitaire

peut avoir entran des diffrentes rponses des cellules iNKT. En effet, ltendue de
la lsion est directement proportionnelle la quantit de signaux de danger libre
aprs une lsion dI/R.
Le sulfatide (self-glycolipid 3-sulfated galactosylceramide), libr aprs lI/R
rnale, peut activer les cellules NKT (type II) via son rcepteur TCR. Dans ltude de 62
139
Yang et coll , les auteurs ont dmontr lexistence dune interaction cruciale entre
iNKT et les NKT (type II) dans les lsions rnales dI/R. Labsence des cellules iNKT
a donn lieu un phnotype dont la fonction Th1 est dominante (augmentation de
lIL-6, TGF-, la rduction de l'IL-10 et IL-13) en aggravant la ncrose tubulaire et
lapoptose aprs lI/R.

Or, le transfert de cellules NKT (type II) traites par le sulfatide chez des souris
dpourvus du gne J18, a donn un phnotype dominant Th2 chez ces
souris (amlioration de lexpression de lIL-4, IL-10 et IL-13 tandis que lexpression
dIL-6, MCP-1 et TGF- ont t supprimes). Finalement, malgr les diffrents
rsultats obtenus, les deux groupes ont montr que les cellules iNKT, associes un
phnotype Th2 dominant, ont un effet nphroprotecteur contre les lsions rnales
dI/R (Fig. 21).

Figure 21. Schma de la rponse inflammatoire mdie par les cellules iNKT aprs lI/R.
Les signaux de danger ou DAMPs sont librs partir des lsions tissulaires de lI/R. A leur tour, les DAMPs de
nature glycolipidique sont prsents aux cellules iNKT travers le CD1d, un rcepteur des cellules T (TCR). En
parallle, les DAMPs sont galement reconnus par les TLRs. Lactivation des TLRs entrane un changement de
phnotype de liNKT en Th1 dominante. Ce phnotype est caractris par la libration des cytokines
proinflammatoires (IFN-y et TNF-) favorisant linfiltration des neutrophiles ce qui provoque le stress
oxydant et la mort cellulaire par ncrose. Cependant, la costimulation des cellules NKT (type II) par les
sulfatide ou lactivation des cellules iNKT via ces rcepteurs TCR et le rcepteur ladnosine A2A (Adora2a),
PARTIE (2) Physiopathologie de lischmie reperfusion et rponse immunitaire

oriente la fonction diNKT vers un phnotype Th2 dominant. Les principales caractristiques de ce phnotype
sont la libration des cytokines IL-4, IL-10, IL-13 afin de rduire linfiltration des leucocytes dangereux, limiter
140
ltendue des lsions tissulaires induit par lI/R, et participer ainsi dans la phase de la rparation (rf. ).

Dans ce cadre, diffrents travaux ont t mis en place pour comprendre les
mcanismes, par lesquels la cellule iNKT fait son choix phnotypique (Th1 ou Th2), 63
un choix qui est li laggravation ou la protection tissulaire contre lI/R. Par
exemple au niveau hpatique, il a t dmontr que ladministration de lGC (alpha-
Galactosyl-Ceramide) induit lexpression de rcepteur de lAdnosine A2A.
Lactivation de ce dernier favorise lactivation des cellules iNKT de phnotype Th2
dominant, qui est corrle avec une baisse de la production IFN-y en exerant un
141
effet hpatoprotecteur vis--vis les lsions dI/R (Fig. 21). En outre, un rle de
HIF-2 a t voqu comme tant un modulateur de la rponse immunitaire des
cellules NKT aprs une squence dI/R rnale. Il sest avr que HIF-2 induit
lexpression des rcepteurs de ladnosine A2A sur les cellules NKT qui vont
acqurir un phnotype dominant Th2 et protge le rein contre les lsions dI/R 142.

1.2. La phase inflammatoire tardive dans les lsions rnales dI/R :

Compare la rponse immunitaire inne (prcoce), la rponse immunitaire


adaptative (tardive) induite par une I/R rnale est moins tudie. Cette rponse
adaptative est spcifique des antignes (agents pathognes ou dbris des cellules
apoptotiques). Elle se produit plusieurs jours aprs la squence ischmique et
comprend la maturation des DCs, la prsentation des antignes, et la prolifration et
lactivation des cellules lymphocytes T CD4 et CD8.

1.2.1. Cellules prsentatrices de lantigne (CPA):

Les leucocytes, tels que les DCs et les macrophages, jouent un rle cl dans
limmunit adaptative. Ces cellules produisent des cytokines proinflammatoires et
prsentant lantigne, bien que ce dernier processus ait reu peu dattention jusqu
143
rcemment . Comme indiqu plus haut, les DCs sont les leucocytes les plus
abondants dans le rein. Lors de la stimulation, les DCs peuvent se convertir en un
type de cellule mature caractrise par des niveaux levs de CMH classe II et des
molcules co-stimulatrices, dotes dune faible capacit de phagocytose. Aprs une
I/R rnale, les DCs subissent un processus de maturation, migrent vers les ganglions
PARTIE (2) Physiopathologie de lischmie reperfusion et rponse immunitaire

lymphatiques qui drainent le rein, induisant la prolifration des cellules


107
lymphocytaires T de manire spcifique lantigne . Il a t dmontr que le
transfert des DCs chez des souris sauvages active la voie Th1/IFN-. Alors que le
transfert des DCs dpourvues en rcepteurs S1P3 (sphingosine 1 -phosphate3) qui
empche la maturation de DCs, favorise lactivation de la voie Th2/IL-4 et attnue les 64
144
lsions dI/R rnale . Cela montre limplication des DCs rnales dans la rponse
immunitaire adaptative induite par lI/R.

1.2.2. Macrophages :

Compte tenu de leur phnotype diversifi, les macrophages semblent jouer un


rle lors du stade prcoce des lsions dI/R, et dans le processus de rparation au
stade tardif. Lors de lactivation, les macrophages alternatifs (M2) produisent des
cytokines anti-inflammatoires comme lIL-10 et TGF-. Les M2 activs augmentent
120
galement la production de la matrice , ce qui suggre une possibilit de leur
145
participation dans la rparation tissulaire . En effet, il a t dmontr que la
dpltion des macrophages durant la priode de la rparation rnale est associe
avec la prolongation de linflammation, laltration de la prolifration des cellules
tubulaires et retardement de la rparation du tissu ls 146.
Les cellules T effectrices (Th2) et les T-rgulatrices (T-reg) sont recrutes dans le
rein et rgulent les rponses immunitaires. Labsorption des cellules apoptotiques, et
la production des cytokines anti-inflammatoires telles que lIL-4 et lIL-10 favorisent la
polarisation des macrophages vers un phnotype (M2) anti-inflammatoire. Les
macrophages M2 prdominent ce stade tardif et contribuent la rsolution de
linflammation et la rparation des tissus. La fibrose peut se produire, en fonction de
la gravit des blessures et si les facteurs pathognes continuent sexprimer
(Fig. 19).
Lactivation des macrophages (M2) favorise la scrtion des facteurs trophiques
tels que Wnt7b, lhme-oxygnase-1 (HO-1), et la protine chitinase comme BRP-39
147
(breast regression protein 39) durant la phase de rparation. En outre, la
galectine-3 et TGF-, produites par les macrophages M2, favorisent directement la
fibrose rnale (Fig. 22). Jusqu maintenant, Lexistence des macrophages
fibrolytiques na pas encore t dmontre.
PARTIE (2) Physiopathologie de lischmie reperfusion et rponse immunitaire

65

112
(rf. )
Figure 22. Schma du rle des macrophages (M1 et M2) dans la rgulation de lquilibre des lsions
rnales, inflammation, la rparation tissulaire et la fibrose.

1.2.3. Lymphocytes T:

Les lymphocytes T sont les principaux mdiateurs de limmunit adaptative. Dans


le processus de dveloppement des cellules T, les cellules prognitrices lymphodes
migrent de la moelle osseuse vers le thymus o elles acquirent une activit
fonctionnelle et se diffrencient en cellules T CD4 et CD8. Ces cellules matures
migrent, par la suite, vers les tissus lymphodes priphriques.
Des tudes avaient dmontr que les cellules T (avec le divers rpertoire des
cellules T) induites des lsions dI/R plus importantes que les cellules T dpourvues
de leurs rcepteurs TCR. Lactivation des rcepteurs de cellules T (TCR), par
lintermdiaire dun mcanisme dantigne-dpendant, est implique dans la
143
pathogense dI/R rnale . Aussi, les souris dficientes en TCR / et TCR /
127
sont t partiellement protges contre les lsions dI/R . Cependant, la dpltion
de cellules T CD4, circulantes en priphrique, nest pas suffisante pour protger
contre les lsions ischmiques observes en insuffisance rnale aigu 148. Une tude
a dmontr que les cellules T effectrices (CD4CD69 et CD8CD69) et les cellules
T mmoire (CD4CD44hiCD62L et CD8CD44hiCD62L) sont infiltres et actives
149
dans le rein 2 et 6 semaines aprs lischmie . Toutefois, la dpltion totale des
lymphocytes T partir du troisime jour aprs lischmie, na eu aucun effet
149
protecteur contre les lsions corticales et mdullaires, 6 semaines aprs lI/R .
Donc, ce moment, le rle pathognique de lactivation tardive du TCR na pas t
dmontr de faon concluante.
PARTIE (2) Physiopathologie de lischmie reperfusion et rponse immunitaire

1.2.4. T rgulatrices :

Les cellules T rgulatrices (T-reg) sont des lymphocytes ayant des proprits
immunosuppressives. Une partie importante de cellules T-reg expriment CD4 et
150
66
CD25 sur la surface cellulaire et le facteur de transcription FoxP3 . Les cellules
T-reg induisent la suppression de linflammation par la production de cytokines anti-
151
inflammatoires comme lIL-10 ou TGF- . Elles ont t galement reconnues pour
favoriser la rparation tubulaire, ventuellement par lintermdiaire de la modulation
de la production de cytokines proinflammatoires des autres lymphocytes T aprs une
lsion rnale aigu 152.
Laugmentation de linfiltration des cellules T-reg dans les reins a t observe
aprs une lsion ischmique. Cette infiltration est suivie par une production rduite
153
dIFN- avec une rparation rnale amliore . En revanche, la dpltion partielle
de T-reg (avec un anticorps anti-CD25) potentialise les lsions rnales induites par
lischmie. Ces lsions sont dues linfiltration de plus des neutrophiles, des
macrophages et la transcription des cytokines de limmunit inne dans le rein ls
154, 155
. Les souris dficientes en cellules T-reg avaient une plus grande infiltration
des leucocytes inflammatoires aprs une ischmie rnale compare aux souris
contenant les cellules T-reg 153.

1.3. La rparation des lsions tubulaires :

la suite dune lsion rnale aigu, la rparation tissulaire peut rsulter de la


prolifration des cellules pithliales adjacentes ddiffrencies et/ou de la
mobilisation des cellules souches matures spcifiques de rein. Ces cellules souches
matures sont des cellules msenchymateuses ou hmatopotiques drives de la
moelle osseuse qui accdent lpithlium ls et o elles se diffrencient en
156
cellules matures . Les cellules tubulaires comprennent des cellules pithliales
matures pluripotentes avec une remarquable capacit de se rgnrer et de
prolifrer aprs une lsion rnale aigu. Aprs une squence ischmique, les
cellules tubulaires survivantes, qui ont chapp de la lsion, perdent rapidement les
proprits des cellules pithliales et acquirent un phnotype msenchymateux. De
plus, les cellules ddiffrencies migrent dans les rgions o la ncrose, lapoptose,
PARTIE (2) Physiopathologie de lischmie reperfusion et rponse immunitaire

ou le dtachement cellulaire a donn lieu la dnudation de la membrane basale


tubulaire. Elles prolifrent, et ventuellement, se diffrencient en cellules pithliales
matures avec lumire polarise, afin dachever le processus de rparation et de
remplacer le tissu endommag 109.
Le processus de restauration et de la maturation de lpithlium endommag 67
aprs une lsion rnale a de nombreux parallles avec le processus de
dveloppement au cours de lorganogense rnale. En effet, les facteurs solubles
impliqus dans le dveloppement du rein ont t identifis pour rguler la rparation
rnale en tant que des facteurs potentiels rnotrophiques. Ces facteurs se sont
avrs tre des agents mitognes des cellules pithliales pour induire la
prolifration cellulaire aprs une lsion tubulaire. De plus, diverses populations de
cellules prognitrices et immunitaires (pro/antiinflammatoires) ainsi que les
interactions cellule-cellule ont t rvls tre troitement impliques dans la
rgnration tubulaire aprs une lsion rnale aigu (Fig. 23).

102
(rf. )
Figure 23. Diffrents types cellulaires impliques dans la rgnration tubulaire aprs
la lsion tissulaire.
PARTIE (2) Physiopathologie de lischmie reperfusion et rponse immunitaire

Morphologiquement, la rparation est annonce par lapparition de cellules


pithliales ddiffrencies qui expriment la vimentine, un marqueur pour les cellules
157 68
msenchymateuses multipotentes . Lorigine de ces cellules reste controverse. Il
a t mis en vidence que ce sont des cellules souches rsidentes (nommes LRCs
: Label-retaining cells) capables de se prolifrer (le BrdU a t incorpor dans lADN
lors de sa synthse), mais dont le renouvellement est lent. Ces LRCs sont localises
principalent dans les tubules proximaux, et un moindre degr dans les canaux
collecteurs, et un trs faible degr dans la branche large ascendante des anses de
Henl et les tubules distaux. Cependant, les LRCs sont absentes dans les
glomrules et les vaisseaux 158.

Dans la phase suivante, les cellules ddiffrencies rgulent positivement des


gnes qui codent pour une varit de facteurs de croissance, tels que lIGF-1, le
facteur de croissance des hpatocytes (HGF) et le facteur de croissance des
fibroblastes, et subissent une prolifration marque. Dans la phase finale, les cellules
expriment des facteurs de diffrenciation, tels que les molcules dadhsion cellulaire
neuronales (NCAM : neural cell adhesion molecule) et lostopontine, puis subissent
une rediffrenciation jusquau rtablissement de la polarisation complte de
lpithlium. Par consquent, lors de la rcupration dune ischmie, les cellules du
tubule rnal rcapitulent les phases et les procds qui sont trs semblables celles
au cours du dveloppement rnal normal 157, 68.

Finalement, lidentification de la source de cellules msenchymateuses


multipotentes et la comprhension des mcanismes molculaires qui sont impliqus
dans les processus de rgnration et de rparation tubulaire peuvent avoir des
implications thrapeutiques importantes. Dans cette optique, des investigations ont
t mises en place afin dutiliser des progniteurs exognes, savoir les cellules
souches msenchymateuses drives de la moelle osseuse qui pourront acclrer la
rparation tubulaire aprs une lsion rnale aigu.
PARTIE (2) Physiopathologie de lischmie reperfusion et rponse immunitaire

2. Actions proinflammatoires et antiinflammatoires de HIFs :

En rponse une squence ischmique, les cellules immunitaires sont


recrutes vers les sites dinflammation. Au cours de cet vnement, ces cellules 69
subissent une chute spectaculaire des niveaux doxygne locaux comme elles
migrent dun flux sanguin riche en oxygne vers le site de linflammation relativement
159
hypoxique . Par consquent, lexposition brutale et profonde de ces cellules
inflammatoires un environnement hypoxique influe gnralement sur la rgulation
de rponse du systme immunitaire. Il est rcemment mis en vidence que cette
baisse de la concentration doxygne conduit lactivation des HIFs dans les cellules
immunitaires. Cet vnement a une norme rpercussion sur leur survie par le biais
de la rgulation des gnes dadaptation et de survie 160.

La dpltion conditionnelle de HIF- dans les lymphocytes T, les cellules B, les


neutrophiles, les macrophages et les cellules dendritiques ont t gnrs et dans
chaque cas, la perte de HIF- a t dmontre ayant un impact profond sur la
fonction immunitaire. En effet, des travaux ont mis en vidence que HIF- joue un
161, 162
rle actif dans la rgulation de la survie et la fonction des neutrophiles , des
163, 164
cellules dendritiques , la survie, la fonction et la diffrenciation des monocytes/
macrophages 165-168, la fonction des cellules NKT 142 et la diffrenciation et la fonction
169, 170
des cellules T . En outre, il a t dmontr que HIF- aurait une fonction anti-
inflammatoire importante implique dans lamlioration de la fonction de la barrire
pithliale intestinale (Fig. 24) rebours des fonctions antiinflammatoires/
proinflammatoire dcrites prcdemment.
PARTIE (2) Physiopathologie de lischmie reperfusion et rponse immunitaire

70

Figure 24. Laction proinflammatoire et antiinflammatoire de HIFs.


Cette action est dpendante du type cellulaire : cellules du systme immunitaire inn ou adaptatif,
cellules dendritiques ou pithliales (rf. 171).

2.1. HIFs et limmunit inne :

Linitiation de la dfense contre les agents pathognes repose sur lactivation des
neutrophiles, des macrophages, des mastocytes, des cellules dendritiques et les
cellules tueuses naturelles. Ces cellules du systme immunitaire inn peuvent
liminer rapidement les agents pathognes et transmettre des signaux qui amplifient
la rponse immunitaire adaptative 172.

Les cellules mylodes ont une voie de fonctionnement HIF-dpendante dans les
160
conditions dpourvues doxygne du microenvironnement hypoxique . Le
dveloppement et la diffrenciation des monocytes et neutrophiles ne sont pas
affects par la dpltion spcifique de HIF-1 dans la ligne mylode. En revanche,
les cellules mylodes, dj diffrencies, dficientes en HIF-1 ont montr une
160, 173
rponse inflammatoire affaiblie . En effet, la relation entre les rponses
hypoxiques et inflammatoires est troitement contrle (Fig. 25). HIF-1 rgule
159
plusieurs fonctions des cellules mylodes . Il permet aux cellules mylodes
160
gnrer lATP dans les tissus inflamms dpourvus en oxygne . Lhypoxie et les
PARTIE (2) Physiopathologie de lischmie reperfusion et rponse immunitaire

infections bactriennes se traduisent par une augmentation de lactivit du facteur


nuclaire (NF-kB) dans les cellules phagocytaires, qui induit son tour la
174
transcription ARNm de HIF-1 . HIF-1 stimule ainsi lagrgation, la motilit,
173
linvasion et lactivit bactricide des cellules mylodes . De plus, il a t
dmontr que les patients atteints la maladie de von Hippel- Lindau (une mutation 71
dans un allle VHL avec une absence dune protine von Hippel- Lindau [pVHL]
fonctionnelle), prsentent des neutrophiles caractriss par la rduction de
lapoptose et lamlioration de la phagocytose des bactries dans des conditions
175
normoxiques . La stabilisation de HIF-1 prolonge galement la migration et la
dure de vie des neutrophiles dans des conditions hypoxiques en inhibant la mort
cellulaire par apoptose 161.

Figure 25. Voie hypoxique et limmunit inne.


HIF-1 et NF-kB rgulent les fonctions inflammatoires essentielles dans les cellules mylodes. HIF-1
augmente lagrgation, linvasion et la motilit des macrophages et induit lexpression des cytokines
pro-inflammatoires (TNF-, IL-6). HIF-1 augmente galement la migration et la survie des
neutrophiles par linhibition de lapoptose (rf. 35).

HIF-2 rgule galement les fonctions inflammatoires essentielles des cellules


immunitaires. Les souris dpourvues HIF-2 dans les cellules mylodes ne
parviennent pas produire une rponse inflammatoire lors dune stimulation par LPS
(lipopolysaccharides). Cela est d une altration de la production du facteur de
ncrose tumorale-a (TNF-a), d'interfron- (IFN-), dIL-12 et dIL-1b. Par contre,
176
HIF-2 naltre pas lexpression du marqueur de lactivation des macrophages .
161
Bien que cette tude et autre ne parviennent pas dtecter lARNm ou la
protine HIF-2 dans les neutrophiles drivs de la moelle osseuse, une publication
rcente a mis en vidence que lhypoxie, linhibition de lhydroxylase, et les bactries
peuvent induire lexpression de HIF-2 dans les neutrophiles du sang priphrique
humains et murins. Les souris, dont les neutrophiles inflammatoires dpourvus en
PARTIE (2) Physiopathologie de lischmie reperfusion et rponse immunitaire

HIF-2, ont montr une augmentation accrue de lapoptose des neutrophiles, ce qui
entrane une rduction de linflammation et une lsion tissulaire rduite 162.
Trs rcemment, il a t dmontr quune dpltion de HIF-2 dans les cellules
NKT induit une augmentation de lexpression du ligand FasL sur les cellules NKT de
priphrique. De plus, la dficience en HIF-2 favorise linfiltration des cellules NKT 72
dans les reins ischmiques. Lactivation des NKT exacerbe les lsions dI/R.
Cependant, lhypoxie induit lexpression du rcepteur Adroa2a (adnosine A2A) sur
les cellules NKT via HIF-2. Ce mcanisme limite lactivit cytotoxique des cellules
NKT (rduit de lexpression de FasL) lorsquils sont confronts un stress oxydatif et
protge ainsi contre les lsions dI/R rnales 142.

2.2. HIFs et limmunit adaptative :

177
HIF-1 influe galement sur limmunit adaptative . La diffrenciation et la
maturation des cellules prognitrices lymphodes en cellules T CD4 et CD8 sont
effectues dans le thymus, un organe connu pour tre hypoxique dans des
178
conditions physiologiques . Contrairement leffet de la dpltion de VHL dans les
cellules mylodes, qui naffecte pas le dveloppement des neutrophiles et
160
monocytes , la dpltion supplmentaire de HIF-1 un dficit de VHL dans les
thymocytes restaure le dveloppement des thymocytes et empche lapoptose
179
excessive de ces cellules . Cela suggre un rle troitement li la voie de
lhypoxie (HIF-1) dans le dveloppement des lymphocytes.

Compte tenu du rle de HIF-1 en rponse lactivation des lymphocytes T et


dans la rgulation du mtabolisme glycolytique, plusieurs groupes ont rcemment
tudi la fonction potentielle de HIF-1 dans les rponses immunitaires adaptatives.
Tandis que le rle de HIF-2 dans les cellules immunitaires est actuellement moins
bien compris.
PARTIE (2) Physiopathologie de lischmie reperfusion et rponse immunitaire

Comment lactivit de HIFs impact lactivation et la diffrenciation des


lymphocytes T est un sujet dactualit. Il est maintenant admis que les changements
dans lactivit mtabolique, non seulement accompagnent lexpansion spectaculaire
et lacquisition de la fonction effectrice entrane par la reconnaissance de lantigne,
mais peuvent galement tre impliqus dans les dcisions de la diffrenciation de 73
35
ces cellules effectrices . Laugmentation de la production de HIF-1 dans les
lymphocytes T induit le passage dun phnotype lymphocyte T auxiliaires de type 1
(Th1), qui amliore les fonctions des macrophages et des lymphocytes T
cytotoxiques, un phnotype lymphocyte T auxiliaires type 2 (Th2), qui inhibe
laction antimicrobienne de Th1 par laugmentation de la production dIL-10 et une
180
diminution des niveaux dIFN- . De plus, les cellules proinflammatoires Th1 et
Th17, gnres in vitro, sont caractrises par une augmentation de la glycolyse et
une baisse de la phosphorylation oxydative (OXPHOS). En revanche, les cellules
T-reg ont montr une plus grande dpendance de loxydation des lipides et OXPHOS
181, 182
. Conformment au rle de HIFs dans la rgulation de la glycolyse, HIF-1
rgule lquilibre de la diffrenciation entre les cellules Th17 et les T-reg (Fig. 26).

35
(Rf. )
Figure 26. Voie hypoxique et limmunit adaptative (Diffrenciation et fonction des
cellules T).
PARTIE (2) Physiopathologie de lischmie reperfusion et rponse immunitaire

En effet, il a t dmontr que HIF-1 est fortement exprim par les


169
cellules Th17 . La dpltion de HIF-1a dans les cellules T altre la diffrenciation
182
des cellules produisant des Th17 (CD4) in vitro . Inversement, lhypoxie et la
suppression de VHL favorisent la stabilisation de HIF-1a, et peuvent amliorer la
gnration des cellules Th17 (CD4) 183. 74

HIF-1 amliore le dveloppement de Th17 grce lactivation de la transcription


directe de RORt (RAR-related orphan receptor t). Ce rcepteur nuclaire forme un
complexe avec le p300 au niveau du promoteur de lIL-17, rgulant ainsi lexpression
de son gne cible (IL-17) qui favorise la diffrenciation des Th17 (Fig. 26).
Paralllement, HIF-1 attnue le dveloppement des cellules T-reg par sa liaison
avec la protine Foxp3. La formation de ce complexe (HIF-1/Foxp3) induit la
169
dgradation de HIF-1 par les protasomes . Cependant, dans des conditions
favorisant linduction des cellules T-reg, HIF-1 peut amliorer lexpression de
lARNm FOXP3 et la prolifration des cellules T-reg 184. Linduction de la fonction des
185
T-reg renforce linhibition des lymphocytes T via laugmentation de lexpression
186
extracellulaire du rcepteur adnosine A2A (adora2a) , ce qui limite les fonctions
effectrices de cellules T et protge les tissus 187.

En outre, HIF-1 peut galement rguler ladaptation mtabolique dans les


cellules T cytolytique CD8 (T cytotoxiques) et contrler lexpression de nombreuses
molcules associes la fonction effectrice et migratoire 188, 189
. La stabilisation de
HIF-1, dans les cellules T CD8 actives, se traduit par une expression accrue et la
libration de molcules cytolytiques (granzyme B, perforine), laugmentation de
lexpression des molcules costimulatrices/inhibitrices (CTLA-4, GITR, 4-1BB) et
laltration de la migration et lexpression des rcepteurs chimiokines 35 (Fig. 26).

Cependant, les lymphocytes dficients en HIF-1 ne prsentent pas un


dveloppement anormal des lymphocytes B 190. La dpltion de HIF-1 induit la
production des taux levs danticorps anti-ADN double brin et le facteur rhumatode
dans le srum (rhumatisme inflammatoire dbutant), ainsi que dune protinurie et
des dpts dIgG et dIgM dans le rein 190. Cela suggre que HIF-1 peut avoir un
rle important dans la fonction humorale des lymphocytes B.
PARTIE (2) Physiopathologie de lischmie reperfusion et rponse immunitaire

3. Signaux de danger les alarmines dans un contexte ischmique :

Le processus physiopathologique de lI/R est mdi par des lsions hypoxiques


tissulaires. Ces lsions sont accentues, aprs le retour de la circulation sanguine et
lapport doxygne, par une inflammation et des dommages oxydatifs. Les initiateurs 75
qui mnent la propagation de la rponse inflammatoire et les lsions tissulaires qui
en rsultent font lobjet de plusieurs investigations. Dans ce cadre, des PAMPs issus
de linvasion microbienne ou des DAMPs librs lors dun stress ou des lsions
cellulaires ont t identifis. Lactivation de certains rcepteurs par ces agents
initiateurs (PAMPs et DAMPs) induit lactivation du systme immunitaire inn, et
limmunit adaptative par la suite, favorisant ainsi lexacerbation ou la protection
contre les lsions tissulaires.

3.1. Signaux de danger endognes :

Les agents pathognes exognes (dorigine infectieux) et leurs produits sont


connus depuis longtemps pour activer le systme immunitaire inn. La
reconnaissance rcente dun groupe des molcules endognes, qui ont une fonction
similaire, a fourni un cadre pour comprendre le chevauchement entre les rponses
inflammatoires actives par des agents pathognes ou par des lsions cellulaires.
Les molcules endognes, appeles aussi alarmines, sont des constituants
cellulaires normaux qui peuvent tre librs dans le milieu extracellulaire pendant les
tats de stress ou de dommages cellulaires, puis activent le systme immunitaire.
191
Des protines nuclaires telles que : lHMGB1 (High mobility group box-1) , et
192, 193
lIL-33 ont reu une attention particulire comme des molcules remplissant
les fonctions dun alarmine. Ces signaux de danger se sont montrs impliqus dans
la rponse inflammatoire des lsions dischmie reperfusion 194, 195.
PARTIE (2) Physiopathologie de lischmie reperfusion et rponse immunitaire

3.2. Interleukine-33 (gnralit):

En 2005, une nouvelle cytokine nomme interleukine-33 (IL-33) a t identifie


comme tant une importante alarmine qui alerte les cellules sentinelles du corps afin
196
dinitier une rponse inflammatoire . Ce signal de danger est gnralement libr
suite un dommage tissulaire (cellules pithliales et endothliales) induit par 76
diffrents stimuli tels que lischmie et les maladies inflammatoires chroniques. Des
modles animaux suggrent que lIL-33 joue un rle dans la perptuation de
linflammation chronique. La rponse lIL-33 implique lactivation des cellules
inflammatoires la fois du systme immunitaire inn et adaptatif. Dans ce cadre,
plusieurs types des cellules immunitaires ont la capacit de reconnaitre le ligand
IL-33 via lexpression de son rcepteur spcifique ST2. Lactivation de ce dernier,
favorise la production des cytokines et chimiokines inflammatoires, mdiateurs du
recrutement et de lactivation des cellules neutrophiles, dendritiques et lymphocytes
T au niveau du site de lsion (Fig. 27).

Figure 27. Diffrents stimuli sont lorigine des lsions cellules, telles que les cellules pithliales.
La ncrose des cellules lses favorise la libration de lIL-33 et provoque la stimulation des cellules
immunitaires, telles que les mastocytes qui expriment le rcepteur de lIL-33 (T1/ST2) en initiant une
rponse proinflammatoire. La liaison de lIL-33 son rcepteur dclenche les mcanismes de
signalisation MyD88-dpendante favorisant lactivation de NF-kB et la transcription subsquente de
plusieurs gnes proinflammatoires. La libration de cytokines, des chimiokines, et des mdiateurs
lipidiques initient ainsi une rponse inflammatoire, par exemple le recrutement des neutrophiles,
197
lactivation et la migration des cellules dendritiques, et la polarisation des cellules Th2 (rf. ).
PARTIE (2) Physiopathologie de lischmie reperfusion et rponse immunitaire

Les sections venir, prciseront plus en dtail, la nature et le rle important de


lIL-33 en rponse lischmie-reperfusion rnale. Nous allons tudier galement la
possibilit de limplication de lIL-33 dans la potentialisation des lsions dI/R rnal
dans les conditions hyperglycmiques.

77
3.2.1. Caractristiques molculaires :

Linterleukine-33 est une cytokine rcemment dcouverte appartenant la famille


dIL-1, qui inclut IL-1, IL-1, IL-18, IL-36, IL-36, IL-36 et IL-37, et les
antagonistes des rcepteurs IL-1Ra, IL-36Ra et peut tre lIL-38. IL-33 est localise
dans le noyau des cellules, mais fonctionne galement comme une cytokine
acellulaire, de faon similaire lIL-1 et lHMGB1 198.
Les gnes de lIL-33 humain (chromosome 9) et murin (chromosome 19) sont
constitus de sept exons codants, qui produisent une protine biologiquement active
(~31 kDa) de 270 et 266 acides amins, respectivement. Les exons 1 3 codent
pour le domaine N-terminal helix-turn-helix (HTH) requis pour lIL-33 localisation
199
nuclaire, alors que les exons 4 7 codent pour le domaine C-terminal IL-1-like .
Le domaine de localisation nuclaire (les acides amins 1-65 chez lhomme)
comprend un motif de liaison la chromatine (les acides amins 40-58). Ce motif
mdie une interaction de lIL-33 avec les dimres dhistones et favorise la
compaction de la chromatine. De plus, lIL-33 a galement t montre pour se lier
la sous-unit p65 de NF-kB via lintermdiaire de son domaine N-terminal (acides
amins 66-109) 200.
Le reste de la protine IL-33 C-terminal (acides amins 109-266 chez la souris)
code pour le domaine de cytokine IL-1-like, et similaire lIL-1a, IL-1b, IL-1Ra et
LIL-18. Ce domaine se lie au rcepteur dIL-33 (ST2L), ce qui facilite le recrutement
dIL-1RAcP pour induire une signalisation via la formation du complexe
htrotrimrique (IL-33/ST2L/IL-1Ra). Contrairement lIL-1, IL-18, la partie
N-terminale de lIL-33 ne ncessite pas de clivage par la caspase-1 pour sa libration
de la cellule ou dinitier la signalisation via ST2. Or, lapoptose est associe un
clivage et linactivation de lIL-33 laide de caspase-3 et caspase-7. Le clivage est
effectu au niveau dun rsidu conserv au sein du domaine IL-1-like (Asp178 chez
lhumain et Asp175 chez la souris). La forme mature 19 kDa, rsultante aprs
protolyse par les protases elastase et cathepsine, reprsente une activit 10 30
201
fois plus leve que la forme complte de lIL33 (~31 kDa) . Alors que dautre
PARTIE (2) Physiopathologie de lischmie reperfusion et rponse immunitaire

202
tude montre que lIL-33 est inactive aprs sa maturation par la caspase-1 (Fig.
28).

78

Figure 28. Reprsentation schmatique de la protine IL-33.


IL-33 est une protine de 31 kD qui va subir un clivage par les Caspases dans de diffrentes conditions
pathologiques. En cas de ncrose tissulaire, IL-33 de 31 kD est cliv par caspase-1 (acide amin 111) pour
donner naissance une forme mature de lIL-33 de 19 kD, la forme qui interagit avec le rcepteur T1/ST2.
En revanche, lors dune apoptose, lIL-33 est inactive suite un clivage par les caspase-3 et caspase-7
(acide amin Asp 178) dans le domaine IL-1-like. Tandis que le domaine N-terminal a un rle nuclaire
203
contenant ainsi un motif de la liaison la chromatine (Modifier partir rf. ).

3.2.2. Expression et libration de lIL-33 :

IL-33 (transcrit et protine) est largement exprime dans des diffrents types
cellulaires. Ces cellules sont la fois dorigine hmatopotique et non
hmatopotique tels que les macrophages, les cellules dendritiques, des
fibroblastes, des adipocytes, des cellules musculaires lisses, des cellules
endothliales, les cellules bronchiques, des ostoblastes et de lpithlium intestinal
204
. Schmitz et coll.,205 ont dmontr que lARNm de lIL-33 est exprim dans les
cellules dendritiques, les cellules pithliales purifies, les macrophages activs. De
plus, ils ont galement dmontr que son expression tait beaucoup plus leve
dans les tissus destomac, le poumon, le cerveau et la peau. Un rsum plus dtaill
de la distribution de lIL-33 est reprsent dans le (Tab. 3).
PARTIE (2) Physiopathologie de lischmie reperfusion et rponse immunitaire

79

206
(Modifier partir rf. )

Tableau 3. Expression de l'IL-33 (transcrit et protine) dans les diffrents compartiments cellulaires et
tissus chez l'homme et souris.

De plus, des tudes rcentes ont rvl que le transcrit et la protine IL-33 sont
galement exprims au niveau rnal dans un modle murin de lsions rnales
207 208
aigus induites par la Cisplatine et par lobstruction urtrale unilatrale . Ces
travaux seront dcrits plus avant (pages 87).

LIL-33 est stocke dans le noyau et libre lors du processus de ncrose en


rponse des lsions cellulaires, une infection ou des dommages mcaniques. Les
niveaux levs dIL-33 constitutives peuvent agir comme une nouvelle alarmine
(signal dalarme intracellulaire libr aprs une lsion cellulaire). Aussi, lIL-33
(comme tous les membres de la famille IL-1) ne possde pas de peptide signal
classique ou dune voie de traitement et dexportation non canonique ou vsiculaire
(via la voie de rticulum endoplasmique et de Golgi). La mort cellulaire par la
ncrose et/ou la ncroptose reste le mcanisme dominant par lequel IL-33 atteint le
milieu extracellulaire.

En effet, cette interleukine est dj produite dans les noyaux des cellules et
stocke dans des vsicules scrtoires. Par la suite, lIL-33 est libre
immdiatement, par exocytose, lors des situations durgence telles que linfection,
PARTIE (2) Physiopathologie de lischmie reperfusion et rponse immunitaire

une lsion ou une inflammation due dautres facteurs de stress. LIL-33 a


209
galement t dtecte en extracellulaire dans le sang humain et le liquide
210
synovial dans les tats pathologiques, par lesquels les cellules ont t
endommages. Cependant, il est difficile de savoir si la mort cellulaire peut expliquer
entirement les effets biologiques de lIL-33. Kouzaki et coll., ont rapport que 80
lexposition des cellules pithliales des voies respiratoires humaines un
champignon (Alternaria alternata) induit une scrtion extracellulaire dIL-33 par
lactivation des rcepteurs P2 purinergiques. Dautres tudes plus pousses sont
ncessaires pour lucider ces diffrentes voies et la faon dont elles sont contrles
211
.

3.2.3. Rcepteur dIL-33 (ST2) :

Le rcepteur de lIL-33, ST2 (suppression of tumorigenicity 2) (encore nomm :


IL-1RL1, DER4, T1 et FIT-1) est un membre de la famille des rcepteurs Toll-like/IL-
1. Cette famille se dfinie par la prsence dun domaine intracellulaire commun TIR
212
(Toll/interleuki,-1 receptor) de ~160 acides amins . Le gne de ST2 se situe sur
un locus conserv dans le chromosome 2 chez lhumain et sur le chromosome 1
chez la souris. Ces loci incluent galement les rcepteurs de lIL-1 (IL-1R1 et
IL-1R2), lIL-18 (IL-18R1 et IL-18RAP), et IL-36 (IL-1RL2). En outre, ST2 est le seul
rcepteur bien document pour lIL-33. En effet, les souris dpourvues du domaine
nuclaire sur la protine IL-33 ou une surexpression constitutive de lIL-33
dveloppent une inflammation systmique. Toutefois, cette inflammation est
nettement diminue chez des souris dficientes en ST2 213.

Une autre complexit dans la physiopathologie de lIL-33 a t mise en vidence


avec la dcouverte de deux isoformes du rcepteur ST2 : soluble (sST2) et ligand
transmembranaire (ST2L). Le rcepteur ST2L est la protine la plus longue qui
comprend un domaine extracellulaire immunoglobuline (Ig)-like, un domaine
214
transmembranaire et un domaine intracellulaire TIR (toll / interleukin-1 receptor) .
Le rcepteur sST2 (60 70 kDa) est la forme raccourcie de ST2 dpourvue des trois
derniers exons. Cette protine soluble ne contient que le domaine extracellulaire de
liaison avec IL-33 (squence de neufs acides amins dans la rgion C-terminale). Le
sST2 est prsent de manire constitutive dans le srum humain o il agit comme un
PARTIE (2) Physiopathologie de lischmie reperfusion et rponse immunitaire

rcepteur de clairance en se liant avec lIL-33 libre. Plusieurs tudes ont montr que
lexpression du rcepteur sST2 est augmente suite des stimuli inflammatoires
215 216 217
divers, des maladies cardio-vasculaires , mtaboliques (diabte) , rnales ,
rhumatologiques et allergiques.

81

3.2.4. Axe IL-33/ST2 : signalisation et rgulation :

Aprs la libration de lIL-33 dans le milieu extracellulaire suite une ncrose, la


signalisation intracellulaire dpend de la liaison du ligand IL-33 avec son
rcepteur ST2L et le recrutement du corcepteur lIL-1RAcP. La structure cristalline
214, 218
de lectodomaine de la liaison ST2L avec lIL-33 a t rsolue . Lectodomaine
de ST2 est compos de 3 domaines Ig -like et ressemble lIL-1R1. Les deux
domaines distaux (D1D2) sont troitement lis et se connectent avec le troisime
domaine proximal (D3) via une partie flexible. LIL-33 vient se fixer entre les
domaines D1D2 et D3 214 (Fig. 29).

Figure 29. Liaison de lIL-33 son rcepteur T1/ST2.


(A) Structure cristalline de l'IL-33 dans le complexe avec le rcepteur ST2. IL-33 et ST2 sont colores en
violet et bleu, respectivement. Les glycanes sur le rcepteur ST2 sont prsents en jaune (Rf 214). (B)
Complexe IL-33/ST2 gnr partir des donnes de perturbation des dplacements chimiques de lIL-33
utilisant le logiciel HADDOCK d'accueil molculaire. La surface du rcepteur ST2 est reprsente en
blanc, tandis que les rsidus de l'IL-33 sont colors en fonction du degr de variation de dplacement
218
chimique (rf. ).
PARTIE (2) Physiopathologie de lischmie reperfusion et rponse immunitaire

La formation du complexe IL-33/ST2L provoque le recrutement dun co-rcepteur


nomm IL-1RAcP. Ce dernier est un composant de signalisation commun aux
rcepteurs IL-1, IL-1, IL-18, IL-36, IL-36 et IL-36. IL-33/ST2L forme alors un
complexe avec la protine exprime de manire ubiquitaire IL-1RAcP. La
82
signalisation intracellulaire est induite par la liaison des deux domaines
cytoplasmiques TIR de ST2 et de lIL-1RAcP. La formation de ce dimre permet
linitiation de la signalisation intracellulaire par le recrutement de ladaptateur
protique MyD88 (Fig. 30).

Figure 30. Reprsentation des complexes de rcepteurs lIL-33.


Le complexe minimal du rcepteur lIL-33 est constitu de ST2 et un corcepteur IL-1RAcP. IL-33 se
lie ST2 induisant un changement de la conformation de ST2. IL-1RAcP se lie troitement au
rcepteur ST2. lintrieur de la cellule, le domaine TIR de ST2 et de lIL-1RAcP se dimrisent qui
permet la formation dun complexe de signalisation intracellulaire comprenant MyD88, les molcules
219
dIRAK et TRAF6 (rf. ).

MyD88 active permet de recruter dautres molcules cytoplasmiques telles que


lIRAK, lIRAK4, et TRAF6. La formation de ce complexe protique cytoplasmique
induit lactivation des voies de MAP kinases, ERK1/2, P38, JNK et des facteurs de
transcription tels que lAP-1 conduisant la translocation de NF-kB vers le noyau. Le
facteur de transcription nuclaire NF-kB intervient dans la transcription et la
production des mdiateurs de linflammation tels que lIL-5, lIL-13 et la MCP-1 dans
les lymphocytes nafs (immunit inne) et lIL-4, lIL-5 et IL-13 dans les cellules Th2
(immunit adaptative) 220 (Fig. 31).
PARTIE (2) Physiopathologie de lischmie reperfusion et rponse immunitaire

tant donn que cette voie de signalisation est en grande partie conserve avec
la signalisation des rcepteurs TLRs (TLR4 et TLR9 en particulier), lIL-1 et IL-18, les
effets biologiques spcifiques de lIL-33 sont susceptibles dtre mdis par
lexpression ST2L. La voie de signalisation IL-33/ST2L peut tre inhibe par la
molcule SIGIRR (single Ig IL-1R-related molecule). Cette dernire est galement 83
connue par TIR8 (Toll/IL-1R8), de sorte que dans des cellules Th2, SIGIRR rgule
ngativement la signalisation de ST2 et inhibe le processus inflammatoire des
cellules Th2 221.
Une autre voie de signalisation ST2L-non dpendante a t dvoile pour lIL-33.
Il est admis que lIL-33 (avec sa forme longue) peut agir de manire autocrine ou
paracrine en se liant son rcepteur transmembranaire ST2L sur plusieurs types
des cellules cibles. En outre, lIL-33 peut agir galement de faon intracrine par une
translocation nuclaire o elle va jouer le rle dun facteur de transcription (se lie la
chromatine et de moduler lexpression gnique). Cette voie implique linteraction de
lIL-33 avec NF-kB qui se produit entre la partie N-terminale de lIL-33 (acides
amins 66-109) et le domaine N-terminal RHD (Rel homology domain) de p65 sur
NF-kB. Cela suggre le nouveau rle pour lIL-33 comme tant un modulateur ngatif
200
de lactivit NF-kB en rduisant la signalisation proinflammatoire . En dpit de ces
donnes, la rgulation de lactivit transcriptionnelle dIL-33 nuclaire ncessite des
tudes plus approfondies.
La rgulation de lactivit de lIL-33 dpend du type de la mort cellulaire ainsi que
de son tat de clivage par les caspases. En effet, aprs une ncrose cellulaire, lATP
cytoplasmique sera libre dans le milieu extracellulaire, cette nergie permettra
lactivation des rcepteurs purinergiques pour induire lentre du calcium dans le
cytoplasme, un point cl dans lactivation de la phospholipase. Cette enzyme est
ncessaire la formation des inflammasomes et lactivation de la caspase-1.
Caspase-1 est implique, dune part, dans la maturation des IL-1, IL-18, et dautre
part, dans la scrtion des protines (sans peptide signal) telles que IL-1, IL-1 et
222
HMGB1 . Il a t dmontr que la protine pro-IL-33 (~31 kDa/1-270 acides
amins) pourrait donc tre clive et active, par caspase-1, pour gnrer une forme
mature (~19 kDa/112-270 acides amins). Cette forme active pourra induire une
signalisation intracellulaire aprs sa fixation sur le rcepteur ST2. Cependant un site
de clivage au niveau du domaine IL-1-like (entre 111-270 acides amins) ne
constitue pas un site de clivage consensus avec la caspase-1 (Fig. 31).
PARTIE (2) Physiopathologie de lischmie reperfusion et rponse immunitaire

84

Figure 31. Libration de lIL-33 et la signalisation via ST2L.


IL-33 est exprim de manire prdominante par les cellules stromales telles que les cellules pithliales et
endothliales. Des dommages pour ces cellules peuvent induire une ncrose et la libration de la forme
longue de lIL-33 qui forme un complexe htrotrimrique avec ST2L et le corcepteur IL-1RAcP.
Cependant la fixation de lIL-33 sur un ST2s neutralise son activit. Dautre part, au cours de lapoptose,
lIL-33 est cliv par la caspases-3/7 conduisant son inactivation. Aprs lactivation de ST2L, MyD88 et
IRAK1/4 sont recrutes. Finalement la signalisation induit la production des cytokines chimiokines telles
195
que lIL-5, lIL-13 et la MCP-1 (rf. ).

La libration des caspase-3 et caspase-7 constitue une des consquences de la


mort cellulaire programme (apoptose). Des tudes ont dj dmontr que les
caspases apoptotiques 3 et 7 ont une capacit de clivage prfrentiel auprs dun
acide aspartique de la protine IL-33. Il se trouve que ce clivage a lieu lintrieur du
domaine IL-1-like (au niveau du Asp178 chez lhumain et Asp175 chez la souris). Par
consquent, ce clivage pendant lapoptose entrainera linactivation de la protine
IL-33 et donc linhibition de la signalisation de lIL-33/ST2L (Fig. 31).
PARTIE (2) Physiopathologie de lischmie reperfusion et rponse immunitaire

Le gne ST2 peut fonctionner non seulement comme mdiateur de lIL-33 dans
sa forme transmembranaire ST2L, mais aussi comme un inhibiteur endogne de
lactivit de lIL-33 via sa forme soluble sST2, agissant comme un rcepteur leurre.
Le sST2 prsent soluble dans le milieu extracellulaire est capable de chasser lIL-33
libre et former un complexe IL-33/sST2. Ce htrodimre empchera linteraction 85
de lIL33 avec son rcepteur transmembranaire ST2L, et entranera donc linhibition
de lactivit IL-33. Bien que cela soutienne lide que lexpression de sST2 pourrait
donc servir de mcanisme physiologique pour rguler ngativement lactivit de
lIL-33. En outre, la concentration de ST2 soluble est augmente dans le srum des
patients atteints de divers troubles associs une rponse anormale des
cellules Th2. Leffet dltre de lIL-33 a t mis en vidence dans certaines
pathologies comme lischmie reperfusion rnale.

Trs rcemment, un nouveau mcanisme de rgulation biologique dIL-33 et son


223
rcepteur ST2 a t dcrit par Cohen et coll., . Ce mcanisme induit un arrt
rapide de lactivit dIL-33 dans lenvironnement extracellulaire suite loxydation des
quatre cystines libres sur la molcule IL-33. Cette oxydation est caractrise par la
formation de deux ponts de disulfure, ce qui entrane un changement de
conformation de la molcule IL-33 en perturbant le site de liaison son
rcepteur ST2. Les diffrences structurelles entre les formes actives et inactives de
lIL-33 (suite la formation des ponts de disulfure) ont t localiss dans le noyau
tonneau- "-barrel" ainsi que dans la boucle suprieure de lpingle cheveux
"-hairpin" de la protine IL-33. Ces deux sites prsentent une forte affinit au
224
rcepteur ST2L (Fig. 32) . Dans ce cadre, il a t mis en vidence que la
perturbation de ce mcanisme dinactivation in vivo conduit une amlioration de
ltendue et de la dure de la rponse immunitaire induite via lactivation de ce
rcepteur.
PARTIE (2) Physiopathologie de lischmie reperfusion et rponse immunitaire

86

Figure 32. Structure des protines IL-33 humaine et murine.


Les zones rouges indiquent lemplacement des quatre cystines o se forment les ponts disulfures, et dont
loxydation entrane des changements de conformation de lIL-33 en empchant ainsi la liaison son
224
rcepteur ST2L (rf. ).

Il est intressant de signaler que plusieurs autres membres de la famille de lIL-1


contiennent ces rsidus cystines libres dans leurs domaines IL-1-like tels que : deux
rsidus IL-1, quatre IL-18, quatre IL-36, six IL-36 et quatre IL-36.
Tandis que lIL-1 a un seul rsidu cystine libre. Parmi ces cytokines, seule lIL-18 a
dj t suggre comme tant sensible loxydation, bien que cela nait pas encore
t tudi en dtail. En fait, dans des conditions qui favorisent la formation de pont
disulfure en IL-33, tout sauf lIL-1a et IL-36b, montre des signes de changements
conformationnels. Cette oxydation de la cystine pourrait tre mcanisme un
important utilis par un certain nombre de membres de lIL-1 famille pour rguler leur
activit et leur exposition systmique 223.
PARTIE (2) Physiopathologie de lischmie reperfusion et rponse immunitaire

3.3. Contribution dIL-33 dans les lsions rnales :

3.3.1. IL-33 et les lsions rnales aigus :


87
Linflammation contribue la pathogense des lsions rnales aigus (AKI :
acute kidey injury). IL-33 est une cytokine proinflammatoire qui entrane des
rponses inflammatoires. Cependant, limplication dIL-33 dans lexacerbation de ces
lsions rnales nest pas bien comprise. Une tude intressante a mis en vidence
une expression accrue des protines IL-33 (31 kDa) dans le rein, 2 jours aprs
207
linduction des lsions rnales aigus avec le cisplatine (effet nphrotoxique) .
IL-33 est connue comme facteur chimiotactique pour les lymphocytes T via le
205, 225, 226
rcepteur membranaire ST2L . Cependant, ladministration du ST2 soluble
(sST2) dans des souris traites par la cisplatine rduit linfiltration des lymphocytes T
CD4 dans le rein, la concentration de la cratinine srique, la ncrose tubulaire
aigu (ATN) et lapoptose.

Par contre, ladministration de lIL-33 recombinant (rIL-33) exacerbe les lsions


rnales aigus induites par le cisplatine. De plus, ces lsions rnales ne se
produisent pas chez des souris dficientes en CD4. Cette tude suggre que les
cellules T CD4 sont les mdiateurs de leffet dltre de lIL-33 via la production des
niveaux plus levs de la chimiokine proinflammatoire CXCL1 (IL-18) 2 jours aprs
traitement par le cisplatine. Tandis que, les souris dficientes en rcepteurs CXCL1
et traites par le cisplatine ont montr une baisse de la concentration en cratinine
srique, de la ncrose tubulaire aigu, et de lapoptose compar des souris de type
sauvage traites par cisplatine 207 (Fig. 33).
PARTIE (2) Physiopathologie de lischmie reperfusion et rponse immunitaire

88

Figure 33. Schma de la squence temporelle des vnements de lsion rnale aigu induite par
cisplatine.
Aprs une injection de cisplatine, lexpression de lIL-33 et linfiltration intra-tissulaire des T CD4 augmentent
J1, J2 et J3 post-induction au niveau rnal. Linfiltration des macrophages, laugmentation de lexpression
du CXCL1, la ncrose tubulaire aigu (ATN) et lapoptose apparaissent J2 et J3. Tandis que linfiltration des
207
neutrophiles, lurmie et la cratininmie augmentent vers le jour 3 (Rf. ).

Dans la mme optique, une trs rcente investigation confirme leffet dltre de
lIL-33 en aggravant la progression de lsion rnale. Cette tude a montr une
surexpression des transcrits de lIL-33 et son rcepteur ST2L dans un modle des
lsions rnales aigus quatre jours aprs lobstruction urtrale unilatrale (OUU)
chez la souris. En outre, la protine IL-33 est galement surexprime dans les
myofibroblastes interstitiels et les cellules endothliales vasculaires pritubulaires 208.
Les souris prsentant une dpltion gnique en IL-33 sont plus rsistantes contre les
lsions tubulaires et la fibrose rnale interstitielle induites par OUU. De plus, les
auteurs de cette tude ont observ galement une prolifration des cellules
pithliales tubulaires dans les reins chez les souris dficientes en IL-33 et ST2L
208
aprs OUU . Cela suggre que laxe IL-33/ST2 reprsente un nouveau mdiateur
des lsions rnales et pourra tre une cible potentielle pour le traitement des
maladies rnales progressives.
En revanche, leffet dltre de lIL-33 observ au niveau rnal na pas t
remarqu dans les autres organes. LIL-33 protge contre les lsions aigus dI/R
myocardique. Cette protection est induite par linhibition de la rponse inflammatoire
227, 228
et de lapoptose des cellules myocardiques , qui peut tre associe une
baisse de lexpression de lHMGB1 et lactivation des voies de signalisations P38 et
229
MAPK . De plus, leffet protecteur de lIL-33 contre les lsions aigus dI/R a t
observ galement au niveau hpatique. 4 heures aprs la reperfusion, on a
remarqu une augmentation de lexpression protique de lIL-33 qui reste leve
PARTIE (2) Physiopathologie de lischmie reperfusion et rponse immunitaire

jusqu 8 heures. Il apparait que lIL-33 a des effets positifs directs sur la survie des
hpatocytes. Cet effet est associ une activation accrue de NF-kB, p38, cycline D1
230
et Bcl2 qui limite les lsions hpatiques et rduit linfiltration des neutrophiles . En
outre, leffet hpatoprotecteur de lIL-33 contre les lsions dI/R peut ventuellement
impliquer principalement la libration des cytokines produites par des Th2 au lieu de 89
212, 225, 231
celles des Th1 . LIL-33 amliore aussi les lsions crbrales ischmiques
en favorisant la rponse Th2 et suppression de la rponse Th17 232.
Finalement, une tude de notre laboratoire a rvl un rle prcoce des deux
voies dalarmine HMGB1/TLR et IL-33/ST2L aprs la transplantation rnale chez
lhomme. De faon remarquable, une corrlation a t trouve entre les niveaux de
lIL-33 (mais pas HMGB1) et la dure de lI/R, fournissant ainsi la preuve dune
233
troite association entre les lsions des cellules et la libration de lIL-33 .
Limplication de lIL-33 et son rcepteur ST2L dans les lsions aigus dI/R rnale
sont trs peu documentes. Il sera lobjet dune partie de mon travail de thse.

3.3.2. IL-33 et les lsions rnales chroniques :

La maladie rnale chronique (CKD : Chronic kidney disease) est le rsultat dun
dsordre multifactoriel, dont les tiologies sont varies : telles que la
glomrulonphrite, la nphropathie hypertensive, nphrite interstitielle, et la
nphropathie diabtique. Certaines tudes indiquent que la CKD est une maladie
immunitaire caractrise par une augmentation des biomarqueurs de linflammation
234, 235
avec un dclin de la fonction rnale . En effet, certaines cytokines jouent un
rle cl dans la rgulation de linflammation et le dveloppement de la CKD. Des
236 237
taux plasmatiques levs de lIL-18 , de lIL-12 et des niveaux plasmatiques
238
bas de lIL-7 ont t observs chez les patients atteints dune CKD. Il a t
suggr quun dsquilibre entre Th1 et Th2 contribue au dveloppement des CKD.
Une tude a rvl une prdominance des Th1 dans des conditions urmiques 237,
239
alors quun autre rapport indique une prvalence des cellules Th2 . Linvestigation
sur la fonction de ST2 a rvl sa participation dans les processus inflammatoires en
particulier en ce qui concerne le choix de la prdominance des Th2. En effet, aprs
sa liaison au rcepteur ST2, lIL-33 favorise lactivation du facteur nuclaire NF-B,
212
conduisant une augmentation de la transcription des cytokines Th2 . Par
consquent, la rponse immunitaire via les lymphocytes T et les cytokines participent
au dveloppement de la CKD. Leffort mis en place pour intervenir dans le contrle
PARTIE (2) Physiopathologie de lischmie reperfusion et rponse immunitaire

de la rponse immunitaire empche le dclin de la fonction rnale et amliore les


rsultats cliniques 240.
Dans ce cadre, certains biomarqueurs ont attir lattention par leur utilit dans
lvaluation clinique des maladies mdiation immunitaire. Parmi eux, le rcepteur
soluble de lIL-33 (ST2s), pourrait tre un nouveau biomarqueur utilis en clinique 90
pour le diagnostic, le pronostic et le suivi des diffrentes maladies aigus et
chroniques humaines 241.
En effet, laxe de lIL-33/ST2 semble jouer un rle important dans plusieurs
242
maladies inflammatoires chroniques, y compris les maladies rnales chroniques ,
243 244, 245 246 247
lasthme , la polyarthrite rhumatode , le diabte type 1 et type 2 , la
248 249, 250
nphropathie diabtique , linsuffisance cardiaque chronique , la fibrose
251 252 253, 254
pulmonaire , lobstruction pulmonaire chronique , la maladie dAlzheimer ,
le dsordre allergique 255 et plusieurs cancers.
Une tude a abord, pour la premire fois, le rle important du rcepteur ST2s
comme tant un biomarqueur de CKD. En effet, une concentration srique leve de
ST2s corrle avec la gravit de la maladie a t observe chez les patients atteints
242
de CKD . De plus, une autre tude a galement rvl des niveaux
significativement levs de ST2s ont t observs aprs une transplantation rnale
chez des patients atteints du syndrome nphrotique idiopathique rcidive (INS :
Idiopathic nephrotic syndrome). En revanche, ce biomarqueur (ST2s) ne semble pas
impliquer dans la pathogense du ce syndrome (INS) 256.
Dautre part, le ST2s a t identifie comme un biomarqueur pronostic prcoce
chez les patients atteints une insuffisance cardiaque aigu et chronique. Ces patients
215, 241, 249, 250
prsentent une concentration srique/plasmatique leve en ST2s . De
plus, les taux sriques de lIL-33, en particulier sa forme longue, ont t
significativement levs chez les patients atteints une insuffisance cardiaque
chronique. A contrario, ce niveau srique de lIL-33 peut tre dpass par les
niveaux simultanment levs du rcepteur ST2s 257.
Or, linsuffisance rnale est frquente chez les patients atteints dinsuffisance
cardiaque et la coexistence des deux conditions se traduit par un mauvais pronostic
258
sur le plan clinique . Bien que les causes de la relation, probablement multiples,
entre linsuffisance rnale et cardiaque, ne sont pas bien claires, la relation entre les
deux organes, considre rciproque et bidirectionnelle est dfinie par le terme
PARTIE (2) Physiopathologie de lischmie reperfusion et rponse immunitaire

259
syndrome cardio-rnal . Une utilisation dune combinaison de biomarqueurs
cibls peut tre utile pour ces patients.
Trs rcemment, de multiples travaux ont t axs sur le dosage du ST2s srique
comme un ventuel biomarqueur la combinaison de linsuffisance rnale et
260, 261
cardiaque . Il a t dmontr que les concentrations sriques de ST2s nont 91
pas t significativement influences par la fonction rnale chez des patients
souffrant dinsuffisance cardiaque. En combinaison avec le NT-proBNP et dautres
biomarqueurs, le ST2s amliore la prdiction clinique chez les patients atteints
260
dinsuffisance cardiaque chronique et insuffisance rnale . Cependant, une tude
plus rcente a rvl une corrlation entre les niveaux sriques en ST2s et le taux
BNP chez les patients atteints dinsuffisance cardiaque aigu et insuffisance rnale
lgre modre 261.

3.4. Relation entre lexpression de lIL-33 et HIFs :

Lischmie, comme on a vu prcdemment, provoque linstallation dun


environnement hypoxique rsultant de la chute de la concentration de lO tissulaire
et lactivation de la glycolyse anarobique. Ces facteurs micro-environnementaux
uniques peuvent induire la stabilisation et lactivation de HIFs, et modifier la
prolifration, la diffrenciation et la fonction des cellulaires inflammatoires infiltres
dans un territoire hypoxique en rgulant probablement lexpression des interleukines
et des cytokines. Cependant, la question de la relation entre la libration de lIL-33 et
lexpression de HIFs induite par lischmie reperfusion nest pas encore investigue
au niveau rnal.
La relation entre IL-33 et HIF-1 a t observe dans une tude trs intressante
sur une maladie inflammatoire chronique : la polyarthrite rhumatode (PAR). Cette
maladie est caractrise par une hyperplasie des fibroblastes synoviaux, linfiltration
des cellules inflammatoires qui produisent des cytokines proinflammatoires, et une
262
hypoxie tissulaire . Dans ce rapport, les patients atteints dune PAR prsentent
des niveaux levs dIL-33 dans le liquide synovial avec une augmentation de
lexpression de HIF-1 et IL-33 dans les fibroblastes synoviaux (cultivs in vitro). Ces
changements exacerbent la gravit de la maladie de la polyarthrite rhumatode,
probablement travers la rgulation de certains nombres de cytokines
262
inflammatoires . En effet, HIF-1 favorise lactivation de la voie de signalisation qui
PARTIE (2) Physiopathologie de lischmie reperfusion et rponse immunitaire

contrle la production de lIL-33, en particulier les vois ERK et P38. De plus, lIL-33
pourrait galement son tour, induire lexpression de HIF-1 dans les fibroblastes
synoviaux formant ainsi un circuit de rgulation HIF-1/IL-33 qui perptuerait le
processus inflammatoire de la polyarthrite rhumatode 262.

92
Or, une publication trs rcente a dcrit le rle dun microenvironnement
hypoxique et inflammatoire sur la fonction des mastocytes, dans une pathologie
263
chronique telle que lasthme et les tumeurs . Les auteurs ont mis en vidence que
lacide lactique, produit lors de la glycolyse anarobique, affecte la production des
263
cytokines inflammatoires induites par IL-33 dans les cellules mastocytes . Une
exposition de ces cellules, rcupres de la moelle osseuse et cultives in vitro,
lacide lactique (12 mM) pendant 24 h provoque une augmentation de lexpression de
lIL-33 (activateur des cellules mastocytes).

En revanche, cette augmentation de lexpression de lIL33 est accompagne


dune rduction de production de ses cytokines effectrices (IL-6, TNF-, MCP-1,
MIP-1 et IL-13). Ce rsultat a t confirm in vivo par une injection I.P dacide
lactique chez des souris, suggrant que lacide lactique affecte la signalisation
intracellulaire de lIL-33 dans les mastocytes. Dautre part lacide lactique augmente
lexpression de HIF-1 dans les mastocytes. Cette augmentation est corrle avec
une baisse de lexpression dune microARN proinflammatoire (miR -155-5 p), rgule
ngativement par HIF-1. Finalement, dans un contexte hypoxique, la suppression
de la rponse inflammatoire des mastocytes actives par lIL-33 est rgule par
263
HIF-1 . Le mcanisme de la rgulation implique le rle de lacide lactique dans
laugmentation de lexpression de lIL-33 et linhibition de la transcription de ces
gnes effecteurs (cytokines). Cette disjonction de la signalisation est HIF-1
dpendante et ncessite une rgulation ngative dun microARN proinflammatoire
(miR -155-5 p) 263.
PARTIE (2) Les phnomnes hypoxiques et immunitaires dans un contexte hyperglycmiques

93

CHAPITRE (2) : Phnomnes hypoxiques et

immunitaires dans un contexte hyperglycmique


PARTIE (2) Les phnomnes hypoxiques et immunitaires dans un contexte hyperglycmiques

I. Hyperglycmie, la glycation et complications diabtiques :

Le diabte sucr est une maladie multifactorielle, classiquement influence par


des dterminants gntiques lis une sensibilit individuelle et par des facteurs
favorisants de lenvironnement, tels que le mode de vie. Il est considr comme un 94
problme majeur de sant publique cause de laugmentation de son incidence et
de ses complications long terme. Les changements mtaboliques lis au diabte
(lhyperglycmie) entranent, la fois, des complications macrovasculaires en
acclrant lathrosclrose, dont la coronaropathie, et des complications
microvasculaires lorigine de la rtinopathie, la nphropathie, et la neuropathie.
De plus, il est gnralement admis que lhyperglycmie est la cause initiale des
lsions tissulaires survenant dans le diabte. Ces lsions sont causes par des
changements aigus rpts dans le mtabolisme cellulaire du glucose ou par
laccumulation chronique des biomolcules glyques ainsi que des produits
terminaux de la glycation (AGEs : advanced glycation end product). Les AGEs
reprsentent un groupe htrogne de composs chimiques rsultant dune raction
non enzymatique entre les sucres rducteurs et des protines, des lipides et des
acides nucliques, ou une combinaison de ceux-ci. Le processus de glycation
(fixation du glucose) influe sur les protines circulantes (lalbumine srique, les
lipoprotines, linsuline, lhmoglobine), tandis que la formation des AGEs implique
des ractifs intermdiaires tels que le mthylglyoxal (MGO).
Schmidt et coll.,264 ont propos lhypothse de la mmoire glycmique
durable rsultant de laccumulation des AGEs long terme et leurs interactions
avec leurs rcepteurs spcifiques RAGE. Lactivation de cette voie induit un stress
oxydatif et la surproduction des EROs. De plus, les AGEs, produits massivement
aprs une hyperglycmie, sont aussi impliqus dans la modulation de la rponse
proinflammatoire, lapparition des complications microvasculaires de nature
hypoxique et finalement laggravation des lsions tissulaires (Fig. 34)
Nous savons que dans le diabte, lhyperglycmie atteint toutes les cellules de
tous les tissus via la circulation sanguine. Alors, pourquoi ces altrations lsionnelles
se produisent seulement dans quelques types cellulaires impliques dans les
complications diabtiques? La rponse est que la plupart des cellules sont capables
de rduire le transport du glucose lintrieur de la cellule quand elle est expose
une hyperglycmie, de sorte que la concentration du glucose interne reste constante.
PARTIE (2) Les phnomnes hypoxiques et immunitaires dans un contexte hyperglycmiques

95

265
(rf. )

Figure 34. Caractristiques gnrales des lsions tissulaires induites par l'hyperglycmie.

En revanche, les cellules endommages par lhyperglycmie sont celles qui ne


peuvent pas maintenir, de manire plus efficace, cet quilibre en internalisant
massivement le glucose 266, 267
. Ainsi, le diabte endommage slectivement les
cellules, comme les cellules endothliales et cellules msangiales 268, 269
dont le
transport du glucose ne diminue pas rapidement la suite de lhyperglycmie,
conduisant une haute teneur en glucose dans les cellules. Dans ce chapitre, nous
nous focaliserons sur linteraction entre lhyperglycmie (aigu et chronique), la
rponse inflammatoire (inne et adaptative) dans linstallation de la nphropathie
diabtique un contexte hypoxique.

1. Hyperglycmie et le stress oxydant :

Chez les sujets normaux, la glycmie est maintenue dans une fourchette
relativement troite ltat de jene. Lhyperglycmie aigu et postprandiale pourrait
dclencher le stress oxydatif chez des sujets sains 270. Alors que dautres donnes
suggrent que non seulement une hyperglycmie prolonge, mais aussi la
fluctuation glycmique, sont des facteurs dterminants de complications diabtiques
travers linduction du stress oxydatif 271, 272. Il est dj admis que le stress oxydatif
rsulte dun dsquilibre entre la production accrue des EROs et le systme de
dfense antioxydant cellulaire. Dans le diabte sucr et ses complications, le stress
oxydatif rsulte dune surproduction des EROs dune part, gnres par lauto-
oxydation du glucose, le dysfonctionnement mitochondrial, via la voie polyol et la
PARTIE (2) Les phnomnes hypoxiques et immunitaires dans un contexte hyperglycmiques

glycation des protines 273, et dune diminution de la dfense antioxydante cellulaire


et plasmatique dautre part. Ces facteurs favorisent lactivation du systme rnine-
angiotensine-aldostrone qui aggrave considrablement la progression de la
nphropathie diabtique 274.

96
1.1. Hyperglycmie aigu ou transitoire :

In vivo, lhyperglycmie aigu dans le diabte est caractrise par une


augmentation des biomarqueurs du stress oxydatif et de la scrtion des cytokines
275
proinflammatoires (TNF-, IL-6 et IL-18 circulantes) . La production de ces
facteurs est concomitante une diminution de lactivit du systme antioxydant
induite par lingestion de glucose. Aprs lingestion du glucose et du fructose, les
niveaux de F2-isoprostanes (biomarqueur du stress oxydatif 276) augmentent alors
que la dfense antioxydante baisse dans le plasma total. Ceci suggre une
participation de la raction de Maillard (voir la glycation dans la prochaine section)
277, 278
. De plus, les niveaux disoprostanes sont bien corrls aux fluctuations de
glucose dtectes par la surveillance en continu de la glycmie, mme en labsence
de laugmentation de la glycmie moyenne ou HbA1c, chez les individus sains et des
patients diabtiques de type 2271. De mme, les expriences in vitro montrent que
les marqueurs biologiques du stress oxydatif sont plus levs dans les cellules
endothliales exposes des fluctuations du glucose (sans atteindre des niveaux
dhypoglycmie) que dans les cellules exposes de faon continuelle des niveaux
levs de glucose 279.

En ce qui concerne le statut redox (rduction/oxydation) intracellulaire, une


augmentation transitoire de la glycmie entrane la gnration de lanion superoxyde
(O) dans les cellules endothliales 280. Cependant le niveau dO nest pas assez
lev pour gnrer le proxynitrite (ONOO ), mais suffisant pour tre dtect par
les systmes de rponse cellulaire et conduisant une augmentation de la libration
des molcules vasodilatatrices (NO) 270. Ceci suggre que lhyperglycmie transitoire
pourrait contribuer la vasodilatation, tandis quune hyperglycmie durable va
gnrer plus danions superoxyde qui interagit avec le NO pour former le ONOO
(une molcule cytotoxique).
PARTIE (2) Les phnomnes hypoxiques et immunitaires dans un contexte hyperglycmiques

Lors de traitement du diabte, la relation entre lhyperglycmie aigu et le stress


oxydatif est prise en charge par des approches thrapeutiques avec les
mdicaments antidiabtiques, tels que les sulfonylures, mglitinide, biguanides et
les thiazolidinediones, des molcules qui diminuent clairement le stress oxydatif 281.
In vitro, bien que les conditions de culture sont loin dtre des conditions 97
physiologiques (concentration leve en glucose dans une majorit de milieux de
culture, la pression O2 leve dans des conditions de culture standard), des cultures
cellulaires ont t utilises pour tudier les effets de glucose lev sur la physiologie
cellulaire. Les cellules endothliales et msangiales cultives dans des conditions
normales (5 mM) et places, par la suite, dans des milieux contenant des niveaux
levs en glucose (25-30 mM) prsentent une augmentation moyenne de la
282, 283
production dEROs intracellulaire . Aussi, une fluctuation rpte dune
concentration (entre 5 et 25 mM) du glucose induit aussi une production dEROs,
mais plus importante compare celle qui est produite dans un milieu contenant des
niveaux levs et constants en glucose 284. Cependant, laugmentation de la
production de radicaux libres dpend de labsorption et le mtabolisme du glucose
qui peuvent tre trs diffrents selon le type de cellule et les lignes cellulaires 285.

1.2. Hyperglycmie chronique :

Laugmentation de la production des EROs est une caractristique commune


des cellules endommages par une hyperglycmie 283. Dans les cellules diabtiques,
la quantit de glucose oxyd dans le cycle de lacide tricarboxylique de Krebs (cycle
de krebs) est augmente. Le recrutement de donneurs dlectrons (NADH et FADH2)
dans la chane du transport dlectrons conduit une augmentation de la production
dEROs 286, 287
. linverse, linsulino-rsistance induit laugmentation du flux des
acides gras libres (FFA : free fatty acid), partir des adipocytes. Les FFA librs vont
subir une oxydation par les mitochondries dans les cellules endothliales
artrielles 288. Ceci suggre que les niveaux levs du glucose favorisent loxydation
excessive des FFA et la surproduction mitochondriale des EROs aggravant ainsi le
stress oxydatif (Fig. 35).
PARTIE (2) Les phnomnes hypoxiques et immunitaires dans un contexte hyperglycmiques

98

265
(rf. )
Figure 35. Linsulino-rsistance provoque une surproduction mitochondriale dEROs dans les cellules
endothliales macrovasculaires en augmentant le flux des acides gras libres (FFA) et loxydation.

Une thorie cohrente de Brownlee 265 suggre que les EROs peuvent
constituer un dclencheur commun des divers effets biologiques qui se produisent
dans le diabte. Dun point de vue chronologique, la voie des polyols est le premier
mcanisme mtabolique dcrit dans le diabte 289. Un second mcanisme est
reprsent par la formation non enzymatique des produits terminaux de glycation
290, 291
(AGEs) . Au cours des annes 1990, deux autres voies ont t dcrites,
lactivation de la voie protine kinase C (PKC) induite par lhyperglycmie 292 et la
voie de lhexosamine 293.

1.2.1. Voie des polyols :

La voie des polyols se focalisent particulirement sur lenzyme aldose-rductase


294
. Cette enzyme catalyse la rduction des aldhydes toxiques pour inactiver les
alcools, mais elle est galement capable de rduire le glucose en sorbitol (Fig. 37).
Cette voie, active principalement en cas de concentration leve en glucose
consomme NADPH, un cofacteur de laldose rductase 295, 296. En rduisant le niveau
de NADPH, la voie des polyols induit une diminution de la capacit cellulaire
rgnrer le glutathion, un rgulateur essentiel de lquilibre redox cellulaire.
Finalement, cette voie induit la baisse de systme antioxydant et augmente le risque
de stress oxydatif intracellulaire. En outre, le sorbitol est mtabolis en fructose, le
fructose -1-phosphate, qui peut tre divis en glycraldhyde et le phosphate de
dihydroxyactone. Le glycraldhyde peut tre mtabolis en glycraldhyde -3-
phosphate, retournant ainsi la glycolyse, ou il peut ragir avec des groupes amine,
participant ainsi la formation AGEs. Le mtabolisme de lautre produit, le
phosphate de dihydroxyactone, se traduit par la formation de lacide phosphatidique
et les diacylglycrols (DAG).
PARTIE (2) Les phnomnes hypoxiques et immunitaires dans un contexte hyperglycmiques

99

Figure 36. Diffrentes voies du mtabolisme du glucose qui conduisent lactivation de la protine
kinase C (PKC) et du facteur de croissance (TGF-)
En plus de la glycolyse, lexcs de glucose est canalis dans la voie des polyols et les voies hexosamine, ce qui
conduit la synthse des lipides et laugmentation de la production de diacylglycrol (DAG) et lactivation de la
274
PKC et de TGF- (rf. ).

1.2.2. Voie des hexosamines :


Une hexosamine est une osamine qui rsulte de la substitution dun groupe
amine par un groupe hydroxyle sur hexose tel que la glucosamine (Fig. 37). Les
niveaux levs de glucosamines conduisent des changements mtaboliques
semblables ceux qui se produisent dans le diabte de type 2297. Dans les
premires tapes de la glycolyse, le glucose est converti en glucose-6 phosphate
puis en fructose-6-phosphate, qui est aussi la premire tape de la biosynthse de
N-actylglucosamine. En effet, le fructose-6-phosphate est converti en glucosamine-
PARTIE (2) Les phnomnes hypoxiques et immunitaires dans un contexte hyperglycmiques

6-phosphate, et enfin en UDP-N-actyl glucosamine (UDPGlcNAc), qui est ensuite


utilise pour la biosynthse des glycoprotines, des protoglycanes, et des
glycolipides. LO-N-actylglucosaminylation (O-GlcNAc), une glycosylation sur la
srine ou la thronine, est une modification post-traductionnelle de la protine qui
participe la dtection de ltat nutritif de la cellule et contrle la localisation, lactivit 100
et la stabilit des protines cytosoliques et nuclaires. Il a t montr quun niveau
lev du glucose entrane une augmentation de la glycosylation dO-GlcNAc des
protines cellulaires, y compris les facteurs de transcription, affectant la rgulation
gnique 265. Par exemple, la forte teneur en glucose augmente lexpression de PAI-1
et de TGF-b via la modification (hexosamine dpendante) les facteurs de
transcription sp1 (specificity protein 1) et mSin3A (Mammalian switch-independent
3A) 298.

Enfin, la surexpression de la GFAT (glutamine : fructose-6-phosphate


amidotransfrase, enzyme qui convertit le phosphate de fructose-6 en glucosamine-6
phosphate) chez les animaux transgniques conduit une rsistance linsuline,
une synthse excessive dacides gras dans le foie et une forte scrtion dinsuline
par les cellules bta, favorisant une hyperinsulinmie 265, 297
. Cela suggre que la
surproduction de la glucosamine-6 phosphate conscutive une concentration
leve en glucose intracellulaire peut induire les caractristiques mtaboliques du
diabte de type 2265.

1.2.3. Voie PKC :

Lactivation de la voie de la PKC (Protein kinase C) par le niveau lev du


glucose intracellulaire est mdie par le DAG, qui agit comme un coactivateur pour
292, 299
plusieurs isoformes, telles que PKC-, , et (Fig. 37). Les DAG peuvent
galement rsulter de lhydrolyse des diacylglycerophospholipides par la
phospholipase C (PLC). Lactivation de la PKC, dclenche par le glucose
intracellulaire lev, participe la modification de la fonction de plusieurs voies de
rgulation et lexpression dune varit de gnes, y compris la rgulation ngative de
la NO synthase endothliale (eNOS), la rgulation positive de lendothline-1,
transformant le facteur de croissance b (TGF-b), inhibiteur de lactivateur du
plasminogne-1 (PAI-1) et facteur de croissance vasculaire endothlial (VEGF).
PARTIE (2) Les phnomnes hypoxiques et immunitaires dans un contexte hyperglycmiques

Ces vnements contribuent augmenter le stress oxydatif et les rponses


inflammatoires et conduisent aussi un dysfonctionnement des rponses cellulaires,
tels que la synthse accrue de collagne et de la fibrose, la permabilit capillaire
anormale, des anomalies du flux sanguin, une angiogense anormale, le remodelage
vasculaire, et une stnose 265. 101
In fine, ces facteurs favorisent linstallation de la nphropathie diabtique
caractrise par la permabilit vasculaire, lexpansion de la matrice extracellulaire
due une hyperfiltration glomrulaire (Fig. 38).

274
(rf. )
Figure 37. Squence dvnements induite par les AGEs et le glucose.
Les AGEs activent leurs rcepteurs RAGE. Le glucose entre dans la cellule via son transporteur Glut. La
signalisation intracellulaire induite par RAGE et Glut permet de produire du diacylglycrol (DAG) et dactiver la
protine kinase C (PKC). Ce dernier module lexpression dune grande varit de gnes altrant la
pathophysiologie glomrulaire, ce qui conduit une augmentation de la permabilit vasculaire, lexpansion
msangiale, hyperfiltration et protinurie. Abrviations : Ang II, langiotensine II; e-NOS, synthase endothliale
de loxyde nitrique; ET-1, lendothline 1; IP3 trisphosphate dinositol; PAI-1, lactivateur du plasminogne.
PARTIE (2) Les phnomnes hypoxiques et immunitaires dans un contexte hyperglycmiques

1.2.4. Voie des AGEs :

Les produits terminaux de la glycation sont un groupe complexe et htrogne


de composs cytotoxiques semblent impliquer dans les complications lies au
diabte. Dans la partie suivante, nous allons apporter plus de dtail sur les AGEs
102
cause de leur rle dltre observ dans laggravation du stress oxydant. Ce rle est
caractris par la surproduction des EROs, linactivation de la fonction biologique de
certaines protines et linduction de la rponse proinflammatoire.

2. Produits de dgradation du glucose intracellulaire :

Il a t dmontr que lhyperglycmie est lorigine des troubles mtaboliques et


hmodynamiques observes chez les patients diabtiques. La formation et
laccumulation des AGEs sont fortement corrles laugmentation de la
concentration du glucose srique. Cependant, lheure actuelle on ne sait pas si les
AGEs sont la cause ou la consquence des complications microvasculaires
remarques dans la rtinopathie, la neuropathie et la nphropathie lie au diabte.
De plus, le concept de stress carbonyle, d aux AGEs, a t mentionn comme tant
une source de la toxicit cellulaire et une cause des lsions tissulaires.

2.1. Glycation et formation des AGEs :

La glycation (parfois appele la glycosylation non enzymatique) a t dcouverte


par LC Maillard 300. Pour viter toute confusion, le terme glycation devrait plutt tre
prfr que de glycosylation non enzymatique. La glycation est une raction
chimique (non enzymatique) entre des sucres rducteurs et des groupements
amines. Il est admis que la glycation affecte gnralement la fonction biologique de
molcules, contrairement la glycosylation enzymatique de protines qui se droule
dans le rticulum endoplasmique et lappareil de Golgi, aboutissant la production
des glycoprotines biologiquement fonctionnelles. La raction initiale de la glycation
est suivie dune cascade de ractions chimiques. Cette cascade est dbute par la
formation de produits intermdiaires (base de Schiff, et produits Amadori), et
sachve en produisant une varit de drivs nomms produits terminaux de
glycation AGEs tels que le mthylglyoxal (MGO), le glyoxal (Go) et les
doxyglycosones (Fig. 39).
PARTIE (2) Les phnomnes hypoxiques et immunitaires dans un contexte hyperglycmiques

103

30
(rf. )

Figure 38. Voies biochimiques pour la formation AGEs.

Les sucres rducteurs (glucose, galactose, fructose et ribose), les produits


intermdiaires du mtabolisme glucidique (glucose -6-phosphate, fructose -6-
phosphate, ribose-5-phosphate et dsoxyribose -5-phosphate, et glycraldhyde),
les mtabolites de la voie des polyols (fructose ou du fructose -3-phosphate) et les
carbonyles sont capables de ragir avec les groupes amins de molcules
biologiques pour former des AGEs 301. On peut noter que le glucose est moins
efficace que les autres monosaccharides rducteurs 302.
La glycation est une raction spontane concentration dpendante. Cette
raction commence par une substitution nuclophile entre un groupe amin libre
(dune protine ou une autre molcule) et un groupe carbonyle partir de glucose
(ou dun sucre rducteur) pour former une base de Schiff rversible. Ensuite, la base
de Schiff peut rorganiser en produits Amadori qui subissent leur tour, une
fragmentation par glycoxydation en prsence dions mtalliques de transition. Cette
fragmentation favorise la formation des composs ractifs chane courte, tels que
le glyoxal (GO), le glycolaldhyde et le mthylglyoxal (MGO). De plus, les GO et les
MGO sont galement gnrs accessoirement par la voie glycolytique et pendant la
peroxydation lipidique (Fig. 39).
PARTIE (2) Les phnomnes hypoxiques et immunitaires dans un contexte hyperglycmiques

2.1.1. Glycation exogne:

La raction de Maillard (glycation et la formation AGEs) est une raction


chimique (non enzymatique) complexe entre les sucres et les groupes amins des
104
molcules (protines, acides amins, des aminolipides, des acides nucliques).
Cette raction est acclre par le chauffage des aliments, un pH alcalin et une
faible concentration en eau. Elle se traduit par une multitude de produits participant
la formation de pigments bruns et des composs aromatiques volatils des aliments
cuits. Les protines glyques sont partiellement rsistantes la protolyse et leur
valeur nutritive est rduite parce que les AGEs alimentaires sont mal digrs et
absorbs. Chez les sujets sains, ces drivs sont prsents dans le sang 303, 304 et son
excrts dans lurine 305. Cependant, chez les patients diabtiques atteints
dinsuffisance rnale, cette excrtion est dficiente, et un rgime riche en AGEs peut
aggraver les dysfonctionnements cellulaires et exacerbe des lsions tissulaires. Les
AGEs exognes ont longtemps t considrs comme des contributeurs sans
importance aux maladies, mais des tudes rcentes ont montr quils peuvent
ajouter leurs propres effets pathognes aux AGEs produits de manire endogne 306.

2.1.2. Glycation endogne:

Les protines sont les cibles classiques de la raction de Maillard par la


formation de bases de Schiff et les produits dAmadori 307, les 3 deoxyglucosones
(1 DG, 3 DG), la furosine, la pentosidine, GO et MGO (Fig. 39-40). Ces composs
peuvent ragir avec les constituants cellulaires pour former directement des AGEs.
Les composs dicarbonyls ont relativement une longue demi-vie (minutes
quelques heures) et facilement traverser la membrane plasmique. Ils agissent ainsi
loin de leur site de production en modifiant des molcules cibles la fois lintrieur
et lextrieur de la cellule.
PARTIE (2) Les phnomnes hypoxiques et immunitaires dans un contexte hyperglycmiques

105

30
(rf. )
Figure 39. Raction de Maillard et la formation chimique des diffrents AGEs.

Chimiquement, les composs carbonyles ractifs peuvent ragir avec les rsidus
lysines, arginines, histidines, ou cystines des protines travers des mcanismes
chimiques complexes, parfois impliquant une tape doxydation (glycoxydation). Ces
ractions favorisent la production dune varit des AGEs et des rsidus liens
croiss comme le G-H1, le MG-H1 et le 3DG-H1. En outre, certains AGEs tels que la
S-carboxymthyl-cystine (CMC), S-carboxythyl-cystine (CEC), GOLD, MOULE et
DOLD 304 peuvent galement rsulter dacides amins 308 et de lipides 309. Aprs leur
formation, les MGO peuvent ragir avec les rsidus darginine pour former de
largpyrimidine hydroimidizalones 310.

Aussi, lADN est susceptible dtre affect par la glycation en produisant de


plusieurs AGEs nuclotidiques. Le dsoxyguanosine, un nucloside constitu dune
base guanine et un dsoxyribose, est trs sensible la glycation. Or, dautres
nuclotides peuvent tre modifis en prsence dune forte concentration de
composs dicarbonyls 310. En outre, les agents de glycation peuvent induire la
formation de liaisons croises au niveau de lADN 310. Les aminophospholipides
peuvent tre cibls galement par des agents de glycation (glucose et des composs
carbonyles) pour former des produits tels que gluco-, carboxymthyl-, et
carboxythyl-phosphatidylthanolamine 311.
PARTIE (2) Les phnomnes hypoxiques et immunitaires dans un contexte hyperglycmiques

2.2. Consquences molculaires et cellulaires de la glycation :

2.2.1. Glycation des protines circules :

La glycation des protines sriques est caractrise par la formation des produits 106
dAmadori suite une liaison de glucose sur des groupes amines libres. De plus,
lhyperglycmie accentue la glycation des protines circulantes et pourra affecter leur
rle biologique.
2.2.1.1. Lhmoglobine :

La glycation de lhmoglobine par la raction de Maillard conduit la formation


de lhmoglobine A1c (HbA1c). Elle rsulte de la formation dun produit de
substitution dun glucose sur le groupe amine de la valine au niveau N-terminale de
la chane de lhmoglobine. La dtermination du niveau sanguin dHbA1c constitue
le paramtre de rfrence dans la surveillance de lquilibre glycmique chez les
patients diabtiques 312. En outre, lHbA1c pourrait participer augmenter les risques
dinsuffisance rnale chronique 313.

2.2.1.2. Linsuline :

Lhyperglycmie provoque la glycation de linsuline dans les cellules


314
pancratiques . Le site de glycosylation chez lhomme a t identifi comme
tant le Phe1 NH2-terminale de la chane B dinsuline 315. Une fois glyque, linsuline
se trouve incapable de rguler lhomostasie du glucose in vivo, de stimuler le
transport du glucose et de la lipogense du tissu adipeux 314.

2.2.1.3. Lalbumine srique :

Lalbumine srique glyque reprsente la plus grande partie des protines


glyques circulantes (~ 80 % des protines totales glyques). Les modifications
Amadori sont prdominantes et observes sur Lys-525, Lys-439, Lys-281 et Lys-199
316
. Le niveau de circulation de lalbumine glyque srique reflte ltat de la
glycmie au cours des semaines prcdentes (demi-vie de lalbumine srique
normale est ~ 20 jours chez lhomme) 317.
PARTIE (2) Les phnomnes hypoxiques et immunitaires dans un contexte hyperglycmiques

Lalbumine glyque prsente une large gamme de proprits biologiques qui ont
316
t largement tudies par le groupe de Cohen . En bref, ces proprits
biologiques sont comparables AGEs, mais nimpliquent pas le rcepteur RAGE, et
316
ne sont pas bloques par linhibition de RAGE . Lexpression des rcepteurs
dAmadori a t rapporte dans des cellules endothliales murines et des cellules 107
msangiales glomrulaires. De plus, lalbumine glyque est transporte travers la
barrire de filtration glomrulaire et reprise par les cellules msangiales
glomrulaires et les cellules pithliales. Son implication dans la nphropathie
diabtique est bien tablie 316.

2.2.1.4. Les lipoprotines : LDL et VLDL

Les lipoprotines de basse densit (LDL : low density lipoprotein) et trs basse
densit (VLDL : very low density lipoprotein) sont des lipoprotines dont leur fonction
est de transporter le cholestrol, estrifi ou libre) dans le sang. Le taux de LDL et de
VLDL glyque est significativement accru chez les patients diabtiques 318 et il est
319
toujours plus lev que le niveau de LDL oxyde circulant . La glycation des VLDL
altre leur dgradation par la lipoprotine lipase (LPL), ce qui contribue augmenter
laccumulation plasmatique, lhypertriglycridmie, et une altration de la clairance
de ces lipoprotines. De plus, les VLDL glyques sont impliques galement dans la
nphropathie diabtique 320.

2.2.2. Effet de laxe AGEs/rcepteur RAGE :

Les AGEs interagissent avec des rcepteurs spcifiques. Lactivation de ces


rcepteurs induit un stress oxydatif et des rponses proinflammatoires. En outre, les
AGEs peuvent directement ragir avec des protines cellulaires et tissulaires,
modifiant ainsi leurs structures et leurs proprits biologiques. Les deux effets
RAGE-dpendants et RAGE indpendant des AGEs sont impliqus dans la
pathogense des complications du diabte.

2.2.2.1. Rcepteur des AGEs (RAGE) :

La dcouverte du rcepteur pour les AGEs (RAGE) a ouvert le chemin pour


lucider des mcanismes trs importants impliqus dans lapparition des
complications diabtiques. RAGE interagit avec ses ligands dclenchent un stress
oxydatif intracellulaire et une signalisation proinflammatoire travers la voie NF-kB.
La liaison des AGEs aux RAGE dans un environnement hyperglycmique et
PARTIE (2) Les phnomnes hypoxiques et immunitaires dans un contexte hyperglycmiques

limplication de cet axe dans les pathogenses des complications microvasculaires


diabtiques ont t plus largement tudies par plusieurs groupes dans des modles
animaux et des patients humains 264, 321-323.

A- Structure de RAGE : RAGE est un simple rcepteur transmembranaire de 108


324-
35 kDa appartenant la famille des immunoglobulines de surface cellulaire
326
. RAGE est constitu de 394 acides amins, parmi lesquels 332 acides
amins organiss dans une grande rgion extracellulaire avec trois domaines
de type immunoglobuline-like (une de type V et de deux domaines
327
dimmunoglobuline de type C) . La rgion transmembranaire est caractrise
par un seul domaine hydrophobe transmembranaire (40 acides amins), alors
que la rgion cytosolique est trs charge lextrmit C-terminale. Les ligands
interagissent avec le domaine V du rcepteur 328, tandis que la rgion
cytosolique est implique dans la signalisation intracellulaire de RAGE.

B- Spcificit du ligand : Les ligands du rcepteur RAGE sont :


 AGEs : RAGE est un rcepteur multi-ligand qui reconnat plusieurs types
de ligands AGEs et non-AGEs. Laffinit de RAGE est plus leve pour les
AGEs ribose que pour les AGEs glucose et le fructose AGEs 329. RAGE
interagit avec les MGO 330 et avec les AGEs toxiques (TAGEs) drivants de
glycraldhyde 331, mais pas avec des composes Amadori drivs du
glucose 316.
 HMGB1 : (High-mobility group box 1), galement appel amphotrine, est
un membre hautement conserv de la famille HMG (High-mobility group)-1
des protines de liaison lADN. HMGB1 extracellulaire rgule la motilit
cellulaire et la migration travers sa liaison des rcepteurs tels que les
TLR4, TLR2 et RAGE 332
 S100-calgranuline. HMGB1 est galement appel EN-RAGE (extracellular
newly identified RAGE-binding protein) appartient de la famille de petite
protine de liaison au calcium associ linflammation 333. Les mcanismes
biochimiques et molculaires prcis qui rgulent lexpression de S100s ne
sont que partiellement lucids. Il a t dmontr quil peut contribuer au
dveloppement de lathrosclrose et de cancers 334.
PARTIE (2) Les phnomnes hypoxiques et immunitaires dans un contexte hyperglycmiques

C- Signalisation de RAGE : La liaison des AGEs son rcepteur RAGE induite


lactivation de la NADPH oxydase via une translocation des sous-units
rgulatrices de la membrane plasmatique (PKC), ce qui induit la gnration
dEROs (O et HO). Ces derniers activent une cascade de signalisation
conduisant la phosphorylation de I-B (linhibiteur cytosolique de NF-B). I- 109
B phosphoryl va subir une polyubiquitination avant de sa dgradation par
les protasomes. Le complexe NF-B/P50/P65 libre (sans linhibiteur I-B)
subi une translocation nuclaire, o il induira la transcription de gnes
proinflammatoires. Cependant, les mcanismes molculaires par lesquels
EROs dclenchent lactivation de NF-B restent largement hypothtiques. Ils
pourraient impliquer des interactions entre le domaine cytosolique de RAGE et
des adaptateurs dautres rcepteurs, tel que le domaine cytosolique TIR
(Toll/IL-1 receptor) des rcepteurs TLRs. Ces domaines activent une cascade
de signalisation favorisant la formation du signalosome IKK et lactivation de
NF-kB (Fig. 41).

Figure 40. Mcanisme de signalisation intracellulaire de rcepteur RAGE activ par AGEs.
Une fois les AGEs se lient sur les rcepteurs RAGE, un stress oxydatif cellulaire (gnration des EROs)
est mis en place suite lactivation de la NADPH oxydase. Ces EROs (O, HO) stimulent des
adaptateurs cytosoliques de RAGE impliqus dans lactivation dune cascade de signalisation et
favorisent la transcription des gnes proinflammatoires via la voie NF-kB (rf. 30)
.
PARTIE (2) Les phnomnes hypoxiques et immunitaires dans un contexte hyperglycmiques

2.2.2.2. AGEs/RAGE et complications diabtiques du rein :

Chez un diabtique, le rein est un site important pour laccumulation des AGEs. Il
a t lun des premiers tissus diabtiques dans lequel laccumulation des AGEs a t 110
335
observe . Leur rle dans la progression de la nphropathie glomrulaire a
galement mis en vidence. Il a t rapport que les AGEs saccumulent dans la
membrane glomrulaire basale, interagissant avec les cellules msangiales,
endothliales et podocytes, pour dclencher un stress oxydatif, une signalisation
proinflammatoire et une apoptose 336, 337.
En outre, le rein contribue laugmentation des AGEs dans le srum chez les
patients diabtiques, car il est le site majeur pour la clairance des AGEs 338. Des
tudes prcdentes ont montr une corrlation entre les niveaux AGEs de collagne
de la peau et le dveloppement et la progression de la nphropathie diabtique chez
339
les patients DT1 . Des rsultats similaires ont t observs chez des patients
atteints DT2 o lautofluorescence de la peau a t montre pour tre un bon
indicateur de complications microvasculaires rnales 340. Lautofluorescence est une
mission naturelle de la lumire par des structures cellulaires, telles que la
mitochondrie et le lysosome, quand elles absorbent la lumire. Cette mthode est
utilise pour mesurer les niveaux des AGEs dans la peau.

Le rcepteur RAGE est exprim par un certain type cellulaire dans le rein, tel que
341, 342
les podocytes , et les cellules endothliales 343. Wautier et Schmidt ont insist
sur le fait que les podocytes expriment des niveaux levs de RAGE (contrairement
312
msangiales et les cellules endothliales) et les lsions des podocytes et de
lapoptose induisent une protinurie et des lsions glomrulaires 344.
Le stress oxydatif, la scrtion de facteurs de croissance et les cytokines sont
impliqus dans la nphropathie induite par les AGEs. Ces facteurs sont enchevtrs
avec lactivation du systme rnine-angiotensine, qui gnre galement des EROs et
des facteurs de croissance 336, 345
. Les expriences sur des modles animaux
soutiennent le rle du stress oxydatif et de RAGE dans la nphropathie diabtique.
Les souris transgniques surexprimant le rcepteur RAGE humain dans les cellules
vasculaires prsentent une prdisposition gnrale la nphropathie,
particulirement en matire de lalbuminurie, laugmentation de la cratinine srique
et de la glomrulosclrose 346.
PARTIE (2) Les phnomnes hypoxiques et immunitaires dans un contexte hyperglycmiques

En revanche, une inhibition pharmacologique de RAGE chez des souris db/db


diabtiques (DT2) ou des souris transgniques avec le gne RAGE invalide, et
traites par la Streptozotocine (STZ), induit une diminution de lalbuminurie, de
lexpansion msangiale et de la glomrulosclrose 341. (STZ : un agent diabtogne
[DT1] provoque la cytotoxicit et la destruction des cellules des lots Langerhans 111
productrices dinsuline). De plus, une tude a mis en vidence les effets bnfiques
de la dltion de RAGE qui induit une baisse de la progression de la maladie rnale
diabtique. En effet, la suppression RAGE a t juge bnfique en favorisant
lattnuation de la nphropathie diabtique chez les souris OVE26 (modle
transgnique caractris par une apparition prcoce de DT1). Leffet rnoprotecteur
de la dpltion de RAGE a t mesur par la rduction de la glomrulosclrose,
leffacement des podocytes et lpaississement de la membrane basale
347
glomrulaire . En parallle, lamlioration de la fonction rnale, mesure par la
clairance de linuline, a t observe chez les souris OVE26 dpourvues du
rcepteur RAGE 347.

Ce travail a montr galement que les niveaux de MGO taient significativement


plus faibles chez les souris diabtiques en absence du rcepteur RAGE. Ces
donnes ont rvl, pour la premire fois, que lactivation du rcepteur RAGE baisse
les niveaux de glyoxalase-I (Glo-I) dans les reins, ce qui rduit le rle protecteur anti-
AGE de cette enzyme.

Glo-I est une enzyme cl qui dtoxifie le principal prcurseur des AGEs (MGO).
Par consquent, la rgulation de RAGE dpendante de cette enzyme, au moins au
niveau du rein diabtique, peut fournir un mcanisme qui limite lamplification de la
glycation et les dommages oxydatifs dans ce tissu.
PARTIE (2) Les phnomnes hypoxiques et immunitaires dans un contexte hyperglycmiques

2.3. Dfense cellulaire contre la glycation et les AGEs :

Plusieurs mcanismes sont impliqus dans la dfense contre laccumulation des


AGEs au niveau cellulaire. Le systme de dfense antioxydant (dcrit dans la 112
partie 2) est impliqu lors une hyperglycmie qui induit une gnration de stress
oxydant via les AGEs. Une premire limitation de la formation des AGEs, travers la
raction de Maillard dans lorganisme animal, rsulte de la proprit chimique du
glucose. Le glucose est moins ractif avec les groupements amines que les autres
sucres. La deuxime limitation est la barrire digestive qui empche la rabsorption
et la biodisponibilit des AGEs alimentaires drives. Cependant, la faible quantit
absorbe des AGEs pourra participer dans la gnration dun stress carbonyle,
principalement observ dans les maladies associes, telles que le diabte et la
nphropathie. Ici, nous citant deux systmes anti-AGEs par lesquels la cellule les
utilise comme une arme dans sa lutte contre le stress carbonyle.

2.3.1. Lamadoriase :

Les amadoriases sont des enzymes capables de mtaboliser (dglycation) les


produits Amadori. Chez les mammifres, il existe deux classes majeures des
enzymes amadoriases 348-350. Premirement, les fructosamines oxydases, un groupe
des enzymes amadoriases qui catalysent la dglycation oxydative des fructosamines
poids molculaires bas (produits Amadori), en transformant les fructoselysines en
lysine, HO et glucosone. Deuximement, les fructosamines kinases, un autre
groupe des amadoriases qui phosphoryle les produits Amadori au niveau du C3 pour
former les fructosamine -3 phosphate. Ces rsidus instables vont tre
dcomposs en 3 doxyglucosone, amine et phosphate 349. Il a t dmontr que
la dpltion du gne fructosamine kinase prsente une quantit leve de
fructoselysine. Cela indique que lenzyme fructosamine kinase intervient dans le
mtabolisme de fructoselysine endogne, soulevant ainsi la question de limportance
physiopathologique de cette voie de dglycation 351.
PARTIE (2) Les phnomnes hypoxiques et immunitaires dans un contexte hyperglycmiques

2.3.2. Le systme Glyoxalase (Glo) :

Le systme de glyoxalase est un ensemble des enzymes qui ont pour rle la
dtoxication du mthylglyoxal (MGO) et dautres espces ractives daldhyde. Il est
compos de deux enzymes GSH-dpendantes : glyoxalase I (Glo-I) et glyoxalase II 113
(Glo-II) qui convertissent a-oxoaldhydes en acides a-hydroxyle. Glo-I mtabolise les
MGO en S-D-lactoylglutathione, alors que Glo-II convertit le S-D-lactoylglutathione en
D-lactate 352. Le systme de glyoxalase mtabolise ractifs a-oxoaldhydes, tels que
MgO, GO, hydroxypyruvaldehyde, et 4,5 doxovalerate, empchant ainsi le stress
carbonyle et ses effets prjudiciables.

Le systme de glyoxalase a t dcrit lorigine en 1913, mais la fonction


complte reste lucider. Shinohara et coll, ont dmontr que la surexpression de
Glo-I dans des cellules endothliales bovines empche compltement la formation
des AGEs dans les cellules cultives dans un milieu avec une concentration leve
en glucose 353. Enfin, on peut noter que le stress oxydatif dplie le GSH (NADPH
utilis pour rduire GSSG), diminuant ainsi lactivit des enzymes NADPH-
dpendantes, telles que Glo-I et les aldhydes rductases 312.

Le rle rnoprotecteur des Glo-I contre les complications lsionnelles induites par
le diabte a t rapport dans une rcente tude. Giacco et coll., ont gnr des
souris transgniques, non diabtique, avec une dpltion homozygote du gne Glo-I.
Les auteurs ont montr une augmentation, des niveaux diabtiques, de la
modification des protines glomrulaires par MGO et du stress oxydant provoquant
354
une altration morphologique chez les souris sans Gol-1 . Alors que, la
surexpression de Glo-1 chez les souris diabtiques, a empch la modification des
protines glomrulaire par MGO, laugmentation des du stress oxydant et le
dveloppement de la nphropathie diabtique 354.
PARTIE (2) Les phnomnes hypoxiques et immunitaires dans un contexte hyperglycmiques

II. Hyperglycmie et les lsions dI/R rnales :

La combinaison physiopathologique entre lhyperglycmie et lischmie


reperfusion rnale est complexe. Plusieurs phnomnes entrent en jeu pour
potentialiser les uns les autres, aggravant finalement les lsions rnales. 114
Linstallation des phnomnes hypoxiques a t observe dans un contexte
hyperglycmique. En effet, le mtabolisme du glucose et de lO dans le rein est
altr dans ces conditions hypoxiques ainsi que la rgulation de la fonction
dhomostasie en O contrl par le facteur HIF-1. En consquence, une baisse
brutale ou chronique en nergie provoque des complications microvasculaires et la
dfaillance de la fonction rnale axe sur la rabsorption et le transport du glucose et
des lectrolytes.

1. Phnomnes hypoxiques lis lhyperglycmie :

Plusieurs tudes ont montr que lhypoxie reprsente un vnement prcoce


dans le dveloppement et la progression de la nphropathie diabtique 355, 356. Cette
hypoxie est accompagne, prcocement, par lexpression accrue de HIF-1 dans les
reins diabtiques chez le rat 357 et chez lhumain 70. De plus, Inoue et coll., en
particulier, ont confirm lexistence dune hypoxie dans le parenchyme rnal chez
des patients atteints dinsuffisance rnale chronique et dune nphropathie
diabtique 358.

1.1. Pseudohypoxie hyperglycmique:

En 1993, Williamson et coll., taient les premiers utiliser le terme


pseudohypoxie qui dsigne un dsquilibre mtabolique et une modification
vasculaire prcoce caractristiques lhyperglycmie aigu et une hypoxie tissulaire.
Ce dsquilibre est associ une augmentation cytosolique du rapport NADH/NAD
provoqu par une altration de loxydation du NADH en NAD dans le tissu 359. Ces
auteurs ont rapport que le taux tissulaire pyruvate/lactate est un paramtre fiable et
reflte dune manire le rapport cytosolique en NADH/NAD. Cela est bas sur le fait
que loxydation du NADH en NAD est couple la rduction du pyruvate en lactate.
En normoxie, le ratio pyruvate/lactate peut tre expliqu par une augmentation soit
de la noglucogense ou la glycolyse. De plus, le mtabolisme accru de glucose par
PARTIE (2) Les phnomnes hypoxiques et immunitaires dans un contexte hyperglycmiques

la voie sorbitol est le mcanisme le plus important pour induire cette pseudohypoxie
hyperglycmique 359. En fin, la pseudohypoxie doit tre considre comme une
hypoxie mtabolique induite par lhyperglycmie, caractrise par une activation
physiopathologique du facteur HIF-1 mme en prsence de loxygne dans les
cellules. 115

1.2. Consommation de lO et complications vasculaires :

A lorigine, les reins sont loin davoir une hypoxie, car ils reoivent environ 25 %
du dbit cardiaque seulement moins de 1 % du poids corporel total. En gnral, la
pression dO tissulaire est dtermine par lquilibre entre le dbit sanguin et la
consommation dO des tissus. Cependant, il na pas t facile de mesurer cette
pression par un tel simple calcul dans le tissu rnal, parce que les reins reoivent du
sang pour rguler la volmie et la composition sanguine et nest pas pour leur propre
consommation. Maintenant, on sait que lapport dO dans le rein humain est de
84 ml/min/100 g, et la consommation dO dans le rein est de 6,8 mL/min/100 g 360.
En fait, le rein a besoin de 3 % 18 % de la consommation totale dO pour le
mtabolisme de base 360. La pompe Na/K-ATPase qui rgule le gradient
lectrochimique du sodium dans les cellules tubulaires proximales va consommer
80 % de lapport dO destin aux reins 361. Lapport rnal en oxygne dpasse
largement la consommation dO rnale. Cependant, les reins ne souffrent pas de
cette hyperoxie. Ils sont plutt sensibles lhypoxie comme il a t dj observ
dans la nphropathie diabtique (ND) ainsi que linsuffisance rnale aigu. Cela
reste un paradoxe de la physiologie de lO dans les reins.

Lune des raisons de la sensibilit des reins lhypoxie est la diffusion de lO au


niveau des anastomoses artrio-veineuses (shunts artrio-veineux). La formation de
ces anastomoses permettra des changes, court-circuit, entre les artres et les
veines sans passer par un rseau capillaire 362, 363
. Dans les conditions
physiologiques normales, ces shunts artrio-veineux jouent un rle de dfense
antioxydant contre la production accrue des EROs induite par lhyperoxie au niveau
du parenchyme rnal. En outre, il est bien connu que la pression de lO dans les
veines rnales est suprieure celles des artrioles effrentes du cortex externe,
tubules proximaux et distaux 364. Un shunt vasculaire prcapillaire provoque une
PARTIE (2) Les phnomnes hypoxiques et immunitaires dans un contexte hyperglycmiques

rduction la pression de lO des nphrons corticaux rpercutant sur le niveau de la


rabsorption tubulaire 364.
En revanche, la consommation dO des tissus rnaux augmente lors dune
augmentation du dbit sanguin rnale (plus de dbit provoque plus de rabsorption
et donc plus de consommation dO pour gnrer plus dATP). tant donn que le 116
diabte augmente le flux sanguin rnal et la rabsorption active du glucose et du
sodium, la pression sanguine provoque une diffusion dun gradient lev en O entre
les artrioles et les veines. Par consquent, ce gradient dO natteindra pas les
capillaires pritubulaires, favorisant ainsi une hypoxie du parenchyme rnal 365 (Fig.
42).

Figure 41. Schma comparatif dun rein normal et diabtique.


Dans le rein normal, la tension doxygne intrarnale est maintenue des niveaux stables un flux
sanguin physiologique grce linteraction hmodynamique et mtabolique de la circulation
sanguine, la consommation de loxygne et les shunts artrio-veineux de loxygne. Ces shunts sont
dvelopps pour lutter contre lhyperoxie. En revanche, dans le rein diabtique, lhyperglycmie
induit une hyperfiltration qui conduit au dveloppement de plus de gradient artrio-veineux
doxygne. La pression en oxygne au niveau des microcapillaires baisse et expose le parenchyme
365
rnal une hypoxie (rf. ).

Curieusement, une autre architecture vasculaire spcifique implique dans la


golmrulopathie diabtique a t mise en vidence. Plusieurs vaisseaux
supplmentaires ont t observs dans le ple vasculaire glomrulaire, en plus des
artrioles affrentes et effrentes habituelles 366-368. Comme la formation de
nouveaux vaisseaux dans la rtinopathie diabtique, la novascularisation au niveau
du ple vasculaire glomrulaire a t dcrite dans la nphropathie diabtique 366, 367,
369
.
PARTIE (2) Les phnomnes hypoxiques et immunitaires dans un contexte hyperglycmiques

Dans ce cadre, Min et Yamanaka avaient dmontr que 72 % des 73 cas


dautopsie et 21 cas de biopsie de glomrulo-nphropathie diabtique ont dvelopp
plusieurs petits vaisseaux autour du ple vasculaire glomrulaire. Ces vaisseaux
relient une branche dartriole affrente aux capillaires pritubulaires 117
intraglomrulaires. Bien que cette anomalie vasculaire soit spcifiquement observe
dans les reins diabtiques, leur rle pathologique reste inconnu. Les auteurs
suggrent que cette novascularisation pourrait avoir un rle fonctionnel en facilitant
le flux sanguin effrent et compenser lhypertension glomrulaire 368.

1.3. Transport du glucose :

Le rein est lorgane unique qui absorbe, mtabolise et produit le glucose. Il a


besoin dO pour la rabsorption du glucose et dlectrolytes filtrs, et produire lATP
via la phosphorylation oxydative et la glycolyse.

Dans des conditions hypoxiques, afin de produire de lATP pour maintenir la


fonction rnale, les reins utilisent la fermentation anarobie travers leffet Pasteur,
une rponse adaptative au stress hypoxique. Mme dans des conditions
normoxiques, lhyperglycmie provoque une augmentation dafflux de glucose en
mme temps que lactivation de la glycolyse. Cela conduit dautres voies
submtaboliques de glucose telles que la voie des polyols.

Le rein est connu pour tre un organe de noglucogense. En effet, le tubule


proximal est capable de rabsorber du glucose et le synthtiser, mais ne le
mtabolise pas. Alors que la mdullaire rnale utilise ce glucose et gnre le lactate
pour sa glycolyse. Simultanment, les tubules proximaux corticaux prennent le
lactate libr par la mdullaire, lutiliser pour la phosphorylation oxydative, puis
gnrer et librer le glucose pour la production dnergie par la glycolyse mdullaire.

Chez un individu sain, tout le glucose filtr par les reins (180 g du glucose/jour)
est rabsorb partir des tubules proximaux vers la circulation sanguine et aucun
glucose nest limin dans les urines. Le mode de transport du glucose travers les
tubules est assur par des cotransporteurs sodium/glucose (SGTLs : sodium glucose
PARTIE (2) Les phnomnes hypoxiques et immunitaires dans un contexte hyperglycmiques

cotransporters) situs principalement dans la membrane de la bordure en brosse. La


capacit maximale de transport du glucose dans le tubule proximal, en moyenne, est
denviron ~ 375 mg/min. De plus, le gradient lectrochimique du sodium gnr par
le transport actif du sodium fournit lnergie ncessaire pour transporter le
glucose 370. Deux cotransporteurs sodium-glucose sont responsables de la 118
rabsorption rnale du glucose. Le transporteur SGLT2 est principalement exprim
dans le rein et est responsable de la rabsorption de ~ 90 % du glucose filtr. Le
SGLT2 est situ dans la partie proximale (segment S3) des tubules proximaux et
prsente une faible affinit et haute capacit de transporter le glucose. Les 10 %
restants du glucose filtr est rabsorb par SGLT1, qui est situ dans la partie distale
(segment S3) du tubule proximal. Le transporteur SGLT1 a une faible capacit et une
haute affinit pour transporter le reste du glucose qui a chapp de la rabsorption
via SGLT2 371.
Ces SGTLs transportent le glucose de la lumire tubulaire lintrieur de
lpithlium tubulaire o il va saccumuler. Le transport du glucose en hors des
cellules travers la membrane basolatrale, est assur par des transporteurs du
glucose (GLUTs : particulirement le GLUT-2) (insulinodpendant 372, 373
) dans le
sens du gradient avec un transport passif de facilit 374, 375 (Fig. 43).

371
(rf. )

Figure 42. Schma la rabsorption du sodium-glucose dans les cellules de lpithlium tubulaire
proximal.
PARTIE (2) Les phnomnes hypoxiques et immunitaires dans un contexte hyperglycmiques

Il est dj admis que le diabte induit une hyperfiltration glomrulaire 376


favorisant la consommation accrue dO au niveau mitochondrial afin de gnrer
lnergie ncessaire pour la rabsorption 377. Par consquent, dans le rein
diabtique, lhyperfiltration dclenche un cercle vicieux entre lapport doxygne 119
croissant et laugmentation de la consommation doxygne qui conduit plus
dapports en O. Des tudes antrieures ont montr que le FUROSEMIDE, un
diurtique agit au niveau de lanse dHenl en inhibant la rabsorption de la branche
ascendante paisse mdullaire. Aussi, le FUROSEMIDE induit une augmentation de
la tension mdullaire en O en rduisant la consommation de lO plutt que par
laugmentation du flux sanguin mdullaire 378. De plus, lutilisation de
371
DAPAGLIFLAZINE, CANAGLIFLAZINE et EMPAGLIFLOZINE , des mdicaments
antidiabtiques et inhibiteurs du SGLT2, attnuent lhyperfiltration rnale chez des
379 380
sujets atteints de DT1 (EMPAGLIFLOZINE) et DT2 (DAPAGLIFLAZINE ,
381 382
CANAGLIFLAZINE et EMPAGLIFLOZINE ). Ceci suggre que le rle
rnoprotecteur des inhibiteurs de la SGLT2 provoque une rduction de
consommation de lO dans les tubules proximaux rnaux diabtiques.

1.4. Hyperglycmie et rgulation de HIF-1 :

Lhyperglycmie et lhypoxie jouent des rles physiopathologiques essentiels


dans les complications du diabte. Ces complications peuvent rsulter dun dfaut de
rponse des tissus une faible tension dO. Comme cela est dcrit ci-dessus, les
reins sont trs sensibles lhypoxie, cause de la demande en permanence de
lnergie pour leur fonctionnement, ce qui est la raison pour laquelle lhypoxie
contribue au mtabolisme du glucose.

1.1.1. HIF-1 et le mtabolisme du glucose et de lO :

La protine HIF-1 joue un rle cl dans la glycolyse via la rgulation des gnes
codant pour la plupart des transporteurs et des enzymes de la glycolyse. Dans les
reins diabtiques, la tension de lO rnal rduite peut augmenter lexpression de
HIFs et favoriser plutt la glycolyse anarobique que de la phosphorylation oxydative
(en arobie), conduisant la production de lactate (effet Pasteur) au niveau
355, 383
mdullaire . Ce lactate pourrait tre repris par les tubules proximaux corticaux
PARTIE (2) Les phnomnes hypoxiques et immunitaires dans un contexte hyperglycmiques

pour la gluconogense. HIFs pourrait ainsi remodeler le systme de production


dnergie des reins diabtiques en hypoxie.

Comme nous avons dcrit dans le chapitre antrieur, le processus de stabilisation


HIF-1 par lhypoxie est clairement tabli. En normoxie, HIF-1 est dgrad par les 120
protasomes au niveau cytoplasmique. En revanche, pendant lhypoxie, HIF-1 est
stabilis dans le cytoplasme, puis subit une translocation nuclaire o il va jouer le
rle dun facteur de transcription en formant le complexe HIF-1/HIF-1/CBP/p300.
Ce complexe se lie au niveau du HRE pour induire lactivit gnique de HIF-1 via la
transcription de ces gnes effecteurs qui interviennent dans ladaptation des cellules
aux faibles tensions dO. Cependant, les mcanismes sous-jacents de leffet
dltre potentiel de lhyperglycmie sur lhypoxie sont encore controverss. En
dpit des rapports dune varit dtudes dmontrent lexistence de ce phnomne.
En dehors de lhypoxie, le glucose affecte lexpression et lactivation de HIF-1.
En effet, la relation entre le glucose et le HIF-1 est parfois mutuelle. Dune part, il a
t dmontr que HIF-1 rgule lexpression de la quasi-totalit des enzymes
impliques dans le processus de glycolyse et de GLUT1 et GLUT3 qui interviennent
dans labsorption du glucose cellulaire 384. Dautre part, le glucose, labsorption du
glucose et la glycolyse influencent la stabilit et lactivit transcriptionnelle de HIF-1
dans certaines cellules.
HIF-1 est le facteur cl du maintien de lhomostasie cellules en O. Ce rle
biologique a t mis en vidence dans la mdulla rnale en conditions
physiologiques normales et hypoxiques 385. Ltude mene par Rosenberger et coll a
montr qu la fois, lhypoxie rgionale et lhypoxie adaptative transitoire se
produisent dans les premiers stades de la nphropathie diabtique chez le rat.
Lhyperglycmie induit une hypoxie favorisant laccumulation de HIF-1 dans la
mdulla rnale externe 357. De plus, il a t mis en vidence que lutilisation de la
Metformine, un mdicament anti-DT2, induit une inhibition de lexpression de HIF-1
dans les tubules rnaux in vitro, et protge contre la nphropathie diabtique chez le
rat 386.
Cependant, plusieurs travaux ont dmontr que lhyperglycmie altre la stabilit
de HIF-1 dans diffrentes cellules en hypoxie, favorisant sa dgradation
protasomique 387-392. Aussi, il a t dmontr que dans des conditions hypoxiques,
le glucose et le mtabolisme du glucose pourraient promouvoir la voie lubiquitination
protasomale de HIF-1 dans les myocytes cardiaques chez les rats diabtiques 393.
PARTIE (2) Les phnomnes hypoxiques et immunitaires dans un contexte hyperglycmiques

Les auteurs ont suggr que leffet du glucose sur la stabilit de HIF-1 aurait servi
comme un mcanisme de rtroaction. Un mcanisme par lequel HIF-1 a acclr
lexpression et lactivation de GLUT1 pour labsorption du glucose et induire la
glycolyse. Cette glycolyse son tour provoque la dgradation protasomique de
HIF-1 393. Leffet dltre du glucose sur lexpression de HIF-1 a t galement 121
394
observ dans une tude in vitro sur les cellules endothliales . En outre,
lactivation chimique de la stabilisation de la protine HIF-1, utilisant le chloride de
cobalt chez des rats diabtiques, empche les altrations mtaboliques dO induites
par le diabte et pourra protger contre le dveloppement de la nphropathie
diabtique 395.

1.1.2. Hyperglycmie et mcanismes daltration de la voie HIF-1 :

En ce qui concerne les mcanismes impliqus dans laltration de la stabilit


protique et lactivit transcriptionnelle de HIF-1 induites par lhyperglycmie, une
masse dtudes indpendantes avaient t menes sur des cellules ou tissus
obtenus partir de patient ou animal diabtique, ou dans les cellules cultives dans
un milieu de glucose lev. Cela a conduit un consensus selon lequel
lhyperglycmie est responsable des niveaux faibles de protine HIF-1 et de
linhibition de sa fonction transcriptionnelle. Bien que les mcanismes molculaires
sous-jacents qui essaient dexpliquer laltration de HIF-1 dans le diabte ou
glucose lev demeurent mal compris, certaines tudes rcentes envisagent cette
voie dinhibition.
Le mthylglyoxal (MGO), galement appel 2 oxopropanal et pyruvaldhyde,
une molcule principalement forme en tant que sous-produit de la glycolyse. Il sagit
de laldhyde de lacide pyruvique possdant deux groupes carbonyles, lun forme
une fonction aldhyde alors que lautre une fonction ctone. Ce compos chimique
fortement cytotoxique est augment lors dun stress oxydatif accru induit par
lhyperglycmie 396. La surexpression de glyoxalase-I (Glo-I), lenzyme qui catabolise
le MGO, renverse certains effets ngatifs de MGO sur lexpression de HIF-1 397, 398
(Fig. 44).
Laccumulation de MGO des concentrations leves du glucose gnre une
inhibition de la stabilit et lactivit fonctionnelle de HIF-1. En effet, Ceradini et coll.,
ont montr que le MGO provoque une modification covalente de la protine HIF-1
au niveau de larginine 17 (Arg-17) et larginine 23 (Arg-23). Ces acides amins se
PARTIE (2) Les phnomnes hypoxiques et immunitaires dans un contexte hyperglycmiques

situent dans le domaine bHLH (lieu dinteraction de HIF-1 avec HIF-1). Le


changement de la conformation de HIF-1 empchera la formation de lhtrodimre
397
et inhibe en outre la fixation de ce complexe sur HRE de ses gnes cibles . En
outre, dans une tude in vivo, Thangarajah et coll., ont rapport que la baisse de
lactivit fonctionnelle de HIF-1 est due une modification covalente du 122
cofacteur p300 induite par le MGO. Ce changement va empcher la liaison entre
p300 et le domaine CTAD de HIF-1 en hyperglycmie. A contrario, les auteurs de
cette tude ont utilis un agent chlateur nomm Dfroxamine (DFO), qui attnue la
production des EROs et le MGO dans les cellules exposes une hyperglycmie.
DFO a favoris la conjugaison entre la p300 et HIF-1 et lactivation
transcriptionnelle des gnes effecteurs de HIF-1 399 (Fig. 44).
Par ailleurs, Bento et coll., ont dmontr que la modification de la conformation
tridimensionnelle de la protine HIF-1 par MGO dans le cytoplasme, permet une
augmentation de la liaison de HIF-1 avec des protines chaperonne de choc
thermique 40/70 (HSP40/70). Cette association favorise le recrutement de (CHIP :
Carboxyl terminus of Heat-shock protein 70Interacting Protein), une ubiquitine
ligase qui exerce une polyubiquitination pour condamner HIF-1 une dgradation
protasomale. Ce processus indpendant du recrutement de pVHL et de
lhydroxylation de proline par les PHDs, a conduit une diminution spectaculaire de
lexpression de HIF-1 et la perte subsquente de la rponse cellulaire lhypoxie
dans des conditions hyperglycmiques 391 (Fig. 44).

Comme indiqu plus haut, lhyperglycmie augmente le stress oxydatif et induit la


surproduction des EROs qui modulent lexpression de HIF-1 290. En effet, une tude
a rvl que les EROs, en particulier les superoxydes (O) peuvent dgrader HIF-1
au niveau post-transcriptionnel. Le mcanisme de dgradation de HIF-1 par lO
implique lactivation dune hydroxylase de la proline, en prsence de fer, et
laugmentation de lactivit ubiquitine protasomique 400 (Fig. 44).

Par ailleurs, Brouwers et coll., ont montr pour la premire fois que la
surexpression de la glyoxalase-I (GLO-I) rduit les niveaux accrus des AGEs et
EROs induits par lhyperglycmie chez des rats diabtiques 401. Par consquent,
lactivation de la voie GLO-I pourra tre une importante cible thrapeutique pour la
prvention contre les complications mtaboliques et vasculaires.
PARTIE (2) Les phnomnes hypoxiques et immunitaires dans un contexte hyperglycmiques

123

Figure 43. Reprsentation schmatique des modles proposs pour la rgulation ngative de
HIF-1 dans des conditions diabtiques.

L'hypoxie et l'hyperglycmie sont des caractristiques importantes de la plupart des complications diabtiques.
Trois diffrents modles ont t proposs pour expliquer la perte de la rponse cellulaire l'hypoxie et
l'affaiblissement de la rgulation de HIF-1 dans le diabte. Dans le modle A, il est suggr que la production
accrue de mthylglyoxal (MGO) dans des conditions leves en glucose altre l'activit transcriptionnelle de HIF-
1, par des mcanismes impliquant des modifications induites par le mthylglyoxal-de HIF-1. (Modle A1) et du
HIF -1 coactivateur p300 (modle A2). Modification de HIF-1 conduit l'inhibition de l'interaction de HIF-
1/HIF-1, tandis que la modification altre la formation du complexe p300/HIF-1, les deux modifications
aboutissant une diminution du facteur de transcription HIF-1. Dans le modle B, il est propos que le MGO
induite une modification de HIF-1 et conduit une interaction accrue de HIF-1 avec les chaperons
molculaires HSP40/HSP70, par la suite au recrutement de CHIP qui induit HIF-1 polyubiquitination et de la
dgradation par le protasome. Les deux modles A et B reposent sur la production accrue de mthylglyoxal
des niveaux levs de glucose, et l'inhibition de cette augmentation de GLO1 semble empcher la diminution de
l'activit de HIF-1 et la stabilit de HIF-1 sous haute teneur en glucose et des conditions hypoxiques. Dans le
modle C, il est suggr que lhyperglycmie induit la dstabilisation de HIF-1 par un mcanisme dpendant de
VHL et HIF-1 hydroxylases qui est inhibe par le MPO et DMOG, qui sont des inhibiteurs de HIF-1 hydroxylation
bien connu. Les deux modles B et C dpendent de la dgradation accrue de HIF-1 dans des conditions leves
53
en glucose (rf. ).
PARTIE (2) Les phnomnes hypoxiques et immunitaires dans un contexte hyperglycmiques

Nous avons voqu plusieurs mcanismes expliquant le mcanisme par lequel


une hyperglycmie induit la dgradation protasomique de HIF-1. Cependant, il y a
aussi un certain nombre dtudes qui dmontrent que HIF-1 est stabilis et activ
dans des conditions hyperglycmiques par le biais de diffrentes voies. Xiao et coll,
ont montr que les concentrations leves du glucose acclrent la synthse de la 124
protine HIF-1 et de promouvoir sa stabilit dans les cellules de lpithlium
pigmentaire rtinien humaines 402.

De plus, Yan et coll., ont indiqu que lhyperglycmie augmente lexpression de


la protine HIF-1 et induit ainsi son activit transcriptionnelle dans les cellules
endothliales du cerveau 403. Nous explorons quelques molcules impliques dans
leffet positif de lhyperglycmie sur la stabilit et lactivit de HIF-1 dans la section
suivante.

Le promoteur de gne HIF-1 a trois squences E-box-like conserve. Llment


de rponse aux glucides (Chre : carbohydrate response element) est situ dans la
404
rgion proximale de la squence E-box-like . Le carbohydrate protine de liaison
llment de rponse (ChREBP : Carbohydrate response element binding protein) un
capteur trs sensible au glucose, est un facteur de transcription qui vient se lier la
squence chre. Il a t dmontr que la liaison de ChREBP au promoteur HIF-1
dans les cellules msangiales glomrulaires, exposes une concentration leve
du glucose, mdi une augmentation de lexpression de lARNm de HIF-1 405, 406
.
De plus, une tude trs rcente a rapport que lhyperglycmie augmente les
niveaux dO-GlcNAc-ChREBP, qui provoque une accumulation des lipides et
augmentation des protines de la fibrose dans les cellules msangiales. Ce
mcanisme pourra avoir un rle dans la progression de la nphropathie diabtique et
la fibrose rnale chronique 1 (Fig. 45).
PARTIE (2) Les phnomnes hypoxiques et immunitaires dans un contexte hyperglycmiques

Le taux lev de glucose induit par O-


GlcNAc-ChREBP amliore le niveau
ChREBP. Ceci, son tour, active la
transcription de ses protines cibles, en
particulier les protines de la lipogense, 125
la fibrose et HIF-1, ce qui peut rendre
les cellules msangiales plus sensibles
1
lhyperglycmie (rf. ).

Figure 44. Voie de signalisation implique dans la lipogense et la fibrose induite ChREBP dans les
cellules msangiales en glucose lev.

Trs rcemment, Li et coll, avaient mis en vidence un autre mcanisme impliqu


dans le dveloppement de la nphropathie diabtique 407. ADAM17 est un promoteur
important de la fibrose dans les reins diabtiques. Ce promoteur est activ par
lhyperglycmie en rgulant la rponse profibrosante dans les cellules
msangiales 408, 409
. Laugmentation de lexpression dADAM17 a t galement
observe dans les reins des patients 410 et souris 411 diabtiques. Au final, les
auteurs ont montr que lhyperglycmie induit laugmentation de la
transcription ADAM17 via la stabilisation de HIF-1 qui va potentialiser lactivit
dADAM17 dans les cellules msangiales 407 (Fig. 46).

407
(rf. )

Figure 45. Cascade mtabolique liant ADAM17 et les gnes de fibrose au niveau glomrulaire, en
situation dhyperglycmie.
PARTIE (2) Les phnomnes hypoxiques et immunitaires dans un contexte hyperglycmiques

2. Susceptibilit des lsions dI/R lhyperglycmie :

La susceptibilit accrue du rein diabtique la squence ischmique a t


rapporte dans des modles exprimentaux de diabte et chez les humains atteints
126
de diabte 8-11. En effet, une hyperglycmie transitoire a accentu les lsions rnales
dI/R chez les rats 412. De plus, les patients atteints de la nphropathie diabtique
prsentent une hypertension glomrulaire et une hyperperfusion. Ils sont plus
sensibles aux lsions dI/R rnales. Avec lapparition des complications vasculaires
induites par le diabte, la tolrance rnale lI/R est significativement compromise et
le rein est plus susceptible de dvelopper une insuffisance rnale aigu 413. Les
mcanismes responsables de lexacerbation des lsions dischmie reperfusion dans
le diabte nont pas t compltement lucids, mais laugmentation du stress
oxydatif basal (production excessive des EROs et/ou lpuisement endogne du
systme de dfense antioxydant) joue probablement le rle le plus important.

Plusieurs tudes ont dj montr une augmentation de la sensibilit rnale aux


lsions rnales dI/R chez des rats diabtiques. Linduction du diabte (DT1) par la
STZ chez les rats suivie par une squence dI/R de 30 minutes a provoqu des
lsions rnales progressives irrversibles caractrises par une fibrose interstitielle,
inflammation et atrophie et apoptose tubulaire 414-416. De plus, Melin et coll., ont
rapport que lischmie chez des rats diabtiques induits une progression rapide
vers une nphropathie diabtique 417. Un traitement linsuline avant la squence
ischmique rduit les lsions ischmiques, alors que ladministration de linsuline
aprs la priode ischmique na eu aucun effet bnfique chez les rats 418. En outre,
une tude sur un modle de diabte (DT2) murin (db/db) a galement dmontr le
risque de dveloppement dune insuffisance rnale aigu. Dans cette tude, une
reprise retarde du flux sanguin rnal a t observe aprs la squence ischmique
chez les souris diabtiques 419.

Cependant, les mcanismes sous-jacents impliqus dans la vulnrabilit du rein


aux lsions dI/R dans le diabte ne sont pas compltement lucids. Gao et coll.,
ont appliqu une squence ischmique rnale de 20 minutes chez des souris db/db
(DT2) associe dun traitement dun anticorps Anit-TNF-. Les auteurs ont remarqu
que linhibition de TNF- offre une protection contre les lsions ischmique chez ces
PARTIE (2) Les phnomnes hypoxiques et immunitaires dans un contexte hyperglycmiques

souris diabtiques. Cela suggre que le diabte augmente la susceptibilit au


dysfonctionnement des reins induits par lischmie impliquant la rponse
11
inflammatoire via TNF- et peut tre la signalisation de la voie TLR-4 . Trs
rcemment, une tude trs intressante a t mene par Peng et coll 9 pour but de
proposer un mcanisme expliquant cette sensibilit accrue des reins diabtiques 127
lI/R. Dans cette tude, ils ont utilis un modle des souris diabtiques induites par la
STZ (DT1) et souris diabtique FVB/NJ Akita (DT1), ainsi quun modle in vitro des
cellules des tubules proximales rnales cultives dans un milieu dont la
concentration du glucose est leve. Les auteurs ont montr une activation dune
protine p53 (facteur de transcription rgulant certaines fonctions cellulaires
importantes comme la mitose ou la mort cellulaire programme) dans les cellules
tubulaires rnales incubes en haute concentration du glucose ainsi que dans les
tissus rnaux des souris diabtiques. La susceptibilit rnale diabtique aux lsions
9
dI/R en augmentant linduction de p53 et la rduction de lexpression de bcl-2 (B-
cell lymphoma 2), une molcule anti-apoptotique et le BMP-7 (bone morphogenetic
420
protein-7), une molcule anti-fibrosante et prodgnrative . Cependant, en plus
des EROs, il existe dautres facteurs pathognes dans le diabte, y compris la
formation des AGEs qui peuvent aussi conduire une activation accrue de la
protine p53 et donc lactivation de la voie apoptotique 274.

Diverses mthodes ont t mises au point pour viter les lsions dI/R. Le
prconditionnement ischmique est mthode applique de manire mcanique ou
pharmacologique avant de cibler lorgane par une ischmie durable pour rduire
ultrieurement les lsions dI/R 421. Lune de ces mthodes est le prconditionnement
ischmique local (LIPC : Local ischemic preconditioning) qui a t dcrit Murry et coll
422
sur le cur en 1986 . Le but de cette technique est dexposer lorgane une
squence courte dI/R avant la squence ischmique durable. Cependant, cette
mthode prsente des inconvnients tels les traumatismes vasculaires et le stress
423
dorgane . De plus, une autre mthode a t mise en place : le
prconditionnement ischmique distance (RIPC : remote ischemic preconditioning)
qui consiste appliquer une squence courte dI/R un autre organe afin de
minimiser le stress sur lorgane en question 424, 425.
PARTIE (2) Les phnomnes hypoxiques et immunitaires dans un contexte hyperglycmiques

Cependant, le prconditionnement ischmique local semble inefficace dans les


conditions diabtiques. En effet, Ozbilgin et coll ont montr que LIPC ne rduit pas
426
le risque de lsion rnale induite par lI/R dans un modle diabtique de rat . En
revanche un prconditionnement pharmacologique a t montr exercer un effet 128
rnoprotecteur contre les lsions dI/R dans les conditions hyperglycmiques. Wang
et coll ; ont rapport que linduction dune hyperglycmie aigu par glucose 25 %
(3 g/kg) 45 minutes avant la squence ischmique, suivie dune administration de la
dexmdtomidine (un agent sdatif 2-agoniste utilis en anesthsiologie humaine
et vtrinaire) 30 minutes avant la squence ischmique, a attnu les lsions dI/R
427
rnales chez des rats non diabtiques . De plus, un prtraitement par le
svoflurane (anesthsie gnrale) pendant 30 minutes suivi dune squence dI/R
aprs 10 minutes de lexposition au svoflurane, protge les reins contre les lsions
dI/R chez les rats diabtiques (induites par la STZ) 413.

3. Impact des AGEs sur laggravation des lsions dI/R rnales :

Plusieurs rapports ont dmontr que le MGO est augment dans lischmie
reperfusion cardiaque et crbrale. Par exemple, dans lI/R cardiaque, le MGO est
augmente dans les homognats du cur 428. De plus, des produits d'addition MGO-
arginine (argpyrimidine) ont t dtects dans les parois artrielles de la zone
ischmique aprs 24 heures de roxygnation au niveau du cerveau 429. De plus, Il a
t tabli que lhyperglycmie aigu aggrave considrablement les lsions
dischmie reperfusion dans un modle pulmonaire. En effet, la dpltion du
rcepteur des AGEs (RAGE) chez des souris empche lexacerbation des lsions
dischmie reperfusion dans un contexte hyperglycmique, suggrant que
lhyperglycmie aggrave les lsions pulmonaires dI/R via la signalisation du
430
rcepteur RAGE .

Par ailleurs, la relation entre le systme glyoxalase et les lsions dIR rnales a
t mis en examen par Kumagai et coll dans un modle dI/R rnale chez le rat. Une
ischmie unilatrale de 45 minutes a induit une rduction de lactivit Glo-I aprs 24
heures de reperfusion. Cette rduction du systme glyoxalase a t associe des
lsions morphologiques et un dysfonctionnement rnal. En revanche, la
surexpression du Glo-I (humain) chez le rat a amlior significativement les lsions
PARTIE (2) Les phnomnes hypoxiques et immunitaires dans un contexte hyperglycmiques

dI/R en rduisant les lsions tubulointerstitielles et lapoptose de cellules tubulaires


431
ainsi que lamlioration de la fonction ranale . Les auteurs de cette tude ont
montr leffet rnoprotecteur de Glo-I contre les lsions dI/R. Glo-I induit une
rduction du MGO et des AGEs dans les cellules tubulaires (Fig. 47).

129

Figure 46. Mcanisme d'amlioration de l'ischmie reperfusion rnale via la surexpression de la


glyoxalase I (Glo-I).

I/R conduit augmentation du mthylglyoxal (MGO) et diminuer lactivit glyoxalase (Glo-I). MGO ragit avec
des protines pour former les AGEs. Linteraction des AGEs avec leur rcepteur RAGE induit une gnration
dun stress oxydatif qui peut augmenter les niveaux de MGO. La surexpression de Glo-I dtoxifie le MGO et
431
pourra couper le cercle vicieux et amliorer ainsi les lsions rnales dI/R (rf. ).
PARTIE (2) Les phnomnes hypoxiques et immunitaires dans un contexte hyperglycmiques

III. Hyperglycmie et la rponse immunitaire:

1. Pathognie du diabte sucr :

1.1. Diabte type 1 :


130
Le diabte de type 1 (DT1) est une maladie autoimmune caractrise par la
destruction slective des cellules des lots du pancras, dans un contexte dun
432
patrimoine multignique sous-jacent . Quand 80% des cellules sont dtruites,
l'absence dune production conscutive d'insuline mne une l'hyperglycmie
ncessitant une insulinothrapie de remplacement le long de la vie.

1.2. Diabte type 2 :

Le diabte de type 2 (DT2) reprsente plus de 90 % des cas diagnostiqus de


diabte. Cest une maladie htrogne caractrise par une rsistance priphrique
linsuline, une altration de la rgulation glucidique hpatique, et le
dysfonctionnement des des lots. Le DT2 est souvent associ lobsit ou le
surpoids, et une rsistance linsuline pourrait secondaire la coexistence de cette
augmentation de ladiposit 433. Si la rsistance linsuline est prsente, les des
lots augmentent la production dinsuline pour maintenir lhomostasie du glucose.
Lorsque les des lots ne peuvent pas librer suffisamment dinsuline, la
concentration de glucose dans le sang augmente, conduisant lintolrance au
glucose et le DT2. Comme dans le DT1, les facteurs gntiques et de
lenvironnement interagissent dans le dveloppement de la maladie. Contrairement
au DT1, des tudes ont constat que la plupart des gnes impliqus dans le DT2
sont lis la fonction des cellules des lots, alors que les gnes associs un
risque accru de DT1 concernent surtout le systme immunitaire. Un lien entre
lobsit, linflammation systmique, et des complications mtaboliques a t
propos depuis des dcennies 433. Des tudes rcentes ont montr que le
mtabolisme et du systme immunitaire sont fortement associs au dveloppement
dune rsistance linsuline dpendante de lobsit, o les deux systmes
immunitaires inne et adaptative jouent un rle cl.
PARTIE (2) Les phnomnes hypoxiques et immunitaires dans un contexte hyperglycmiques

1.3. Nphropathie diabtique (ND) :

La ND est lexemple prototypique de complications rnovasculaires du diabte et


la principale cause de linsuffisance rnale terminale. Bien quil ait t dmontr que 131
nombreuses interventions thrapeutiques, y compris la rduction de lhyperglycmie
et de la pression intraglomrulaire, pour ralentir la progression de la ND, de
nombreux patients dveloppent encore une maladie rnale au stade terminal. Cela
peut rsulter du fait que les lsions de divers compartiments rnaux dus au diabte
sont peut-tre multifactorielles. Rcemment, lattention de plusieurs chercheurs a t
tablie pour contrler cliniquement linflammation chronique dans le rein des patients
diabtiques. Une tude trs rcente a montr que linhibition du rcepteur du ligand
CCL2 (appel aussi MCP-1) CCR2 (C-C chemokine recptor type 2) impliqu dans
lattraction des cellules proinflammatoires particulirement les monocytes) par le
CCX14-B a un effet rnoprotecteur chez les patients diabtiques DT2 et ND 434.

2. Influence de lhyperglycmie sur la rponse de limmunit inne :

Les perturbations hmodynamiques et mtaboliques induites par


lhyperglycmie ont t considres comme les principaux facteurs favorisant les
lsions rnales diabtiques. Au cours de la dernire dcennie, le rle de limmunit
inne et de la microinflammation ont t apparu comme des facteurs aggravants ces
lsions rnales dans le contexte diabtique. Lvolution de ce concept a dbut avec
la dcouverte de laccumulation des AGEs dans la membrane basale glomrulaire.
Ces radicaux sont capables de stimuler et induire la scrtion de TNF- et
linterleukine-1 (IL-1) par les macrophages, qui expriment le rcepteur des AGEs
435
(RAGE) . Le rle important des macrophages dans la progression de la ND a t
dj dmontr suite une observation dun afflux transitoire de macrophages
principalement dans les glomrules et qui diminue en stade avanc de la
glomrulosclrose diabtique 436.
En fonction de leur phnotype, les macrophages peuvent scrter des cytokines
proinflammatoires ou anti-inflammatoires. Les macrophages classiquement activs
(M1) induisent la production des cytokines proinflammatoires, tandis que les
macrophages alternativement activs (M2) sont capables de moduler les rponses
immunitaires par lintermdiaire des mcanismes antiinflammatoires 120, 437
. Les
PARTIE (2) Les phnomnes hypoxiques et immunitaires dans un contexte hyperglycmiques

macrophages trouvs sur les sites de lsion tissulaire diabtique prsentent un


120, 438
phnotype (M1) . linverse, le transfert adoptif des macrophages (M2) des
souris diabtiques (STZ) a entran une diminution de laccumulation de
macrophages dans le rein. Ces souris ont galement affich une faible atrophie
tubulaire, hypertrophie glomrulaire et expansion interstitielle 439. 132
Une tude rcente a montr que le recrutement des monocytes/macrophages
est fortement corrl avec la progression de la ND. Le facteur de ncrose tumorale
(TNF-) est produit par les monocytes/macrophages, mais le rle direct de TNF-
dans la progression de la nphropathie diabtique restes pas clair. Une tude
rcente a montr que linhibition de TNF- (Anticorps murin anti-TNF-) a rduit
lalbuminurie, la cratinmie, les lsions histologiques tubulo-glomrulaires, le
recrutement des macrophages/monocytes, accompagn dune baisse dexpression
des cytokines inflammatoires telles que MCP-1 [CCL2 (C-C ligand 2)], et les niveaux
des cytokines plasmatiques proinflammatoires, chez des souris diabtiques 2
440
. De plus, la progression de la ND chez des souris transgniques dpourvues de
TNF- dans les macrophages (CD11b TNF /
) et traites avec la STZ tait
significativement rduite. Ltude a prouv que le TNF- produit par les
macrophages, dans un contexte hyperglycmique, joue un rle important dans la
pathognie de la ND 440. Cette nouvelle dcouverte renforce limportance des tudes
antrieures, qui ont lucid le rle des cytokines inflammatoires dans lorchestration
dune srie complexe dvnements de signalisation. En effet, aprs avoir accumul
dans les glomrules et/ou linterstitium, les macrophages initient une srie
dvnements impliquant linteraction avec les cellules rsidentes du rein. La
consquence de cette interaction est la scrtion des cytokines proinflammatoires
qui aboutissent une lsion rnale diabtique.

Dans le milieu diabtique, les facteurs, y compris lhyperglycmie, les AGEs, les
LDL-oxyde les EROs ainsi que langiotensine-II (Ang-II) peuvent activer les cellules
rnales rsidentes msangiales, podocytes, endothliales et tubulaires. Lactivation
de ces cellules induit laugmentation de la scrtion de chimiokines, MCP-1 et CSF-1
(colony-stimulating factor-1), lexpression des molcules dadhsion, ICAM et VCAM
441
. Ces cascades facilitent le recrutement et la migration des monocytes et des
macrophages qui sont en liaison avec les cellules du parenchyme rnal. En outre,
LDL-oxyds induit lactivation des macrophages en se liant sur le rcepteur FCR
(fragment crystallizable gamma receptor). Les AGEs se lient leurs rcepteurs
PARTIE (2) Les phnomnes hypoxiques et immunitaires dans un contexte hyperglycmiques

RAGE, exprims la surface des macrophages, favorisant lactivation et la


maturation des monocytes/macrophages et les lymphocytes T. Les macrophages
induisent, par la suite, la libration et la surexpression de TNF- ainsi que dautres
cytokines proinflammatoires telles que lIL-1, lIL-6 et lIL-18.

133
Ces cytokines et EROs sont labores dune manire autocrine et paracrine,
tablissant ainsi un cercle vicieux de lsions inflammatoires dans les compartiments
glomrulaires et tubulointerstitiels du rein, impliques dans la progression de la ND
(Fig. 48).

442
(rf. )
Figure 47. Squence des vnements dmontrant les lsions inflammatoires dans le rein lors de la
progression de la nphropathie diabtique.

Par ailleurs, dautres tudes ont galement mis en vidence une rduction de
lexcrtion urinaire dalbumine et lamlioration de la fonction rnale aprs
ladministration danticorps monoclonal dirig contre le TNF- (infliximab) chez les
443
rats diabtiques (STZ) , ou dun rcepteur de circulation protine de fusion
(tanercept) chez des souris KK-A (y) diabtiques 444, ou un antagoniste du
445
rcepteur du TNF- (progranuline) . Un autre inhibiteur de petite molcule anti-
inflammatoire, la pentoxifylline (PTX) 446, a t dmontr pour ralentir la progression
de la ND. Cette molcule ayant t aussi teste et valide chez les sujet diabtiques
de type 2 447.
PARTIE (2) Les phnomnes hypoxiques et immunitaires dans un contexte hyperglycmiques

Mis part une augmentation de linfiltration des monocytes/macrophages et la


surproduction de cytokines, des agents chimio-attractifs et des protines de la
matrice dans linterstitium qui contribuent la pathogense de linflammation dans la
ND. Des aperus rcents dans lactivation du systme immunitaire inn et linduction 134
de la cascade proinflammatoire via lactivation des rcepteurs TLRs, spcifiquement
TLR2 et TLR4 dans le diabte et ses complications, ont suscit un intrt significatif
dans ses mcanismes de signalisation cl. Les rcepteurs TLRs sont exprims dans
les diffrents types cellulaires du rein, y compris les cellules dendritiques 448, les
lymphocytes 449, les macrophages 450 ainsi que des cellules rnales telles que les
451 452, 453
podocytes , msangiale cellules , les cellules endothliales 454 et cellules
pithliales tubulaires 455. En outre, Les DAMPs, ligands des TLRs, tels que les
produits de dgradation de la matrice extracellulaire, des acides gras, protines de
choc thermique, hyperglycmie, AGEs, LDL-oxyde, LDL glyque, et EROs, sont
des signaux librs lors dune lsion tissulaire et inflammatoire 456, 457
. La
signalisation, via lactivation de NF-kB, mdiateur cl des voies de linflammation,
favorise la transcription des gnes profibrosants et proinflammatoires impliqus dans
la progression de la ND 458 (Fig. 49).

Figure 48. Signalisation de TLR-2 et TLR-4 dans le rein diabtique.


La libration de ligands endognes dans le milieu diabtique (hyperglycmie, dyslipidmie et hypoxie) active les
rcepteurs TLR-2 et TLR-4 dans les cellules immunitaires et les cellules rnales. Le passage par la voie MyD88
induit lactivation de NF-kB. Ce dernier est responsable de la synthse des cytokines proinflammatoires,
chimiokines, molcules dadhsion cellulaire et des marqueurs profibrosants impliqus dans linflammation et la
459
fibrose conduisant finalement la progression de la nphropathie diabtique (rf. ).
PARTIE (2) Les phnomnes hypoxiques et immunitaires dans un contexte hyperglycmiques

En outre, Il a t dmontr que lhyperglycmie induit la surexpression des


TLR-2 et TLR-4 dans les diffrents compartiments rnaux chez les diabtiques DT1
450, 460 461
, et DT2 . En effet, plusieurs tudes avaient mis laccent sur le rle des
TLR-2 dans la ND. Li et coll, ont montr une surexpression des TLR-2 dans les
135
tubules rnaux chez des rats diabtiques (STZ), avec une augmentation
concomitante de lexpression de MyD88, NF-kB et linfiltration des macrophages 462.
Lexpression de TLR-2 a galement t observe au niveau glomrulaire et
tubulo-interstitiel dans des biopsies rnales des patients atteints la ND 462.
Cependant, lutilisation des souris dpourvues du rcepteur TLR-2 et diabtiques
(STZ) a diminu ltendu de la ND, en attnuant lexpression de TLR-2 la surface
des macrophages, MyD88, et cytokines proinflammatoires 463.

Le rle pathogne du TLR-4 a galement t vident dans la ND. Il a t


dmontr une augmentation de lexpression tubulaire en TLR-4 dans les biopsies
rnales des patients atteints une ND. Cette augmentation a t associe
linfiltration interstitielle des macrophages. linverse, le TLR-2 est exprim
constitutivement sans augmentation de lexpression chez ces patients 464. De plus,
Kaur et coll, ont rapport que lhyperglycmie induit lexpression de TLR-4 dans les
cellules msangiales. Ils ont suggr que lactivation de TLR-4 pourra avoir un rle
dans lexpansion des cellules msangiales et contribuera dans la progression de la
ND chez les patients diabtiques 453. En revanche, les souris dficientes en TLR-4 et
diabtiques (STZ) ont t protges contre lalbuminurie, lactivation de NF-kB dans
le cortex rnal, lexpression tubulaire de MCP-1 et linfiltration interstitielle des
macrophages 464.

2. Influence de lhyperglycmie sur la rponse de limmunit adaptative :

La plupart des recherches ont port sur la contribution des macrophages dans la
pathognie du diabte et de la ND, car ce sont les cellules immunitaires initialement
observes infiltrer les reins diabtiques. Linflammation induite par les macrophages
peut dclencher des mcanismes importants dans la progression de la ND.
Limportance des macrophages dans les lsions rnales diabtiques a t clairement
dmontre; cependant, on sait peu sur le rle des lymphocytes. Les niveaux de
465, 466
circulation des lymphocytes activs taient plus levs chez les patients DT1 .
Ceci suggre que les lymphocytes T activs peuvent aussi tre associs au
PARTIE (2) Les phnomnes hypoxiques et immunitaires dans un contexte hyperglycmiques

dveloppement de ND issue du DT1. Limplication des cellules T dans le


dveloppement de la ND en DT2 reste inconnue.

2.1. Lymphocyte Th1: 136

Les lymphocytes circulants travers les tissus peuvent interagir avec les AGEs
de tissus. Lexposition des lymphocytes T activs aux AGEs peut augmenter
lexpression de linterfron gamma (IFN-). Ceci indique que le rcepteur des AGEs
(RAGE) prsent sur la surface des cellules T pourrait tre li la production des
lymphokines impliques dans les lsions rnales.

Dans les conditions daccumulation excessive des AGEs (le cas du diabte), la
production accrue de lIFN- induite par les AGEs peut acclrer les rponses
467
immunitaires qui contribuent une lsion tissulaire via lactivation des Th1 . Par
consquent, il est possible que les cellules Th1 soient rpandues dans la ND de
DT1. Des niveaux levs dICAM-1 et P-slectine dans le rein diabtique, associe
une augmentation des taux dIFN- ont t associes linfiltration des cellules Th1
effectrices dans les glomrules 468.

Toutefois, on connat mal les mcanismes de la migration des cellules Th1 dans
DT2 au cours du dveloppement et de la progression de la ND. Des niveaux plus
levs dIFN- srique, des cytokines de Th1, et des corrlations positives entre le
plasma IFN-, protinurie, et lestimation des taux de filtration glomrulaire ont t
observs chez des patients diabtiques DT2 prsentant une nphropathie
manifeste 469. Des concentrations plasmatiques leves de lIL-2R (rcepteur de lIL-
2 prsent sur les Th1) ont t trouves chez patients diabtiques DT2 avec une ND
dveloppe. En outre, une corrlation positive significative a t dtermine entre le
plasma IL-2R et la protinurie 469.

Ces rsultats indiquent que limmunit cellulaire de type Th1 et les cytokines
proinflammatoires peuvent tre implique dans les lsions tissulaires chez les
patients atteints de la ND.
PARTIE (2) Les phnomnes hypoxiques et immunitaires dans un contexte hyperglycmiques

2.2. Lymphocyte Th2 :

les lymphocytes Th2, produisant des cytokines IL-4, peuvent contribuer


limmunit humorale, supprimer lactivation des cellules Th1, et fonctionnent comme
une cytokine inhibitrice de lauto-immunit et linflammation 470. Aucun changement 137
significatif de lIL-4 srique a t observ dans les patients DT2 et atteints une
ND 469. IL-10, une autre cytokine importante des Th2, exerce essentiellement des
effets antiinflammatoires et immunosuppressifs 471. Une faible capacit de production
472
de lIL-10 est associe au syndrome mtabolique et du DT2 . Cependant,
certaines tudes ont mis en vidence des niveaux levs de lIL-10 dans le srum
des patients diabtiques atteints de nphropathie. Ces niveaux dIL-10 ont t
corrls avec les niveaux dalbuminurie suggrant sa participation dans la
pathogense de la DN 473, 474.

2.3. Lymphocyte Th17 :

Le lymphocyte Th17 est un troisime type distinct de cellules T auxiliaires. Il a t


rvl jou un rle essentiel dans la pathogense de plusieurs maladies auto-
immunes comme la sclrose en plaques et la polyarthrite rhumatode 475. Plusieurs
preuves dmontrent que les cellules Th17 sont impliques dans le dveloppement
du DT1 chez les patients et dans un modle murin 476-478. De plus, il a t rvl que
les des cellules Th17/Th1 ont acquis un phnotype proinflammatoire chez des
patients DT2, ce qui ncessite des monocytes pour lentretien et promouvoir
479
linflammation chronique via laugmentation de la production de lIFN- et lIL-17 .
Une tude rcente a montr que le taux des cellules Th1 et Th17 intrarnal est plus
lev que le taux des Th1 et Th17 systmique 8 semaines aprs linduction par STZ.
Cette quipe a suggr que Th17 peut jouer un rle indpendant dans la progression
de la ND et la modulation de lIL-17 un potentiel comme cible thrapeutique
immunologique 480.
PARTIE (2) Les phnomnes hypoxiques et immunitaires dans un contexte hyperglycmiques

2.4. Lymphocyte T rgulatrice (T-reg) :

Chez les patients DT2, le taux de cellules CD4CD25Foxp3T-reg reste non


significatif (compar un contrle) 481. En revanche, les patients DT2 prsentant une 138
microalbuminurie et macroalbuminurie avaient montrs une rduction de lexpression
des cellules T-reg. Cette rduction cellulaire de T-reg est plus importante chez les
patients prsentent une macroalbuminurie compars aux patients qui ont une
microalbuminurie. des corrlations significativement inverses ont t notes entre
lvolution de la maladie et lexpression des cellules T-reg, et entre le taux
481
dalbumine urinaire excrt et lexpression de T-reg . La fonction rgulatrice des
T-reg dans le DT2 ncessite plus dinvestigations.

2.5. Lymphocyte T cytotoxique (CD8):

Lactivation des cellules T CD8 dans les tissus adipeux a t dj dmontre.


Les T CD8 favorisent le recrutement et lactivation des macrophages dans les
syndromes mtaboliques. Lutilisation dun anticorps anti-CD8 a attnue linfiltration
des macrophages et la progression de ladipose inflammatoire 482. Dans les reins
diabtiques des souris NOD, laccumulation des CD8 est associe une
augmentation de lexpression gnique de la perforine (enzyme cytotoxique) et
483
granzyme B (une protase secrte par les cellules T CD8 et les NK) . Ceci
suggre que les cellules CD8 peuvent exercer une fonction cytolytique dans le rein
diabtique. De plus, chez les rats diabtiques (STZ) atteints une ND, lexpression
des cellules T CD4 a t plus importante au 1 mois quaux 8 mois, alors que
lexpression des cellules T CD8 est plus importante aux 8 mois post-traitement
STZ 484. Cette tude a suggr que la ND est probablement initie et pilote par les
lymphocytes Th1 proinflammatoire. Cependant, la fonction des lymphocytes
cytotoxiques (CD8) devienne plus importante aux stades ultrieurs de la ND,
lorsque la perte de tissu est vidente 485.
PARTIE (2) Les phnomnes hypoxiques et immunitaires dans un contexte hyperglycmiques

2.6. Lymphocyte B :

Il existe peu de donnes sur le rle potentiel que les cellules B pourraient jouer
dans la pathogense de la ND. En utilisant des souris (NOD) diabtique non obse
(DT1), Xiao et coll., ont montr une infiltration de lymphocytes B avec des 139
483
lymphocytes T et des cellules dendritiques dans les glomrules de ces souris . En
outre, les patients diabtiques DT2 ont montr une augmentation des cellules CD20
(antigne prsent sur la surface des lymphocytes B et joue un rle dans leur
maturation) dans linterstitium rnal. Laugmentation du nombre de ces cellules est
corrle avec la quantit de la protinurie 469.

3. Relation IL-33 et hyperglycmie :

Rcemment, linterleukine IL-33 a t prsente comme une molcule alarmine


qui favorise le recrutement des cellules inflammatoires lors de la nphropathie induite
par le cisplatine chez la souris 207. Ceci suggre que lIL-33 est lune des cytokines
les plus importantes dans la pathogense de diverses nphropathies, y compris la
ND. Un rle controvers de lIL-33 dans la physiopathologie du diabte et dans la
progression de la ND a t mis en vidence chez les patients et dans des modles
animaux. En effet, plusieurs tudes cliniques et exprimentales ont montr une
augmentation des taux sriques de lIL-33 chez les patients diabtiques DT1246, DT2
209
, et dans les modles murins diabtiques 486, 487
. Alors que dautres rapports ont
montr une diminution des niveaux de lIL-33 chez des patients atteints une
nphropathie diabtique 248. Cependant, les mcanismes de rgulation directe de
laxe IL-33/ST2 dans la progression du diabte et la ND nont pas encore mis en
vidence.

Nous avons dj dcrit, plus haut, quen plus de la production accrue des EROs,
lhyperglycmie favorise galement la production massive des AGEs, sont aussi
impliqus dans la modulation de la rponse proinflammatoire, lapparition des
complications microvasculaires de nature hypoxique et finalement laggravation des
lsions tissulaires au niveau rnal. Une tude rcente a montr lexistence dune
relation entre lexpression de lIL-33 et le stress oxydatif et carbonyle induit par
lhyperglycmie. En effet, ltude trs rcente mene par Onk et coll, a rvl que les
niveaux de lIL-33 dans le tissu rnal et le srum ainsi que les marqueurs du stress
oxydant (EROs) ont t significativement augments chez des rats diabtiques (STZ)
PARTIE (2) Les phnomnes hypoxiques et immunitaires dans un contexte hyperglycmiques

486
. De plus, les taux (srique et tissu rnal) de lIL-33, lIL-6 et lIL-1b, se sont avrs
tre augments de manire significative chez les rats diabtiques (STZ).
Laugmentation de ces cytokines a t corrle, dune part, avec les marqueurs de
lapoptose (y compris la caspase-3, caspase-8 clives, et la caspase-9) dans les
glomrules et les tubules, et dautre part avec les marqueurs de lautophagie 140
(LC3B et Beclin-1 : orthologues de la protine Atg6) dans linterstitium et les
487
glomrules . Ces corrlations observes entre les niveaux de lIL-33 et les EROs,
lapoptose et lautophagie suggrent leurs implications dans la pathogense de la
ND.

La suppression du gne ST2 en souris BALB/c conduit une sensibilit accrue


au diabte induit par la streptozotocine, suggrant un effet antiinflammatoire de
488
lIL-33 . Le rle antiinflammatoire de lIL-33 via lactivation de Th2 a t dcrit par
Shruthi et coll. Une augmentation de la concentration srique de lIL-33 et lIL-4
(cytokine de Th2) a t observe chez les sujets DT1 avec ou sans complications
246
microvasculaires (rtinopathie et nphropathie) . Au revanche, Anand et coll., ont
montr une diminution du taux srique en IL-33 associe une augmentation des
niveaux de cytokines Th1 (IL-12, IFN- and IL-2) et suppression de cytokine Th2
(IL-4, IL-5 et IL-13) chez des patients atteints une ND 248.

Jusqu prsent, les donnes bibliographiques nont pas expliqu, de manire


claire, les mcanismes de la susceptibilit des lsions rnales induites par lischmie
reperfusion dans le contexte hyperglycmique. En plus les EROs, les AGEs produits
massivement aprs une hyperglycmie, sont aussi impliqus dans lapparition des
complications microvasculaires de nature hypoxique, la modulation de la rponse
proinflammatoire et finalement laggravation des lsions tissulaires.
Objectifs

141
Objectifs
Ne me dites pas que ce problme est difficile. Sil ntait pas difficile, ce
ne serait pas un problme.

Marchal Foch

Nous avons mis lhypothse quune molcule alarmine, lIL-33, pourrait jouer
un rle cl au carrefour qui lie lhyperglycmie lI/R rnale.

Le premier objectif de notre travail a t de mettre en place un modle


exprimental dI/R rnale chez la souris, afin de slectionner les conditions les plus
adquates pour tester notre hypothse. Nous avons compar notamment leffet du
type danesthsie, le type dabord (ventral ou lombaire), le type dischmie (uni - ou
bilatrale) et la dure dischmie.

Le second objectif de ce travail a t dtudier leffet de la dltion du


rcepteur ST2 de lIL-33 sur les lsions dI/R rnales, en fonction dun contexte
hyperglycmique. Nous avons utilis des souris transgniques dpourvues du
rcepteur ST2 de lIL-33 ou des souris sauvages de mme fond gntique et trait
les animaux par la streptozotocine ou son excipient pour moduler le contexte
dhyperglycmie, permettant dobtenir une hyperglycmie chronique, considre
comme modle de diabte de type 1.
Matriels & mthodes

Matriels & mthodes 142

Protocole exprimental et mise au point du modle dI/R rnale chez la


souris

La thorie, cest quand on sait tout mais que rien ne fonctionne. La pratique,
cest quand tout fonctionne mais que personne ne sait pourquoi.

Albert Einstein
Matriels & mthodes

Les animaux utiliss sont des souris C57BL/6 sauvages et transgniques ST2-/-
dans un fond gntique C57BL/6. Ces souris sont leves au sein de lanimalerie de
lunit U1082 dont les conditions de lumire (cycle 12h de lumire et 12h
dobscurit), de temprature (21 28 C), dhumidit (55 10%), et dalimentation 143
(eau et aliment) ad libitum ont t maintenues. Aprs le sevrage 3 semaines dge,
les souris mles de 8 et 12 semaines dge (adultes) ont t utilises pour nos
expriences.

LI/R rnale est une tape incontournable pour la TR. Elle conduit une
insuffisance rnale aigu (AKI : Acute kidney injury). Une varit de modles
exprimentaux, la fois in vitro et in vivo, ont t utiliss pour tudier les
mcanismes pathogniques de lAKI dorigine ischmique et est test des stratgies
thrapeutiques nphroprotectrices. Parmi ceux-ci, le modle de clampage du
pdicule rnal chez la souris est le plus largement utilis.

La mise en place dun modle dI/R rnale reproductible chez la souris a t


progressivement valide par plusieurs tapes techniques en examinant :

- Le choix de lanesthsie.
- Le choix de labord chirurgical (ventral-mdian ou dorso-lombaire).
- Le type de clampage (uni - ou bilatral).
- La dure de clampage.

1. Le choix de lanesthsie :

Il existe deux formes dadministration dune anesthsie gnrale, soit sous forme
gazeuse par inhalation, soit sous forme injectable intramusculaire (IM) ou
intrapritonale (IP). Ces deux approches sont compatibles avec la chirurgie des
petits animaux et considres comme tant peu coteuses.

Le choix de lanesthsie dpend de nombreux facteurs, comme le type


dopration, les effets anesthsiques souhaits (sommeil et rveil rapide,
Matriels & mthodes

myorelaxant et analgsie), la dure de lopratoire, la vitesse dobtention des effets


anesthsiques et la manire de mtaboliser et dliminer lagent anesthsique.

En chirurgie vtrinaire, lanesthsie par voie inhalation en utilisant une


anesthsie volatile telle que le protoxyde dazote, isoflurane ou lhalothane, combin
lO, ou ladministration injectable dune solution anesthsique comme les 144
barbituriques ou la combinaison ktamine et xylazine, sont les types danesthsies
les plus rpandues. Cependant, la molcule anesthsique pourra avoir une influence
sur les organes tels que le foie (voie de dtoxification du mdicament) et les reins
(voie dlimination des dchets).

Dans cette partie de la mise au point du modle dI/R rnale chez la souris, la
question du choix de lanesthsie a t pose. En effet, il a t voqu que les
anesthsies volatiles 17, telles que Isoflurane 489, Xenon 490 et Propofol 491, ont un
effet rnoprotecteur contre les lsions dI/R. Ainsi, un prconditionnement
ischmique par une exposition lisoflurane a montr un effet bnfique contre les
lsions dI/R rnales chez la souris 492. La procdure usuelle dinduction de
lanesthsie ne comprend pas cette tape de prconditionnement ischmique. Ceci
nous a conduit faire une comparaison entre deux types danesthsies au sein de
notre laboratoire, isoflurane par voie inhale, et combinaison ktamine et xylazine
par voie intrapritonale. Deux groupes de souris mles C57BL/6j dge 8 12
semaines ont t mis tudis. Le premier groupe (n= 5) a t anesthsi par
lisoflurane combin lO, tandis que le deuxime groupe (n= 5) a t anesthsi
par la combinaison ktamine xylazine. Les animaux ont subi une ischmie rnale
unilatrale de 32 minutes.

Isoflurane vs Ktamine/xylazine
Comparaison de type danesthsie isoflurane et
250 la combinaison ktamine/xylazine.
ns
Cratininmie (mg/dL)

200 (n= 5 souris) chez des souris sauvages C57BL/6j


150
Ischmie unilatrale avec nphrectomie
100 controlatrale de 32 minutes.

50 One way ANOVA test.


0
0)

1)

0)

1)
(J

(J

(J

(J
in
in
ne

la

m
xy
m
ra

32
32

a/
lu

IR
t
IR
of

+
is

la
ne

xy
ra

a/
lu

t
of

K
is
Matriels & mthodes

Aprs 24 h de reperfusion, nous avons observ que le niveau de la cratinine


srique tait non significativement diffrent chez les souris anesthsies par
lisoflurane compar au groupe des souris anesthsies par la ktamine/xylazine.
Dans notre protocole, lisoflurane na donc pas un effet rnoprotecteur. 145

Grce ce rsultat, nous avons choisi dutiliser lisoflurane comme anesthsie


pour toutes nos expriences dI/R rnale chez la souris. De plus, lutilisation de
lisoflurane comme anesthsie gnrale a plusieurs avantages techniques mais aussi
thiques assurant le bien-tre de lanimal. En effet, ce type danesthsie propose :

- Une induction et un rveil rapide (moins de stress pour la souris).


- Un stade chirurgical indolore : lanesthsie est maintenue pendant toute le
long de lopration.
- Une anesthsie approprie pour les chirurgies de longue (transplantation
rnale) et courte dures (I/R rnale).
- limination rapide de lanesthsie chez la souris.
- Pas deffets nphrotoxiques observs (les souris anesthsies par lisoflurane
ne dveloppent pas des affections rnales).

Lisoflurane permet galement des conditions favorables pour le chirurgien


particulirement pendant les anastomoses vasculaires lors dune TR. En revanche,
une exposition forte concentration lisoflurane ou pour une priode qui dpasse le
2 heures pourra provoquer des syncopes respiratoires (stade de surdosage :
paralysie mdullaire qui induit une paralysie respiratoire) et la mort de la souris. Dans
le cas de surdosage anesthsique, une ventilation avec lO pur et un massage
cardio-thoracique pourra dans les meilleurs des cas restimuler la respiration et
sauver la souris. Dans nos expriences, la dure opratoire sous anesthsie ne
dpasse pas 45 minutes pour chaque animal.
Matriels & mthodes

2. Le choix de labord chirurgical (dorsal vs ventral):

Chaque type dintervention chirurgicale se fait par une voie dabord lective, en
fonction de la position anatomique de lorgane en question. Le choix de labord est
146
galement un choix du chirurgien pour accder lorgane en question de faon la
moins invasive possible.

Chez la souris, deux voies dincision sont possibles pour atteindre les reins, soit
par voie laparotomie qui est la voie vento-mdiane, ou via la voie dorso-lombaire au
niveau du flanc de la souris. Dans la littrature, les deux abords sont largement
utiliss dans le modle dI/R rnale chez la souris. Dans notre tude, nous avons
voulu savoir si labord chirurgical a un effet sur ltendue des lsions rnales induites
par lI/R. Pour cela, nous avons compar les deux abords (ventral vs dorsal) chez
des souris C57BL/6j de 8 12 semaines dges avec une ischmie bilatrale de 32
minutes (n=4 pour chaque groupe). Un dosage de la cratinine srique a t effectu
pour valuer la fonction rnale suite une ischmie rnale via les deux abords.

Dans la partie suivante, nous allons apporter plus de dtail sur la procdure
chirurgicale commune et les caractristiques techniques de chaque type dabord. Par
la suite, nous allons faire une tude comparative entre les deux abords chirurgicaux.

Figure 49. Plan exprimental gnral des diffrentes approches chirurgicales en I/R rnale.
Des souris mles de 8 semaines dge ont eu une squence ischmique de 32 minutes suivie dune reperfusion
rnale de 24 heures. J0, un prlvement sanguin a t effectu pour valuer la fonction rnale via le dosage
de la cratinine.
Matriels & mthodes

 Procdure chirurgicale :

Une sance chirurgicale est lensemble des procdures pri-opratoires


147
prendre en considration pour pratiquer lacte chirurgical dans les bonnes conditions
tout en assurant le bien-tre de lanimal en question. Ces procdures commencent
ds la prparation de lanimal, passant par lacte chirurgical lui-mme, et sachvent
par une surveillance postopratoire.

A- Prparation et anesthsie de lanimal :

1- Le poil de la rgion de lincision est ras par la tondeuse cheveux.


2- La peau de la rgion chirurgicale est nettoye par lalcool 70 % ou par la
Btadine.
3- Un prlvement sanguin propratoire au niveau de la veine
sub-mandibulaire (utilis pour tablir les paramtres biologiques de base)
4- Linduction anesthsique (2 ml/min dO, 4 % dIsoflurane) pendant 2
3 min dans la chambre dinduction.
5- Le maintien de lanesthsie est assur par 0,5 ml/min dO et 2 %
disoflurane.
6- La souris est place sur une plaque thermostatique afin de maintenir la
temprature corporelle (36,5 37 C) tout le long de lopration. La
chirurgie commence aprs un contrle de la profondeur de lanesthsie
(absence de rponse la douleur induite par le pincement de lorteil).

B- Lacte chirurgical :

Deux abords chirurgicaux sont acquis, un abord dorso-latral (flanc) et un abord


ventro-mdian.
Matriels & mthodes

 Abord dorso-lombaire (flanc) : il consiste extrioriser les reins par


une incision au niveau du flanc selon le modle propos par Wei et coll
493
.
1. La souris est place sur le ct droit et fixe sur la plaque thermostatique
(Fig. 50-A). 148

Figure 50. Lieux d'incision dorso-lombaire chez la souris.

1. Incision dorsale (parallle avec la colonne vertbrale) de 1 1,5 cm au niveau


du 1/3 du corps partir de larrire de la souris (flanc gauche).
2. Le rein gauche est expuls en dehors via lincision laide dun coton-tige
strile pour exposer le pdicule rnal (artre et veine rnale).
3. Dissection du tissu adipeux qui entoure le rein, tout en librant la rgion entre
le rein et la veine cave jusquau pdicule rnal laide dune pincette pointe
ultrafine (la rgion apicale du rein devant tre manipule minutieusement afin
dviter un risque dhmorragie lors du dtachement de la glande surrnale).
4. La souris est place sur le ct gauche (Fig. 50-B).
5. Incision dorsale de 1 1,5 cm en parallle avec le diaphragme (flanc droit).
6. Le pdicule du rein droit est expos et dissqu par une procdure
chirurgicale similaire celle applique au pdicule gauche.
7. Les deux reins sont extrioriss de la cavit abdominale pour pouvoir les
clamper de manire simultane (Fig. 51).
8. La dure entre le clampage du rein gauche et celui du rein droit est
approximativement de 30 secondes 1 minute (la dure dischmie chaude
doit tre la mme pour les deux reins).
9. Les reins sous ischmie sont replacs dans la cavit abdominale pendant la
priode ischmique.
Matriels & mthodes

149

Figure 51. Exposition des deux reins pour une ischmie bilatrale par voie dorso-lombaire chez
la souris.

 Abord ventro-mdiane (laparotomie) :

Il sagit dappliquer une laparotomie qui consiste faire une incision allant du
pubis au bord infrieur du sternum (xiphode). Cet abord offre un accs total aux
organes au niveau de labdomen. Il prsente lapproche chirurgicale la plus
approprie pour pratiquer une ischmie rnale bilatrale ou une transplantation
rnale.

1. La souris est place sur le dos, les pieds attachs contre la plaque
thermostatique (Fig. 52).
2. Une incision franche est ralise laide dune paire de ciseaux bord arrondi
partir du pubis jusquau bord infrieur du sternum (xiphode) au niveau de la
ligne mdiane non vascularise.
3. Un carteur est plac entre les deux bords de lincision assurant une bonne
ouverture de labdomen.
4. Hydratation des intestins par un srum physiologique tide (0,9 % NaCl).
5. A laide de cotons-tiges, les intestins sont dplacs sur le ct droit pour
exposer le rein gauche.
6. Les intestins sont couverts par une compresse chaude.
Matriels & mthodes

150

Figure 52. Exposition de rein droit par voie vontro-mdiane chez la souris.

7. Le tissu adipeux qui entoure le rein est dissqu avec les cotons-tiges et le
pdicule rnal est libr.
8. Aprs prparation du rein gauche, les intestins sont mis sur le ct gauche
pour exposer le rein droit (Fig. 52).
9. La dissection du pdicule du rein droit doit se faire avec des cotons-tiges tout
en vitant la lsion du lobe du foie qui couvre le rein droit (risque
dhmorragie).
10. Le tissu adipeux qui entoure le rein gauche est dissqu dlicatement et
replac dans la cavit abdominale en attendant la prparation du rein droit.
11. Une ischmie de 32 minutes par un clampage simultan des deux reins est
ralise (dlai de 30 secondes).
12. Les intestins sont remis dans la cavit abdominale.
13. La souris est couverte par une compresse pour la tenir au chaud pendant la
priode ischmique.

C- Fin de chirurgie et suivi postopratoire :

1. Aprs le dclampage (la reperfusion), les intestins sont replacs dans la


cavit abdominale.
2. Hydratation des intestins par un srum physiologique avant la fermeture de
labdomen.
3. Les muscles abdominaux et la peau sont suturs avec des points darrt.
Matriels & mthodes

4. Nettoyage de la rgion suture par la Btadine ou lalcool 70 %.


5. Administration immdiate de 0,5 ml de srum (0,9 % sodium chloride) tide
strile en sous-cutan au niveau de lencolure.
6. La souris est mise sur un coussin ou une plaque chauffante jusqu son rveil
avant dtre transfre dans son portoir dhbergement. 151
Dans cette approche comparative entre les deux abords chirurgicaux, une
ischmie bilatrale de 32 minutes provoque une augmentation des taux de la
cratinine sriques via les deux abords aprs 24 heures de reperfusion. Cependant,
aucune dfrence significative na t observe entre les deux abords (ventral vs
dorsal), ce qui suggre que labord chirurgical na aucun effet sur les lsions rnales
induites par ischmie chez les souris C57BL/6 (Fig. 53).

Bilatrale (dorsale vs ventrale)


4 Figure 53. tude comparative des
Cratininmie (mg/dL)

ns abords (dorsal vs ventral) chez la


3
souris C57BL/6 sauvage.
2 Une comparaison dune ischmie
bilatrale de 32 minutes entre labord
1 ventral (n=4 souris) et dorsal (n=4
souris) chez des souris sauvages
0 C57BL/6j (B6). One way ANOVA test.
0)

1)

0)

1)
(J

(J

(J

(J
in
le

e
in

al

m
ra

rs

32
32
nt

do

IR
ve

IR

+
6

B
B

e
le

al
ra

rs
nt

do
ve

6
B
6
B

Les deux abords chirurgicaux sont acquis techniquement au sein de notre


laboratoire. Le choix de type de lincision sera purement technique en tenant compte
des avantages et inconvnients de chaque approche chirurgicale. En effet, labord
dorsal prsente les avantages suivants :

 Moins invasif : il sagit dappliquer de petites incisions dorsales.


 Accs rapide et direct aux reins.
 Moins de dshydratation.
 Moins de perte thermique.
 Les organes au niveau abdominal sont labri et protgs dans labdomen.
 Cicatrisation rapide des lieux dincision.
Matriels & mthodes

 Accs lalimentation : pas de douleur en position debout en postopratoire.

En revanche, labord ventral est envisag pour effectuer la transplantation


rnale chez la souris, car il offre un champ opratoire qui favorise laccs la fois
aux reins et aux gros vaisseaux (veine cave antrieure et laorte abdominale). Les
inconvnients de cet abord sont multiples : 152

 Risque de torsion intestinale lors de lextriorisation des intestins


 Risque de lser les organes de voisinage (diaphragme, foie, rate)
 Plus de dshydratation et perte de chaleur corporelle
 Risque dinfection post opratoire de lieu dincision
 Douleur postopratoire au niveau de lieu dincision (difficult se mettre
debout pour accder lalimentation)
 Laccs labdomen via une laparotomie peut stimuler le systme nerveux
sympathique lors de manipulation des intestins.

Finalement, nous avons utilis labord dorsal comme un abord de choix pour nos
expriences. Cet abord prsente lapproche chirurgicale rapide et relativement
faiblement invasive pour appliquer le modle dI/R rnale bilatrale et unilatrale
avec ou sans nphrectomie controlatrale chez la souris.

3. Le choix de type dischmie (unilatral vs bilatral) :

Globalement, trois modles ischmiques ont t dcrits largement dans la


littrature. Le modle I/R rnal bilatrale qui consiste clamper les deux reins
494, 495
simultanment est le modle le plus utilis , car il simule les conditions
pathologiques o lapprovisionnement sanguin et linsuffisance rnale aigu affecte
les deux reins 493. Cependant, ce modle ne permet pas davoir un rein contrle non
ischmique sur le mme animal. De plus, le modle dischmie rnale unilatrale est
souvent utilis avec ou sans nphrectomie controlatrale. Une ischmie unilatrale
sans nphrectomie est un modle utilis pour tudier linteraction entre les deux
reins. Alors que lischmie rnale unilatrale accompagne dune nphrectomie
controlatrale permettra dutiliser ce rein prlev comme contrle chez la mme
souris.
Matriels & mthodes

Lischmie unilatrale consiste clamper le rein droit et appliquer une


nphrectomie de rein gauche. Alors que lischmie bilatrale consiste clamper les
deux reins simultanment (Fig. 54). Le pdicule est clamp laide dun clamp
micro-anvrisme (clampage valid par le changement de couleur du rein du rouge
vif au violet fonc en quelques secondes) (Fig. 55). 153

Figure 54. Clampage bilatral via un abord dorsal. Figure 55. Clampage de pdicule rnal

Dans notre tude, nous avons voulu savoir si le type dischmie (unilatrale ou
bilatrale) a un effet sur la gravit des lsions rnales induites par lI/R. Pour cela,
nous avons compar les deux types dischmies de 32 minutes (unilatrale vs
bilatrale) chez des souris C57BL/6j de 8 12 semaines dges via un abord dorsal
(n=4 pour le groupe ischmie bilatrale et n= 6 pour le groupe ischmie unilatrale).
Pour valuer la fonction rnale suite une ischmie rnale via les deux types
dischmie, un dosage de la cratinine srique a t effectu.

Abord dorsale (Unilatrale vs Bilatrale) B6


Figure 56. tude comparative de type
4
dischmie chaude (unilatrale vs Bilatrale)
Cratininmie (mg/dL)

ns chez la souris C57BL/6 sauvage.


3

Comparaison dune ischmie de 32


2
minutes entre bilatrale (n=4 souris) vs
unilatrale (n=4 souris) via labord dorsal
1
chez des souris sauvages C57BL/6j (B6).
One way ANOVA test.
0
0)

0)

1)
1)
(J

(J

(J

(J
32

le

32
le

ra
ra

IR

IR
t
t

+
ila
la

le

le
ni

B
ra

ra
U

t
la

ila
ni

B
U
Matriels & mthodes

Dans cette tude comparative entre les deux types dischmie, nous navons pas
observ une diffrence significative des niveaux de cratinine aprs 24 heures de la
reperfusion. Le choix de type dincision est port sur le modle dischmie rnale
unilatrale avec nphrectomie controlatrale, un modle qui nous permettra dutiliser
le rein prlev par nphrectomie comme rein contrle et compar avec le rein 154
ischmique sur la mme souris. En outre, ce modle permettra galement de mimer
la situation de la TR chez lhomme o le rein clamp reprsente le greffe, alors que
le rein nphroctomis reprsente les deux reins en insuffisance rnale terminale (non
fonctionnels).

4. La dure de lischmie chaude :

Nous avons test des dures variables dischmie chaude comprises entre 15 et
32 minutes. Une dure dischmie entre 26 et 32 minutes a permis dinduire de
manire reproductible des lsions caractristiques de linsuffisance rnale aigu
atteste par une ncrose tubulaire aigu. Cette dure de 26-32 minutes qui a donc
t choisie pour nos expriences est considre dans la littrature comme induisant
des lsions dischmie modres, car rversibles au bout de 14 jours post-
ischmique. Une squence ischmique de 45 minutes (ischmie svre) provoque
des lsions rnales irrversibles chez la souris 496.

Cette partie de mise au point du modle a t effectue sur des souris C57BL/6
entre 8 et 12 semaines dge. Les reins de ces souris ont subi des diffrents temps
ischmiques (15, 26 et 30 minutes). Ceci dans le but dvaluer la corrlation entre le
temps ischmique et lvolution des lsions rnales induites par lischmie. Des
lames histologiques des reins ischmiques ont t colores avec la coloration PAS
(periodic acid Schiff). Les lsions rnales dI/R ont t bases sur lobservation de la
ncrose tubulaire aigu, caractrise par la dilatation tubulaire, la perte de la bordure
en brosse et le dtachement cellulaire (Fig. 57).

Aprs une ischmie chaude de 15 minutes, nous avons observ lapparition dun
dme cytotoxique au niveau interstitiel. Cependant, nous navons pas observ des
lsions de souffrance rnale de type ncrose tubulaire aigu comparativement aux
contrles. Ceci suggre que le temps ischmique est insuffisant pour induire ces
lsions dI/R. Par contre, nous avons observ de lgres lsions de ncrose
tubulaire aigu aprs une ischmie chaude de 26 minutes. Par la suite, des
Matriels & mthodes

ischmies de 30 32 minutes ont t ralises chez des souris C57BL/6j nous ont
permet de mettre en vidence des lsions de type ncrose tubulaire aigu plus ou
moins tendues (Fig. 57).

155

Rein non ischmique (Contrle) Ischmie rnale de 15 minutes

Ischmie rnale de 26 minutes Ischmie rnale de 30 minutes

Figure 57. Choix de la dure de lischmie chaude

Finalement, une dure de 32 minutes dischmie chaude a t choisie pour


raliser une ischmie rnale pour cette tude.
Article soumis

156

Article soumis
Article soumis

Title: IL-33 receptor ST2 deficiency attenuates renal ischemia-reperfusion injury in

euglycemic but not in streptozotocin-induced hyperglycemic mice

Running title: Alarmins, renal ischemia-reperfusion and hyperglycemia

Authors: M Sehnine (1,2)*, M Ferhat (1,2)*, S Sena (1,3), JM Gombert (1,2,3), JM Goujon

(1,2,4), A Thierry (1,2,5), T Hauet (1,2,3), A Herbelin** (1,2,3), S Hadjadj** (1,2,6)

*/** both authors equally contributed to this manuscript

Institutions:

1- INSERM U1082, Poitiers, France

2- Universit de Poitiers, UFR Mdecine Pharmacie, Poitiers, France

3- CHU Poitiers, Pole BIOSPHARM, Poitiers, France

4- CHU Poitiers, Department of Pathology, Poitiers, France

5- CHU Poitiers, Department of Nephrology, Poitiers, France

6- CHU Poitiers, Department of Endocrinology and Diabetology, Poitiers, France

Corresponding author:

Samy HADJADJ, samy.hadjadj@gmail.com

Word count: 2300 ; Abstract : 250 words ; 2 Tables, 5 Figures,

Supplementary material: 1 table, 5 Figures

Key words: acute tubular necrosis, diabetic nephropathy, hyperglycemia, IL-33/ST2,

inflammation, renal ischemia-reperfusion, streptozotocin


Article soumis

Abstract

Kidney hypoxia can predispose to the development of acute and chronic renal failure in

diabetes. Ischemia-reperfusion injury (IRI) causes inflammation and diabetes was found to

exacerbate this inflammatory response in the kidney. The alarmin IL-33 could act as an innate

immune mediator during kidney IRI. The aim of the present study was to examine the impact

of genetic IL-33 receptor ST2 deficiency (ST2-/-) on renal IRI in euglycemic and

hyperglycemic mice.

Material and methods: Hyperglycemia was induced with multiple low-dose of

streptozotocin (STZ) in adult male C57BL/6JRj wild-type (WT) mice and ST2-/- mice.

Unilateral renal IRI was achieved after 3 months following STZ treatment, through left

kidney nephrectomy (non-ischemic control kidney) and clamping of the right renal artery for

32 minutes of STZ- and Vehicle-treated animals. Twenty-four hours post-reperfusion, renal

function and injury were determined by measurement of plasma creatinine, blood urea

nitrogen (BUN) and histology scoring of tubules. In a complementary pilot study, soluble ST2

concentration was compared in diabetic and non-diabetic patients.

Results: Urinary albumin was significantly increased in STZ-induced hyperglycemic mice,

regardless of genotypic background. Twenty-four hours post-ischemia, plasma creatinine,

BUN and tubular injury were significantly reduced in ST2-/- mice compared to WT mice, in

Vehicle-treated animals but this protective effect was lost in STZ-induced hyperglycemic

ST2-/- animals. Plasma concentration of soluble ST2 did not significantly differ between

diabetic and non-diabetic patients.

Conclusion: Our data suggest that the IL-33/ST2 pathway exerts differential effects

depending on glucose environment, opening new avenues for further research on alarmins and

diabetes in ischemia-related diseases.


Article soumis

Rsum en Franais

L'hypoxie rnale prdispose au dveloppement de l'insuffisance rnale aigu et chronique,

dans le diabte. Les lsions dischmie reperfusion (IR) sont associes une inflammation et

le diabte facilite la rponse inflammatoire rnale. La voie de lalarmine IL-33 et de son

rcepteur ST2 pourrait agir comme un mdiateur de l'immunit inne pendant le phnomne

dIR rnale. Le but de ces travaux a t d'examiner l'effet du dficit en rcepteur ST2 sur les

lsions dIR rnale chez des souris normoglycmiques et hyperglycmiques.

Matriels et mthodes : L'hyperglycmie a t induite par des injections rptes de faibles

doses de streptozotocine (STZ) chez des souris males adultes C57BL/6JRj sauvages (WT) et

dficiente en ST2 (ST2-/-) La procdure opratoire a t ralise 3 mois aprs l'injection de

STZ et consist en une nphrectomie gauche (rein contrle non ischmique) et clampage de

l'artre rnale droite pendant 32 minutes chez les animaux traits et non traits par STZ. La

fonction rnale et les lsions tissulaires ont t dtermines aprs 24 heures de reperfusion par

dosage de la cratinine plasmatique, de l'ure sanguine et par score histologique. Dans une

tude pilote complmentaire, les concentrations de ST2 soluble ont t compares chez des

sujets diabtiques et non diabtiques.

Rsultats : L'albumine urinaire tait significativement augmente chez les souris

hyperglycmiques, quel que soit le fond gntique. Vingt-quatre heures aprs ischmie, la

cratinine plasmatique, lure et les lsions tubulaires taient significativement rduites chez

les souris ST2-/- comparativement aux souris WT. Cet effet protecteur observ chez les souris

ST2-/- normoglycmiques tait perdu chez les animaux hyperglycmiques. La concentration

plasmatique de ST2 soluble ne diffrait pas entre les patients diabtiques et non diabtiques.

Conclusion : Nos donnes suggrent que la voie IL-33/ST2 exerce des effets diffrentiels

dpendant de l'environnement en glucose, ce qui ouvre de nouvelles voies de recherche sur les

alarmines et le diabte dans les maladies relies l'ischmie.


Article soumis

Introduction

Diabetes mellitus is a chronic condition whose incidence and prevalence are rapidly

increasing globally (1) with chronic renal complications associated in approximately one third

of affected patients (2). In addition to its impact on long-term complications, diabetes is a risk

factor for acute kidney injury (AKI) (3). Recently, diabetes emerged as a risk factor for renal

hypoxia, probably linking acute kidney injury and diabetes (4). Renal ischemia-perfusion

injury (IRI) is an important condition, which can act in conjunction with hyperglycemia to

favor the development of diabetic nephropathy (5). The link between IRI and diabetes is

supported by animal models in which acute transient hyperglycemia increases renal IRI (6; 7).

The relationship between IRI and chronic kidney disease in diabetes is not fully understood

but might involve pro inflammatory pathways, as supported by data in obese diabetic rats (8).

The cytokine/alarmin Interleukin 33 (IL-33), a member of the IL-1 cytokine family, is

released by endothelial and epithelial cells under stress and necrosis and recognized by the

immune system as an endogenous danger signal (8; 9). The recent demonstration that IL-33

contributes to cisplatin-induced acute kidney injury (AKI) (10) leads to hypothesize that the

IL-33 acts as an innate immune mediator during kidney IRI. Indeed, IL-33 targets iNKT cells,

NK cells, polynuclear neutrophils and monocytes/macrophages (8; 9) that are involved in the

development of kidney IRI (11). IL-33 binds to both isoforms of the ST2 receptor, the

transmembrane isoform (ST2 or ST2L) and the soluble isoform (sST2). ST2 heterodimerizes

with IL-1 receptor accessory protein (IL-1RAcP) to transduct IL-33 signals (9).

The role of the IL-33/ST2 pathway was shown to be important in cisplatin-induced AKI (10)

while a deleterious impact of diabetes was previously established in renal IRI (6; 7).

However, the relationship between alarmins and diabetes is largely unknown. The aim of our

study was thus to evaluate the impact of renal IRI in IL-33 receptor ST2 deficient-mice
Article soumis

(ST2-/-), in the context of streptozotocin (STZ)-induced diabetes. We also determined the

plasma concentration of sST2 in diabetic and control subjects, in a complementary pilot study.

Material and Methods

Study animals and surgical procedures

Eight to twelve week-old male wild-type (WT) C57BL/6JRj and mutant (ST2-/-) mice were

used and bred in our animal facility (UFR Medicine, Poitiers) under specific pathogen-free

conditions. ST2-/- mice were generated as previously described (12) and backcrossed onto the

C57BL/6JRj background for 12 generations.

Hyperglycemia was induced by intraperitoneal injections of STZ (50 mg/kg/day for 5

consecutive days) or vehicle (sodium citrate buffer) as previously described

(http://www.diacomp.org/shared/document.aspx?id=19&docType=Protocol), . Animals were

screened for blood glucose using a Bayer glucometer to ensure chronic hyperglycemia.

IRI experiments were performed at 5 months of age. Animals were anaesthetized with

isoflurane. Temperature control was set at 37C. A flank incision was performed and a left

unilateral nephrectomy was performed, allowing access to renal tissue at baseline (D0). IRI

was performed on the right kidney by 32 minutes clamping of the renal pedicle followed by

24 hours reperfusion (D1). Blood and renal tissue were then collected. All procedures were

performed in accordance with the recommendations of the European Accreditation of

Laboratory Animal Care and French institutional committee (CEEA-122: 2012-06).


Article soumis

Renal function tests

Mice were kept in an individual metabolic cage for 24-hour urine collection, 2 days before

surgical procedure. Urinary albumin excretion (UAE) on 24-hour urine collection was

determined with an immunoturbidimetric method. Urinary and blood glucose were

determined using a glucose oxydase method. Blood samples were collected from retroocular

vein plexus. Creatinine and blood urea nitrogen were determined using a modified Jaffes

method and a colorimetric method, respectively on a Modular System P (Roche Diagnostics

GmbH, Mannheim, Germany).

Histological preparation

One half of the kidney was fixed in 4% paraformaldehyde. Paraffin-embedded tissues were

stained with periodic acid Schiff (PAS) and examined using an Olympus BX51 microscope.

A renal pathologist, blinded to experimental conditions, evaluated the presence of acute

tubular necrosis in tubular proximal cell, according to three different criteria: tubular

dilatation, cell detachment and loss of brush border, using a semi quantitative scoring, in a 5-

scale numerical score as follows : 0 : no lesions 1 : lesions affecting less than 25% of kidneys

samples, 2 : lesions affecting 25-50% of kidney samples 3 : lesions affecting 50-75% of

kidney samples 4 : lesions affecting more than 75% of kidney samples (13).

RNA extraction and Real-Time Quantitative Reverse Transcription PCR (qRT-PCR)

Total RNA was extracted from mouse kidney tissue using the Nucleospin RNA Extraction kit,

according to the manufacturers instructions (Macherey-Nagel). One microgram of RNA was

then retro-transcribed using the qScript cDNA Supermix (Quanta Biosciences). Quantitative

real-time PCR were performed with the 2X Perfecta SYBR Green Mix (Quanta Biosciences),
Article soumis

using the Rotor-Gene Q Lightcycler (Qiagen). For each primer pair used, PCR efficiency was

determined and integrated to calculate relative mRNA quantity against a standard curve. We

evaluated six housekeeping genes (-actin, hypoxanthine phosphoribosyl-transferase 1

(HPRT), Ribosomal Protein L5 (RLP5), non-POU-domain-containing, octamer binding

protein (Nono), HydroxyMethylBilane Synthase (HMBS) and vascular endothelial growth

factor A (VEGF-A)) to determine the reference gene most suitable to normalize the Cp value

of IL-33 gene with the same set of kidney samples from euglycemic and hyperglycemic WT

mice. Results were then normalized against VEGF-A as a loading control (identified as the

most stably expressed gene according to the averaged expression stability values). See

Supplemental Table for primer sequences and accession numbers.

Patients and plasma sST2 quantification

Plasma sST2 concentrations were compared in patients with diabetes vs non-diabetic patients.

Blood samples were collected in a fasted state and stored at -80C, until used at the Poitiers

CRB 0033-00068. All patients gave written informed consent and the biobanking project

(Biobanque Maladies Mtaboliques) was approved by the local ethics committee (CPP Ouest

3). The type of diabetes was determined according to clinical factors (age at diagnosis below

40 years in type 1, above in type 2 diabetes), the time for definitive insulin requirement (lower

than 1 year in type 1, higher than 2 years in type 2). Plasma sST2 levels were measured using

the Quantikine Human ST2/IL33 R Immunoassay (R&D Systems), according to the

manufacturers instructions.
Article soumis

Statistical analysis

Data are given as means SD or median (minimum-maximum) if not normally distributed.

Comparison between animal groups was performed using an ANOVA or Kruskal-Wallis test,

if data were skewed. qRT-PCR data were compared using 2-tailed unpaired t-test. Patients

with and without diabetes were compared using unpaired student t-test and chi-2 tests for

categorical variables. Animal and human analyses were performed using GraphPad Prism

version 5.01 software (San Diego California USA) and Statview 5 software (SAS Institute,

Cary, NC, USA), respectively. P value at 0.05 was considered as statistically significant.
Article soumis

Results

1- Baseline characteristics

Baseline clinical and biological characteristics of WT and ST2-/- mice are presented in Table

1.

As expected, blood glucose concentration was higher in STZ-treated mice. Hyperglycemic

animals had a significantly decreased body weight and significantly higher kidney weight and

kidney weight/body weight ratio compared with euglycemic animals. Of note, ST2-/- mice

were leaner than WT mice even though STZ-treated ST2-/- and WT mice were not

significantly different regarding renal parameters.

Urinary albumin excretion (UAE) rates are presented in Figure 1. As expected, UAE was

higher in hyperglycemic mice. Interestingly, in mice with hyperglycemia, urinary albumin

was higher in ST2-/- versus WT mice. However, glomerular histology showed no mesangial

expansion in hyperglycemic animals regardless of WT and ST2-/- genotype (data not shown).

Using RT-PCR, we found an increased renal gene expression of IL-33 (IL-33/VEGF-A

mRNA ratio; relative values) in kidneys from hyperglycemic vs euglycemic WT mice: 1.00

0.19 vs 1.49 0.47, respectively; p = 0.023.

2- Effect of renal IRI

Renal function was analyzed 24hours after renal IR procedure. As expected, plasma creatinine

(Figure 2) and BUN (Figure 3) levels were significantly higher post-IR compared to baseline

in both STZ-treated and euglycemic WT mice. In contrast to WT mice for which no

difference in serum creatinine and BUN levels was found between euglycemic and

hyperglycemic phenotypes, their counterpart levels in ST2-/- mice were lower in euglycemic

compared to hyperglycemic mice (Figure 2 and Figure 3). When comparing control

euglycemic ST2-/- and WT animals, both serum creatinine and BUN levels post-IR were
Article soumis

significantly lower in ST2-/- mice compared to their WT counterparts. This protective effect

was not maintained in hyperglycemic animals, in which serum creatinine (Figure 2) and BUN

levels (Figure 3) post-IR did not differ between ST2-/- and WT mice.

A similar conclusion was obtained when considering histological features of acute tubular

injury (Figure 4 and supplementary figure) showing a statistically significant protective effect

provided by the lack of ST2 in euglycemic control animals but not in hyperglycemic animals.

3- Pilot study: sST2 in diabetic and non-diabetic patients

The comparison between diabetic and non-diabetic patients is presented in Table 2. Briefly

type 1 diabetes patients were leaner than patients with type 2 diabetes.

We found that the plasma concentration of sST2 was not significantly different in diabetes

patients compared with matched controls (See table 2). In addition, no significant difference

was evidenced regarding sST2 concentration between those patients with or without diabetic

nephropathy: 81 (36-985), 103 (65-276) and 124 (54-656) ng/ml; p=0.273, in patients without

nephropathy, with incipient nephropathy and in established nephropathy, respectively.

We found no significant correlation between sST2 concentration and BMI, age or CKD-EPI

estimated GFR (data not shown).


Article soumis

Discussion
Our data showed that the defect of ST2, which is expected to lead to a lack of transmission of

alarmin signals mediated by IL-33 was associated with a reduced kidney injury profile after a

renal IR sequence, as attested by decreased levels of serum creatinine, BUN and lesser

histology scores of tubular injury. However, this protective effect was not maintained in

hyperglycemic animals.

The finding that the lack of ST2 was associated with a reduced renal injury 24-hours after

renal ischemia suggests that the deletion of the signalization of the IL-33 alarmin reduces

acute renal injury. This is in line with the known effects of IL-33, which is released in

response to cell stress, and whose function is to indicate to target cells of an injury requiring

either reparation or apoptosis (9). This is consistent with data generated in another model of

AKI (cisplatin-induced) where administration of IL-33 was associated with more severe renal

injury (10).

Although reported for the first time, to our knowledge, our results of a protective effect

affording by genetic deletion of ST2 in renal IRI are suitable with the commonly described

role of alarmins. However, the finding of a loss of this protective effect in hyperglycemic

animals was unexpected, leading us to speculate that IL-33 exerts differential effects

depending on glucose environment (9).

In this context, we speculate that the IL-33/ST2 pathway could already be up-regulated in

hyperglycemic mice, as supported by our data showing an increased local gene expression of

IL-33 in kidney of hyperglycemic vs euglycemic WT mice, in accordance with a recent

finding (14). On the other hand, since hyperglycemia was previously shown to be associated

with low-grade inflammation (15), we cannot exclude adaptive mechanisms leading to

differential IL-33 signaling. These two non-exclusive hypotheses could explain why when

hyperglycemia is induced, an increase in urinary albumin and a higher susceptibility to IRI

were selectively found in ST2-/- animals.


Article soumis

The molecular effectors responsible for this differential effect of the IL-33/ST2 pathway

could unfortunately not be identified. We focused our analyses on transcripts involved in the

inflammation pathway, such as MCP-1, VCAM1 and ICAM1, but we could not evidence any

differential expression in these candidate genes paralleling biological and histological

findings (data not shown).

The differential protective effect on renal IRI between WT and ST2-/- STZ-treated mice could

depend on hyperglycemia or on renal injury or both. We acknowledge that there is a

statistically significant difference in urinary albumin between euglycemic and hyperglycemic

mice. However, this difference was not associated with any glomerular lesion in favor of an

early diabetic nephropathy stage.

From our data in mice, it is tempting to speculate that the IL-33/ST2 pathway is deregulated

in diabetic patients. Regarding our observational pilot study, the concentrations of circulating

sST2, commonly considered a functional signature of IL-33 signaling in vivo, did not differ

according to diabetes and nephropathy status. To our knowledge, the relationship between

high glucose and the alarmin system was not searched in details in experimental setting, and

only few studies were reported, showing a significant effect of diabetes on sST2 serum

concentration at variance with our findings (16; 17). Although diabetes-related inflammation

is a likely pathway linking chronic hyperglycemia to endothelial and epithelial damage (18;

19), ultimately leading to a vicious circle of more inflammation-driven damage (18), here we

could not find a relevant metabolic pathway linking glucose and alarmins, leaving this

question open.

A remaining question is whether the IL-33/ST2 pathway has an impact not only in the early

post-reperfusion phase of renal IRI, as demonstrated here 24 hours post-IRI, but also in the

subsequent phase of tissue repair/remodeling. Indeed, IL-33 is involved in the development of


Article soumis

fibrous tissue, as reported during chronic inflammation in lung (20). On the other hand, by its

capacity to induce angiogenesis (21), IL-33 might act as a repair factor much later than the IR

phase.

The consequences of our findings in clinical setting must be examined. The inhibition of

alarmins could be a good strategy to prevent IRI and thus represent a possible therapeutic

avenue, in AKI, particularly in non-diabetic persons. This point will be examined with future

developments of some drugs targeting this pathway. However, a second consequence of our

findings is that they give some impetus to search for the relationship between glucose and

alarmins, as this aspect might be involved in the relationship between AKI and diabetes,

considering the deleterious impact of AKI in diabetes patients (22).

Acknowledgments

We thank Jeffrey Arsham for editing the English of our manuscript. We thank Aurlie Robin,

Sbastien Giraud and the staff of U1082 for their kind technical support, Michle Grosdenier

and Sonia Brishoual (CRB 0033-00068) for their help with human samples. This study was

supported by INSERM, CHU de Poitiers, Universit de Poitiers, Association pour la

Recherche en Immunologie-Poitou-Charentes (ARIM-PC, France), Groupement pour lEtude

des Maladies Mtaboliques et Systmiques (GEMMS, Poitiers, France) and Ministre de la

Recherche. ST2-/- mice are a kind gift of A. McKenzie (Laboratory of Molecular Biology,

Cambridge, UK).
Article soumis

References

1. Collaboration NCDRF: Worldwide trends in diabetes since 1980: a pooled analysis of 751 population-based
studies with 4.4 million participants. Lancet 2016;387:1513-1530

2. Rossing P: Prediction, progression and prevention of diabetic nephropathy. The Minkowski Lecture 2005.
Diabetologia 2006;49:11-19

3. Hertzberg D, Sartipy U, Holzmann MJ: Type 1 and type 2 diabetes mellitus and risk of acute kidney injury after
coronary artery bypass grafting. Am Heart J 2015;170:895-902

4. Takiyama Y, Haneda M: Hypoxia in diabetic kidneys. Biomed Res Int 2014;2014:837421

5. Chawla LS, Kimmel PL: Acute kidney injury and chronic kidney disease: an integrated clinical syndrome.
Kidney Int 2012;82:516-524

6. Goor Y, Peer G, Iaina A, Blum M, Wollman Y, Chernihovsky T, Silverberg D, Cabili S: Nitric oxide in ischaemic
acute renal failure of streptozotocin diabetic rats. Diabetologia 1996;39:1036-1040

7. Podrazik RM, Natale JE, Zelenock GB, D'Alecy LG: Hyperglycemia exacerbates and insulin fails to protect in
acute renal ischemia in the rat. J Surg Res 1989;46:572-578

8. Kelly KJ, Burford JL, Dominguez JH: Postischemic inflammatory syndrome: a critical mechanism of progression
in diabetic nephropathy. Am J Physiol Renal Physiol 2009;297:F923-931

9. Molofsky AB, Savage AK, Locksley RM: Interleukin-33 in Tissue Homeostasis, Injury, and Inflammation.
Immunity 2015;42:1005-1019

10. Akcay A, Nguyen Q, He Z, Turkmen K, Won Lee D, Hernando AA, Altmann C, Toker A, Pacic A, Ljubanovic DG,
Jani A, Faubel S, Edelstein CL: IL-33 exacerbates acute kidney injury. J Am Soc Nephrol 2011;22:2057-
2067

11. Jang HR, Rabb H: Immune cells in experimental acute kidney injury. Nat Rev Nephrol 2015;11:88-101

12. Townsend MJ, Fallon PG, Matthews DJ, Jolin HE, McKenzie AN: T1/ST2-deficient mice demonstrate the
importance of T1/ST2 in developing primary T helper cell type 2 responses. J Exp Med 2000;191:1069-
1076

13. Goujon JM, Hauet T, Menet E, Levillain P, Babin P, Carretier M: Histological evaluation of proximal tubule
cell injury in isolated perfused pig kidneys exposed to cold ischemia. J Surg Res 1999;82:228-233

14. Onk D, Onk OA, Turkmen K, Erol HS, Ayazoglu TA, Keles ON, Halici M, Topal E: Melatonin Attenuates
Contrast-Induced Nephropathy in Diabetic Rats: The Role of Interleukin-33 and Oxidative Stress.
Mediators Inflamm 2016;2016:9050828

15. Stehouwer CD, Gall MA, Twisk JW, Knudsen E, Emeis JJ, Parving HH: Increased urinary albumin excretion,
endothelial dysfunction, and chronic low-grade inflammation in type 2 diabetes: progressive,
interrelated, and independently associated with risk of death. Diabetes 2002;51:1157-1165

16. Caporali A, Meloni M, Miller AM, Vierlinger K, Cardinali A, Spinetti G, Nailor A, Faglia E, Losa S, Gotti A,
Fortunato O, Mitic T, Hofner M, Noehammer C, Madeddu P, Emanueli C: Soluble ST2 is regulated by
p75 neurotrophin receptor and predicts mortality in diabetic patients with critical limb ischemia.
Arterioscler Thromb Vasc Biol 2012;32:e149-160

17. Miller AM, Purves D, McConnachie A, Asquith DL, Batty GD, Burns H, Cavanagh J, Ford I, McLean JS, Packard
CJ, Shiels PG, Turner H, Velupillai YN, Deans KA, Welsh P, McInnes IB, Sattar N: Soluble ST2 associates
Article soumis

with diabetes but not established cardiovascular risk factors: a new inflammatory pathway of
relevance to diabetes? PLoS One 2012;7:e47830

18. Lopes-Virella MF, Carter RE, Gilbert GE, Klein RL, Jaffa M, Jenkins AJ, Lyons TJ, Garvey WT, Virella G: Risk
factors related to inflammation and endothelial dysfunction in the DCCT/EDIC cohort and their
relationship with nephropathy and macrovascular complications. Diabetes Care 2008;31:2006-2012

19. Nguyen DV, Shaw LC, Grant MB: Inflammation in the pathogenesis of microvascular complications in
diabetes. Front Endocrinol (Lausanne) 2012;3:170

20. Li D, Guabiraba R, Besnard AG, Komai-Koma M, Jabir MS, Zhang L, Graham GJ, Kurowska-Stolarska M, Liew
FY, McSharry C, Xu D: IL-33 promotes ST2-dependent lung fibrosis by the induction of alternatively
activated macrophages and innate lymphoid cells in mice. J Allergy Clin Immunol 2014;134:1422-1432
e1411

21. Choi YS, Choi HJ, Min JK, Pyun BJ, Maeng YS, Park H, Kim J, Kim YM, Kwon YG: Interleukin-33 induces
angiogenesis and vascular permeability through ST2/TRAF6-mediated endothelial nitric oxide
production. Blood 2009;114:3117-3126

22. Monseu M, Gand E, Saulnier PJ, Ragot S, Piguel X, Zaoui P, Rigalleau V, Marechaud R, Roussel R, Hadjadj S,
Halimi JM, Group SS: Acute Kidney Injury Predicts Major Adverse Outcomes in Diabetes: Synergic
Impact With Low Glomerular Filtration Rate and Albuminuria. Diabetes Care 2015;38:2333-2340
Article soumis

Table 1: Baseline clinical and biological characteristics of WT and ST2-/- mice with and without STZ-induced hyperglycemia
Article soumis

Table 2

T1 T2 Controls P value
all 3 T1 vs T1 vs
groups T2 Controls
Age (yrs) 61.5 +/- 8.7 66.3 +/- 9.4 42.2 +/- 12.5 <0.0001 <0.0001 <0.0001
Sex (M//F) 18//15 30//30 19/20 0.915 0.675 0.782
Body mass index (Kg/m2) 25.3 +/- 3.7 33.4 +/- 5.1 24.5 +/- 4.4 <0.0001 0.0014 0.528
Serum ST2 (ug/l) 111 (42-579) 85 (60-935) 126 (29-711) 0.476 0.436 0.961
SBP (mm Hg) 123 +/- 25 126 +/- 15 / / 0.456 /
DBP (mm Hg) 68 +/- 16 70 +/- 11 / / 0.484 /
HbA1c (%) 7.9 +/- 1.4 7.5 +/- 1.2 / / 0.139 /
Serum creatinine (umol/l) 75 +/- 13 105 +/- 62 / / 0.069 /

T1, is for patients living with type 1 diabetes (T1DM)


T2, is for patients living with type 2 diabetes (T2DM)
Data are means +/ SD or medians (min-max) if not normally distributed
Article soumis

Figure legends

Figure 1: Urinary albumin excretion in WT and ST2-/- mice with euglycemia or STZ-

induced hyperglycemia. Data are means and error bars are SEM (n=8 mice per group). ns,

non significant; * P < 0.05, *** P < 0.0001 (Mann-Whitney test for between group

comparison).

Figure 2: Serum creatinine in WT and ST2-/- mice with euglycemia or STZ-induced

hyperglycemia. D0 data correspond to baseline data. D1 data correspond to data 24 hours

after reperfusion following 32 minutes warm-ischemia. Data are means and error bars are

SEM (n=8 mice per group). ns, non significant; * P < 0.05, ** P < 0.001, *** P < 0.0001

(Mann-Whitney test for between group comparison).

Figure 3: Blood urea nitrogen in WT and ST2-/- mice with euglycemia or STZ-induced

hyperglycemia. D0 data correspond to baseline data. D1 data correspond to data 24 hours

after reperfusion following 32 minutes warm-ischemia. Data are means and error bars are

SEM (n=8 mice per group). ns, non significant; * P < 0.05, ** P < 0.001, *** P < 0.0001

(Mann-Whitney test for between group comparison)

Figure 4: Acute tubular necrosis staging in WT and ST2-/- mice with euglycemia or STZ-

induced hyperglycemia. D0 data correspond to baseline (control kidney obtained by left

nephrectomy). D1 data correspond to data 24 hours after reperfusion, following 32 minutes

warm-ischemia. Data are means and error bars are SEM (n=8 mice per group). ns, non

significant; * P < 0.05, ** P < 0.001, *** P < 0.0001 (Mann-Whitney test for between group

comparison).
Article soumis

Supplementary Figure: Representative histological findings at baseline and at D1 (24


hours after reperfusion, following 32 minutes warm-ischemia). Light microscopy on PAS
stained kidney samples. Arrows represent typical acute tubular necrosis with extensive tubular
dilation.
Figure 1:

Urin ary alb u min e xcre tio n (UAE)


(g/24h )
W
T

0
5
10
15
20
(V
eh 25
ic
le
)
W

*
T
(S
TZ
ns

ST
2 )
-/-
(V
eh
ic
le
*

)
ST
2
***

-/-
(S
TZ
)
Article soumis
Figure 2:

Serum Creatinine
W (mol/L)
T
(b

20
40
60
80
100

0
as
e lin
W
T e)

D0
(V
**

eh
i cl
e)
**

D1
W
ST T
ns

2 (S
-/- T Z)

D1
(b
as
*

ST el
2 in
e)
**

-/-
(V D0
**

eh
ns

ic
ST le
)
***

D1

2
-/-
**

(S
TZ
)
D1
Article soumis
Figure 3:

W BUN (mg/dL)
T
(b

0
5
10
15
20

a se
W lin
T e)

D0
(V
**

eh
i cl
**

e)

D1
W
ST T
ns

2 (S
- /- TZ
)
D1
(b
as
*

ST el
2 in
**

- /- e)
D0
(V
*

eh
ns

ic
ST le
)
D1

2
***

- /-
*

(S
TZ
)
D1
Article soumis
Figure 4:

W Acute tubular necrosis


T
(b

0
4
8
12
as
e lin
W
T e)

D0
(V
eh
ic
le
)

D1
W
ST T
ns

2 (S
- /- TZ
)

D1
(b
as
*

ST el
2 in
*

- /- e)

D0
(V
eh
ns

ic
ST le
2 )

D1
-/-
*

(S
TZ
)
D1
Article soumis
Article soumis

Supplementary table: Primer sequences used for quantification of mRNA levels by RT-

PCR

Gene Name
Gene Sequence of forward and reverse primers (5 3)
Amplicon size (base pair, bp)
GenBank Accession Number

Interleukin 33, Mus musculus (IL33)


Forward : CTACTGCATGAGACTCCGTTCTG
Reverse : AGAATCCCGTGGATAGGCAGAG
136 bp
NM_001164724

Vascular Endothelial Growth Factor A, Mus musculus (Vegfa)


Forward : CTGCTGTAACGATGAAGCCCTG
Reverse: GCTGTAGGAAGCTCATCTCTCC
119 bp
NM_001025250

Primer pairs were designed based on GenBank reference sequences. We used the Primer
BLAST interface from NCBI. Unless specified, each primer-pair is separated at least by one
intron on the corresponding genomic DNA. To avoid non-specific amplifications, primer
sequences were blasted against mouse genes. Dissociation curves were analyzed and agarose
gels were run for all primer-pairs to ensure single product amplification.
Article soumis

Supplementary Figure

D0

ATN ATN

ATN

ATN

ATN

ATN
ATN ATN
Discussion gnrale

Discussion gnrale

Malgr laugmentation significative du nombre de prlvements destins la


182
transplantation rnale ralise en France au cours des dernires annes, il existe
aujourdhui, du fait de la prvalence leve de la maladie rnale chronique, une
situation proccupante de pnurie de greffons. Lventualit dutiliser des donneurs
critre largi, particulirement les donneurs diabtiques a t voque pour faire
face la pnurie dorganes. La combinaison physiopathologique entre
lhyperglycmie et lischmie reperfusion rnale est complexe. Une tude a montr
que lischmie chez des rats diabtiques induits une progression rapide vers une
nphropathie diabtique 417. Cependant, les mcanismes sous-jacents impliqus
dans la vulnrabilit du rein aux lsions dI/R dans le diabte ne sont pas
compltement lucids, mais peuvent inclure des voies proinflammatoires, comme a
t soutenu par des donnes chez les rats obses diabtiques11. Laxe IL-33/ST2 a
t suggr avoir un rle jouer autant quune alarmine/cytokine dans la
combinaison entre lI/R rnale et la maladie rnale chronique comme le diabte.

Dans ce travail, nous avons valu leffet dinhibition de la voie de signalisation


IL-33/ST2 sur les lsions dI/R rnales dans un contexte hyperglycmique. Pour cela,
nous avons mis en place un modle dischmie reperfusion rnale chez des souris
hyperglycmiques dpourvues du rcepteur lIL-33 (ST2). Lhyperglycmie a t
induite par ladministration de la streptozotocine (STZ) favorisant lapparition des
symptmes observs chez les diabtiques DT1.

Dans notre tude, une hyperglycmie de 3 mois a induit une augmentation


significative de lexpression gnique de lIL-33 chez les souris WT (STZ) compare
aux souris WT (vhicule). En absence du rcepteur ST2 (ST2-/-) lIL-33, les niveaux
de la glycmie et de la glycosurie ont t significativement levs compares aux
souris sauvages (WT) diabtiques. Ceci montre que les souris ST2-/- sont plus
sensibles au traitement de STZ et que lIL-33 avait un rle protecteur contre les effets
dltres de lhyperglycmie. Cette constatation a t observe chez des souris
BALB reconnues comme tant des souris rsistantes au diabte. La suppression du
gne ST2 chez ces souris a provoqu une sensibilit accrue au diabte induit par la
STZ. De plus, il a t rapport dans la mme tude que cette susceptibilit vers le
Discussion gnrale

diabte DT1 est accompagne par la production des niveaux levs de cytokines
488
proinflammatoires telles que TNF-, IFN- et IL-17 . Ce qui suggre que leffet
rnoprotecteur de lIL-33 chez les souris est d son rle comme tant une cytokine
antiinflammatoire (dans les situations chroniques) qui favorise la voie des
cellules Th2 et inhibe la voie Th1/Th17. 183
Lalbuminurie, un signe de la souffrance rnale, a galement t dose dans
notre tude. Aprs 3 mois diabte, en comparant les souris diabtiques (WT vs
ST2-/-), une augmentation significative de lalbumine urinaire a t observe chez les
souris ST2-/- diabtiques, ce qui suggre encore une fois le rle protecteur de lIL-33
contre les altrations rnales induites par lhyperglycmie. Cependant, lobservation
histopathologiques de cette nphropathie dtecte chez les souris ST2-/- diabtiques
na montr aucune lsion glomrulaire aprs 3 mois dhyperglycmie.

Normalement, le diabte type 1 (DT1) rsulte dun dsordre en production de


linsuline. Il favorise lapparition des symptmes pathognomoniques en particulier
lhyperglycmie, le syndrome polyurie polydipsie et albuminurie 497. Sur le plan
histologique, dans le DT1, les lsions rnales touchent la fois les glomrules, les
artrioles, linterstitium et les tubules, mais latteinte glomrulaire est la lsion la plus
importante. Lpaississement de membranes basales glomrulaires (MBG) est la
premire modification quantifiable dans le DT1. Il peut tre mis en vidence
498
prcocement, un an et demi deux ans et demi aprs le dbut du diabte . Dans
notre tude, nous pensons quune dure de 3 mois dhyperglycmie nest pas
suffisante pour pouvoir identifier ces lsions glomrulaires initiatrices de la
nphropathie diabtique. En outre, ces lsions apparaissent probablement plus
tardivement chez la souris. Une tude en microscope lectronique sera une
approche technique envisageable pour mesurer lpaississement de la membrane
basale glomrulaire et confirmer lexistence des lsions glomrulaires induites par
lhyperglycmie chez ces souris traites par la STZ.

De plus, afin dtudier limpact de lI/R rnale dans le contexte hyperglycmique,


nous avons pratiqu une squence ischmique de 32 minutes chez des souris
sauvage (WT) et souris mutes (ST2-/-) aprs 3 mois de traitement par la STZ.
Discussion gnrale

Aprs 24 heure de la reperfusion rnale, les niveaux sriques de la cratinine et


ure (BUN : blood urea nitrogen) ont t significativement levs chez les souris WT
(Vhicule et STZ). En outre, J1, aucune diffrence de ces niveaux na t dtecte
chez les souris WT (Vhicule vs STZ). Ce qui suggre que la prsence de lIL-33 a 184
un effet dltre sur les lsions rnales induites par I/R chez les souris sauvages.
Leffet dltre de lIL-33 a t confirm par les observations des lsions
histologiques caractrises par une augmentation significative de ncrose tubulaire
aigu. Cependant, lenvironnement (normoglycmique ou hyperglycmique) ne
semble pas avoir un impact sur leffet dltre de lIL-33 sur les lsions dI/R chez les
souris WT.

En dehors du contexte hyperglycmique, lIL-33 a t prsente comme une


molcule alarmine implique dans la pathogense des lsions rnales aigus dans
207
un modle cisplatine chez la souris . Dans cette tude, une corrlation entre
laugmentation de lexpression protique rnale en IL-33 et linfiltration des cellules
proinflammatoires a t mise en vidence chez les souris traites par la cisplatine.
Aussi, ladministration de lIL-33 recombinant (rIL-33) a aggrav les lsions rnales
207
aigus induites par le cisplatine . Leffet dltre de lIL-33 dans un modle dI/R
rnale murin a galement t dmontr dans le travail de Maroua F au sein de notre
quipe. Maroua a montr que les souris transgniques dpourvues en IL-33 sont
protges contre lI/R rnale et les ncroses tubulaires aigus aprs 24 heures de
reperfusion. En parallle, leffet dltre de lIL-33 a t confirm, dans notre tude,
par la dpltion gnique de son rcepteur (ST2) chez des souris normoglycmiques.
Une baisse significative de la concentration srique en cratinine et lure ainsi
quune baisse significative de lampleur des lsions histologiques ont t mises en
vidence 24 heures aprs lI/R rnale. Ce qui suggre que labsence du rcepteur
ST2 a un effet rnoprotecteur contre les lsions dI/R. Ces rsultats pourraient tre
expliqus par la libration de lIL-33 partir des cellules ncrotiques endommages
par des stimuli tels que lischmie, le stress oxydant et lhyperglycmie par exemple.
Aprs sa libration, IL-33 se fixe son rcepteur et induit une signalisation
intracellulaire. Lactivation de cette signalisation favorise la transcription des facteurs
impliqus dans le recrutement des cellules proinflammatoires telles que les
macrophages et les neutrophiles de phnotype Th1, des cellules qui aggravent les
lsions dI/R rnales. Cependant, linterruption de la signalisation de lIL-33 (soit par
Discussion gnrale

la dpltion de lIL-33 ou son rcepteur ST2) a probablement limit linfiltration de


ces cellules proinflammatoires protgeant le rein contre les lsions I/R.

En revanche, leffet protecteur de la dficience en ST2 contre les lsions I/R a


t perdu dans les conditions hyperglycmiques. Linactivation de laxe IL-33/st2
induit laltration des lsions rnales dIR dans le contexte diabtique. Ce qui peut 185
suggrer quil peut y avoir dautres voies dltres impliques en hyperglycmie. Les
AGEs (molcules cytotoxiques) sont surproduits lors dune hyperglycmie. Aprs une
ischmie reperfusion, un stress oxydant accru se met en place et la formation des
EROs saccroit et les AGEs encore plus. Cela suggre que la voie AGEs/RAGE
pourra tre une voie qui marche en parallle avec laxe il-33/ST2 pour induire les
lsions rnales en hyperglycmie (en prsence ou absence de ST2, laxe AGEs/rage
est toujours fonctionnel) ce qui explique le mme tendu lsionnel entre les souris
diabtique (sauvage ou mute en ST2) en post ischmie. Une autre voie ne pas
ngliger la voie TLR-4 qui est galement indpendance de la voie IL-33/st2 et qui
activ par lhypoxie et lhyperglycmie. Cette voie peut galement induire des lsions
rnales. Le mcanisme expliquant cette perte de protection contre les lsions dI/R
en absence de rcepteur ST2 dans un contexte hyperglycmique nest pas encore
clair, laissant la question ouverte. Pour rpondre sur cette question, plusieurs gnes
ont t valus par RT-PCR, deux gnes TSP-1 (Thrombosplondine 1 : une
molcule implique dans la coagulation) et IL-6 sembleraient impliquer dans la
protection contre les lsions dI/R chez les souris mutes ST2 en normoglycmie.

Les phnomnes hypoxiques observs au niveau rnal dans un contexte


ischmique et hyperglycmique nous a orient tudier le facteur HIFs, vu son rle
dans le maintien de lhomostasie cellulaire en O. Nous avons examin lexpression
protique et gnique de HIF-1 aprs 24 heures de la reperfusion chez des souris
sauvages et mutes en ST2. Malheureusement, nous navons pas une rponse
claire sur le rle de HIF-1 dans ces diffrentes situations. HIF-1a est une molcule
dgradation rapide dans la cellule (5 minutes), nous pensons que 24 heures aprs
ischmie sont trop tard pour valuer lexpression de cette molcule importante. Une
cintique des temps ds les premires heures de la reperfusion sera utile pour
tudier son implication. En outre, nous avons vu que lexpression de lIL-33 local
(rnal) est augmente chez les souris diabtique sauvage compare aux souris non
diabtiques. La question de lorigine locale ou systmique de lIL-33 a t pose
chez les souris traites par STZ. La STZ provoque des endommagements des
Discussion gnrale

cellules des lots pancratiques ce qui suggre une libration de lIL-33 dans la
circulation sanguine en affectant par la suite les lsions dI/R rnales. Un dosage
srique en ST2s ou en IL-33 ainsi une tude immunohistochimique pour localiser IL-
33 au niveau local permettra dvaluer les voies dimplication de lIL-33 dans les
conditions hyperglycmiques. 186
Finalement, plusieurs limitations ont t confrontes dans notre modle, le
modle diabtique qui a t utilis dans notre tude est un modle DT1 chez les
souris. Ces dernires ont t traites par la streptozotocine (STZ), une molcule qui
provoque une cytotoxicit des cellules lots pancratiques en assurant donc leur
destruction. Or, il a t dj rapport que la STZ induit galement une nphrotoxicit
chez la souris 499 et le rat 500. Dans ce modle, il est difficile de dfinir la relation
entre lischmie et hyperglycmie au niveau rnal en prsence de leffet cytotoxique
rnal induit par la STZ. Parmi les pistes qui peuvent apporter une rponse la
question, on a le traitement par linsuline exogne afin de normaliser la glycmie et
surveiller lvolution de la fonction rnale : lalbuminurie, la filtration glomrulaire
rnale et la protinurie qui refltent les conditions diabtiques. Ceci pourra confirmer
limplication de lhyperglycmie dans laltration de la fonction rnale et ngliger les
effets nphrotoxiques dans ce modle.

Le taux de survie des souris diabtiques (STZ) est stable et maintenu pendant
les 3 mois qui succde le traitement (pas de dcs enregistr). A part quelques
souris traites par STZ confirmes hyperglycmiques aprs 1 mois de traitement, ont
t trouves en normoglycmie. Ce qui suggre une possible rgnration des
cellules pancratiques productrices de linsuline. En effet, cette rgnration des
cellules a t observe 48 heures aprs un traitement de STZ dose unique de
65 mg/kg chez des rats SD (Sprague-Dawley) 501.

En revanche, un taux de mortalit trs lev a t observ aprs une squence


dischmie rnale chez ces souris STZ. Ce constat nous a men reporter lide de
la rparation post ischmique chez les souris diabtiques. Une rparation tissulaire
qui dbutera normalement en parallle avec linfiltration des cellules macrophages
M2 de phnotype antiinflammatoire. Cette monte de M2 entre les J4 et J8, est
caractrise par la production des cytokines telles que lIL-4, lIL-10 et TGF- pour
arrter linflammation, le TGF- et Galectin-3 pour induire la fibrose des tissus
gravement lses et Wnt7b, BRP-39 pour initier la rparation tissulaire. On suggre
Discussion gnrale

quun traitement base dinsuline exogne pourra amliorer la survie post-


ischmique chez les souris diabtiques (STZ).

Or, dautres modles de souris diabtiques nous semblent plus pertinents


utiliser pour tudier la relation entre lhyperglycmie et lischmie reperfusion. La
souris transgnique C57BL/6 Ins2 appeles aussi Akita, une htrozygote 187
dveloppe un diabte insulino-dpendant, y compris hyperglycmie,
hypoinsulinmie, polydipsie, polyurie, non obse. Cette souris sera trs utile pour
tudier les complications diabtiques telles que la nphropathie ainsi que la
rparation rnale post ischmique.

De plus, nous avons effectu, dans notre modle, le clampage du rein droit et la
nphrectomie du rein gauche. Cependant, il existe une diffrence anatomique entre
le rein gauche et droit en ce qui concerne la taille des vaisseaux. En fait, le pdicule
rnal (veine et artre rnale) est plus long au niveau du rein gauche que celui du rein
droit. Parfois le rein droit est mme compltement coll contre la veine cave et
laorte. Ceci nous a pos une contrainte technique lors du clampage du rein droit vue
de sa petite taille. Dans ce cas le clampage rnal risque de ne pas tre complet
malgr le changement de couleur du rein ischmique, et les risques dhmorragie
augmentent vus de sa position la proximit du foie. Nous pensons que a aurait t
mieux techniquement dutiliser le rein gauche pour le clampage et le rein droit pour la
nphrectomie afin dassurer un bon clampage sans risque dhmorragie.
Conclusions & Perspectives

Conclusions & Perspectives

188
La susceptibilit accrue du rein diabtique la squence ischmique a t
rapporte dans des modles exprimentaux de diabte et chez les patients atteints
de diabte. Cependant, les mcanismes sous-jacents impliqus dans la vulnrabilit
du rein aux lsions dI/R dans le diabte ne sont pas compltement lucids. Nous
avons mis lhypothse quune molcule alarmine, lIL-33, pourrait jouer un rle cl
entre lhyperglycmie et lI/R rnale. Pour cela, nous avons mis en place, dans un
premier temps, un modle dI/R rnale reproductible chez la souris qui consiste
appliquer une ischmie unilatrale de 32 minutes accompagne dune nphrectomie
controlatrale via un abord dorsal sous isoflurane. Par la suite, nous avons valu
limpact dune I/R rnale sur des souris transgniques dpourvues du rcepteur ST2
de lIL-33 et traites par la streptozotocine.

Notre tude a montr que la dpltion de rcepteur ST2 a augment la


susceptibilit rnale au traitement de STZ, suggrant un effet protecteur de lIL-33
contre la progression de la nphropathie induite par lhyperglycmie. IL-33 jouerait
un rle de cytokine antiinflammatoire dans linsuffisance rnale chronique
(nphropathie diabtique).

En revanche, une I/R rnale applique des souris sauvages a provoqu une
aggravation des lsions rnales, alors que la dpltion du rcepteur ST2 protge le
rein contre les lsions dI/R suggrant un effet dltre de lIL-33. IL-33 jouerait donc
un rle dune alarmine proinflammatoire dans linsuffisance rnale aigu.

Lensemble de nos donnes, tout en rvlant un possible rle diffrentiel de la


voie IL-33/ST2 sur le rein, nexclut pas la mise en jeu dautres mcanismes au cours
du diabte ayant un impact sur le rein dans notre modle, en particulier ceux
impliquant les voies AGEs/RAGE et HMGB1/TLR2-4 ou encore HIF-1 dont les liens
avec la voie ST2/IL-33 restent explorer.
Conclusions & Perspectives

En perspective, lutilisation des souris diabtiques Akita sera envisage pour


minimiser les interfrences provoques par leffet nphrotoxique de la
streptozotocine. Ceci nous permettra probablement damliorer la survie des souris
diabtique en post ischmie pour tudier la question de la rparation rnale. Une 189
approche gnomique pourra tre associe afin de proposer des gnes candidats
impliqus dans la susceptibilit accrue du rein diabtique la squence ischmique.
Rfrences bibliographiques

Rfrences bibliographiques

1. Park, M.J. et al. High-glucose-Induced O-GlcNAcylated Carbohydrate Response Element-binding Protein 190
(ChREBP) Mediates Mesangial Cell Lipogenesis and Fibrosis : The Possible Role of the Development of
Diabetic Nephropathy. The Journal of biological chemistry (2014).

2. biomedecine, A.d. rapport annuel 2014. (2014).

3. Kanwar, Y.S. et al. Diabetic nephropathy: mechanisms of renal disease progression. Exp Biol Med
(Maywood) 233, 4-11 (2008).

4. biomdecine, A.d. Le plan greffe 2012-2016. 2012 Jun: 112. (2012).

5. biomdecine, A.d. Le prlvement dorganes sur donneurs dcds aprs arrt circulatoire suite la
limitation ou larrt des thrapeutiques. (2014).

6. Nyberg, S.L. et al. Improved scoring system to assess adult donors for cadaver renal transplantation.
American journal of transplantation : official journal of the American Society of Transplantation and
the American Society of Transplant Surgeons 3, 715-721 (2003).

7. Remuzzi, G. et al. Long-term outcome of renal transplantation from older donors. The New England
journal of medicine 354, 343-352 (2006).

8. Melin, J., Hellberg, O. & Fellstrom, B. Hyperglycaemia and renal ischaemia-reperfusion injury.
Nephrology, dialysis, transplantation : official publication of the European Dialysis and Transplant
Association - European Renal Association 18, 460-462 (2003).

9. Peng, J. et al. Hyperglycemia, p53, and mitochondrial pathway of apoptosis are involved in the
susceptibility of diabetic models to ischemic acute kidney injury. Kidney international 87, 137-150
(2015).

10. Vallon, V. Do tubular changes in the diabetic kidney affect the susceptibility to acute kidney injury?
Nephron. Clinical practice 127, 133-138 (2014).

11. Gao, G. et al. TNF-alpha mediates increased susceptibility to ischemic AKI in diabetes. American journal
of physiology. Renal physiology 304, F515-521 (2013).

12. Group, T.D.C.a.C.T.R. The effect of intensive treatment of diabetes on the development and progression
of long-term complications in insulin-dependent diabetes mellitus. The Diabetes Control and
Complications Trial Research Group. The New England journal of medicine 329, 977-986 (1993).

13. Jiang, A.T., Bhsc, Rowe, N., Sener, A. & Luke, P. Simultaneous pancreas-kidney transplantation: The role
in the treatment of type 1 diabetes and end-stage renal disease. Can Urol Assoc J 8, 135-138 (2014).

14. Wiseman, A.C. & Gralla, J. Simultaneous pancreas kidney transplant versus other kidney transplant
options in patients with type 2 diabetes. Clinical journal of the American Society of Nephrology : CJASN
7, 656-664 (2012).

15. Huang, Y., Rabb, H. & Womer, K.L. Ischemia-reperfusion and immediate T cell responses. Cellular
immunology 248, 4-11 (2007).

16. Jassem, W. & Heaton, N.D. The role of mitochondria in ischemia/reperfusion injury in organ
transplantation. Kidney international 66, 514-517 (2004).
Rfrences bibliographiques

17. Khajuria, A., Tay, C., Shi, J., Zhao, H. & Ma, D. Anesthetics attenuate ischemia-reperfusion induced
renal injury: effects and mechanisms. Acta Anaesthesiol Taiwan 52, 176-184 (2014).

18. Sanada, S., Komuro, I. & Kitakaze, M. Pathophysiology of myocardial reperfusion injury:
preconditioning, postconditioning, and translational aspects of protective measures. American journal
of physiology. Heart and circulatory physiology 301, H1723-1741 (2011).

19. Kalogeris, T., Baines, C.P., Krenz, M. & Korthuis, R.J. Cell biology of ischemia/reperfusion injury. 191
International review of cell and molecular biology 298, 229-317 (2012).

20. Brodsky, S.V. et al. Endothelial dysfunction in ischemic acute renal failure: rescue by transplanted
endothelial cells. American journal of physiology. Renal physiology 282, F1140-1149 (2002).

21. Schwartz, B.G. & Kloner, R.A. Coronary no reflow. J Mol Cell Cardiol 52, 873-882 (2012).

22. Lawson, C.A. et al. Monocytes and tissue factor promote thrombosis in a murine model of oxygen
deprivation. The Journal of clinical investigation 99, 1729-1738 (1997).

23. Gute, D.C., Ishida, T., Yarimizu, K. & Korthuis, R.J. Inflammatory responses to ischemia and reperfusion
in skeletal muscle. Molecular and cellular biochemistry 179, 169-187 (1998).

24. Verma, S.K. & Molitoris, B.A. Renal endothelial injury and microvascular dysfunction in acute kidney
injury. Seminars in nephrology 35, 96-107 (2015).

25. Fernandez-Klett, F., Offenhauser, N., Dirnagl, U., Priller, J. & Lindauer, U. Pericytes in capillaries are
contractile in vivo, but arterioles mediate functional hyperemia in the mouse brain. Proceedings of the
National Academy of Sciences of the United States of America 107, 22290-22295 (2010).

26. Bachmann, S., Le Hir, M. & Eckardt, K.U. Co-localization of erythropoietin mRNA and ecto-5'-
nucleotidase immunoreactivity in peritubular cells of rat renal cortex indicates that fibroblasts produce
erythropoietin. J Histochem Cytochem 41, 335-341 (1993).

27. Lemos, D.R. et al. Maintenance of vascular integrity by pericytes is essential for normal kidney function.
American journal of physiology. Renal physiology, ajprenal 00030 02016 (2016).

28. Peppiatt, C.M., Howarth, C., Mobbs, P. & Attwell, D. Bidirectional control of CNS capillary diameter by
pericytes. Nature 443, 700-704 (2006).

29. Yemisci, M. et al. Pericyte contraction induced by oxidative-nitrative stress impairs capillary reflow
despite successful opening of an occluded cerebral artery. Nature medicine 15, 1031-1037 (2009).

30. Negre-Salvayre, A., Salvayre, R., Auge, N., Pamplona, R. & Portero-Otin, M. Hyperglycemia and
glycation in diabetic complications. Antioxidants & redox signaling 11, 3071-3109 (2009).

31. Ozkan, F., Senayli, Y., Ozyurt, H., Erkorkmaz, U. & Bostan, B. Antioxidant effects of propofol on
tourniquet-induced ischemia-reperfusion injury: an experimental study. The Journal of surgical
research 176, 601-607 (2012).

32. Kezic, A., Thaiss, F., Becker, J.U., Tsui, T.Y. & Bajcetic, M. Effects of everolimus on oxidative stress in
kidney model of ischemia/reperfusion injury. American journal of nephrology 37, 291-301 (2013).

33. Rouslin, W. Mitochondrial complexes I, II, III, IV, and V in myocardial ischemia and autolysis. Am J
Physiol 244, H743-748 (1983).

34. Cavadas, M.A., Nguyen, L.K. & Cheong, A. Hypoxia-inducible factor (HIF) network: insights from
mathematical models. Cell communication and signaling : CCS 11, 42 (2013).
Rfrences bibliographiques

35. Palazon, A., Goldrath, A.W., Nizet, V. & Johnson, R.S. HIF transcription factors, inflammation, and
immunity. Immunity 41, 518-528 (2014).

36. Semenza, G.L. Hypoxia-inducible factor 1: master regulator of O2 homeostasis. Curr Opin Genet Dev 8,
588-594 (1998).

37. Wang, G.L., Jiang, B.H., Rue, E.A. & Semenza, G.L. Hypoxia-inducible factor 1 is a basic-helix-loop-helix-
PAS heterodimer regulated by cellular O2 tension. Proceedings of the National Academy of Sciences of 192
the United States of America 92, 5510-5514 (1995).

38. Reyes, H., Reisz-Porszasz, S. & Hankinson, O. Identification of the Ah receptor nuclear translocator
protein (Arnt) as a component of the DNA binding form of the Ah receptor. Science 256, 1193-1195
(1992).

39. Ruas, J.L., Poellinger, L. & Pereira, T. Functional analysis of hypoxia-inducible factor-1 alpha-mediated
transactivation. Identification of amino acid residues critical for transcriptional activation and/or
interaction with CREB-binding protein. The Journal of biological chemistry 277, 38723-38730 (2002).

40. Lando, D., Peet, D.J., Whelan, D.A., Gorman, J.J. & Whitelaw, M.L. Asparagine hydroxylation of the HIF
transactivation domain a hypoxic switch. Science 295, 858-861 (2002).

41. Pugh, C.W., O'Rourke, J.F., Nagao, M., Gleadle, J.M. & Ratcliffe, P.J. Activation of hypoxia-inducible
factor-1; definition of regulatory domains within the alpha subunit. The Journal of biological chemistry
272, 11205-11214 (1997).

42. Ke, Q. & Costa, M. Hypoxia-inducible factor-1 (HIF-1). Mol Pharmacol 70, 1469-1480 (2006).

43. Makino, Y., Kanopka, A., Wilson, W.J., Tanaka, H. & Poellinger, L. Inhibitory PAS domain protein (IPAS)
is a hypoxia-inducible splicing variant of the hypoxia-inducible factor-3alpha locus. The Journal of
biological chemistry 277, 32405-32408 (2002).

44. Huang, L.E., Arany, Z., Livingston, D.M. & Bunn, H.F. Activation of hypoxia-inducible transcription factor
depends primarily upon redox-sensitive stabilization of its alpha subunit. The Journal of biological
chemistry 271, 32253-32259 (1996).

45. Souvenir, R. et al. Erythropoietin Inhibits HIF-1 alpha Expression via Upregulation of PHD-2
Transcription and Translation in an In Vitro Model of Hypoxia-Ischemia. Translational Stroke Research
5, 118-127 (2014).

46. Franke, K. et al. HIF-1 alpha is a protective factor in conditional PHD2-deficient mice suffering from
severe HIF-2 alpha-induced excessive erythropoiesis. Blood 121, 1436-1445 (2013).

47. Dayan, F., Monticelli, M., Pouyssegur, J. & Pecou, E. Gene regulation in response to graded hypoxia: the
non-redundant roles of the oxygen sensors PHD and FIH in the HIF pathway. J Theor Biol 259, 304-316
(2009).

48. Cockman, M.E., Webb, J.D. & Ratcliffe, P.J. FIH-dependent asparaginyl hydroxylation of ankyrin repeat
domain-containing proteins. Annals of the New York Academy of Sciences 1177, 9-18 (2009).

49. Soilleux, E.J. et al. Use of novel monoclonal antibodies to determine the expression and distribution of
the hypoxia regulatory factors PHD-1, PHD-2, PHD-3 and FIH in normal and neoplastic human tissues.
Histopathology 47, 602-610 (2005).

50. Mahon, P.C., Hirota, K. & Semenza, G.L. FIH-1: a novel protein that interacts with HIF-1alpha and VHL
to mediate repression of HIF-1 transcriptional activity. Genes & development 15, 2675-2686 (2001).

51. Hirota, K. & Semenza, G.L. Regulation of hypoxia-inducible factor 1 by prolyl and asparaginyl
hydroxylases. Biochem Biophys Res Commun 338, 610-616 (2005).
Rfrences bibliographiques

52. Walmsley, S.R., McGovern, N.N., Whyte, M.K. & Chilvers, E.R. The HIF/VHL pathway: from oxygen
sensing to innate immunity. Am J Respir Cell Mol Biol 38, 251-255 (2008).

53. Bento, C.F. & Pereira, P. Regulation of hypoxia-inducible factor 1 and the loss of the cellular response
to hypoxia in diabetes. Diabetologia 54, 1946-1956 (2011).

54. Jantsch, J. et al. Toll-like receptor activation and hypoxia use distinct signaling pathways to stabilize
hypoxia-inducible factor 1alpha (HIF1A) and result in differential HIF1A-dependent gene expression. 193
Journal of leukocyte biology 90, 551-562 (2011).

55. Schodel, J. et al. High-resolution genome-wide mapping of HIF-binding sites by ChIP-seq. Blood 117,
e207-217 (2011).

56. Khamaisi, M. et al. Endothelin-converting enzyme is a plausible target gene for hypoxia-inducible
factor. Kidney international 87, 761-770 (2015).

57. Wenger, R.H., Stiehl, D.P. & Camenisch, G. Integration of oxygen signaling at the consensus HRE. Sci
STKE 2005, re12 (2005).

58. Haase, V.H. Hypoxia-inducible factors in the kidney. American journal of physiology. Renal physiology
291, F271-281 (2006).

59. Mimura, I., Tanaka, T., Wada, Y., Kodama, T. & Nangaku, M. Pathophysiological response to hypoxia -
from the molecular mechanisms of malady to drug discovery: epigenetic regulation of the hypoxic
response via hypoxia-inducible factor and histone modifying enzymes. J Pharmacol Sci 115, 453-458
(2011).

60. Hulbert, A.J., Pamplona, R., Buffenstein, R. & Buttemer, W.A. Life and death: metabolic rate,
membrane composition, and life span of animals. Physiol Rev 87, 1175-1213 (2007).

61. Abraham, N.G. & Kappas, A. Heme oxygenase and the cardiovascular-renal system. Free radical
biology & medicine 39, 1-25 (2005).

62. Sanz, A., Pamplona, R. & Barja, G. Is the mitochondrial free radical theory of aging intact? Antioxidants
& redox signaling 8, 582-599 (2006).

63. Stadtman, E.R., Van Remmen, H., Richardson, A., Wehr, N.B. & Levine, R.L. Methionine oxidation and
aging. Biochimica et biophysica acta 1703, 135-140 (2005).

64. Moskovitz, J. Methionine sulfoxide reductases: ubiquitous enzymes involved in antioxidant defense,
protein regulation, and prevention of aging-associated diseases. Biochimica et biophysica acta 1703,
213-219 (2005).

65. Havasi, A. & Borkan, S.C. Apoptosis and acute kidney injury. Kidney international 80, 29-40 (2011).

66. Kaushal, G.P. Autophagy protects proximal tubular cells from injury and apoptosis. Kidney
international 82, 1250-1253 (2012).

67. Tanaka, Y. et al. Autophagy as a therapeutic target in diabetic nephropathy. Exp Diabetes Res 2012,
628978 (2012).

68. Devarajan, P. Update on mechanisms of ischemic acute kidney injury. Journal of the American Society
of Nephrology : JASN 17, 1503-1520 (2006).

69. Abuelo, J.G. Normotensive ischemic acute renal failure. The New England journal of medicine 357, 797-
805 (2007).
Rfrences bibliographiques

70. Higgins, D.F. et al. Hypoxia promotes fibrogenesis in vivo via HIF-1 stimulation of epithelial-to-
mesenchymal transition. The Journal of clinical investigation 117, 3810-3820 (2007).

71. Nangaku, M. Chronic hypoxia and tubulointerstitial injury: a final common pathway to end-stage renal
failure. Journal of the American Society of Nephrology : JASN 17, 17-25 (2006).

72. Manotham, K. et al. Transdifferentiation of cultured tubular cells induced by hypoxia. Kidney
international 65, 871-880 (2004). 194
73. Kim, J., Seok, Y.M., Jung, K.J. & Park, K.M. Reactive oxygen species/oxidative stress contributes to
progression of kidney fibrosis following transient ischemic injury in mice. American journal of
physiology. Renal physiology 297, F461-470 (2009).

74. Kalucka, J. et al. Kidney injury is independent of endothelial HIF-1alpha. Journal of molecular medicine
(2015).

75. Kimura, K. et al. Stable expression of HIF-1alpha in tubular epithelial cells promotes interstitial fibrosis.
American journal of physiology. Renal physiology 295, F1023-1029 (2008).

76. Luo, R. et al. Elevated Endothelial Hypoxia-Inducible Factor-1alpha Contributes to Glomerular Injury
and Promotes Hypertensive Chronic Kidney Disease. Hypertension 66, 75-84 (2015).

77. Tanaka, T. A mechanistic link between renal ischemia and fibrosis. Med Mol Morphol (2016).

78. Tanaka, T. & Nangaku, M. The role of hypoxia, increased oxygen consumption, and hypoxia-inducible
factor-1 alpha in progression of chronic kidney disease. Current opinion in nephrology and
hypertension 19, 43-50 (2010).

79. Tanaka, T. et al. Induction of protective genes by cobalt ameliorates tubulointerstitial injury in the
progressive Thy1 nephritis. Kidney international 68, 2714-2725 (2005).

80. Portilla, D. & Okusa, M.D. T cells and T-cell receptors in acute renal failure. Kidney international 69,
208-210 (2006).

81. Lackey, D.E. & Olefsky, J.M. Regulation of metabolism by the innate immune system. Nat Rev
Endocrinol 12, 15-28 (2016).

82. Bajwa, A., Kinsey, G.R. & Okusa, M.D. Immune mechanisms and novel pharmacological therapies of
acute kidney injury. Curr Drug Targets 10, 1196-1204 (2009).

83. Ysebaert, D.K. et al. T cells as mediators in renal ischemia/reperfusion injury. Kidney international 66,
491-496 (2004).

84. Ysebaert, D.K. et al. Identification and kinetics of leukocytes after severe ischaemia/reperfusion renal
injury. Nephrology, dialysis, transplantation : official publication of the European Dialysis and
Transplant Association - European Renal Association 15, 1562-1574 (2000).

85. Cook, H.T. Complement and kidney disease. Current opinion in nephrology and hypertension 22, 295-
301 (2013).

86. Seelen, M.A., Roos, A. & Daha, M.R. Role of complement in innate and autoimmunity. Journal of
nephrology 18, 642-653 (2005).

87. Kinsey, G.R., Li, L. & Okusa, M.D. Inflammation in acute kidney injury. Nephron. Experimental
nephrology 109, e102-107 (2008).

88. Sutton, T.A. et al. Injury of the renal microvascular endothelium alters barrier function after ischemia.
American journal of physiology. Renal physiology 285, F191-198 (2003).
Rfrences bibliographiques

89. Collard, C.D. & Gelman, S. Pathophysiology, clinical manifestations, and prevention of ischemia-
reperfusion injury. Anesthesiology 94, 1133-1138 (2001).

90. Sutton, T.A., Fisher, C.J. & Molitoris, B.A. Microvascular endothelial injury and dysfunction during
ischemic acute renal failure. Kidney international 62, 1539-1549 (2002).

91. Okusa, M.D. et al. A(2A) adenosine receptor-mediated inhibition of renal injury and neutrophil
adhesion. American journal of physiology. Renal physiology 279, F809-818 (2000). 195
92. Oh, D.J. et al. Fractalkine receptor (CX3CR1) inhibition is protective against ischemic acute renal failure
in mice. American journal of physiology. Renal physiology 294, F264-271 (2008).

93. Li, L. et al. The chemokine receptors CCR2 and CX3CR1 mediate monocyte/macrophage trafficking in
kidney ischemia-reperfusion injury. Kidney international 74, 1526-1537 (2008).

94. Kelly, K.J. et al. Intercellular adhesion molecule-1-deficient mice are protected against ischemic renal
injury. The Journal of clinical investigation 97, 1056-1063 (1996).

95. Thurman, J.M. et al. Altered renal tubular expression of the complement inhibitor Crry permits
complement activation after ischemia/reperfusion. The Journal of clinical investigation 116, 357-368
(2006).

96. Thurman, J.M. et al. C3a is required for the production of CXC chemokines by tubular epithelial cells
after renal ishemia/reperfusion. Journal of immunology 178, 1819-1828 (2007).

97. Jang, H.R., Ko, G.J., Wasowska, B.A. & Rabb, H. The interaction between ischemia-reperfusion and
immune responses in the kidney. Journal of molecular medicine 87, 859-864 (2009).

98. Leemans, J.C. et al. Renal-associated TLR2 mediates ischemia/reperfusion injury in the kidney. The
Journal of clinical investigation 115, 2894-2903 (2005).

99. Wu, H. et al. TLR4 activation mediates kidney ischemia/reperfusion injury. The Journal of clinical
investigation 117, 2847-2859 (2007).

100. Zhang, X. & Mosser, D.M. Macrophage activation by endogenous danger signals. J Pathol 214, 161-178
(2008).

101. Shigeoka, A.A. et al. TLR2 is constitutively expressed within the kidney and participates in ischemic
renal injury through both MyD88-dependent and -independent pathways. Journal of immunology 178,
6252-6258 (2007).

102. Maeshima, A., Takahashi, S., Nakasatomi, M. & Nojima, Y. Diverse Cell Populations Involved in
Regeneration of Renal Tubular Epithelium following Acute Kidney Injury. Stem cells international 2015,
964849 (2015).

103. Soos, T.J. et al. CX3CR1+ interstitial dendritic cells form a contiguous network throughout the entire
kidney. Kidney international 70, 591-596 (2006).

104. Kawakami, T. et al. Resident renal mononuclear phagocytes comprise five discrete populations with
distinct phenotypes and functions. Journal of immunology 191, 3358-3372 (2013).

105. Li, L. et al. NKT cell activation mediates neutrophil IFN-gamma production and renal ischemia-
reperfusion injury. Journal of immunology 178, 5899-5911 (2007).

106. Dong, X. et al. Resident dendritic cells are the predominant TNF-secreting cell in early renal ischemia-
reperfusion injury. Kidney international 71, 619-628 (2007).
Rfrences bibliographiques

107. Dong, X. et al. Antigen presentation by dendritic cells in renal lymph nodes is linked to systemic and
local injury to the kidney. Kidney international 68, 1096-1108 (2005).

108. Li, L. et al. IL-17 produced by neutrophils regulates IFN-gamma-mediated neutrophil migration in
mouse kidney ischemia-reperfusion injury. The Journal of clinical investigation 120, 331-342 (2010).

109. Bonventre, J.V. & Weinberg, J.M. Recent advances in the pathophysiology of ischemic acute renal
failure. Journal of the American Society of Nephrology : JASN 14, 2199-2210 (2003). 196
110. Okusa, M.D. The inflammatory cascade in acute ischemic renal failure. Nephron 90, 133-138 (2002).

111. Huen, S.C. & Cantley, L.G. Macrophage-mediated injury and repair after ischemic kidney injury.
Pediatric nephrology 30, 199-209 (2015).

112. Cao, Q., Harris, D.C. & Wang, Y. Macrophages in kidney injury, inflammation, and fibrosis. Physiology
(Bethesda) 30, 183-194 (2015).

113. Zhang, Z.X. et al. NK cells induce apoptosis in tubular epithelial cells and contribute to renal ischemia-
reperfusion injury. Journal of immunology 181, 7489-7498 (2008).

114. Kim, H.J. et al. TLR2 signaling in tubular epithelial cells regulates NK cell recruitment in kidney
ischemia-reperfusion injury. Journal of immunology 191, 2657-2664 (2013).

115. Day, Y.J. et al. Renal ischemia-reperfusion injury and adenosine 2A receptor-mediated tissue
protection: the role of CD4+ T cells and IFN-gamma. Journal of immunology 176, 3108-3114 (2006).

116. Araki, M. et al. Expression of IL-8 during reperfusion of renal allografts is dependent on ischemic time.
Transplantation 81, 783-788 (2006).

117. Awad, A.S. et al. Compartmentalization of neutrophils in the kidney and lung following acute ischemic
kidney injury. Kidney international 75, 689-698 (2009).

118. Gordon, S. & Taylor, P.R. Monocyte and macrophage heterogeneity. Nat Rev Immunol 5, 953-964
(2005).

119. Geissmann, F., Jung, S. & Littman, D.R. Blood monocytes consist of two principal subsets with distinct
migratory properties. Immunity 19, 71-82 (2003).

120. Gordon, S. Alternative activation of macrophages. Nat Rev Immunol 3, 23-35 (2003).

121. Lech, M. & Anders, H.J. Macrophages and fibrosis: How resident and infiltrating mononuclear
phagocytes orchestrate all phases of tissue injury and repair. Biochimica et biophysica acta 1832, 989-
997 (2013).

122. Karasawa, K. et al. Vascular-resident CD169-positive monocytes and macrophages control neutrophil
accumulation in the kidney with ischemia-reperfusion injury. Journal of the American Society of
Nephrology : JASN 26, 896-906 (2015).

123. Kielar, M.L. et al. Maladaptive role of IL-6 in ischemic acute renal failure. Journal of the American
Society of Nephrology : JASN 16, 3315-3325 (2005).

124. Jo, S.K., Sung, S.A., Cho, W.Y., Go, K.J. & Kim, H.K. Macrophages contribute to the initiation of
ischaemic acute renal failure in rats. Nephrology, dialysis, transplantation : official publication of the
European Dialysis and Transplant Association - European Renal Association 21, 1231-1239 (2006).

125. Burne, M.J. et al. Identification of the CD4(+) T cell as a major pathogenic factor in ischemic acute renal
failure. The Journal of clinical investigation 108, 1283-1290 (2001).
Rfrences bibliographiques

126. Rabb, H. et al. Pathophysiological role of T lymphocytes in renal ischemia-reperfusion injury in mice.
American journal of physiology. Renal physiology 279, F525-531 (2000).

127. Savransky, V. et al. Role of the T-cell receptor in kidney ischemia-reperfusion injury. Kidney
international 69, 233-238 (2006).

128. Pinheiro, H.S. et al. Contribution of CD4+ T cells to the early mechanisms of ischemia- reperfusion injury
in a mouse model of acute renal failure. Brazilian journal of medical and biological research = Revista 197
brasileira de pesquisas medicas e biologicas / Sociedade Brasileira de Biofisica ... [et al.] 40, 557-568
(2007).

129. Burne-Taney, M.J., Yokota-Ikeda, N. & Rabb, H. Effects of combined T- and B-cell deficiency on murine
ischemia reperfusion injury. American journal of transplantation : official journal of the American
Society of Transplantation and the American Society of Transplant Surgeons 5, 1186-1193 (2005).

130. Park, P. et al. Injury in renal ischemia-reperfusion is independent from immunoglobulins and T
lymphocytes. American journal of physiology. Renal physiology 282, F352-357 (2002).

131. Burne-Taney, M.J. et al. B cell deficiency confers protection from renal ischemia reperfusion injury.
Journal of immunology 171, 3210-3215 (2003).

132. Jang, H.R. et al. B cells limit repair after ischemic acute kidney injury. Journal of the American Society of
Nephrology : JASN 21, 654-665 (2010).

133. Birkholz, A.M. & Kronenberg, M. Antigen specificity of invariant natural killer T-cells. Biomed J 38, 470-
483 (2015).

134. Hameg, A. et al. A subset of NKT cells that lacks the NK1.1 marker, expresses CD1d molecules, and
autopresents the alpha-galactosylceramide antigen. Journal of immunology 165, 4917-4926 (2000).

135. Peralbo, E., Alonso, C. & Solana, R. Invariant NKT and NKT-like lymphocytes: two different T cell subsets
that are differentially affected by ageing. Exp Gerontol 42, 703-708 (2007).

136. Li, Y. et al. The Valpha14 invariant natural killer T cell TCR forces microbial glycolipids and CD1d into a
conserved binding mode. The Journal of experimental medicine 207, 2383-2393 (2010).

137. Walton, E.L. The two faces of invariant natural killer T cells. Biomed J 38, 465-468 (2015).

138. Godfrey, D.I., MacDonald, H.R., Kronenberg, M., Smyth, M.J. & Van Kaer, L. NKT cells: what's in a
name? Nat Rev Immunol 4, 231-237 (2004).

139. Yang, S.H. et al. Sulfatide-reactive natural killer T cells abrogate ischemia-reperfusion injury. Journal of
the American Society of Nephrology : JASN 22, 1305-1314 (2011).

140. Arslan, F. Mediators of inflammation after cardiac ischemia: the role of invariant natural killer T (iNKT)
cells. J Mol Cell Cardiol 63, 118-121 (2013).

141. Lappas, C.M., Day, Y.J., Marshall, M.A., Engelhard, V.H. & Linden, J. Adenosine A2A receptor activation
reduces hepatic ischemia reperfusion injury by inhibiting CD1d-dependent NKT cell activation. The
Journal of experimental medicine 203, 2639-2648 (2006).

142. Zhang, J. et al. Hypoxia-Inducible Factor-2alpha Limits Natural Killer T Cell Cytotoxicity in Renal
Ischemia/Reperfusion Injury. Journal of the American Society of Nephrology : JASN (2015).

143. Satpute, S.R. et al. The role for T cell repertoire/antigen-specific interactions in experimental kidney
ischemia reperfusion injury. Journal of immunology 183, 984-992 (2009).
Rfrences bibliographiques

144. Bajwa, A. et al. Dendritic cell sphingosine 1-phosphate receptor-3 regulates Th1-Th2 polarity in kidney
ischemia-reperfusion injury. Journal of immunology 189, 2584-2596 (2012).

145. Lee, S. et al. Distinct macrophage phenotypes contribute to kidney injury and repair. Journal of the
American Society of Nephrology : JASN 22, 317-326 (2011).

146. Kim, M.G. et al. Depletion of kidney CD11c+ F4/80+ cells impairs the recovery process in
ischaemia/reperfusion-induced acute kidney injury. Nephrology, dialysis, transplantation : official 198
publication of the European Dialysis and Transplant Association - European Renal Association 25, 2908-
2921 (2010).

147. Lee, C.G. et al. Role of breast regression protein 39 (BRP-39)/chitinase 3-like-1 in Th2 and IL-13-induced
tissue responses and apoptosis. The Journal of experimental medicine 206, 1149-1166 (2009).

148. Faubel, S. et al. Peripheral CD4 T-cell depletion is not sufficient to prevent ischemic acute renal failure.
Transplantation 80, 643-649 (2005).

149. Ascon, M. et al. Renal ischemia-reperfusion leads to long term infiltration of activated and effector-
memory T lymphocytes. Kidney international 75, 526-535 (2009).

150. Fontenot, J.D., Gavin, M.A. & Rudensky, A.Y. Foxp3 programs the development and function of
CD4+CD25+ regulatory T cells. Nat Immunol 4, 330-336 (2003).

151. Shevach, E.M. Mechanisms of foxp3+ T regulatory cell-mediated suppression. Immunity 30, 636-645
(2009).

152. Gandolfo, M.T. et al. Foxp3+ regulatory T cells participate in repair of ischemic acute kidney injury.
Kidney international 76, 717-729 (2009).

153. Kinsey, G.R. et al. Regulatory T cells suppress innate immunity in kidney ischemia-reperfusion injury.
Journal of the American Society of Nephrology : JASN 20, 1744-1753 (2009).

154. Kinsey, G.R., Huang, L., Vergis, A.L., Li, L. & Okusa, M.D. Regulatory T cells contribute to the protective
effect of ischemic preconditioning in the kidney. Kidney international 77, 771-780 (2010).

155. Lai, L.W., Yong, K.C. & Lien, Y.H. Pharmacologic recruitment of regulatory T cells as a therapy for
ischemic acute kidney injury. Kidney international 81, 983-992 (2012).

156. Krause, D. & Cantley, L.G. Bone marrow plasticity revisited: protection or differentiation in the kidney
tubule? The Journal of clinical investigation 115, 1705-1708 (2005).

157. Bonventre, J.V. Dedifferentiation and proliferation of surviving epithelial cells in acute renal failure.
Journal of the American Society of Nephrology : JASN 14 Suppl 1, S55-61 (2003).

158. Haymann, J.P. & Baud, L. [What is the contribution of stem cells to tubular repair after renal
ischemia?]. Medecine sciences : M/S 21, 679-680 (2005).

159. Nizet, V. & Johnson, R.S. Interdependence of hypoxic and innate immune responses. Nat Rev Immunol
9, 609-617 (2009).

160. Cramer, T. et al. HIF-1alpha is essential for myeloid cell-mediated inflammation. Cell 112, 645-657
(2003).

161. Walmsley, S.R. et al. Hypoxia-induced neutrophil survival is mediated by HIF-1alpha-dependent NF-
kappaB activity. The Journal of experimental medicine 201, 105-115 (2005).

162. Thompson, A.A. et al. Hypoxia-inducible factor 2alpha regulates key neutrophil functions in humans,
mice, and zebrafish. Blood 123, 366-376 (2014).
Rfrences bibliographiques

163. Jantsch, J. et al. Hypoxia and hypoxia-inducible factor-1 alpha modulate lipopolysaccharide-induced
dendritic cell activation and function. Journal of immunology 180, 4697-4705 (2008).

164. Naldini, A. et al. Hypoxia affects dendritic cell survival: role of the hypoxia-inducible factor-1alpha and
lipopolysaccharide. J Cell Physiol 227, 587-595 (2012).

165. Oda, T. et al. Activation of hypoxia-inducible factor 1 during macrophage differentiation. American
journal of physiology. Cell physiology 291, C104-113 (2006). 199
166. Anand, R.J. et al. Hypoxia causes an increase in phagocytosis by macrophages in a HIF-1alpha-
dependent manner. Journal of leukocyte biology 82, 1257-1265 (2007).

167. Staples, K.J. et al. Monocyte-derived macrophages matured under prolonged hypoxia transcriptionally
up-regulate HIF-1alpha mRNA. Immunobiology 216, 832-839 (2011).

168. Riboldi, E. et al. Hypoxia-mediated regulation of macrophage functions in pathophysiology. Int


Immunol 25, 67-75 (2013).

169. Dang, E.V. et al. Control of T(H)17/T(reg) balance by hypoxia-inducible factor 1. Cell 146, 772-784
(2011).

170. Tao, J.H., Barbi, J. & Pan, F. Hypoxia-inducible factors in T lymphocyte differentiation and function. A
Review in the Theme: Cellular Responses to Hypoxia. American journal of physiology. Cell physiology
309, C580-589 (2015).

171. Scholz, C.C. & Taylor, C.T. Targeting the HIF pathway in inflammation and immunity. Curr Opin
Pharmacol 13, 646-653 (2013).

172. Eltzschig, H.K. & Carmeliet, P. Hypoxia and inflammation. The New England journal of medicine 364,
656-665 (2011).

173. Peyssonnaux, C. et al. HIF-1alpha expression regulates the bactericidal capacity of phagocytes. The
Journal of clinical investigation 115, 1806-1815 (2005).

174. Fitzpatrick, S.F. et al. An intact canonical NF-kappaB pathway is required for inflammatory gene
expression in response to hypoxia. Journal of immunology 186, 1091-1096 (2011).

175. Walmsley, S.R. et al. Neutrophils from patients with heterozygous germline mutations in the von Hippel
Lindau protein (pVHL) display delayed apoptosis and enhanced bacterial phagocytosis. Blood 108,
3176-3178 (2006).

176. Imtiyaz, H.Z. et al. Hypoxia-inducible factor 2alpha regulates macrophage function in mouse models of
acute and tumor inflammation. The Journal of clinical investigation 120, 2699-2714 (2010).

177. Sitkovsky, M. & Lukashev, D. Regulation of immune cells by local-tissue oxygen tension: HIF1 alpha and
adenosine receptors. Nat Rev Immunol 5, 712-721 (2005).

178. Hale, L.P., Braun, R.D., Gwinn, W.M., Greer, P.K. & Dewhirst, M.W. Hypoxia in the thymus: role of
oxygen tension in thymocyte survival. American journal of physiology. Heart and circulatory physiology
282, H1467-1477 (2002).

179. Biju, M.P. et al. Vhlh gene deletion induces Hif-1-mediated cell death in thymocytes. Mol Cell Biol 24,
9038-9047 (2004).

180. Ben-Shoshan, J. et al. HIF-1alpha overexpression and experimental murine atherosclerosis.


Arteriosclerosis, thrombosis, and vascular biology 29, 665-670 (2009).
Rfrences bibliographiques

181. Michalek, R.D. et al. Cutting edge: distinct glycolytic and lipid oxidative metabolic programs are
essential for effector and regulatory CD4+ T cell subsets. Journal of immunology 186, 3299-3303
(2011).

182. Shi, L.Z. et al. HIF1alpha-dependent glycolytic pathway orchestrates a metabolic checkpoint for the
differentiation of TH17 and Treg cells. The Journal of experimental medicine 208, 1367-1376 (2011).

183. Wang, H. et al. Negative regulation of Hif1a expression and TH17 differentiation by the hypoxia- 200
regulated microRNA miR-210. Nat Immunol 15, 393-401 (2014).

184. Ben-Shoshan, J., Maysel-Auslender, S., Mor, A., Keren, G. & George, J. Hypoxia controls CD4+CD25+
regulatory T-cell homeostasis via hypoxia-inducible factor-1alpha. European journal of immunology 38,
2412-2418 (2008).

185. D'Alessio, F.R. et al. CD4+CD25+Foxp3+ Tregs resolve experimental lung injury in mice and are present
in humans with acute lung injury. The Journal of clinical investigation 119, 2898-2913 (2009).

186. Deaglio, S. et al. Adenosine generation catalyzed by CD39 and CD73 expressed on regulatory T cells
mediates immune suppression. The Journal of experimental medicine 204, 1257-1265 (2007).

187. Sitkovsky, M.V. T regulatory cells: hypoxia-adenosinergic suppression and re-direction of the immune
response. Trends in immunology 30, 102-108 (2009).

188. Doedens, A.L. et al. Hypoxia-inducible factors enhance the effector responses of CD8(+) T cells to
persistent antigen. Nat Immunol 14, 1173-1182 (2013).

189. Finlay, D.K. et al. PDK1 regulation of mTOR and hypoxia-inducible factor 1 integrate metabolism and
migration of CD8+ T cells. The Journal of experimental medicine 209, 2441-2453 (2012).

190. Kojima, H. et al. Abnormal B lymphocyte development and autoimmunity in hypoxia-inducible factor
1alpha -deficient chimeric mice. Proceedings of the National Academy of Sciences of the United States
of America 99, 2170-2174 (2002).

191. Klune, J.R., Dhupar, R., Cardinal, J., Billiar, T.R. & Tsung, A. HMGB1: endogenous danger signaling. Mol
Med 14, 476-484 (2008).

192. Byrne, S.N., Beaugie, C., O'Sullivan, C., Leighton, S. & Halliday, G.M. The immune-modulating cytokine
and endogenous Alarmin interleukin-33 is upregulated in skin exposed to inflammatory UVB radiation.
The American journal of pathology 179, 211-222 (2011).

193. Martin, N.T. & Martin, M.U. Interleukin 33 is a guardian of barriers and a local alarmin. Nat Immunol
17, 122-131 (2016).

194. Rabadi, M.M., Ghaly, T., Goligorksy, M.S. & Ratliff, B.B. HMGB1 in renal ischemic injury. American
journal of physiology. Renal physiology 303, F873-885 (2012).

195. Miller, A.M. Role of IL-33 in inflammation and disease. Journal of inflammation 8, 22 (2011).

196. Moussion, C., Ortega, N. & Girard, J.P. The IL-1-like cytokine IL-33 is constitutively expressed in the
nucleus of endothelial cells and epithelial cells in vivo: a novel 'alarmin'? PLoS One 3, e3331 (2008).

197. Lunderius-Andersson, C., Enoksson, M. & Nilsson, G. Mast Cells Respond to Cell Injury through the
Recognition of IL-33. Front Immunol 3, 82 (2012).

198. Garlanda, C., Dinarello, C.A. & Mantovani, A. The interleukin-1 family: back to the future. Immunity 39,
1003-1018 (2013).
Rfrences bibliographiques

199. Carriere, V. et al. IL-33, the IL-1-like cytokine ligand for ST2 receptor, is a chromatin-associated nuclear
factor in vivo. Proceedings of the National Academy of Sciences of the United States of America 104,
282-287 (2007).

200. Ali, S. et al. The dual function cytokine IL-33 interacts with the transcription factor NF-kappaB to
dampen NF-kappaB-stimulated gene transcription. Journal of immunology 187, 1609-1616 (2011).

201. Molofsky, A.B., Savage, A.K. & Locksley, R.M. Interleukin-33 in Tissue Homeostasis, Injury, and 201
Inflammation. Immunity 42, 1005-1019 (2015).

202. Cayrol, C. & Girard, J.P. The IL-1-like cytokine IL-33 is inactivated after maturation by caspase-1.
Proceedings of the National Academy of Sciences of the United States of America 106, 9021-9026
(2009).

203. Palmer, G. & Gabay, C. Interleukin-33 biology with potential insights into human diseases. Nat Rev
Rheumatol 7, 321-329 (2011).

204. Pichery, M. et al. Endogenous IL-33 is highly expressed in mouse epithelial barrier tissues, lymphoid
organs, brain, embryos, and inflamed tissues: in situ analysis using a novel Il-33-LacZ gene trap
reporter strain. Journal of immunology 188, 3488-3495 (2012).

205. Schmitz, J. et al. IL-33, an interleukin-1-like cytokine that signals via the IL-1 receptor-related protein
ST2 and induces T helper type 2-associated cytokines. Immunity 23, 479-490 (2005).

206. Saluja, R., Khan, M., Church, M.K. & Maurer, M. The role of IL-33 and mast cells in allergy and
inflammation. Clin Transl Allergy 5, 33 (2015).

207. Akcay, A. et al. IL-33 exacerbates acute kidney injury. Journal of the American Society of Nephrology :
JASN 22, 2057-2067 (2011).

208. Chen, W.Y. et al. Upregulation of Interleukin-33 in obstructive renal injury. Biochem Biophys Res
Commun (2016).

209. Caner, S. et al. Is IL-33 useful to detect early stage of renal failure? Renal failure 36, 78-80 (2014).

210. Matsuyama, Y. et al. Increased levels of interleukin 33 in sera and synovial fluid from patients with
active rheumatoid arthritis. J Rheumatol 37, 18-25 (2010).

211. Kouzaki, H., Iijima, K., Kobayashi, T., O'Grady, S.M. & Kita, H. The danger signal, extracellular ATP, is a
sensor for an airborne allergen and triggers IL-33 release and innate Th2-type responses. Journal of
immunology 186, 4375-4387 (2011).

212. Kakkar, R. & Lee, R.T. The IL-33/ST2 pathway: therapeutic target and novel biomarker. Nat Rev Drug
Discov 7, 827-840 (2008).

213. Talabot-Ayer, D. et al. Severe neutrophil-dominated inflammation and enhanced myelopoiesis in IL-33-
overexpressing CMV/IL33 mice. Journal of immunology 194, 750-760 (2015).

214. Liu, X. et al. Structural insights into the interaction of IL-33 with its receptors. Proceedings of the
National Academy of Sciences of the United States of America 110, 14918-14923 (2013).

215. Ciccone, M.M. et al. A novel cardiac bio-marker: ST2: a review. Molecules 18, 15314-15328 (2013).

216. Miller, A.M. et al. Soluble ST2 associates with diabetes but not established cardiovascular risk factors:
a new inflammatory pathway of relevance to diabetes? PLoS One 7, e47830 (2012).

217. Tung, Y.C., Chang, C.H., Chen, Y.C. & Chu, P.H. Combined biomarker analysis for risk of acute kidney
injury in patients with ST-segment elevation myocardial infarction. PLoS One 10, e0125282 (2015).
Rfrences bibliographiques

218. Lingel, A. et al. Structure of IL-33 and its interaction with the ST2 and IL-1RAcP receptors--insight into
heterotrimeric IL-1 signaling complexes. Structure 17, 1398-1410 (2009).

219. Martin, M.U. Special aspects of interleukin-33 and the IL-33 receptor complex. Semin Immunol 25, 449-
457 (2013).

220. Anders, H.J. Of Inflammasomes and Alarmins: IL-1beta and IL-1alpha in Kidney Disease. Journal of the
American Society of Nephrology : JASN 27, 2564-2575 (2016). 202
221. Bulek, K. et al. The essential role of single Ig IL-1 receptor-related molecule/Toll IL-1R8 in regulation of
Th2 immune response. Journal of immunology 182, 2601-2609 (2009).

222. Lefrancais, E. & Cayrol, C. Mechanisms of IL-33 processing and secretion: differences and similarities
between IL-1 family members. Eur Cytokine Netw 23, 120-127 (2012).

223. Cohen, E.S. et al. Oxidation of the alarmin IL-33 regulates ST2-dependent inflammation. Nat Commun
6, 8327 (2015).

224. Schwartz, C., O'Grady, K., Lavelle, E.C. & Fallon, P.G. Interleukin 33: an innate alarm for adaptive
responses beyond Th2 immunity-emerging roles in obesity, intestinal inflammation, and cancer.
European journal of immunology 46, 1091-1100 (2016).

225. Zeng, S., Wu, J., Liu, J., Qi, F. & Liu, B. IL-33 Receptor (ST2) Signalling is Important for Regulation of Th2-
Mediated Airway Inflammation in a Murine Model of Acute Respiratory Syncytial Virus Infection. Scand
J Immunol 81, 494-501 (2015).

226. Dinarello, C.A. An IL-1 family member requires caspase-1 processing and signals through the ST2
receptor. Immunity 23, 461-462 (2005).

227. Rui, T. & Tang, Q. IL-33 attenuates anoxia/reoxygenation-induced cardiomyocyte apoptosis by


inhibition of PKCbeta/JNK pathway. PLoS One 8, e56089 (2013).

228. Seki, K. et al. Interleukin-33 prevents apoptosis and improves survival after experimental myocardial
infarction through ST2 signaling. Circ Heart Fail 2, 684-691 (2009).

229. Ruisong, M. et al. The Protective Role of Interleukin-33 in Myocardial Ischemia and Reperfusion Is
Associated with Decreased HMGB1 Expression and Up-Regulation of the P38 MAPK Signaling Pathway.
PLoS One 10, e0143064 (2015).

230. Sakai, N. et al. Interleukin-33 is hepatoprotective during liver ischemia/reperfusion in mice. Hepatology
56, 1468-1478 (2012).

231. Li, S., Zhu, F.X., Zhang, H.B., Li, H. & An, Y.Z. Pretreatment with interleukin-33 reduces warm hepatic
ischemia/reperfusion injury in mice. Chin Med J (Engl) 126, 1855-1859 (2013).

232. Luo, Y. et al. Interleukin-33 ameliorates ischemic brain injury in experimental stroke through promoting
Th2 response and suppressing Th17 response. Brain research 1597, 86-94 (2015).

233. Thierry, A. et al. The alarmin concept applied to human renal transplantation: evidence for a
differential implication of HMGB1 and IL-33. PLoS One 9, e88742 (2014).

234. Amdur, R.L. et al. Inflammation and Progression of CKD: The CRIC Study. Clinical journal of the
American Society of Nephrology : CJASN (2016).

235. Gupta, J. et al. Association between albuminuria, kidney function, and inflammatory biomarker profile
in CKD in CRIC. Clinical journal of the American Society of Nephrology : CJASN 7, 1938-1946 (2012).
Rfrences bibliographiques

236. Chiang, C.K. et al. Plasma interleukin-18 levels in chronic renal failure and continuous ambulatory
peritoneal dialysis. Blood Purif 23, 144-148 (2005).

237. Sester, U. et al. T-cell activation follows Th1 rather than Th2 pattern in haemodialysis patients.
Nephrology, dialysis, transplantation : official publication of the European Dialysis and Transplant
Association - European Renal Association 15, 1217-1223 (2000).

238. Litjens, N.H., van Druningen, C.J. & Betjes, M.G. Progressive loss of renal function is associated with 203
activation and depletion of naive T lymphocytes. Clin Immunol 118, 83-91 (2006).

239. Libetta, C., Rampino, T. & Dal Canton, A. Polarization of T-helper lymphocytes toward the Th2
phenotype in uremic patients. American journal of kidney diseases : the official journal of the National
Kidney Foundation 38, 286-295 (2001).

240. Kato, S. et al. Aspects of immune dysfunction in end-stage renal disease. Clinical journal of the
American Society of Nephrology : CJASN 3, 1526-1533 (2008).

241. Dieplinger, B. & Mueller, T. Soluble ST2 in heart failure. Clin Chim Acta 443, 57-70 (2015).

242. Bao, Y.S. et al. Characterization of interleukin-33 and soluble ST2 in serum and their association with
disease severity in patients with chronic kidney disease. J Clin Immunol 32, 587-594 (2012).

243. Gordon, E.D. et al. Alternative splicing of interleukin-33 and type 2 inflammation in asthma.
Proceedings of the National Academy of Sciences of the United States of America 113, 8765-8770
(2016).

244. Palmer, G. et al. Inhibition of interleukin-33 signaling attenuates the severity of experimental arthritis.
Arthritis Rheum 60, 738-749 (2009).

245. Macedo, R.B., Kakehasi, A.M. & Andrade, M.V. IL33 in rheumatoid arthritis: potencial contribution to
pathogenesis. Rev Bras Reumatol (2016).

246. Shruthi, S., Mohan, V., Amutha, A. & Aravindhan, V. Increased serum levels of novel T cell cytokines IL-
33, IL-9 and IL-17 in subjects with type-1 diabetes. Cytokine 86, 6-9 (2016).

247. Fousteris, E. et al. Toll/interleukin-1 receptor member ST2 exhibits higher soluble levels in type 2
diabetes, especially when accompanied with left ventricular diastolic dysfunction. Cardiovascular
diabetology 10, 101 (2011).

248. Anand, G., Vasanthakumar, R., Mohan, V., Babu, S. & Aravindhan, V. Increased IL-12 and decreased IL-
33 serum levels are associated with increased Th1 and suppressed Th2 cytokine profile in patients with
diabetic nephropathy (CURES-134). Int J Clin Exp Pathol 7, 8008-8015 (2014).

249. Ky, B. et al. High-sensitivity ST2 for prediction of adverse outcomes in chronic heart failure. Circ Heart
Fail 4, 180-187 (2011).

250. Bhardwaj, A. & Januzzi, J.L., Jr. ST2: a novel biomarker for heart failure. Expert Rev Mol Diagn 10, 459-
464 (2010).

251. Xu, J., Zheng, J., Song, P., Zhou, Y. & Guan, S. IL33/ST2 pathway in a bleomycininduced pulmonary
fibrosis model. Mol Med Rep 14, 1704-1708 (2016).

252. Barnes, P.J. Inflammatory mechanisms in patients with chronic obstructive pulmonary disease. J Allergy
Clin Immunol 138, 16-27 (2016).

253. Fu, A.K. et al. IL-33 ameliorates Alzheimer's disease-like pathology and cognitive decline. Proceedings
of the National Academy of Sciences of the United States of America 113, E2705-2713 (2016).
Rfrences bibliographiques

254. Olsen, I. & Singhrao, S.K. Inflammasome Involvement in Alzheimer's Disease. J Alzheimers Dis 54, 45-53
(2016).

255. Saluja, R. et al. The role of the IL-33/IL-1RL1 axis in mast cell and basophil activation in allergic
disorders. Molecular immunology 63, 80-85 (2015).

256. Bruneau, S. et al. Potential role of soluble ST2 protein in idiopathic nephrotic syndrome recurrence
following kidney transplantation. American journal of kidney diseases : the official journal of the 204
National Kidney Foundation 54, 522-532 (2009).

257. Zhang, H.F. et al. Altered serum levels of IL-33 in patients with advanced systolic chronic heart failure:
correlation with oxidative stress. Journal of translational medicine 10, 120 (2012).

258. McAlister, F.A., Ezekowitz, J., Tonelli, M. & Armstrong, P.W. Renal insufficiency and heart failure:
prognostic and therapeutic implications from a prospective cohort study. Circulation 109, 1004-1009
(2004).

259. House, A.A. et al. Definition and classification of Cardio-Renal Syndromes: workgroup statements from
the 7th ADQI Consensus Conference. Nephrology, dialysis, transplantation : official publication of the
European Dialysis and Transplant Association - European Renal Association 25, 1416-1420 (2010).

260. Bayes-Genis, A. et al. Soluble ST2 serum concentration and renal function in heart failure. J Card Fail
19, 768-775 (2013).

261. Kim, M.S., Jeong, T.D., Han, S.B., Min, W.K. & Kim, J.J. Role of Soluble ST2 as a Prognostic Marker in
Patients with Acute Heart Failure and Renal Insufficiency. J Korean Med Sci 30, 569-575 (2015).

262. Hu, F. et al. Hypoxia-inducible factor-1alpha and interleukin 33 form a regulatory circuit to perpetuate
the inflammation in rheumatoid arthritis. PLoS One 8, e72650 (2013).

263. Abebayehu, D. et al. Lactic Acid Suppresses IL-33-Mediated Mast Cell Inflammatory Responses via
Hypoxia-Inducible Factor-1alpha-Dependent miR-155 Suppression. Journal of immunology (2016).

264. Yan, S.F. et al. RAGE and its ligands: a lasting memory in diabetic complications? Diabetes & vascular
disease research : official journal of the International Society of Diabetes and Vascular Disease 1, 10-20
(2004).

265. Brownlee, M. The pathobiology of diabetic complications: a unifying mechanism. Diabetes 54, 1615-
1625 (2005).

266. Brosius, F.C. & Heilig, C.W. Glucose transporters in diabetic nephropathy. Pediatric nephrology 20, 447-
451 (2005).

267. Kaiser, N. et al. Differential regulation of glucose transport and transporters by glucose in vascular
endothelial and smooth muscle cells. Diabetes 42, 80-89 (1993).

268. Henry, D.N., Busik, J.V., Brosius, F.C., 3rd & Heilig, C.W. Glucose transporters control gene expression of
aldose reductase, PKCalpha, and GLUT1 in mesangial cells in vitro. Am J Physiol 277, F97-104 (1999).

269. Heilig, C.W. et al. Overexpression of glucose transporters in rat mesangial cells cultured in a normal
glucose milieu mimics the diabetic phenotype. The Journal of clinical investigation 96, 1802-1814
(1995).

270. Marfella, R., Quagliaro, L., Nappo, F., Ceriello, A. & Giugliano, D. Acute hyperglycemia induces an
oxidative stress in healthy subjects. The Journal of clinical investigation 108, 635-636 (2001).

271. Monnier, L. et al. Activation of oxidative stress by acute glucose fluctuations compared with sustained
chronic hyperglycemia in patients with type 2 diabetes. JAMA 295, 1681-1687 (2006).
Rfrences bibliographiques

272. Colette, C. & Monnier, L. Acute glucose fluctuations and chronic sustained hyperglycemia as risk factors
for cardiovascular diseases in patients with type 2 diabetes. Horm Metab Res 39, 683-686 (2007).

273. Ceriello, A. Oxidative stress and diabetes-associated complications. Endocr Pract 12 Suppl 1, 60-62
(2006).

274. Kanwar, Y.S., Sun, L., Xie, P., Liu, F.Y. & Chen, S. A glimpse of various pathogenetic mechanisms of
diabetic nephropathy. Annual review of pathology 6, 395-423 (2011). 205
275. Esposito, K., Marfella, R. & Giugliano, D. Stress hyperglycemia, inflammation, and cardiovascular
events. Diabetes Care 26, 1650-1651 (2003).

276. Milne, G.L., Musiek, E.S. & Morrow, J.D. F2-isoprostanes as markers of oxidative stress in vivo: an
overview. Biomarkers 10 Suppl 1, S10-23 (2005).

277. Faure, P., Polge, C., Monneret, D., Favier, A. & Halimi, S. Plasma 15-F2t isoprostane concentrations are
increased during acute fructose loading in type 2 diabetes. Diabetes Metab 34, 148-154 (2008).

278. Sampson, M.J., Gopaul, N., Davies, I.R., Hughes, D.A. & Carrier, M.J. Plasma F2 isoprostanes: direct
evidence of increased free radical damage during acute hyperglycemia in type 2 diabetes. Diabetes
Care 25, 537-541 (2002).

279. Quagliaro, L. et al. Intermittent high glucose enhances apoptosis related to oxidative stress in human
umbilical vein endothelial cells: the role of protein kinase C and NAD(P)H-oxidase activation. Diabetes
52, 2795-2804 (2003).

280. Zhu, M. et al. Propofol protects against high glucose-induced endothelial apoptosis and dysfunction in
human umbilical vein endothelial cells. Anesth Analg 120, 781-789 (2015).

281. Giannini, S., Serio, M. & Galli, A. Pleiotropic effects of thiazolidinediones: taking a look beyond
antidiabetic activity. J Endocrinol Invest 27, 982-991 (2004).

282. Ha, H. & Lee, H.B. Reactive oxygen species as glucose signaling molecules in mesangial cells cultured
under high glucose. Kidney international. Supplement 77, S19-25 (2000).

283. Nishikawa, T. et al. Normalizing mitochondrial superoxide production blocks three pathways of
hyperglycaemic damage. Nature 404, 787-790 (2000).

284. Okouchi, M., Okayama, N. & Aw, T.Y. Hyperglycemia potentiates carbonyl stress-induced apoptosis in
naive PC-12 cells: relationship to cellular redox and activator protease factor-1 expression. Curr
Neurovasc Res 2, 375-386 (2005).

285. Choi, S.W., Benzie, I.F., Ma, S.W., Strain, J.J. & Hannigan, B.M. Acute hyperglycemia and oxidative
stress: direct cause and effect? Free radical biology & medicine 44, 1217-1231 (2008).

286. Pamplona, R. & Barja, G. Highly resistant macromolecular components and low rate of generation of
endogenous damage: two key traits of longevity. Ageing Res Rev 6, 189-210 (2007).

287. Du, X.L. et al. Hyperglycemia inhibits endothelial nitric oxide synthase activity by posttranslational
modification at the Akt site. The Journal of clinical investigation 108, 1341-1348 (2001).

288. Group, U.P.D.S.U. Intensive blood-glucose control with sulphonylureas or insulin compared with
conventional treatment and risk of complications in patients with type 2 diabetes (UKPDS 33). UK
Prospective Diabetes Study (UKPDS) Group. Lancet 352, 837-853 (1998).

289. Gabbay, K.H., Merola, L.O. & Field, R.A. Sorbitol pathway: presence in nerve and cord with substrate
accumulation in diabetes. Science 151, 209-210 (1966).
Rfrences bibliographiques

290. Baynes, J.W. Role of oxidative stress in development of complications in diabetes. Diabetes 40, 405-412
(1991).

291. Bunn, H.F. & Higgins, P.J. Reaction of monosaccharides with proteins: possible evolutionary
significance. Science 213, 222-224 (1981).

292. Koya, D. et al. Characterization of protein kinase C beta isoform activation on the gene expression of
transforming growth factor-beta, extracellular matrix components, and prostanoids in the glomeruli of 206
diabetic rats. The Journal of clinical investigation 100, 115-126 (1997).

293. Kolm-Litty, V., Sauer, U., Nerlich, A., Lehmann, R. & Schleicher, E.D. High glucose-induced transforming
growth factor beta1 production is mediated by the hexosamine pathway in porcine glomerular
mesangial cells. The Journal of clinical investigation 101, 160-169 (1998).

294. Del Corso, A., Cappiello, M. & Mura, U. From a dull enzyme to something else: facts and perspectives
regarding aldose reductase. Curr Med Chem 15, 1452-1461 (2008).

295. Engerman, R.L., Kern, T.S. & Larson, M.E. Nerve conduction and aldose reductase inhibition during 5
years of diabetes or galactosaemia in dogs. Diabetologia 37, 141-144 (1994).

296. Lee, A.Y. & Chung, S.S. Contributions of polyol pathway to oxidative stress in diabetic cataract. FASEB
journal : official publication of the Federation of American Societies for Experimental Biology 13, 23-30
(1999).

297. McClain, D.A. Hexosamines as mediators of nutrient sensing and regulation in diabetes. J Diabetes
Complications 16, 72-80 (2002).

298. Yao, D. et al. High glucose increases angiopoietin-2 transcription in microvascular endothelial cells
through methylglyoxal modification of mSin3A. The Journal of biological chemistry 282, 31038-31045
(2007).

299. Xia, P. et al. Characterization of the mechanism for the chronic activation of diacylglycerol-protein
kinase C pathway in diabetes and hypergalactosemia. Diabetes 43, 1122-1129 (1994).

300. D, M. Action des acides amines sur les sucres: formation des melanoidines par voie methodique. .
Compt Rend Hebd Seances Acad Sci 154, 6668 (1912).

301. Dunn, J.A., Patrick, J.S., Thorpe, S.R. & Baynes, J.W. Oxidation of glycated proteins: age-dependent
accumulation of N epsilon-(carboxymethyl)lysine in lens proteins. Biochemistry 28, 9464-9468 (1989).

302. Singh, R., Barden, A., Mori, T. & Beilin, L. Advanced glycation end-products: a review. Diabetologia 44,
129-146 (2001).

303. Faist, V. & Erbersdobler, H.F. Metabolic transit and in vivo effects of melanoidins and precursor
compounds deriving from the Maillard reaction. Ann Nutr Metab 45, 1-12 (2001).

304. Ahmed, N. et al. Processing of protein glycation, oxidation and nitrosation adducts in the liver and the
effect of cirrhosis. J Hepatol 41, 913-919 (2004).

305. Forster, A., Kuhne, Y. & Henle, T. Studies on absorption and elimination of dietary maillard reaction
products. Annals of the New York Academy of Sciences 1043, 474-481 (2005).

306. Vlassara, H. & Striker, G.E. Advanced glycation endproducts in diabetes and diabetic complications.
Endocrinol Metab Clin North Am 42, 697-719 (2013).

307. Thorpe, S.R. & Baynes, J.W. Maillard reaction products in tissue proteins: new products and new
perspectives. Amino Acids 25, 275-281 (2003).
Rfrences bibliographiques

308. Anderson, M.M., Requena, J.R., Crowley, J.R., Thorpe, S.R. & Heinecke, J.W. The myeloperoxidase
system of human phagocytes generates Nepsilon-(carboxymethyl)lysine on proteins: a mechanism for
producing advanced glycation end products at sites of inflammation. The Journal of clinical
investigation 104, 103-113 (1999).

309. Fu, M.X. et al. The advanced glycation end product, Nepsilon-(carboxymethyl)lysine, is a product of
both lipid peroxidation and glycoxidation reactions. The Journal of biological chemistry 271, 9982-9986
(1996). 207
310. Thornalley, P.J. Protein and nucleotide damage by glyoxal and methylglyoxal in physiological systems--
role in ageing and disease. Drug Metabol Drug Interact 23, 125-150 (2008).

311. Pamplona, R. et al. Carboxymethylated phosphatidylethanolamine in mitochondrial membranes of


mammals--evidence for intracellular lipid glycoxidation. Eur J Biochem 255, 685-689 (1998).

312. Wautier, J.L. & Schmidt, A.M. Protein glycation: a firm link to endothelial cell dysfunction. Circulation
research 95, 233-238 (2004).

313. Selvaraj, N., Bobby, Z. & Sridhar, M.G. Increased glycation of hemoglobin in chronic renal failure:
[corrected] potential role of oxidative stress. Arch Med Res 39, 277-284 (2008).

314. Abdel-Wahab, Y.H. et al. Glycation of insulin in the islets of Langerhans of normal and diabetic animals.
Diabetes 45, 1489-1496 (1996).

315. Hofmann, S.M. et al. Improved insulin sensitivity is associated with restricted intake of dietary
glycoxidation products in the db/db mouse. Diabetes 51, 2082-2089 (2002).

316. Cohen, M.P., Shea, E., Chen, S. & Shearman, C.W. Glycated albumin increases oxidative stress,
activates NF-kappa B and extracellular signal-regulated kinase (ERK), and stimulates ERK-dependent
transforming growth factor-beta 1 production in macrophage RAW cells. J Lab Clin Med 141, 242-249
(2003).

317. Kallner, A. Elimination of 14C-glycated albumin from serum of rabbit. Scand J Clin Lab Invest 50, 763-
768 (1990).

318. Tames, F.J., Mackness, M.I., Arrol, S., Laing, I. & Durrington, P.N. Non-enzymatic glycation of
apolipoprotein B in the sera of diabetic and non-diabetic subjects. Atherosclerosis 93, 237-244 (1992).

319. Tsimikas, S. & Witztum, J.L. Measuring circulating oxidized low-density lipoprotein to evaluate
coronary risk. Circulation 103, 1930-1932 (2001).

320. Mamo, J.C., Szeto, L. & Steiner, G. Glycation of very low density lipoprotein from rat plasma impairs its
catabolism. Diabetologia 33, 339-345 (1990).

321. Zhuang, A. & Forbes, J.M. Diabetic kidney disease: a role for advanced glycation end-product receptor
1 (AGE-R1)? Glycoconj J 33, 645-652 (2016).

322. Manigrasso, M.B., Juranek, J., Ramasamy, R. & Schmidt, A.M. Unlocking the biology of RAGE in
diabetic microvascular complications. Trends Endocrinol Metab 25, 15-22 (2014).

323. Yan, S.F., Ramasamy, R. & Schmidt, A.M. Mechanisms of disease: advanced glycation end-products and
their receptor in inflammation and diabetes complications. Nat Clin Pract Endocrinol Metab 4, 285-293
(2008).

324. Stern, D.M., Yan, S.D., Yan, S.F. & Schmidt, A.M. Receptor for advanced glycation endproducts (RAGE)
and the complications of diabetes. Ageing Res Rev 1, 1-15 (2002).
Rfrences bibliographiques

325. Schmidt, A.M., Yan, S.D., Yan, S.F. & Stern, D.M. The biology of the receptor for advanced glycation end
products and its ligands. Biochimica et biophysica acta 1498, 99-111 (2000).

326. Ramasamy, R., Yan, S.F. & Schmidt, A.M. Arguing for the motion: yes, RAGE is a receptor for advanced
glycation endproducts. Mol Nutr Food Res 51, 1111-1115 (2007).

327. Dattilo, B.M. et al. The extracellular region of the receptor for advanced glycation end products is
composed of two independent structural units. Biochemistry 46, 6957-6970 (2007). 208
328. Hofmann, M.A. et al. RAGE mediates a novel proinflammatory axis: a central cell surface receptor for
S100/calgranulin polypeptides. Cell 97, 889-901 (1999).

329. Valencia, J.V. et al. Advanced glycation end product ligands for the receptor for advanced glycation end
products: biochemical characterization and formation kinetics. Anal Biochem 324, 68-78 (2004).

330. Berlanga, J. et al. Methylglyoxal administration induces diabetes-like microvascular changes and
perturbs the healing process of cutaneous wounds. Clin Sci (Lond) 109, 83-95 (2005).

331. Sato, T. et al. TAGE (toxic AGEs) theory in diabetic complications. Curr Mol Med 6, 351-358 (2006).

332. Rauvala, H. & Rouhiainen, A. RAGE as a receptor of HMGB1 (Amphoterin): roles in health and disease.
Curr Mol Med 7, 725-734 (2007).

333. Heizmann, C.W., Ackermann, G.E. & Galichet, A. Pathologies involving the S100 proteins and RAGE.
Subcell Biochem 45, 93-138 (2007).

334. Mori, Y. et al. Increased plasma S100A12 (EN-RAGE) levels in hemodialysis patients with
atherosclerosis. American journal of nephrology 29, 18-24 (2009).

335. Soulis, T. et al. Advanced glycation end products and their receptors co-localise in rat organs
susceptible to diabetic microvascular injury. Diabetologia 40, 619-628 (1997).

336. Fukami, K., Yamagishi, S., Ueda, S. & Okuda, S. Role of AGEs in diabetic nephropathy. Current
pharmaceutical design 14, 946-952 (2008).

337. Sakurai, S. et al. The AGE-RAGE system and diabetic nephropathy. Journal of the American Society of
Nephrology : JASN 14, S259-263 (2003).

338. Miyata, T. et al. Renal catabolism of advanced glycation end products: the fate of pentosidine. Kidney
international 53, 416-422 (1998).

339. Genuth, S. et al. Glycation and carboxymethyllysine levels in skin collagen predict the risk of future 10-
year progression of diabetic retinopathy and nephropathy in the diabetes control and complications
trial and epidemiology of diabetes interventions and complications participants with type 1 diabetes.
Diabetes 54, 3103-3111 (2005).

340. Gerrits, E.G. et al. Skin autofluorescence: a tool to identify type 2 diabetic patients at risk for
developing microvascular complications. Diabetes Care 31, 517-521 (2008).

341. Wendt, T.M. et al. RAGE drives the development of glomerulosclerosis and implicates podocyte
activation in the pathogenesis of diabetic nephropathy. The American journal of pathology 162, 1123-
1137 (2003).

342. Tanji, N. et al. Expression of advanced glycation end products and their cellular receptor RAGE in
diabetic nephropathy and nondiabetic renal disease. Journal of the American Society of Nephrology :
JASN 11, 1656-1666 (2000).
Rfrences bibliographiques

343. Pala, L. et al. Vascular endothelial growth factor receptor-2 and low affinity VEGF binding sites on
human glomerular endothelial cells: Biological effects and advanced glycosilation end products
modulation. Microvasc Res 70, 179-188 (2005).

344. Moreno, J.A. et al. A slit in podocyte death. Curr Med Chem 15, 1645-1654 (2008).

345. Forbes, J.M., Coughlan, M.T. & Cooper, M.E. Oxidative stress as a major culprit in kidney disease in
diabetes. Diabetes 57, 1446-1454 (2008). 209
346. Yamamoto, Y. et al. Development and prevention of advanced diabetic nephropathy in RAGE-
overexpressing mice. The Journal of clinical investigation 108, 261-268 (2001).

347. Reiniger, N. et al. Deletion of the receptor for advanced glycation end products reduces
glomerulosclerosis and preserves renal function in the diabetic OVE26 mouse. Diabetes 59, 2043-2054
(2010).

348. Brown, S.M., Smith, D.M., Alt, N., Thorpe, S.R. & Baynes, J.W. Tissue-specific variation in glycation of
proteins in diabetes: evidence for a functional role of amadoriase enzymes. Annals of the New York
Academy of Sciences 1043, 817-823 (2005).

349. Delpierre, G., Veiga-da-Cunha, M., Vertommen, D., Buysschaert, M. & Van Schaftingen, E. Variability in
erythrocyte fructosamine 3-kinase activity in humans correlates with polymorphisms in the FN3K gene
and impacts on haemoglobin glycation at specific sites. Diabetes Metab 32, 31-39 (2006).

350. Monnier, V.M. & Wu, X. Enzymatic deglycation with amadoriase enzymes from Aspergillus sp. as a
potential strategy against the complications of diabetes and aging. Biochem Soc Trans 31, 1349-1353
(2003).

351. Veiga da-Cunha, M. et al. Increased protein glycation in fructosamine 3-kinase-deficient mice. The
Biochemical journal 399, 257-264 (2006).

352. Thornalley, P.J. The glyoxalase system: new developments towards functional characterization of a
metabolic pathway fundamental to biological life. The Biochemical journal 269, 1-11 (1990).

353. Shinohara, M. et al. Overexpression of glyoxalase-I in bovine endothelial cells inhibits intracellular
advanced glycation endproduct formation and prevents hyperglycemia-induced increases in
macromolecular endocytosis. The Journal of clinical investigation 101, 1142-1147 (1998).

354. Giacco, F. et al. Knockdown of glyoxalase 1 mimics diabetic nephropathy in nondiabetic mice. Diabetes
63, 291-299 (2014).

355. Palm, F. et al. Polyol-pathway-dependent disturbances in renal medullary metabolism in experimental


insulin-deficient diabetes mellitus in rats. Diabetologia 47, 1223-1231 (2004).

356. Ries, M. et al. Renal diffusion and BOLD MRI in experimental diabetic nephropathy. Blood oxygen level-
dependent. J Magn Reson Imaging 17, 104-113 (2003).

357. Rosenberger, C. et al. Adaptation to hypoxia in the diabetic rat kidney. Kidney international 73, 34-42
(2008).

358. Inoue, T. et al. Noninvasive evaluation of kidney hypoxia and fibrosis using magnetic resonance
imaging. Journal of the American Society of Nephrology : JASN 22, 1429-1434 (2011).

359. Williamson, J.R. et al. Hyperglycemic pseudohypoxia and diabetic complications. Diabetes 42, 801-813
(1993).

360. McDonuogh, A., Thomson, S., Brebbber, B. & Rector, F. Metabolic basis of solute transport. The Kidney:
Physiology and Pathophysiology, 138-157 (2011).
Rfrences bibliographiques

361. Thaysen, J.H., Lassen, N.A. & Munck, O. Sodium transport and oxygen consumption in the mammalian
kidney. Nature 190, 919-921 (1961).

362. O'Connor, P.M., Anderson, W.P., Kett, M.M. & Evans, R.G. Renal preglomerular arterial-venous O2
shunting is a structural anti-oxidant defence mechanism of the renal cortex. Clinical and experimental
pharmacology & physiology 33, 637-641 (2006).

363. Leong, C.L., Anderson, W.P., O'Connor, P.M. & Evans, R.G. Evidence that renal arterial-venous oxygen 210
shunting contributes to dynamic regulation of renal oxygenation. American journal of physiology.
Renal physiology 292, F1726-1733 (2007).

364. Welch, W.J., Baumgartl, H., Lubbers, D. & Wilcox, C.S. Nephron pO2 and renal oxygen usage in the
hypertensive rat kidney. Kidney international 59, 230-237 (2001).

365. Takiyama, Y. & Haneda, M. Hypoxia in Diabetic Kidneys. BioMed research international 2014, 837421
(2014).

366. Stout, L.C. & Whorton, E.B. Pathogenesis of extra efferent vessel development in diabetic glomeruli.
Hum Pathol 38, 1167-1177 (2007).

367. Osterby, R. et al. Neovascularization at the vascular pole region in diabetic glomerulopathy.
Nephrology, dialysis, transplantation : official publication of the European Dialysis and Transplant
Association - European Renal Association 14, 348-352 (1999).

368. Min, W. & Yamanaka, N. Three-dimensional analysis of increased vasculature around the glomerular
vascular pole in diabetic nephropathy. Virchows Arch A Pathol Anat Histopathol 423, 201-207 (1993).

369. Meyer, C., Woerle, H.J., Dostou, J.M., Welle, S.L. & Gerich, J.E. Abnormal renal, hepatic, and muscle
glucose metabolism following glucose ingestion in type 2 diabetes. American journal of physiology.
Endocrinology and metabolism 287, E1049-1056 (2004).

370. Wright, E.M., Loo, D.D. & Hirayama, B.A. Biology of human sodium glucose transporters. Physiol Rev
91, 733-794 (2011).

371. Abdul-Ghani, M.A. & DeFronzo, R.A. Lowering plasma glucose concentration by inhibiting renal
sodium-glucose cotransport. Journal of internal medicine 276, 352-363 (2014).

372. Kanzaki, M. Insulin receptor signals regulating GLUT4 translocation and actin dynamics. Endocrine
journal 53, 267-293 (2006).

373. Saltiel, A.R. & Kahn, C.R. Insulin signalling and the regulation of glucose and lipid metabolism. Nature
414, 799-806 (2001).

374. Wright, E.M. Renal Na(+)-glucose cotransporters. American journal of physiology. Renal physiology
280, F10-18 (2001).

375. Wright, E.M. I. Glucose galactose malabsorption. Am J Physiol 275, G879-882 (1998).

376. Jerums, G., Premaratne, E., Panagiotopoulos, S. & MacIsaac, R.J. The clinical significance of
hyperfiltration in diabetes. Diabetologia 53, 2093-2104 (2010).

377. Gullans, S.R., Harris, S.I. & Mandel, L.J. Glucose-dependent respiration in suspensions of rabbit cortical
tubules. J Membr Biol 78, 257-262 (1984).

378. Epstein, F.H. & Prasad, P. Effects of furosemide on medullary oxygenation in younger and older
subjects. Kidney international 57, 2080-2083 (2000).
Rfrences bibliographiques

379. Vallon, V. et al. SGLT2 inhibitor empagliflozin reduces renal growth and albuminuria in proportion to
hyperglycemia and prevents glomerular hyperfiltration in diabetic Akita mice. American journal of
physiology. Renal physiology 306, F194-204 (2014).

380. Hasan, F.M., Alsahli, M. & Gerich, J.E. SGLT2 inhibitors in the treatment of type 2 diabetes. Diabetes
research and clinical practice 104, 297-322 (2014).

381. Sha, S. et al. Canagliflozin, a novel inhibitor of sodium glucose co-transporter 2, dose dependently 211
reduces calculated renal threshold for glucose excretion and increases urinary glucose excretion in
healthy subjects. Diabetes, obesity & metabolism 13, 669-672 (2011).

382. Romera, I. et al. Efficacy and safety of empagliflozin in combination with other oral hypoglycemic
agents in patients with type 2 diabetes mellitus. Endocrinol Nutr (2016).

383. Palm, F. Intrarenal oxygen in diabetes and a possible link to diabetic nephropathy. Clinical and
experimental pharmacology & physiology 33, 997-1001 (2006).

384. Chen, C., Pore, N., Behrooz, A., Ismail-Beigi, F. & Maity, A. Regulation of glut1 mRNA by hypoxia-
inducible factor-1. Interaction between H-ras and hypoxia. The Journal of biological chemistry 276,
9519-9525 (2001).

385. Manotham, K. et al. A biologic role of HIF-1 in the renal medulla. Kidney international 67, 1428-1439
(2005).

386. Takiyama, Y. et al. Tubular injury in a rat model of type 2 diabetes is prevented by metformin: a
possible role of HIF-1alpha expression and oxygen metabolism. Diabetes 60, 981-992 (2011).

387. Semenza, G.L. Vascular responses to hypoxia and ischemia. Arteriosclerosis, thrombosis, and vascular
biology 30, 648-652 (2010).

388. Botusan, I.R. et al. Stabilization of HIF-1alpha is critical to improve wound healing in diabetic mice.
Proceedings of the National Academy of Sciences of the United States of America 105, 19426-19431
(2008).

389. Catrina, S.B., Botusan, I.R. & Sunkari, V.G. Hyperglycemia and hypoxia inducible factor, a multifaceted
story. Cell cycle 9, 1856 (2010).

390. Gu, H.F. et al. Impact of the Hypoxia-Inducible Factor-1 alpha (HIF1A) Pro582Ser Polymorphism on
Diabetes Nephropathy. Diabetes Care 36, 415-421 (2013).

391. Bento, C.F. et al. The chaperone-dependent ubiquitin ligase CHIP targets HIF-1alpha for degradation in
the presence of methylglyoxal. PLoS One 5, e15062 (2010).

392. Catrina, S.B., Okamoto, K., Pereira, T., Brismar, K. & Poellinger, L. Hyperglycemia regulates hypoxia-
inducible factor-1alpha protein stability and function. Diabetes 53, 3226-3232 (2004).

393. Malhotra, R. et al. Glucose uptake and adenoviral mediated GLUT1 infection decrease hypoxia-induced
HIF-1alpha levels in cardiac myocytes. J Mol Cell Cardiol 34, 1063-1073 (2002).

394. Gao, W. et al. Glucose attenuates hypoxia-induced changes in endothelial cell growth by inhibiting HIF-
1alpha expression. Diabetes & vascular disease research : official journal of the International Society of
Diabetes and Vascular Disease (2014).

395. Nordquist, L. et al. Activation of hypoxia-inducible factors prevents diabetic nephropathy. Journal of
the American Society of Nephrology : JASN 26, 328-338 (2015).

396. Kalapos, M.P. Methylglyoxal in living organisms: chemistry, biochemistry, toxicology and biological
implications. Toxicol Lett 110, 145-175 (1999).
Rfrences bibliographiques

397. Ceradini, D.J. et al. Decreasing intracellular superoxide corrects defective ischemia-induced new vessel
formation in diabetic mice. The Journal of biological chemistry 283, 10930-10938 (2008).

398. Bento, C.F. et al. Methylglyoxal-induced imbalance in the ratio of vascular endothelial growth factor to
angiopoietin 2 secreted by retinal pigment epithelial cells leads to endothelial dysfunction.
Experimental physiology 95, 955-970 (2010).

399. Thangarajah, H. et al. The molecular basis for impaired hypoxia-induced VEGF expression in diabetic 212
tissues. Proceedings of the National Academy of Sciences of the United States of America 106, 13505-
13510 (2009).

400. Zou, A.P. & Cowley, A.W., Jr. Reactive oxygen species and molecular regulation of renal oxygenation.
Acta Physiol Scand 179, 233-241 (2003).

401. Brouwers, O. et al. Overexpression of glyoxalase-I reduces hyperglycemia-induced levels of advanced


glycation end products and oxidative stress in diabetic rats. The Journal of biological chemistry 286,
1374-1380 (2011).

402. Xiao, Q., Zeng, S., Ling, S. & Lv, M. Up-regulation of HIF-1alpha and VEGF expression by elevated
glucose concentration and hypoxia in cultured human retinal pigment epithelial cells. Journal of
Huazhong University of Science and Technology. Medical sciences = Hua zhong ke ji da xue xue bao. Yi
xue Ying De wen ban = Huazhong keji daxue xuebao. Yixue Yingdewen ban 26, 463-465 (2006).

403. Yan, J., Zhang, Z. & Shi, H. HIF-1 is involved in high glucose-induced paracellular permeability of brain
endothelial cells. Cellular and molecular life sciences : CMLS 69, 115-128 (2012).

404. Uyeda, K. & Repa, J.J. Carbohydrate response element binding protein, ChREBP, a transcription factor
coupling hepatic glucose utilization and lipid synthesis. Cell metabolism 4, 107-110 (2006).

405. Isoe, T. et al. High glucose activates HIF-1-mediated signal transduction in glomerular mesangial cells
through a carbohydrate response element binding protein. Kidney international 78, 48-59 (2010).

406. Haase, V.H. The sweet side of HIF. Kidney international 78, 10-13 (2010).

407. Li, R. et al. High Glucose Upregulates ADAM17 through HIF-1alpha in Mesangial Cells. The Journal of
biological chemistry (2015).

408. Taniguchi, K. et al. Inhibition of Src kinase blocks high glucose-induced EGFR transactivation and
collagen synthesis in mesangial cells and prevents diabetic nephropathy in mice. Diabetes 62, 3874-
3886 (2013).

409. Uttarwar, L. et al. HB-EGF release mediates glucose-induced activation of the epidermal growth factor
receptor in mesangial cells. American journal of physiology. Renal physiology 300, F921-931 (2011).

410. Melenhorst, W.B. et al. ADAM17 upregulation in human renal disease: a role in modulating TGF-alpha
availability? American journal of physiology. Renal physiology 297, F781-790 (2009).

411. Ford, B.M. et al. ADAM17 mediates Nox4 expression and NADPH oxidase activity in the kidney cortex of
OVE26 mice. American journal of physiology. Renal physiology 305, F323-332 (2013).

412. Hirose, R. et al. Transient hyperglycemia affects the extent of ischemia-reperfusion-induced renal injury
in rats. Anesthesiology 108, 402-414 (2008).

413. Zhou, S.P., Liao, W.T., Yang, L.K. & Sun, L. Effects of sevoflurane pretreatment on renal Src and FAK
expression in diabetic rats after renal ischemia/reperfusion injury. Molecular and cellular biochemistry
384, 203-211 (2013).
Rfrences bibliographiques

414. Fouad, A.A., Al-Mulhim, A.S., Jresat, I. & Morsy, M.A. Protective effects of captopril in diabetic rats
exposed to ischemia/reperfusion renal injury. J Pharm Pharmacol 65, 243-252 (2013).

415. Kuramochi, G. & Homma, S. Effects of furosemide on renal oxygen consumption after ischemia in
normal and streptozotocin diabetic rats. Nephron 64, 436-442 (1993).

416. Wald, H., Markowitz, H., Zevin, S. & Popovtzer, M.M. Opposite effects of diabetes on nephrotoxic and
ischemic acute tubular necrosis. Proc Soc Exp Biol Med 195, 51-56 (1990). 213
417. Melin, J. et al. Ischemia causes rapidly progressive nephropathy in the diabetic rat. Kidney international
52, 985-991 (1997).

418. Melin, J., Hellberg, O., Larsson, E., Zezina, L. & Fellstrom, B.C. Protective effect of insulin on ischemic
renal injury in diabetes mellitus. Kidney international 61, 1383-1392 (2002).

419. Shi, H., Patschan, D., Epstein, T., Goligorsky, M.S. & Winaver, J. Delayed recovery of renal regional
blood flow in diabetic mice subjected to acute ischemic kidney injury. American journal of physiology.
Renal physiology 293, F1512-1517 (2007).

420. Nakazawa, J. et al. Renoprotective effects of asialoerythropoietin in diabetic mice against ischaemia-
reperfusion-induced acute kidney injury. Nephrology 15, 93-101 (2010).

421. Lejay, A. et al. Ischemia reperfusion injury, ischemic conditioning and diabetes mellitus. J Mol Cell
Cardiol (2015).

422. Murry, C.E., Jennings, R.B. & Reimer, K.A. Preconditioning with ischemia: a delay of lethal cell injury in
ischemic myocardium. Circulation 74, 1124-1136 (1986).

423. Yuen, P.S., Jo, S.K., Holly, M.K., Hu, X. & Star, R.A. Ischemic and nephrotoxic acute renal failure are
distinguished by their broad transcriptomic responses. Physiol Genomics 25, 375-386 (2006).

424. Yoon, Y.E. et al. Renoprotective Mechanism of Remote Ischemic Preconditioning Based on
Transcriptomic Analysis in a Porcine Renal Ischemia Reperfusion Injury Model. PLoS One 10, e0141099
(2015).

425. Mejia-Vilet, J.M. et al. Renal ischemia-reperfusion injury is prevented by the mineralocorticoid receptor
blocker spironolactone. American journal of physiology. Renal physiology 293, F78-86 (2007).

426. Ozbilgin, S. et al. Renal Ischemia/Reperfusion Injury in Diabetic Rats: The Role of Local Ischemic
Preconditioning. BioMed research international 2016, 8580475 (2016).

427. Wang, H. et al. Acute hyperglycemia prevents dexmedetomidine-induced preconditioning against renal
ischemia-reperfusion injury. Acta cirurgica brasileira / Sociedade Brasileira para Desenvolvimento
Pesquisa em Cirurgia 29, 812-818 (2014).

428. Bucciarelli, L.G. et al. Receptor for advanced-glycation end products: key modulator of myocardial
ischemic injury. Circulation 113, 1226-1234 (2006).

429. Oya, T. et al. Methylglyoxal modification of protein. Chemical and immunochemical characterization of
methylglyoxal-arginine adducts. The Journal of biological chemistry 274, 18492-18502 (1999).

430. Lapar, D.J. et al. Acute hyperglycemic exacerbation of lung ischemia-reperfusion injury is mediated by
receptor for advanced glycation end-products signaling. Am J Respir Cell Mol Biol 46, 299-305 (2012).

431. Kumagai, T., Nangaku, M. & Inagi, R. Pathophysiological role of the glyoxalase system in renal hypoxic
injury. Annals of the New York Academy of Sciences 1126, 265-267 (2008).

432. Atkinson, M.A., Eisenbarth, G.S. & Michels, A.W. Type 1 diabetes. Lancet 383, 69-82 (2014).
Rfrences bibliographiques

433. Kahn, S.E., Cooper, M.E. & Del Prato, S. Pathophysiology and treatment of type 2 diabetes: perspectives
on the past, present, and future. Lancet 383, 1068-1083 (2014).

434. de Zeeuw, D. et al. The effect of CCR2 inhibitor CCX140-B on residual albuminuria in patients with type
2 diabetes and nephropathy: a randomised trial. Lancet Diabetes Endocrinol 3, 687-696 (2015).

435. Hasegawa, G. et al. Possible role of tumor necrosis factor and interleukin-1 in the development of
diabetic nephropathy. Kidney international 40, 1007-1012 (1991). 214
436. Furuta, T. et al. The role of macrophages in diabetic glomerulosclerosis. American journal of kidney
diseases : the official journal of the National Kidney Foundation 21, 480-485 (1993).

437. Kennedy, A., Fearon, U., Veale, D.J. & Godson, C. Macrophages in synovial inflammation. Front
Immunol 2, 52 (2011).

438. Chow, F.Y. et al. Monocyte chemoattractant protein-1-induced tissue inflammation is critical for the
development of renal injury but not type 2 diabetes in obese db/db mice. Diabetologia 50, 471-480
(2007).

439. Zheng, D. et al. Transfused macrophages ameliorate pancreatic and renal injury in murine diabetes
mellitus. Nephron. Experimental nephrology 118, e87-99 (2011).

440. Awad, A.S. et al. Macrophage-derived tumor necrosis factor-alpha mediates diabetic renal injury.
Kidney international 88, 722-733 (2015).

441. Hickey, F.B. & Martin, F. Diabetic kidney disease and immune modulation. Curr Opin Pharmacol 13,
602-612 (2013).

442. Sun, L. & Kanwar, Y.S. Relevance of TNF-alpha in the context of other inflammatory cytokines in the
progression of diabetic nephropathy. Kidney international 88, 662-665 (2015).

443. Moriwaki, Y. et al. Effect of TNF-alpha inhibition on urinary albumin excretion in experimental diabetic
rats. Acta Diabetol 44, 215-218 (2007).

444. Omote, K. et al. Role of the TNF pathway in the progression of diabetic nephropathy in KK-A(y) mice.
American journal of physiology. Renal physiology 306, F1335-1347 (2014).

445. Xu, L. et al. Serum Levels of Progranulin Are Closely Associated with Microvascular Complication in
Type 2 Diabetes. Dis Markers 2015, 357279 (2015).

446. Sun, H.K. et al. Phosphodiesterase inhibitor improves renal tubulointerstitial hypoxia of the diabetic rat
kidney. The Korean journal of internal medicine 27, 163-170 (2012).

447. Navarro-Gonzalez, J.F. et al. Effect of pentoxifylline on renal function and urinary albumin excretion in
patients with diabetic kidney disease: the PREDIAN trial. Journal of the American Society of Nephrology
: JASN 26, 220-229 (2015).

448. Watts, C., West, M.A. & Zaru, R. TLR signalling regulated antigen presentation in dendritic cells. Curr
Opin Immunol 22, 124-130 (2010).

449. Anders, H.J., Banas, B. & Schlondorff, D. Signaling danger: toll-like receptors and their potential roles in
kidney disease. Journal of the American Society of Nephrology : JASN 15, 854-867 (2004).

450. Devaraj, S., Dasu, M.R., Park, S.H. & Jialal, I. Increased levels of ligands of Toll-like receptors 2 and 4 in
type 1 diabetes. Diabetologia 52, 1665-1668 (2009).

451. Banas, M.C. et al. TLR4 links podocytes with the innate immune system to mediate glomerular injury.
Journal of the American Society of Nephrology : JASN 19, 704-713 (2008).
Rfrences bibliographiques

452. Wolf, G. et al. Angiotensin II upregulates toll-like receptor 4 on mesangial cells. Journal of the American
Society of Nephrology : JASN 17, 1585-1593 (2006).

453. Kaur, H., Chien, A. & Jialal, I. Hyperglycemia induces Toll like receptor 4 expression and activity in
mouse mesangial cells: relevance to diabetic nephropathy. American journal of physiology. Renal
physiology 303, F1145-1150 (2012).

454. Takata, S., Sawa, Y., Uchiyama, T. & Ishikawa, H. Expression of Toll-Like Receptor 4 in Glomerular 215
Endothelial Cells under Diabetic Conditions. Acta Histochem Cytochem 46, 35-42 (2013).

455. Kruger, B. et al. Donor Toll-like receptor 4 contributes to ischemia and reperfusion injury following
human kidney transplantation. Proceedings of the National Academy of Sciences of the United States
of America 106, 3390-3395 (2009).

456. Kawai, T. & Akira, S. The role of pattern-recognition receptors in innate immunity: update on Toll-like
receptors. Nat Immunol 11, 373-384 (2010).

457. Erridge, C. Endogenous ligands of TLR2 and TLR4: agonists or assistants? Journal of leukocyte biology
87, 989-999 (2010).

458. Navarro-Gonzalez, J.F., Mora-Fernandez, C., Muros de Fuentes, M. & Garcia-Perez, J. Inflammatory
molecules and pathways in the pathogenesis of diabetic nephropathy. Nature reviews. Nephrology 7,
327-340 (2011).

459. Mudaliar, H., Pollock, C. & Panchapakesan, U. Role of Toll-like receptors in diabetic nephropathy. Clin
Sci (Lond) 126, 685-694 (2014).

460. Devaraj, S. et al. Increased toll-like receptor (TLR) 2 and TLR4 expression in monocytes from patients
with type 1 diabetes: further evidence of a proinflammatory state. The Journal of clinical endocrinology
and metabolism 93, 578-583 (2008).

461. Dasu, M.R., Devaraj, S., Park, S. & Jialal, I. Increased toll-like receptor (TLR) activation and TLR ligands
in recently diagnosed type 2 diabetic subjects. Diabetes Care 33, 861-868 (2010).

462. Li, F. et al. Increased expression of toll-like receptor 2 in rat diabetic nephropathy. American journal of
nephrology 32, 179-186 (2010).

463. Devaraj, S. et al. Knockout of toll-like receptor-2 attenuates both the proinflammatory state of diabetes
and incipient diabetic nephropathy. Arteriosclerosis, thrombosis, and vascular biology 31, 1796-1804
(2011).

464. Lin, M. et al. Toll-like receptor 4 promotes tubular inflammation in diabetic nephropathy. Journal of the
American Society of Nephrology : JASN 23, 86-102 (2012).

465. Bending, J.J., Lobo-Yeo, A., Vergani, D. & Viberti, G.C. Proteinuria and activated T-lymphocytes in
diabetic nephropathy. Diabetes 37, 507-511 (1988).

466. Moriya, R., Manivel, J.C. & Mauer, M. Juxtaglomerular apparatus T-cell infiltration affects glomerular
structure in Type 1 diabetic patients. Diabetologia 47, 82-88 (2004).

467. van Belle, T.L., Coppieters, K.T. & von Herrath, M.G. Type 1 diabetes: etiology, immunology, and
therapeutic strategies. Physiol Rev 91, 79-118 (2011).

468. Odobasic, D., Kitching, A.R., Tipping, P.G. & Holdsworth, S.R. CD80 and CD86 costimulatory molecules
regulate crescentic glomerulonephritis by different mechanisms. Kidney international 68, 584-594
(2005).
Rfrences bibliographiques

469. Wu, C.C. et al. Aberrant cytokines/chemokines production correlate with proteinuria in patients with
overt diabetic nephropathy. Clin Chim Acta 411, 700-704 (2010).

470. Abbas, A.K., Murphy, K.M. & Sher, A. Functional diversity of helper T lymphocytes. Nature 383, 787-793
(1996).

471. Lalani, I., Bhol, K. & Ahmed, A.R. Interleukin-10: biology, role in inflammation and autoimmunity. Ann
Allergy Asthma Immunol 79, 469-483 (1997). 216
472. van Exel, E. et al. Low production capacity of interleukin-10 associates with the metabolic syndrome
and type 2 diabetes : the Leiden 85-Plus Study. Diabetes 51, 1088-1092 (2002).

473. Mysliwska, J. et al. High levels of circulating interleukin-10 in diabetic nephropathy patients. Eur
Cytokine Netw 16, 117-122 (2005).

474. Zamauskaite, A., Yaqoob, M.M., Madrigal, J.A. & Cohen, S.B. The frequency of Th2 type cells increases
with time on peritoneal dialysis in patients with diabetic nephropathy. Eur Cytokine Netw 10, 219-226
(1999).

475. Miossec, P., Korn, T. & Kuchroo, V.K. Interleukin-17 and type 17 helper T cells. The New England journal
of medicine 361, 888-898 (2009).

476. Heurtier, A.H. & Boitard, C. T-cell regulation in murine and human autoimmune diabetes: the role of
TH1 and TH2 cells. Diabetes Metab 23, 377-385 (1997).

477. Bending, D. et al. Highly purified Th17 cells from BDC2.5NOD mice convert into Th1-like cells in
NOD/SCID recipient mice. The Journal of clinical investigation 119, 565-572 (2009).

478. Bradshaw, E.M. et al. Monocytes from patients with type 1 diabetes spontaneously secrete
proinflammatory cytokines inducing Th17 cells. Journal of immunology 183, 4432-4439 (2009).

479. Jagannathan-Bogdan, M. et al. Elevated proinflammatory cytokine production by a skewed T cell


compartment requires monocytes and promotes inflammation in type 2 diabetes. Journal of
immunology 186, 1162-1172 (2011).

480. Kim, S.M. et al. Targeting T helper 17 by mycophenolate mofetil attenuates diabetic nephropathy
progression. Transl Res 166, 375-383 (2015).

481. Xu, J., Su, H.L., Wang, J.H. & Zhang, C.H. [Role of CD4+CD25+Foxp3+ regulatory T cells in type 2 diabetic
nephropathy]. Nan Fang Yi Ke Da Xue Xue Bao 29, 137-139 (2009).

482. Nishimura, S. et al. CD8+ effector T cells contribute to macrophage recruitment and adipose tissue
inflammation in obesity. Nature medicine 15, 914-920 (2009).

483. Xiao, X. et al. Cellular and humoral immune responses in the early stages of diabetic nephropathy in
NOD mice. J Autoimmun 32, 85-93 (2009).

484. Mensah-Brown, E.P. et al. Streptozotocin-induced diabetic nephropathy in rats: the role of
inflammatory cytokines. Cytokine 31, 180-190 (2005).

485. Lim, A.K. et al. Lymphocytes promote albuminuria, but not renal dysfunction or histological damage in
a mouse model of diabetic renal injury. Diabetologia 53, 1772-1782 (2010).

486. Onk, D. et al. Melatonin Attenuates Contrast-Induced Nephropathy in Diabetic Rats: The Role of
Interleukin-33 and Oxidative Stress. Mediators of inflammation 2016, 9050828 (2016).

487. Demirtas, L. et al. The possible role of interleukin-33 as a new player in the pathogenesis of contrast-
induced nephropathy in diabetic rats. Renal failure 38, 952-960 (2016).
Rfrences bibliographiques

488. Zdravkovic, N., Shahin, A., Arsenijevic, N., Lukic, M.L. & Mensah-Brown, E.P. Regulatory T cells and ST2
signaling control diabetes induction with multiple low doses of streptozotocin. Molecular immunology
47, 28-36 (2009).

489. Kim, M., Park, S.W., Kim, M., D'Agati, V.D. & Lee, H.T. Isoflurane activates intestinal sphingosine kinase
to protect against renal ischemia-reperfusion-induced liver and intestine injury. Anesthesiology 114,
363-373 (2011).
217
490. Ma, D. et al. Xenon preconditioning protects against renal ischemic-reperfusion injury via HIF-1alpha
activation. Journal of the American Society of Nephrology : JASN 20, 713-720 (2009).

491. Yoo, Y.C. et al. Propofol attenuates renal ischemia-reperfusion injury aggravated by hyperglycemia.
The Journal of surgical research 183, 783-791 (2013).

492. Zhang, L. et al. Pre-treatment with isoflurane ameliorates renal ischemic-reperfusion injury in mice. Life
Sci 88, 1102-1107 (2011).

493. Wei, Q. & Dong, Z. Mouse model of ischemic acute kidney injury: technical notes and tricks. American
journal of physiology. Renal physiology 303, F1487-1494 (2012).

494. Bellinger, M.A. et al. Concordant changes of plasma and kidney microRNA in the early stages of acute
kidney injury: time course in a mouse model of bilateral renal ischemia-reperfusion. PLoS One 9,
e93297 (2014).

495. Hu, H., Wang, G., Batteux, F. & Nicco, C. Gender differences in the susceptibility to renal ischemia-
reperfusion injury in BALB/c mice. The Tohoku journal of experimental medicine 218, 325-329 (2009).

496. Hueper, K. et al. Acute kidney injury: arterial spin labeling to monitor renal perfusion impairment in
mice-comparison with histopathologic results and renal function. Radiology 270, 117-124 (2014).

497. Graham, M.L., Janecek, J.L., Kittredge, J.A., Hering, B.J. & Schuurman, H.J. The streptozotocin-induced
diabetic nude mouse model: differences between animals from different sources. Comparative
medicine 61, 356-360 (2011).

498. osterby, R. Early phases in the development of diabetic glomerulopathy. Acta Med Scand Suppl 574, 3-
82 (1974).

499. Aldahmash, B.A., El-Nagar, D.M., Ibrahim, K.E. & Metwaly, M.S. Biotin amelioration of nephrotoxicity
in streptozotocin-induced diabetic mice. Saudi J Biol Sci 22, 564-569 (2015).

500. Palm, F., Ortsater, H., Hansell, P., Liss, P. & Carlsson, P.O. Differentiating between effects of
streptozotocin per se and subsequent hyperglycemia on renal function and metabolism in the
streptozotocin-diabetic rat model. Diabetes Metab Res Rev 20, 452-459 (2004).

501. Cheng, Y. et al. Beta-cell regeneration from vimentin+/MafB+ cells after STZ-induced extreme beta-cell
ablation. Sci Rep 5, 11703 (2015).
Rsum

La transplantation rnale (TR) est la stratgie thrapeutique de choix pour les insuffisances rnales
terminales. Lutilisation de greffons de donneurs critres tendus, tels les sujets diabtiques, est devenue
une ncessit face la pnurie de greffons, malgr le risque accru de dysfonction du greffon.
Lischmie/reperfusion (I/R) est une tape inhrente la TR. Le diabte est un facteur de risque pour le
dveloppement de lsions rnales aigus mais les mcanismes daction mis en jeu restent lucider. Il
existe peu de donnes exprimentales sur les consquences dltres du diabte sur les lsions dI/R
rnales. Nous avons fait lhypothse que lIL-33, en tant qualarmine, joue un rle cl au carrefour qui lie
lhyperglycmie lI/R.

Lobjectif de ce travail a t dtudier leffet de la dltion du rcepteur ST2 de lIL-33 sur les lsions dI/R
rnales dans un contexte hyperglycmique. Nous avons utilis un modle dI/R rnale chez des souris
transgniques dpourvues du rcepteur ST2. Le diabte type 1 a t induit par la streptozotocine. Nous
avons dmontr que la dltion du rcepteur ST2 a un effet nphroprotecteur en situation euglycmique,
suggrant un effet exacerbateur de lIL-33 sur les lsions dI/R rnales. Cette protection rnale a t perdue
en condition hyperglycmique. Lensemble de ces rsultats suggre que lIL-33, en tant qualarmine, a des
effets diffrentiels en fonction de lenvironnement hyperglycmique. Sur le plan clinique, compte tenu de
limpact nfaste du diabte sur le rein, nos rsultats conduisent proposer dtudier la place de lIL-33 dans
linflammation chronique associe au diabte et de ses consquences sur la fonction rnale.

------------------------------

Mots cls : transplantation rnale, hyperglycmie, euglycmie, ischmie/reperfusion rnale, axe IL-33/ST2,
streptozotocine, alarmine, greffon.

Abstract

Renal transplantation (RT) is the therapeutic strategy of choice for end-stage renal failure. The use of graft
from extended criteria donors, including patients with diabetes, has become mandatory to cope with the
shortage of grafts, despite an increased risk of graft dysfunction. Ischemia reperfusion (I/R) is a key step in
RT. Diabetes is a risk-factor for the development of acute kidney injury (AKI), which mecanisms are not fully
elucidated. Moreover, there are few experimental data on the deleterious effects of diabetes on ischemic
AKI. We hypothesized that IL-33, as an alarmin, plays a key role at the crossroads linking hyperglycemia to
I/R injury.

The objective of this work was to study the effect of the deletion of the ST2 receptor of IL-33 on I/R injury in
the context of hyperglycemic environment. We thus used a renal I/R model in transgenic mice lacking the IL-
33 receptor (ST2). Type 1 diabetes was induced by streptozotocin. We demonstrated that the deletion of
ST2 has a renal protective effect in euglycemic conditions, suggesting an exacerbating effect of IL-33 in
renal I/R injury. The protective effect induced by the absence of ST2 was lost in hyperglycemic conditions.
Taken together, these findings indicate that IL-33 exerts differential effects depending on hyperglycemia.
Clinically, given the deleterious impact of diabetes on the kidney, our results lead to propose to further study
the place of IL-33 in chronic inflammation associated with diabetes and its effects on renal function.

------------------------------

Key words: renal transplantation, hyperglycemic, euglycemic, renal ischemia/reperfusion, IL-33/ST2 axis, streptozotocin,
alarmin, graft.