Eur J Clin Pharmacol (2003) 59: 303312
DOI 10.1007/s00228-003-0606-2
PHARMACOKINETICS AND DISPOSITION
Elena A. Gaikovitch Ingolf Cascorbi
Przemyslaw M. Mrozikiewicz Jurgen Brockmoller
Roland Frotschl Karla Kopke Thomas Gerlo
Jury N. Chernov Ivar Roots
Polymorphisms of drug-metabolizing enzymes CYP2C9, CYP2C19,
CYP2D6, CYP1A1, NAT2 and of P-glycoprotein in a Russian population
Received: 10 June 2002 / Accepted: 31 March 2003 / Published online: 15 July 2003

Springer-Verlag 2003
Abstract Objective: The frequency of functionally
important mutations and alleles of genes coding for
xenobiotic metabolizing enzymes shows a wide ethnic
variation. However, little is known of the frequency
distribution of the major allelic variants in the Russian
population.
Methods: Using polymerase chain reaction/restriction
fragment length polymorphism (PCR/RFLP) genotyp-
ing assays and the real-time PCR with uorescent
probes, the frequencies of functionally important vari-
ants of the cytochromes P450 (CYP) 2C9, 2C19, 2D6,
1A1 as well as arylamine N-acetyltransferase 2 (NAT2)
and P-glycoprotein (MDR1) were determined in a
sample of 290 Russian volunteers derived from Voro-
nezh area.
Results: CYP2C9*2 and *3 alleles were found with
allelic frequencies of 10.5% and 6.7%, respectively. The
novel intron-2 T>C mutation at exon 2 +73 bp oc-
curred in 24.8% of alleles. CYP2C19*2 and *3 alleles
occurred in 11.4% and 0.3%, respectively. Six persons
(2.1%) carried two of these CYP2C19 alleles responsible
for poor metabolizing activity. Of all subjects, 5.9%
were CYP2D6 poor metabolizers, whereas 3.4% were
addressed to ultra-rapid metabolizers (CYP2D6*12/
E. A. Gaikovitch (&) P. M. Mrozikiewicz R. Frotschl
K. Kopke T. Gerloff I. Roots
Institute of Clinical Pharmacology,
University Clinic Charite, Humboldt University of Berlin,
Schumannstrasse 20/21, 10098 Berlin, Germany
E-mail: elena.gaikovitch@charite.de
Tel.: +49-30-450525229
Fax: +49-30-450525925
E. A. Gaikovitch J. N. Chernov
Department of Clinical Pharmacology,
Voronezh State Medical Academy, Voronezh, Russia
I. Cascorbi
Institute of Pharmacology, Ernst-Moritz-Arndt University,
Greifswald, Germany
J. Brockmoller
Department of Clinical Pharmacology,
Georg-August University, Gottingen, Germany
*1). The CYP1A1*2A allele was found in 4.7%, *2B in
5.0%, *4 in 2.6%, and the 5-mutations )3219C>T,
)3229G>A, and the novel )4335G>A in 6.0%, 2.9%
and 26.0% of alleles, respectively. Genotyping of eight
dierent single nucleotide polymorphisms in the NAT2
gene provided in 58.0% a genotype associated with slow
acetylation. The MDR1 triple variants G2677T and
G2677A in exon 21 had an allelic frequency of 41.9%
and 3.3%, respectively, and the variant C3435T in exon
26 one of 54.3%. Frequencies of functionally important
haplotypes were calculated.
Conclusion: The overview of allele distribution of
important xenobiotic-metabolizing enzymes among a
Russian population shows similarity to other Cauca-
sians. The data will be useful for clinical pharmacokinetic
investigations and for drug dosage recommendations in
the Russian population.
Keywords Cytochrome P450 CYP NAT2 MDR1
Russians Haplotypes
Introduction
Drug-metabolizing enzymes (DMEs) play a multiple
role in the organism. They inactivate drugs and xeno-
biotics preparing them for excretion [1]. However, they
are also capable of activating prodrugs or of trans-
forming foreign compounds to highly reactive interme-
diates that might act as carcinogens or mutagens.
Therefore, DMEs also play a key role in the etiopa-
thology of several malignancies [2]. Genetic dierences
in the regulation, expression, and activity of DME genes
might be crucial factors in dening cancer susceptibility,
as well as in determining the ecacy of drugs and the
toxic potential of environmental pollutants. Almost all
DMEs are subject to genetic polymorphism. The activity
of these variant enzymes ranges from the absolute
absence to high metabolizing capacity.
The allelic distribution of the major genes coding for
xenobiotic metabolizing cytochrome P450, namely
304

CYP2D6 [3, 4, 5, 6, 7], CYP2C9 [8, 9, 10], CYP2C19

[6, 9, 11], and CYP1A1 [12, 13, 14], as well as the phase-
II enzyme, arylamine N-acetyltransferase 2 (NAT2)
[15, 16, 17, 18], is well established in various popula-
tions. The prevalence of polymorphisms and haplotypes
in the ABC-transporter P-glycoprotein (MDR1 gene),
which were identied recently, has shown great inter-
ethnic variability [19, 20, 21, 22, 23, 24]. However, there
is scarce information about allele frequency distribution
of these enzymes and transporters among the Russian
population. There are investigations of the frequencies
of CYP2D6 alleles *3 and *4 and CYP2C19 alleles
*2 and *3 in Russians living in Estonia [25], and the
study of CYP2D6*4, CYP1A1Val, contained in CY-
P1A1*2B allele, and GSTM*0 alleles in a population of
Tundra Nentsi and Russian Caucasians from Western
Siberia [26]. Therefore, we determined the common
DMEs and drug-transporter polymorphisms responsible
for the pharmacokinetics of a large number of drugs,
among a sample of Russians, as the biggest Slavic
population.
Fig. 1 DNA sequencing electropherogram of the region containing
the position +73 bp at exon 2 of CYP2C9. The top sequence
represents a wild-type sequence (T), the middle sequence a
Materials and methods heterozygous (N), and the bottom sequence characterizes variant
sample (C)
Participants

A total of 290 (152 males, 138 females) unrelated individuals from

the European part of Russia (Voronezh and region) was included
into the study. The mean age was 40.916.4 years (range
1477 years). Except for 71 healthy volunteers, subjects were out-
patients of the Central Railway Clinic in Voronezh with non-
malignant diseases from the departments of otorhinolaryngology
(141), surgery (41), neurology (34) and traumatology (3). The main
diagnoses were: pharyngitis, sinusitis, diseases of the gallbladder
and bile duct, and traumatic bone fracture. All subjects gave their
written informed consent, and the study was approved by the
Central Moscow ethics committee.
Leukocytes were isolated in Voronezh, Russia, and transported
to Berlin for genotyping procedures. DNA was extracted using a
standard phenol/chloroform method.
CYP2C9
Mutations were identied according to Aynacioglu et al. [8] for
alleles *2 (430C>T; Arg144Cys) and *3 (1075A>C; Ile359Leu)
and according to Cascorbi et al. [27] for intron 2 T>C polymor-
phism, which is situated 73 bp downstream from exon 2. Briey, a
375-bp fragment was amplied with primers 5-CACTGGCTG-
AAAGAGCTAACAGAG and 5-GTGATATGGAGTAGGGT-
CACCCAC and digested with BglI. In addition, fragments were
sequenced forward and in reverse using a dye terminator
sequencing kit (Applied Biosystems), and analyzed with sequencer
310 Genetic Analyzer (ABI PRISM) (Fig. 1). For the nomenclature
of CYP alleles, see http://www.imm.ki.se/CYPalleles/.
CYP2C19
The CYP2C19 mutation m1 (681G>A), which is contained in
allele *2, was genotyped according to de Morais et al. [28], and
mutation m2 (636G>A), coding for allele *3, was determined
using LightCycler (Roche Diagnostics Inc., Mannheim, Germany)
assay according to Borlak et al. [29].
CYP2D6
Identication of CYP2D6 alleles *1 (wild type), *3, *4, *5 (deletion),
*6, *10, and CYP2D6 gene duplications*12, *22 and *42was
performed using polymerase chain reaction/restriction fragment
length polymorphism (PCR-RFLP) according to Sachse et al. [3].
CYP1A1
Mutation m1 (3801T>C) known as 3-UTR MspI polymorphism
present in CYP1A1*2A and *2B; m2 (2455A>G) causing the
Ile462Val exchange in exon 7 in *2B; m3 (3205T>C), polymor-
phism in *3; and m4 (2453C>A), coding for exon 7 Thr461Asn in
*4, were identied according to Cascorbi et al. [12]. The recently in
our laboratory discovered )4335G>A mutation was analyzed
after amplication with primers 5-TGGGGCATATTAC-
TTGTCTCCTT and 5-CGGCCTCGTGCATTGCAGAAATA
and subsequent digestion with HhaI. The results of PCR-RFLP
were veried by forward and reverse sequencing (Fig. 2). For the
analysis of mutations )3219C>T and )3229G>A [30], ampli-
cation with primers 5-GAACCTCAGCTAGTCGCCC and 5-
AGAGAGGGTACGGGAAGCTC and digestion with BslI and
NcoI, respectively, were performed.
NAT2
Eight polymorphic sites of NAT2 gene were analyzed. Mutations
191G>A, 282C>T, 341T>C, 481C>T, 590G>A, 803A>G, and
857G>A were identied by PCR-RFLP analyses [15] for 111T>C
according to Le et al. [31]. NAT2 allele nomenclature is updated
in [32].
NAT2 genotyping using hybridization-probe assay
A subgroup of 127 samples was checked for the mutations at the
positions 111, 341, 481, 590, 803, and 857, using LightCycler assay.

Fig. 2 DNA sequencing electropherogram of the region containing
the position )4335 of CYP1A1. The top sequence: a wild-type
sequence (G), the middle sequence: a heterozygous (N), and the
bottom sequence: variant sample (A)
Mutations at the positions 481 and 857 were genotyped as
described [33]. The hybridization probes for the detection of
mutations at positions 111, 341, 590 and 803 were designed by Tib
Molbiol (Berlin, Germany). For the detection of the 111T>C
and 341T>C polymorphisms, a 421-bp fragment was amplied
with the primers 5-GACATTGAAGCATATTTTGAAAG and
5-TCCTTCCCAGAAATTAATTCTAG and detected with
hybridization probes 5-LC Red 640-CATGTTAAGGTTCTC-
AAAGGGAACAG and 5-CCAACTCCATGGCTTGCCCAC-
AAT-Flu for the 111T>C, and 5-CAGGTGACCACTIICGGCA
GGAATTACAT-Flu and 5-LC Red 640-TCGATGCTGGGTCT
GGAAGCTCCTCCC for the 341T>C mutation. After denatur-
ation at 95C for 2 min, 45 cycles were performed with denatur-
ation at 95C for 3 s, annealing at 56C for 14 s, and extension
at 72C for 20 s. For the detection of the 590G>A polymor-
phism, a 197-bp fragment was amplied with the primers
5-CCTGGACCAAATCAGGAGAG and 5-GCAAGGAACA-
AAATGATGTGG and detected with the hybridization probes 5-
TTGAACCTCAAACAATTGAA-Flu and 5-LC Red
640-TTTGAGTCTATGAATACATACCTGCAGACGTCT. For
genotyping of 803A>G, a PCR with the primers 5-
GTGGGCTTCATCCTCACCTA and 5-ACACAAGGGTTT-
ATTTTGTTCC was performed and the polymorphism was
detected with the hybridization probes 5-TTGAAGAAGTGC-
TAAAAATATTTAAGA-Flu and 5-LC Red 640-TTCCTT-
GGGGCGAAATCTCTGGC. The PCR conditions were as
follows: initial denaturation at 95C for 2 min, 45 cycles at 95C for
3 s, 60C for 12 s, and at 72C for 18 s. After the PCRs, the
detection was performed with the analysis of DNA melting curves
(Fig. 3).
MDR1
The triple polymorphism in exon 21 (2677G>T/A) was genotyped
using hybridization probes assay [34] and the variant in exon 26
(3435C>T) of MDR1 using PCR-RFLP [20].
305
Fig. 3 Detection of the mutation 590G>A of NAT2 gene using the
LightCycler method. Data of the uorescence signal were obtained
during the melting transition of the uorescein-labeled detection
probe from the amplied fragment. The melting curve is plotted for
a sample homozygous for wild-type (G) allele (a), a heterozygous
(GA) sample (b), and a sample homozygous for the mutant (A)
allele (c). Melting analysis of a no-template control (d) is also
performed
Haplotype analysis
Haplotypes were constructed for the MDR1 gene as combinations of
the two polymorphisms 2677G(reference)>T in exon 21 and
3435C(reference)>T in exon 26 [21]. Genotypes and haplotypes are
given as a sequence of these variants as follows: with respect to
genotype, 1 codes for homozygous status (according to reference
sequence), 2 for heterogygous status, and 3 for homozygous mutated
status. With respect to haplotypes, 1 denotes the reference sequence
at this position, and 2 denotes the mutant sequence. Individuals with
the rare variant 2677A were studied separately. Haplotype
frequencies were calculated by the program ithap-cgi [35].
Statistical analysis
Expected genotype frequencies were calculated using the Hardy-
Weinberg equation from the allele frequencies (p2+2pq+q2=1).
Statistical signicance of odds ratios was calculated using the v2
test. Odds ratios are given with 95% condence intervals (CI).
Results
CYP2C9
The prediction of haplotypes as combinations of the
three described mutations 2T>C, 430C>T and
1075A>C resulted in four alleles: the wild-type allele *1
appeared in 57.9% (95% CI, 53.861.2%), the 2 T>C
mutation was not found in combination with any other
mutation in any allele and built a new allele (*1b) with a
frequency of 24.8% (21.428.6%), and the defected al-
leles *2 and *3 were found with frequencies of 10.5%
(8.113.3%) and 6.7% (4.89.1%), respectively. The
genotypes are given in Table 1.
CYP2C19
The frequency of the mutations m1 (681G>A) and m2
(636G>A) coding for poor metabolizing activity was
11.4% (8.914.3%) and 0.3% (0.041.2%), respectively.
306

Table 1 Frequencies ofCYP2C9 and CYP2C19 genotypes in a (0.42.2%), *4 - 18.2% (15.121.5%), *5 - 2.4% (1.3
sample of the Russian population (n=290). EM extensive metab- 4.0%), *6 - 1.2% (0.52.5%), *10 - 4.2% (2.76.1%).
olizer, SM slow metabolizer, PM poor metabolizer. Expected
genotype frequencies were calculated using the Hardy-Weinberg The allelic frequency of gene duplication of active wild-
equation from allele frequencies. CYP2C9*1b represents wild type type allele *12 was 1.7% (0.83.2%) and of allele *22
carrying the intron-2 T>C mutation at 73 bp downstream of exon with slightly decreased activity 0.5% (0.11.5%). The
2 duplication of the decient allele CYP2D6*4 was
Genotype n % 95% CI Expected not detected in our sample. Of all the subjects, 5.9%
% was identied as CYP2D6 poor metabolizers, whereas
3.4% was addressed to ultra-rapid metabolizers
CYP2C9 (CYP2D6*12/*1; Table 2).
2 active alleles (EM/EM), sum 252 87.0 82.590.6 87.0
*1/*1 91 31.5 26.137.1 33.6
*1/*1b 90 31.0 25.836.7 28.8
*1b/*1b 16 5.5 3.28.8 6.1 CYP1A1
*1/*2 37 12.8 9.117.2 12.2
*1b/*2 16 5.5 3.28.8 5.2 Mutation 3801T>C (m1) forming an MspI restriction
*2/*2 2 0.7 0.02.5 1.1
1 active allele (EM/SM), sum 37 12.7 9.117.2 12.5
site in the 3-anking region was the most frequent
*1/*3 27 9.3 6.213.3 7.8 previously known mutation (Table 3). The African-
*1b/*3 6 2.0 0.84.5 3.3 Black mutation 3205T>C (m3) in the 3-anking region
*2/*3 4 1.4 0.43.5 1.4 was not found. The novel mutation )4335G>A oc-
2 low-active alleles (SM/SM), sum 1 0.3 0.01.9 0.4 curred in 26.0% (22.529.8%) of alleles. The possible
*3/*3 1 0.3 0.01.9 0.4
mutation combinations, i.e., genotypes (Table 4), were
CYP2C19 dened according to the most frequent alleles appearing
2 active alleles (EM/EM), sum 228 78.7 73.583.2 78.0
*1/*1 228 78.7 73.583.2 78.0 in Caucasians as shown by Mrozikiewicz et al. [13].
1 active allele (EM/PM), sum 56 19.3 14.924.3 20.6 Wild-type allele CYP1A1*1A was found in 55.7% (51.5
*1/*2 55 19.0 14.624.0 20.1 59.8%) of all alleles. All 29 individuals with the m2
*1/*3 1 0.3 0.011.9 0.5 mutation had also the m1 mutation. The frequency of
0 active alleles (PM/PM), sum 6 2.0 0.84.5 1.4
*2/*2 5 1.7 0.64.0 1.3
allele CYP1A1*2B was 5.0% (3.47.1%). Allele CY-
*2/*3 1 0.3 0.011.9 0.1 P1A1*2A, carrying only m1, appeared in 4.7% (3.1
6.7%). Frequency of the m4-containing allele, termed
CYP1A1*4, was 2.6% (1.54.2%). The polymorphism
Five subjects (1.7%) were homozygous for the allele *2 in the 5-region )3219C>T was found only in one
and one person (0.3%) carried the combination *2/*3. haplotype, where all other variants corresponded with
Fifty-ve (19.0%) volunteers had genotype *1/*2 and the reference sequence. A frequency of 6.0% (4.28.3%)
one (0.3%) genotype *1/*3 (Table 1). was predicted in the Russian population for this allele
*1B. The novel mutation )4335G>A was observed in
two haplotypes: in the one haplotype, only this mutation
CYP2D6 occurred; in the other haplotype, mutation )4335G>A
was combined with variant )3229G>A. The frequen-
The frequencies of CYP2D6 alleles were: wild-type allele cies of these haplotypes were predicted with 23.1%
*1 - 70.8% (67.074.5%), mutant alleles *3 - 1.0% (19.726.8%) and 2.9% (1.74.7%), respectively.

Table 2 Genotype frequencies

of CYP2D6 among 290 CYP2D6 genotype n % 95% CI Expected %
Russians.UM
ultrarapid metabolizer, 3 active alleles (UM/EM), sum 10 3.4 1.76.3 2.6
EMextensive metabolizer, PM *12/*1 10 3.4 1.76.3 2.6
poor metabolizer 2 active alleles (EM/EM, UM/PM), sum 168 57.9 52.063.7 56.5
*1/*1 148 51.0 45.156.9 50.1
*22/*4 3 1.0 0.23.0 0.2
*1/*10 16 5.5 3.28.8 5.9
*10/*10 1 0.3 0.01.9 0.2
1 active allele (EM/PM), sum 95 32.8 27.438.5 34.2
*1/*3 4 1.4 0.43.5 1.5
*1/*4 70 24.1 19.329.5 25.8
*1/*5 10 3.4 1.76.3 3.6
*1/*6 5 1.7 0.64.0 1.8
*4/*10 6 2.1 0.84.5 1.5
0 active alleles (PM/PM), sum 17 5.9 3.59.2 5.0
*3/*4 2 0.7 0.12.5 0.4
*4/*4 9 3.1 1.45.8 3.3
*4/*5 4 1.4 0.43.5 0.9
*4/*6 2 0.7 0.12.5 0.4
 307

Table 3 Mutation frequencies

and suggested allele frequencies CYP1A1 allele Nucleotide position (nt) n % 95% CI
of CYP1A1 in a Russian sample
(290 individuals) 3801 m1 2455 m2 3205 m3 2453 m4 )4335 )3219 )3229

*1A T A T C G C G 323 55.7 51.559.8

*1B T A T C G T G 35 6.0 4.28.3
*1C T A T C G C A 0 0.0 0.00.6
)4335A T A T C A C G 134 23.1 19.726.8
*1C, )4335A T A T C A C A 17 2.9 1.74.7
*2A C A T C G C G 27 4.7 3.16.7
*2B C G T C G C G 29 5.0 3.47.1
*3 T A C C G C G 0 0.0 0.00.6
*4 T A T A G C G 15 2.6 1.54.2
Frequency of point mutations
n 56 29 0 15 151 35 17
% 9.7 5.0 0.0 2.6 26.0 6.0 2.9
a
a
Lower l 7.4 3.4 0.0 1.5 22.5 4.2 1.7
Lower and upper limits of 95% Upper la 14.4 7.1 0.6 4.2 29.8 8.3 4.7
condence interval

Table 4 CYP1A1 genotype

frequencies in 290 participants Genotype n % 95% CI Expected, %
of Russian origin, as calculated
on the basis of established *1A/*1A 93 32.2 26.737.8 31.0
alleles. Theoretical alternation *1A/*1B 19 6.7 4.010.0 6.7
are given in footnotes *1A/)4335A 72 24.8 20.030.2 25.7
*1A/*2A 15 5.2 2.98.4 5.2
*1A/*2B 15 5.2 2.98.4 5.6
*1A/*4 6 2.1 0.84.5 2.9
*1B/)4335Aa 9 3.1 1.45.8 2.8
*1B/*1C,)4335A 2 0.7 0.12.5 0.3
*1B/*2A 1 0.3 0.01.9 0.6
*1B/*2B 1 0.3 0.01.9 0.6
*1B/*4 3 1.0 0.23.0 0.3
*1A/*1C, )4335Ab 10 3.4 1.76.3 3.2
)4335A /)4335A 13 4.4 2.47.5 5.3
)4335A /*1C, )4335A 5 1.7 0.64.0 1.3
)4335A /*2A 8 2.8 1.25.4 2.1
)4335A /*2B 11 3.8 1.96.7 2.3
a
)4335A /*4 3 1.0 0.23.0 1.2
Other possible genotype is *1- *2A/*2B 1 0.3 0.01.9 0.5
A/*1B, )4335A *2A/*4 2 0.7 0.12.5 0.2
b
Other possible genotype is *1- *2B/*4 1 0.3 0.01.9 0.3
C/)4335A

Variant )3229G>A was found to be strictly linked with
mutation at position )4335.
NAT2
Seven of eight tested point mutations were detected and
could be allocated to eight dierent allelic variants. The
most frequent mutation was the 341T>C transition,
which appeared in 41.7%, whereas the 111T>C variant
was found only in 0.3% of alleles. No case of the specic
African-Black 191G>A mutation was found. One
hundred and twenty-two subjects (42.0%) carried one or
two alleles encoding fast acetylation (*4 and *12 [36])
and should provided fast-acetylation genotype
(Table 5). The most common genotypes, coding slow
acetylation were NAT*5B/*6A (24.6%) and *5B/*5B
(12.8%). Hybridization probes assay was validated for
the detection of mutations at positions 111, 341, 590 and
803. All 127 samples rechecked by real-time PCR
showed concordance with results by PCR-RFLP assays.
Homogeneous melting curves were observed for wild-
type and mutant alleles, whereas heterogeneous curves
resulted in the case of simultaneous presence of both
alleles (Fig. 3).
MDR1
The allele and genotype frequencies of MDR1 gene are
given in Table 6. Homozygous carriers of wild-type
allele 2677G in exon 21 were found to be 30.3% of all
participants. No carrier of homozygous 2677A was
observed. Homozygosity for mutant allele 3435T in exon
26 was observed in 30.0% of the sample. Genotype
frequencies as combinations of the two frequent poly-
morphisms in exons 21 and 26 are shown in Table 6 for
271 individuals, who did not carry the nucleotide A at
308

Table 5 Frequency ofNAT2

genotypes in a sample of 290 Genotype n % 95% CI Expected, %
Russians according to
established alleles. Notice that *4/*4 14 4.8 2.78.0 5.3
the 191G>A mutation was not *4/*12A 1 0.3 0.01.9 0.2
found in our samples, so Homozygous, rapid acetylators, sum 15 5.1 2.98.4 5.5
genotypes with *14A *4/*5A 2 0.7 0.12.5 1.0
(191G>A) and *14B *4/*5B 51 17.6 13.422.5 17.0
(191G>A, 282C>T) alleles are *4/*5C 3 1.0 0.23.0 1.3
not listed. A systemic *4/*6A 43 14.8 10.919.5 14.6
experimental evaluation of *4/*7B 6 2.1 0.84.5 1.3
mutation linkage (haplotypes) *6A/*12A 2 0.7 0.12.5 0.3
is given in references [15, 16, 36]. Heterozygous, rapid acetylators, sum 107 36.9 31.342.7 35.5
The denition of NAT2 alleles *5A/*5B 5 1.7 0.64.0 1.5
in the table is: NAT2*4 wild *5A/*6A 5 1.7 0.64.0 1.3
type;*5A 341C, 481T; *5B/*5B 37 12.8 9.117.2 13.5
*5B341C, 481T, 803G; *5B/*5C 7 2.4 1.04.9 2.1
*5C341C, 803G; *6A 282T, *5B/*6A 71 24.6 19.629.9 23.1
590A; *6D 111C, 282T, 590A; *5B/*7B 5 1.7 0.64.0 2.1
*7B 282T, 857A;*12A 803G *5C/*6A 5 1.7 0.64.0 1.8
[32] *5C/*7B 2 0.7 0.12.5 0.2
*6A/*6A 26 9.0 5.912.9 9.9
*6A/*6D 2 0.7 0.12.5 0.2
*6A/*7B 2 0.7 0.12.5 1.8
*7B/*7B 1 0.3 0.01.9 0.1
Slow acetylators, sum 168 58.0 52.063.4 57.6

Table 6 Allele, genotype and haplotype frequencies of MDR1 exon- homozygous for nucleotides dierent from reference sequence;
21 G2677T/A and exon-26 C3435T in 290 Russians. Notice that haplotypes coding: rst letter nucleotide at position 2677, second
genotypes coding: 1 homozygous for reference sequence (rst digit letter nucleotide at position 3435, 1 reference sequence, 2
position 2677, second digit position 3435), 2 heterozygous, 3 nucleotide dierent from reference sequence

Variant Allele frequency, % Genotype Frequency

Observed Expected, %

% 95% CI

Exon 21 position 2677 G 54.8 GG 30.3 25.136.0 30.0

T 41.9 GT 44.9 39.050.8 45.9
A 3.3 TT 18.3 14.023.2 17.6
GA 4.1 2.27.1 3.6
TA 2.4 1.04.9 2.8
AA 0.0 0.01.3 0.1
Exon 26 position 3435 C 45.7 CC 21.4 16.826.6 20.9
T 54.3 CT 48.6 42.754.5 49.6
TT 30.0 24.835.6 29.5

position 2677. Because a program for the prediction of

triallelic variants does not exist up to now, the haplotype
frequencies were calculated only for these genotypes.
The haplotypes 11 and 22 were found with frequencies
of 43.3% and 42.1%, respectively. A frequency of 13.1%
was predicted for haplotype 12, whereas the haplotype
21 was rare with a frequency of 1.5%. In the complete
sample of 290 individuals, two further haplotypes were
observed: the haplotypes, which have the variant A at
position 2677 and the nucleotide G at position 3435 or
the nucleotide T at this position, respectively. For both
haplotypes together, a frequency of 3.3% was observed
in the complete sample of 290 individualsthe haplo-
type with nucleotide G was more frequent.
Discussion
Xenobiotic-metabolizing enzymes play an essential role
in the basic processes of carcinogenesis, toxicity, and
drug ecacy. The knowledge about the distribution of
relevant polymorphic DMEs and transporters in a
population might help elucidate the genetic background
of drug response and side eects.
Cytochrome P4502C9
The clinical importance of CYP2C9 was exemplied
with warfarin, as slow metabolizers are at higher risk of

experiencing bleeding complications [37]. Further major
drugs metabolized by CYP2C9 are phenytoin, oral
hypoglycemic drugs such as tolbutamide [38], angio-
tensin receptor antagonists such as losartan, and a
number of nonsteroidal anti-inammatory drugs [39]
(reviewed in Miners et al. [40] and Lee et al. [41]). Re-
cently, the rst recommendations on a CYP2C9-geno-
type dependent dose adaptation were published [1].
The results of allelic frequency of CYP2C9*2 and
CYP2C9*3 in a Russian sample are comparable with
those obtained in large studies of the Swedish (frequency
of 2C9*210.7%and of 2C9*37.4%[42]) and similar to that of other European populations. The fre-
Turkish (frequency of 2C9*210.6%and of 2C9*3
10.0%[8]) populations. In contrast, lower frequencies
of mutant alleles have been described in the Japanese
(0% of CYP2C9* 2 and 1.8% of CYP2C9*3, [9]), Han
Chinese (0% and 2.6%, respectively) and Taiwanese
(0% and 1.7%, respectively [10]) populations. The novel
polymorphism T>C in intron 2 occurred in 10.2% (7.8
12.9%) of alleles. Comparative data of other popula-
tions do not exist yet.
Cytochrome P4502C19
Albeit CYP2C19 metabolizes a small number of drugs,
there are some clinically important issues. CYP2C19 is
involved in the oxidative metabolism of proton-pump
inhibitors such as omeprazole [43]. Allele CYP2C19*2
was found with a frequency of 11.4% (8.914.3%) in
Russians. A similar frequency was described for German
and Turkish populations [6] (15.9% and 12.1%,
respectively), whereas a high incidence of 35% was de-
tected in the Far East [9]. The frequency of the
CYP2C19*3 allele in our sample was 0.3% (0.01.2%),
which is comparable with German and Turkish samples
(0.15% and 0.4%) and much rarer than in Japa-
nese11% [9]. The frequency of poor metabolizers
varies considerably among populations. They are rela-
tively rare in the Turkish and German populations [6], in
Caucasians of European descent [11] and black Tanza-
nians [44] (1.0, 4.3, 2.1, and 1.5%, respectively), and
quite frequent in people of Asiatic origin13.8% in the
Chinese [45] and 23.6% in the Japanese [9]. Our study
showed that the frequency of poor metabolizers in
Russians (2.0%) is similar to those of other Caucasians.
Cytochrome P4502D6
CYP2D6 catalyses the biotransformation of nearly 25%
of all clinically important drugs such as tricyclic an-
tidepressants, neuroleptics, class-C antiarrhythmics,
some b-blockers and others [1, 2]. In this study, we
screened for the most of functionally important
CYP2D6 alleles *1,*3, *4, *5, *6, *10 and the gene
duplications, which should be sucient to predict the
metabolizing phenotype in up to 99% of individuals
[3, 46]. We did not investigate the frequency of allele *2
309
(except in the case of allele *2 duplication), which has
been shown to have only a slightly lower activity than
allele *1 [3]. In the case of allele duplication, the dis-
crimination of duplicated alleles*22 and *42is
clinically important to avoid misclassication of the *4
duplication as an ultrarapid allele. The frequencies of
the alleles *9 and *17 were relatively low in previous
studies of Caucasians [3]; hence, we did not include these
and rarer alleles, such as *8, *11, *12, *14, or *15 in this
study.
The mutation spectrum of CYP2D6 in our study was
quency of gene duplication alleles (*12 and *22) in
Russians (2.2%) was not signicantly dierent from
those in Germans (2.0% [3]), but tended to be higher
than in the Swedish population (1.0% [4]). The fre-
quency of gene duplications increases from north to
south and amounts to 6% in the Turkish population [6],
to 29% in Ethiopians [5] and to 21% in Saudi Arabians
[7]. Conversely, the proportion of poor metabolizers
increases from south to north and arrives at 7.2% in
Caucasians of German origin [3]. The proportion of
poor, intermediate (carriers of one active allele) and
extensive metabolizers in the Russian sample was similar
to that in other European populations.
Cytochrome P4501A1
The CYP1A1 gene encodes the aryl hydrocarbon
hydroxylase which is responsible for the oxidative
metabolism of carcinogens such as benzo(a)pyrene [47].
CYP1A1 polymorphisms were reported to be associated
with enhanced risk of lung cancer; however, data are
conicting [12, 48]. The frequencies of CYP1A1 muta-
tions m1 and m2 in the 290 Russians tended to be higher
than in the German population (n=880): m1
(3801T>C) was found in 9.7% of Russians and in 7.7%
of Germans [12]; m2 (2455A>G) occurred in 5.0% of
Russians and 2.7% of Germans, whereas the frequency
of m4 (2453C>A) was 2.6% in Russians and 3.0% in
Germans. This trend may reect a gradient to the Far
Eastern high frequencies of m1 and m2. The frequencies
of the CYP1A1 alleles CYP1A1*2A and CYP1A1*2B
were 4.7% (3.16.7%) and 5% (3.47.1%), which is
similar to those of the Polish population4.5% and
4.3% [13], respectively. The frequency of the novel
)4335G>A variant was 26.0%, the corresponding data
of other populations are not present.
Arylamine N-acetyltransferase 2
NAT2 plays an important role in the biotransformation
of a number of aromatic amines and hydrazines, which
are part of such substances as isoniazid, dapson and
caeine, and are contained in cigarette smoke and grilled
meat. Two groups can be distinguished by the incidence
of mutations at positions 341T>C and 481C>T
310

(NAT2*5A, B, C) and 857G>A (NAT2*7B). In Cau- Table 7 Haplotype frequencies of MDR1 exon-21 G2677T/A and
casians and Africans, the frequencies of alleles *5 are exon-26 C3435T in 290 Russians
high and the frequency of allele *7 is low, whereas it is Genotype Haplotype analysis ofMDR1a
just opposite in the Japanese, Chinese and other Far
Eastern populations. The frequency of allele *6 in the Haplotype pair n % 95% CI
Russian sample (31.8%) was similar to that in other
11 GC/GC (11/11) 53 19.5 15.024.8
Caucasians [16, 49]; whereas, in Oriental populations, 12 GC/GT (11/12) 31 11.4 7.915.8
the frequencies were lower, 2030% [18, 50]. The dif- 13 GT/GT (12/12) 4 1.5 0.43.7
ference in the incidence of the slow acetylator phenotype 21 GC/TC (11/21) 1 0.4 0.02.0
between Caucasians and Asian populations is thus 22 GC/TTb (11/22) 98 36.2 30.442.2
mostly the result of the low incidence of the NAT2*5 23 GT/TT (12/22) 31 11.4 7.915.8
31 TC/TC (21/21) 1 0.4 0.02.0
alleles in Asians. Asian populations show a higher fre- 32 TC/TT (21/22) 4 1.5 0.43.7
quency of the wild-type allele NAT2*4 (44 to 79%) than 33 TT/TT (22/22) 48 17.7 13.422.8
other ethnic groups (624%). The frequencies of point a
mutations, alleles and genotypes of NAT2 in the Russian Performed in 271 individuals, i.e., without those carrying a 2677A
allele in exon 21
sample were similar to those in Middle and South b
The alternative haplotype pair GT/TC was calculated to be very
European ethnicities [15, 16, 17]. rare (<1%)
In addition to conventional PCR-RFLP genotyping,
127 samples were analyzed for the NAT2 mutations at
six nucleotide positions by a newly developed method
using LightCycler technology. The results achieved with Statistical methods to calculate the probability of hapl-
these two methods correlated perfectly. The uorescent otypes become of great value when population samples
probes assay is easy, fast, reliable and allows genotyping are concerned. The allelic distribution of the most
to be performed on a large scale. important DMEs in the Russian sample is similar to that
in Middle European populations. Therefore, it may be
expected that the number of drug side eects or lack of
ecacy due to an individuals genetic background is also
P-glycoprotein gene MDR1 similar.
The multidrug-resistance gene (MDR1) encodes the Acknowledgements We thank M. Buchneva, Voronezh, for col-
membrane protein P-glycoprotein, which exports drugs lection of blood samples. The help of O. Landt (Tib Molbiol) in
and other xenobiotics from the inside of endothelial hybridization probes design is gratefully acknowledged. We
cells to the outside. Various polymorphisms in the appreciate critical reading of the manuscript by Dr. G. Laschinski
and Dr. J. Kirchheiner.
human MDR1 gene have been described so far, and the
two studied here correlated with intestinal P-glycopro-
tein expression and oral bioavailability of digoxin [19,
References
21, 51]. The triallelic locus at position 2677 of exon 21
represents a genetic rarity. The frequencies of poly- 1. Meisel C, Roots I, Cascorbi I, Brinkmann U, Brockmoller J
morphisms 2677G>T/A in exon 21 and 3435C>T in (2000) How to manage individualized drug therapy: application
exon 26 in the Russian sample were not signicantly of pharmacogenetic knowledge of drug metabolism and
dierent (P=0.96, 0.12, and 0.92, respectively) from transport. Clin Chem Lab Med 38:869876
those found in a German sample [20]. However large 2. Nebert DW (2000) Drug-metabolizing enzymes, polymor-
phisms and interindividual response to environmental
variations have been reported among dierent popu- toxicants. Clin Chem Lab Med 38:857861
lations [24]. We recently demonstrated for the P-gly- 3. Sachse C, Brockmoller J, Bauer S, Roots I (1997) Cytochrome
coprotein substrate digoxin that certain haplotypes P450 2D6 variants in a Caucasian population: allele frequencies
were of greater functional impact than the single and phenotypic consequences. Am J Hum Genet 60:284295
4. Dahl ML, Johansson I, Bertilsson L, Ingelman Sundberg M,
polymorphisms [21]. Haplotype 12, for example, was Sjoqvist F (1995) Ultrarapid hydroxylation of debrisoquine in a
associated with low P-glycoprotein activity. It was Swedish population. Analysis of the molecular genetic basis.
found in 11.4% (7.915.8%) of MDR1 genes (Table 7); J Pharmacol Exp Ther 274:516520
therefore, 22.8% (18.128.0%) of the Russian popula- 5. Aklillu E, Persson I, Bertilsson L, Johansson I, Rodrigues F,
Ingelman-Sundberg M (1996) Frequent distribution of ultra-
tion is endowed with one or two copies of this distinct rapid metabolizers of debrisoquine in an ethiopian population
haplotype. carrying duplicated and multiduplicated functional CYP2D6
alleles. J Pharmacol Exp Ther 278:441446
6. Aynacioglu AS, Sachse C, Bozkurt A, Kortunay S, Nacak M,
Schroder T, Kayaalp SO, Roots I, Brockmoller J (1999) Low
Conclusion frequency of defective alleles of cytochrome P450 enzymes
2C19 and 2D6 in the Turkish population. Clin Pharmacol Ther
66:185192
With the number of detected mutations in many genes 7. McLellan RA, Oscarson M, Seidegard J, Evans DA, Ingelman-
continuously increasing, the unequivalent denition of Sundberg M (1997) Frequent occurrence of CYP2D6 gene
alleles often becomes dicult in a given individual. duplication in Saudi Arabians. Pharmacogenetics 7:187191

8. Aynacioglu AS, Brockmoller J, Bauer S, Sachse C, Guzelbey P,
Ongen Z, Nacak M, Roots I (1999) Frequency of cytochrome
P450 CYP2C9 variants in a Turkish population and functional
relevance for phenytoin. Br J Clin Pharmacol 48:409415
9. Kimura M, Ieiri I, Mamiya K, Urae A, Higuchi S (1998) Ge-
netic polymorphism of cytochrome P450 s, CYP2C19, and
CYP2C9 in a Japanese population. Ther Drug Monit 20:243
247
10. Wang SL, Huang J, Lai MD, Tsai JJ (1995) Detection of
CYP2C9 polymorphism based on the polymerase chain reac-
tion in Chinese. Pharmacogenetics 5:3742
11. Xie HG, Stein CM, Kim RB, Wilkinson GR, Flockhart DA,
Wood AJ (1999) Allelic, genotypic and phenotypic distribu-
tions of S-mephenytoin 4-hydroxylase (CYP2C19) in healthy
Caucasian populations of European descent throughout the
world. Pharmacogenetics 9:539549
12. Cascorbi I, Brockmoller J, Roots I (1996) A C4887A poly-
morphism in exon 7 of human CYP1A1: population frequency,
mutation linkages, and impact on lung cancer susceptibility.
Cancer Res 56:49654969
13. Mrozikiewicz PM, Cascorbi I, Brockmoller J, Roots I (1997)
CYP1A1 mutations 4887A, 4889G, 5639C and 6235C in the
Polish population and their allelic linkage, determined by
peptide nucleic acid-mediated PCR clamping. Pharmacoge-
netics 7:303307
14. Inoue K, Asao T, Shimada T (2000) Ethnic-related dierences
in the frequency distribution of genetic polymorphisms in the
CYP1A1 and CYP1B1 genes in Japanese and Caucasian pop-
ulations. Xenobiotica 30:285295
15. Cascorbi I, Drakoulis N, Brockmoller J, Maurer A, Sperling K,
Roots I (1995) Arylamine N-acetyltransferase (NAT2) muta-
tions and their allelic linkage in unrelated Caucasian individ-
uals: correlation with phenotypic activity. Am J Hum Genet
57:581592
16. Mrozikiewicz PM, Cascorbi I, Brockmoller J, Roots I (1996)
Determination and allelic allocation of seven nucleotide tran-
sitions within the arylamine N-acetyltransferase gene in the
Polish population. Clin Pharmacol Ther 59:376382
17. Aynacioglu AS, Cascorbi I, Mrozikiewicz PM, Roots I (1997)
Arylamine N-acetyltransferase (NAT2) genotypes in a Turkish
population. Pharmacogenetics 7:327331
18. Lee EJ, Zhao B, Seow-Choen F (1998) Relationship between
polymorphism of N-acetyltransferase gene and susceptibility to
colorectal carcinoma in a Chinese population. Pharmacoge-
netics 8:513517
19. Homeyer S, Burk O, von Richter O, Arnold HP, Brockmoller
J, Johne A, Cascorbi I, Gerlo T, Roots I, Eichelbaum M,
Brinkmann U (2000) Functional polymorphisms of the human
multidrug-resistance gene: multiple sequence variations and
correlation of one allele with P-glycoprotein expression and
activity in vivo. Proc Natl Acad Sci U S A 97:34733478
20. Cascorbi I, Gerlo T, Johne A, Meisel C, Homeyer S, Schwab
M, Schaeeler E, Eichelbaum M, Brinkmann U, Roots I (2001)
Frequency of single nucleotide polymorphisms in the P-glyco-
protein drug transporter MDR1 gene in white subjects. Clin
Pharmacol Ther 69:169174
21. Johne A, Kopke K, Gerlo T, Mai I, Rietbrock S, Meisel C,
Homeyer S, Kerb R, Fromm MF, Brinkmann U, Eichelbaum
M, Brockmoller J, Cascorbi I, Roots I (2002) Modulation of
steady-state kinetics of digoxin by haplotypes of the P-glyco-
protein MDR1 gene. Clin Pharmacol Ther 72:584594
22. Schaeeler E, Eichelbaum M, Brinkmann U, Penger A, Asante-
Poku S, Zanger UM, Schwab M (2001) Frequency of C3435T
polymorphism of MDR1 gene in African people. Lancet
358:383384
23. Ito S, Ieiri I, Tanabe M, Suzuki A, Higuchi S, Otsubo K (2001)
Polymorphism of the ABC transporter genes, MDR1, MRP1
and MRP2/cMOAT, in healthy Japanese subjects. Pharmaco-
genetics 11:175184
311
24. Ameyaw MM, Regateiro F, Li T, Liu X, Tariq M, Mobarek A,
Thornton N, Folayan GO, Githanga J, Indalo A, Ofori-Adjei
D, Price-Evans DA, McLeod HL (2001) MDR1 pharmacoge-
netics: frequency of the C3435T mutation in exon 26 is signif-
icantly inuenced by ethnicity. Pharmacogenetics 11:217221
25. Marandi T, Dahl ML, Rago L, Kiivet R, Sjoqvist F (1997)
Debrisoquine and S-mephenytoin hydroxylation polymor-
phisms in a Russian population living in Estonia. Eur J Clin
Pharmacol 53:257260
26. Duzhak T, Mitrofanov D, Ostashevskii V, Gutkina N, Cha-
sovnikova O, Posukh O, Osipova L, Lyakhovich VV (2000)
Genetic polymorphisms of CYP2D6, CYP1A1, GSTM1 and
p53 genes in a unique Siberian population of Tundra Nentsi.
Pharmacogenetics 10:531537
27. Cascorbi I, Ackermann E, Sachse C, Brockmoller J, Roots I
(1998) A novel CYP2C9 intron 2 T/C transition and linkage to
mutations Leu359 and Cys144 (abstract). Clin Pharmacol Ther
63:198
28. de Morais SM, Wilkinson GR, Blaisdell J, Nakamura K,
Meyer UA, Goldstein JA (1994) The major genetic defect
responsible for the polymorphism of S-mephenytoin metabo-
lism in humans. J Biol Chem 269:1541915422
29. Borlak J, Thum T (2002) Identication of major CYP2C9 and
CYP2C19 polymorphisms by uorescence resonance energy
transfer analysis. Clin Chem 48:15921594
30. Smart J, Daly AK (2000) Variation in induced CYP1A1 levels:
relationship to CYP1A1, Ah receptor and GSTM1 polymor-
phisms. Pharmacogenetics 10:1124
31. Le MA, Fretland AJ, Doll MA, Hein DW (1999) Novel hu-
man N-acetyltransferase 2 alleles that dier in mechanism for
slow acetylator phenotype. J Biol Chem 274:3451934522
32. Hein D (2002) Molecular genetics and function of NAT1 and
NAT2: role in aromatic amine metabolism and carcinogenesis.
Mutat Res 65:506507
33. Blomeke B, Sieben S, Spotter D, Landt O, Merk HF (1999)
Identication of N-acetyltransferase 2 genotypes by continuous
monitoring of uorogenic hybridization probes. Anal Biochem
275:9397
34. Oselin K, Gerlo T, Mrozikiewicz PM, Pahkla R, Roots I
(2003) MDR1 polymorphisms G2677T in exon 21 and C3435T
in exon 26 fail to aect rhodamine 123 eux in peripheral
blood lymphocytes. Fundam Clin Pharmacol 17:17
35. Rohde K, Fuerst R (2001) Haplotyping and estimation of
haplotype frequencies for closely linked biallelic multilocus
genetic phenotypes including nuclear family information. Hum
Mutat 17:289295
36. Cascorbi I, Brockmoller J, Bauer S, Reum T, Roots I (1996)
NAT2*12A (803A G) codes for rapid arylamine N-acety-
lation in humans. Pharmacogenetics 6:257259
37. Aithal GP, Day CP, Kesteven PJ, Daly AK (1999) Association
of polymorphisms in the cytochrome P450 CYP2C9 with
warfarin dose requirement and risk of bleeding complications.
Lancet 353:717719
38. Kirchheiner J, Bauer S, Meineke I, Rohde W, Prang V, Meisel
C, Roots I, Brockmoller J (2002) Impact of CYP2C9 and
CYP2C19 polymorphisms on tolbutamide kinetics and the
insulin and glucose response in healthy volunteers. Pharmaco-
genetics 12:101109
39. Kirchheiner J, Meineke I, Freytag G, Meisel C, Roots I,
Brockmoller J (2002) Enantiospecic eects of cytochrome
P450 2C9 amino acid variants on ibuprofen pharmacokinetics
and on the inhibition of cyclooxygenases 1 and 2. Clin Phar-
macol Ther 72:6275
40. Miners JO, Birkett DJ (1998) Cytochrome P4502C9: an enzyme
of major importance in human drug metabolism. Br J Clin
Pharmacol 45:525538
41. Lee CR, Goldstein JA, Pieper JA (2002) Cytochrome P450 2C9
polymorphisms: a comprehensive review of the in-vitro and
human data. Pharmacogenetics 12:251263
312
42. Yasar U, Eliasson E, Dahl ML, Johansson I, Ingelman-Sund-
berg M, Sjoqvist F (1999) Validation of methods for CYP2C9
genotyping: frequencies of mutant alleles in a Swedish popu-
lation. Biochem Biophys Res Commun 254:628631
43. Rost KL, Roots I (1996) Nonlinear kinetics after high-dose
omeprazole caused by saturation of genetically variable
CYP2C19. Hepatology 23:14911497
44. Bathum L, Skjelbo E, Mutabingwa TK, Madsen H, Horder M,
Brsen K (1999) Phenotypes and genotypes for CYP2D6 and
CYP2C19 in a black Tanzanian population. Br J Clin Phar-
macol 48:395401
45. Xie HG (2000) Genetic variations of S-mephenytoin 4-
hydroxylase (CYP2C19) in the Chinese population. Life Sci
66:L175L181
46. Griese EU, Zanger UM, Brudermanns U, Gaedigk A, Mikus
G, Morike K, Stuven T, Eichelbaum M (1998) Assessment of
the predictive power of genotypes for the in-vivo catalytic
function of CYP2D6 in a German population. Pharmacoge-
netics 8:1526
47. Schwarz D, Kisselev P, Cascorbi I, Schunck WH, Roots I
(2001) Dierential metabolism of benzo[a]pyrene and
benzo[a]pyrene-7,8-dihydrodiol by human CYP1A1 variants.
Carcinogenesis 22:453459
48. Houlston RS (2000) CYP1A1 polymorphisms and lung cancer
risk: a meta-analysis. Pharmacogenetics 10:105114
49. Cascorbi I, Brockmoller J, Mrozikiewicz PM, Muller A, Roots
I (1999) Arylamine N-acetyltransferase activity in man. Drug
Metab Rev 31:489502
50. Okumura K, Kita T, Chikazawa S, Komada F, Iwakawa S,
Tanigawara Y (1997) Genotyping of N-acetylation polymor-
phism and correlation with procainamide metabolism. Clin
Pharmacol Ther 61:509517
51. Kim RB, Leake BF, Choo EF, Dresser GK, Kubba SV, Sch-
warz UI, Taylor A, Xie HG, McKinsey J, Zhou S, Lan LB,
Schuetz JD, Schuetz EG, Wilkinson GR (2001) Identication
of functionally variant MDR1 alleles among European Amer-
icans and African Americans. Clin Pharmacol Ther 70:189199