Académique Documents
Professionnel Documents
Culture Documents
A dihybrid cross between two individuals with the genotype AaBb Page 250 What has changed is the mothers age. The older the woman, the
higher the risk she has of nondisjunction during meiosis. Thus, she also has a much
AB Ab aB ab greater risk of producing a child with Down syndrome.
AB AABB AABb AaBB AaBb Page 251 XY egg is fertilized by an X sperm. A normal X egg is fertilized by an
m
XY sperm.
Ab AAbB AAbb AabB Aabb
Page 253 Advanced maternal age, a previous child with birth defects, or a family
aB aABB aABb aaBB aaBb history of birth defects.
ab aAbB aAbb aabB aabb
co
U N D E R S TA N D
Phenotypic ratio: 9 dominant dominant to 3 dominant recessive to 3 1. c 2. d 3. d 4. a 5. c 6. c 7. c
recessive dominant to 1 recessive recessive
Using Product Rule: Prob(A_ B_) = ()() = 9/16 A P P LY
Prob(A_ bb) = ()() = 3/16 1. c 2. b 3. c 4. b 5. c 6. b
y.
Prob(aa B_) = ()() = 3/16
Prob(aa bb) = ()() = 1/16 SYNTHESIZE
c. A dihybrid cross between individuals with the genotype AaBb and aabb 1. Theoretically, 25% of the children from this cross will be color blind. All of
bl
the color blind children will be male and 50% of the males will be color
AB Ab aB ab blind.
ab aAbB aAbb aabB aabb 2. Parents of heterozygous plant were: green wrinkled X yellow round
ee
Frequency of recombinants is 36+29/1300=0.05
Using Product Rule: Prob(A_ B_) = ()(1) = 1/16 Map distance = 5 cM
Prob(A_ bb) = ()(1) = 1/16 3. Male calico cats are very rare. The coloration that is associated with calico
Prob(aa B_) = ()(1) = 1/16 cats is the product of X inactivation. X inactivation only occurs in females as a
Prob(aa bb) = ()(1) = 1/16 response to dosage levels of the X-linked genes. The only way to get a male
.w
calico is to be heterozygous for the color gene and to be the equivalent of a
2. The segregation of different alleles for any gene occurs due to the pairing of
Klinefelters male (XXY).
homologous chromosomes, and the subsequent separation of these
homologues during anaphase I. The independent assortment of traits, more
accurately the independent segregation of different allele pairs, is due to the
independent alignment of chromosomes during metaphase I of meiosis.
CHAPTER 14
3. There seems to be the loss of a genotype as there are only 3 possible
coat color, but also causes lethality when homozygous, then this could
cs
outcomes (2 yellow and 1 black). If the yellow gene has a dominant effect on
INQUIRY QUESTIONS
using unidirectional polymerases that require RNA primers. The size of eukary-
Page 244 There would probably be very little if any recombination so the ex- otic genomes also means that the time necessary to replicate the genome is much
pected assortment ratios would have been skewed from the expected 9:3:3:1. greater than in prokaryotes with smaller genomes. Thus the use of multiple origins
w
Page 247 About 10% of the progeny would have been recombinants, based of replication.
on the relationship of 1 cM (map unit or centimorgan) equals 1% recombination Page 275 Cells have a variety of DNA repair pathways that allow them to
frequency. When gene loci are separated by greater distances, the frequency of restore damaged DNA to its normal constitution. If DNA repair pathways are
recombination between them increases to the extent that the number of recombi-
w
compromised, the cell will have a higher mutation rate. This can lead to higher
nant gametes roughly equals the number of parental gametes. In that instance, the rates of cancer in a multicellular organism such as humans.
genes would exhibit independent assortment. With a recombination frequency of
only 10%, it is doubtful that it would have led Mendel to the concept of indepen- U N D E R S TA N D
dent assortment. 1. d 2. a 3. c 4. a 5. c 6. b 7. b
appendix A A-7
m
1. a. If both bacteria are heat-killed, then the transfer of DNA will have no Page 289 Splicing can produce multiple transcripts from the same gene.
effect since pathogenicity requires the production of proteins encoded by Page 297 Wobble not only explains the number of tRNAs that are observed due
the DNA. Protein synthesis will not occur in a dead cell. to the increased flexibility in the 5 position, it also accounts for the degeneracy
b. The nonpathogenic cells will be transformed to pathogenic cells. Loss of that is observed in the Genetic Code. The degenerate base is the one in the wobble
co
proteins will not alter DNA. position.
c. The nonpathogenic cells remain nonpathogenic. If the DNA is digested, it U N D E R S TA N D
will not be transferred and no transformation will occur.
1. d 2. c 3. d 4. b 5. c 6. b 7. c
2. The region could be an origin of replication. Origins of replication are adenine-
y.
and thymine-rich regions since only these nucleotides form two hydrogen bonds A P P LY
versus the three hydrogen bonds formed between guanine and cytosine, making
it easier to separate the two strands of DNA. 1. d 2. c 3. b 4. b 5. c 6. b 7. b
The RNA primer sequences would be 5-ACUAUUGCUUUAUAA-3.
bl
The sequence is antiparallel to the DNA sequence (review Figure 14.16)
SYNTHESIZE
meaning that the 5 end of the RNA is matching up with the 3 end of the 1. the predicted sequence of the mRNA for this gene
DNA. It is also important to remember that in RNA the thymine nucleotide 5GCAAUGGGCUCGGCAUGCUAAUCC3
is replaced by uracil (U). Therefore, the adenine in DNA will form a the predicted amino acid sequence of the protein
ee
complementary base-pair with uracil. 5GCA AUG GGC UCG GCA UGC UAA UCC3
Met-Gly-Ser-Ala-Cys-STOP
3. a. DNA gyrase functions to relieve torsional strain on the DNA. If DNA
gyrase were not functioning, the DNA molecule would undergo 2. A frameshift essentially turns the sequence of bases into a random
supercoiling, causing the DNA to wind up on itself, preventing the sequence. If you consider the genetic code, 3 of the 64 codons are STOP, so
continued binding of the polymerases necessary for replication. the probability of hitting a STOP in a random sequence is 3/64 or about 1
.w
every 20 codons.
b. DNA polymerase III is the primary polymerase involved in the addition of
new nucleotides to the growing polymer and in the formation of the 3. a. mRNA = 5GCA AUG GGC UCG GCA UUG CUA AUC C3
phosphodiester bonds that make up the sugarphosphate backbone. If this The amino acid sequence would then be: Met-Gly-Ser-Ala-Leu-Leu-Iso-.
enzyme were not functioning, then no new DNA strand would be There is no stop codon. This is an example of a frameshift mutation. The
synthesized and there would be no replication.
c. DNA ligase is involved in the formation of phosphodiester bonds between
cs
Okazaki fragments. If this enzyme was not functioning, then the fragments
would remain disconnected and would be more susceptible to digestion by
addition of a nucleotide alters the reading frame, resulting in a change in
the type and number of amino acids in this protein.
b. mRNA = 5GCA AUG GGC UAG GCA UGC UAA UCC3
The amino acid sequence would then be: Met-Gly-STOP.
nucleases. This is an example of a nonsense mutation. A single nucleotide change has
si
Apago PDF Enhancer
d. DNA polymerase I functions to remove and replace the RNA primers that resulted in the early termination of protein synthesis by altering the codon
are required for DNA polymerase III function. If DNA polymerase I was for Ser into a stop codon.
not available, then the RNA primers would remain and the replicated c. mRNA = 5GCA AUG GGC UCG GCA AGC UAA UCC 3
hy
DNA would become a mix of DNA and RNA. The amino acid sequence would then be: Met-Gly-Ser-Ala-Ser-STOP.
This base substitution has affected the codon that would normally encode
Cys (UGC) and resulted in the addition of Ser (AGC).
CHAPTER 15 4. The split genes of eukaryotes offers the opportunity to control the splicing
LEARNING OUTCOME QUESTIONS process, which does not exist in prokaryotes. This is also true for poly
p
15.7 Attaching amino acids to tRNAs, bringing charged tRNAs to the ribosome,
and ribosome translocation all require energy. 16.5 These genes are necessary for the ordinary functions of the cell. That is, the
role of these genes is in ordinary housekeeping and not in any special functions.
15.8 No. It depends on where the breakpoints are that created the inversion, or
16.6 RNA interference offers a way to specifically affect gene expression using
w
duplication. For duplications it also depends on the genes that are duplicated.
drugs made of siRNAs.
INQUIRY QUESTIONS 16.7 As there are many proteins in a cell doing a variety of functions, uncon-
Page 281 One would expect higher amounts of error in transcription over DNA trolled degradation of proteins would be devastating to the cell.
w
A-8 appendix A
m
17.6 The pollen from the plant with the recombinant gene might fertilize a
U N D E R S TA N D closely related wild plant. If the offspring are viable, the recombinant gene will be
1. c 2. d 3. a 4. c 5. b 6. c 7. b introduced into the wild population.
co
A P P LY INQUIRY QUESTIONS
1. c 2. c 3. b 4. d 5. c 6. a 7. c Page 331 A bacterial artificial chromosome or a yeast artificial chromosome
would be the best way to go as a plasmid vector only can stably hold up to 10 kb.
SYNTHESIZE Page 332 No, cDNA is created using mRNA as a template, therefore, intron
1. Mutations that affect binding sites for proteins on DNA will control the sequences would not be expressed.
y.
expression of genes covalently linked to them. Introducing a wild type Page 340 Yes, if you first used reverse transcriptase to make cDNA to amplify.
binding site on a plasmid will not affect this. We call this being cis-dominant. This is called RT PCR.
Mutations in proteins that bind to DNA would be recessive to a wild type
bl
gene introduced on a plasmid. U N D E R S TA N D
2. Negative control of transcription occurs when the ability to initiate 1. b 2. b 3. d 4. d 5. c 6. c 7. b 8. d 9. a
transcription is reduced. Positive control occurs when the ability to initiate
transcription is enhanced. The lac operon is regulated by the presence or A P P LY
ee
absence of lactose. The proteins encoded within the operon are specific to the 1. d 2. c 3. d
catabolism (breakdown) of lactose. For this reason, operon expression is only
required when there is lactose in the environment. Allolactose is formed when SYNTHESIZE
lactose is present in the cell. The allolactose binds to a repressor protein,
1. Genes coding for each of the subunits would need to be inserted into
altering its conformation and allowing RNA polymerase to bind. In addition
different plasmids that are integrated into different bacteria. The cultures
.w
to the role of lactose, there is also a role for the activator protein CAP in
would need to be grown separately and the different protein subunits would
regulation of lac. When cAMP levels are high then CAP can bind to DNA and
then need to be isolated and purified. If the subunits can self assemble in
make it easier for RNA polymerase to bind to the promoter. The lac operon is
vitro, then the protein could be functional. It could be difficult to establish
an example of both positive and negative control.
just the right conditions for the assembly of the multiple subunits.
The trp operon encodes protein manufacture of tryptophan in a cell. This
operon must be expressed when cellular levels of tryptophan are low.
cs
Conversely, when tryptophan is available in the cell, there is no need to
transcribe the operon. The tryptophan repressor must bind tryptophan
before it can take on the right shape to bind to the operator. This is an
2. 5CTGATAGTCAGCTG3
CHAPTER 18
si
example of negative control.
Apago PDF Enhancer
LEARNING OUTCOME QUESTIONS
3. Forms that control gene expression that are unique to eukaryotes include
18.1 Banding sites on karyotypes depend on dyes binding to the condensed
alternative splicing, control of chromatin structure, control of transport of DNA that is wrapped around protein. The dyes bind to some regions, but not
mRNA from the nucleus to the cytoplasm, control of translation by small all and are therefore not evenly spaced along the genome in the way that sequential
hy
RNAs, and control of protein levels by ubiquitin- directed destruction. Of base-pairs are evenly spaced.
these, most are obviously part of the unique features of eukaryotic cells. The
only mechanisms that could work in prokaryotes would be translational 18.2 Sequencing is not a perfect process and a small number of errors would oc-
control by small RNAs and controlled destruction of proteins. cur. Also, the number of base-pairs that can be sequenced in an individual sequenc-
ing reaction is limited. Multiple copies of the genome need to be cut in different
4. Mutation is a permanent change in the DNA. Regulation is a short-term
p
places and sequenced so that the overlapping pieces can be assembled into an over-
change controlled by the cell. Like mutations, regulation can alter the all genome sequence. If there were not multiple, overlapping sequences, it would
number of proteins in a cell, change the size of a protein, or eliminate the not be possible to determine the order of the smaller pieces that are sequenced.
ar
protein altogether. The key difference is that gene regulation can be reversed
in response to changes in the cells environment. Mutations do not allow for 18.3 One possibility is that transposable elements can move within the genome
this kind of rapid response. and create new genetic variability, subject to natural selection.
18.4 From the transcriptome, it is possible to predict the proteins that may be
translated and available for use in part of an organism at a specific time in develop-
sw
CHAPTER 17 ment.
LEARNING OUTCOME QUESTIONS 18.5 Yes. Additional protein could enhance the nutritional value of the potato for
human consumption. One caveat would be that the increased level of protein not
17.1 EcoRI is a restriction enzyme that can be used to cut DNA at specific places.
change the texture or flavor of potatoes that a consumer is expecting.
Ligase is used to glue together pieces of DNA that have been cut with the same
restriction enzyme. The two enzymes make it possible to add foreign DNA into an
.a
INQUIRY QUESTIONS
E. coli plasmid.
Page 354 Repetitive elements are one of the main obstacles to assembling the
17.2 A cDNA library is constructed from mRNA. Unlike the gene itself, cDNA DNA sequences in proper order. There is one copy of bcr (see with green probe)
does not include the introns or regulatory elements. and one copy of abl (seen with red probe).
w
17.3 Multiple rounds of DNA replication allow for an exponential increase in The other bcr and abl genes are fused and the yellow color is the result of red
copies of the DNA. A heat-stable DNA polymerase makes this possible. plus green fluorescence combined).
17.4 The gene coding for a functional protein must be mutated. Recombination Page 361 Repetitive elements are one of the main obstacles to assembling
w
allows for the knockout gene to be specifically targeted. the DNA sequences in proper order because it is difficult to determine which
17.5 The protein must be completely pure so that the patient does not have an sequences are overlapping.
immune response to proteins from another organism. Page 366 Proteins exhibit post-translational modification and the formation of
w
It is important that the protein have exactly the same structure when it is protein complexes. Additionally a single gene can code for multiple proteins using
produced in a bacterial cell as in a human cell. Because post-translational modifica- alternative splicing.
tion is specific to eukaryotes, the human DNA may need to be modified before it Page 367 A proteome is all the proteins coded for by the genome, and the tran-
is inserted in a bacterial genome to ensure the protein structure in identical to the scriptome is all the RNA present in a cell or tissue at a specific time.
human protein.
appendix A A-9
m
region of the corn genome that you might want to sequence to find your gene. 1. The horizontal lines of the fate map represent cell divisions. Starting with the
A subsequent step might be to modify the corn gene that corresponds to the rice egg, four cell divisions are required to establish a population of cells that will
gene to see if you can increase drought tolerance. become nervous tissue. It takes another eight to nine divisions to produce the
final number of cells that will make up the nervous system of the worm. It
co
U N D E R S TA N D takes seven to eight rounds of cell division to generate the population of cells
that will become the gonads. Once established, another seven to eight cell
1. b 2. a 3. c 4. d 5. b 6. c 7. b 8. d divisions are required to produce the actual gonad cells.
A P P LY 2. Not every cell in a developing embryo will survive. The process of apoptosis
is responsible for eliminating cells from the embryo. In C. elegans, the process
y.
1. b 2. a 3. d 4. b 5. c 6. d 7. d
of apoptosis is regulated by three genes: ced-3, ced-4, and ced-9. Both ced-3 and
SYNTHESIZE ced-4 encode proteases, enzymes that degrade proteins. Interestingly, the ced-3
protease functions to activate gene expression of the ced-4 protease. Together,
1. The STSs represent unique sequences in the genome. They can be used to
bl
these proteases will destroy the cell from the inside-out. The ced-9 gene
align the clones into one contiguous sequence of the genome based on the functions to repress the activity of the protease-encoding genes, thereby
presence or absence of an STS in a clone. The contig, with aligned clones, preventing apoptosis.
would look like this:
3. a. N-cadherin plays a specific role in differentiating cells of the nervous
ee
system from ectodermal cells. Ectodermal cells express E-cadherin, but
STS 1 STS 2 neural cells express N-cadherin. The difference in cell-surface cadherins
Clone E means that the neural cells lose their contact with the surrounding
STS 2 STS 3 ectodermal cells and establish new contacts with other neural cells. In the
Clone B absence of N-cadherin, the nervous system would not form. If you assume
.w
STS 3 STS 4 STS 5 that E-cadherin expression is also lost (as would occur normally in
Clone A development) then these cells would lose all cellcell contacts and would
probably undergo apoptosis.
STS 3 STS 4
Clone D b. Integrins mediate the connection between a cell and its surrounding
environment, the extracellular matrix (ECM). The loss of integrins would
Clone C
STS 5 STS 6 cs result in the loss of cell adhesion to the ECM. These cells would not be
able to move and therefore, gastrulation and other developmental
processes would be disrupted.
STS 1 STS 2 STS 3 STS 4 STS 5 STS 6 c. Integrins function by linking the cells cytoskeleton to the ECM. This
si
Contig
Apago PDF Enhancer connection is critical for cell movement. The deletion of the cytoplasmic
domain of the integrin would not affect the ability of integrin to attach to
2. The anthrax genome has been sequenced. Investigators would look for the ECM, but it would prevent the cytoskeleton from getting a grip.
differences in the genome between existing natural strains and those collected This deletion would likely result in a disruption of development similar to
hy
from a suspected outbreak. The genome of an infectious agent can be modified, the complete loss of integrin.
or weaponized, to make it more deadly. Also, single-nucleotide polymorphisms
4. Adult cells from the patient would be cultured with factors that reprogram
could be used to identify the source of the anthrax. In the case of the Florida
the nucleus into pluripotent cells. These cells would then be grown in culture
anthrax outbreak it was determined that the source was a research laboratory.
with factors necessary to induce differentiation into a specific cell type that
could be transplanted into the patient. This would be easiest for tissue like a
p
liver that regenerates, but could in theory be used for a variety of cell types.
CHAPTER 19
ar
prevent induction, or to follow a particular cells lineage. environment than others. These individuals live longer and reproduce more, leav-
19.4 The nucleus must be reprogrammed. What this means exactly on the mo- ing more offspring with the traits that enabled their parents to thrive. In essence,
lecular level is not clear, but probably involves changes in chromatin structure and genetic variation within a population provides the raw material on which natural
methylation patterns. selection can act.
19.5 Homeotic genes seem to have arisen very early in the evolutionary history 20.2 To determine if a population is in Hardy Weinberg equilibrium, one would
.a
of bilaterians. These have been duplicated and they have diversified with increasing first need to determine the actual allele frequencies, which can be calculated based
morphological complexity. on the actual genotype frequencies. After assigning variables p and q to the actual
allele frequencies, one would then use the Hardy Weinberg equation, p2 + 2pq +
19.6 Cell death can be a patterning mechanism. Your fingers were sculpted from q2 = 1 in order to determine the expected genotype frequencies. If the actual and
a paddle-like structure by cell death.
w
expected genotype frequencies are the same (or, at least not significantly different)
then it is safe to say that the population is in Hardy Weinberg equilibrium.
INQUIRY QUESTION
20.3 There are five mechanisms of evolutionnatural selection, mutation, gene
Page 378 The macho-1 gene product is a transcription factor that can activate
w
flow (migration), genetic drift, and nonrandom mating. Any of these mechanisms
the expression of several muscle-specific genes. Whether or not the fibroblast
can alter allele frequencies within a population, although usually a change in allele
growth factor (FGF) signal is received from underlying endoderm precursor cells
frequency results from more than one mechanism working in concert (for example,
in the embryo determines how macho-1 acts. If the FGF signal is present, it acti-
mutation will introduce a beneficial new allele into the population, and natural se-
w
vates a Ras/MAP kinase pathway which, together with macho-1, either suppresses
lection will select for that allele such that its frequency increases over the course of
muscle genes or activates the transcription of mesenchyme genes. Without the
two or more generations). Natural selection, the first mechanism and probably the
FGF signal, macho-1 alone triggers the transcription of muscle genes.
most influential in bringing about evolutionary change, is also the only mechanism
U N D E R S TA N D to produce adaptive change, that is, change that results in the population being bet-
ter adapted to its environment. Mutation is the only way in which new alleles can
1. b 2. d 3. c 4. d 5. b 6. c 7. b
A-10 appendix A
m
the allele frequency within both the recipient and donor populations. Genetic drift total of 84 cats, the new frequency of homozygous black cats is 36/84 or 43%, with
is the random, chance factor of evolutionwhile the results of genetic drift can be the heterozygous black cats now comprising 57% of the population. If p2 = 0.43,
negligible in a large population, small populations can see drastic changes in allele then p = 0.65 (approximately), then 1p = q, and q = 0.35. The frequency of white
frequency due to this agent. Finally, nonrandom mating results in populations kittens in the next generation, q2, is 0.12 or 12%.
co
varying from Hardy Weinberg equilibrium not by changing allele frequencies but Page 405 Differential predation might favor brown toads over green toads,
by changing genotype frequenciesnonrandom mating reduces the proportion of green toads might be more susceptible to disease, or green toads might be less able
heterozygotes in a population. to tolerate variations in climate, among other possibilities.
20.4 Reproductive success relative to other individuals within an organisms Page 406 Since the intermediate-sized water strider has the highest level of fit-
y.
population is referred to as that organisms fitness. Its fitness is determined by its ness, it would be expected that the intermediate size would become more prevalent
longevity, mating frequency, and the number of offspring it produces for each mat- in the population. If the number of eggs laid per day was not affected by body size,
ing. None of these factors is always the most important in determining reproduc- the small water striders would be favored because of their tendency to live longer
tive successinstead it is the cumulative effects of all three factors that determines than their larger counterparts.
bl
an individuals reproductive success. For example, an individual that has a very long
life span but mates only infrequently might have lower fitness than a conspecific Page 407 Yes. The frequency of copper tolerance will decrease as distance from
that lives only half as long but mates more frequently and with greater success. As the mine increases.
seen with the water strider example in this section, traits that are favored for one Page 411 The proportion of flies moving toward light (positive phototropism)
ee
component of fitness, say, for example, longevity, may be disadvantageous for other would again begin to increase in successive generations.
components of fitness, say, lifetime fecundity. Page 411 The distribution of birth weights in the human population would
20.5 The dynamics among the different evolutionary mechanisms are very expand somewhat to include more babies of higher and lower birth weights.
intricate, and it is often difficult, if not impossible, to discern which direction each Page 413 Guppy predators evidently locate their prey using visual cues. The
process is operating within a populationit is much easier to simply see the final more colorful the guppy, the more likely it is to be seen and thus the more likely it
.w
cumulative effects of the various agents of evolutionary change. However, there will become prey.
are cases in which more than one evolutionary process will operate in the same
direction, with the resulting population changing, or evolving, more rapidly than it Page 414 Thoroughbred horse breeders have been using selective breeding for
would have under only one evolutionary mechanism. For example, mutation may certain traits over many decades, effectively removing variation from the popula-
introduce a beneficial allele into a population; gene flow could then spread the new tion of thoroughbred horses. Unless mutation produces a faster horse, it remains
tion should favor both homozygous forms. This would result in disruptive selec-
cs
allele to other populations. Natural selection will favor this allele within each popu-
lation, resulting in relatively rapid evolutionary adaptation of a novel phenotype.
20.6 In a population wherein heterozygotes had the lowest fitness, natural selec-
unlikely that winning speeds will improve.
U N D E R S TA N D
1. a 2. b 3. d 4. a 5. d 6. a 7. d
si
it could lead to a speciation event.
Apago PDF Enhancer
tion, and a bimodal distribution of traits within the population. Over enough time,
A P P LY
1. d 2. d 3. a
20.7 Directional selection occurs when one phenotype has an adaptive advantage
hy
over other phenotypes in the population, regardless of its relative frequency SYNTHESIZE
within the population. Frequency-dependent selection, on the other hand, results
when either a common (positive frequency-dependent selection) or rare (nega- 1. The results depend on coloration of guppies increasing their conspicuousness
tive frequency-dependent selection) has a selective advantage simply by virtue of to predators such that an individuals probability of survival is lower than if it
its commonality or rarity. In other words, if a mutation introduces a novel allele was a drab morph. In the laboratory it may be possible to conduct trials in
simulated environments; we would predict, based on the hypothesis of
p
into a population, directional selection may result in evolution because the allele is
advantageous, not because it is rare. predation, that the predator would capture more of the colorful morph than
the drab morph when given access to both. Design of the simulated
20.8 Wild guppies have to balance natural selection, which, in the presence of a
ar
camouflage used by many species to avoid predation; again, however, in many cases individuals with black coloration within a population will have a selective
this example of natural selection runs counter to sexual selectionmales want to advantage because they will be more cryptic to predators. On the other hand, on
be inconspicuous to predators but attractive to potential mates. For example, to test small flows, which are disrupted by light sand and green plants, dark individuals
the effects of predation on background color matching in a species of butterfly, one would be at an adaptive disadvantage for the same reason. You can read more
might raise captive populations of butterflies with a normal variation in coloration. about this in chapter 21 (21.2); the black peppered moths had an advantage on
After a few generations, add natural predators to half of the enclosures. After the trees lacking lichen, but a disadvantage on lichen-covered trees.
.a
several generations, one would expect the butterflies in the predatory environment 3. Ultimately, genetic variation is produced by the process of mutation.
to have a high degree of background color matching in order to avoid predation, However, compared with the speed at which natural selection can reduce
while the non-predatory environment would have promoted brightly-colored variation in traits that are closely related to fitness, mutation alone cannot
individuals where color would correlate with mating success. account for the persistence of genetic variation in traits that are under strong
w
20.9 Pleiotropic effects occur with many genes; in other words, a single gene selection. Other processes can account for the observation that genetic
has multiple effects on the phenotype of the individual. Whereas natural selection variation can persist under strong selection. They include gene flow.
might favor a particular aspect of the pleiotropic gene, it might select against Populations are often distributed along environmental gradients of some
w
another aspect of the same gene; thus, pleiotropy often limits the degree to which a type. To the extent that different environments favor slightly different
phenotype can be altered by natural selection. Epistasis occurs when the expression variants of phenotypes that have a genetic basis, gene flow among areas in the
of one gene is controlled or altered by the existence or expression of another gene. habitat gradient can introduce new genetic variation or help maintain existing
Thus, the outcome of natural selection will depend not just on the genotype of one variation. Similarly, just as populations frequently encounter different
w
gene, but the other genotype as well. selective environments across their range (think of the guppies living above
and below the waterfalls in Trinidad), a single population also encounters
INQUIRY QUESTIONS variation in selective environments across time (oscillating selection). Traits
favored this year may not be the same as those favored next year, leading to a
Page 399 In the example of Figure 20.3, the frequency of the recessive white switching of natural selection and the maintenance of genetic variation.
genotype is 0.16. The remaining 84 cats (out of 100) in the population are ho-
appendix A A-11
m
the phenotype is a result of the environment, not the genotype. Natural selection smaller size, as it had in the ancestral horses, before horses moved into open, grass-
can only act upon those traits with a genetic component. Just as a body builder land habitats. Another possibility is that there were many species of horses present
develops large muscles in his or her lifetime but does not have well-muscled at that time, and different sized horses ate different types of food. By evolving small
offspring, birds that develop large beaks in their lifetime will not necessarily have size, Nannippus may have been able to eat a type of food not eaten by the others.
co
offspring with larger beaks.
21.2 An experimental design that would test this hypothesis could be as simple U N D E R S TA N D
as producing enclosures for the moths and placing equal numbers of both morphs 1. d 2. b 3. b 4. a 5. b 6. b 7. b
into each enclosure and then presenting predatory birds to each enclosure. One
enclosure could be used as a control. One enclosure would have a dark background A P P LY
y.
while the other would have a light background. After several generations, measur- 1. a 2. d 3. d
ing the phenotype frequency of the moths should reveal very clear trendsthe
enclosure with the dark background should consist of mostly dark moths, the SYNTHESIZE
enclosure with the light background mostly light moths, and the neutral enclosure
bl
1. Briefly, they are:
should have an approximately equal ratio of light to dark moths.
A. There must be variation among individuals within a population.
21.3 If the trait that is being artificially selected for is due to the environment
rather than underlying genotype, then the individuals selected that have that trait B. Variation among individuals must be related to differences among
individuals in their success in producing offspring over their lifetime.
ee
will not necessarily pass it on to their offspring.
C. Variation related to lifetime reproductive success must have a genetic
21.4 The major selective agent in most cases of natural selection is the environ-
(heritable) basis.
ment; thus, climatic changes, major continental shifts, and other major geological
changes would result in dramatic changes in selective pressure; during these times 2. Figure 21.2a shows in an indirect way that beak depth varies from year to
the rate and direction of evolutionary change would likely be affected in many, if year. Presumably this is a function of variation among individuals in beak size.
However, the most important point of 21.2a is that it shows the result of
.w
not most, species. On the other hand, during periods of relative environmental
stability, the selective pressure does not change and we would not expect to see selection. That is, if the three conditions hold, we might expect to see average
many major evolutionary events. beak depth change accordingly as precipitation varies from year to year.
Figure 21.2b is more directly relevant to the conditions noted for natural
21.5 The only other explanation that could be used to explain homologous selection to occur. The figure shows that beak size varies among individuals,
characteristics and vestigial structures could be mutation. Especially in the case of
the other effects of the genetic anomaly were selected for, then the vestigial struc-
ture would also be selected for, much like a rider on a Congressional Bill.
cs
vestigial structures, if one resulted from a mutation that had pleiotropic effects, and
and that it tends to be inherited.
3. The relationship would be given by a cloud of points with no obvious linear
trend in any direction different from a zero slope. In other words, it would be
a horizontal line through an approximately circular cloud of points. Such data
21.6 Convergence occurs when distantly related species experience similar would suggest that whether a parent(s) has a large or small beak has no
si
Apago PDF Enhancer
environmental pressures and respond, through natural selection, in similar ways.
For example, penguins (birds), sharks (fish), sea lions (mammals) and even the
bearing on the beak size of its offspring.
extinct ichthyosaur (reptile) all exhibit the fusiform shape. Each of these animals 4. Assuming that small and large individuals would breed with each other, then
has similar environmental pressures in that they are all aquatic predators and need middle-sized offspring would still be born (the result of matings between
hy
to be able to move swiftly and agilely through the water. Clearly their most recent small and large flies). Nonetheless, there would also be many small and large
common ancestor does not have the fusiform body shape; thus the similarities are individuals (the result of small small and large large matings). Thus, the
due to convergence (environment) rather than homology (ancestry). However, frequency distribution of body sizes would be much broader than the
similar environmental pressures will not always result in convergent evolution. distributions in the figures. In some experiments, reproductive isolation
Most importantly, in order for a trait to appear for the first time in a lineage, there evolves in which small and large individuals evolve mating preferences that
p
must have been a mutation; however, mutations are rare events, and even rarer is prevent them from interbreeding, leading to the production of two
a beneficial mutation. There may also be other species that already occupy a par- different-sized species. This would be a laboratory example of sympatric
speciation. Most studies, however, have failed to produce such reproductive
ar
ticular niche; in these cases it would be unlikely that natural selection would favor
traits that would increase the competition between two species. isolation; rather, a single population remains through time with great
variation.
21.7 It is really neither a hypothesis nor a theory. Theories are the building
blocks of scientific knowledge, they have withstood the most rigorous testing and 5. The evolution of horses was not a linear event; instead it occurred over
55 million years and included descendents of 34 different genera. By
sw
review. Hypotheses, on the other hand, are tentative answers to a question. Unfor-
tunately, a good hypothesis must be testable and falsifiable, and stating that humans examining the fossil record, one can see that horse evolution did not occur
came from Mars is not realistically testable or falsifiable; thus, it is, in the realm of gradually and steadily; instead several major evolutionary events occurred in
biological science, a nonsense statement. response to drastic changes in environmental pressures. The fossil record of
horse evolution is remarkably detailed, and shows that while there have been
INQUIRY QUESTIONS trends toward certain characteristics, change has not been fluid and constant
over time, nor has it been entirely consistent across all of the horse lineages.
.a
Page 419 The figure demonstrates that the beak depth of offspring can be
For example, some lineages experienced rapid increases in body size over
predicted by the average beak depth of the parents bills. Thus, one would expect
relatively short periods of geological time, while other lineages actually saw
the offspring to have the same beak depth if their parents mean beak depth is the
decreases in body size.
same. This is only correct if males and females do not differ in beak depth. In spe-
w
cies for which the sexes differ (such as height in humans), then one would need to
know both the depth and the sex of the parents and the calculation would be more
complicated.
CHAPTER 22
LEARNING OUTCOME QUESTIONS
w
Page 421 Such a parallel trend would suggest that similar processes are operat-
ing in both localities. Thus, one would conduct a study to identify similarities. In 22.1 The Biological Species Concept states that different species are capable of
this case, both areas have experienced coincident reductions in air pollution, which mating and producing viable, fertile offspring. If sympatric species are unable to
most likely is the cause of the parallel evolutionary trends. do so, they will remain reproductively isolated and thus distinct species. Along the
w
Page 422 Assuming that small and large individuals would breed with each same lines, gene flow between populations of the same species allow for homogeni-
other, then middle-sized offspring would still be born (the result of matings zation of the two populations such that they remain the same species.
between small and large flies). Nonetheless, there would also be many small and 22.2 In order for reinforcement to occur and complete the process of speciation,
large individuals (the result of small small and large large matings). Thus, the two populations must have some reproductive barriers in place prior to sympatry.
In the absence of this initial reproductive isolation we would expect rapid exchange
A-12 appendix A
m
22.3 Reproductive isolation that occurs due to different environments is a factor selection may favor reduced viability of hybrids because parents of such
of natural selection; the environmental pressure favors individuals best suited for individuals will not waste further time and energy on them.
that environment. As isolated populations continue to develop, they accumulate 2. The biological species concept, despite its limitations, reveals the continuum
co
differences due to natural selection that eventually will result in two populations so of biological processes and the complexity and dynamics of organic evolution.
different that they are reproductively isolated. Reinforcement, on the other hand, At the very least, the biological species concept provides a mechanism for
is a process that specifically relates to reproductive isolation. It occurs when natural biologists to communicate about taxa and know that they are talking about
selection favors non-hybrids because of hybrid infertility or are simply less fit than the same thing! Perhaps even more significantly, discussion and debate about
their parents. In this way, populations that may have been only partly reproduc- the meaning of species fuels a deeper understanding about biology and
y.
tively isolated become completely reproductively isolated. evolution in general. It is unlikely that we will ever have a single unifying
22.4 Polyploidy occurs instantaneously; in a single generation, the offspring of concept of species given the vast diversity of life, both extinct and extant.
two different parental species may be reproductively isolated; however, if it is ca- 3. The principle is the same as in character displacement. In sympatry,
pable of self-fertilization then it is, according to the Biological Species Concept, a individuals of the two species that look alike may mate with each other. If the
bl
new species. Disruptive selection, on the other hand, requires many generations as species are not completely interfertile, then individuals hybridizing will be at
reproductive barriers between the two populations must evolve and be reinforced a selective disadvantage. If a trait appears in one species that allows that
before the two would be considered separate species. species to more easily recognize members of its own species and thus avoid
hybridization, then individuals bearing that trait will have higher fitness and
ee
22.5 In the archipelago model, adaptive radiation occurs as each individual island
population adapts to its different environmental pressures. In sympatric speciation that trait will spread through the population.
resulting from disruptive selection, on the other hand, traits are selected for that 4. I would expect the two species to have more similar morphology when they
are not necessarily best suited for a novel environment but are best able to reduce are found alone (allopatry) than when they are found together (sympatry),
competition with other individuals. It is in the latter scenario wherein adaptive assuming that food resources were the same from one island to the next. This
radiation due to a key innovation is most likely to occur. would be the result of character displacement expected under a hypothesis of
.w
22.6 It depends on what species concept you are using to define a given spe- competition for food when the two species occur in sympatry. A species pair
cies. Certainly evolutionary change can be punctuated, but in times of changing that is more distantly related might not be expected to show the pattern of
environmental pressures we would expect adaptation to occur. The adaptations, character displacement since they show greater differences in morphology
however, do not necessarily have to lead to the splitting of a speciesinstead one (and presumably in ecology and behavior as well), which should reduce the
species could simply change in accordance with the environmental changes to
which it is subjected. This would be an example of non-branching, as opposed to
branching, evolution; but again, whether the end-result organism is a different
cs
species from its ancestral organism that preceded the punctuated event is subject to
interpretation.
potential for competition to drive character divergence.
CHAPTER 23
LEARNING OUTCOME QUESTIONS
si
Apago PDF Enhancer
22.7 Unlike the previous major mass extinction events, the current mass extinc-
23.1 Because of convergent evolution; two distantly related species subjected to
tion is largely attributable to human activity, including but not limited to habitat the same environmental pressures may be more phenotypically similar than two
degradation, pollution, and hunting. species with different environmental pressures but a more recent common ances-
hy
tor. Other reasons for the possible dissimilarity between closely related species
INQUIRY QUESTIONS include oscillating selection and rapid adaptive radiations in which species rapidly
Page 447 Speciation can occur under allopatric conditions because isolated adapt to a new available niche.
populations are more likely to diverge over time due to drift or selection. Adaptive 23.2 In some cases wherein characters diverge rapidly relative to the frequency
radiation tends to occur in places inhabited by only a few other species or where of speciation, it can be difficult to construct a phylogeny using cladistics because
p
many resources in a habitat are unused. Different environmental conditions typical the most parsimonious phylogeny may not be the most accurate. In most cases,
of adaptive radiation tend to favor certain traits within a population. Allopatric however, cladistics is a very useful tool for inferring phylogenetic relationships
conditions would then generally favor adaptive radiation.
ar
not used by the other group. Competition for a resource would be reduced for retaining its ancestral traits and the other deriving new traits. The ancestral group
these individuals, possibly favoring their survival and leading to selection for the in each population may be part of the same biological species but would be consid-
tendency to use the new resource. Character displacement tends to compliment ered polyphyletic because to include their common ancestor would also necessitate
sympatric speciation. including the other, more derived species (which may have diverged enough to be
reproductively isolated).
Page 452 If one area experiences an unfavorable change in climate, a mobile
23.4 Not necessarily; it is possible that the character changed since the common
.a
species can move to another area where the climate was like it was before the
change. With little environmental change to drive natural selection within that ancestor and is present in each group due to convergence. While the most recent
species, stasis would be favored. common ancestor possessing the character is the most parsimonious, and thus
the most likely, explanation, it is possible, especially for small clades, that similar
U N D E R S TA N D environmental pressures resulted in the emergence of the same character state
w
around; it began as a simian disease and mutated to become a human form, and
1. b 2. a 3. d 4. a 5. b 6. b
that this has occurred several times.
SYNTHESIZE
INQUIRY QUESTIONS
w
1. If hybrids between two species have reduced viability or fertility, then natural
Page 461 In parsimony analyses of phylogenies, the least complex explanation
selection will favor any trait that prevents hybrid matings. The reason is that
is favored. High rates of evolutionary change and few character states complicate
individuals that dont waste time, energy, or resources on such matings will
matters. High rates of evolutionary change, such as occur when mutations arise in
have greater fitness if they instead spend the time, energy, and resources on
noncoding portions of DNA, can be misleading when constructing phylogenies.
mating with members of their own species. For this reason, natural selection
Mutations arising in noncoding DNA are not eliminated by natural selection in
appendix A A-13
m
evolutionary events lead to the best hypothesis of phylogenetic relationshipsand convergent; the most recent common ancestor surely did not have wings (or
resulting phylogenies are inaccurate. all other mammals and reptiles would have had to have lost the wing, which
Page 462 The only other hypothesis is that the most recent common ancestor violates the rule of parsimony). The wing of flying insects is purely
convergent with the vertebrate wing, as the forelimb of the insect is not
co
of birds and bats was also winged. Of course, this scenario is much less parsimoni-
ous (and thus much more unlikely) than the convergence hypothesis, especially homologous with the vertebrate forelimb.
given the vast number of reptiles and mammals without wings. Most phylogenies 6. The biological species concept focuses on processes, in particular those which
are constructed based on the rule of parsimony; in the absence of fossil evidence of result in the evolution of a population to the degree that it becomes reproduc-
other winged animals and molecular data supporting a closer relationship between tively isolated from its ancestral population. The process of speciation as utilized
y.
birds and bats than previously thought, there is no way to test the hypothesis that by the biological species concept occurs through the interrelatedness of
bird and bat wings are homologous rather than analogous. evolutionary mechanisms such as natural selection, mutation, and genetic drift.
Page 471 If the victim had contracted HIV from a source other than the patient, On the other hand, the phylogenetic species concept focuses not on process but
the most recent common ancestor of the two strains would be much more distant. on history, on the evolutionary patterns that led to the divergence between
bl
As it is, the phylogeny shows that the victim and patient strains share a relatively populations. Neither species concept is more right or more wrong; species
recent ancestor, and that the victims strain is derived from the patients strain. concepts are, by their very nature, subjective and potentially controversial.
U N D E R S TA N D
ee
1. d 2. b 3. a 4. b 5. a 6. d 7. b 8. c
CHAPTER 24
LEARNING OUTCOME QUESTIONS
A P P LY 24.1 There should be a high degree of similarity between the two genomes because
1. c 2. d 3. d 4. a they are relatively closely related. There could be differences in the relative amounts of
.w
non-coding DNA. Genes that are necessary for bony skeletal development might be
SYNTHESIZE found in the bony fish. The cartilaginous fish might lack those genes or have substantial
1. Naming of groups can be variable; names provided here are just examples. sequences in the genes needed for skeletal development in bony fish.
Jawsshark, salamander, lizard, tiger, gorilla, human (jawed vertebrates); 24.2 There would now be three copies of the chromosome from the same spe-
lungssalamander, lizard, tiger, gorilla, human (terrestrial tetrapods); cies. This would cause a problem for the cell during meiosis I as there would not be
amniotic membranelizard, tiger, gorilla, human (amniote tetrapods);
hairtiger, gorilla, human (mammals); no tailgorilla, human (humanoid
primate); bipedalhuman (human).
2. It would seem to be somewhat of a conundrum, or potentially circular;
cs an even number of homologs of the chromosome to pair up and segregate.
24.3 Compare the sequence of the pseudogene with other species. If, for
example, it is a pseudogene of an olfactory gene that is found in mice or chimps,
the sequences will be much more similar than in a more distantly related species.
si
choosing a closely related species as an outgroup when we do not even know
Apago PDF Enhancer
the relationships of the species of interest. One way of guarding against a poor
If horizontal gene transfer explains the origins of the gene, there may not be a
very similar gene in closely related species. You might use the BLAST algorithm
choice for an outgroup is to choose several species as outgroups and examine discussed in chapter 18 to identify similar sequences and then construct a phyloge-
how the phylogenetic hypothesis for the group of interest changes as a netic tree to compare the relationships among the different species.
hy
3. Recognizing that birds are reptiles potentially provides insight to the biology
both copies of the nonprotein-coding gene were knocked out.
of both birds and reptiles. For example, some characteristics of birds are
clearly of reptilian origin, such as feathers (modified scales), nasal salt 24.6 Much of the non-coding DNA could contain retrotransposons that
secreting glands, and strategies of osmoregulation/excretion (excreting replicate and insert the new DNA into the genome, enlarging the genome. Since
nitrogenous waste products as uric acid) representing ancestral traits, that the number of genes does not change, polyploidy is not a good explanation.
sw
continue to serve birds well in their environments. On the other hand, some 24.7 An effective drug might bind only to the region of the pathogen protein that
differences from other reptiles (again, feathers) seem to have such profound is distinct from the human protein. The drug could render the pathogen protein inef-
significance biologically, that they overwhelm similarities visible in shared fective without making the human ill. If the seven amino acids that differ are scattered
ancestral characteristics. For example, no extant nonavian reptiles can fly, or throughout the genome, they might have a minimal effect on the protein and it would
are endothermic and these two traits have created a fundamental distinction be difficult to develop a drug that could detect small differences. Its possible that the
in the minds of many biologists. Indeed, many vertebrate biologists prefer to
.a
INQUIRY QUESTIONS
traditional classification schemes.
Page 478 Meiosis in a 3n cell would be impossible because three sets of
4. In fact, such evolutionary transitions (the loss of the larval mode, and the
chromosomes cannot be divided equally between two cells. In a 3n cell, all three
re-evolution of a larval mode from direct development) are treated with equal
w
be taken into account in various ways. The simplest way might be to assign
chromosomes.
weights based on likelihoods; two transitions from larval development to
direct development is equal to one reversal from direct development back to a Page 479 Polyploidization seems to induce the elimination of duplicated genes.
larval mode. In fact, there are such methods, and they are similar in spirit to Duplicate genes code for the same gene product. It is reasonable that duplicate
the statistical approaches used to build specific models of evolutionary change genes would be eliminated to decrease the redundancy arising from the translation
rather than rely on simple parsimony. of several copies of the same gene.
A-14 appendix A
m
Page 495 Because there is a stop codon located in the middle of the CAL (cau-
U N D E R S TA N D liflower) gene coding sequence, the wild-type function of CAL must be concerned
1. c 2. d 3. d 4. b 5. b 6. a with producing branches rather than leaves. The wild type of Brassica oleracea con-
sists of compact plants that add leaves rather than branches; branches are typical of
A P P LY
co
the flowering heads of broccoli and cauliflower. Additional evolutionary events pos-
1. a 2. d 3. d 4. a sibly include large flower heads, unusual head coloration, protective leaves covering
flower heads, or head size variants, among other possibilities.
SYNTHESIZE Page 501 Functional analysis involves the use of a variety of experiments
1. The two amino acid difference between the FOXP2 protein in humans and designed to test the function of a specific gene in different species. By mixing and
y.
closely related primates must alter the way the protein functions in the brain. matching parts of the AP3 and PI genes and introducing them into ap3 mutant
The protein affects motor function in the brain allowing coordination of plants, it was found that the C terminus sequence of the AP3 protein is essential
larynx, mouth and brain for speech in humans. For example, if the protein for specifying petal function. Without the 3 region of the AP3 gene, the Arabidopsis
affects transcription, there could be differences in the genes that are regulated plant cannot make petals.
bl
by FOXP2 in humans and chimps.
U N D E R S TA N D
2. Human and chimp DNA is close to 99% similar, yet our phenotypes are
conspicuously different in many ways. This suggests that a catalogue of genes 1. c 2. b 3. a 4. a 5. b 6. d 7. b 8. c 9. c 10. d
ee
is just the first step to identifying the mechanisms underlying genetically
influenced diseases like cancer or cystic fibrosis. Clearly, gene expression, A P P LY
which might involve the actions of multiple noncoding segments of the DNA 1. b 2. a 3. d 4. b
and other potentially complex regulatory mechanics, are important sources of
how phenotypes are formed, and it is likely that many genetically determined SYNTHESIZE
.w
diseases result from such complex underlying mechanisms, making the gene 1. Mutations in the promoter region of other genes allowed them to be recognized
identification of genomics just the first step; a necessary but not nearly by Tbx5, which led to transcriptional control of these genes by Tbx5.
sufficient strategy. What complete genomes do offer is a starting point to
2. Development is a highly conserved and constrained process; small perturba-
correlating sequence differences among humans with genetic disease, as well
tions can have drastic consequences, and most of these are negative. Given
as the opportunity to examine how multiple genes and regulatory sequences
the thousands or hundreds of thousands of variables that can change in even a
interact to cause disease.
3. Phylogenetic analysis usually assumes that most genetic and phenotypic cs
variation arises from descent with modification (vertical inheritance). If
genetic and phenotypic characteristics can be passed horizontally (that is, not
vertically through genetic lineages) then using patterns of shared character
simple developmental pathway, most perturbations lead to negative outcomes.
Over millions of years, some of these changes will arise under the right
circumstances to produce a benefit. In this way, developmental perturbations
are not different from what we know about mutations in general. Beneficial
mutations are rare, but with enough time they will emerge and spread under
si
Apago PDF Enhancer
variation to infer genealogical relationships will be subject to potentially specific circumstances.
significant error. We might expect that organisms with higher rates of HGT Not all mutations provide a selective advantage. For example, reduced
will have phylogenetic hypotheses that are less reliable or at least are not body armor increases the fitness of fish in freshwater, but it was not selected
hy
resolved as a neatly branching tree. for in a marine environment where the armor was important for protection
from predators. The new trait can persist at low levels for a very long time
until a change in environmental conditions results in an increase in fitness for
CHAPTER 25 individuals exhibiting the trait.
LEARNING OUTCOME QUESTIONS 3. The latter view represents our current understanding. There are many
p
25.1 A change in the promoter of a gene necessary for wing development might examples of small gene families (such as, Hox, MADS) whose apparent role in
lead to the repression of wing development in a second segment of a fly in a species generating phenotypic diversity among major groupings of organisms is in
altering the expression of other genes. Alterations in timing (heterochrony)
ar
species. The extra-long jaw would have to offer some selective advantage or the the two species do not have different sets of developmental genes, rather the
trait would not persist in the population. expression of those genes differ. Another example that makes the same point
25.3 Yes, although this is not the only explanation. The coding regions could is the evolution of an image forming eye. Recent studies suggest, in contrast
be identical but the promoter or other regulatory regions could have been altered to the view that eyes across the animal kingdom evolved independently
by mutation, leading to altered patterns of gene expression. To test this hypoth- multiple times, that image-forming eyes from very distantly related taxa (such
esis, the pitx1 gene should be sequenced in both fish and compared. as, insects and vertebrates) may trace back to the common origin of the Pax6
.a
25.4 The pectoral fins are homoplastic because sharks and whales are only dis- gene. If that view is correct, then genes controlling major developmental
tantly related and pectoral fins are not found in whales more recent ancestors. patterns would seem to be highly conserved across long periods of time, with
expression being the major form of variation.
25.5 The duplication could persist if a mutation in the duplicated gene prevented
w
its expression or altered the coding region, and either a regulatory or a coding 4. Unless the Pax6 gene was derived multiple times, it is difficult to hypothesize
change could lead to a new function. multiple origins of eyes. Pax6 initiaties eye development in many species. The
variation in eyes among animals is a result of which genes are expressed and
25.6 A phylogenetic analysis of paleoAP3 and its gene duplicates demonstrated when after Pax6 initiates eye development.
w
that the presence of AP3 correlates with petal formation. The specific domain of
AP3 that is necessary for petal development was identified by making gene con- 5. Maize relies on paleoAP3 and PI for flower development while tomato has three
structs of the AP3 gene where the C terminus of the protein was eliminated or was genes because of a duplication of paleoAP3. This duplication event in the ancestor
replaced with the C terminus from the duplicate gene. The C terminus was shown of tomato, but not maize, is correlated with independent petal origin.
w
to be essential for petal formation. 6. The direct developing sea urchin has an ancestor that had one or more
25.7 There is no need for eyes in the dark. Perhaps the fish expend less energy mutations in genes that were needed to regulate the expression of other genes
when eyes are not produced and that offered a selective advantage in cavefish. In needed for larval stage development. When those genes were not expressed,
a habitat with light, a mutation that resulted in a functional Pax6 would likely be there was no larval development and the genes necessary for adult develop-
ment were expressed.
appendix A A-15
m
to pass on information from generation to generation (heredity), regulates its inter- However, DNA acts as a molecular record of a species past. Combining what
nal processes and can maintain homeostasis, grows and develops, has some sort of is being learned from both morphological and molecular data leads to more
cellular organization, and can respond to some stimuli. robust evolutionary hypotheses.
26.2 You can infer that both a squirrel and fox are in the class Mammalia but are
co
in different orders. Thus they share many, but not all traits. They likely shared a
common ancestor. However the taxonomic hierarchy does not show the evolution- CHAPTER 27
ary relationships among organisms the way a phylogeny would. LEARNING OUTCOME QUESTIONS
26.3 The viral genome would now be part of the infected cells genome and the 27.1 Viruses use cellular machinery for replication. They do not make all of the
viral genes could be expressed. One example of this is the chicken pox virus.
y.
proteins necessary for complete replication.
26.4 Without atmospheric oxygen, organisms would still be anaerobic. There would 27.2 A prophage carrying such a mutation could not be induced to undergo the
be no cellular respiration and no mitochondria in cells. Organisms would not be as lytic cycle.
effective at producing energy and they may not have evolved to be as large as some life
27.3 This therapy, at present, does not remove all detectable viruses. This cannot
bl
forms today because they couldnt meet the energy demands of the cells.
be considered a true cure.
26.5 Insect vectors might carry DNA from moss to a flowering plant.
27.4 In addition to a high mutation rate, the influenza genome consists of
26.6 Closely related living organisms might have diverged from a common an- multiple RNA segments that can recombine during infection. This causes the main
ee
cestor millions of years ago. Even though they are the closest living relatives, much antigens for the immune system to shift rapidly.
evolutionary change could have occurred during the intervening years.
27.5 Prions carry information in their three-dimensional structure. This 3-D
INQUIRY QUESTIONS information is different from the essentially one-dimensional genetic information
in DNA.
Page 515 A clade is an evolutionary unit consisting of a common ancestor and
.w
all of its descendants. Evidence suggests that the Archaea are very different from U N D E R S TA N D
all other organisms, which justifies including the Archaea in a separate domain.
Phylogenetically, each domain forms a clade. 1. c 2. b 3. c 4. d 5. b 6. d 7. b
SYNTHESIZE
3. c 4. d 5. b 6. c 7. c 8. a
1. A set of genes that are involved in the response to DNA damage are normally
Page 522 To determine if a moss gene had a function you would employ func- induced by the same system. The protein involved destroys a repressor that
si
moss gene in Amborella.
Apago PDF Enhancer
tional analysis, using a variety of experiments, to test for possible functions of the keeps DNA repair genes unexpressed. Lambda has evolved to use this system
to its advantage.
U N D E R S TA N D 2. Since viruses require the replication machinery of a host cell to replicate, it is
hy
unlikely that they existed before the origin of the first cells.
1. b 2. c 3. c 5. The protists are a bit of a catchall and are not monophyletic.
Organisms that were clearly eukarotic but did not fit with plants, fungi, or animals 3. This is a complex situation. Factors that act include the high mutation rate of
were placed in the protists 6. c 7. c 8. d the virus and the fact that the virus targets the very cells that mount an immune
response. The influenza virus also requires a new vaccine every year due to
A P P LY rapids changes in the virus. The smallpox virus was a DNA virus that had
p
1. Kindgom Fungi because some fungi have flagella and cell walls made of chitin. antigenic determinants that did not change rapidly making a vaccine possible.
Fungi lack a nervous system 2. a 3. c 4. d 5. b 6. d 4. Emerging viruses are those that jump species and thus are new to humans.
ar
location by the action of meteorites and comets. As you have seen with
convergent evolution, panspermia would still not be proven by such a finding. CHAPTER 28
However, if the life was biochemically different it would suggest that life
originated independently on the moons and Earth. LEARNING OUTCOME QUESTIONS
2. 28.1 Evidence would take the form of microfossils, evidence for altered isotopic
ratios, or biomarkers such as hydrocarbons that do not arise by abiotic processes.
.a
Arthropods 28.2 Archaea have ether linked instead of ester linked phospholipids; their cell
wall is made of unique material.
Echinoderms
Crustaceans
Nematodes
28.3 Compare their DNA. The many metabolic tests we have used for years
Myriapods
Mollusks
w Annelids
A-16 appendix A
m
parameters other than level of sexual activity. The virulence or infectivity of one
or both disease agents may be changing, for example, or some aspect of exposed 29.8 Comparative genomic studies of choanoflagellates and sponges would be
people may be changing in such a way as to alter susceptibility. Only a thorough helpful. Considering the similarities among a broader range of genes than just the
public health study can sort this out. conserved tyrosine kinase receptor would provide additional evidence.
co
29.9 It is unlikely that cellular and plasmodial slime molds are closely related.
U N D E R S TA N D They both appear in the last section of this chapter because they have yet to be
1. b 2. a 3. c 4. c 5. d 6. a 7. b assigned to clades. The substantial differences in their cell biology are inconsistent
with a close phylogenetic relationship.
A P P LY
y.
1. c 2. b 3. b 4. c 5. d 6. b 7. a INQUIRY QUESTION
Page 570 Red and green algae obtained chloroplasts by engulfing photosyn-
SYNTHESIZE thetic bacteria by primary endosymbiosis; chloroplasts in these cells have two
bl
1. The study of carbon signatures in rocks using isotopic data assumes that membranes. Brown algae obtained chloroplasts by engulfing cells of red algae
ancient carbon fixation involves one of two pathways that each show a bias through secondary endosymbiosis; chloroplasts in cells of brown algae have four
towards incorporation of carbon 12. If this bias were not present, it is not membranes. Counting the number of cell membranes of chloroplasts indicates
possible to infer early carbon fixation by this pathway. This pathway could primary or secondary endosymbiosis.
ee
have arisen even earlier and we would have no way to detect it.
U N D E R S TA N D
2. The heat killing of the virulent S strain of Streptococcus released the genome
of the virulent smooth strain into the environment. These strains of 1. b 2. a 3. b 4. c 5. d 6. b 7. a 8. c 9. b, c 10. a, d
Streptococcus bacteria are capable of natural transformation. At least some of 11. d 12. a
the rough strain cells took up smooth strain genes that encoded the
A P P LY
.w
polysaccharide coat from the environment. These genes entered into the
rough strain genome by recombination, and then were expressed. These 1. d 2. a 3. a
transformed cells were now smooth bacteria.
SYNTHESIZE
3. The multiple antibiotics are not a bad idea if all of the bacteria are killed. In
the case of some persistent infections, this is an effective strategy. However, it 1. Cellular and plasmodial slime molds both exhibit group behavior and can
does provide very strong selective pressure for rare genetic events that
cs
produce multiple resistances in a single bacteria species. For this reason, it is
not a good idea for it to be the normal practice. The more bacteria that
undergo this selection for multiple resistance, the more likely it will arise.
produce mobile slime mold masses. However, these two groups are very
distantly related phylogenetically.
2. The development of a vaccine, though challenging, will be the most
promising in the long run. It is difficult to eradicate all the mosquito vectors
si
Apago PDF Enhancer
This is helped by patients not taking the entire course as bacteria may survive
by chance and proliferate with each generation providing the opportunity for
and many eradication methods can be harmful to the environment.
Treatments to kill the parasites are also difficult because the parasite is likely
new mutations. This is also complicated by the horizontal transfer of to become resistant to each new poison or drug. A vaccine would provide
resistance via resistance plasmids, and the existence of transposable genetic long-term protection without the need to use harmful pesticides or drugs
hy
elements that can move genes from one piece of DNA to another. where drug resistance is a real possibility.
4. Most species on the planet are incapable of fixing nitrogen without the 3. For the first experiment, plate the cellular slime molds on a plate that has no
assistance of bacteria. Without nitrogen, amino acids and other compounds bacteria. Spot cyclic-AMP and designated places on the plate and determine
cannot be synthesized. Thus a loss of the nitrogen fixing bacteria due to if the bacteria aggregate around the cAMP.
increased UV radiation levels would reduce the ability of plants to grow,
p
For the second experiment, repeat the first experiment using plates that
severely limiting the food sources of the animals. have a uniform coating of bacteria as well as plates with no bacteria. If the
cellular slime molds aggregate on both plates, resource scarcity is not an
ar
issue. If the cells aggregate only in the absence of bacteria, you can conclude
CHAPTER 29 that the attraction to cAMP occurs only under starvation conditions.
LEARNING OUTCOME QUESTIONS
29.1 Mitochondria and chloroplasts contain their own DNA. Mitochondrial CHAPTER 30
sw
29.2 There are distinct clades in the Protista that do not share a common ances- directly by meiosis.
tor. The group of organisms commonly referred to as protists are actually a collec- 30.2 Chlorophytes have chloroplasts which are not found in choanoflagellates.
tion of a number of monophyletic clades. The lack of water is the major barrier for sperm that move through water to
Pseudopodia provide a large surface area and substantial traction for stable reach the egg. It is more difficult for sperm to reach the egg on land.
w
movement.
30.3 Moss are extremely desiccation tolerant and can withstand the lack of water.
29.3 Undulating membranes would be effective on surfaces with curvature that Also, freezing temperatures at the poles are less damaging when moss have a low
may not always be smooth, including intestinal walls. water content.
w
29.4 Contractile vacuoles collect and remove excess water from within 30.4 The sporophyte generation has evolved to be the larger generation and
the Euglena. therefore an effective means to transporting water and nutrients over greater
29.5 The Plasmodium often becomes resistant to new poisons and drugs. distances would be advantageous.
w
29.6 While the gametophytes are often much smaller than the sporophytes, you 30.5 There was substantial climate change during that time period. Glaciers had
could be most confident in your answer if you counted the chromosomes in the spread, then melted and retreated. Drier climates could have contributed to the ex-
cells of each. The diploid sporophyte will have twice as many chromosomes as the tinction of large club mosses. Refer to chapter 26 for more information on changes
haploid gametophyte. in Earths climate over geological time.
appendix A A-17
m
30.8 The ovule rests, exposed on the scale (a modified leaf). 31.6 A dikaryotic cell has two nuclei, each with a single set of chromosomes. A
diploid cell has a single nucleus with two sets of chromosomes.
30.9 Animals that consume the fruit disperse the seed over longer distances than
wind can disperse seed. The species can colonize a larger territory more rapidly. 31.7 Preventing the spread of the fungal infection using fungicides and good
cultivation practices could help. If farmworkers must tend to infected fields, masks
co
INQUIRY QUESTIONS that filter out the spores could protect the workers.
Page 592 The diploid sporophyte of Ulva produces sporangia in which meiosis 31.8 The fungi that ants consumed may have originally been growing on leaves. Over
occurs. The resultant haploid spores develop into either plus or minus strains evolutionary time, mutations that altered ant behavior so the ants would bring leaves to
of multicellular gametophytes which, in turn, produce haploid gametangia. The a stash of fungi would have been favored and the tripartite symbiosis evolved.
y.
gametangia produce haploid gametes. Meiosis is involved in the formation of Ulva 31.9 Wind can spread spores over large distances, resulting in the spread of
gametes, but not directly. fungal disease.
Page 596 Tracheophytes developed vascular tissue, enabling them to have ef-
ficient water- and food-conducting systems. Vascular tissue allowed tracheophytes U N D E R S TA N D
bl
to grow larger, possibly then able to out-compete smaller, nonvascular land plants. 1. c 2. d 3. a 4. d 5. b 6. d 7. d
A protective cuticle and stomata that can close during dry conditions also conferred
a selective advantage. A P P LY
ee
Page 610 Endosperm provides nutrients for the developing embryo in most 1. d 2. b 3. a 4. c 5. d
flowering plants. The embryo cannot derive nutrition from soil prior to root devel-
opment, therefore without endosperm, the embryo is unlikely to survive. SYNTHESIZE
1. Fungi possess cell walls. Although the composition of these cell walls differs
U N D E R S TA N D from that of the plants, cell walls are completely absent in animals. Fungi are
.w
1. d 2. d, c 4. c 5. a 6. c 7. b 8. d 9. a 10. d also immobile (except for chytrids), and mobility is a key characteristic of the
animals.
A P P LY 2. The mycorrhizal relationships between the fungi and plants allow plants to
2. d 3. b 4. c 5. c 6. a 7. b 8. a 9. a make use of nutrient poor soil. Without the colonization of land by plants, it
is unlikely that animals would have diversified to the level they have achieved
SYNTHESIZE
1. Moss has a dominant gametophyte generation while lycophytes have a
dominant sporophyte generation. Perhaps a comparison of the two genomes
would provide insight into the genomic differences associated with the
cs today. Lichens are important organisms in the colonization of land. Early
land masses would have been composed primarily of barren rock, with little
or no soil for plant colonization. As lichens colonize an area they begin the
process of soil formation, which allows other plant
evolutionary shift from dominant gametophyte to dominant sporophyte.
si
2. Answers to this question may vary. However, gymnosperms are defined as
Apago PDF 3.Enhancer
Antibiotics are designed to combat prokaryotic organisms and fungi are
eukaryotic. In addition, fungi possess a cell wall that has a different chemical
naked seed plants. Therefore, an ovule that is not completely protected by constitution (chitin) from that of prokaryotes.
sporophyte tissue would be characteristic of a gymnosperm. To be classified
hy
for sexual reproduction. Sexual reproduction is designed to increase the true phylogeny. As there are living organisms that are both multicellular and unicel-
genetic variability of a species. If a plant allows self-pollination, then the lular, it stands to reason that the first organisms were unicellular, and multicellularity
amount of genetic diversity will be reduced, but this is a better alternative followed. Animals are also all heterotrophs; if they were the first type of life to have
ar
than not reproducing at all. This would be especially useful in species in evolved, there would not have been any autotrophs on which they could feed.
which the individuals are widely dispersed.
32.2 Cephalization, the concentration of nervous tissue in a distinct head region,
4. The benefit is that by developing a relationship with a specific pollinator, the is intrinsically connected to the onset of bilateral symmetry. Bilateral symmetry
plant species increases the chance that its pollen will be brought to promotes the development of a central nerve center, which in turn favors the ner-
sw
another member of its species for pollination. If the pollinator is a vous tissue concentration in the head. In addition, the onset of both cephalization
generalist, then the pollinator might not travel to another member of the and bilateral symmetry allows for the marriage of directional movement (bilateral
same species, and pollination would not occur. The drawback is that if symmetry) and the presence of sensory organs facing the direction in which the
something happens to the pollinator (extinction or drop in population size) animal is moving (cephalization).
then the plant species would be left with either a reduced or nonexistent
means of pollination. 32.3 This allows systematists to classify animals based solely on derived charac-
.a
teristics. Using features that have only evolved once implies that the species that
have that characteristic are more closely related to each other than they are to
CHAPTER 31 species that do not have the characteristic.
32.4 One hypothesis is that the rapid diversification in body plan was a biological
LEARNING OUTCOME QUESTIONS
w
A-18 appendix A
m
information in Figure 32.4. Therefore, some of the different types of body activities such as reproduction and excretion, even if those systems themselves are
cavities have evolved multiple times, and the body cavities are not good segmented. Likewise, a body-wide circulatory system enables efficient oxygen
characteristics to infer phylogenetic relationships. delivery to all of the body cells regardless of the nature of the organisms individual
segments.
2. Answers may vary depending on the classification used. Many students will
co
place the Echinoderms near the Cnidaria due to radial symmetry; others will 34.4 Lophophorates are sessile suspension-feeding animals. Much of their body
place them closer to the Annelids. also remains submerged in the ocean floor. Thus, a traditional tubular digestive
system would require either the mouth or the anus to be inaccessible to the water
columnmeaning the animal either could not feed or would have to excrete waste
CHAPTER 33 into a closed environment. The U-shaped gut allows them to both acquire nutri-
y.
ents from and excrete waste into their environment.
LEARNING OUTCOME QUESTIONS
34.5 One of the defining features of the arthropods is the presence of a chitinous
33.1 The cells of a truly colonial organism, such as a colonial protist, are all exoskeleton. As arthropods increase in size, the exoskeleton must increase in thick-
structurally and functionally identical; however, sponge cells are differentiated and
bl
ness disproportionately, in order to bear the pull of the animals muscles. This puts
these cells coordinate to perform functions required by the whole organism. Unlike a limit on the size a terrestrial arthropod can reach, as the increased bulk of the
all other animals, however, sponges do appear much like colonial organisms in that exoskeleton would prohibit the animals ability to move. Water is denser than air
they are not comprised of true tissues, and the cells are capable of differentiating and thus provides more support; for this reason aquatic arthropods are able to be
ee
from one type to another. larger than terrestrial arthropods.
33.2 The importance of triploblasty relates to the placement of ctenophores on 34.6 Bilateral symmetry evolved relatively early in animal phylogeny, with the
the animal phylogenetic tree. Until recently, ctenophores have been considered platyhelminthes. Echinoderms clearly branched off later in evolutionary history, as
diploblasts, with platyhelminthes as the first triploblasts. New evidence, however, evidenced by their deuterostome development, and yet, as adults they exhibit radial
indicates that ctenophores are actually triploblastic. In addition, molecular evidence (or, more accurately, pentaradial) symmetry. This might be a confusing factor when
suggests that this phylum belongs at the base of the animal phylogenythus
.w
determining the phylogeny of animals, if not for the bilateral form the echinoderm
implying that the ancestor to all animals was triploblastic. larvae take. The bilaterally symmetrical larvae suggest that the echinoderm ances-
33.3 Tapeworms are parasitic platyhelminthes that live in the digestive system of their tor is in fact bilaterally symmetrical, rather than radially symmetrical.
host. Tapeworms have a scolex, or head, with hooks for attaching to the wall of their
hosts digestive system. Another way in which the anatomy of a tapeworm relates to its U N D E R S TA N D
cs
way of life is their dorsoventrally flattened body and corresponding lack of a diges-
tive system. Tapeworms live in their food; as such they absorb their nutrients directly
through the body wall, and their flat bodies facilitate this form of nutrient delivery.
33.4 Ascaris lumbricoides, the intestinal roundworm, infects humans when the
1. c 2. b
A P P LY
1. b 2. c
3. a
3. d
4. d
4. a
5. d 6. b 7. c 8. d 9. d 10. a 11. a
si
Apago PDF Enhancer
human swallows food or water contaminated with roundworm eggs. The most
SYNTHESIZE
effective ways of preventing the spread of intestinal roundworms is to increase
sanitation, especially those in food handling, education, and cease using human 1. Clams and scallops are bivalves, which are filter feeders that siphon large
feces as fertilizer. Not surprisingly, infection by these parasites is most common in amounts of water through their bodies to obtain food. They act as natural
hy
areas without modern plumbing. pollution-control systems for bays and estuaries. A loss of bivalves (from
overfishing, predation, or toxic chemicals) would upset the aquatic ecosystem
U N D E R S TA N D and allow pollution levels to rise.
1. c 2. a 3. b 4. b 5. d 6. d 7. c
2. Chitin is an example of convergent evolution since these organisms do not
p
SYNTHESIZE CHAPTER 35
1. Answers may vary. Phylum Acoela represents a reclassification of the
platyhelminthes and phylum Cycliophora represents an entirely new
LEARNING OUTCOME QUESTIONS
sw
kingdom. Since we have most likely not discovered all of the noncoelomate 35.1 Chordates have a truly internal skeleton (an endoskeleton), compared to
invertebrate species on the planet, and we are utilizing new molecular tools to the endoskeleton on echinoderms, which is functionally similar to the exoskeleton
examine the relationships of existing phyla, it is unlikely that the modern of arthropods. Whereas an echinoderm uses tube feet attached to an internal
phylogeny presented in section 33.2 is complete. water vascular system for locomotion, a chordate has muscular attachments to its
endoskeleton. Finally, chordates have a suite of four characteristics that are unique
2. Since the population size of a parasitic species may be very small (just a few
to the phyluma nerve chord, a notochord, pharyngeal slits, and a postanal tail.
individuals), possessing both male and female reproductive structures would
.a
allow the benefits of sexual reproduction. 35.2 While mature and immature lancelets are similar in form, the tadpole-like
tunicate larvae are markedly different from the sessile, vase-like adult form. Both
3. Answers may vary. However, it is known that the tapeworm is not the
tunicates and lancelets are chordates, but they differ from vertebrates in that they
ancestral form of platyhelminthes; instead it has lost its digestive tract due to
do not have vertebrae or internal bony skeletons.
its role as an intestinal parasite. As an intestinal parasite, the tapeworm relies
w
on the digestive system of its host to break down nutrients into their building 35.3 The functions of an exoskeleton include protection and locomotionar-
blocks for absorption. thropod exoskeletons, for example, provide a fulcrum to which the animals muscles
attach. In order to resist the pull of increasingly large muscles, the exoskeleton
w
must dramatically increase in thickness as the animal grows larger. There is thus a
CHAPTER 34 limit on the size of an organism with an exoskeletonif it gets too large it will be
unable to move due to the weight and heft of its exoskeleton.
LEARNING OUTCOME QUESTIONS
w
35.4 Lobe-finned fish are able to move their fins independently, whereas ray-
34.1 Cephalopods are the most active of all mollusks, and this increased level of finned fish must move their fins simultaneously. This ability to walk with their
activity necessitates a more efficient oxygen delivery system. The extensive series of fins indicates that lobe-finned fish are most certainly the ancestors of amphibians.
blood vessels, and thus more efficient gas exchange, in the cephalopod circulatory
system allows the animal to move more rapidly and over longer periods of time. 35.5 The challenges of moving onto land were plentiful for the amphibians.
First, amphibians needed to be able to support their body weight and locomote on
34.2 With a flow-through digestive tract, food moves in only one direction. land; this challenge was overcome by the evolution of legs. Second, amphibians
This allows for specialization within the tract; sections may be specialized for needed to be able to exchange oxygen with the atmosphere; this was accomplished
appendix A A-19
m
scarce, thus conserving water. Trichomes are hairlike outgrowths of the epidermis of
to develop a way of staying hydrated in a non-aquatic environment, and these early
stems, leaves, and reproductive organs. Trichomes help to cool leaf surfaces and reduce
amphibians developed leathery skin that helped prevent desiccation.
evaporation from stomata. Root hairs are epidermal extensions of certain cells in
35.6 Amphibians remain tied to the water for their reproduction; their eggs are young roots and greatly increase the surface area for absorption.
co
jelly-like and if laid on the land will quickly desiccate. Reptile eggs, on the other
hand, are amniotic eggsthey are watertight and contain a yolk, which nourishes U N D E R S TA N D
the developing embryo, and a series of four protective and nutritive membranes. 1. d 2. d 3. c 4. b 5. a 6. c 7a 8. b
35.7 There are two primary traits shared between birds and reptiles. First, both
lay amniotic eggs. Second, they both possess scales (which cover the entire reptile A P P LY
y.
body but solely the legs and feet of birds). Birds also share characteristics only with 1. a 2. c 3. d 4. c
one group of reptilesthe crocodilians, such as a four-chambered heart.
35.8 The most striking convergence between birds and mammals is endothermy, SYNTHESIZE
bl
the ability to regulate body temperature internally. Less striking is flight; found in 1. Roots lack leaves with axillary buds at nodes, although there may be lateral
most birds and only one mammal, the ability to fly is another example of conver- roots that originated from deep within the root. The vascular tissue would have
gent evolution. a different pattern in roots and stems. If there is a vascular stele at the core with
35.9 Only the hominids comprise a monophyletic group. Prosimians, monkeys, a pericycle surrounded by a Casparian strip, you are looking at a root.
ee
and apes are all paraphyleticthey include the common ancestor but not all 2. Lenticels increase gas exchange. In wet soil, the opportunity for gas exchange
descendents: the clade that prosimians share with the common prosimian ancestor decreases. Lenticels could compensate for decreased gas exchange, which
excludes all anthropoids, the clade that monkeys share with the common monkey would be adaptive.
ancestor excludes hominoids, and the clade that apes share with the common ape
3. The tree is likely to die because the phloem and vascular cambium is located
ancestor excludes hominids.
near the surface. Removing a ring of bark results in the loss of the vascular
.w
cambium and phloem, leading to starvation and death.
U N D E R S TA N D
1. c 2. c 3. a 4. c 5. a 6. d 7. a 8. d
A P P LY
CHAPTER 37
1. c 2. c
SYNTHESIZE
3. b
cs LEARNING OUTCOME QUESTIONS
37.1 Only angiosperms have an endosperm which results from double fertiliza-
tion. The endosperm is the nutrient source in angiosperms. Gymnosperm embryos
rely on megagametophytic tissue sources for nutrients.
1. Increased insulation would have allowed birds to become endothermic and
si
Apago PDF 37.2
Enhancer
thus to be active at times that ectothermic species could not be active. High
These seeds might be sensitive to temperature and require a period of cold
body temperature may also allow flight muscles to function more efficiently.
before germinating.
2. Birds evolved from one type of dinosaurs. Thus, in phylogenetic terms, birds 37.3 Fruits with fleshy coverings, often shiny black or bright blue or red, nor-
hy
evolution of horses. However, like in horse evolution, there are examples of Page 758 The root meristem never forms, although the shoot meristem is fully
evolutionary decreases in body size as seen in Homo floresiensis. Hominid functional. This plant is missisng the HOBBIT protein which normally allows auxin
evolution also reveals the coexistence of related species, as seen with Homo to induce the expression of a gene or genes needed for correct cell division to make a
ar
neaderthalensis and Homo sapiens. Hominid evolution, like horse evolution, was root meristem. Without the correct cell divisions, the meristem fails to form.
not a straight and steady progression to the animal that exists today.
Page 758 The MONOPTEROS (MP) gene product cannot act as a transcription
factor when it is bound by its repressor. With a MP protein that can no longer bind
sw
36.2 Vessels transport water and are part of the xylem. The cells are dead with the embryo, is diploid.
only the walls remaining. Cylinders of stacked vessels move water from the roots
to the leaves of plants. Sieve tube members are part of the phloem and transport U N D E R S TA N D
nutrients. Sieve tube members are living cells, but they lack a nucleus. The rely on
w
1. c 2. a 3. d 4. a 5. d 6. b 7. a 8. c 9. c
neighboring companion cells to carry out some metabolic functions. Like vessels,
sieve tube members are stacked to form a cylinder. A P P LY
36.3 The energy of the cell is used primarily to elongate the cell. It would be 1. c 2. c 3. b 4. d 5. c
w
difficult for a root hair to form in the region of elongation because its base would
be pulled apart by the elongation of the cell wall. SYNTHESIZE
36.4 Roots are constantly growing through soil where cells are damaged and 1. Place Fucus zygotes on a screen and shine a light from the bottom. If light is
w
sloughed off. The tips of stems do not encounter the same barriers and do not more important, the rhizoid will form towards the light, even though that is
require the additional protection. the opposite direction gravity would dictate. If gravity is more important, the
36.5 Both sides of the leaf are equally exposed to sunlight. In contrast, horizontal rhizoid will form away from the direction of the light.
leaves have a top and a bottom. Palisade layers are tightly packed with minimum 2. The endosperm has three times as many copies of each gene. If transcription
airspace between the cells which maximizes photosynthetic surface area. occurs at a constant rate in both nutritive tissues, more will be produced in
the endosperm because of the extra copies of the genes.
A-20 appendix A
m
of the animal. You could substitute for natural scarification by rubbing your Humans sweat, but dogs do not. Some animals have adaptations for living in
seeds on sand paper before germinating them. It is possible that your seed needs aquatic or high saline environment, as do plants. Vascular plants move vast
to be exposed to light or received insufficient water when you first planted it. amounts of water through the plant body via the xylem, using evaporation to
You may need to soak your seed in water for a bit to imbibe it. Exposing the fuel the transport. Animals with closed circulatory systems can move water
co
imbibed seed to sunlight might also increase the chances of germination. throughout the organism and also excrete excess water through the urinary
system, which is responsible for osmoregulation.
4. The rate of transpiration is greater during the day than the night. Since water
CHAPTER 38 loss first occurs in the upper part of the tree where more leaves with stomata
y.
LEARNING OUTCOME QUESTIONS are located, the decrease in water volume in the xylem would first be observed
in the upper portion, followed by the lower portion of the tree.
38.1 Physical pressures include gravity and transpiration, as well as turgor pres-
sure as an expanding cell presses against its cell wall. Increases in turgor pressure 5. Spring year 1The new carrot seedling undergoes photosynthesis in
and other physical pressures are associated with increases water potential. Solute developing leaves and the sucrose moves towards the growing tip.
bl
concentration determines whether water enters or leaves a cell via osmosis. The Summer year 1The developing leaves are sources of carbohydrate,
smallest amount of pressure on the side of the cell membrane with the greater solute which now moves to the developing root and also the growing young tip.
concentration that is necessary to stop osmosis is the solute potential. Water potential Fall year 1The carrot root is now the sink for all carbohydrates
produced by the shoot.
ee
is the sum of the pressure from physical forces and from the solute potential.
Spring year 2Stored carbohydrate in the root begins to move upwards
38.2 Proteins in the cell membrane allow diffusion to be selective. Other protein
into the shoot.
channels are involved in active transport across the membrane. Water moves through
Summer year 2The shoot is flowering and the developing flowers are
channels called aquaporins. For a review of membrane properties, see chapter 5.
the primary sink for carbohydrates from the root and also from photosynthe-
38.3 The driving force for transpiration is the gradient between 100% humidity sis in the leaves.
.w
inside the leaf and the external humidity. When the external humidity is low, the Fall year 2Seeds are developing and they are the primary sink. The root
rate of transpiration is high, limited primarily by the amount of water available for reserves have been utilized and any remaining carbohydrates from photosyn-
uptake through the root system. thesis are transported to developing seeds.
The minerals are used for metabolic activities. Some minerals can move into
the phloem and be transported to metabolically active areas of the plants, but oth-
ers, including calcium, cannot be relocated after they leave the xylem.
38.4
cs
Once carbon dioxide is dissolved in water, it can be transported to photo-
synthetically active cells where it is used in carbon fixation in the Calvin Cycle (see
chapter 8 for a review of photosynthesis).
CHAPTER 39
LEARNING OUTCOME QUESTIONS
39.1
a plant.
Alkaline soil can affect the availability of nutrients in the soil for uptake by
si
38.5 Apago PDF Enhancer
Physical changes in the roots in response to oxygen deprivation may pre-
39.2 Magnesium is found in the center of the chlorophyll molecule. Without
vent further transport of water in the xylem. Although the leaves may be producing sufficient magnesium, chlorophyll deficiencies will result in decreased photosyn-
oxygen, it is not available to the roots. thesis and decreased yield per acre.
hy
38.6 Phloem liquid is rich in organic compounds including sucrose and plant hor- 39.3 Nitrogen is essential for all amino acids, the building blocks of pro-
mones dissolved in water. Fluid in the xylem consists of minerals dissolved in water. tein. Without sufficient levels of proteins that function as enzymes, membrane
transporters, transcription factors, and structural components, plant growth and
INQUIRY QUESTIONS reproduction will be limited.
Page 773 Before equilibrium, the solute potential of the solution is 0.5 MPa, 39.4 Increasing the amount of available nitrogen in the soil is one strategy. This
p
and that of the cell is 0.2 MPa. Since the solution contains more solute than does
can be accomplished with chemically produced ammonia for fertilizing, intercrop-
the cell, water will leave the cell to the point that the cell is plasmolyzed. Initial
ping with nitrogen-fixing legumes, or using organic matter rich in nitrogen for
turgor pressure (p ) of the cell = 0.05 MPa, while that of the solution is 0 MPa. At
ar
enriching the soil. Efforts to reduce the relative amounts of atmospheric carbon
equilibrium, both the solution and the cell will have the same w. cell = 0.2 MPa
dioxide would also be helpful.
+ 0.5 MPa = 0.3 MPa before equilibrium is reached. At equilibrium, cell = solution
=0.5MPa, thus w cell = 0.5 MPa. At equilibrium, the plasmolyzed cell P = 0 39.5 Large poplar trees that are not palatable to animals offer a partial solution.
MPa. Finally, using the relationship W(cell) = p + s and W(cell) = 0.5 MPa, P(cel) Fencing in areas that are undergoing phytoremediation is another possibility, but it
sw
= 0 MPa, then s(cell) = 0.5 MPa. would be difficult to isolate all animals, especially birds. Plants that naturally deter
herbivores with secondary compounds, including some mustard species (Brassica
Page 775 The fastest route for water movement through cells has the least species) could be effective for phytoremediation.
hindrance, and thus is the symplast route. The route that exerts the most control
over what substances enter and leave the cell is the transmembrane route, which is INQUIRY QUESTION
then the best route for moving nutrients into the plant.
Page 797 At low and high temperature extremes, enzymes involved in plant
.a
Page 777 If a mutation increases the radius, r, of a xylem vessel threefold, then the respiration are denatured. Plants tend to acclimate to slower long-term changes in
movement of water through the vessel would increase 81-fold (r 4 = 34 = 81). A plant temperature, and rates of respiration are able to adjust. Short-term more dramatic
with larger diameter vessels can move much more water up its stems. changes might slow or halt respiration, especially if a temperature change is large
enough to cause enzymes to denature.
w
U N D E R S TA N D
1. a 2. c 3. d 4. a 5. c 6. d 7. b 8. a 9. b 10. b U N D E R S TA N D
1. b 2. a 3. c 4. d 5. a 6. b 7. c 8. a
A P P LY
w
1. b 2. c 3. b 4. c 5. b A P P LY
1. c 2. a 3. a 4. d 5. The macronutrient potassium constitutes 0.56% of the
SYNTHESIZE
w
dry weight. Lets assume that the potato is 90% water. The dry weight would be
1. The solute concentration outside the root cells is greater than inside the cells. 10% of 1000 kg, or 100 kg. Next you calculate 0.5% of 100, which is 0.5 kg. You
Thus the solute potential is more negative outside the cell and water moves out of would do the same type of calculation for 6%.
the root cells and into the soil. Without access to water, your plant wilts. The micronutrient problems would also use the estimate of 100 kg dry weight.
2. Look for wilty plants since the rate of water movement across the membrane The conversion you need to use is that 1 ppm is the same as 1 mg/kg. So, 4 ppm of
would decrease in the aquaporin mutants. copper is the same as 4 mg/kg. Multiply this by 100 kg of dry weight potato and
appendix A A-21
m
41.3 Folding leaves can startle an herbivore that lands on the plant. The herbi-
1. Bacteria that are important for nitrogen fixation could be destroyed. Other
vore leaves and the plant is protected.
microorganisms that make nutrients available to plants could also be destroyed.
41.4 During the winter months the leaves would cease photosynthesis except
2. Grow the tomatoes hydroponically in a complete nutrient solution minus
on a few warm days. If the weather warmed briefly, water would move into the
co
boron and complete nutrient solution with varying concentrations of boron.
leaves and photosynthesis would begin. Unfortunately, the minute the temperature
Compare the coloration of the leaves, the rate of growth (number of new
dropped, the leaves would freeze and be permanently damaged. Come the spring,
leaves per unit time), and number and size of fruits produced on plants in
the leaves would not be able to function and the tree would die. It is to the trees
each treatment group. It would also be helpful to compare the dry weights of
advantage to shed its leaves and grow new, viable leaves in the spring when the
plants from each treatment group at the end of the study.
danger of freezing is past.
y.
3. Other inputs include both the macronutrients and micronutrients. Nitrogen,
41.5 Abscisic acid could be isolated from root caps of several plants. The isolated
potassium, and phosphorous are common macronutrients in fertilizers. Of
abscisic acid could then be applied to the buds on stems of other plants of the same
course the plants also need to be watered.
species. The growth of these buds (or lack of growth) could be compared with
bl
untreated controls to determine whether or not the abscisic acid had an effect.
CHAPTER 40 INQUIRY QUESTIONS
LEARNING OUTCOME QUESTIONS Page 816 A number of red-light-mediated responses are linked to phytochrome
ee
40.1 The lipid-based compounds help to create a water impermeable layer on action alone, including seed germination, shoot elongation, and plant spacing. Only
the leaves. some of the red-light-mediated responses leading to gene expression are dependent
on the action of protein kinases. When phytochrome converts to the Pfr form, a
40.2 A drug prepared from a whole plant or plant tissue would contain a number of protein kinase triggers phosphorylation that, in turn, initiates a signaling cascade
different compounds, in addition to the active ingredient. Chemically synthesized or
that triggers the translation of certain light-regulated genes. Not all red-light-
.w
purified substances contain one or more known substances in known quantities.
mediated responses are disrupted in a plant with a mutation in the protein kinase
40.3 It is unlikely that wasps will kill all the caterpillars. When attacked by a domain of phytochrome.
caterpillar, the plant releases a volatile substance that attracts the wasp. But, the
Page 819 Auxin is involved in the phototropic growth responses of plants,
wasp has to be within the vicinity of the signal when the plant releases the signal.
including the bending of stems and leaves toward light. Auxin increases the plastic-
As a result, some caterpillars will escape detection by wasps.
40.4 The local death of cells creates a barrier between the pathogen and the rest
of the plant.
INQUIRY QUESTION
cs
ity of plants cells and signals their elongation. The highest concentration of auxin
would most likely occur at the tips of stems where sun exposure is maximal.
Page 827 A chemical substance, such as the hormone auxin, could trigger the
elongation of cells on the shaded side of a stem, causing the stem to bend toward
the light.
si
Apago PDF UEnhancer
Page 808 Ricin functions as a ribosome-binding protein that limits translation.
A very small quantity of rice was injected into Markovs thigh from the modified
N D E R S TA N D
tip of his assassins umbrella. Without translation of proteins in cells, enzymes and
1. c 2. a 3. d 4. d 5. b 6. d
other gene products are no longer produced, causing the victims metabolism to
hy
elongation. This strategy is useful for potato shoots. The sprouts will be long
SYNTHESIZE
so they can get to the surface more quickly. They will remain white until
1. Humans learn quickly and plants with toxins that made people ill would not exposed to sunlight which will signal the production of chlorophyll.
become a dietary mainstay. If there was variation in the levels of toxin in the
sw
barrier to success. more resistant to wind and rain once they are moved to the field. The
seedlings will be less likely to snap once they are moved to the more
3. If a plant is flowering or has fruits developing, the systemin will move
challenging environment.
towards the fruit or flowers, providing protection for the developing seed. If
w
the plant is a biennial, such as a carrot plant, in its first year of growth,
systemin will likely be diverted to the root or other storage organ that will
reserve food stores for the plant for the following year.
CHAPTER 42
w
A-22 appendix A
m
tains muscle, connective tissue and epithelial tissue.
the plant from flowering.
43.2 The epithelium in glandular tissue produces secretions, the epithelium has
42.3 Flowers can attract pollinators, enhancing the probability of reproduction. microvilli on the apical surface that increase surface area for absorption.
42.4 No because the gametes are formed by meiosis which allows for new com- 43.3 Blood is a form of connective tissue because it contains abundant extracel-
co
binations of alleles to combine. You may want to review Mendels law of indepen- lular material: the plasma.
dent assortment.
43.4 The function of heart cell requires their being electrically connected.
42.5 When conditions are uniform and the plant is well adapted to those con- The gap junctions allow the flow of ions between cells.
stant conditions, genetic variation would not be advantageous. Rather, vegetative
reproduction will ensure that the genotypes that are well adapted to the current 43.5 Neurons may be a meter long, but this is a very thin projection that still can
y.
conditions are maintained. allow diffusion of materials along its length. They do require specialized transport
along microtubules to move proteins from the cell body to the synapse.
42.6 A biennial life cycle allows an organism to store up substantial reserves to
be used to support reproduction during the second season. The downside to this 43.6 The organ systems may overlap. Consider the respiratory and circulatory
bl
strategy is that the plant might not survive the winter between the two growing systems. These systems are interdependent.
seasons and its fitness would be reduced to zero. 43.7 Yes.
43.8 The distinction should be between the ability to generate metabolic heat to
INQUIRY QUESTIONS modulate temperature, and the lack of that ability. Thus ectotherms and endo-
ee
Page 843 Strict levels of CONSTANS (CO) gene protein are maintained ac- therms have replaced cold-blooded and warm-blooded.
cording to the circadian clock. Phytochrome, the pigment that perceives photope-
riod, regulates the transcription of CO. By examining posttranslational regulation INQUIRY QUESTIONS
of CO, it might be possible to determine whether protein levels are modulated by Page 880 After two minutes of shivering, the thoracic muscles have warmed up
means other than transcription. An additional level of control might be needed to enough to engage in full contractions. The muscle contractions that allow the full
.w
ensure that the activation of floral meristem genes coincides with the activation of range of motion of the wings utilize kinetic energy in the movement of the wings,
genes that code for individual flower organs. rather than releasing the energy as heat, which occurred in the shivering response.
Page 846 Flower production employs up to four genetically-regulated pathways. Page 882 Small mammals, with a proportionately larger surface area, dissipate
These pathways ensure than the plant flowers when it has reached adult size, when heat readily, which is helpful in a warm environment, but detrimental in a cold
could occur in the absence of flower-repressing genes, even if the plant had not
environment. In cold conditions, small mammals must seek shelter or have adapta-
tions, such as insulating hair, to maintain body temperature. Because of a greater
volume and proportionately less surface area, large mammals are better adapted
to cold environments since it takes much longer for them to lose body heat. Hot
environments pose a greater challenge for them for the same reason.
si
Apago PDF Enhancer
achieved adult size. Thus flowering might occur earlier than normal.
U N D E R S TA N D
U N D E R S TA N D 1. a 2. c 3. c 4. d 5. a 6. d 7. b 8. b
hy
1. a 2. c 3. a 4. d 5. d 6. c 7. d 8. c 9. b 10. c 11. a
A P P LY
A P P LY 1. b 2. b 3. c 4. c 5. d 6. a 7. c
1. b 2. c 3. b 4. d 5. b
SYNTHESIZE
p
SYNTHESIZE 1. Yes, both the gut and the skin include epithelial tissue. A disease that affects
1. Pointsettias are short day plants. The lights from the cars on the new epithelial cells could affect both the digestive system and the skin. For
highway interrupt the long night and prevent flowering. example, cystic fibrosis affects the ion transport system in epithelial
ar
2. Spinach is a long day plant and you want to harvest the vegetative, not the membranes. It is manifested in the lungs, gut, and sweat glands.
reproductive parts of the plant. Spinach will flower during the summer as the 2. The digestive, circulatory, and respiratory systems are grouped together
days get longer. Only leaves will be produced during the spring. If you grow because they all provide necessary nutrients for the body. The digestive
system is responsible for the acquisition of nutrients from food; the
sw
and harvest your spinach in the early spring, you will be able to harvest the
leaves before the plant flowers and begins to senesce. respiratory system provides oxygen and removes waste (carbon monoxide).
3. Cross-pollination increases the genetic diversity of the next generation. But, The circulatory system transports nutrients to the cells of the body and
self-pollination is better than no pollination. The floral morphology of removes metabolic wastes.
columbine favors cross-pollination, but self-pollination is a backup option. 3. Hunger is a negative feedback stimulus. Hunger stimulates an individual to
Should this back up option be utilized, there is still one more opportunity for eat which in turn causes a feeling of fullness that removes hunger. Hunger is
.a
cross-pollination to override self-pollination because the pollen tube from the the stimulus; eating is the response that removes the stimulus.
other plant can still grow through the style more rapidly than the pollen tube 4. The internal environment is constantly changing. As you move through your
from the same plant. day, muscle activity raises your body temperature, but when you sit down to
4. Potatoes grown from true seed take longer to produce new potatoes than eat or rest, your temperature cools. The body must constantly adjust to
w
potatoes grown from tubers. Seeds are easier to store between growing changes in activity or the environment.
seasons and require much less storage space than whole potatoes. The
seed-grown potatoes will have greater genetic diversity than the asexually
CHAPTER 44
w
the tuber-grown potatoes will outperform the more variable seed-grown 44.2 A positive current inwards (influx of Na+) depolarizes the membrane while a
potatoes. But, if conditions are not optimal for the asexually propagated positive current outward (efflux of K+) repolarizes the membrane.
potatoes, the seed-grown potatoes may have the higher yield.
44.3 Tobacco contains the compound nicotine, which can bind some acetylcho-
line receptors. This leads to the classic symptoms of addiction due to underlying
habituation involving changes to receptor numbers and responses.
appendix A A-23
m
U N D E R S TA N D by which individuals could compare the signals between the retina and the brain. If
there are other cues available, such as color saturation or object shape and size, indi-
1. a 2. c 3. a 4. a 5. d 6. d 7. a
viduals with a less severe form of color blindness may be able to learn to distinguish
these colors. In the absence of other references, however, it would be very difficult for
co
A P P LY
individuals with even partial red-green color blindness to distinguish these colors.
1. d 2. b 3. c 4. a 5. a 6. c 7. d
45.6 The body temperature of an ectothermic organism is not necessarily the
SYNTHESIZE same as the ambient temperature; for example, other reptiles may bask in the sun,
wherein on a chilly day the sun may warm the animals body temperature above
1. TEA blocks K+ channels so that they will not permit the passage of K+ out of the
y.
the ambient temperature. In this situation, the heat-sensing organs of, for example,
cell, thereby not allowing the cell to return to the resting potential. Voltage-gated a pit viper would still be effective in hunting as it would be able to distinguish the
Na+ channels would still be functional and Na+ would still flow into the cell but differences between the environment and its ectothermic prey.
there would be no repolarization. Na+ would continue to flow into the cell until an
bl
electrochemical equilibrium was reached for Na+, which is + 60 mV. After the INQUIRY QUESTIONS
membrane potential reached + 60 mV, there would be no net movement of Na+,
Page 921 As the injured fish thrashed around, it would produce vibrations,
but the membrane would also not be able to repolarize back to the resting
rapid changes in the pressure of the water. The lateral line system in fish consists
membrane potential. The neuron would no longer be able to function.
of canals filled with sensory cells that send a signal to the brain in response to the
ee
The effects on the postsynaptic cell would be somewhat similar if TEA
changes in water pressure.
were applied to the presynaptic cell. The presynaptic cell would depolarize
and would continue to release neurotransmitter until it had exhausted its Page 927 Both taste and smell utilize chemoreceptors as sensory receptors,
store of synaptic vesicles. As a result, the postsynaptic cell would be wherein the binding of specific proteins to the receptor induces an action potential
bombarded with neurotransmitters and would be stimulated continuously which is sent as a sensory signal to the brain. The chemicals detected by both
systems must first be dissolved in extracellular fluid before they can be detected.
.w
until the stores of presynaptic neurotransmitter were depleted. The
postsynaptic cell however would recover, being able to repolarize its One major difference between the two systems is that the olfactory system does not
membrane, and return to the resting membrane potential. route a signal through the thalamus; instead, action potentials are routed directly to
the olfactory cortex. Another difference is that olfactory receptors occur in larger
2. Rising: Na+ gates open, K+ closed
numberstens of millions, as opposed to tens or hundreds of thousands for taste
Falling: Na+ inactivation gate closes, K+ open
Undershoot: Na+ activation gate closed, inactivation gate open,
K+ gate closing.
3. Action potential arrives at the end of the axon.
cs receptors.
Page 929 In humans, the ganglion cells attach to the front of the retinal cells,
thus forcing the optic nerve to disrupt the continuity of the retina, leading to the
formation of a blind spot. In mollusks, however, the ganglion cells attach to the
Ca2+ channels open.
back of the retina and thus the retina is uninterrupted, eliminating the blind spot.
si
Synaptic vesicles release their neurotransmitter. Apago PDF UEnhancer
Ca2+ causes synaptic vesicles to fuse with the axon membrane at the synapse.
N D E R S TA N D
Neurotransmitter molecules diffuse across synaptic cleft.
Postsynaptic receptor proteins bind neurotransmitter. 1. d 2. b 3. d 4. b 5. a 6. c 7. b 8. d 9. a
hy
of receptor proteins they produce because the stimulatory signal is so abundant. 1. When blood pH becomes acidic, chemoreceptors in the circulatory and the
The result is that it now takes more stimuli to achieve the same result. nervous systems notify the brain and the body responds by increasing the
ar
LEARNING OUTCOME QUESTIONS 2. In order to reach the retina and generate action potentials on the optic nerve,
sw
light must first pass through the ganglion and bipolar cells to reach the rods
45.1 When the log values of the intensity of the stimulus and the frequency of and cones that synapse with the bipolar cells. The bipolar cells then synapse
the resulting action potentials are plotted against each other, a straight line results; with ganglion cells. These in turn send action potentials to the brain. Because
this is referred to as a logarithmic relationship. the retina comprises three layers, with the rods and cones located farthest
45.2 Proprioceptors detect the stretching of muscles and subsequently relay from the pupil, light must travel to the deepest level to set off reactions that
information about the relative position and movement of different parts of the move up through the more superficial levels and result in optic signals.
.a
organisms body to the central nervous system. This knowledge is critical for the 3. Without gravity to force the otoliths down toward the hair cells, the otolith
central nervous system; it must be able to respond to these data by signaling the organ will not function properly. The otolith membrane would not rest on
appropriate muscular responses, allowing for balance, coordinated locomotion, and the hair cells and would not move in response to movement of the body
reflexive responses. parallel or perpendicular to the pull of gravity. Consequently, the hair cell
w
45.3 The lateral line system supplements the sense of hearing in fish and would not bend and so would not produce receptor potentials. Because the
amphibian larvae by allowing the organism to detect minute changes in the pres- astronauts can see, they would have an impression of motionthey can see
sure and vibrations of its environment. This is facilitated by the density of water; themselves move in relation to objects around thembut with their eyes
w
without an aquatic environment the adult, terrestrial amphibian will no longer be closed, they would not know if they were moving in relation to their
able to make use of this system. On land, sound waves are more easily detectable by surroundings. Because their proprioceptors would still function, they would
the sense of hearing than are vibratory or pressure waves by the similar structures be able to sense when they moved their arms or legs, but they would not have
of a lateral line. the sensation of their enter body moving through space.
w
45.4 Many insects, such as the housefly, have chemoreceptors on their feet with The semicircular canals would not function equally well in zero-gravity
which they can detect the presence of edible materials as they move through their conditions. Although the fluid in the semicircular canals is still able to move
environment. These insects can thus taste what they are walking on, and when around, some sensation of angular movement would most likely occur, but
they encounter an edible substrate they can then descend their proboscis and the full function of the semicircular canals requires the force of gravity to aid
consume the food. in the directional movement of the fluid in the canals.
A-24 appendix A
m
membrane. Hormones enter the circulatory system and are thus delivered to the for the aerobic respiration of glucose, thus providing a higher ATP yield than
entire body. anaerobic respiration. Increased mitochondria also increases the ATP productivity
46.2 The response of a particular tissue depends first on the receptors on its of the muscle by increasing availability of cellular respiration and thus allows for
surface, and second on the response pathways active in a cell. There can be dif- sustained aerobic activity.
co
ferent receptor subtypes that bind the same hormone, and the same receptor can 47.5 Locomotion via alternation of legs requires a greater degree of nervous system
stimulate different response pathways. coordination and balance; the animal needs to constantly monitor its center of gravity
46.3 This might lower the amount of GH in circulation. As a treatment, it may in order to maintain stability. In addition, a series of leaps will cover more ground per
have unwanted side effects. unit time and energy expenditure than will movement by alternation of legs.
y.
46.4 With two hormones that have antagonistic effects, the body can maintain a INQUIRY QUESTIONS
fine level of blood sugar.
Page 969 The idea is very similar; both quadrupeds and insects such as
46.5 Reducing blood volume should also reduce blood pressure. grasshoppers have flexors and extensors that exert antagonistic control over many
of their muscles. The main different is in the structure rather than functionin a
bl
U N D E R S TA N D grasshopper, the muscles are covered by the skeletal elements, while in organisms
1. b 2. d 3. c 4. b 5. d 6. b 7. a with an endoskeleton, the muscles overlie the bony skeleton.
Page 974 Increasing the frequency of stimulation to a maximum rate will yield
A P P LY
ee
the maximum amplitude of a summated muscle contraction. The strength of a
1. a 2. c 3. c 4. b 5. b 6. b 7. b contraction increases because little or no relaxation time occurs between successive
twitches.
SYNTHESIZE
Page 974 A rough estimate of the composition of calf muscle could be obtained
1. If the target cell for a common hormone or paracrine becomes cancerous, it by measuring the amount of time the calf muscle takes to reach maximum tension
.w
may become hypersensitive to the messenger. This may in turn cause over and compare that amount with the contraction speed of muscles of known fiber
production of cells, which would result in tumor formation. By blocking the composition. Alternatively, a small sample of muscle could be extracted and exam-
production of the hormone specific to that tissue (for example, breast or ined for histological differences in fiber composition.
prostate tissue and sex steroids), it would be possible to slow the growth rate
and decrease the size of the tumor. U N D E R S TA N D
2. The same hormone can affect two different organs in different ways because
the second messengers triggered by the hormone have different targets inside cs
the cell because the cells have different functions. Epinephrine affects the cells
of the heart by increasing metabolism so that their contractions are faster and
stronger. However, liver cells do not contract and so the second messenger in
1. d 2. b
A P P LY
1. d 2. b
3. c
3. d
4. a
4. b
5. c
5. b
6. a
6. b
7. b 8. a
si
Apago PDF Enhancer
liver cells triggers the conversion of glycogen into glucose. That is why
SYNTHESIZE
hormones are so valuable but also economical to the body. One hormone can
be produced, one receptor can be made, and one second-messenger system can 1. Although a hydrostatic skeleton might have advantages in terms of ease of
hy
be used, but there can be two different targets inside the cell. transport and flexibility of movement, the exoskeleton would probably do a
better job at protecting the delicate instruments within. This agrees with our
3. With hormones such as thyroxine, whose effects are slower and have a observations of these support systems on Earth. Worms and marine
broader range of activity, a negative feedback system using one hormone invertebrates use hydrostatic skeletons, although arthropods (hard bodies)
adequately controls the system. However, for certain parameters that have a use an exoskeleton. Worms are very flexible, but easily crushed.
very narrow range and change constantly within that range, a regulatory
p
system that uses up-and-down regulation is desirable. Too much or too little 2. The first 90 seconds of muscle activity are anaerobic in which the cells utilize
Ca2+ or glucose in the blood can have devastating effects on the body and so quick sources of energy (creatine phosphate, lactic acid fermentation) to
generate ATP. After that, the respiratory and circulatory systems will catch up
ar
wing evolution.
and thus it has to increase in thickness as the animal gets larger. The weight of a thicker
exoskeleton would impose debilitating constraints on the animals ability to move.
47.2 Vitamin D is important for the absorption of dietary calcium as well as the de- CHAPTER 48
w
position of calcium phosphate in bone. Children undergo a great deal of skeletal growth
and development; without sufficient calcium deposition their bones can become soft and LEARNING OUTCOME QUESTIONS
pliable, leading to a condition known as rickets, which causes a bending or bowing of 48.1 The cells and tissues of a one-way digestive system are specialized such
w
the lower limbs. In the elderly, bone remodeling without adequate mineralization of the that ingestion, digestion, and elimination can happen concurrently, making it more
bony tissue can lead to brittle bones, a condition known as osteoporosis. efficient in terms of food processing and energy utilization. With a gastrovascular
47.3 First, unlike the chitinous exoskeleton, a bony endoskeleton is made of cavity, however, all of the cells are exposed to all aspects of digestion.
living tissue; thus, the endoskeleton can grow along with the organism. Second, 48.2 Voluntary processes include bringing food into the mouth (food capture),
because the muscles that act upon the bony endoskeleton are not confined within mastication, and the initiation of swallowing. Salivation and the swallowing reflex
a rigid structure, they are able to strengthen and grow with increased use. Finally, are involuntary.
the size limitations imposed by a heavy exoskeleton that covers the entire organism
appendix A A-25
m
48.4 Fats are broken down, by emulsification, into fatty acids and monoglycer- CHAPTER 49
ides, both of which are nonpolar molecules. Nonpolar molecules are able to enter LEARNING OUTCOME QUESTIONS
the epithelial cells by simple diffusion.
49.1 Ficks law states that the rate of diffusion (R) can be increased by
co
48.5 The success of any mutation depends upon the selective pressures that increasing the surface area of a respiratory surface, increase the concentration
species is subjected to. Thus, if two different species are subjected to similar difference between respiratory gases, and decreasing the distance the gases
environmental conditions and undergo the same mutation, then, yes, the mutation must diffuse: R = DA p. Continually beating cilia increase the concentration
should be similarly successful. If two species undergo the same mutation but are difference (p). d
under different selective pressures, then the mutation may not be successful in both
y.
49.2 Countercurrent flow systems maximize the oxygenation of the blood by
species.
increasing p, thus maintaining a higher oxygen concentration in the water than
48.6 The sight, taste, and, yes, smell of food are the triggers the digestive system in the blood throughout the entire diffusion pathway. The lamellae, found within a
needs to release digestive enzymes and hormones. The saliva and gastric secretions fishs gill filaments, facilitate this process by allowing water to flow in only one direc-
bl
that are required for proper digestion and are triggered by the sense of smell would tion, counter to the blood flow within the capillary network in the gill.
be affected by anosmia.
49.3 Birds have a more efficient respiratory system than other terrestrial verte-
48.7 Any ingested compounds that might be dangerous are metabolized first by brates. Birds that live or fly at high altitudes are subjected to lower oxygen partial
the liver, thus reducing the risk to the rest of the body. pressure and thus have evolved a respiratory system that is capable of maximizing
ee
48.8 Even with normal leptin levels, individuals with reduced sensitivity in the the diffusion and retention of oxygen in the lungs. In addition, efficient oxygen ex-
brain to the signaling molecule may still become obese. change is crucial during flight; flying is more energetically taxing than most forms
of locomotion and without efficient oxygen exchange birds would be unable to fly
INQUIRY QUESTIONS even short distances safely.
Page 985 If the epiglottis does not properly seal off the larynx and trachea, food 49.4 There are both structural and functional differences in bird and mamma-
.w
can accidentally become lodged in the airway, causing choking. lian respiration. Both mammals and birds have lungs, but only birds also have air
Page 986 The digestive system secretes a mucus layer that helps to protect the sacs, which they use to move air in and out of the respiratory system, while only
delicate tissues of the alimentary canal from acidic secretions. mammals have a muscular diaphragm used to move air and in and out of the lungs.
Mammalian lungs are pliable, and gas exchange occurs within small closed-ended
Page 992 The amino acid sequences for lysozyme evolved convergently among
ruminants and langur monkeys. Thus, if a phylogeny was constructed using solely
the lysozyme molecular data, these speciesruminants and langur monkeys
would be adjacent to each other on the phylogenetic tree.
cs sacs in the mammalian lung called alveoli. In contrast, bird lungs are rigid, and gas
exchange occurs in the unidirectional parabronchi. In addition, because air flow in
mammals is bi-directional, there is a mixing of oxygenated and deoxygenated air,
while the unidirectional air flow in birds increases the purity of the oxygen entering
Page 997 GIP and CCK send inhibitory signals to the hypothalamus upon food the capillaries. Mammalian respiration is less efficient than avian respiration; birds
si
Apago PDF Enhancer
intake. If the hypothalamus sensors did not work properly, leptin levels would
increase; increased leptin levels would result in a loss of appetite.
transfer more oxygen with each breath than do mammals. Finally, mammals only
have one respiratory cycle whereas birds have two complete cycles.
49.5 Most oxygen is transported in the blood bound to hemoglobin (forming
U N D E R S TA N D
hy
bird consumes the food but stores it in her crop. When she returns to the nest, every cell of the body. Because of their small size and large number, the surface
she regurgitates the food into the mouths of the fledglings. Mammals on the area for gas exchange through them is maximized. This capillary arrangement also
other hand feed their young with milk that is produced in the mothers works well with the tiny alveoli of the lungs which also provide a large surface area
mammary glands. Young feed by latching onto the mothers nipples and sucking for gas exchange. Since capillaries are in intimate contact with alveoli, rapid gas
sw
the milk. Mammals have no need for a crop in their digestive system because exchange is enhanced.
they dont feed their young in the same way as birds. Page 1012 Ficks law of diffusion states that for a dissolved gas, the rate of diffu-
2. Leptin is produced by the adipose cells and serves as a signal for feeding sion is directly proportional to the pressure difference between the two sides of the
behavior. Since low blood leptin levels signal the brain to initiate feeding, a membrane and to the area over which the diffusion occurs. In emphysema, alveolar
treatment for obesity would need to raise leptin levels, thereby decreasing walls break down and alveoli increase in size, effectively reducing the surface area
appetite. for gas exchange. Emphysema thus reduces the diffusion of gases.
.a
3. The liver plays many important roles in maintaining homeostasis. Two of Page 1013 Most veins have a bluish color and function to return oxygen-deplet-
those roles are detoxifying drugs and chemicals and producing plasma ed blood to the heart. The pulmonary veins, however, are bright red because they
proteins. A drop in plasma protein levels is indicative of liver disease, which in return fully oxygenated blood from the lungs to the left atrium of the heart.
w
turn could be caused by abuse of alcohol or other drugs. Page 1013 The difference in oxygen content between arteries and veins during
4. The selective pressures that guide the adaptation of mutated alleles within a rest and exercise shows how much oxygen was unloaded to the tissues.
population were the same in these two groups of organisms. Both ruminants Page 1014 Not really. A healthy individual still has a substantial oxygen reserve
w
and langur monkeys eat tough, fibrous plant materials which are broken in the blood even after intense exercise.
down by intestinal bacteria. The ruminants and langurs then absorb the
Page 1014 It increases it. At any pH or temperature, the percentage of O2 satu-
nutrients from the cellulose by digesting those bacteria; this is accomplished
ration falls (e.g. more O2 is delivered to tissues) as pressure increases.
through the use of these adapted lysozymes. Normal lysozymes, found in
w
A-26 appendix A
m
1. Fish gills have not only a large respiratory surface area but also a countercur- plasma where it causes an increase in volume and subsequent increase in
rent flow system, which maintains an oxygen concentration gradient blood pressure. Another hormone, aldosterone, also causes an increase in
throughout the entire exchange pathway, thus providing the most efficient blood pressure by causing the kidney to retain Na+, which sets up a
system for the oxygenation of blood. Amphibian respiratory systems are not concentration gradient that also pulls water back into the blood.
co
very efficient. They practice positive pressure breathing. Bird lungs are quite 2. Blood includes plasma (comprised primarily of water with dissolved proteins)
effective, in that they have a large surface area and one-way air flow; and formed elements (red blood cells, white blood cells, and platelets).
mammals, on the other hand, have only a large surface area but no mecha- Lymph is comprised of interstitial fluid and found only within the lymphatic
nism to ensure the maintenance of a strong concentration gradient. vessels and organs. Both blood and lymph are found in organisms with closed
2. During exercise, cellular respiration increases the amount of carbon dioxide circulatory systems. Hemolymph is both the circulating fluid and the
y.
released, thus decreasing the pH of the blood. In addition, the increased interstitial fluid found in organisms with open circulatory systems.
cellular respiration increases temperature, as heat is released during glucose 3. Many argue that the evolution of endothermy was less an adaptation to
metabolism. Decreased pH and increased temperature both facilitate an maintain a constant internal temperature and more an adaptation to function
bl
approximately 20% increase in oxygen unloading in the peripheral tissues. in environments low in oxygen. If this is the case, then yes, it makes sense that
3. Unicellular prokaryotic organisms, protists, and many invertebrates are small the evolution of the four-chambered heart, an adaptation that increases the
enough such that gas exchange can occur over the body surface directly from availability of oxygen in the body tissues and which would be highly
the environment. Only larger organisms, where most cells are not in direct beneficial in an oxygen-poor environment, and the evolution of endothermy
ee
contact with the environment with which gases must be exchanged, require were related. These two adaptations can also be looked at as related in that
specialized structures for gas exchange. the more efficient heart would be able to provide the oxygen necessary for
the increased metabolic activity that accompanies endothermy.
4. The SA node acts as a natural pacemaker. If it is malfunctioning, one would
CHAPTER 50 expect a slow or irregular heartbeat or irregular electrical activity between the
.w
atria and the ventricles.
LEARNING OUTCOME QUESTIONS
50.1 Following an injury to a vessel, vasoconstriction is followed by the
accumulation of platelets at the site of injury and the subsequent formation of a CHAPTER 51
platelet plug. This triggers a positive feedback enzyme cascade, attracting more
cs
platelets, clotting factors, and other chemicals, each of which continually attract
additional clotting molecules until the clot is formed. The enzyme cascade also
causes fibrinogen to come out of solution as fibrin, forming a fibrin clot that will
eventually replace the platelet plug.
50.2 When the insect heart contracts, it forces hemolymph out through the
LEARNING OUTCOME QUESTIONS
51.1 Water moves towards regions of higher osmolarity.
51.2 The are both involved in water conservation.
51.3 This may have arisen independently in both the mammalian and avian
si
Apago PDF Enhancer
lineages, or lost from the reptilian lineage.
vessels and into the body cavities. When it relaxes, the resulting negative pressure
gradient, combined with muscular contractions in the body, draws the blood back 51.4 Nitrogenous waste is a problem because it is toxic, and it is a result of
to the heart. degrading old proteins.
hy
50.3 The primary advantage of having two ventricles rather than one is the sepa- 51.5 This would increase the osmolarity within the tubule system, and thus
ration of oxygenated from deoxygenated blood. In fish and amphibians, oxygenated should decrease reabsorption of water. This would lead to loss of water.
and deoxygenated blood mix, leading to less oxygen being delivered to the bodys 51.6 Blocking aquaporin channels would prevent reabsorption of water from the
cells. collecting duct.
50.4 The delay following auricular allows the atrioventricular valves to close
p
prior to ventricular contraction. Without that delay, the contraction of the ven- U N D E R S TA N D
tricles would force blood back up through the valves into the atria. 1. d 2. a 3. c 4. c 5. d 6. d 7. d
ar
50.5 During systemic gas exchange, only about 90% of the fluid that diffuses out
of the capillaries returns to the blood vessels; the rest moves into the lymphatic
A P P LY
vessels, which then return the fluid to the circulatory system via the left and right 1. d 2. c 3. b 4. b 5. c 6. b
subclavian veins.
sw
SYNTHESIZE
50.6 Breathing rate is regulated to ensure ample oxygen is available to the body.
However, the heart rate must be regulated to ensure efficient delivery of the avail- 1a. Antidiuretic hormone (ADH) is produced in the hypothalamus and is
able oxygen to the body cells and tissues. For example, during exertion, respiratory secreted by the posterior pituitary. ADH targets the collecting duct of the
rates will increase in order to increase oxygenation and allow for increased aerobic nephron and stimulates the reabsorption of water from the urine by
cellular respiration. But simply increasing the oxygen availability is not enough increasing the permeability of water in the walls of the duct. The primary
the heart rate must also increase so that the additional oxygen can be quickly stimulus for ADH secretion is an increase in the osmolarity of blood.
.a
delivered to the muscles undergoing cellular respiration. 1b. Aldosterone is produced and secreted by the adrenal cortex in response to a
drop in blood Na+ concentration. Aldosterone stimulates the distal convoluted
INQUIRY QUESTION tubules to reabsorb Na+, decreasing the excretion of Na+ in the urine. The
reabsorption of Na+ is followed by Cl and water, and so aldosterone has the
w
Olympics and other sporting events. the juxtaglomerular apparatus, detect drops in blood volume that then
stimulates the renin-angiotensin-aldosterone system.
U N D E R S TA N D 1c. Atrial natriuretic hormone (ANH) is produced and secreted by the right
w
appendix A A-27
m
CHAPTER 53
CHAPTER 52
LEARNING OUTCOME QUESTIONS
LEARNING OUTCOME QUESTIONS
53.1 Genetic sex determination essentially guarantees equal sex ratios; when sex
co
52.1 No, innate immunity shows some specificity for classes of molecules com- ratios are not equal, the predominant sex is selected against because those individu-
mon to pathogens. als have more competition for mates. Temperature-dependent sex-determination
52.2 Hematopoetic stem cells. can result in skewed sex ratios in which one sex or the other is selected against.
52.3 T-cell receptors are rearranged to generate a large number of different Genetic sex determination, on the other hand, can provide much greater stability
within the population, and consequently the genetic characteristics that provide
y.
receptors with specific binding abilities. Toll-like receptors are not rearranged, and
recognize specific classes of molecules, not specific molecules. that stability are selected for.
52.4 Ig receptors are rearranged to generate many different specificities. TLR 53.2 Estrous cycles occur in most mammals, and most mammalian species have
innate receptors are not rearranged and bind to specific classes of molecules. relatively complex social organizations and mating behaviors. The cycling of sexual
bl
receptivity allows for these complex mating systems. Specifically, in social groups
52.5 Allergies are a case of the immune system overreacting while autoimmune where male infanticide is a danger, synchronized estrous among females may be
disorders involve the immune system being compromised. selected for as it would eliminate the ability of the male to quickly impregnate the
52.6 Diagnostic kits use monoclonal antibodies because they are against a single group females. Physiologically, estrous cycles result in the maturation of the egg
ee
specific epitope of an antigen. They also use cells that can be grown in culture, accompanying the hormones that promote sexual receptivity.
and do not require immunizing an animal, bleeding them and then isolating the 53.3 In mating systems where males compete for mates, sperm competition, a
antibodies from their sera. form of sexual selection, is very common. In these social groups, multiple males
52.7 The main difference between Polio and influenza is the rate at which the may mate with a given female, and thus those individuals who produced the highest
viruses can change. The Polio virus is a RNA virus with a genome that consists number of sperm would have a reproductive advantagea higher likelihood of
.w
of a single RNA. The viral surface proteins do not change rapidly allowing im- siring the offspring.
munity via a vaccine. Influenza is an RNA virus with a high mutation rate, which 53.4 The answer varies depending upon the circumstances. In a species that is
means that surface proteins change rapidly. Influenza has a genome that consists very r-selected, in other words, one that reproduces early in life and often but does
of multiple RNAs, which allows recombination of the different viral RNAs during not invest much in the form of parental care, multiple offspring per pregnancy
infection with different strains.
INQUIRY QUESTIONS
Page 1059 The viruses would be liberated into the body where they could infect
cs would definitely be favored by natural selection. In K-selected species where paren-
tal care is very high, on the other hand, single births might be favored because the
likelihood of offspring survival is greater if the parental resources are not divided
among the offspring.
numerous additional cells.
53.5 The birth control pill works by hormonally controlling the ovulation cycle
si
Page 1063 Apago PDF inOvulation
The antigenic properties of the two viruses must be similar enough
that immunity to cowpox also enables protection against smallpox.
Enhancer
women. By releasing progesterone continuously the pill prevents ovulation.
is a cyclical event and under hormonal control, thus it is easy for the
Page 1074 The common structure and mechanism of formation of B cell immu- process to be controlled artificially. In addition, the female birth control pill only
hy
noglobulins (Igs) and T-cell receptors (TCRs) suggests a common ancestral form has to halt the release of a single ovum. An analogous male birth control pill, on the
of adaptive immunity gave rise to the two cell lines existing today. other hand, would have to completely cease sperm production (and men produce
millions of sperm each day), and such hormonal upheaval in the male could lead to
Page 1078 A high level of HCG in a urine sample will block the binding of the infertility or other intolerable side effects.
antibody to HCG-coated particles and prevent any agglutination.
Page 1079 Influenza frequently alters its surface antigens making it impossible INQUIRY QUESTIONS
p
to produce a vaccine with a long-term effect. Smallpox virus has a considerably Page 1085 The ultimate goal of any organism is to maximize its relative fitness.
more stable structure. Small females are able to reproduce but once they become very large they would
ar
reproductive success by becoming female and mating with the available male than
1. d 2. c 3. c 4. a. b., then d., then c 5. c 6. b 7. a by waiting for a female (and then having to compete for her with the other male).
Page 1088 The evolutionary progression from oviparity to viviparity is a
SYNTHESIZE complex process; requiring the development of a placenta or comparable structure.
1. It would be difficult to advertise this lotion as immune-enhancing. The skin Once a complex structure evolves, it is rare for an evolutionary reversal to occur.
serves as a barrier to infection because it is oily and acidic. Applying a lotion Perhaps more importantly, there are several advantages to viviparity over oviparity,
.a
that is watery and alkaline will dilute the protective effects of the skin especially in cold environments where eggs are vulnerable to mortality due to cold
secretions, thereby inhibiting the immune functions. Perhaps it is time to weather (and predation). In aquatic reptiles such as sea snakes, viviparity allows
look for another job. the female to remain at sea and avoid coming ashore, where both she and her eggs
would be exposed to predators.
w
also increases the temperature of the skin by bringing warm blood closer to stimulating hormone). Following castration, testosterone and inhibin are no longer
the surface. Leakage of fluid from the vessels causes swelling in the area of produced and thus the brain will overproduce LH and FSH. For this reason,
the injury, which can cause pressure on the pain sensors in the skin. All of hormone therapy is usually prescribed following castration.
w
these serve to draw defensive cells and molecules to the injury site, thereby
helping to defend her against infection. U N D E R S TA N D
3. There are a number of ways that this could be done. However, one method would 1. c 2. d 3. d 4. d 5. b 6. c 7. a 8. c 9. a
be to show that viral genetic material never appears within the cells of those who
claim immunity. Another method would involve testing for the presence of A P P LY
interferon, which is released by cells in response to viral infection. 1. a 2. b 3. d 4. a
A-28 appendix A
m
2. Amphibians and fish that rely on external fertilization also have access to Homeoboxes in mammals turn on genes that cause the development of
water. Lizards, birds, and mammals have adaptations that allow them to mammalian structures, and those in insects would generate insect structures.
reproduce away from a watery environment. These adaptations include eggs
3. After fertilization, the zygote produces hCG, which inhibits menstruation and
that have protective shells or internal development, or both.
co
maintains the corpus luteum. At 10 weeks gestation, the placenta stops
3. FSH and LH are produced by the anterior pituitary in both males and releasing hCG but it does continue to release estradiol and progesterone,
females. In both cases they play roles in the production of sex hormones and which maintain the uterine lining and inhibit the pituitary production of FSH
gametogenesis. However, FSH stimulates spermatogenesis in males and and LH. Without FSH and LH no ovulation and no menstruation occur.
oogenesis in females, whereas LH promotes the production of testosterone in
4. Spemann and Mangold removed cells from the dorsal lip of one amphibian
males and estradiol in females.
y.
embryo and transplanted them to a different location on a second embryo.
4. It could indeed work. The hormone hCG is produced by the zygote to The transplanted cells caused cells that would normally form skin and belly
prevent menstruation, which would in turn prevent implantation in the to instead form somites and the structures associated with the dorsal area.
uterine lining. Blocking the hormone receptors would prevent implantation Because of this and because the secondary dorsal structures contained both
bl
and therefore pregnancy. host and transplanted cells, Spemann and Mangold concluded that the
5. Parthenogenic species reproduce from gametes that remain diploid. Sperm transplanted cells acted as organizers for dorsal development.
are haploid, whereas eggs do not complete meiosis (becoming haploid) until
ee
after fertilization. Therefore, only eggs could develop without DNA from an
outside source. In addition, only eggs have the cellular structures needed for CHAPTER 55
development. Therefore only females can undergo parthenogenesis.
LEARNING OUTCOME QUESTIONS
55.1 Just as with morphological characteristics that enhance an individuals fit-
CHAPTER 54 ness, behavioral characteristics can also affect an individuals survivability and
.w
reproductive success. Understanding the evolutionary origins of many behaviors
LEARNING OUTCOME QUESTIONS allows biologists insights into animal behavior, including that of humans.
54.1 Ca2+ ions act as second messengers and bring about changes in protein 55.2 A male songbird injected with testosterone prior to the usual mating season
activity that result in blocking polyspermy and increasing the rate of protein would likely begin singing prior to the usual mating season. However, since female mat-
synthesis within the egg.
54.2
separating them will still allow for normal development. In frogs, on the other
cs
In a mammal, the cells at the four-cell stage are still uncommitted and thus
hand, yolk distribution results in displaced cleavage; thus, at the four-cell stage
the cells do not each contain a nucleus which contains the genetic information
ing behavior is largely controlled by hormones (estrogen) as well, most likely that male
will not have increased fitness (and may actually have decreased fitness, if the singing
stops before the females are ready to mate, or if the energetic expenditure from singing
for two additional weeks is compensated by reduced sperm production).
55.3 The genetic control over pair-bonding in prairie voles has been fairly
si
required for normal development. Apago PDF Enhancer
well-established. The fact that males sometimes seek extra-pair copulations indi-
cates that the formation of pair-bonds is under not only genetic control but also
54.3 The cellular behaviors necessary for gastrulation differ across organisms;
however, some processes are necessary for any gastrulation to occur. Specifically, behavioral control.
hy
cells must rearrange and migrate throughout the developing embryo. 55.4 In species where males travel farther from the nest (and thus have larger range
54.4 Noneural crest cell fate is determined by its migratory pathway. sizes), there should be significant sex differences in spatial memory. However, in species
without sexual differences in range sizes should not express sex differences in spatial
54.5 Marginal zone cells in both the ventral and dorsal regions express bone
memory. To test the hypothesis you could perform maze tests on males and females
morphogenetic protein 4 (BMP4). The fate of these cells is determined by the
of species with sex differences in range size as well as those species without range size
number of receptors on the cell membrane to bind to BMP4; greater BMP4 bind-
p
differences between the sexes. (NOTE: such experiments have been performed and
ing will induce a ventral mesodermal fate. The organizer cells, which previously
do support the hypothesis that there is a significant correlation between range size and
were thought to activate dorsal development, have been found to actually inhibit
spatial memory, so in species with sex differences in range size there are indeed sex
ar
ventral development by secreting one of many proteins that block the BMP4
differences in spatial memory. See Jones, CM et al., 2003. The Evolution of Sex Dif-
receptors on the dorsal cells.
ferences in Spatial Ability. Behavioral Neuroscience. 117(3): 403-411)
54.6 Most of the differentiation of the embryo, in which the initial structure
55.5 Although there may be a link between IQ and genes in humans, there is
formation occurs, happens during the first trimester; the second and third trimes-
most certainly also an environmental component to IQ. The danger of assigning
sw
ters are primarily times of growth and organ maturation, rather than the actual
a genetic correlation to IQ lies in the prospect of selective breeding and the
development and differentiation of structures. Thus, teratogens are most potent
emergence of designer babies.
during this time of rapid organogenesis.
55.6 One experiment that has been implemented in testing counting ability
INQUIRY QUESTION among different primate and bird species is to present the animal with a number
Page 1127 High levels of estradiol and progesterone in the absence of pregnancy and have him match the target number to one of several arrays containing that
.a
would still affect the body in the same way. High levels of both hormones would inhib- number of objects. In another experiment, the animal may be asked to select the
it the release of FSH and LH, thereby preventing ovulation. This is how birth control appropriate number of individual items within an array of items that equals the
pills work. The pills contain synthetic forms of either both estradiol and progesterone target number.
or just progesterone. The high levels of these hormones in the pill trick the body into 55.7 Butterflies and birds have extremely different anatomy and physiology and
w
thinking that it is pregnant and so the body does not ovulate. thus most likely use very different navigation systems. Birds generally migrate
bi-directionally; moving south during the cold months and back north during the
U N D E R S TA N D warmer months. Usually, then, migrations are multi-generational events and it
could be argued that younger birds can learn migratory routes from older genera-
w
1. d 2. b 3. d 4. c 5. d 6. b
tions. Butterflies, on the other hand, fly south to breed and die. Their offspring
A P P LY must then fly north having never been there before.
1. c 2. b 3. a 4. a 5. d 6. b 7. c 55.8 In addition to chemical reproductive barriers, many species also employ
w
appendix A A-29
m
55.10 The males should exhibit mate choice, as they are the sex with the greater lower quality, or they may have been individuals that could not compete for a
parental investment and energy expenditure; thus, like females of most species, they limited number of suitable territories for breeding. Often, the best territories
should be the choosier sex. are won by the most aggressive or largest or otherwise best competitors,
55.11 Generally, reciprocal behaviors are low-cost while behaviors due to kin meaning that the new territory holders would likely have been less fierce
co
selection may be low- or high-cost. Protecting infants from a predator is definitely competitors. If new residents were weaker competitors (due to aggression or
a high-risk / potentially high-cost behavior; thus it would seem that the behavior is body size), then the birds not removed would have been able to expand their
due to kin selection. The only way to truly test this hypothesis, however, is to con- territories to acquire even more critical resources.
duct genetic tests or, in a particularly well-studied population, consult a pedigree. 3. The key here is that if the tail feathers are a handicap, then by reducing the
Living in a group is associated with both costs and benefits. The primary cost handicap in these males should enhance their survival compared with males
y.
is increased competition for resources, while the primary benefit is protection from with naturally shorter tail feathers. The logic is simple. If the mail with long
predation. Altruism toward kin is considered selfish because helping individuals tail feathers is superior such that it can survive the negative effect of the long
closely related to you will directly affect your inclusive fitness. Most armies more tail feathers, then that superior phenotype should be exposed with the
closely resemble insect societies than vertebrate societies. Insect societies consist of removal or reduction of the tail feathers. Various aspects of performance
bl
multitudes of individuals congregated for the purpose of supporting and defend- could be measured since it is thought that the tail feathers hinder flying. Can
ing a select few individuals. One could think of these few protected and revered males with shorter tails fly faster? Can males with shorter tails turn better?
individuals as the society the army is charged with protecting. These insect societ- Ultimately, whether males with shorter tails survive better than males with
ies, like human armies, are composed of individuals each assigned to a particular un-manipulated tails can be measured.
ee
task. Most vertebrate societies, on the other hand, are less altruistic and express 4. Both reciprocity and kin selection explain the evolution of altruistic acts by
increased competition and aggression between group members. In short, vertebrate examining the hidden benefits of the behavior. In both cases, altruism actually
societies are comprised of individuals whose primary concern is usually their own benefits the individual performing the act in terms of its fitness effects. If it
fitness, while insect societies are comprised of individuals whose primary concern is didnt, it would be very hard to explain how such behavior could be
the colony itself. maintained because actions that reduce the fitness of an individual should be
.w
selected against. Definition of the behavior reflects the apparent paradox of
INQUIRY QUESTIONS the behavior because it focuses on the cost and not the benefit that also
Page 1135 Selection for learning ability would cease, and thus change from one accrues to the actor.
generation to the next in maze learning ability; would only result from random
genetic drift. cs SYNTHESIZE
Page 1136 Normal fosB alleles produce a protein that in turn affects enzymes 1. The best experiment for determining whether predatory avoidance of certain
that affect the brain. Ultimately, these enzymes trigger maternal behavior. In the coloration patterns would involve rearing a predator without an opportunity
absence of the enzymes, normal maternal behavior does not occur. to learn avoidance and subsequently presenting the predator with prey with
Page 1140 Peter Marlers experiments addressed this question and determined different patterns. If the predator avoids the black and yellow coloration
si
Apago PDF Enhancer
that both instinct and learning are instrumental in song development in birds. more frequently than expected then the avoidance is most likely innate. If the
predator does not express any preference but upon injury from a prey with
Page 1148 Many factors affect the behavior of an animal other than its at- the specific coloration does begin to express a preference, then the avoidance
tempts to maximize energy intake. For example, avoiding predation is also impor-
hy
is most likely learned. In this case, the learning would be operant condition-
tant. Thus, it may be that larger prey take longer to subdue and ingest, thus making ing; the predator has learned to associate the coloration with pain and thus
the crabs more vulnerable to predators. Hence, the crabs may trade off decreased subsequently avoids prey with that coloration. To measure the adaptive
energy gain for decreased vulnerability for predators. Many other similar explana- significance of black and yellow coloration, both poisonous (or stinging) and
tions are possible. harmless prey species with the coloration and without the coloration pattern
Page 1150 A question that is the subject of much current research. Ideas could be presented to predators; if predators avoid both the harmful and the
p
include the possibility that males with longer tails are in better condition (because harmless prey, the coloration is evolutionary significant.
males in poor condition couldnt survive the disadvantage imposed by the tail). The 2. In many cases the organisms in question are unavailable for or unrealistic
ar
advantage to a female mating with a male in better condition might be either that to study in a laboratory setting. Model organisms allow behavioral geneticists
the male is less likely to be parasitized, and thus less likely to pass that parasite on to overcome this obstacle by determining general patterns and then applying
to the female, or the male may have better genes, which in turn would be passed on these patterns and findings to other, similar organisms. The primary
to the offspring. Another possibility is the visual system for some reason is better disadvantage of the model system is, of course, the vast differences that are
sw
able to detect males with long tails, and thus long-tailed males are preferred by usually found between groups of taxa; however, when applying general
females simply because the longer tails are more easily detected and responded to. principles, in particular those of genetic behavioral regulation, the benefits of
Page 1151 Yes, the larger the male, the larger the prenuptial gift, which provides using a model outweigh the costs. Phylogenetic analysis is the best way to
energy that the female converts into egg production. determine the scale of applicability when using model organisms.
Page 1158 If more birds are present, then each one can spend less time watch- 3. Extra-pair copulations and mating with males that are outside a females
ing for predators, and thus have more time for foraging. territory are, by and large, more beneficial than costly to the female. By
.a
mating with males outside her territory, she reduces the likelihood that a
U N D E R S TA N D male challenging the owner of her territory would target her offspring; males
1. b 2. a 3. a 4. c 5. a 6. c 7. d 8. a 9. b 10. a of many species are infanticidal but would not likely attack infants that could
be their own. Historical data have actually shown that in many cases, females
w
11. c 12. d
are more attracted to infanticidal males if those males win territory prior to
A P P LY their infanticidal behavior.
1. Presumably, the model is basic, taking into account only size and energetic
w
value of mussels. However, it may be that larger mussels are in places where
shore crabs would be exposed to higher levels of predation or greater
CHAPTER 56
physiological stress. Similarly, it could be that the model underestimated time LEARNING OUTCOME QUESTIONS
w
A-30 appendix A
m
56.3 It depends upon the initial sizes of the populations in question; a small
population with a high survivorship rate will not necessarily grow faster than a Page 1177 If hare population levels were kept high, then we would expect lynx
large population with a lower survivorship rate. populations to stay high as well because lynx populations respond to food avail-
56.4 A species with high levels of predation would likely exhibit an earlier age ability. If lynx populations were maintained at a high level, we would expect hare
co
at first reproduction and shorter inter-birth intervals in order to maximize its populations to remain low because increased reproduction of hares would lead to
fitness under the selective pressure of the predation. On the other hand, species increased food for the lynxes.
with few predators have the luxury of waiting until they are more mature before Page 1179 If human populations are regulated by density-dependent fac-
reproducing and can increase the inter-birth interval (and thus invest more in each tors, then as the population approaches the carrying capacity, either birthrates
offspring) because their risk of early mortality is decreased. will decrease or death rates will increase, or both. If populations are regulated by
y.
56.5 Many different factors might affect the carrying capacity of a population. density-independent factors, then if environmental conditions change, then either
For example, climate changes, even on a relatively small scale, could have large both rates will decline, death rates will increase, or both.
effects on carrying capacity by altering the available water and vegetation, as well as Page 1179 The answer depends on whether age-specific birth and death rates
bl
the phenology and distribution of the vegetation. Regardless of the type of change stay unchanged. If they do, then the Swedish distribution would remain about the
in the environment, however, most populations will move toward carrying capacity; same. By contrast, because birthrates are far outstripping death rates, the Kenyan
thus, if the carrying capacity is lowered, the population should decrease, and if the distribution will become increasingly unbalanced as the bulge of young individuals
carrying capacity is raised, the population should increase. enter their reproductive years and start producing even more offspring.
ee
56.6 A given population can experience both positive and negative density-de- Page 1181 Both are important causes and the relative importance of the two
pendent effects, but not at the same time. Negative density-dependent effects, such depends on which resource we are discussing. One thing is clear: The world can-
as low food availability or high predation pressure, would decrease the population not support its current population size if everyone lived at the level of resource
size. On the other hand, positive density-dependent effects, such as is seen with the consumption of people in the United States.
Allee effect, results in a rapid increase in population size. Since a population cannot
.w
both increase and decrease at the same time, the two cannot occur concurrently. U N D E R S TA N D
However, the selective pressures on a population are on a positive-negative con- 1. b 2. c 3. a 4. b 5. d 6. b 7. c
tinuum, and the forces shaping population size can not only vary in intensity but
can also change direction from negative to positive or positive to negative. A P P LY
56.7 The two are closely tied together, and both are extremely important if the 1. d 2. c 3. b 4. c
human population is not to exceed the Earths carrying capacity. As population
cs
growth increases, the human population approaches the planets carrying capacity;
as consumption increases, the carrying capacity is loweredthus, both trends must
be reversed.
SYNTHESIZE
1. The genetic makeup of isolated populations will change over time based on
the basic mechanisms of evolutionary change; for example, natural selection,
si
INQUIRY QUESTIONS Apago PDF Enhancer mutation, assortative mating, and drift. These same processes affect the
genetic makeup of populations in a metapopulation, but the outcomes are
Page 1164 Very possibly. How fast a lizard runs is a function of its body likely to be much more complicated. For example, if immigration between a
temperature. Researchers have shown that lizards in shaded habitats have lower source and a sink population is very high, then local selection in a sink
hy
temperatures and thus lower maximal running speeds. In such circumstances, population may be swamped by the regular flow of individuals carrying alleles
lizards often adopt alternative escape tactics that rely less on rapidly running away of lower fitness from a source population where natural selection may not be
from potential predators. acting against those alleles; divergence might be slowed or even stopped
Page 1169 Because of their shorter generation times, smaller species tend under some circumstances. On the other hand, if sinks go through repeated
population declines such that they often are made up of a very small number
p
to reproduce more quickly, and thus would be able to respond more quickly to
increased resources in the environment. of individuals, then they may lose considerable genetic diversity due to drift.
If immigration from source populations is greater than zero but not large,
Page 1171 Based on the survivorship curve of meadow grass, the older the
ar
which only a few individuals manage to survive to an older age, would suggest the
selection of a middle-aged plant that had survived the early stages of life since it 2. The probability that an animal lives to the next year should decline with age
would also be more likely to survive to old age. (Note that in Figure 55.11, all the curves decrease with age) so the cost of
reproduction for an old animal would, all else being equal, be lower than for a
Page 1172 It depends on the situation. If only large individuals are likely to
young animal. The reason is that the cost of reproduction is measured by
reproduce (as is the case in some territorial species, in which only large males can
changes in fitness. Imagine a very old animal that has almost no chance in
hold a territory), then a few large offspring would be favored; alternatively, if body
.a
Page 1174 Because when the population is below carrying capacity, the popula-
so, it would be maximizing its fitness by increasing the number of related
tion increases in size. As it approaches the carrying capacity, growth rate slows
individuals in the next generation.
down either from increased death rates, decreased birthrates, or both, becoming
zero as the population hits the carrying capacity. Similarly, populations well above 4. By increasing the mean generation time (increasing the age at which an
w
the carrying capacity will experience large decreases in growth rate, resulting either individual can begin reproducing; age at first reproduction), keeping all else
from low birthrates or high death rates, that also approach zero as the population equal, one would expect that the population growth rate would be reduced.
hits the carrying capacity. That comes simply from the fact of reducing the number of individuals that
are producing offspring in the adult age classes; lower population birth rates
w
Page 1175 There are many possible reasons. Perhaps resources become limited,
would lead to a reduced population growth rate. As to which would have a
so that females are not able to produce as many offspring. Another possibility is
larger influence, that is hard to say. If the change in generation time
that space is limited so that, at higher populations, individuals spend more time in
(increased age at first reproduction) had an overall larger effect on the total
interactions with other individuals and squander energy that otherwise could be
number of offspring an individual female had than a reduced fecundity at any
invested in producing and raising more young.
age, then population growth rate would probably be more sensitive to the
appendix A A-31
m
for those prey populations to rebound once the predator pressure is removed.
CHAPTER 57 3. Although the mechanism might be known in this system, hidden interactions
LEARNING OUTCOME QUESTIONS might affect interpretations in many ways because ecological systems are
co
complex. For example, what if some other activity of the rodents besides their
57.1 The answer depends upon the habitat of the community in question. Some
reduction of large seeds leading to an increase in the number of small seeds
habitats are more hospitable to animals, and others to plants. The abundance of
was responsible for the positive effect of rodents on ants? One way to test the
plants and animals in most habitats is also closely tied; thus the variation in abun-
specific mechanism would be to increase the abundance of small seeds
dance of one would affect the variation in abundance of the other.
experimentally independent of any manipulation of rodents. Under the
y.
57.2 It depends upon whether we are talking about fundamental niche or current hypothesis, an increase in ant population size would be expected and
realized niche. Two species can certainly have identical fundamental niches and should be sustained, unlike the initial increase followed by a decrease seen
coexist indefinitely, because they could develop different realized niches within the when rodents are removed.
fundamental niche. In order for two species with identical realized niches to coexist
4. By itself, the pattern shown in Figure 56.7 suggests character displacement,
bl
indefinitely, the resources within the niche must not be limited.
but alternative hypotheses are possible. For example, what if the distribution
57.3 This is an example of Batesian mimicry, in which a non-poisonous species of seeds available on the two islands where the species are found alone is
evolves coloration similar to a poisonous species. different from that seen where they are found in sympatry? If there were no
large and small seeds seen on Los Hermanos or Daphne, just medium-sized
ee
57.4 In an ecosystem with limited resources and multiple prey species, one prey
species could out-compete another to extinction in the absence of a predator. In ones, then it would be hard to conclude that the bill size on San Cristobal has
the presence of the predator, however, the prey species that would have otherwise diverged relative to the other islands just due to competition. This is a
be driven to extinction by competitive exclusion is able to persist in the community. general criticism of inferring the process of character displacement with just
The predators that lower the likelihood of competitive exclusion are known as comparing the size distributions in allopatry and sympatry. In this case,
keystone predators. however, the Galpagos system has been very well studied. It has been
.w
established that the size distribution of seeds available is not measurably
57.5 Selective harvesting of individual trees would be preferable from a commu-
different. Furthermore, natural selection-induced changes seen in the bill size
nity point of view. According to the Intermediate Disturbance Hypothesis, moder-
of birds on a single island, in response to drought-induced changes in seed
ate degrees of disturbance, as in selective harvesting, increase species richness and
size lend further support to the role of competition in establishing and
biodiversity more than severe disturbances, such as clear-cutting.
maintaining these patterns.
INQUIRY QUESTIONS
Page 1187
cs
The different soil types require very different adaptations, and thus
different species are adapted to each soil type.
5. It is possible, as the definition of an ecosystem depends upon scale. In some
ecosystems, there may be other, smaller ecosystems operating within it. For
example, within a rainforest ecosystem, there are small aquatic ecosystems,
ecosystems within the soil, ecosystems upon an individual tree. Research seems
si
Apago PDF Enhancer
Page 1191 The kangaroo rats competed with all the other rodent species for
resources, keeping the size of other rodent populations smaller. In the absence of
to indicate that most species behave individualistically, but there are some
instances where groups of species do depend upon one another and do function
competition when the kangaroo rats were removed, there were more resources holistically. We would expect this kind of dual community structure especially
available which allowed the other rodent populations to increase in size. in areas of overlap between distinct ecosystems, where ecotones exist.
hy
Page 1192 This could be accomplished in a variety of ways. One option would
be to provide refuges to give some Paramecium a way of escaping the predators.
Another option would be to include predators of the Didinium, which would limit CHAPTER 58
their populations (see Ecosystem chapter).
LEARNING OUTCOME QUESTIONS
p
Page 1201 By removing the kangaroo rats from the experimental enclosures
58.1 Yes, fertilization with natural materials such as manure is less disruptive to
and measuring the effects on both plants and ants. At first, the number of small
the ecosystem than is chemical fertilization. Many chemical fertilizers, for example,
seeds available to ants increases due to the absence of rodents. However, over time,
contain higher levels of phosphates than does manure and thus chemical fertiliza-
ar
plants that produce large seeds outcompete plants that produce small seeds, and
tion has disrupted the natural global phosphorus cycle.
thus fewer small seeds are produced and available to ants; hence, ant populations
decline. 58.2 Both matter and energy flow through ecosystems by changing form, but
neither can be created or destroyed. Both matter and energy also flow through
sw
U N D E R S TA N D the trophic levels within an ecosystem. The flow of matter such as carbon atoms is
more complex and multi-leveled than is energy flow, largely because it is truly a cy-
1. a 2. a 3. d 4. a 5. b 6. d 7. c 8. c
cle. The atoms in the carbon cycle truly cycle through the ecosystem, with no clear
A P P LY beginning or end. The carbon is changed during the process of cycling from a solid
to a gaseous state and back again. On the other hand, energy flow is unidirectional.
1. d 2. b 3. d 4. d 5. d The ultimate source of the energy in an ecosystem is the sun. The solar energy is
.a
captured by the primary producers at the first trophic level and is changed in form
SYNTHESIZE from solar to chemical energy. The chemical energy is transferred from one trophic
1. Experiments are useful means to test hypotheses about ecological limitations, level to another, until only heat, low quality energy, remains.
but they are generally limited to rapidly reproducing species that occur in
58.3 Yes, there are certainly situations in ecosystems in which the top preda-
w
growth or reproductive rate. Another means of assessing interspecific 58.4 It depends on whether the amount of sunlight captured by the primary pro-
interactions is to study one species in different areas, in only some of which a ducers was affected. Currently, only approximately 1% of the solar energy in Earths
second species occurs. Such studies must be interpreted cautiously, however, atmosphere is captured by primary producers for photosynthesis. If less sunlight
reached Earths surface, but a correlating increase in energy capture accompanied the
w
because there may be many important differences between the areas in addition
to the difference in the presence or absence of the second species. decrease in sunlight, then the primary productivity should not be affected.
2. Adding differentially preferred prey species might have the same effect as 58.5 The equilibrium model of island biogeography describes the relationship
putting in a refuge for prey in the single species system. One way to think between species richness and not only island size but also distance from the main-
about it is that if a highly preferred species becomes rare due to removal by land. A small island closer to the mainland would be expected to have more species
the predator, then a predator might switch to a less desirable species, even if it than would a larger island that is farther from the mainland.
A-32 appendix A
m
Page 1219 In the inverted pyramid, the primary producers reproduce quickly relationship, we would need to conduct experiments to test specific
and are eaten quickly, so that at any given time, a small population of primary hypotheses. For example, if we hypothesize that some species that require
producers exist relative to the heterotroph population. greater structural complexity in order to persist in a particular habitat, we
could modify the habitat (reduce plant structure) and test whether species
co
Page 1220 Because the trout eat the invertebrates which graze the algae. With
fewer grazers, there is more algae. originally present were reduced in numbers or became unable to persist.
Page 1220 The snakes might reduce the number of fish, which would allow
an increase in damselflies, which would reduce the number of chironomids and
increase the algae. In other words, lower levels of the food chain would be identical
CHAPTER 59
y.
for the snake and fish and no fish and no snake treatments. Both would differ LEARNING OUTCOME QUESTIONS
from the enclosures with only fish.
59.1 If the Earth rotated in the opposite direction, the Coriolis Effect would be
Page 1222 Herbivores consume much of the algal biomass even as primary reversed. In other words, winds descending between 30 north or 30 south and the
productivity increases. Increases in primary productivity can lead to increased her- equator would still be moving more slowly than the underlying surface so it would
bl
bivore populations. The additional herbivores crop the biomass of the algae even be deflected; however, they would be deflected to the left in the northern hemi-
while primary productivity increases. sphere and to the right in the southern hemisphere. The pattern would be reversed
Page 1222 More light means more photosynthesis. More plant material means between 30 and 60 because the winds would be moving more rapidly than the un-
ee
more herbivores, which translates into more predator biomass. derlying surface, and would thus be deflected again in the opposite directions from
normalto the left in the northern hemisphere and to the right in the southern
Page 1223 Introduce them yourself. For example, each spring, you could place a
hemisphere. All of this would result in Trade Winds that blew from west to east and
premeasured number of seeds of a particular invasive species in each plot. Such an
Westerlies that were actually Easterlies, blowing east to west.
experiment would have the advantage of more precisely controlling the opportu-
nity for invasion, but also would be less natural, which is one of the advantages of 59.2 As with elevation, latitude is a primary determinant of climate and precipi-
.w
the Cedar Creek study site: the plots are real ecosystems, interacting with their tation, which together largely determine the vegetational structure of a particular
surrounding environment in natural ways. area, which in turn defines biomes.
Page 1224 (a) Perhaps because an intermediate number of predators is enough 59.3 The spring and fall overturns that occur in freshwater lakes found in
to keep numbers of superior competitors down. (b) Perhaps because there are more temperate climates result in the oxygen-poor water near the bottom of the lake
habitats available and thus more different ways of surviving in the environment. (c) getting re-mixed with the oxygen-rich water near the top of the lake, essentially
U N D E R S TA N D
cs
Hard to say. Possibly more stable environments permit greater specialization, thus eliminating, at least temporarily, the thermocline layer. In the tropics, there is less
temperature fluctuation; thus the thermocline layer is more permanent and the
oxygen depletion (and resulting paucity of animal life) is sustained.
59.4 Regions affected by the ENSO, or El Nio Southern Oscillation events,
si
1. d 2. d 3. b 4. a 5. a 6. b 7. a 8. a 9. c Apago PDF Enhancer
experience cyclical warming events in the waters around the coastline. The warmed
water lowers the primary productivity, which stresses and subsequently decreases
A P P LY the populations of fish, seabirds, and sea mammals.
hy
energy (about 90%) as energy is transferred to each higher level, it would However, while climate change and ozone depletion are both global environmental
be reasonable to expect that the ectotherm-dominated food chains would be concerns due to the impact each has on human health, the environment, economics,
longer than the endotherm-dominated chains. In fact, there is some indirect and politics, there are some different approaches to combating and understanding
ar
evidence for this from real food chains, and it is also predicted by some each dilemma. Ozone depletion results in an increase in the ultraviolet radiation
advanced ecological models. However, whether in reality such is the case, is reaching the earths surface. Global climate change, on the other hand, results in
difficult to determine due to all of the complex factors that determine food long-term changes in sea level, ice flow, and storm activity.
chain length and structure. Moreover, there are many practical difficulties
sw
associated with measuring actual food chain length in natural systems. INQUIRY QUESTIONS
2. It is critical to distinguish, as this chapter points out, between energy and Page 1232 Because of the tilt of the Earths axis and the spherical shape of the
mass transfer in trophic dynamics of ecosystems. The standing biomass of planet, the light (and heat) from the sun hits the equator and nearby latitudes more
phytoplankton is not necessarily a reliable measure of the energy contained directly than it does at the poles.
in the trophic level. If phytoplankton are eaten as quickly as they are Page 1236 Increased precipitation and temperature allows for the sustainability
produced, they may contribute a tremendous amount of energy, which can
.a
translates into the reality that effects on any particular species are unlikely to
be limited to that species itself. less incident solar radiation per unit surface area (because the angle of
incidence is oblique). The northern and southern hemispheres alternate
4. There are many ways to answer this question, but the obvious place to start is between angling towards vs. away from the Sun on the Earths annual orbit.
to think about the many ways plant structural diversity potentially affects These two facts mean that the annual mean temperature will decline as you
animals that are not eating the plants directly. For example, plants may move away from the equator, and that variation in the mean temperatures of
provide shelter, refuges, food for prey, substrate for nesting, among other
appendix A A-33
m
warmed air picks up moisture and rises. As it rises, equatorial air, now 1. d 2. d 3. a 4. d
saturated with moisture, cools and releases rain, the air falling back to Earths
surface displaced north and south to approximately 30. The air, warming as SYNTHESIZE
it descends, absorbs moisture from the land and vegetation below, resulting in
1. Although it is true that extinction is a natural part of the existence of a
co
desiccation in the latitudes around 30.
species, several pieces of evidence suggest that current rates of extinction are
3. Even though there have been global climate changes in the past, conservation much elevated over the natural background level and the disappearance is
biologists are concerned about the current warming trend for two reasons. associated with human activities (which many of the most pronounced
First, the warming rate is rapid, thus the selective pressures on the most extinction events in the history of the Earth were not). It is important to
vulnerable organisms may be too strong for the species to adapt. Second, the appreciate the length of time over which the estimate of 99% is made. The
y.
natural areas that covered most of the globe during past climatic changes are history of life on Earth extends back billions of years. Certainly, clear patterns
now in much more limited, restricted areas, thus greatly impeding the ability of the emergence and extinction of species in the fossil record extend back
of organisms to migrate to more suitable habitats. many hundreds of millions of years. Since the average time of species
existence is short relative to the great expanse of time over which we can
bl
4. Two characteristics can lead to a phenomenon known as biological magnifica-
tion. First, if a pesticide actually persists in the bodies of target species (that is, estimate the percentage of species that have disappeared, the perception
it doesnt degrade after having its effect), then depending on its chemical might be that extinction rates have always been high, when in fact the high
composition, it might actually be sequestered in the bodies of animals that eat number is driven by the great expanse of time of measurement. We have very
ee
the target species. Because large numbers of prey are consumed at each trophic good evidence that modern extinction rates (over human history) are
level (due to the 10% rate of transfer of energy), large amounts of the pesticide considerably elevated above background levels. Furthermore, the circum-
may be passed up the food chain. So, persistence and magnification can lead to stances of the extinctions may be very different because they are also
toxic exposures at the top of food chains. associated with habitat and resource removal; thus potentially limiting the
natural processes that replace extinct species.
.w
2. The problem is not unique and not new. It represents a classic conflict that is
CHAPTER 60 the basic source of societal laws and regulations, especially in the manage-
LEARNING OUTCOME QUESTIONS ment of resources. For example, whether or not to place air pollution
scrubbers on the smoke stacks of coal-fired power plants is precisely the same
60.1 Unfortunately, most of the Earths biodiversity hotspots are also areas of the issue. In this case, it is not ecosystem conversion, per se, but the fact that the
greatest human population growth; human population growth is accompanied by
increased resource utilization and exploitation.
60.2 I would tell the shrimp farmers that if they were to shut down the shrimp
farm and remediate the natural mangrove swamp on which their property sits,
cs businesses that run the power plants benefit from their operation, but the
public owns and relies on the atmosphere is a conflict between public and
private interests. Some of the ways to navigate the dilemma is for society to
create regulations to protect the public interest. The problem is difficult and
other, more economically lucrative businesses could be developed, such as timber, clearly does not depend solely on economic valuation of the costs and
si
charcoal production, and offshore fishing. Apago PDF Enhancer benefits because there can be considerable debate about those estimates. One
only has to look at the global climate change problem to suggest how hard it
60.3 Absolutely. The hope of conservation biologists is that even if a species is
endangered to the brink of extinction due to habitat degradation, the habitat may will be to make progress in an expedient manner.
hy
someday be restored. The endangered species can be bred in captivity (which also 3. This is not a trivial undertaking, which is why, since the first concerns were
allows for the maintenance of genetic diversity within the species) and either re- raised in the late 1980s, it has taken nearly 15 years to collect evidence
introduced to a restored habitat, or even introduced to another suitable habitat. showing a decline is likely. Although progress has been made on identifying
60.4 It depends upon the reason for the degradation of the habitat in the first potential causes, much work remains to be done. Many amphibians are
place, but yes, in some cases, habitat restoration can approach a pristine state. secretive, relatively long-lived, and subject to extreme population fluctua-
p
For example, the Nashau River in New England was heavily polluted, but habitat tions. Given those facts about their biology, documenting population
restoration efforts returned it to a relatively pristine state. However, because fluctuations (conducting censuses of the number of individuals in popula-
habitat degradation affects so many species within the ecosystem, and the depth tions) for long periods of time is the only way to ultimately establish the
ar
and complexity of the trophic relationships within the ecosystem are difficult if not likely fate of populations, and that process is time-consuming and costly.
impossible to fully understand, restoration is rarely if ever truly pristine. 4. Within an ecosystem, every species is dependent upon and depended upon by
any number of other species. Even the smallest organisms, bacteria, are often
INQUIRY QUESTIONS specific about the species they feed upon, live within, parasitize, etc. So, the
sw
Page 1260 Many factors affect human population trends, including resource extinction of a single species anywhere in the ecosystem will affect not only
availability, governmental support for settlement in new areas or for protecting the organisms it directly feeds upon and that directly feed upon it, but also
natural areas, and the extent to which governments attempt to manage population those related more distantly. In the simplest terms, if, for example, a species
growth. of rodent goes extinct, the insects and vegetation upon which it feeds would
no longer be under the same predation pressure and thus could grow out of
Page 1262 The mangroves provide many economic services. For example, with-
control, outcompeting other species and leading to their demise. In addition,
.a
out them, fisheries become less productive and storm damage increases. However,
the predators of the rodent would have to find other prey, which would result
because the people who benefit from these services do not own the mangroves,
in competition with those species predators. And so on, and so on. The
governmental action is needed to ensure that the value of what are economists call
affects could be catastrophic to the entire ecosystem. By looking at the
common goods is protected.
trophic chains in which a particular organism is involved, one could predict
w
Page 1266 On smaller islands, populations tend to be smaller. As we discuss the affects its extinction would have on other species.
later in this chapter, small populations are vulnerable to many problems, which
5. Population size is not necessarily a direct cause of extinction, but it certainly
individually or in concert can heighten the risk of extinction.
is an indirect cause. Smaller populations have a number of problems that
w
Page 1269 As discussed in this chapter, populations that are small face many themselves can lead directly to extinction, such as loss of diversity (and thus
problems that can reinforce one another and eventually cause extinction. increased susceptibility to pathogens) and greater vulnerability to natural
Page 1274 As we discussed in chapter 21, allele frequencies change randomly catastrophes.
w
in a process called genetic drift. The smaller the population size, the greater these
random fluctuations will be. Thus, small populations are particularly prone to one
allele being lost from a population due to these random changes.
A-34 appendix A
m
co
active transport The pumping of individual ions allantois A membrane of the amniotic egg that
A or other molecules across a cellular membrane functions in respiration and excretion in birds
ABO blood group A set of four phenotypes from a region of lower concentration to and reptiles and plays an important role in the
produced by different combinations of three one of higher concentration (i.e., against a development of the placenta in most mammals.
alleles at a single locus; blood types are A, B, AB, concentration gradient); this transport process allele One of two or more alternative states of a gene.
y.
and O, depending on which alleles are expressed requires energy, which is typically supplied by allele frequency A measure of the occurrence
as antigens on the red blood cell surface. the expenditure of ATP. of an allele in a population, expressed as
abscission In vascular plants, the dropping of adaptation A peculiarity of structure, physiology, proportion of the entire population, for
bl
leaves, flowers, fruits, or stems at the end of the or behavior that promotes the likelihood of example, an occurrence of 0.84 (84%).
growing season, as the result of the formation an organisms survival and reproduction in a allometric growth A pattern of growth in which
of a layer of specialized cells (the abscission particular environment. different components grow at different rates.
ee
zone) and the action of a hormone (ethylene). adapter protein Any of a class of proteins that acts allelopathy The release of a substance from the
absorption spectrum The relationship of as a link between a receptor and other proteins roots of one plant that block the germination
absorbance vs. wavelength for a pigment to initiate signal transduction. of nearby seeds or inhibits the growth of a
molecule. This indicates which wavelengths are adaptive radiation The evolution of several neighboring plant.
absorbed maximally by a pigment. For example, divergent forms from a primitive and allopatric speciation The differentiation of
.w
chlorophyll a absorbs most strongly in the violet- unspecialized ancestor. geographically isolated populations into
blue and red regions of the visible light spectrum. adenosine triphosphate (ATP) A nucleotide distinct species.
acceptor stem The 3 end of a tRNA molecule; consisting of adenine, ribose sugar, and three allopolyploid A polyploid organism that contains
the portion that amino acids become attached phosphate groups; ATP is the energy currency the genomes of two or more different species.
to during the tRNA charging reaction.
accessory pigment A secondary light-absorbing
pigment used in photosynthesis, including
chlorophyll b and the carotenoids, that
complement the absorption spectrum of
cs
of cellular metabolism in all organisms.
adherins junction An anchoring junction that
connects the actin filaments of one cell with those
of adjacent cells or with the extracellular matrix.
ATP synthase The enzyme responsible for
allosteric activator A substance that binds to an
enzymes allosteric site and keeps the enzyme
in its active configuration.
allosteric inhibitor A noncompetitive inhibitor
that binds to an enzymes allosteric site and
si
chlorophyll a. Apago PDF Enhancer
producing ATP in oxidative phosphorylation; prevents the enzyme from changing to its
aceolomate An animal, such as a flatworm, having it uses the energy from a proton gradient to active configuration.
a body plan that has no body cavity; the space catalyze the reaction ADP + Pi ATP. allosteric site A part of an enzyme, away from its
hy
between mesoderm and endoderm is filled with adenylyl cyclase An enzyme that produces large active site, that serves as an on/off switch for
cells and organic materials. amounts of cAMP from ATP; the cAMP acts the function of the enzyme.
acetyl-CoA The product of the transition reaction as a second messenger in a target cell. alpha () helix A form of secondary structure
between glycolysis and the Krebs cycle. adhesion The tendency of water to cling to other in proteins where the polypeptide chain
Pyruvate is oxidized to acetyl-CoA by NAD+, polar compounds due to hydrogen bonding. is wound into a spiral due to interactions
p
also producing CO2, and NADH. adipose cells Fat cells, found in loose connective between amino and carboxyl groups in the
achiasmate segregation The lining up and tissue, usually in large groups that form adipose peptide backbone.
ar
subsequent separation of homologues during tissue. Each adipose cell can store a droplet of alternation of generations A reproductive cycle
meiosis I without the formation of chiasmata fat (triacylglyceride). in which a haploid (n) phase (the gametophyte),
between homologues; found in Drosophila males adventitious Referring to a structure arising from gives rise to gametes, which, after fusion to
and some other species. an unusual place, such as stems from roots or form a zygote, germinate to produce a diploid
sw
acid Any substance that dissociates in water to roots from stems. (2n) phase (the sporophyte). Spores produced
increase the hydrogen ion (H+) concentration aerenchyma In plants, loose parenchymal tissue by meiotic division from the sporophyte give
and thus lower the pH. with large air spaces in it; often found in plants rise to new gametophytes, completing the cycle.
actin One of the two major proteins that make up that grow in water. alternative splicing In eukaryotes, the production
vertebrate muscle; the other is myosin. aerobic Requiring free oxygen; any biological of different mRNAs from a single primary
.a
action potential A transient, all-or-none reversal process that can occur in the presence of transcript by including different sets of exons.
of the electric potential across a membrane; gaseous oxygen. altruism Self-sacrifice for the benefit of others;
in neurons, an action potential initiates aerobic respiration The process that results in the in formal terms, the behavior that increases
transmission of a nerve impulse. complete oxidation of glucose using oxygen as the fitness of the recipient while reducing the
w
action spectrum A measure of the efficiency of the final electron acceptor. Oxygen acts as the fitness of the altruistic individual.
different wavelengths of light for photosynthesis. final electron acceptor for an electron transport alveolus, pl. alveoli One of many small, thin-
In plants it corresponds to the absorption chain that produces a proton gradient for the walled air sacs within the lungs in which
w
undergo a specific chemical reaction. -amylase that breaks down the carbohydrates of central carbon atom with a carboxyl group
active site The region of an enzyme surface to the endosperm to nourish the embryo. ( COOH), an amino group ( NH2), a
which a specific set of substrates binds, lowering alga, pl. algae A unicellular or simple multicellular hydrogen, and a side group (R group); only
the activation energy required for a particular photosynthetic organism lacking multicellular the side group differs from one amino acid
chemical reaction and so facilitating it. sex organs. to another.
G-1
m
obtained from a sample of the amniotic fluid or that can be detected using molecular techniques. immediately by meiosis; at maturity, an ascus
tests on the fluid itself. antenna complex A complex of hundreds of pigment contains ascospores.
amnion The innermost of the extraembryonic molecules in a photosystem that collects photons asexual reproduction The process by which an
membranes; the amnion forms a fluid-filled sac and feeds the light energy to a reaction center. individual inherits all of its chromosomes from
co
around the embryo in amniotic eggs. anther In angiosperm flowers, the pollen-bearing a single parent, thus being genetically identical
amniote A vertebrate that produces an egg portion of a stamen. to that parent; cell division is by mitosis only.
surrounded by four membranes, one of which antheridium, pl. antheridia A sperm-producing A site In a ribosome, the aminoacyl site, which
is the amnion; amniote groups are the reptiles, organ. binds to the tRNA carrying the next amino acid
y.
birds, and mammals. anthropoid Any member of the mammalian group to be added to a polypeptide chain.
amniotic egg An egg that is isolated and consisting of monkeys, apes, and humans. assembly The phase of a viruss reproductive cycle
protected from the environment by a more antibody A protein called immunoglobulin that during which the newly made components are
or less impervious shell during the period of is produced by lymphocytes in response to a assembled into viral particles.
bl
its development and that is completely self- foreign substance (antigen) and released into assortative mating A type of nonrandom mating
sufficient, requiring only oxygen. the bloodstream. in which phenotypically similar individuals
ampulla In echinoderms, a muscular sac at the base of anticodon The three-nucleotide sequence at mate more frequently.
ee
a tube foot that contracts to extend the tube foot. the end of a transfer RNA molecule that is aster In animal cell mitosis, a radial array of
amyloplast A plant organelle called a plastid that complementary to, and base-pairs with, an microtubules extending from the centrioles
specializes in storing starch. amino-acidspecifying codon in messenger RNA. toward the plasma membrane, possibly serving to
anabolism The biosynthetic or constructive part of antigen A foreign substance, usually a protein brace the centrioles for retraction of the spindle.
metabolism; those chemical reactions involved or polysaccharide, that stimulates an immune atom The smallest unit of an element that contains
.w
in biosynthesis. response. all the characteristics of that element. Atoms
anaerobic Any process that can occur without antiporter A carrier protein in a cells membrane are the building blocks of matter.
oxygen, such as anaerobic fermentation or H2S that transports two molecules in opposite atrial peptide Any of a group of small polypeptide
photosynthesis. directions across the membrane. hormones that may be useful in treatment
anaerobic respiration The use of electron
transport to generate a proton gradient for
chemiosmotic synthesis of ATP using a final
electron acceptor other than oxygen.
the anus.
cs
anus The terminal opening of the gut; the solid
residues of digestion are eliminated through
initiated by the separation of sister chromatids, point at the tip of the root or stem. it on to the thick-walled ventricle; in the ear,
during which the daughter chromosomes apoplast route In plant roots, the pathway for the tympanic cavity.
move to opposite poles of the cell; in meiosis I, movement of water and minerals that leads autonomic nervous system The involuntary
marked by separation of replicated homologous through cell walls and between cells. neurons and ganglia of the peripheral nervous
p
chromosomes. apoptosis A process of programmed cell death, in system of vertebrates; regulates the heart,
anaphase-promoting complex (APC) A protein which dying cells shrivel and shrink; used in all glands, visceral organs, and smooth muscle.
complex that triggers anaphase; it initiates a animal cell development to produce planned autopolyploid A polyploid organism that contains
ar
series of reactions that ultimately degrades and orderly elimination of cells not destined to a duplicated genome of the same species; may
cohesin, the protein complex that holds be present in the final tissue. result from a meiotic error.
the sister chromatids together. The sister aposematic coloration An ecological strategy autosome Any eukaryotic chromosome that is not
chromatids are then released and move toward of some organisms that advertise their a sex chromosome; autosomes are present in
sw
opposite poles in the cell. poisonous nature by the use of bright colors. the same number and kind in both males and
anchoring junction A type of cell junction that aquaporin A membrane channel that allows water females of the species.
mechanically attaches the cytoskeleton of a cell to cross the membrane more easily than by autotroph An organism able to build all the complex
to the cytoskeletons of adjacent cells or to the diffusion through the membrane. organic molecules that it requires as its own food
extracellular matrix. aquifers Permeable, saturated, underground source, using only simple inorganic compounds.
.a
androecium The floral whorl that comprises layers of rock, sand, and gravel, which serve as auxin (Gr. auxein, to increase) A plant hormone that
the stamens. reservoirs for groundwater. controls cell elongation, among other effects.
aneuploidy The condition in an organism whose archegonium, pl. archegonia The multicellular auxotroph A mutation, or the organism that
w
cells have lost or gained a chromosome; Down egg-producing organ in bryophytes and some carries it, that affects a biochemical pathway
syndrome, which results from an extra copy vascular plants. causing a nutritional requirement.
of human chromosome 21, is an example of archenteron The principal cavity of a vertebrate avirulent pathogen Any type of normally pathogenic
aneuploidy in humans. embryo in the gastrula stage; lined with organism or virus that utilizes host resources but
w
angiosperms The flowering plants, one of five endoderm, it opens up to the outside and does not cause extensive damage or death.
phyla of seed plants. In angiosperms, the represents the future digestive cavity. axil In plants, the angle between a leafs petiole and
ovules at the time of pollination are completely arteriole A smaller artery, leading from the arteries the stem to which it is attached.
w
enclosed by tissues. to the capillaries. axillary bud In plants, a bud found in the axil of a
animal pole In fish and other aquatic vertebrates artificial selection Change in the genetic structure of stem and leaf; an axillary bud may develop into
with asymmetrical yolk distribution in their populations due to selective breeding by humans. a new shoot or may become a flower.
eggs, the hemisphere of the blastula comprising Many domestic animal breeds and crop varieties axon A process extending out from a neuron that
cells relatively poor in yolk. have been produced through artificial selection. conducts impulses away from the cell body.
G-2 glossary
m
with more than one X chromosome, that is are reproductively isolated from other groups. C4 photosynthesis A process of CO2 fixation in
a condensed and inactivated X. Only one biomass The total mass of all the living organisms photosynthesis by which the first product is the
X remains active in each cell after early in a given population, area, or other unit being 4-carbon oxaloacetate molecule.
embryogenesis. measured. cadherin One of a large group of transmembrane
co
basal body A self-reproducing, cylindrical, biome One of the major terrestrial ecosystems, proteins that contain a Ca2+-mediated binding
cytoplasmic organelle composed of nine characterized by climatic and soil conditions; between cells; these proteins are responsible
triplets of microtubules from which the flagella the largest ecological unit. for cell-to-cell adhesion between cells of the
or cilia arise. bipolar cell A specialized type of neuron same type.
y.
base Any substance that dissociates in water to connecting cone cells to ganglion cells in callus Undifferentiated tissue; a term used in tissue
absorb and therefore decrease the hydrogen ion the visual system. Bipolar cells receive a culture, grafting, and wound healing.
(H+) concentration and thus raise the pH. hyperpolarized stimulus from the cone cell and Calvin cycle The dark reactions of C3 photo-
base-pair A complementary pair of nucleotide then transmit a depolarization stimulus to the synthesis; also called the CalvinBenson cycle.
bl
bases, consisting of a purine and a pyrimidine. ganglion cell. calyx The sepals collectively; the outermost flower
basidium, pl. basidia A specialized reproductive biramous Two-branched; describes the appendages whorl.
cell of the basidiomycetes, often club-shaped, in of crustaceans. CAM plant Plants that use C4 carbon fixation at
ee
which nuclear fusion and meiosis occur. blade The broad, expanded part of a leaf; also night, then use the stored malate to generate
basophil A leukocyte containing granules that called the lamina. CO2 during the day to minimize dessication.
rupture and release chemicals that enhance the blastocoel The central cavity of the blastula stage Cambrian explosion The huge increase in animal
inflammatory response. Important in causing of vertebrate embryos. diversity that occurred at the beginning of the
allergic responses. blastodisc In the development of birds, a disclike Cambrian period.
.w
Batesian mimicry A survival strategy in which area on the surface of a large, yolky egg that cAMP response protein (CRP) See catabolite
a palatable or nontoxic organism resembles undergoes cleavage and gives rise to the embryo. activator protein (CAP)
another kind of organism that is distasteful or blastomere One of the cells of a blastula. cancer The unrestrained growth and division of cells;
toxic. Both species exhibit warning coloration. blastopore In vertebrate development, the it results from a failure of cell division control.
B cell A type of lymphocyte that, when confronted
with a suitable antigen, is capable of secreting a
specific antibody protein.
behavioral ecology The study of how natural
selection shapes behavior.
cs
opening that connects the archenteron cavity of
a gastrula stage embryo with the outside.
blastula In vertebrates, an early embryonic stage
consisting of a hollow, fluid-filled ball of cells
one layer thick; a vertebrate embryo after
capillary The smallest of the blood vessels; the
very thin walls of capillaries are permeable to
many molecules, and exchanges between blood
and the tissues occur across them; the vessels
that connect arteries with veins.
si
biennial A plant that normally requires two Apago PDF Enhancer
cleavage and before gastrulation. capsid The outermost protein covering of a virus.
growing seasons to complete its life cycle. Bohr effect The release of oxygen by hemoglobin capsule In bacteria, a gelatinous layer surrounding
Biennials flower in the second year of their lives. molecules in response to elevated ambient the cell wall.
hy
bilateral symmetry A single plane divides an levels of CO2. carapace (Fr. from Sp. carapacho, shell) Shieldlike
organism into two structural halves that are bottleneck effect A loss of genetic variability that plate covering the cephalothorax of decapod
mirror images of each other. occurs when a population is reduced drastically crustaceans; the dorsal part of the shell of a turtle.
bile salts A solution of organic salts that is secreted in size. carbohydrate An organic compound consisting
p
by the vertebrate liver and temporarily stored Bowmans capsule In the vertebrate kidney, the of a chain or ring of carbon atoms to which
in the gallbladder; emulsifies fats in the small bulbous unit of the nephron, which surrounds hydrogen and oxygen atoms are attached
intestine. the glomerulus. in a ratio of approximately 2:1; having the
ar
binary fission Asexual reproduction by division of -oxidation The oxygen-dependent reactions generalized formula (CH2O)n; carbohydrates
one cell or body into two equal or nearly equal where 2-carbon units of fatty acids are cleaved include sugars, starch, glycogen, and cellulose.
parts. and combined with CoA to produce acetyl-CoA, carbon fixation The conversion of CO2 into
binomial distribution The distribution of which then enters the Krebs cycle. This occurs organic compounds during photosynthesis;
sw
phenotypes seen among the progeny of a cross cyclically until the entire fatty acid is oxidized. the first stage of the dark reactions of
in which there are only two alternative alleles. sheet A form of secondary structure in proteins photosynthesis, in which carbon dioxide from
binomial name The scientific name of a species where the polypeptide folds back on itself the air is combined with ribulose
that consists of two parts, the genus name and one or more times to form a planar structure 1,5-bisphosphate.
the specific species name, for example, Apis stabilized by hydrogen bonding between amino carotenoid Any of a group of accessory pigments
.a
mellifera. and carboxyl groups in the peptide backbone. found in plants; in addition to absorbing light
biochemical pathway A sequence of chemical Also known as a -pleated sheet. energy, these pigments act as antioxidants,
reactions in which the product of one reaction book lung In some spiders, a unique respiratory scavenging potentially damaging free radicals.
becomes the substrate of the next reaction. The carpel A leaflike organ in angiosperms that
w
and other adaptations, in an area. trachea (windpipe) into either lung. and allows passage through the membrane.
bioenergetics The analysis of how energy powers bud An asexually produced outgrowth that carrying capacity The maximum population size
the activities of living systems. develops into a new individual. In plants, an that a habitat can support.
w
biofilm A complex bacterial community embryonic shoot, often protected by young cartilage A connective tissue in skeletons of
comprising different species; plaque on teeth is leaves; buds may give rise to branch shoots. vertebrates. Cartilage forms much of the
a biofilm. buffer A substance that resists changes in pH. It skeleton of embryos, very young vertebrates,
biogeography The study of the geographic releases hydrogen ions (H+) when a base is and some adult vertebrates, such as sharks and
distribution of species. added and absorbs H+ when an acid is added. their relatives.
glossary G-3
m
result in the breakdown of complex molecules sac found in plant cells that stores proteins, energetic electrons excited by light (in
into simpler compounds, often with the release pigments, and waste materials, and is involved chloroplasts) or extracted by oxidation in the
of energy. in water balance. Krebs cycle (in mitochondria) are used to drive
catabolite activator protein (CAP) A protein centriole A cytoplasmic organelle located outside the proton pumps, creating a proton concentration
co
that, when bound to cAMP, can bind to DNA nuclear membrane, identical in structure to a basal gradient; when protons subsequently flow
and activate transcription. The level of cAMP body; found in animal cells and in the flagellated back across the membrane, they pass through
is inversely related to the level of glucose, and cells of other groups; divides and organizes spindle channels that couple their movement to the
CAP/cAMP in E. coli activates the lac (lactose) fibers during mitosis and meiosis. synthesis of ATP.
y.
operon. Also called cAMP response protein (CRP). centromere A visible point of constriction on chiasma An X-shaped figure that can be seen in
catalysis The process by which chemical a chromosome that contains repeated DNA the light microscope during meiosis; evidence
subunits of larger organic molecules are held sequences that bind specific proteins. These of crossing over, where two chromatids have
and positioned by enzymes that stress their proteins make up the kinetochore to which exchanged parts; chiasmata move to the ends
bl
chemical bonds, leading to the disassembly of microtubules attach during cell division. of the chromosome arms as the homologues
the larger molecule into its subunits, often with cephalization The evolution of a head and brain separate.
the release of energy. area in the anterior end of animals; thought to chitin A tough, resistant, nitrogen-containing
ee
cation A positively charged ion. be a consequence of bilateral symmetry. polysaccharide that forms the cell walls of
cavitation In plants and animals, the blockage of a cerebellum The hindbrain region of the vertebrate certain fungi, the exoskeleton of arthropods,
vessel by an air bubble that breaks the cohesion brain that lies above the medulla (brainstem) and and the epidermal cuticle of other surface
of the solution in the vessel; in animals more behind the forebrain; it integrates information structures of certain other invertebrates.
often called embolism. about body position and motion, coordinates chlorophyll The primary type of light-absorbing
.w
CD4+ cell A subtype of helper T cell that is muscular activities, and maintains equilibrium. pigment in photosynthesis. Chlorophyll a
identified by the presence of the CD4 protein cerebral cortex The thin surface layer of neurons absorbs light in the violet-blue and the red
on its surface. This cell type is targeted by the and glial cells covering the cerebrum; well ranges of the visible light spectrum; chlorophyll
HIV virus that causes AIDS. developed only in mammals, and particularly b is an accessory pigment to chlorophyll a,
cecum In vertebrates, a blind pouch at the
beginning of the large intestine.
cell cycle The repeating sequence of growth
and division through which cells pass each
muscular activity.
cs
prominent in humans. The cerebral cortex is
the seat of conscious sensations and voluntary
This occurs before overt differentiation sensory input and coordinates motor responses. sponges; choanocytes line the body interior.
and can be a stepwise process. chaetae Bristles of chitin on each body segment that chorion The outer member of the double membrane
cell-mediated immunity Arm of the adaptive help anchor annelid worms during locomotion. that surrounds the embryo of reptiles, birds, and
immune system mediated by T cells, which channel protein (ion channel) A transmembrane mammals; in placental mammals, it contributes to
p
includes cytotoxic cells and cells that assist the protein with a hydrophilic interior that the structure of the placenta.
rest of the immune system. provides an aqueous channel allowing diffusion chorionic villi sampling A technique in which
cell plate The structure that forms at the equator of species that cannot cross the membrane. fetal cells are sampled from the chorion of the
ar
of the spindle during early telophase in the Usually allows passage of specific ions such as placenta rather than from the amniotic fluid;
dividing cells of plants and a few green algae. K+, Na+, or Ca2+ across the membrane. this less invasive technique can be used earlier
cell-surface marker A glycoprotein or glycolipid chaperone protein A class of enzymes that help in pregnancy than amniocentesis.
on the outer surface of a cells membrane that proteins fold into the correct configuration and chromatid One of the two daughter strands of
sw
acts as an identifier; different cell types carry can refold proteins that have been misfolded or a duplicated chromosome that is joined by a
different markers. denatured. single centromere.
cell-surface receptor A cell surface protein character displacement A process in which chromatin The complex of DNA and proteins of
that binds a signal molecule and converts the natural selection favors individuals in a species which eukaryotic chromosomes are composed;
extracellular signal into an intracellular one. that use resources not used by other species. chromatin is highly uncoiled and diffuse in
.a
cellular blastoderm In insect embryonic This results in evolutionary change leading to interphase nuclei, condensing to form the visible
development, the stage during which the nuclei species dissimilar in resource use. chromosomes in prophase.
of the syncitial blastoderm become separate character state In cladistics, one of two or more chromatin-remodeling complex A large protein
w
cells through membrane formation. distinguishable forms of a character, such as complex that has been found to modify histones
cellular respiration The metabolic harvesting of the presence or absence of teeth in amniote and DNA and that can change the structure of
energy by oxidation, ultimately dependent on vertebrates. chromatin, moving or transferring nucleosomes.
molecular oxygen; carried out by the Krebs charging reaction The reaction by which an chromosomal mutation Any mutation that affects
w
cycle and oxidative phosphorylation. aminoacyl-tRNA synthetase attaches a specific chromosome structure.
cellulose The chief constituent of the cell wall in amino acid to the correct tRNA using energy chromosome The vehicle by which hereditary
all green plants, some algae, and a few other from ATP. information is physically transmitted from
w
organisms; an insoluble complex carbohydrate chelicera, pl. chelicerae The first pair of one generation to the next; in a bacterium, the
formed of microfibrils of glucose molecules. appendages in horseshoe crabs, sea spiders, chromosome consists of a single naked circle
cell wall The rigid, outermost layer of the cells of and arachnidsthe chelicerates, a group of of DNA; in eukaryotes, each chromosome
plants, some protists, and most bacteria; the cell arthropods. Chelicerae usually take the form of consists of a single linear DNA molecule and
wall surrounds the plasma membrane. pincers or fangs. associated proteins.
G-4 glossary
m
circadian rhythm An endogenous cyclical rhythm codominance Describes a case in which two complete digestive system A digestive system
that oscillates on a daily (24-hour) basis. or more alleles of a gene are each dominant that has both a mouth and an anus, allowing
circulatory system A network of vessels in to other alleles but not to each other. The unidirectional flow of ingested food.
coelomate animals that carries fluids to and phenotype of a heterozygote for codominant compound eye An organ of sight in many
co
from different areas of the body. alleles exhibit characteristics of each of the arthropods composed of many independent
cisterna A small collecting vessel that pinches homozygous forms. For example, in human visual units called ommatidia.
off from the end of a Golgi body to form a blood types, a cross between an AA individual concentration gradient A difference in
transport vesicle that moves materials through and a BB individual yields AB individuals. concentration of a substance from one location
y.
the cytoplasm. codon The basic unit of the genetic code; a to another, often across a membrane.
cisternal space The inner region of a membrane- sequence of three adjacent nucleotides in DNA condensin A protein complex involved in
bounded structure. Usually used to describe or mRNA that codes for one amino acid. condensation of chromosomes during mitosis
the interior of the endoplasmic reticulum; also coelom In animals, a fluid-filled body cavity that and meiosis.
bl
called the lumen. develops entirely within the mesoderm. cone (1) In plants, the reproductive structure of
clade A taxonomic group composed of an ancestor coenzyme A nonprotein organic molecule such as a conifer. (2) In vertebrates, a type of light-
and all its descendents. NAD that plays an accessory role in enzyme- sensitive neuron in the retina concerned with
ee
cladistics A taxonomic technique used for creating catalyzed processes, often by acting as a donor the perception of color and with the most acute
hierarchies of organisms that represent true or acceptor of electrons. discrimination of detail.
phylogenetic relationship and descent. coevolution The simultaneous development of conidia An asexually produced fungal spore.
class A taxonomic category between phyla and adaptations in two or more populations, species, conjugation Temporary union of two unicellular
orders. A class contains one or more orders, and or other categories that interact so closely that organisms, during which genetic material is
.w
belongs to a particular phylum. each is a strong selective force on the other. transferred from one cell to the other; occurs in
classical conditioning The repeated presentation cofactor One or more nonprotein components bacteria, protists, and certain algae and fungi.
of a stimulus in association with a response that required by enzymes in order to function; consensus sequence In genome sequencing, the
causes the brain to form an association between many cofactors are metal ions, others are overall sequence that is consistent with the
the stimulus and the response, even if they have
never been associated before.
clathrin A protein located just inside the plasma
membrane in eukaryotic cells, in indentations
called clathrin-coated pits.
cs
organic coenzymes.
cohesin A protein complex that holds sister
chromatids together during cell division. The
loss of cohesins at the centromere allow the
anaphase movement of chromosomes.
sequences of individual fragments; computer
programs are used to compare sequences and
generate a consensus sequence.
conservation of synteny The preservation over
evolutionary time of arrangements of DNA
si
cleavage In vertebrates, a rapid series of successiveApago PDF Enhancer
collenchyma cell In plants, the cells that form a segments in related species.
cell divisions of a fertilized egg, forming a supporting tissue called collenchyma; often contig A contiguous segment of DNA assembled
hollow sphere of cells, the blastula. found in regions of primary growth in stems by analyzing sequence overlaps from smaller
hy
cleavage furrow The constriction that forms during and in some leaves. fragments.
cytokinesis in animal cells that is responsible for colloblast A specialized type of cell found in continuous variation Variation in a trait that
dividing the cell into two daughter cells. members of the animal phylum Ctenophora occurs along a continuum, such as the trait of
climax vegetation Vegetation encountered in a (comb jellies) that bursts on contact with height in human beings; often occurs when a
p
self-perpetuating community of plants that has zooplankton, releasing an adhesive substance trait is determined by more than one gene.
proceeded through all the stages of succession to help capture this prey. contractile vacuole In protists and some animals,
and stabilized. colonial flagellate hypothesis The proposal first a clear fluid-filled vacuole that takes up water
ar
cloaca In some animals, the common exit chamber put forth by Haeckel that metazoans descended from within the cell and then contracts,
from the digestive, reproductive, and urinary from colonial protists; supported by the releasing it to the outside through a pore
system; in others, the cloaca may also serve as a similarity of sponges to choanoflagellate protists. in a cyclical manner; functions primarily in
respiratory duct. commensalism A relationship in which one osmoregulation and excretion.
sw
clone-by-clone sequencing A method of individual lives close to or on another and conus arteriosus The anteriormost chamber of
genome sequencing in which a physical map benefits, and the host is unaffected; a kind the embryonic heart in vertebrate animals.
is constructed first, followed by sequencing of of symbiosis. convergent evolution The independent
fragments and identifying overlap regions. community All of the species inhabiting a common development of similar structures in
clonal selection Amplification of a clone of environment and interacting with one another. organisms that are not directly related;
.a
immune cells initiated by antigen recognition. companion cell A specialized parenchyma cell that often found in organisms living in similar
cloning Producing a cell line or culture all of is associated with each sieve-tube member in environments.
whose members contain identical copies of a the phloem of a plant. cork cambium The lateral meristem that forms
w
particular nucleotide sequence; an essential competitive exclusion The hypothesis that two the periderm, producing cork (phellem)
element in genetic engineering. species with identical ecological requirements toward the surface (outside) of the plant and
closed circulatory system A circulatory system cannot exist in the same locality indefinitely, and phelloderm toward the inside.
in which the blood is physically separated from that the more efficient of the two in utilizing the cornea The transparent outer layer of the
w
other body fluids. available scarce resources will exclude the other; vertebrate eye.
coacervate A spherical aggregation of lipid also known as Gauses principle. corolla The petals, collectively; usually the
molecules in water, held together by competitive inhibitor An inhibitor that binds to conspicuously colored flower whorl.
w
hydrophobic forces. the same active site as an enzymes substrate, corpus callosum The band of nerve fibers that
coactivator A protein that functions to link thereby competing with the substrate. connects the two hemispheres of the cerebrum
transcriptional activators to the transcription complementary Describes genetic information in in humans and other primates.
complex consisting of RNA polymerase II and which each nucleotide base has a complementary corpus luteum A structure that develops from a
general transcription factors. partner with which it forms a base-pair. ruptured follicle in the ovary after ovulation.
glossary G-5
m
crassulacean acid metabolism (CAM) A mode cell, anchors its organelles, and is involved in determinate development A type of development
of carbon dioxide fixation by which CO2 animal cell motility. in animals in which each embryonic cell has
enters open leaf stomata at night and is used in cytosol The fluid portion of the cytoplasm; it a predetermined fate in terms of what kind of
photosynthesis during the day, when stomata contains dissolved organic molecules and ions. tissue it will form in the adult.
co
are closed to prevent water loss. cytotoxic T cell A special T cell activated during deuterostome Any member of a grouping of
crista A folded extension of the inner membrane cell-mediated immune response that recognizes bilaterally symmetrical animals in which the anus
of a mitochondrion. Mitochondria contain and destroys infected body cells. develops first and the mouth second; echinoderms
numerous cristae. and vertebrates are deuterostome animals.
y.
cross-current flow In bird lungs, the latticework diacylglycerol (DAG) A second messenger
of capillaries arranged across the air flow, at a D that is released, along with inositol-1,4,5-
90 angle. deamination The removal of an amino group; part trisphosphate (IP3), when phospholipase C
crossing over In meiosis, the exchange of of the degradation of proteins into compounds cleaves PIP2. DAG can have a variety of cellular
bl
corresponding chromatid segments between that can enter the Krebs cycle. effects through activation of protein kinases.
homologous chromosomes; responsible for deductive reasoning The logical application of diaphragm (1) In mammals, a sheet of muscle
genetic recombination between homologous general principles to predict a specific result. In tissue that separates the abdominal and
ee
chromosomes. science, deductive reasoning is used to test the thoracic cavities and functions in breathing.
ctenidia Respiratory gills of mollusks; they consist validity of general ideas. (2) A contraceptive device used to block the
of a system of filamentous projections of the dehydration reaction A type of chemical reaction entrance to the uterus temporarily and thus
mantle that are rich in blood vessels. in which two molecules join to form one larger prevent sperm from entering during sexual
cuticle A waxy or fatty, noncellular layer (formed molecule, simultaneously splitting out a molecule intercourse.
.w
of a substance called cutin) on the outer wall of of water; one molecule is stripped of a hydrogen diapsid Any of a group of reptiles that have two pairs
epidermal cells. atom, and another is stripped of a hydroxyl of temporal openings in the skull, one lateral and
cutin In plants, a fatty layer produced by the group ( OH), resulting in the joining of the one more dorsal; one lineage of this group gave
epidermis that forms the cuticle on the two molecules, while the H and OH released rise to dinosaurs, modern reptiles, and birds.
outside surface.
cyanobacteria A group of photosynthetic bacteria,
sometimes called the blue-green algae, that
contain the chlorophyll pigments most abundant
cs
may combine to form a water molecule.
dehydrogenation Chemical reaction involving the
loss of a hydrogen atom. This is an oxidation that
combines loss of an electron with loss of a proton.
diastolic pressure In the measurement of human
blood pressure, the minimum pressure between
heartbeats (repolarization of the ventricles).
Compare with systolic pressure.
in plants and algae, as well as other pigments. deletion A mutation in which a portion of a dicer An enzyme that generates small RNA molecules
si
cyclic AMP (cAMP) A form of adenosine Apago PDF Enhancer
chromosome is lost; if too much information is in a cell by chopping up double-stranded RNAs;
monophosphate (AMP) in which the atoms lost, the deletion can be fatal. dicer produces miRNAs and siRNAs.
of the phosphate group form a ring; found in demography The properties of the rate of growth dicot Short for dicotyledon; a class of flowering
hy
almost all organisms, cAMP functions as an and the age structure of populations. plants generally characterized as having two
intracellular second messenger that regulates a denaturation The loss of the native configuration cotyledons, net-veined leaves, and flower parts
diverse array of metabolic activities. of a protein or nucleic acid as a result of excessive usually in fours or fives.
cyclic photophosphorylation Reactions that begin heat, extremes of pH, chemical modification, dideoxynucleotide A nucleotide lacking OH
p
with the absorption of light by reaction center or changes in solvent ionic strength or polarity groups at both the 2 and 3 positions; used as a
chlorophyll that excites an electron. The excited that disrupt hydrophobic interactions; usually chain terminator in the enzymatic sequencing
electron returns to the photosystem, generating accompanied by loss of biological activity. of DNA.
ar
ATP by chemiosmosis in the process. This is dendrite A process extending from the cell body of a differentiation A developmental process by which a
found in the single bacterial photosystem, and neuron, typically branched, that conducts impulses relatively unspecialized cell undergoes a progressive
can occur in plants in photosystem I. toward the cell body. change to a more specialized form or function.
cyclin Any of a number of proteins that are deoxyribonucleic acid (DNA) The genetic diffusion The net movement of dissolved
sw
produced in synchrony with the cell cycle material of all organisms; composed of two molecules or other particles from a region
and combine with certain protein kinases, the complementary chains of nucleotides wound in where they are more concentrated to a region
cyclin-dependent kinases, at certain points a double helix. where they are less concentrated.
during cell division. dephosphorylation The removal of a phosphate dihybrid An individual heterozygous at two
cyclin-dependent kinase (Cdk) Any of a group group, usually by a phosphatase enzyme. Many different loci; for example A/a B/b.
.a
of protein kinase enzymes that control progress proteins can be activated or inactivated by dihybrid cross A single genetic cross involving
through the cell cycle. These enzymes are only dephosphorylation. two different traits, such as flower color and
active when complexed with cyclin. The cdc2 depolarization The movement of ions across a plant height.
w
protein, produced by the cdc2 gene, was the first plasma membrane that locally wipes out an dikaryotic In fungi, having pairs of nuclei within
Cdk enzyme discovered. electrical potential difference. each cell.
cytochrome Any of several iron-containing derived character A characteristic used in dioecious Having the male and female elements
protein pigments that serve as electron carriers taxonomic analysis representing a departure on different individuals.
w
in transport chains of photosynthesis and from the primitive form. diploid Having two sets of chromosomes (2n);
cellular respiration. dermal tissue In multicellular organisms, a type in animals, twice the number characteristic of
cytochrome b6f complex A proton pump found of tissue that forms the outer layer of the body gametes; in plants, the chromosome number
w
in the thylakoid membrane. This complex uses and is in contact with the environment; it has a characteristic of the sporophyte generation; in
energy from excited electrons to pump protons protective function. contrast to haploid (n).
from the stroma into the thylakoid compartment. desmosome A type of anchoring junction directional selection A form of selection in which
cytokinesis Division of the cytoplasm of a cell that links adjacent cells by connecting their selection acts to eliminate one extreme from an
after nuclear division. cytoskeletons with cadherin proteins. array of phenotypes.
G-6 glossary
m
without altering their tertiary structure. Also refers double helix The structure of DNA, in which two membrane; the uptake of solid material is
to the dissolving of ionic compounds in water. complementary polynucleotide strands coil phagocytosis, and that of dissolved material is
disassortative mating A type of nonrandom around a common helical axis. pinocytosis.
mating in which phenotypically different duodenum In vertebrates, the upper portion of the endoderm One of the three embryonic germ
co
individuals mate more frequently. small intestine. layers of early vertebrate embryos, destined to
diurnal Active during the day. duplication A mutation in which a portion of a give rise to the epithelium that lines internal
DNA-binding motif A region found in a chromosome is duplicated; if the duplicated structures and most of the digestive and
regulatory protein that is capable of binding to region does not lie within a gene, the respiratory tracts.
y.
a specific base sequence in DNA; a critical part duplication may have no effect. endodermis In vascular plants, a layer of cells
of the proteins DNA-binding domain. forming the innermost layer of the cortex in
DNA fingerprinting An identification technique that roots and some stems.
makes use of a variety of molecular techniques to E endomembrane system A system of connected
bl
identify differences in the DNA of individuals. ecdysis Shedding of outer, cuticular layer; molting, membranous compartments found in
DNA gyrase A topoisomerase involved in DNA as in insects or crustaceans. eukaryotic cells.
replication; it relieves the torsional strain ecdysone Molting hormone of arthropods, which endometrium The lining of the uterus in
ee
caused by unwinding the DNA strands. triggers when ecdysis occurs. mammals; thickens in response to secretion of
DNA library A collection of DNAs in a vector (a ecology The study of interactions of organisms with estrogens and progesterone and is sloughed off
plasmid, phage, or artificial chromosome) that one another and with their physical environment. in menstruation.
taken together represent a complex mixture of ecosystem A major interacting system that includes endomycorrhizae Mycorrhizae that develop
DNAs, such as the entire genome, or the cDNAs organisms and their nonliving environment. within cells.
.w
made from all of the mRNA in a specific cell type. ecotype A locally adapted variant of an organism; endonuclease An enzyme capable of cleaving
DNA ligase The enzyme responsible for differing genetically from other ecotypes. phosphodiester bonds between nucleotides
formation of phosphodiester bonds between ectoderm One of the three embryonic germ layers located internally in a DNA strand.
adjacent nucleotides in DNA. of early vertebrate embryos; ectoderm gives endoplasmic reticulum (ER) Internal membrane
DNA microarray An array of DNA fragments
on a microscope slide or silicon chip, used in
hybridization experiments with labeled mRNA
or DNA to identify active and inactive genes, or
the presence or absence of particular sequences.
cs
rise to the outer epithelium of the body (skin,
hair, nails) and to the nerve tissue, including the
sense organs, brain, and spinal cord.
ectomycorrhizae Externally developing mycorrhizae
that do not penetrate the cells they surround.
system that forms a netlike array of channels
and interconnections within the cytoplasm of
eukaryotic cells. The ER is divided into rough
(RER) and smooth (SER) compartments.
endorphin One of a group of small neuropeptides
si
DNA polymerase A class of enzymes that all Apago PDF Enhancer
ectotherms Animals such as reptiles, fish, or produced by the vertebrate brain; like morphine,
synthesize DNA from a preexisting template. amphibians, whose body temperature is regulated endorphins modulate pain perception.
All synthesize only in the 5-to-3 direction, and by their behavior or by their surroundings. endosperm A storage tissue characteristic of the
hy
require a primer to extend. electronegativity A property of atomic nuclei that seeds of angiosperms, which develops from the
DNA vaccine A type of vaccine that uses DNA refers to the affinity of the nuclei for valence union of a male nucleus and the polar nuclei
from a virus or bacterium that stimulates the electrons; a nucleus that is more electronegative of the embryo sac. The endosperm is digested
cellular immune response. has a greater pull on electrons than one that is by the growing sporophyte either before
p
domain (1) A distinct modular region of a protein less electronegative. maturation of the seed or during its germination.
that serves a particular function in the action of electron transport chain The passage of energetic endospore A highly resistant, thick-walled bacterial
the protein, such as a regulatory domain or a electrons through a series of membrane- spore that can survive harsh environmental
ar
DNA-binding domain. (2) In taxonomy, the level associated electron-carrier molecules to proton stress, such as heat or dessication, and then
higher than kingdom. The three domains currently pumps embedded within mitochondrial or germinate when conditions become favorable.
recognized are Bacteria, Archaea, and Eukarya. chloroplast membranes. See chemiosmosis. endosymbiosis Theory that proposes that
Domain Archaea In the three-domain system of elongation factor (Ef-Tu) In protein synthesis in eukaryotic cells evolved from a symbiosis
sw
taxonomy, the group that contains only the E. coli, a factor that binds to GTP and to a charged between different species of prokaryotes.
Archaea, a highly diverse group of unicellular tRNA to accomplish binding of the charged endotherm An animal capable of maintaining a
prokaryotes. tRNA to the A site of the ribosome, so that constant body temperature. See homeotherm.
Domain Bacteria In the three-domain system elongation of the polypeptide chain can occur. energy level A discrete level, or quantum, of
of taxonomy, the group that contains only the embryo A multicellular developmental stage that energy that an electron in an atom possesses. To
.a
Bacteria, a vast group of unicellular prokaryotes. follows cell division of the zygote. change energy levels, an electron must absorb
Domain Eukarya In the three-domain system of embryonic stem cell (ES cell) A stem cell derived or release energy.
taxonomy, the group that contains eukaryotic from an early embryo that can develop into enhancer A site of regulatory protein binding on
w
organisms including protists, fungi, plants, and different adult tissues and give rise to an adult the DNA molecule distant from the promoter
animals. organism when injected into a blastocyst. and start site for a genes transcription.
dominant An allele that is expressed when present emergent properties Novel properties arising from enthalpy In a chemical reaction, the energy
in either the heterozygous or the homozygous the way in which components interact. Emergent contained in the chemical bonds of the
w
condition. properties often cannot be deduced solely from molecule, symbolized as H; in a cellular
dosage compensation A phenomenon by knowledge of the individual components. reaction, the free energy is equal to the enthalpy
which the expression of genes carried on sex emerging virus Any virus that originates in one of the reactant molecules in the reaction.
w
chromosomes is kept the same in males and organism but then passes to another; usually entropy A measure of the randomness or disorder
females, despite a different number of sex refers to transmission to humans. of a system; a measure of how much energy
chromosomes. In mammals, inactivation of endergonic Describes a chemical reaction in in a system has become so dispersed (usually
one of the X chromosomes in female cells which the products contain more energy than as evenly distributed heat) that it is no longer
accomplishes dosage compensation. the reactants, so that free energy must be put available to do work.
glossary G-7
m
epicotyl The region just above where the at an end of a DNA strand. This allows sequential from the surface of a cell and used in locomotion.
cotyledons are attached. removal of nucleotides from the end of DNA. flame cell A specialized cell found in the network
epidermal cell In plants, a cell that collectively exoskeleton An external skeleton, as in arthropods. of tubules inside flatworms that assists in water
forms the outermost layer of the primary experiment A test of one or more hypotheses. regulation and some waste excretion.
co
plant body; includes specialized cells such as Hypotheses make contrasting predictions that flavin adenine dinucleotide (FAD, FADH2) A
trichomes and guard cells. can be tested experimentally in control and test cofactor that acts as a soluble (not membrane-
epidermis The outermost layers of cells; in plants, the experiments where a single variable is altered. bound) electron carrier (can be reversibly
exterior primary tissue of leaves, young stems, and expressed sequence tag (EST) A short sequence of a oxidized and reduced).
y.
roots; in vertebrates, the nonvascular external layer cDNA that unambiguously identifies the cDNA. fluorescent in situ hybridization (FISH) A
of skin, of ectodermal origin; in invertebrates, a expression vector A type of vector (plasmid or phage) cytological method used to find specific DNA
single layer of ectodermal epithelium. that contains the sequences necessary to drive sequences on chromosomes with a specific
epididymis A sperm storage vessel; a coiled part of expression of inserted DNA in a specific cell type. fluorescently labeled probe.
bl
the sperm duct that lies near the testis. exteroceptor A receptor that is excited by stimuli food security Having access to sufficient, safe food
epistasis Interaction between two nonallelic genes from the external world. to avoid malnutrition and starvation; a global
in which one of them modifies the phenotypic extremophile An archaean organism that lives human issue.
ee
expression of the other. in extreme environments; different archaean foraging behavior A collective term for the
epithelium In animals, a type of tissue that covers species may live in hot springs (thermophiles), many complex, evolved behaviors that
an exposed surface or lines a tube or cavity. highly saline environments (halophiles), highly influence what an animal eats and how the
equilibrium A stable condition; the point at which acidic or basic environments, or under high food is obtained.
a chemical reaction proceeds as rapidly in pressure at the bottom of oceans. founder effect The effect by which rare alleles
.w
the reverse direction as it does in the forward and combinations of alleles may be enhanced in
direction, so that there is no further net change new populations.
in the concentrations of products or reactants. F fovea A small depression in the center of the retina
In ecology, a stable condition that resists 5 cap In eukaryotes, a structure added to the 5 with a high concentration of cones; the area of
change and fairly quickly returns to its original
state if disturbed by humans or natural events.
erythrocyte Red blood cell, the carrier of hemoglobin.
erythropoiesis The manufacture of blood cells in
cs
end of an mRNA consisting of methylated
GTP attached by a 5 to 5 bond. The cap
protects this end from degradation and is
involved in the initiation of translation.
sharpest vision.
frameshift mutation A mutation in which a base
is added or deleted from the DNA sequence.
These changes alter the reading frame
the bone marrow. facilitated diffusion Carrier-assisted diffusion of downstream of the mutation.
si
E site In a ribosome, the exit site that binds to Apago PDF Enhancer
molecules across a cellular membrane through free energy Energy available to do work.
the tRNA that carried the previous amino acid specific channels from a region of higher free radical An ionized atom with one or more
added to the polypeptide chain. concentration to one of lower concentration; the unpaired electrons, resulting from electrons
hy
estrus The period of maximum female sexual process is driven by the concentration gradient that have been energized by ionizing radiation
receptivity, associated with ovulation of the egg. and does not require cellular energy from ATP. being ejected from the atom; free radicals react
ethology The study of patterns of animal behavior family A taxonomic grouping of similar species violently with other molecules, such as DNA,
in nature. above the level of genus. causing damage by mutation.
p
euchromatin That portion of a eukaryotic fat A molecule composed of glycerol and three frequency-dependent selection A type of selection
chromosome that is transcribed into mRNA; fatty acid molecules. that depends on how frequently or infrequently
contains active genes that are not tightly feedback inhibition Control mechanism a phenotype occurs in a population.
ar
condensed during interphase. whereby an increase in the concentration of fruit In angiosperms, a mature, ripened ovary
eukaryote A cell characterized by membrane- some molecules inhibits the synthesis of that (or group of ovaries), containing the seeds.
bounded organelles, most notably the nucleus, molecule. functional genomics The study of the function
and one that possesses chromosomes whose fermentation The enzyme-catalyzed extraction of of genes and their products, beyond simply
sw
DNA is associated with proteins; an organism energy from organic compounds without the ascertaining gene sequences.
composed of such cells. involvement of oxygen. functional group A molecular group attached to
eutherian A placental mammal. fertilization The fusion of two haploid gamete a hydrocarbon that confers chemical properties
eutrophic Refers to a lake in which an abundant nuclei to form a diploid zygote nucleus. or reactivities. Examples include hydroxyl
supply of minerals and organic matter exists. fibroblast A flat, irregularly branching cell of ( OH), carboxylic acid ( COOH) and
.a
evolution Genetic change in a population of connective tissue that secretes structurally strong amino groups ( NH2).
organisms; in general, evolution leads to proteins into the matrix between the cells. fundamental niche Also referred to as the
progressive change from simple to complex. first filial (F1) generation The offspring resulting hypothetical niche, this is the entire niche an
w
excision repair A nonspecific mechanism to from a cross between a parental generation (P); organism could fill if there were no other
repair damage to DNA during synthesis. The in experimental crosses, these parents usually interacting factors (such as competition
damaged or mismatched region is excised, and have different phenotypes. or predation).
DNA polymerase replaces the region removed. First Law of Thermodynamics Energy cannot
w
exergonic Describes a chemical reaction in which the be created or destroyed, but can only undergo
products contain less free energy than the reactants, conversion from one form to another; thus, G
so that free energy is released in the reaction. the amount of energy in the universe is G0 phase The stage of the cell cycle occupied by
w
exhalant siphon In bivalve mollusks, the siphon unchangeable. cells that are not actively dividing.
through which outgoing water leaves the body. fitness The genetic contribution of an individual G1 phase The phase of the cell cycle after
exocrine gland A type of gland that releases its to succeeding generations. relative fitness refers cytokinesis and before DNA replication called
secretion through a duct, such as a digestive to the fitness of an individual relative to other the first gap phase. This phase is the primary
gland or a sweat gland. individuals in a population. growth phase of a cell.
G-8 glossary
m
G2/M checkpoint The second cell-division control genetic map An abstract map that places the this enzyme-catalyzed process yields two
point, at which division can be delayed if DNA relative location of genes on a chromosome molecules of pyruvate with a net of two
has not been properly replicated or is damaged. based on recombination frequency. molecules of ATP.
gametangium, pl. gametangia A cell or organ in genome The entire DNA sequence of an organism. glycoprotein Protein molecule modified within
co
which gametes are formed. genomic imprinting Describes an exception to the Golgi complex by having a short sugar
gamete A haploid reproductive cell. Mendelian genetics in some mammals in which chain (polysaccharide) attached.
gametocytes Cells in the malarial sporozoite life the phenotype caused by an allele is exhibited glyoxysome A small cellular organelle or
cycle capable of giving rise to gametes when in when the allele comes from one parent, but not microbody containing enzymes necessary for
y.
the correct host. from the other. conversion of fats into carbohydrates.
gametophyte In plants, the haploid (n), gamete- genomic library A DNA library that contains glyphosate A biodegradable herbicide that works
producing generation, which alternates with the a representation of the entire genome of an by inhibiting EPSP synthetase, a plant enzyme
diploid (2n) sporophyte. organism. that makes aromatic amino acids; genetic
bl
ganglion, pl. ganglia An aggregation of nerve genomics The study of genomes as opposed to engineering has allowed crop species to be
cell bodies; in invertebrates, ganglia are the individual genes. created that are resistant to glyphosate.
integrative centers; in vertebrates, the term is genotype The genetic constitution underlying a Golgi apparatus (Golgi body) A collection of
ee
restricted to aggregations of nerve cell bodies single trait or set of traits. flattened stacks of membranes in the cytoplasm
located outside the central nervous system. genotype frequency A measure of the occurrence of eukaryotic cells; functions in collection,
gap gene Any of certain genes in Drosophila of a genotype in a population, expressed as packaging, and distribution of molecules
development that divide the embryo into a proportion of the entire population, for synthesized in the cell.
large blocks in the process of segmentation; example, an occurrence of 0.25 (25%) for a G protein A protein that binds guanosine
.w
hunchback is a gap gene. homozygous recessive genotype. triphosphate (GTP) and assists in the function
gap junction A junction between adjacent animal genus, pl. genera A taxonomic group that ranks of cell-surface receptors. When the receptor
cells that allows the passage of materials below a family and above a species. binds its signal molecule, the G protein binds
between the cells. germination The resumption of growth and GTP and is activated to start a chain of events
gastrodermis In eumetazoan animals, the layer of
digestive tissue that develops from the endoderm.
gastrula In vertebrates, the embryonic stage in
which the blastula with its single layer of cells
turns into a three-layered embryo made up of
cs
development by a spore or seed.
germ layers The three cell layers formed at
gastrulation of the embryo that foreshadow
the future organization of tissues; the layers,
from the outside inward, are the ectoderm, the
within the cell.
G protein-coupled receptor (GPCR) A receptor
that acts through a heterotrimeric (three
component) G protein to activate effector
proteins. The effector proteins then function as
si
ectoderm, mesoderm, and endoderm. Apago PDF Enhancer
mesoderm, and the endoderm. enzymes to produce second messengers such as
gastrulation Developmental process that converts germ-line cells During zygote development, cells that cAMP or IP3.
blastula into embryo with three embryonic germ are set aside from the somatic cells and that will gradualism The view that species change very
hy
layers: endoderm, mesoderm, and ectoderm. eventually undergo meiosis to produce gametes. slowly in ways that may be imperceptible from
Involves massive cell migration to convert the gill (1) In aquatic animals, a respiratory organ, one generation to the next but that accumulate
hollow structure into a three-layered structure. usually a thin-walled projection from some part and lead to major changes over thousands or
gene The basic unit of heredity; a sequence of DNA of the external body surface, endowed with a rich millions of years.
p
nucleotides on a chromosome that encodes a capillary bed and having a large surface area. Gram stain Staining technique that divides
protein, tRNA, or rRNA molecule, or regulates (2) In basidiomycete fungi, the plates on the bacteria into gram-negative or gram-positive
the transcription of such a sequence. underside of the cap. based on retention of a violet dye. Differences
ar
gene conversion Alteration of one homologous globular protein Proteins with a compact tertiary in staining are due to cell wall construction.
chromosome by the cells error-detection and structure with hydrophobic amino acids mainly granum (pl. grana) A stacked column of flattened,
repair system to make it resemble the sequence in the interior. interconnected disks (thylakoids) that are
on the other homologue. glomerular filtrate The fluid that passes out of part of the thylakoid membrane system in
sw
gene expression The conversion of the genotype the capillaries of each glomerulus. chloroplasts.
into the phenotype; the process by which glomerulus A cluster of capillaries enclosed by gravitropism Growth response to gravity in plants;
DNA is transcribed into RNA, which is then Bowmans capsule. formerly called geotropism.
translated into a protein product. glucagon A vertebrate hormone produced in the ground meristem The primary meristem, or
gene pool All the alleles present in a species. pancreas that acts to initiate the breakdown of meristematic tissue, that gives rise to the plant
.a
gene-for-gene hypothesis A plant defense glycogen to glucose subunits. body (except for the epidermis and vascular
mechanism in which a specific protein encoded gluconeogenesis The synthesis of glucose from tissues).
by a viral, bacterial, or fungal pathogen binds to noncarbohydrates (such as proteins or fats). ground tissue In plants, a type of tissue that
w
a protein encoded by a plant gene and triggers glucose A common six-carbon sugar (C6H12O6); performs many functions, including support,
a defense response in the plant. the most common monosaccharide in most storage, secretion, and photosynthesis; may
general transcription factor Any of a group of organisms. consist of many cell types.
transcription factors that are required for formation glucose repression In E. coli, the preferential use growth factor Any of a number of proteins that
w
of an initiation complex by RNA polymerase II at of glucose even when other sugars are present; bind to membrane receptors and initiate
a promoter. This allows a basal level that can be transcription of mRNA encoding the enzymes intracellular signaling systems that result in cell
increased by the action of specific factors. for utilizing the other sugars does not occur. growth and division.
w
generalized transduction A form of gene transfer glycocalyx A sugar coating on the surface guard cell In plants, one of a pair of sausage-
in prokaryotes in which any gene can be of a cell resulting from the presence shaped cells flanking a stoma; the guard cells
transferred between cells. This uses a lytic of polysaccharides on glycolipids and open and close the stomata.
bacteriophage as a carrier where the virion is glycoproteins embedded in the outer layer of guttation The exudation of liquid water from
accidentally packaged with host DNA. the plasma membrane. leaves due to root pressure.
glossary G-9
m
habitat The environment of an organism; the chemicals, and so must feed on other plants convergent evolution or evolutionary reversal.
place where it is usually found. and animals, obtaining chemical energy by The wings of birds and of bats, which are
habituation A form of learning; a diminishing degrading their organic molecules. convergent structures, are examples.
response to a repeated stimulus. heterozygote advantage The situation in which homosporous In some plants, production of only
co
halophyte A plant that is salt-tolerant. individuals heterozygous for a trait have one type of spore rather than differentiated
haplodiploidy A phenomenon occurring in certain a selective advantage over those who are types. Compare with heterosporous.
organisms such as wasps, wherein both haploid homozygous; an example is sickle cell anemia. homozygous Being a homozygote, having two
(male) and diploid (female) individuals are heterozygous Having two different alleles of the same identical alleles of the same gene; the term is
y.
encountered. gene; the term is usually applied to one or more usually applied to one or more specific loci, as
haploid Having only one set of chromosomes (n), specific loci, as in heterozygous with respect to the in homozygous with respect to the W locus
in contrast to diploid (2n). W locus (that is, the genotype is W/w). (i.e., the genotype is W/W or w/w).
haplotype A region of a chromosome that is Hfr cell An E. coli cell that has a high frequency horizontal gene transfer (HGT) The passing of
bl
usually inherited intact, that is, it does not of recombination due to integration of an genes laterally between species; more prevalent
undergo recombination. These are identified F plasmid into its genome. very early in the history of life.
based on analysis of SNPs. histone One of a group of relatively small, very hormone A molecule, usually a peptide or steroid,
ee
Hardy-Weinberg equilibrium A mathematical basic polypeptides, rich in arginine and lysine, that is produced in one part of an organism
description of the fact that allele and genotype forming the core of nucleosomes around and triggers a specific cellular reaction in target
frequencies remain constant in a random- which DNA is wrapped in the first stage of tissues and organs some distance away.
mating population in the absence of inbreeding, chromosome condensation. host range The range of organisms that can be
selection, or other evolutionary forces; usually histone protein Any of eight proteins with an infected by a particular virus.
.w
stated: if the frequency of allele a is p and the overall positive charge that associate in a complex. Hox gene A group of homeobox-containing genes
frequency of allele b is q, then the genotype The DNA duplex coils around a core of eight that control developmental events, usually
frequencies after one generation of random histone proteins, held by its negatively charged found organized into clusters of genes. These
mating will always be p2 + 2pq + q2 = 1. phosphate groups, forming a nucleosome. genes have been conserved in many different
Haversian canal Narrow channels that run parallel
to the length of a bone and contain blood
vessels and nerve cells.
heat A measure of the random motion of
cs
holoblastic cleavage Process in vertebrate
embryos in which the cleavage divisions all
occur at the same rate, yielding a uniform cell
size in the blastula.
multicellular animals, both invertebrates and
vertebrates, although the number of clusters
changes in lineages, leading to four clusters
in vertebrates.
molecules; the greater the heat, the greater the homeobox A sequence of 180 nucleotides located humoral immunity Arm of the adaptive immune
si
motion. Heat is one form of kinetic energy. Apago PDF Enhancer
in homeotic genes that produces a 60-amino- system involving B cells that produce soluble
heat of vaporization The amount of energy required acid peptide sequence (the homeodomain) antibodies specific for foreign antigens.
to change 1 g of a substance from a liquid to a gas. active in transcription factors. humus Partly decayed organic material found
hy
heavy metal Any of the metallic elements with homeodomain motif A special class of helix-turn- in topsoil.
high atomic numbers, such as arsenic, cadmium, helix motifs found in regulatory proteins that hybridization The mating of unlike parents.
lead, etc. Many heavy metals are toxic to control development in eukaryotes. hydration shell A cloud of water molecules
animals even in small amounts. homeosis A change in the normal spatial surrounding a dissolved substance, such as
p
helicase Any of a group of enzymes that unwind pattern of gene expression that can result sucrose or Na+ and Cl ions.
the two DNA strands in the double helix to in homeotic mutants where a wild-type hydrogen bond A weak association formed with
facilitate DNA replication. structure develops in the wrong place in or hydrogen in polar covalent bonds. The partially
ar
helix-turn-helix motif A common DNA-binding on the organism. positive hydrogen is attracted to partially
motif found in regulatory proteins; it consists homeostasis The maintenance of a relatively negative atoms in polar covalent bonds. In
of two -helices linked by a nonhelical segment stable internal physiological environment in water, oxygen and hydrogen in different water
(the turn). an organism; usually involves some form of molecules form hydrogen bonds.
sw
helper T cell A class of white blood cells that initiates feedback self-regulation. hydrolysis reaction A reaction that breaks a bond
both the cell-mediated immune response and the homeotherm An organism, such as a bird or by the addition of water. This is the reverse of
humoral immune response; helper T cells are the mammal, capable of maintaining a stable body dehydration, a reaction that joins molecules
targets of the AIDS virus (HIV). temperature independent of the environmental with the loss of water.
hemoglobin A globular protein in vertebrate red temperature. See endotherm. hydrophilic Literally translates as water-loving
.a
blood cells and in the plasma of many invertebrates homeotic gene One of a series of master switch and describes substances that are soluble in water.
that carries oxygen and carbon dioxide. genes that determine the form of segments These must be either polar or charged (ions).
hemopoietic stem cell The cells in bone marrow developing in the embryo. hydrophobic Literally translates as water-fearing
w
where blood cells are formed. hominid Any primate in the human family, and describes nonpolar substances that are not
hermaphroditism Condition in which an Hominidae. Homo sapiens is the only living soluble in water. Nonpolar molecules in water
organism has both male and female functional representative. associate with each other and form droplets.
reproductive organs. hominoid Collectively, hominids and apes; hydrophobic exclusion The tendency of nonpolar
w
heterochromatin The portion of a eukaryotic the monkeys and hominoids constitute the molecules to aggregate together when placed in
chromosome that is not transcribed into RNA; anthropoid primates. water. Exclusion refers to the action of water in
remains condensed in interphase and stains homokaryotic In fungi, having nuclei with the forcing these molecules together.
w
intensely in histological preparations. same genetic makeup within a mycelium. hydrostatic skeleton The skeleton of most
heterochrony An alteration in the timing of homologue One of a pair of chromosomes of the soft-bodied invertebrates that have neither an
developmental events due to a genetic change; same kind located in a diploid cell; one copy internal nor an external skeleton. They use the
for example, a mutation that delays flowering of each pair of homologues comes from each relative incompressibility of the water within
in plants. gamete that formed the zygote. their bodies as a kind of skeleton.
G-10 glossary
m
pathogens by selectively killing plant cells to one of which could develop separately into a found only in the middle of the spinal cord
block the spread of the pathogen. complete organism; their fate is indeterminate. that acts as a functional link between sensory
hypertonic A solution with a higher concentration inducer exclusion Part of the mechanism of neurons and motor neurons.
of solutes than the cell. A cell in a hypertonic glucose repression in E. coli in which the internode In plants, the region of a stem between
co
solution tends to lose water by osmosis. presence of glucose prevents the entry of lactose two successive nodes.
hypha, pl. hyphae A filament of a fungus or such that the lac operon cannot be induced. interoceptor A receptor that senses information
oomycete; collectively, the hyphae constitute induction (1) Production of enzymes in response related to the body itself, its internal condition,
the mycelium. to a substrate; a mechanism by which binding and its position.
y.
hypocotyl The region immediately below where of an inducer to a repressor allows transcription interphase The period between two mitotic or
the cotyledons are attached. of an operon. This is seen in catabolic operons meiotic divisions in which a cell grows and its
hypoosmotic The condition in which a and results in production of enzymes to DNA replicates; includes G1, S, and G2 phases.
(hypoosmotic) solution has a lower osmotic degrade a compound only when it is available. intracellular receptor A signal receptor that binds
bl
concentration than that of a second solution. (2) In embryonic development, the process by a ligand inside a cell, such as the receptors for
Compare with hyperosmotic. which the development of a cell is influenced NO, steroid hormones, vitamin D, and thyroid
hypothalamus A region of the vertebrate brain by interaction with an adjacent cell. hormones.
ee
just below the cerebral hemispheres, under the inductive reasoning The logical application of intron Portion of mRNA as transcribed from
thalamus; a center of the autonomic nervous specific observations to make a generalization. eukaryotic DNA that is removed by enzymes
system, responsible for the integration and In science, inductive reasoning is used to before the mature mRNA is translated into
correlation of many neural and endocrine formulate testable hypotheses. protein. See exon.
functions. industrial melanism Phrase used to describe the inversion A reversal in order of a segment of
.w
hypotonic A solution with a lower concentration evolutionary process in which initially light- a chromosome; also, to turn inside out, as in
of solutes than the cell. A cell in a hypotonic colored organisms become dark as a result of embryogenesis of sponges or discharge of
solution tends to take in water by osmosis. natural selection. a nematocyst.
inflammatory response A generalized nonspecific ionizing radiation High-energy radiation that is
I
icosahedron A structure consisting of 20 equilateral
triangular facets; this is commonly seen in
viruses and forms one kind of viral capsid.
cs
response to infection that acts to clear an
infected area of infecting microbes and dead
tissue cells so that tissue repair can begin.
inhalant siphon In bivalve mollusks, the siphon
through which incoming water enters the body.
highly mutagenic, producing free radicals that
react with DNA; includes X-rays and -rays.
isomer One of a group of molecules identical in
atomic composition but differing in structural
arrangement; for example, glucose and fructose.
si
imaginal disk One of about a dozen groups of cells Apago PDF Enhancer
inheritance of acquired characteristics Also isosmotic The condition in which the osmotic
set aside in the abdomen of a larval insect and known as Lamarckism; the theory, now concentrations of two solutions are equal, so
committed to forming key parts of the adult discounted, that individuals genetically pass on to that no net water movement occurs between
hy
insects body. their offspring physical and behavioral changes them by osmosis.
immune response In vertebrates, a defensive developed during the individuals own lifetime. isotonic A solution having the same concentration
reaction of the body to invasion by a foreign inhibitor A substance that binds to an enzyme and of solutes as the cell. A cell in an isotonic solution
substance or organism. See antibody and B cell. decreases its activity. takes in and loses the same amount of water.
p
immunoglobulin An antibody molecule. initiation factor One of several proteins involved isotope Different forms of the same element with
immunological tolerance Process where immune in the formation of an initiation complex in the same number of protons but different
system learns to not react to self-antigens. prokaryote polypeptide synthesis. numbers of neutrons.
ar
in vitro mutagenesis The ability to create initiator tRNA A tRNA molecule involved in
mutations at any site in a cloned gene to
examine the mutations effects on function.
the beginning of translation. In prokaryotes,
the initiator tRNA is charged with
J
jasmonic acid An organic molecule that is part
inbreeding The breeding of genetically related N-formylmethionine (tRNAfMet); in eukaryotes,
sw
kin (other than offspring) whose existence results many other cellular reactions. an organism as viewed with a light microscope.
from the benefit of the individuals altruism. inositol-1,4,5-trisphosphate (IP3) Second keratin A tough, fibrous protein formed in epidermal
incomplete dominance Describes a case in messenger produced by the cleavage of tissues and modified into skin, feathers, hair, and
w
which two or more alleles of a gene do not phosphatidylinositol-4,5-bisphosphate. hard structures such as horns and nails.
display clear dominance. The phenotype of insertional inactivation Destruction of a genes key innovation A newly evolved trait in a species
a heterozygote is intermediate between the function by the insertion of a transposon. that allows members to use resources or other
homozygous forms. For example, crossing instar A larval developmental stage in insects. aspects of the environment that were previously
w
red-flowered with white-flowered four oclocks integrin Any of a group of cell-surface proteins inaccessible.
yields pink heterozygotes. involved in adhesion of cells to substrates. kidney In vertebrates, the organ that filters the blood
independent assortment In a dihybrid cross, Critical to migrating cells moving through the to remove nitrogenous wastes and regulates the
w
describes the random assortment of alleles cell matrix in tissues such as connective tissue. balance of water and solutes in blood plasma.
for each of the genes. For genes on different intercalary meristem A type of meristem that kilocalorie Unit describing the amount of heat
chromosomes this results from the random arises in stem internodes in some plants, such as required to raise the temperature of a kilogram
orientations of different homologous pairs corn and horsetails; responsible for elongation of water by 1C; sometimes called a Calorie,
during metaphase I of meiosis. For genes on of the internodes. equivalent to 1000 calories.
glossary G-11
m
kinetochore Disk-shaped protein structure within lichen Symbiotic association between a fungus and and Bryozoa.
the centromere to which the spindle fibers attach a photosynthetic organism such as a green alga lumen A term for any bounded opening; for
during mitosis or meiosis. See centromere. or cyanobacterium. example, the cisternal space of the endoplasmic
kingdom The second highest commonly used ligand A signaling molecule that binds to a specific reticulum of eukaryotic cells, the passage
co
taxonomic category. receptor protein, initiating signal transduction through which blood flows inside a blood
kin selection Selection favoring relatives; an in cells. vessel, and the passage through which material
increase in the frequency of related individuals light-dependent reactions In photosynthesis, moves inside the intestine during digestion.
(kin) in a population, leading to an increase in the reactions in which light energy is captured luteal phase The second phase of the female
y.
the relative frequency in the population of those and used in production of ATP and NADPH. reproductive cycle, during which the mature
alleles shared by members of the kin group. In plants this involves the action of two linked eggs are released into the fallopian tubes, a
knockout mice Mice in which a known gene is photosystems. process called ovulation.
inactivated (knocked out) using recombinant light-independent reactions In photosynthesis, lymph In animals, a colorless fluid derived from
bl
DNA and ES cells. the reactions of the Calvin cycle in which blood by filtration through capillary walls in
Krebs cycle Another name for the citric acid cycle; ATP and NADPH from the light-dependent the tissues.
also called the tricarboxylic acid (TCA) cycle. reactions are used to reduce CO2 and produce lymphatic system In animals, an open vascular
ee
organic compounds such as glucose. This system that reclaims water that has entered
L involves the process of carbon fixation, or interstitial regions from the bloodstream
labrum The upper lip of insects and crustaceans the conversion of inorganic carbon (CO2) to (lymph); includes the lymph nodes, spleen,
situated above or in front of the mandibles. organic carbon (ultimately carbohydrates). thymus, and tonsils.
lac operon In E. coli, the operon containing genes lignin A highly branched polymer that makes plant lymphocyte A type of white blood cell. Lymphocytes
.w
that encode the enzymes to metabolize lactose. cell walls more rigid; an important component are responsible for the immune response; there
lagging strand The DNA strand that must be of wood. are two principal classes: B cells and T cells.
synthesized discontinuously because of the 5- limbic system The hypothalamus, together with the lymphokine A regulatory molecule that is secreted
to-3 directionality of DNA polymerase during network of neurons that link the hypothalamus by lymphocytes. In the immune response,
replication, and the antiparallel nature of DNA.
Compare leading strand.
larva A developmental stage that is unlike the
adult found in organisms that undergo
cs
to some areas of the cerebral cortex. Responsible
for many of the most deep-seated drives and
emotions of vertebrates, including pain, anger,
sex, hunger, thirst, and pleasure.
lymphokines secreted by helper T cells unleash
the cell-mediated immune response.
lysis Disintegration of a cell by rupture of its
plasma membrane.
metamorphosis. Embryos develop into larvae linked genes Genes that are physically close lysogenic cycle A viral cycle in which the viral
si
that produce the adult form by metamorphosis. Apago PDF Enhancer
together and therefore tend to segregate DNA becomes integrated into the host
larynx The voice box; a cartilaginous organ that together; recombination occurring between chromosome and is replicated during cell
lies between the pharynx and trachea and is linked genes can be used to produce a map of reproduction. Results in vertical rather than
hy
responsible for sound production in vertebrates. genetic distance for a chromosome. horizontal transmission.
lateral line system A sensory system encountered in linkage disequilibrium Association of alleles for 2 lysosome A membrane-bounded vesicle
fish, through which mechanoreceptors in a line or more loci in a population that is higher than containing digestive enzymes that is produced
down the side of the fish are sensitive to motion. expected by chance. by the Golgi apparatus in eukaryotic cells.
p
lateral meristems In vascular plants, the lipase An enzyme that catalyzes the hydrolysis of fats. lytic cycle A viral cycle in which the host cell is
meristems that give rise to secondary tissue; the lipid A nonpolar hydrophobic organic molecule killed (lysed) by the virus after viral duplication
vascular cambium and cork cambium. that is insoluble in water (which is polar) to release viral particles.
ar
Law of Segregation Mendels first law of heredity, in which two layers of phospholipids the extinction of old ones.
stating that alternative alleles for the same gene spontaneously align so that the hydrophilic macromolecule An extremely large biological
segregate from each other in production of head groups are exposed to water, while the molecule; refers specifically to proteins, nucleic
gametes. hydrophobic fatty acid tails are pointed toward acids, polysaccharides, lipids, and complexes
leading strand The DNA strand that can be the center of the membrane. of these.
.a
synthesized continuously from the origin of lipopolysaccharide A lipid with a polysaccharide macronutrients Inorganic chemical elements
replication. Compare lagging strand. molecule attached; found in the outer required in large amounts for plant growth,
leaf primordium, pl. primordia A lateral membrane layer of gram-negative bacteria; the such as nitrogen, potassium, calcium,
w
outgrowth from the apical meristem that will outer membrane layer protects the cell wall phosphorus, magnesium, and sulfur.
eventually become a leaf. from antibiotic attack. macrophage A large phagocytic cell that is able to
lenticels Spongy areas in the cork surfaces of locus The position on a chromosome where a gene engulf and digest cellular debris and invading
stem, roots, and other plant parts that allow is located. bacteria.
w
interchange of gases between internal tissues long interspersed element (LINE) Any of a madreporite A sievelike plate on the surface of
and the atmosphere through the periderm. type of large transposable element found in echinoderms through which water enters the
leucine zipper motif A motif in regulatory humans and other primates that contains all the watervascular system.
w
proteins in which two different protein subunits biochemical machinery needed for transposition. MADS box gene Any of a family of genes
associate to form a single DNA-binding site; long terminal repeat (LTR) A particular type of identified by possessing shared motifs that are
the proteins are connected by an association retrotransposon that has repeated elements at the predominant homeotic genes of plants;
between hydrophobic regions containing its ends. These elements make up 8% of the a small number of MADS box genes are also
leucines (the zipper). human genome. found in animals.
G-12 glossary
m
plasma membrane, which the immune system haploid daughter cells. very short and only recently could be detected.
uses to identify self. All the cells of a given membrane receptor A signal receptor present as See also small interfering RNAs (siRNAs).
individual have the same self marker, called an integral protein in the cell membrane, such microtubule In eukaryotic cells, a long, hollow
an MHC protein. as GPCRs, chemically gated ion channels in protein cylinder, composed of the protein
co
Malpighian tubules Blind tubules opening into neurons, and RTKs. tubulin; these influence cell shape, move the
the hindgut of terrestrial arthropods; they Mendelian ratio The characteristic dominant- chromosomes in cell division, and provide the
function as excretory organs. to-recessive phenotypic ratios that Mendel functional internal structure of cilia and flagella.
mandibles In crustaceans, insects, and myriapods, observed in his genetics experiments. For microvillus Cytoplasmic projection from epithelial
y.
the appendages immediately posterior to the example, the F2 generation in a monohybrid cells; microvilli greatly increase the surface area
antennae; used to seize, hold, bite, or chew food. cross shows a ratio of 3:1; the F2 generation in a of the small intestine.
mantle The soft, outermost layer of the body wall dihybrid cross shows a ratio of 9:3:3:1. middle lamella The layer of intercellular material,
in mollusks; the mantle secretes the shell. menstruation Periodic sloughing off of the blood- rich in pectic compounds, that cements together
bl
map unit Each 1% of recombination frequency enriched lining of the uterus when pregnancy the primary walls of adjacent plant cells.
between two genetic loci; the unit is termed a does not occur. mimicry The resemblance in form, color, or
centimorgan (cM) or simply a map unit (m.u.). meristem Undifferentiated plant tissue from behavior of certain organisms (mimics) to other
ee
marsupial A mammal in which the young are born which new cells arise. more powerful or more protected ones (models).
early in their development, sometimes as soon meroblastic cleavage A type of cleavage in the miracidium The ciliated first-stage larva inside
as eight days after fertilization, and are retained eggs of reptiles, birds, and some fish. Occurs the egg of the liver fluke; eggs are passed in
in a pouch. only on the blastodisc. feces, and if they reach water they may be
mass extinction A relatively sudden, sharp decline mesoderm One of the three embryonic germ eaten by a host snail in which they continue
.w
in the number of species; for example, the layers that form in the gastrula; gives rise to their life cycle.
extinction at the end of the Cretaceous period muscle, bone and other connective tissue, the missense mutation A base substitution mutation that
in which the dinosaurs and a variety of other peritoneum, the circulatory system, and most of results in the alteration of a single amino acid.
organisms disappeared. the excretory and reproductive systems. mitochondrion The organelle called the powerhouse
mass flow hypothesis The overall process by
which materials move in the phloem of plants.
mast cells Leukocytes with granules containing
molecules that initiate inflammation.
maternal inheritance A mode of uniparental
cs
mesophyll The photosynthetic parenchyma of a
leaf, located within the epidermis.
messenger RNA (mRNA) The RNA transcribed
from structural genes; RNA molecules
complementary to a portion of one strand of
of the cell. Consists of an outer membrane, an
elaborate inner membrane that supports electron
transport and chemiosmotic synthesis of ATP, and
a soluble matrix containing Krebs cycle enzymes.
mitogen-activated protein (MAP) kinase Any
si
inheritance from the female parent; for Apago PDF Enhancer
DNA, which are translated by the ribosomes to of a class of protein kinases that activate
example, in humans mitochondria and their form protein. transcription factors to alter gene expression.
genomes are inherited from the mother. metabolism The sum of all chemical processes A mitogen is any molecule that stimulates
hy
matrix In mitochondria, the solution in the occurring within a living cell or organism. cell division. MAP kinases are activated by
interior space surrounded by the cristae that metamorphosis Process in which a marked change kinase cascades.
contains the enzymes and other molecules in form takes place during postembryonic mitosis Somatic cell division; nuclear division in
involved in oxidative respiration; more development as, for example, from tadpole which the duplicated chromosomes separate to
p
generally, that part of a tissue within which an to frog. form two genetically identical daughter nuclei.
organ or process is embedded. metaphase The stage of mitosis or meiosis during molar concentration Concentration expressed as
medusa A free-floating, often umbrella-shaped body which microtubules become organized into a moles of a substance in 1 L of pure water.
ar
form found in cnidarian animals, such as jellyfish. spindle and the chromosomes come to lie in the mole The weight of a substance in grams that
megapascal (MPa) A unit of measure used for spindles equatorial plane. corresponds to the atomic masses of all the
pressure in water potential. metastasis The process by which cancer cells component atoms in a molecule of that
megaphyll In plants, a leaf that has several to many move from their point of origin to other substance. One mole of a compound always
sw
veins connecting it to the vascular cylinder of locations in the body; also, a population of contains 6.023 1023 molecules.
the stem; most plants have megaphylls. cancer cells in a secondary location, the result molecular clock method In evolutionary theory,
mesoglea A layer of gelatinous material found of movement from the primary tumor. the method in which the rate of evolution of a
between the epidermis and gastrodermis of methanogens Obligate, anaerobic archaebacteria molecule is constant through time.
eumetazoans; it contains the muscles in most of that produce methane. molecular cloning The isolation and amplification
.a
these animals. microarray DNA sequences are placed on a of a specific sequence of DNA.
mesohyl A gelatinous, protein-rich matrix found microscope slide or chip with a robot. The monocot Short for monocotyledon; flowering plant
between the choanocyte layer and the epithelial microarray can then be probed with RNA from in which the embryos have only one cotyledon,
w
layer of the body of a sponge; various types of specific tissues to identify expressed DNA. the floral parts are generally in threes, and the
amoeboid cells may occur in the mesohyl. microbody A cellular organelle bounded by a single leaves typically are parallel-veined.
metacercaria An encysted form of a larval liver membrane and containing a variety of enzymes; monocyte A type of leukocyte that becomes a
fluke, found in muscle tissue of an infected generally derived from endoplasmic reticulum; phagocytic cell (macrophage) after moving
w
animal; if the muscle is eaten, cysts dissolves in includes peroxisomes and glyoxysomes. into tissues.
the digestive tract, releasing the flukes into the microevolution Refers to the evolutionary process monoecious A plant in which the staminate and
body of the new host. itself. Evolution within a species. Also called pistillate flowers are separate, but borne on the
w
glossary G-13
m
which a chromosome has been lost due to mycelium, pl. mycelia In fungi, a mass of hyphae. intimately associated with neurons and appear
nondisjunction during meiosis, producing mycorrhiza, pl. mycorrhizae A symbiotic association to provide nutritional support.
a diploid embryo with only one of these between fungi and the roots of a plant. neuromuscular junction The structure formed
autosomes. myelin sheath A fatty layer surrounding the long when the tips of axons contact (innervate) a
co
monotreme An egg-laying mammal. axons of motor neurons in the peripheral muscle fiber.
morphogen A signal molecule produced by an nervous system of vertebrates. neuron A nerve cell specialized for signal
embryonic organizer region that informs myofilament A contractile microfilament, composed transmission; includes cell body, dendrites,
surrounding cells of their distance from the largely of actin and myosin, within muscle. and axon.
y.
organizer, thus determining relative positions of myosin One of the two protein components of neurotransmitter A chemical released at the axon
cells during development. microfilaments (the other is actin); a principal terminal of a neuron that travels across the
morphogenesis The development of an component of vertebrate muscle. synaptic cleft, binds a specific receptor on
organisms body form, namely its organs and the far side, and depending on the nature
bl
anatomical features; it may involve apoptosis as of the receptor, depolarizes or hyperpolarizes
well as cell division, differentiation, and changes N a second neuron or a muscle or gland cell.
in cell shape. natural killer cell A cell that does not kill invading neurulation A process in early embryonic
ee
morphology The form and structure of an microbes, but rather, the cells infected by them. development by which a dorsal band of
organism. natural selection The differential reproduction ectoderm thickens and rolls into the neural tube.
morula Solid ball of cells in the early stage of of genotypes; caused by factors in the neutrophil An abundant type of granulocyte capable
embryonic development. environment; leads to evolutionary change. of engulfing microorganisms and other foreign
mosaic development A pattern of embryonic nauplius A larval form characteristic of particles; neutrophils comprise about 5070% of
.w
development in which initial cells produced crustaceans. the total number of white blood cells.
by cleavage divisions contain different negative control A type of control at the level niche The role played by a particular species in its
developmental signals (determinants) from the of DNA transcription initiation in which the environment.
egg, setting the individual cells on different frequency of initiation is decreased; repressor nicotinamide adenine dinucleotide (NAD) A
developmental paths.
motif A substructure in proteins that confers
function and can be found in multiple proteins.
One example is the helix-turn-helix motif
cs
proteins mediate negative control.
negative feedback A homeostatic control
mechanism whereby an increase in some
substance or activity inhibits the process
molecule that becomes reduced (to NADH) as
it carries high-energy electrons from oxidized
molecules and delivers them to ATP-producing
pathways in the cell.
found in a number of proteins that is used to leading to the increase; also known as feedback NADH dehydrogenase An enzyme located on the
si
bind to DNA. Apago PDF Enhancer
inhibition. inner mitochondrial membrane that catalyzes
motor (efferent) neuron Neuron that transmits nematocyst A harpoonlike structure found in the the oxidation by NAD+ of pyruvate to acetyl-
nerve impulses from the central nervous cnidocytes of animals in the phylum Cnidaria, CoA. This reaction links glycolysis and the
hy
system to an effector, which is typically a which includes the jellyfish among other Krebs cycle.
muscle or gland. groups; the nematocyst, when released, stings nitrification The oxidization of ammonia or nitrite
M phase The phase of cell division during which and helps capture prey. to produce nitrate, the form of nitrogen taken
chromosomes are separated. The spindle nephridium, pl. nephridia In invertebrates, a up by plants; some bacteria are capable of
p
enzyme active at the G2/M checkpoint. waste pass from the body across the membrane nocturnal Active primarily at night.
Mllerian mimicry A phenomenon in which into a collecting organ, from which they are node The part of a plant stem where one or more
two or more unrelated but protected species expelled to the outside through a pore. leaves are attached. See internode.
resemble one another, thus achieving a kind of nephron Functional unit of the vertebrate node of Ranvier A gap formed at the point
sw
group defense. kidney; one of numerous tubules involved in where two Schwann cells meet and where the
multidrug-resistant (MDR) strain Any bacterial filtration and selective reabsorption of blood; axon is in direct contact with the surrounding
strain that has become resistant to more than each nephron consists of a Bowmans capsule, intercellular fluid.
one antibiotic drug; MDR Staphylococcus strains, an enclosed glomerulus, and a long attached nodule In plants, a specialized tissue that
for example, are responsible for many infection tubule; in humans, called a renal tubule. surrounds and houses beneficial bacteria,
.a
deaths. nephrostome The funnel-shaped opening that such as root nodules of legumes that contain
multienzyme complex An assembly consisting of leads to the nephridium, which is the excretory nitrogen-fixing bacteria.
several enzymes catalyzing different steps in a organ of mollusks. nonassociative learning A learned behavior
w
sequence of reactions. Close proximity of these nerve A group or bundle of nerve fibers (axons) that does not require an animal to form an
related enzymes speeds the overall process, with accompanying neurological cells, held association between two stimuli, or between a
making it more efficient. together by connective tissue; located in the stimulus and a response.
multigene family A collection of related genes peripheral nervous system. noncompetitive inhibitor An inhibitor that binds
w
on a single chromosome or on different nerve cord One of the distinguishing features of to a location other than the active site of an
chromosomes. chordates, running lengthwise just beneath enzyme, changing the enzymes shape so that it
muscle fiber A long, cylindrical, multinucleated the embryos dorsal surface; in vertebrates, cannot bind the substrate.
w
cell containing numerous myofibrils, which is differentiates into the brain and spinal cord. noncyclic photophosphorylation The set of
capable of contraction when stimulated. neural crest A special strip of cells that develops light-dependent reactions of the two plant
mutagen An agent that induces changes in DNA just before the neural groove closes over photosystems, in which excited electrons
(mutations); includes physical agents that damage to form the neural tube in embryonic are shuttled between the two photosystems,
DNA and chemicals that alter DNA bases. development. producing a proton gradient that is used for the
G-14 glossary
m
nonextreme archaea Archaean groups that are electron shell. to the side containing a higher
not extremophiles, living in more moderate Okazaki fragment A short segment of DNA concentration.
environments on Earth today. produced by discontinuous replication elongating osmotic concentration The property of a
nonpolar Said of a covalent bond that involves equal in the 5-to-3 direction away from the replication. solution that takes into account all dissolved
co
sharing of electrons. Can also refer to a compound olfaction The function of smelling. solutes in the solution; if two solutions with
held together by nonpolar covalent bonds. ommatidium, pl. ommatidia The visual unit in different osmotic concentrations are separated
nonsense codon One of three codons (UAA, the compound eye of arthropods; contains light- by a water-permeable membrane, water will
UAG, and UGA) that are not recognized by sensitive cells and a lens able to form an image. move from the solution with lower osmotic
oncogene A mutant form of a growth-regulating
y.
tRNAs, thus serving as stop signals in the concentration to the solution with higher
mRNA message and terminating translation. gene that is inappropriately on, causing osmotic concentration.
nonsense mutation A base substitution in which a unrestrained cell growth and division. osmotic pressure The potential pressure
codon is changed into a stop codon. The protein oocyst The zygote in a sporozoan life cycle. developed by a solution separated from pure
bl
is truncated because of premature termination. It is surrounded by a tough cyst to prevent water by a differentially permeable membrane.
Northern blot A blotting technique used to dehydration or other damage. The higher the solute concentration, the
identify a specific mRNA sequence in a open circulatory system A circulatory system in greater the osmotic potential of the solution;
ee
complex mixture. See Southern blot. which the blood flows into sinuses in which also called osmotic potential.
notochord In chordates, a dorsal rod of cartilage it mixes with body fluid and then reenters the ossicle Any of a number of movable or fixed
that runs the length of the body and forms the vessels in another location. calcium-rich plates that collectively make up
primitive axial skeleton in the embryos of all open reading frame (ORF) A region of DNA that the endoskeleton of echinoderms.
chordates. encodes a sequence of amino acids with no stop osteoblast A bone-forming cell.
.w
nucellus Tissue composing the chief pair of young codons in the reading frame. osteocyte A mature osteoblast.
ovules, in which the embryo sac develops; operant conditioning A learning mechanism in outcrossing Breeding with individuals other than
equivalent to a megasporangium. which the reward follows only after the correct oneself or ones close relatives.
nuclear envelope The bounding structure of behavioral response. ovary (1) In animals, the organ in which eggs are
operator A regulatory site on DNA to which
the eukaryotic nucleus. Composed of two
phospholipid bilayers with the outer one
connected to the endoplasmic reticulum.
nuclear pore One of a multitude of tiny but
complex openings in the nuclear envelope that
cs
a repressor can bind to prevent or decrease
initiation of transcription.
operculum A flat, bony, external protective
covering over the gill chamber in fish.
produced. (2) In flowering plants, the enlarged
basal portion of a carpel that contains the
ovule(s); the ovary matures to become
the fruit.
oviduct In vertebrates, the passageway through
si
allow selective passage of proteins and nucleic Apago PDF Enhancer
operon A cluster of adjacent structural genes which ova (eggs) travel from the ovary to
acids into and out of the nucleus. transcribed as a unit into a single mRNA the uterus.
nuclear receptor Intracellular receptors are found molecule. oviparity Refers to a type of reproduction in which
hy
in both the cytoplasm and the nucleus. The site opisthosoma The posterior portion of the body of the eggs are developed after leaving the body of
of action of the hormonereceptor complex an arachnid. the mother, as in reptiles.
is in the nucleus where they modify gene oral surface The surface on which the mouth is ovoviviparity Refers to a type of reproduction in
expression. found; used as a reference when describing the which young hatch from eggs that are retained
body structure of echinoderms because of their
p
nucleic acid A nucleotide polymer; chief types are in the mothers uterus.
deoxyribonucleic acid (DNA), which is double- adult radial symmetry. ovulation In animals, the release of an egg or eggs
stranded, and ribonucleic acid (RNA), which is orbital A region around the nucleus of an atom from the ovary.
ar
typically single-stranded. with a high probability of containing an ovum, pl. ova The egg cell; female gamete.
nucleoid The area of a prokaryotic cell, usually electron. The position of electrons can only be oxidation Loss of an electron by an atom or
near the center, that contains the genome in the described by these probability distributions. molecule; in metabolism, often associated with
form of DNA compacted with protein. order A category of classification above the level of a gain of oxygen or a loss of hydrogen.
sw
nucleolus In eukaryotes, the site of rRNA family and below that of class. oxidationreduction reaction A type of paired
synthesis; a spherical body composed chiefly of organ A body structure composed of several reaction in living systems in which electrons
rRNA in the process of being transcribed from different tissues grouped in a structural and lost from one atom (oxidation) are gained
multiple copies of rRNA genes. functional unit. by another atom (reduction). Termed a redox
nucleosome A complex consisting of a DNA duplex organelle Specialized part of a cell; literally, a reaction for short.
.a
wound around a core of eight histone proteins. small cytoplasmic organ. oxidative phosphorylation Synthesis of ATP
nucleotide A single unit of nucleic acid, composed orthologues Genes that reflect the conservation of by ATP synthase using energy from a
of a phosphate, a five-carbon sugar (either ribose a single gene found in an ancestor. proton gradient. The proton gradient is
oscillating selection The situation in which
w
eukaryotic cells, the membranous organelle that conditions versus during wet conditions. during exercise back into glucose.
houses the chromosomal DNA; in the central osculum A specialized, larger pore in sponges oxytocin A hormone of the posterior pituitary
nervous system, a cluster of nerve cell bodies. through which filtered water is forced to the gland that affects uterine contractions during
w
nutritional mutation A mutation affecting a outside of the body. childbirth and stimulates lactation.
synthetic pathway for a vital compound, such osmoconformer An animal that maintains the ozone O3, a stratospheric layer of the Earths
as an amino acid or vitamin; microorganisms osmotic concentration of its body fluids at atmosphere responsible for filtering
with a nutritional mutation must be grown on about the same level as that of the medium in out ultraviolet radiation supplied by
medium that supplies the missing nutrient. which it is living. the Sun.
glossary G-15
m
pacemaker A patch of excitatory tissue in the responsible for catalyzing the formation of a substrates and secretes a chitinous tube in which
vertebrate heart that initiates the heartbeat. peptide bond between each new amino acid it lives out its life; it extends its lophophore
pair-rule gene Any of certain genes in Drosophila and the previous amino acid in a growing tentacles to feed on drifting food particles.
development controlled by the gap genes that polypeptide chain. phosphatase Any of a number of enzymes that
co
are expressed in stripes that subdivide the perianth In flowering plants, the petals and sepals removes a phosphate group from a protein,
embryo in the process of segmentation. taken together. reversing the action of a kinase.
paleopolyploid An ancient polyploid organism pericycle In vascular plants, one or more cell phosphodiester bond The linkage between
used in analysis of polyploidy events in the layers surrounding the vascular tissues of the two sugars in the backbone of a nucleic acid
y.
study of a species genome evolution. root, bounded externally by the endodermis molecule; the phosphate group connects the
palisade parenchyma In plant leaves, the and internally by the phloem. pentose sugars through a pair of ester bonds.
columnar, chloroplast-containing parenchyma periderm Outer protective tissue in vascular phospholipid Similar in structure to a fat, but
cells of the mesophyll. Also called palisade cells. plants that is produced by the cork cambium having only two fatty acids attached to the
bl
panspermia The hypothesis that meteors or and functionally replaces epidermis when it glycerol backbone, with the third space linked
cosmic dust may have brought significant is destroyed during secondary growth; the to a phosphorylated molecule; contains a polar
amounts of complex organic molecules to periderm includes the cork, cork cambium, and hydrophilic head end (phosphate group) and
ee
Earth, kicking off the evolution of life. phelloderm. a nonpolar hydrophobic tail end (fatty acids).
papilla A small projection of tissue. peristalsis In animals, a series of alternating phospholipid bilayer The main component
paracrine A type of chemical signaling between cells contracting and relaxing muscle movements of cell membranes; phospholipids naturally
in which the effects are local and short-lived. along the length of a tube such as the oviduct associate in a bilayer with hydrophobic fatty
paralogues Two genes within an organism that or alimentary canal that tend to force material acids oriented to the inside and hydrophilic
.w
arose from the duplication of one gene in an such as an egg cell or food through the tube. phosphate groups facing outward on both sides.
ancestor. peroxisome A microbody that plays an important phosphorylation Chemical reaction resulting in
paraphyletic In phylogenetic classification, a group role in the breakdown of highly oxidative the addition of a phosphate group to an organic
that includes the most recent common ancestor hydrogen peroxide by catalase. molecule. Phosphorylation of ADP yields ATP.
of the group, but not all its descendants.
parapodia One of the paired lateral processes on each
side of most segments in polychaete annelids.
parasexuality In certain fungi, the fusion and
cs
petal A flower part, usually conspicuously colored;
one of the units of the corolla.
petiole The stalk of a leaf.
phage conversion The phenomenon by which
Many proteins are also activated or inactivated
by phosphorylation.
photoelectric effect The ability of a beam of light
to excite electrons, creating an electrical current.
segregation of heterokaryotic haploid nuclei to DNA from a virus, incorporated into a host photon A particle of light having a discrete amount
si
produce recombinant nuclei. Apago PDF Enhancer
cells genome, alters the host cells function in a of energy. The wave concept of light explains
parasitism A living arrangement in which an significant way; for example, the conversion of the different colors of the spectrum, whereas
organism lives on or in an organism of a Vibrio cholerae bacteria into a pathogenic form the particle concept of light explains the energy
hy
different species and derives nutrients from it. that releases cholera toxin. transfers during photosynthesis.
parenchyma cell The most common type of plant phage lambda () A well-known bacteriophage photoperiodism The tendency of biological
cell; characterized by large vacuoles, thin walls, that has been widely used in genetic studies and reactions to respond to the duration and timing
and functional nuclei. is often a vector for DNA libraries. of day and night; a mechanism for measuring
p
parthenogenesis The development of an egg phagocyte Any cell that engulfs and devours seasonal time.
without fertilization, as in aphids, bees, ants, microorganisms or other particles. photoreceptor A light-sensitive sensory cell.
and some lizards. phagocytosis Endocytosis of a solid particle; the photorespiration Action of the enzyme rubisco,
ar
partial diploid (merodiploid) Describes an E. coli plasma membrane folds inward around the which catalyzes the oxidization of RuBP,
cell that carries an F plasmid with host genes. particle (which may be another cell) and engulfs releasing CO2; this reverses carbon fixation and
This makes the cell diploid for the genes it to form a vacuole. can reduce the yield of photosynthesis.
carried by the F plasmid. pharyngeal pouches In chordates, embryonic photosystem An organized complex of
sw
partial pressure The components of each regions that become pharyngeal slits in aquatic chlorophyll, other pigments, and proteins that
individual gassuch as nitrogen, oxygen, and and marine chordates and vertebrates, but traps light energy as excited electrons. Plants
carbon dioxidethat together constitute the do not develop openings to the outside in have two linked photosystems in the thylakoid
total air pressure. terrestrial vertebrates. membrane of chloroplasts. Photosystem II
passive transport The movement of substances pharyngeal slits One of the distinguishing features passes an excited electron through an electron
.a
across a cells membrane without the of chordates; a group of openings on each side transport chain to photosystem I to replace
expenditure of energy. of the anterior region that form a passageway an excited electron passed to NADPH. The
pedigree A consistent graphic representation from the pharynx and esophagus to the external electron lost from photosystem II is replaced by
w
found in arachnids; in male spiders, these are phenotype The realized expression of the basicity. Defined as the negative log of H+
specialized as copulatory organs, whereas in genotype; the physical appearance or functional concentration. Ranges from 0 to 14. A value
scorpions they are large pincers. expression of a trait. of 7 is neutral; below 7 is acidic and above 7
w
pelagic Free-swimming, usually in open water. pheromone Chemical substance released by is basic.
pellicle A tough, flexible covering in ciliates and one organism that influences the behavior or phycobiloprotein A type of accessory pigment
euglenoids. physiological processes of another organism found in cyanobacteria and some algae.
pentaradial symmetry The five-part radial of the same species. Pheromones serve as sex Complexes of phycobiloprotein are able to
symmetry characteristic of adult echinoderms. attractants, as trail markers, and as alarm signals. absorb light energy in the green range.
G-16 glossary
m
phylogenetic relationships. plasmid A small fragment of extrachromosomal sequence of interest repeatedly, making millions
phylogenetic tree A pattern of descent generated DNA, usually circular, that replicates of copies of the same DNA.
by analysis of similarities and differences among independently of the main chromosome, polymorphism The presence in a population of
organisms. Modern gene-sequencing techniques although it may have been derived from it. more than one allele of a gene at a frequency
co
have produced phylogenetic trees showing the plasmodesmata In plants, cytoplasmic connections greater than that of newly arising mutations.
evolutionary history of individual genes. between adjacent cells. polyp A typically sessile, cylindrical body form
phylogeny The evolutionary history of an plasmodium Stage in the life cycle of found in cnidarian animals, such as hydras.
organism, including which species are closely myxomycetes (plasmodial slime molds); a polypeptide A molecule consisting of many
y.
related and in what order related species multinucleate mass of protoplasm surrounded joined amino acids; not usually as complex
evolved; often represented in the form of an by a membrane. as a protein.
evolutionary tree. plasmolysis The shrinking of a plant cell in a polyphyletic In phylogenetic classification, a group
phylum, pl. phyla A major category, between hypertonic solution such that it pulls away from that does not include the most recent common
bl
kingdom and class, of taxonomic classifications. the cell wall. ancestor of all members of the group.
physical map A map of the DNA sequence of plastid An organelle in the cells of photosynthetic polyploidy Condition in which one or more entire
a chromosome or genome based on actual eukaryotes that is the site of photosynthesis sets of chromosomes is added to the diploid
ee
landmarks within the DNA. and, in plants and green algae, of starch storage. genome.
phytochrome A plant pigment that is associated platelet In mammals, a fragment of a white blood polysaccharide A carbohydrate composed of many
with the absorption of light; photoreceptor for cell that circulates in the blood and functions in monosaccharide sugar subunits linked together
red to far-red light. the formation of blood clots at sites of injury. in a long chain; examples are glycogen, starch,
phytoestrogen One of a number of secondary pleiotropy Condition in which an individual allele and cellulose.
.w
metabolites in some plants that are structurally has more than one effect on production of the polyunsaturated fat A fat molecule having at least
and functionally similar to the animal hormone phenotype. two double bonds between adjacent carbons in
estrogen. plesiomorphy In cladistics, another term for an one or more of the fatty acid chains.
phytoremediation The process that uses plants to ancestral character state. population Any group of individuals, usually of
remove contamination from soil or water.
pigment A molecule that absorbs light.
pilus, pl. pili Extensions of a bacterial cell enabling
it to transfer genetic materials from one
individual to another or to adhere to substrates.
cs
plumule The epicotyl of a plant with its two
young leaves.
point mutation An alteration of one nucleotide in
a chromosomal DNA molecule.
polar body Minute, nonfunctioning cell produced
a single species, occupying a given area at the
same time.
population genetics The study of the properties
of genes in populations.
positive control A type of control at the level
si
pinocytosis The process of fluid uptake by Apago PDF Enhancer
during the meiotic divisions leading to gamete of DNA transcription initiation in which the
endocytosis in a cell. formation in vertebrates. frequency of initiation is increased; activator
pistil Central organ of flowers, typically consisting polar covalent bond A covalent bond in which proteins mediate positive control.
hy
of ovary, style, and stigma; a pistil may consist electrons are shared unequally due to differences posttranscriptional control A mechanism of
of one or more fused carpels and is more in electronegativity of the atoms involved. One control over gene expression that operates after
technically and better known as the gynoecium. atom has a partial negative charge and the other a the transcription of mRNA is complete.
pith The ground tissue occupying the center of the partial positive charge, even though the molecule postzygotic isolating mechanism A type of
p
stem or root within the vascular cylinder. is electrically neutral overall. reproductive isolation in which zygotes are
pituitary gland Endocrine gland at the base of polarity (1) Refers to unequal charge distribution produced but are unable to develop into
the hypothalamus composed of anterior and in a molecule such as water, which has a positive reproducing adults; these mechanisms may
ar
posterior lobes. Pituitary hormones affect a region and a negative region although it is range from inviability of zygotes or embryos to
wide variety of processes in vertebrates. neutral overall. (2) Refers to axial differences adults that are sterile.
placenta, pl. placentae (1) In flowering plants, in a developing embryo that result in anterior potential energy Energy that is not being used,
the part of the ovary wall to which the ovules posterior and dorsalventral axes in a bilaterally but could be; energy in a potentially usable
sw
or seeds are attached. (2) In mammals, a tissue symmetrical animal. form; often called energy of position.
formed in part from the inner lining of the polarize In cladistics, to determine whether precapillary sphincter A ring of muscle that
uterus and in part from other membranes, character states are ancestral or derived. guards each capillary loop and that, when
through which the embryo (later the fetus) pollen tube A tube formed after germination of closed, blocks flow through the capillary.
is nourished while in the uterus and through the pollen grain; carries the male gametes into pre-mRNA splicing In eukaryotes, the process by
.a
which wastes are carried away. the ovule. which introns are removed from the primary
plankton Free-floating, mostly microscopic, pollination The transfer of pollen from an anther transcript to produce mature mRNA; pre-
aquatic organisms. to a stigma. mRNA splicing occurs in the nucleus.
w
plant receptor kinase Any of a group of plant polyandry The condition in which a female mates pressure potential In plants, the turgor
membrane receptors that, when activated with more than one male. pressure resulting from pressure against the
by binding ligand, have kinase enzymatic polyclonal antibody An antibody response cell wall.
activity. These receptors phosphorylate serine in which an antigen elicits many different prezygotic isolating mechanism A type of
w
or threonine, unlike RTKs in animals that antibodies, each fitting a different portion of reproductive isolation in which the formation
phosphorylate tyrosine. the antigen surface. of a zygote is prevented; these mechanisms
planula A ciliated, free-swimming larva produced polygenic inheritance Describes a mode of may range from physical separation in different
w
by the medusae of cnidarian animals. inheritance in which more than one gene habitats to gametic in which gametes are
plasma The fluid of vertebrate blood; contains affects a trait, such as height in human incapable of fusing.
dissolved salts, metabolic wastes, hormones, beings; polygenic inheritance may produce a primary endosperm nucleus In flowering plants,
and a variety of proteins, including antibodies continuous range of phenotypic values, rather the result of the fusion of a sperm nucleus and
and albumin; blood minus the blood cells. than discrete eitheror values. the (usually) two polar nuclei.
glossary G-17
m
primary response will respond more quickly. prosimian Any member of the mammalian group phases.
primary induction Inductions between the three that is a sister group to the anthropoids; purine The larger of the two general kinds of
primary tissue types: mesoderm and endoderm. prosimian means before monkeys. Members nucleotide base found in DNA and RNA; a
primary meristem Any of the three meristems include the lemurs, lorises, and tarsiers. nitrogenous base with a double-ring structure,
co
produced by the apical meristem; primary prosoma The anterior portion of the body of an such as adenine or guanine.
meristems give rise to the dermal, vascular, and arachnid, which bears all the appendages. pyrimidine The smaller of two general kinds of
ground tissues. prostaglandins A group of modified fatty acids nucleotide base found in DNA and RNA; a
primary nondisjunction Failure of chromosomes that function as chemical messengers. nitrogenous base with a single-ring structure,
y.
to separate properly at meiosis I. prostate gland In male mammals, a mass of such as cytosine, thymine, or uracil.
primary phloem The cells involved in food glandular tissue at the base of the urethra that pyruvate A three-carbon molecule that is the end
conduction in plants. secretes an alkaline fluid that has a stimulating product of glycolysis; each glucose molecule
primary plant body The part of a plant consisting effect on the sperm as they are released. yields two pyruvate molecules.
bl
of young, soft shoots and roots derived from protease An enzyme that degrades proteins by
apical meristem tissues.
primary productivity The amount of energy
breaking peptide bonds; in cells, proteases are
often compartmentalized into vesicles such
Q
quantitative trait A trait that is determined by
ee
produced by photosynthetic organisms in a as lysosomes.
the effects of more than one gene; such a trait
community. proteasome A large, cylindrical cellular organelle
usually exhibits continuous variation rather
primary structure The specific amino acid that degrades proteins marked with ubiquitin.
than discrete eitheror values.
sequence of a protein. protein A chain of amino acids joined by peptide
quaternary structure The structural level
primary tissues Tissues that make up the primary bonds.
.w
of a protein composed of more than one
plant body. protein kinase An enzyme that adds phosphate
polypeptide chain, each of which has its own
primary transcript The initial mRNA molecule groups to proteins, changing their activity.
tertiary structure; the individual chains are
copied from a gene by RNA polymerase, protein microarray An array of proteins on a
called subunits.
containing a faithful copy of the entire gene, microscope slide or silicon chip. The array
including introns as well as exons.
primary wall In plants, the wall layer deposited
during the period of cell expansion.
primase The enzyme that synthesizes the RNA
cs
may be used with a variety of probes, including
antibodies, to analyze the presence or absence
of specific proteins in a complex mixture.
proteome All the proteins coded for by a
R
radial canal Any of five canals that connect to the
ring canal of an echinoderms watervascular
primers required by DNA polymerases. particular genome. system.
si
primate Monkeys and apes (including humans). Apago PDF Enhancer
proteomics The study of the proteomes of radial cleavage The embryonic cleavage pattern
primitive streak In the early embryos of birds, organisms. This is related to functional of deuterostome animals in which cells divide
reptiles, and mammals, a dorsal, longitudinal genomics as the proteome is responsible for parallel to and at right angles to the polar axis
hy
strip of ectoderm and mesoderm that is much of the function encoded by a genome. of the embryo.
equivalent to the blastopore in other forms. protoderm The primary meristem that gives rise radial symmetry A type of structural symmetry
primordium In plants, a bulge on the young shoot to the dermal tissue. with a circular plan, such that dividing the
produced by the apical meristem; primordia proton pump A protein channel in a membrane of body or structure through the midpoint in any
p
can differentiate into leaves, other shoots, the cell that expends energy to transport protons direction yields two identical sections.
or flowers. against a concentration gradient; involved in the radicle The part of the plant embryo that develops
principle of parsimony Principle stating that chemiosmotic generation of ATP. into the root.
ar
scientists should favor the hypothesis that proto-oncogene A normal cellular gene that can radioactive isotope An isotope that is unstable
requires the fewest assumptions. act as an oncogene when mutated. and undergoes radioactive decay, releasing
prions Infectious proteinaceous particles. protostome Any member of a grouping of energy.
procambium In vascular plants, a primary bilaterally symmetrical animals in which the radioactivity The emission of nuclear particles and
sw
meristematic tissue that gives rise to primary mouth develops first and the anus second; rays by unstable atoms as they decay into more
vascular tissues. flatworms, nematodes, mollusks, annelids, and stable forms.
product rule See rule of multiplication. arthropods are protostomes. radula Rasping tongue found in most mollusks.
proglottid A repeated body segment in pseudocoel A body cavity located between the reaction center A transmembrane protein
tapeworms that contains both male and female endoderm and mesoderm. complex in a photosystem that receives
.a
reproductive organs; proglottids eventually pseudogene A copy of a gene that is not energy from the antenna complex exciting
form eggs and embryos, which leave the hosts transcribed. an electron that is passed to an acceptor
body in feces. pseudomurien A component of the cell wall molecule.
w
prokaryote A bacterium; a cell lacking a of archaea; it is similar to peptidoglycan in reading frame The correct succession of
membrane-bounded nucleus or membrane- structure and function but contains different nucleotides in triplet codons that specify amino
bounded organelles. components. acids on translation. The reading frame is
prometaphase The transitional phase between pseudopod A nonpermanent cytoplasmic established by the first codon in the sequence as
w
prophase and metaphase during which the extension of the cell body. there are no spaces in the genetic code.
spindle attaches to the kinetochores of sister P site In a ribosome, the peptidyl site that binds to realized niche The actual niche occupied by
chromatids. the tRNA attached to the growing polypeptide an organism when all biotic and abiotic
w
promoter A DNA sequence that provides a chain. interactions are taken into account.
recognition and attachment site for RNA punctuated equilibrium A hypothesis about the receptor-mediated endocytosis Process by which
polymerase to begin the process of gene mechanism of evolutionary change proposing specific macromolecules are transported into
transcription; it is located upstream from the that long periods of little or no change are eukaryotic cells at clathrin-coated pits, after
transcription start site. punctuated by periods of rapid evolution. binding to specific cell-surface receptors.
G-18 glossary
m
activation can lead to diverse cellular responses. colonies growing on a Petri plate is made on a underground stem; may be enlarged for storage
recessive An allele that is only expressed when velvet surface, which is then used to transfer the or may function in vegetative reproduction.
present in the homozygous condition, but being colonies to plates containing different media, rhynchocoel A true coelomic cavity in
hidden by the expression of a dominant allele such that auxotrophs can be identified. ribbonworms that serves as a hydraulic power
co
in the heterozygous condition. replication fork The Y-shaped end of a growing source for extending the proboscis.
redia A secondary, nonciliated larva produced in replication bubble in a DNA molecule ribonucleic acid (RNA) A class of nucleic acids
the sporocysts of liver flukes. undergoing replication. characterized by the presence of the sugar
regulatory protein Any of a group of proteins that repolarization Return of the ions in a nerve to ribose and the pyrimidine uracil; includes
y.
modulates the ability of RNA polymerase to bind their resting potential distribution following mRNA, tRNA, and rRNA.
to a promoter and begin DNA transcription. depolarization. ribosomal RNA (rRNA) A class of RNA
replicon An origin of DNA replication and the repression In general, control of gene expression molecules found, together with characteristic
DNA whose replication is controlled by by preventing transcription. Specifically, proteins, in ribosomes; transcribed from the
bl
this origin. In prokaryotic replication, the in bacteria such as E. coli this is mediated DNA of the nucleolus.
chromosome plus the origin consist of a single by repressor proteins. In anabolic operons, ribosome The molecular machine that carries
replicon; eukaryotic chromosomes consist of repressors bind DNA in the absence of out protein synthesis; the most complicated
ee
multiple replicons. corepressors to repress an operon. aggregation of proteins in a cell, also containing
replisome The macromolecular assembly of repressor A protein that regulates DNA three different rRNA molecules.
enzymes involved in DNA replication; transcription by preventing RNA polymerase ribosome-binding sequence (RBS) In
analogous to the ribosome in protein synthesis. from attaching to the promoter and prokaryotes, a conserved sequence at the 5 end
reciprocal altruism Performance of an altruistic transcribing the structural gene. See operator. of mRNA that is complementary to the 3 end
.w
act with the expectation that the favor will reproductive isolating mechanism Any barrier of a small subunit rRNA and helps to position
be returned. A key and very controversial that prevents genetic exchange between species. the ribosome during initiation.
assumption of many theories dealing with the residual volume The amount of air remaining in ribozyme An RNA molecule that can behave
evolution of social behavior. See altruism. the lungs after the maximum amount of air has as an enzyme, sometimes catalyzing its own
reciprocal cross A genetic cross involving a single
trait in which the sex of the parents is reversed;
for example, if pollen from a white-flowered
plant is used to fertilize a purple-flowered plant,
the reciprocal cross would be pollen from a
cs
been exhaled.
resting membrane potential The charge
difference (difference in electric potential) that
exists across a neuron at rest (about 70 mV).
restriction endonuclease An enzyme that cleaves
assembly; rRNA also acts as a ribozyme in the
polymerization of amino acids to form protein.
ribulose 1,5-bisphosphate (RuBP) In the Calvin
cycle, the five-carbon sugar to which CO2 is
attached, accomplishing carbon fixation. This
si
purple-flowered plant used to fertilize a white- Apago PDF Enhancer
a DNA duplex molecule at a particular base reaction is catalyzed by the enzyme rubisco.
flowered plant. sequence, usually within or near a palindromic ribulose bisphosphate carboxylase/oxygenase
reciprocal recombination A mechanism of sequence; also called a restriction enzyme. (rubisco) The four-subunit enzyme in the
hy
genetic recombination that occurs only restriction fragment length polymorphism chloroplast that catalyzes the carbon fixation
in eukaryotic organisms, in which two (RFLP) Restriction enzymes recognize very reaction joining CO2 to RuBP.
chromosomes trade segments; can occur specific DNA sequences. Alleles of the same RNA interference A type of gene silencing in
between nonhomologous chromosomes as gene or surrounding sequences may have which the mRNA transcript is prevented
p
well as the more usual exchange between base-pair differences, so that DNA near one from being translated; small interfering RNAs
homologous chromosomes in meiosis. allele is cut into a different-length fragment (siRNAs) have been found to bind to mRNA and
recombinant DNA Fragments of DNA from two than DNA near the other allele. These target its degradation prior to its translation.
ar
different species, such as a bacterium and a different fragments separate based on size on RNA polymerase An enzyme that catalyzes the
mammal, spliced together in the laboratory into electrophoresis gels. assembly of an mRNA molecule, the sequence
a single molecule. retina The photosensitive layer of the vertebrate of which is complementary to a DNA molecule
recombination frequency The value obtained by eye; contains several layers of neurons and light used as a template. See transcription.
sw
dividing the number of recombinant progeny receptors (rods and cones); receives the image RNA primer In DNA replication, a sequence of
by the total progeny in a genetic cross. This formed by the lens and transmits it to the brain about 10 RNA nucleotides complementary to
value is converted into a percentage, and each via the optic nerve. unwound DNA that attaches at a replication
1% is termed a map unit. retinoblastoma susceptibility gene (Rb) A gene fork; the DNA polymerase uses the RNA
reduction The gain of an electron by an atom, that, when mutated, predisposes individuals to primer as a starting point for addition of DNA
.a
often with an associated proton. a rare form of cancer of the retina; one of the nucleotides to form the new DNA strand; the
reflex In the nervous system, a motor response first tumor-suppressor genes discovered. RNA primer is later removed and replaced by
subject to little associative modification; a retrovirus An RNA virus. When a retrovirus enters DNA nucleotides.
w
reflex is among the simplest neural pathways, a cell, a viral enzyme (reverse transcriptase) RNA splicing A nuclear process by which intron
involving only a sensory neuron, sometimes transcribes viral RNA into duplex DNA, sequences of a primary mRNA transcript are cut
(but not always) an interneuron, and one or which the cells machinery then replicates and out and the exon sequences spliced together to
more motor neurons. transcribes as if it were its own. give the correct linkages of genetic information
w
reflex arc The nerve path in the body that leads reverse genetics An approach by which a that will be used in protein construction.
from stimulus to reflex action. researcher uses a cloned gene of unknown rod Light-sensitive nerve cell found in the
refractory period The recovery period after function, creates a mutation, and introduces the vertebrate retina; sensitive to very dim light;
w
membrane depolarization during which the mutant gene back into the organism to assess responsible for night vision.
membrane is unable to respond to additional the effect of the mutation. root The usually descending axis of a plant,
stimulation. reverse transcriptase A viral enzyme found in normally below ground, which anchors the
reinforcement In speciation, the process by retroviruses that is capable of converting their plant and serves as the major point of entry for
which partial reproductive isolation between RNA genome into a DNA copy. water and minerals.
glossary G-19
m
absorption. impregnated with lignin. semicircular canal Any of three fluid-filled canals
root pressure In plants, pressure exerted by water secondary growth In vascular plants, an increase in the inner ear that help to maintain balance.
in the roots in response to a solute potential in stem and root diameter made possible by cell semiconservative replication DNA replication in
in the absence of transpiration; often occurs division of the lateral meristems. which each strand of the original duplex serves
co
at night. Root pressure can result in guttation, secondary immune response The swifter as the template for construction of a totally new
excretion of water from cells of leaves as dew. response of the body the second time it is complementary strand, so the original duplex
root system In plants, the portion of the plant invaded by the same pathogen because of is partially conserved in each of the two new
body that anchors the plant and absorbs ions the presence of memory cells, which quickly DNA molecules.
y.
and water. become antibody-producing plasma cells. senescent Aged, or in the process of aging.
R plasmid A resistance plasmid; a conjugative secondary induction An induction between sensory (afferent) neuron A neuron that transmits
plasmid that picks up antibiotic resistance genes tissues that have already differentiated. nerve impulses from a sensory receptor to the
and can therefore transfer resistance from one secondary metabolite A molecule not directly central nervous system or central ganglion.
bl
bacterium to another. involved in growth, development, or reproduction sensory setae In insect, bristles attached to the
rule of addition The rule stating that for two of an organism; in plants these molecules, which nervous system that are sensitive mechanical
independent events, the probability of either include nicotine, caffeine, tannins, and menthols, and chemical stimulation; most abundant on
ee
event occurring is the sum of the individual can discourage herbivores. antennae and legs.
probabilities. secondary plant body The part of a plant sepal A member of the outermost floral whorl of a
rule of multiplication The rule stating that for consisting of secondary tissues from lateral flowering plant.
two independent events, the probability of both meristem tissues; the older trunk, branches, and septation In prokaryotic cell division, the
events occurring is the product of the individual roots of woody plants. formation of a septum where new cell
.w
probabilities. secondary structure In a protein, hydrogen- membrane and cell wall is formed to separate
rumen An extra stomach in cows and related bonding interactions between CO and NH the two daughter cells.
mammals wherein digestion of cellulose occurs groups of the primary structure. septum, pl. septa A wall between two cavities.
and from which partially digested material can secondary tissue Any tissue formed from lateral sequence-tagged site (STS) A small stretch of
be ejected back into the mouth.
S
cs
meristems in trees and shrubs.
Second Law of Thermodynamics A statement
concerning the transformation of potential
energy into heat; it says that disorder (entropy)
DNA that is unique in a genome, that is, it
occurs only once; useful as a physical marker on
genomic maps.
seta, pl. setae (L., bristle) In an annelid, bristles
salicylic acid In plants, an organic molecule that is continually increasing in the universe as of chitin that help anchor the worm during
si
is a long-distance signal in systemic acquired Apago PDF Enhancer
energy changes occur, so disorder is more likely locomotion or when it is in its burrow.
resistance. than order. severe acute respiratory syndrome (SARS) A
saltatory conduction A very fast form of nerve second messenger A small molecule or ion that respiratory infection with an 8% mortality rate
hy
impulse conduction in which the impulses leap carries the message from a receptor on the that is caused by a coronavirus.
from node to node over insulated portions. target cell surface into the cytoplasm. sex chromosome A chromosome that is related to
saprobes Heterotrophic organisms that digest seed bank Ungerminated seeds in the soil of an area. sex; in humans, the sex chromosomes are the X
their food externally (e.g., most fungi). Regeneration of plants after events such as fire and Y chromosomes.
p
sarcolemma The specialized cell membrane in a often depends on the presence of a seed bank. sex-linked A trait determined by a gene carried on the
muscle cell. seed coat In plants, the outer layers of the ovule, X chromosome and absent on the Y chromosome.
sarcomere Fundamental unit of contraction in which become a relatively impermeable barrier Sexual dimorphism Morphological differences
ar
skeletal muscle; repeating bands of actin and to protect the dormant embryo and stored food. between the sexes of a species.
myosin that appear between two Z lines. segment polarity gene Any of certain genes in sexual reproduction The process of producing
sarcoplasmic reticulum The endoplasmic Drosophila development that are expressed in offspring through an alternation of fertilization
reticulum of a muscle cell. A sleeve of stripes that subdivide the stripes created by the (producing diploid cells) and meiotic reduction in
sw
membrane that wraps around each myofilament. pair-rule genes in the process of segmentation. chromosome number (producing haploid cells).
satellite DNA A nontranscribed region of segmentation The division of the developing sexual selection A type of differential
the chromosome with a distinctive base animal body into repeated units; segmentation reproduction that results from variable success
composition; a short nucleotide sequence allows for redundant systems and more efficient in obtaining mates.
repeated tandemly many thousands of times. locomotion. shared derived character In cladistics, character
.a
saturated fat A fat composed of fatty acids in segmentation gene Any of the three classes states that are shared by species and that are
which all the internal carbon atoms contain the of genes that control development of the different from the ancestral character state.
maximum possible number of hydrogen atoms. segmented body plan of insects; includes shoot In vascular plants, the aboveground portions,
w
Schwann cells The supporting cells associated with the gap genes, pair-rule genes, and segment such as the stem and leaves.
projecting axons, along with all the other nerve polarity genes. short interspersed element (SINE) Any of a type
cells that make up the peripheral nervous system. segregation The process by which alternative of retrotransposon found in humans and other
sclereid In vascular plants, a sclerenchyma cell forms of traits are expressed in offspring primates that does not contain the biochemical
w
with a thick, lignified, secondary wall having rather than blending each trait of the parents machinery needed for transposition; half a
many pits; not elongate like a fiber. in the offspring. million copies of a SINE element called Alu is
sclerenchyma cell Tough, thick-walled cells that selection The process by which some organisms nested in the LINEs of the human genome.
w
strengthen plant tissues. leave more offspring than competing ones, and shotgun sequencing The method of DNA
scolex The attachment organ at the anterior end of their genetic traits tend to appear in greater sequencing in which the DNA is randomly cut
a tapeworm. proportions among members of succeeding into small fragments, and the fragments cloned
scrotum The pouch that contains the testes in generations than the traits of those individuals and sequenced. A computer is then used to
most mammals. that leave fewer offspring. assemble a final sequence.
G-20 glossary
m
and then docks with a receptor that forms a neurons of the peripheral nervous system that spiralian A member of a group of invertebrate
channel in the ER membrane. In this way the control skeletal muscle. animals; many groups exhibit spiral cleavage.
polypeptide is released into the lumen of the ER. somite One of the blocks, or segments, of tissue Mollusks, annelids, and flatworms are examples
signal transduction The events that occur within into which the mesoderm is divided during of spiralians.
co
a cell on receipt of a signal, ligand binding to a differentiation of the vertebrate embryo. spliceosome In eukaryotes, a complex composed
receptor protein. Signal transduction pathways Southern blot A technique in which DNA of multiple snRNPs and other associated
produce the cellular response to a signaling fragments are separated by gel electrophoresis, proteins that is responsible for excision of
molecule. denatured into single-stranded DNA, and then introns and joining of exons to convert the
y.
simple sequence repeat (SSR) A one- to three- blotted onto a sheet of filter paper; the filter primary transcript into the mature mRNA.
nucleotide sequence such as CA or CCG that is is then incubated with a labeled probe to locate spongin A tough protein made by many kinds of
repeated thousands of times. DNA sequences of interest. sponges as a structural component within the
single-nucleotide polymorphism (SNP) A site S phase The phase of the cell cycle during which mesohyl.
bl
present in at least 1% of the population at DNA replication occurs. spongy parenchyma A leaf tissue composed of
which individuals differ by a single nucleotide. specialized transduction The transfer of only loosely arranged, chloroplast-bearing cells. See
These can be used as genetic markers to map a few specific genes into a bacterium, using a palisade parenchyma.
ee
unknown genes or traits. lysogenic bacteriophage as a carrier. sporangium, pl. sporangia A structure in which
sinus A cavity or space in tissues or in bone. speciation The process by which new species arise, spores are produced.
sister chromatid One of two identical copies either by transformation of one species into spore A haploid reproductive cell, usually
of each chromosome, still linked at the another, or by the splitting of one ancestral unicellular, capable of developing into an adult
centromere, produced as the chromosomes species into two descendant species. without fusion with another cell.
.w
duplicate for mitotic division; similarly, one species, pl. species A kind of organism; species are sporophyte The spore-producing, diploid
of two identical copies of each homologous designated by binomial names written in italics. (2n) phase in the life cycle of a plant having
chromosome present in a tetrad at meiosis. specific heat The amount of heat that must be alternation of generations.
small interfering RNAs (siRNAs) A class of absorbed or lost by 1 g of a substance to raise or stabilizing selection A form of selection in which
micro-RNAs that appear to be involved in
control of gene transcription and that play a
role in protecting cells from viral attack.
small nuclear ribonucleoprotein particles
(snRNP) In eukaryotes, a complex composed
cs
lower its temperature 1C.
specific transcription factor Any of a great
number of transcription factors that act in a
time- or tissue-dependent manner to increase
DNA transcription above the basal level.
selection acts to eliminate both extremes from a
range of phenotypes.
stamen The organ of a flower that produces
the pollen; usually consists of anther and
filament; collectively, the stamens make up the
si
of snRNA and protein that clusters together Apago PDF Enhancer
spectrin A scaffold of proteins that links plasma androecium.
with other snRNPs to form the spliceosome, membrane proteins to actin filaments in the starch An insoluble polymer of glucose; the chief
which removes introns from the primary cytoplasm of red blood cells, producing their food storage substance of plants.
hy
transcript. characteristic biconcave shape. start codon The AUG triplet, which indicates the
small nuclear RNA (snRNA) In eukaryotes, a spermatid In animals, each of four haploid (n) site of the beginning of mRNA translation;
small RNA sequence that, as part of a small cells that result from the meiotic divisions of this codon also codes for the amino acid
nuclear ribonucleoprotein complex, facilitates a spermatocyte; each spermatid differentiates methionine.
p
recognition and excision of introns by base- into a sperm cell. stasis A period of time during which little
pairing with the 5 end of an intron or at a spermatozoa The male gamete, usually smaller evolutionary change occurs.
branch site of the same intron. than the female gamete, and usually motile. statocyst Sensory receptor sensitive to gravity
ar
respective concentration gradients; maintains spicule Any of a number of minute needles differentiated tissue cells.
the resting membrane potential of neurons and of silica or calcium carbonate made in the stereoscopic vision Ability to perceive a single,
other cells. mesohyl by some kinds of sponges as a three-dimensional image from the simultaneous
solute A molecule dissolved in some solution; as a structural component. but slightly divergent two-dimensional images
general rule, solutes dissolve only in solutions spindle The structure composed of microtubules delivered to the brain by each eye.
.a
of similar polarity; for example, glucose (polar) radiating from the poles of the dividing cell that stigma (1) In angiosperm flowers, the region of a
dissolves in (forms hydrogen bonds with) water will ultimately guide the sister chromatids to carpel that serves as a receptive surface for pollen
(also polar), but not in vegetable oil (nonpolar). the two poles. grains. (2) Light-sensitive eyespot of some algae.
w
solute potential The amount of osmotic pressure spindle apparatus The assembly that carries out stipules Leaflike appendages that occur at the base
arising from the presence of a solute or solutes the separation of chromosomes during cell of some flowering plant leaves or stems.
in water; measure by counterbalancing the division; composed of microtubules (spindle stolon A stem that grows horizontally along the
pressure until osmosis stops. fibers) and assembled during prophase at the ground surface and may form adventitious
w
solvent The medium in which one or more solutes equator of the dividing cell. roots, such as runners of the strawberry plant.
is dissolved. spindle checkpoint The third cell-division stoma, pl. stomata In plants, a minute opening
somatic cell Any of the cells of a multicellular checkpoint, at which all chromosomes must be bordered by guard cells in the epidermis of
w
organism except those that are destined to form attached to the spindle. Passage through this leaves and stems; water passes out of a plant
gametes (germ-line cells). checkpoint commits the cell to anaphase. mainly through the stomata.
somatic cell nuclear transfer (SCNT) The spinnerets Organs at the posterior end of a stop codon Any of the three codons UAA, UAG,
transfer of the nucleus of a somatic cell into spiders abdomen that secrete a fluid protein and UGA, that indicate the point at which
an enucleated egg cell that then undergoes that becomes silk. mRNA translation is to be terminated.
glossary G-21
m
cardiac muscle. movement of water and minerals within the cell T box A transcription factor protein domain that
stroma In chloroplasts, the semiliquid substance cytoplasm that leads through plasmodesmata has been conserved, although with differing
that surrounds the thylakoid system and that that connect cells. developmental effects, in invertebrates and
contains the enzymes needed to assemble symplesiomorphy In cladistics, another term for a chordates.
co
organic molecules from CO2. shared ancestral character state. tagma, pl. tagmata A compound body section of
stromatolite A fossilized mat of ancient bacteria symporter A carrier protein in a cells membrane an arthropod resulting from embryonic fusion
formed as long as 2 bya, in which the bacterial that transports two molecules or ions in the of two or more segments; for example, head,
remains individually resemble some modern- same direction across the membrane. thorax, abdomen.
y.
day bacteria. synapomorphy In systematics, a derived character Taq polymerase A DNA polymerase isolated from
style In flowers, the slender column of tissue that that is shared by clade members. the thermophilic bacterium Thermus aquaticus
arises from the top of the ovary and through synapse A junction between a neuron and (Taq); this polymerase is functional at higher
which the pollen tube grows. another neuron or muscle cell; the two cells temperatures, and is used in PCR amplification
bl
stylet A piercing organ, usually a mouthpart, in do not touch, the gap being bridged by of DNA.
some species of invertebrates. neurotransmitter molecules. TATA box In eukaryotes, a sequence located
suberin In plants, a fatty acid chain that forms the synapsid Any of an early group of reptiles that upstream of the transcription start site. The
ee
impermeable barrier in the Casparian strip of had a pair of temporal openings in the skull TATA box is one element of eukaryotic core
root endoderm. behind the eye sockets; jaw muscles attached promoters for RNA polymerase II.
subspecies A geographically defined population to these openings. Early ancestors of mammals taxis, pl. taxes An orientation movement by a
or group of populations within a single species belonged to this group. (usually) simple organism in response to an
that has distinctive characteristics. synapsis The point-by-point alignment (pairing) environmental stimulus.
.w
substrate (1) The foundation to which an of homologous chromosomes that occurs taxonomy The science of classifying living things.
organism is attached. (2) A molecule on which before the first meiotic division; crossing over By agreement among taxonomists, no two
an enzyme acts. takes place during synapsis. organisms can have the same name, and all
subunit vaccine A type of vaccine created by using synaptic cleft The space between two adjacent names are expressed in Latin.
a subunit of a viral protein coat to elicit an
immune response; may be useful in preventing
viral diseases such as hepatitis B.
succession In ecology, the slow, orderly
neurons. cs
synaptic vesicle A vesicle of a neurotransmitter
produced by the axon terminal of a nerve.
The filled vesicle migrates to the presynaptic
T cell A type of lymphocyte involved in cell-
mediated immunity and interactions with B
cells; the T refers to the fact that T cells are
produced in the thymus.
progression of changes in community membrane, fuses with it, and releases the telencephalon The most anterior portion of the
si
composition that takes place through time. Apago PDF Enhancer
neurotransmitter into the synaptic cleft. brain, including the cerebrum and associated
summation Repetitive activation of the motor synaptonemal complex A protein lattice that structures.
neuron resulting in maximum sustained forms between two homologous chromosomes telomerase An enzyme that synthesizes telomeres
hy
contraction of a muscle. in prophase I of meiosis, holding the replicated on eukaryotic chromosomes using an internal
supercoiling The coiling in space of double- chromosomes in precise register with each RNA template.
stranded DNA molecules due to torsional other so that base-pairs can form between telomere A specialized nontranscribed structure
strain, such as occurs when the helix is nonsister chromatids for crossing over that is that caps each end of a chromosome.
p
unwound. usually exact within a gene sequence. telophase The phase of cell division during
surface tension A tautness of the surface of a syncytial blastoderm A structure composed of a which the spindle breaks down, the nuclear
liquid, caused by the cohesion of the molecules single large cytoplasm containing about 4000 envelope of each daughter cell forms, and the
ar
of liquid. Water has an extremely high surface nuclei in embryonic development of insects chromosomes uncoil and become diffuse.
tension. such as Drosophila. telson The tail spine of lobsters and crayfish.
surface area-to-volume ratio Relationship of the syngamy The process by which two haploid temperate (lysogenic) phage A virus that is
surface area of a structure, such as a cell, to the cells (gametes) fuse to form a diploid zygote; capable of incorporating its DNA into the
sw
tissue to the embryo. In gymnosperms the systematics The reconstruction and study of copied to produce a complementary mRNA
suspensor positions the embryo closer to stored evolutionary relationships. transcript.
food reserves. systemic acquired resistance (SAR) In plants, tendon (Gr. tendon, stretch) A strap of cartilage
that attaches muscle to bone.
w
or a specialized network of capillaries. systemin In plants, an 18-amino-acid peptide that strength that helps keep the water column
swimmerets In lobsters and crayfish, appendages is produced by damaged or injured leaves that continuous.
that occur in lines along the ventral surface of leads to the wound response. tertiary structure The folded shape of a protein,
w
the abdomen and are used in swimming and systolic pressure A measurement of how hard produced by hydrophobic interactions with
reproduction. the heart is contracting. When measured water, ionic and covalent bonding between side
symbiosis The condition in which two or more during a blood pressure reading, ventricular chains of different amino acids, and van der
dissimilar organisms live together in close systole (contraction) is what is being Waals forces; may be changed by denaturation
association; includes parasitism (harmful to one monitored. so that the protein becomes inactive.
G-22 glossary
m
organ. tracheids In plant xylem, dead cells that taper at transposable elements Segments of DNA that
tetanus Sustained forceful muscle contraction with the ends and overlap one another. are able to move from one location on a
no relaxation. tracheole The smallest branches of the respiratory chromosome to another. Also termed transposons
thalamus That part of the vertebrate forebrain just system of terrestrial arthropods; tracheoles or mobile genetic elements.
co
posterior to the cerebrum; governs the flow of convey air from the tracheae, which connect to transposition Type of genetic recombination in
information from all other parts of the nervous the outside of the body at spiracles. which transposable elements (transposons)
system to the cerebrum. trait In genetics, a characteristic that has move from one site in the DNA sequence to
therapeutic cloning The use of somatic cell alternative forms, such as purple or white another, apparently randomly.
y.
nuclear transfer to create stem cells from a flower color in pea plants or different blood transposon DNA sequence capable of
single individual that may be reimplanted in type in humans. transposition.
that individual to replace damaged cells, such as transcription The enzyme-catalyzed assembly of trichome In plants, a hairlike outgrowth from an
in a skin graft. an RNA molecule complementary to a strand epidermal cell; glandular trichomes secrete oils
bl
thermodynamics The study of transformations of of DNA. or other substances that deter insects.
energy, using heat as the most convenient form transcription complex The complex of RNA triglyceride (triacylglycerol) An individual fat
of measurement of energy. polymerase II plus necessary activators, molecule, composed of a glycerol and three
ee
thermogenesis Generation of internal heat by coactivators, transcription factors, and fatty acids.
endothermic animals to modulate temperature. other factors that are engaged in actively triploid Possessing three sets of chromosomes.
thigmotropism In plants, unequal growth in transcribing DNA. trisomic Describes the condition in which an
some structure that comes about as a result of transcription factor One of a set of proteins additional chromosome has been gained due to
physical contact with an object. required for RNA polymerase to bind to a nondisjunction during meiosis, and the diploid
.w
threshold The minimum amount of stimulus eukaryotic promoter region, become stabilized, embryo therefore has three of these autosomes.
required for a nerve to fire (depolarize). and begin the transcription process. In humans, trisomic individuals may survive
thylakoid In chloroplasts, a complex, organized transcription bubble The region containing the if the autosome is small; Down syndrome
internal membrane composed of flattened disks, RNA polymerase, the DNA template, and the individuals are trisomic for chromosome 21.
which contain the photosystems involved in the
light-dependent reactions of photosynthesis.
Ti (tumor-inducing) plasmid A plasmid found in
the plant bacterium Agrobacterium tumefaciens
that has been extensively used to introduce
cs
RNA transcript, so called because of the locally
unwound bubble of DNA.
transcription unit The region of DNA between a
promoter and a terminator.
transcriptome All the RNA present in a cell or
trochophore A specialized type of free-living larva
found in lophotrochozoans.
trophic level A step in the movement of energy
through an ecosystem.
trophoblast In vertebrate embryos, the outer
si
recombinant DNA into broadleaf plants. Apago PDF Enhancer
tissue at a given time. ectodermal layer of the blastodermic vesicle; in
Recent modifications have allowed its use with transfection The transformation of eukaryotic mammals, it is part of the chorion and attaches
cereal grains as well. cells in culture. to the uterine wall.
hy
tight junction Region of actual fusion of plasma transfer RNA (tRNA) A class of small RNAs tropism Response to an external stimulus.
membranes between two adjacent animal cells (about 80 nucleotides) with two functional tropomyosin Low-molecular-weight protein
that prevents materials from leaking through sites; at one site, an activating enzyme adds a surrounding the actin filaments of striated
the tissue. specific amino acid, while the other site carries muscle.
p
tissue A group of similar cells organized into a the nucleotide triplet (anticodon) specific for troponin Complex of globular proteins positioned
structural and functional unit. that amino acid. at intervals along the actin filament of skeletal
tissue plasminogen activator (TPA) A human transformation The uptake of DNA directly from muscle; thought to serve as a calcium-
ar
protein that causes blood clots to dissolve; if the environment; a natural process in some dependent switch in muscle contraction.
used within 3 hours of an ischemic stroke, TPA bacterial species. trp operon In E. coli, the operon containing genes
may prevent disability. transgenic organism An organism into which a that code for enzymes that synthesize tryptophan.
tissue-specific stem cell A stem cell that is gene has been introduced without conventional true-breeding Said of a breed or variety of
sw
capable of developing into the cells of a certain breeding, that is, through genetic engineering organism in which offspring are uniform and
tissue, such as muscle or epithelium; these cells techniques. consistent from one generation to the next;
persist even in adults. translation The assembly of a protein on the for example. This is due to the genotypes that
tissue system In plants, any of the three types ribosomes, using mRNA to specify the order of determine relevant traits being homozygous.
of tissue; called a system because the tissue amino acids. tube foot In echinoderms, a flexible, external
.a
extends throughout the roots and shoots. translation repressor protein One of a number of extension of the watervascular system that
tissue tropism The affinity of a virus for certain proteins that prevent translation of mRNA by is capable of attaching to a surface through
cells within a multicellular host; for example, binding to the beginning of the transcript and suction.
w
hepatitis B virus targets liver cells. preventing its attachment to a ribosome. tubulin Globular protein subunit forming the
tonoplast The membrane surrounding the central translocation (1) In plants, the long-distance hollow cylinder of microtubules.
vacuole in plant cells that contains water channels; transport of soluble food molecules (mostly tumor-suppressor gene A gene that normally
helps maintain the cells osmotic balance. sucrose), which occurs primarily in the sieve functions to inhibit cell division; mutated forms
w
topoisomerase Any of a class of enzymes that can tubes of phloem tissue. (2) In genetics, the can lead to the unrestrained cell division of
change the topological state of DNA to relieve interchange of chromosome segments between cancer, but only when both copies of the gene
torsion caused by unwinding. nonhomologous chromosomes. are mutant.
w
torsion The process in embryonic development transmembrane domain Hydrophobic region of turgor pressure The internal pressure inside a
of gastropods by which the mantle cavity a transmembrane protein that anchors it in the plant cell, resulting from osmotic intake of
and anus move from a posterior location to membrane. Often composed of -helices, but water, that presses its cell membrane tightly
the front of the body, closer to the location of sometimes utilizing -pleated sheets to form a against the cell wall, making the cell rigid. Also
the mouth. barrel-shaped pore. known as hydrostatic pressure.
glossary G-23
m
beginning of a foot, shell, and mantle can be seen. wobble pairing Refers to flexibility in the pairing
eukaryotic cells attach as a marker to proteins ventricle A muscular chamber of the heart that between the base at the 5 end of a tRNA
that are to be degraded. receives blood from an atrium and pumps blood anticodon and the base at the 3 end of an
unequal crossing over A process by which a out to either the lungs or the body tissues. mRNA codon. This flexibility allows a single
co
crossover in a small region of misalignment at vertebrate A chordate with a spinal column; in tRNA to read more than one mRNA codon.
synapsis causes two homologous chromosomes vertebrates, the notochord develops into the wound response In plants, a signaling pathway
to exchange segments of unequal length. vertebral column composed of a series of vertebrae initiated by leaf damage, such as being chewed
uniporter A carrier protein in a cells membrane that that enclose and protect the dorsal nerve cord. by a herbivore, and lead to the production
transports only a single type of molecule or ion.
y.
vertical gene transfer (VGT) The passing of genes of proteinase inhibitors that give herbivores
uniramous Single-branched; describes the from one generation to the next within a species. indigestion.
appendages of insects. vesicle A small intracellular, membrane-
unsaturated fat A fat molecule in which one or bounded sac in which various substances are
X
bl
more of the fatty acids contain fewer than the transported or stored.
maximum number of hydrogens attached to X chromosome One of two sex chromosomes; in
vessel element In vascular plants, a typically
their carbons. mammals and in Drosophila, female individuals
elongated cell, dead at maturity, which conducts
urea An organic molecule formed in the vertebrate have two X chromosomes.
ee
water and solutes in the xylem.
liver; the principal form of disposal of xylem In vascular plants, a specialized tissue,
vestibular apparatus The complicated sensory
nitrogenous wastes by mammals. composed primarily of elongate, thick-walled
apparatus of the inner ear that provides
urethra The tube carrying urine from the bladder conducting cells, which transports water and
for balance and orientation of the head in
to the exterior of mammals. solutes through the plant body.
vertebrates.
.w
uric acid Insoluble nitrogenous waste products vestigial structure A morphological feature that
produced largely by reptiles, birds, and insects.
urine The liquid waste filtered from the blood by
has no apparent current function and is thought Y
to be an evolutionary relic; for example, the Y chromosome One of two sex chromosomes; in
the kidney and stored in the bladder pending vestigial hip bones of boa constrictors. mammals and in Drosophila, male individuals
elimination through the urethra.
uropod One of a group of flattened appendages
at the end of the abdomen of lobsters and
crayfish that collectively act as a tail for a rapid
cs
villus, pl. villi In vertebrates, one of the minute,
fingerlike projections lining the small intestine
that serve to increase the absorptive surface
area of the intestine.
have a Y chromosome and an X chromosome;
the Y determines maleness.
yolk plug A plug occurring in the blastopore
of amphibians during formation of the
burst of speed. virion A single virus particle. archenteron in embryological development.
si
uterus In mammals, a chamber in which the Apago PDF Enhancer
viroid Any of a group of small, naked RNA yolk sac The membrane that surrounds the yolk
developing embryo is contained and nurtured molecules that are capable of causing of an egg and connects the yolk, a rich food
during pregnancy. plant diseases, presumably by disrupting supply, to the embryo via blood vessels.
hy
chromosome integrity.
V virus Any of a group of complex biochemical
entities consisting of genetic material wrapped
Z
vacuole A membrane-bounded sac in the zinc finger motif A type of DNA-binding motif
cytoplasm of some cells, used for storage or in protein; viruses can reproduce only within in regulatory proteins that incorporates zinc
p
digestion purposes in different kinds of cells; living host cells and are thus not considered atoms in its structure.
plant cells often contain a large central vacuole organisms. zona pellucida An outer membrane that encases a
that stores water, proteins, and waste materials. visceral mass Internal organs in the body cavity of mammalian egg.
ar
valence electron An electron in the outermost an animal. zone of cell division In plants, the part of the
energy level of an atom. vitamin An organic substance that cannot be young root that includes the root apical
variable A factor that influences a process, outcome, synthesized by a particular organism but is required meristem and the cells just posterior to it; cells
in small amounts for normal metabolic function.
sw
the vascular cambium increases stem or root a change in the voltage, or charge difference, that lies posterior to the zone of elongation;
diameter. across the plasma membrane. cells in this zone differentiate into specific cell
vascular tissue Containing or concerning vessels types.
W
w
vasopressin A posterior pituitary hormone that gravity, pressure, concentration of solute zygomycetes A type of fungus whose chief
regulates the kidneys retention of water. particles) for the water potential, water moves characteristic is the production of sexual
vector In molecular biology, a plasmid, phage or from a region where water potential is greater structures called zygosporangia, which
artificial chromosome that allows propagation to a region where water potential is lower. result from the fusion of two of its simple
w
of recombinant DNA in a host cell into which watervascular system A fluid-filled hydraulic reproductive organs.
it is introduced. system found only in echinoderms that provides zygote The diploid (2n) cell resulting from
vegetal pole The hemisphere of the zygote body support and a unique type of locomotion the fusion of male and female gametes
comprising cells rich in yolk. via extensions called tube feet. (fertilization).
G-24 glossary
m
co
of E.H. Newcomb & T.D. Pugh, University of BioPhoto Associates/Photo Researchers, Inc.;
Photo Credits Wisconsin; 4.5a: Eye of Science/Photo 10.6: CNRI/Photo Researchers, Inc.; 10.10:
Chapter 1 Researchers, Inc.; 4.8b: Dr. Richard Kessel & Image courtesy of S. Hauf and J-M. Peters, IMP,
Opener: Soames Summerhays/Natural Visions; Dr. Gene Shih/Visuals Unlimited; 4.8c: John Vienna, Austria; 10.11a-g, 10.12: Andrew
T. Hansen, Ph.D/Phototake; 4.8d: Reprinted by S. Bajer, University of Oregon; 10.13a-b:
y.
1.1d: Dr. Donald Fawcett & Porter/Visuals
Unlimited; 1.1e: Lennart Nilsson/Albert permission from Macmillan Publishers Ltd: Dr. Jeremy Pickett-Heaps; 10.14a: David
Bonniers Frlag AB; 1.1f: Ed Reschke; 1.1i-j: Nature, 323, 560-564, The nuclear lamina is a M. Phillips/Visuals Unlimited; 10.14b: Guenter
Getty RF; 1.1k-l: Volume 44/Getty RF; 1.1m: meshwork of intermediate-type filaments, Ueli Albrecht-Buehler, Northwestern University,
bl
Steve Harper/Grant Heilman Photography, Aebi, Julie Cohn, Loren Buhle, Larry Gerace, Chicago; 10.15: B.A. Palevits & E.H. Newcomb/
Inc.; 1.1n: Robert and Jean Pollock; 1.1o: 1986; 4.10c: R. Bolender & D. Fawcett/Visuals BPS/Tom Stack & Associates.
NASA; 1.5: Huntington Library/SuperStock; Unlimited; 4.11c: Dennis Kunkel/Phototake;
Chapter 11
ee
1.11a: Dennis Kunkel/Phototake; 1.11b: 4.14: From Microbody-Like Organelles in Leaf
Cells, Sue Ellen Frederick and Eldon H. Opener: Science VU/L. Maziarski/Visuals
Karl E. Deckart/Phototake; 1.12a: Alan
Newcomb, SCIENCE, Vol. 163: 1353-1355 21 Unlimited; 11.3b: Reprinted, with permission,
L. Detrick/Photo Researchers, Inc.; 1.12b:
March 1969. Reprinted with permission from from the Annual Review of Genetics, Volume 6
DAVID M. DENNIS/Animals Animals - Earth
AAAS; 4.15: Dr. Henry Aldrich/Visuals 1972 by Annual Reviews, www.annualreviews.org;
Scenes; 1.12c: Volume 46/Corbis RF; 1.12d:
.w
Unlimited; 4.16c: Dr. Donald Fawcett & 11.7a-h: Clare A. Hasenkampf/Biological Photo
Corbis RF; 1.12e: Mediscan/Corbis; 1.12f:
Dr. Porter/Visuals Unlimited; 4.17c: Dr. Jeremy Service.
Volume 15/Photodisc/Getty RF; 1.12g: Corbis
RF; 1.12h: Tom Brakefield/Corbis; 1.12i: Burgess/Photo Researchers, Inc.; 4.23a-b:
Chapter 12
Volume 44/Photodisc/Getty RF; 1.12j: Volume William Dentler, University of Kansas; 4.24a-b:
Opener: Corbis RF; 12.1: Norbert Schaefer/
64/Corbis RF; 1.12k: T.E. Adams/Visuals
Unlimited; 1.12l: Douglas P. Wilson/Frank
Lane Picture Agency/Corbis; 1.12m:
R. Robinson/Visuals Unlimited; 1.12n: Kari
Lounatman/Photo Researchers, Inc.; 1.12o:
cs
SPL/Photo Researchers, Inc.; 4.25: BioPhoto
Associates/Photo Researchers, Inc.; 4.27a:
Courtesy of Daniel Goodenough; 4.27b-c:
Dr. Donald Fawcett/Visuals Unlimited.
Corbis; 12.2: David Sieren/Visuals Unlimited;
12.3: Leslie Holzer/Photo Researchers, Inc.;
12.11: From Albert F. Blakeslee CORN AND
MEN: The Interacting Influence of Heredity
si
Dwight R. Kuhn; 1.12p: Alfred Pasieka/Science
Apago
Chapter 5PDF Enhancer
Opener: Dr. Gopal Murti/Science Photo Library/
and EnvironmentMovements for Betterment
of Men, or Corn, or Any Other Living Thing,
Photo Library/Photo Researchers, Inc. One-sided Unless They Take Both Factors into
Photo Researchers, Inc.; p. 91 (top)-5.3: Don
hy
Opener: Dr. Gopal Murti/Photo Researchers, 8.20: Dr. Jeremy Burgess/Photo Researchers, Courtesy of Cold Spring Harbor Laboratory
Inc.; Table 4.1a: David M. Phillips/Visuals Inc.; 8.22a: John Shaw/Photo Researchers, Inc.; Archives; 14.6: Barrington Brown/Photo
Unlimited; Table 4.1b: Mike Abbey/Visuals 8.22b: Joseph Nettis/National Audubon Society Researchers, Inc.; 14.11: From M. Meselson and
w
Unlimited; Table 4.1c: David M. Phillips/Visuals Collection/Photo Researchers, Inc.; 8.24: Clyde F.W. Stahl/PNAS 44(1958):671; 14.16a-b: From
Unlimited; Table 4.1d: Mike Abbey/Visuals H. Smith/Peter Arnold Inc. Biochemistry by Stryer. 1995, 1981, 1988, 1995
Unlimited; Table 4.1e: DR TORSTEN by Lupert Stryer. Used with permission of W.H.
w
WITTMANN/Photo Researchers, Inc.; Table 4.1f: Chapter 9 Freeman and Company; 14.20: Dr. Don W.
Med. Mic. Sciences, Cardiff Uni./Wellcome Opener: RMF/Scientifica/Visuals Unlimited. Fawcett/Visuals Unlimited.
Images; Table 4.1g: Microworks/Phototake;
Table 4.1h: Stanley Flegler/Visuals Unlimited; Chapter 10 Chapter 15
p. 62 (plasma membrane): Dr. Don W. Fawcett/ Opener: Stem Jems/Photo Researchers, Inc.; Opener: Dr. Gopal Murti/Visuals Unlimited;
Visuals Unlimited; 4.3: Phototake; 4.4: Courtesy 10.2a-b: Courtesy of William Margolin; 10.4: 15.3: From R.C. Williams, PNAS 74(1977):2313;
C-1
m
Moreland and Apostol Gramada (mbt.sdsc.edu). Corbis RF. Expression of the Eyeless Gene in Drosophila,
The MBT is financed by grant GM63208; 15.17: G. Halder, P. Callaerts, Walter J. Gehring,
From The Structural Basis of Ribosome Activity
Chapter 21 SCIENCE, Vol. 267: 1788-1792 24 March 1995.
Opener: Photodisc/Getty RF; 21.3a-b: Breck
in Peptide Bond Synthesis, Poul Nissen, Jeffrey Reprinted with permission from AAAS; 25.12a-b:
co
P. Kent/Animals Animals - Earth Scenes; 21.8a-b:
Hansen, Nenad Ban, Peter B. Moore, and Thomas Courtesy of Dr. William Jeffrey.
Courtesy of Lyudmila N. Trut, Institute of
A. Steitz, SCIENCE Vol. 289: 920-930 11 August
Cytology & Genetics, Siberian Dept. of the Chapter 26
2000. Reprinted with permission from AAAS.
Russian Academy of Sciences; 21.11: Kevin Opener: Jeff Hunter/The Image Bank/Getty
Chapter 16 Schafer/Peter Arnold Inc.; 21.15a: James
y.
Images; 26.1: T.E. Adams/Visuals Unlimited;
Opener: Dr. Claus Pelling; 16.10a-b: Courtesy Hanken, Museum of Comparative Zoology, p. 508 (bottom): NASA/Photo Researchers,
of Dr. Harrison Echols; 16.22: Reprinted with Harvard University, Cambridge. Inc.; 26.2: NASA/JPL/UA/Lockheed Martin;
permission from the Annual Review of Biochemistry, Chapter 22 26.5a: Tom Walker/Riser/Getty Images; 26.5b:
bl
Volume 68 1999 by Annual Reviews, Opener: Chris Johns/National Geographic/ Volume 8/Corbis RF; 26.5c: Volume 102/
www.annualreviews.org. Getty Images; 22.2: Porterfield/Chickering/ Corbis RF; 26.5d: Volume 1/Photodisc/Getty
Photo Researchers, Inc.; 22.3: Barbara Gerlach/ RF; 26.14: Sean W. Graham, UBC Botanical
ee
Chapter 17 Visuals Unlimited; 22.7a: Jonathan Losos; Garden & Centre for Plant Research, University
Opener: Prof. Stanley Cohen/Photo of British Columbia.
22.7b: Chas McRae/Visuals Unlimited;
Researchers, Inc.; 17.2d: Courtesy of Biorad
22.7c-d: Jonathan Losos; 22.13a-b: Jeffrey
Laboratories; 17.7: SSPL/The Image Works;
Taylor; 22.16a(1): Photo New Zealand/
Chapter 27
17.9: Courtesy of Lifecodes Corp, Stamford CT; Opener: Dr. Gopal Murti/Visuals Unlimited;
Hedgehog House; 22.16a(2): Jim Harding/First
.w
17.10: Matt Meadows/Peter Arnold Inc.; 17.12a: 27.2: From Three-dimensional structure of
Light; 22.16a(3): Colin Harris/Light Touch
2007, Illumina Inc. All rights reserved; 17.16: poliovirus at 2.9 A resolution, JM Hogle, M Chow,
Images/Alamy; 22.16a(4)-(5): Focus New
R. L. Brinster, School of Veterinary Medicine, and DJ Filman, SCIENCE Vol. 229: 1358-1365
Zealand Photo Library.
University of Pennsylvania; 17.19(right): Rob 27 September 1985. Reprinted with permission
Horsch, Monsanto Company.
Chapter 18
Opener: William C. Ray, Director, Bioinformatics
Chapter 23 cs
Opener: G. Mermet/Peter Arnold Inc.; 23.1a:
Reproduced by kind permission of the Syndics
of Cambridge University Library, Darwins
from AAAS; 27.3a: Dept. of Biology,
Biozentrum/SPL/Photo Researchers, Inc.;
Corbis RF.
and Computational Biology Division, Biophysics Notebook B, Tree of Life Sketch, p. 36 from Chapter 28
si
Program, The Ohio State University; 18.2b: Apago PDF EnhancerOpener: David M. Phillips/Visuals Unlimited;
DAR.121 D312; 23.8a: Image #5789, photo by
Reprinted by permission from Macmillan D. Finnin/American Museum of Natural 28.1: J. William Schopf, UCLA; 28.2: Roger
Publishers Ltd: Bone Marrow Transplantation 33, History; 23.8b: Roger De La harpe/Animals Garwood & Trish Ainslie/Corbis; 28.5a: SPL/
hy
247-249, Secondary Philadelphia chromosome Animals - Earth Scenes; 23.10a: Lee W. Wilcox; Photo Researchers, Inc.; 28.5b; Dr. R. Rachel
after non-myeloablative peripheral blood stem cell 23.10b: Dr. Richard Kessel & Dr. Gene Shih/ and Prof. Dr. K. O. Stetten, University of
transplantation for a myelodysplastic syndrome in Visuals Unlimited. Regensburg, Lehrstuhl fuer Mikrobiologie,
transformation, T Prebet, A-S Michallet, C Regensburg, Germany; 28.5c: Andrew Syred/
Charrin, S Hayette, J-P Magaud, A Thibaut, M Chapter 24 SPL/Photo Researchers, Inc.; 28.5d: Microfiield
p
Michallet, F E Nicolini 2004; 18.4a: Courtesy of Opener: Martin Harvey/Gallo Images/Corbis; Scientific Ltd/SPL/Photo Researchers, Inc.; 28.5e:
Celera Genomics; 18.4b: Gregory D. May; 18.4c: 24.1a: Steve Gschmeissner/Photo Researchers, Alfred Paseika/SPL/Photo Researchers, Inc.;
ar
2007, Illumina Inc. All rights reserved; 18.11a-d: Inc.; 24.1b: Leslie Saint-Julien, National Human 28.5f: Dr. Robert Calentine/Visuals Unlimited;
From Fredy Altpeter, Vimla Vasil, Vibha Srivastava, Genome Research Institute; 24.1c: David 28.5g: Science VU/S. Watson/Visuals
Eva Stger and Indra K. Vasil, Accelerated M. Phillips/Visuals Unlimited; 24.1d: Nigel Unlimited; 28.5h: Dennis Kunkel Microscopy,
production of transgenic wheat (Triticum aestivum Cattlin/Visuals Unlimited/Getty Images; 24.1e: Inc.; 28.5i: Prof. Dr. Hans Reichenbach,
sw
L.) plants, Plant Cell Reports, Vol. 16, pp. 12-17 James Stevenson/Photo Researchers, Inc.; 24.1f: Helmholtz Centre for Infection Research,
1996 Springer; 18.12: Image from the RCSB PDB AGB Photo Library/Grant Heilman Photography, Braunschweig; p. 552(top left): Dr. Gary
(www.pdb.org); PDB ID 1AZ2; Harrison, D.H., Inc.; 24.1g: Stephen Frink/Corbis; 24.1h: Gaugler/Science Photo Library/Photo
Bohren, K.M., Petsko, G.A., Ringe, D., Gabbay, Dr. Dennis Kunkel/Visuals Unlimited; 24.1i: Researchers, Inc.; p. 552(top center): CNRI/
K.H. (1997) The alrestatin double-decker: binding Steve Gschmeissner/Photo Researchers, Inc.; 24.1j: Photo Researchers, Inc.; p. 552(top right):
.a
of two inhibitor molecules to human aldose Photo by Gary Kramer, USDA Natural Resources Dr. Richard Kessel & Dr. Gene Shih/Visuals
reductase reveals a new specificity determinant, Conservation Service; 24.1k: T. Brain/Photo Unlimited; 28.6b: Jack Bostrack/Visuals
Biochemistry 36(51): 16134-40, 1997; 18.13: Researchers, Inc.; 24.1l: McDonald Wildlife Unlimited; 28.8b: Julius Adler; 28.9a: Science
Royalty-Free/Corbis; 18.14: Grant Heilman/ Photography/Animals Animals - Earth Scenes; VU/S. W. Watson/Visuals Unlimited; 28.9b:
w
Grant Heilman Photography, Inc. 24.1m: Digital Vision RF; 24.1n: Corbis RF; Norma J. Lang/Biological Photo Service; 28.10a:
24.1o: Nicole Duplaix/National Geographic/ Dr. Dennis Kunkel/Visuals Unlimited.
Chapter 19 Getty Images; 24.1p: Ian Murray/Getty Images;
w
Opener: Andrew Paul Leonard/Photo 24.13: Courtesy of Dr. Lewis G. Tilney and Chapter 29
Researchers, Inc.; 19.1a-c: Carolina Biological Dr. David S. Roos, University of Pennsylvania; Opener: Wim van Egmond/Visuals Unlimited;
Supply Company/Phototake; 19.5b(1)-(4): 24.14a: Eye of Science/Photo Researchers, Inc.; 29.1: Andrew H. Knoll/Harvard University;
w
J. Richard Whittaker, used by permission; 19.8b: 24.14b: LSHTM/Stone/Getty Images; 24.14c: 29.6-29.7: Science VU/E. White/Visuals
University of Wisconsin-Madison; 19.9: Dr. Dennis Kunkel/Visuals Unlimited. Unlimited; 29.8a: Andrew Syred/Photo
APTV/AP Photo; 19.13a: Steve Paddock and Researchers, Inc.; 29.10a: Manfred Kage/Peter
Sean Carroll; 19.13b-d: Jim Langeland, Chapter 25 Arnold Inc.; 29.10b: Edward S. Ross; 29.11:
Steve Paddock and Sean Carroll; 19.16a: Opener: Michael&Patricia Fogden/Minden Vern Carruthers, David Elliott; 29.13: David
Dr. Daniel St. Johnston/Wellcome Images; 19.16b: Pictures; 25.4a: Michael Persson; 25.4b: M. Phillips/Visuals Unlimited; 29.15: Michael
C-2 c re d i t s
m
29.24a: Manfred Kage/Peter Arnold Inc.; 31.17b: Dr. Gerald Van Dyke/Visuals Unlimited; Cleveland P. Hickman; 34.33b: Valorie
29.24b: Wim van Egmond/Visuals Unlimited; 31.18: Scott Camazine/Photo Researchers, Inc.; Hodgson/Visuals Unlimited; 34.33c: Gyorgy
29.24c: Runk/Schoenberger/Grant Heilman 31.19a: Courtesy of Ralph Williams/USDA Forest Csoka, Hungary Forest Research Institute,
photography, Inc.; 29.25: William Bourland, Service; 31.19b: agefotostock/SuperStock; Bugwood.org; 34.33d: Kjell Sandved/Butterfly
co
image used under license to MBL; 29.26: Eye 31.19c: USDA Forest Service Archive, USDA Alphabet; 34.33e: Greg Johnston/Lonely Planet
of Science/Photo Researchers, Inc.; 29.27: Phil Forest Service, Bugwood.org; 31.20a: Dayton Images/Getty Images; 34.33f: Natures Images/
A. Harrington/Peter Arnold Inc.; 29.28: Wild/Visuals Unlimited; 31.20b: Manfred Kage/ Photo Researchers, Inc.; 34.35: Dwight Kuhn;
Manfred Kage/Peter Arnold Inc.; 29.29: Ric Peter Arnold Inc.; 31.21(inset): Courtesy of 34.36: Kjell Sandved/Butterfly Alphabet; 34.37a:
y.
Ergenbright/Corbis; 29.30: Peter Arnold Inc./ Dr. Peter Daszak; 31.21: School of Biological Alex Kerstich/Visuals Unlimited; 34.37b:
Alamy; 29.31: John Shaw/Tom Stack & Sciences, University of Canterbury, New Zealand. Edward S. Ross; 34.38b: Frederic Pacorel/Getty
Associates; 29.32: Mark J. Grimson and Richard Images; 34.39: Wim van Egmond/Visuals
L. Blanton, Biological Sciences Electron Chapter 32 Unlimited; 34.40a: Alex Kerstitch/Visuals
bl
Microscopy Laboratory, Texas Tech University. Opener: Volume 53/Corbis RF; Table 32.1a: Unlimited; 34.40b: Randy Morse,
Volume 86/Corbis RF; Table 32.1b: Corbis RF; GoldenStateImages.com; 34.40c: Daniel W.
Chapter 30 Table 32.1c: David M. Phillips/Visuals Gotshall/Visuals Unlimited; 34.40d: Reinhard
ee
Opener: S.J. Krasemann/Peter Arnold Inc.; 30.3: Unlimited; Table 32.1d: Corbis RF; Table 32.1e: Dirscherl/Visuals Unlimited; 34.40e: Jeff
Dr. Richard Kessel & Dr. Gene Shih/Visuals Edward S. Ross; Table 32.1f: Volume 65/ Rotman/Photo Researchers, Inc.
Unlimited; 30.4: Wim van Egmond/Visuals Corbis RF; Table 32.1g: Cleveland P. Hickman;
Unlimited; 30.5b: Dr. Diane S. Littler; 30.6(left): Table 32.1h: Cabisco/Phototake; Table 32.1i: Chapter 35
Dr. John D. Cunningham/Visuals Unlimited; Ed Reschke; 32.6: Steven C. Zinski. Opener: PHONE Ferrero J.P./Labat J.M./Peter
.w
30.6(right): Dr. Charles F. Delwiche, University Arnold Inc.; 35.2: Eric N. Olson, PhD/The
of Maryland; 30.7: David Sieren/Visuals Chapter 33 University of Texas MD Anderson Cancer Center;
Unlimited; 30.8: Edward S. Ross; 30.11: Lee Opener: Denise Tackett/Tackett Productions; 35.4a: Rick Harbo; 35.5: Heather Angel/
W. Wilcox; 30.12a: Courtesy of Hans Steur, The 33.1a: Andrew J. Martinez/Photo Researchers, Natural Visions; 35.9(top): agefotostock/
Inc.; 33.2 (left): Roland Birke/Phototake; 33.4:
Netherlands; 30.15: Dr. Jody Banks, Purdue
University; 30.16: Kingsley Stern; 30.17:
Stephen P. Parker/Photo Researchers, Inc.; 30.18:
NHPA/Photoshot; 30.20(left): Ed Reschke;
30.20(right): Mike Zensa/Corbis; 30.21b:
cs
VIOLAS PHOTO VISIONS INC./Animals
Animals - Earth Scenes; 33.5: Neil G. McDaniel/
Photo Researchers, Inc.; 33.6: Kelvin Aitken/
Peter Arnold Inc.; Brandon Cole/Visuals
SuperStock; 35.9(bottom left): Corbis RF;
35.9(bottom right): Brandon Cole/www.
brandoncole.com/Visuals Unlimited; 35.11:
Volume 33/Corbis RF; 35.13a: Federico
Cabello/SuperStock; 35.13b: Raymond Tercafs/
si
Biology Media/Photo Researchers, Inc.; 30.22: Apago PDF Enhancer
Unlimited; 33.8: Amos Nachoum/Corbis; 33.9: Bruce Coleman/Photoshot; 35.16a: John Shaw/
Patti Murray/Animals Animal - Earth Scenes; Biosphoto/Leroy Christian/Peter Arnold Inc.; Tom Stack & Associates; 35.16b: Suzanne L.
30.24a: Jim Strawser/Grant Heilman 33.10: David Wrobel/Visuals Unlimited; Collins & Joseph T. Collins/Photo Researchers,
hy
Photography, Inc.; 30.24b: Nancy Hoyt Belcher/ 33.11(top): Tom Adams/Visuals Unlimited; Inc.; 35.16c: Jany Sauvanet/Photo Researchers,
Grant Heilman Photography, Inc.; 30.24c: 33.12: Dwight Kuhn; 33.13: The Natural Inc.; 35.22: Paul Sareno, courtesy of Project
Robert Gustafson/Visuals Unlimited; 30.25 History Museum/Alamy; 33.14(left): Dennis Exploration; 35.24a(left): William J. Weber/
(bottom right): Goodshoot/Alamy RF; 30.26a: Kunkel/Phototake; 33.15: L. Newman & Visuals Unlimited; 35.24a(right): Frans
David Dilcher and Ge Sun; 30.27: Courtesy of A. Flowers/Photo Researchers, Inc.; 33.16: Peter Lemmens/Getty Images; 35.24b, 35.24c(left):
p
Sandra Floyd; 30.31: Dr. Joseph Williams. Funch, Aarhus University; 33.17: Gary Jonathan Losos; 35.24c(right): Rod Planck;
D. Gaugler/Photo Researchers, Inc.; 33.18: 35.24d(left): Volume 6/Corbis RF; 35.24d(right):
ar
Chapter 31 Educational Images Ltd., Elmira, NY, USA. Used Zigmund Leszczynski/Animals Animals - Earth
Opener: Ullstein-Joker/Peter Arnold Inc.; 31.1a: by Permission; 33.19: T.E.Adams/Visuals Scenes; 35.28: Layne Kennedy/Corbis; 35.29a:
Dr. Ronny Larsson; 31.1b: Contributed by Don Unlimited. Corbis RF; 35.29b: Arthur C. Smith III/Grant
Barr, Mycological Society of America; 31.1c: Heilman Photography, Inc.; 35.29c: David
sw
Carolina Biological Supply Company/Phototake; Chapter 34 Boyle/Animals Animals - Earth Scenes; 35.29d:
31.1d: Contributed by Don Barr, Mycological Opener: James H. Robinson/Animals John Cancalosi/Peter Arnold Inc.; 35.32:
Society of America; 31.1e: Dr. Yuuji Tsukii; Animals - Earth Scenes; 34.1a: Marty Stephen Dalton/National Audubon Society
31.1f: Yolande Dalpe, Agriculture and Agri-Food Snyderman/Visuals Unlimited; 34.1b: Alex Collection/Photo Researchers, Inc.; 35.33a (left):
Canada; 31.1g: inga spence/Alamy; 31.1h: Kerstitch/Visuals Unlimited; 34.1c: Douglas B.J Alcock/Visuals Unlimited; 35.33a(right):
.a
Michael&Patricia Fogden; 31.2b: Garry T. Cole/ Faulkner/Photo Researchers, Inc.; 34.1d: Dave Watts/Alamy; 35.33b(left): Volume 6/
Biological Photo Service; 31.3(inset): Micro agefotostock/SuperStock; 34.2: A. Flowers & Corbis RF; 35.33b(right): W. Perry Conway/
Discovery/Corbis; 31.3(right): Michael&Patricia L. Newman/Photo Researchers, Inc.; 34.4: Eye Corbis; 35.33c(left): Stephen J. Krasemann/
Fogden/Corbis; 31.4: Eye of Science/Photo of Science/Photo Researchers, Inc.; 34.5a: DRK Photo; 35.33c(right): Juergen & Christine
w
Researchers, Inc.; 31.5a: Carolina Biological Demian Koop, Kathryn Green, Daniel J. Jackson; Sohns/Animals Animals - Earth Scenes; 35.34:
Supply Company/Phototake; 31.5b: L. West/ 34.5b: Kjell Sandved/Butterfly Alphabet; 34.6: Alan G. Nelson/Animals Animals - Earth Scenes;
Photo Researchers, Inc.; 31.6(left): Daniel Kelvin Aitken/Peter Arnold Inc.; 34.7: Rosemary 35.35a: Peter Arnold Inc./Alamy; 35.35b:
w
P. Fedorko; 31.7: Contributed by Daniel Wubah, Calvert/Getty Images; 34.8: Photodisc Green/ Martin Harvey/Peter Arnold Inc.; 35.35c (left):
Mycological Society of America; 31.8: Contributed Getty Images; 34.10: AFP/Getty Images; 34.11: Joe McDonald/Visuals Unlimited; 35.35c (right):
by Don Barr, Mycological Society of America; Jeff Rotman/Photo Researchers, Inc.; 34.12: Dynamic Graphics Group/IT Stock Free/
w
31.9a, 31.10a: Carolina Biological Supply Kjell Sandved/Butterfly Alphabet; 34.13: Ken Alamy; 35.39: AP/Wide World Photos.
Company/Phototake; 31.11a: Alexandra Lowry/ Lucas/Visuals Unlimited; 34.15: Ronald
The National Audubon Society Collection/Photo L. Shimek; 34.16: Fred Grassle, Woods Hole Chapter 36
Researchers, Inc.; 31.12a: Richard Kolar/ Oceanographic Institution; 34.17: David Opener: Susan Singer; 36.4(top left)-(top right):
Animals Animals - Earth Scenes; 31.12b: Ed M. Dennis/Animals Animals - Earth Scenes; 34.18: Dr. Robert Lyndon; 36.4(bottom left)-(bottom
Reschke/Peter Arnold Inc.; 31.13: David Scharf/ Pascal Goetgheluck/Photo Researchers, Inc.; right): Biodisc/Visuals Unlimited; 36.6a:
c re d i t s C-3
m
W. Wilcox; 36.11b: George Wilder/Visuals Phil Ashley/Getty Images; 37.16d: John Vol. 1, Issue 5, pp. 523-532 1989 American
Unlimited; 36.11c: Lee W. Wilcox; 36.12(top): Kaprielian/Photo Researchers, Inc.; 37.18a: Society of Plant Biologists; 41.34c: ISM/
NC Brown Center for Ultrastucture Studies, Nigel Cattlin/Alamy; 37.18b: PHONE Thiriet Phototake.
SUNY, College of Environmental Science and Claudius/Peter Arnold Inc.
co
Forestry, Syracuse, NY; 36.12(bottom): USDA Chapter 42
Forest Service, Forest Products Laboratory, Chapter 38 Opener: Heather Angel/Natural Visions; 42.3a:
Madison, WI; 36.13b: Dr. Richard Kessel & Opener: Richard Rowans Collection Inc/Photo Fred Habegger/Grant Heilman Photography,
Dr. Gene Shih/Visuals Unlimited; 36.14: Biodisc/ Researchers, Inc.; 38.4a-b: Jim Strawser/Grant Inc.; 42.3b: Pat Breen, Oregon State University;
y.
Visuals Unlimited; 36.15b, 36.16b: Reprinted from Heilman Photography, Inc.; 38.7: Ken Wagner/ 42.4: Courtesy of Lingjing Chen & Renee Sung;
Cell, Volume 99, Issue 5, Myeong Min Lee & John Phototake; 38.11a-b: Dr. Ryder/Jason Borns/ 42.5a; Mack Henley/Visuals Unlimited; 42.5a(i):
Schiefelbein, WEREWOLF, a MYB-Related Phototake; 38.14: Herve Conge/ISM/Phototake; Michael Gadomski/Animals Animals - Earth
Protein in Arabidopsis, Is a Position-Dependent 38.15a: Ed Reschke; 38.15b: Jon Bertsch/ Scenes; 42.5b: Max Planck Institute; 42.5b(i):
bl
Regulator of Epidermal Cell Patterning, pp. 473- Visuals Unlimited; 38.16: Mark Boulton/Photo Ove Nilsson and Detlef Weigel, Salk Institute/Max
483, 24 November 1999, with permission from Researchers, Inc.; 38.18a: Andrew Syred/Photo Planck Institute; 42.7: Jim Strawser/Grant
Elsevier.; 36.17(top left): Carolina Biological Researchers, Inc.; 38.18b: Bruce Iverson Heilman Photography, Inc.; 42.12a-d: Courtesy of
ee
Supply Company/Phototake; 36.17(top right): Photomicrography. John L. Bowman; 42.15: John Bishop/Visuals
Photo by George S. Ellmore; 36.17(bottom left): Unlimited; 42.16: Paul Gier/Visuals Unlimited;
Lee W. Wilcox; 36.17(bottom right): Photo by Chapter 39 42.17a-b; Courtesy of Enrico Coen; 42.19a-b:
George S. Ellmore; 36.19a: E.R. Degginger/ Opener: Photodisc/Getty RF; 39.4a: Hulton L. DeVos - Free University of Brussels; 42.20:
Photo Researchers, Inc.; 36.19b: Peter Archive/Getty Images; 39.4b: UNESCO/M.L. Kingsley Stern; 42.21: David Cappaert,
.w
Frischmuth/Peter Arnold Inc.; 36.19c: Walter Bonsirven-Fontana; 39.6a-d: Photo courtesy of Bugwood.org; 42.23: Michael Fogden/Animals
H. Hodge/Peter Arnold Inc.; 36.19d: Gerald & the International Plant Nutrition Institute (IPNI), Animals - Earth Scenes; 42.24a-b: Thomas
Buff Corsi/Visuals Unlimited; 36.19e: Kingsley Norcross, Georgia, U.S.A.; 39.8: George Eisner, Cornell University; 42.25: John D.
Stern; 36.20: Courtesy of J.H. Troughton and L. Bernard/Animals Animals - Earth Scenes; 39.9: Cunningham/Visuals Unlimited; 42.26: Edward
Donaldson/Industrial Research Ltd.; 36.23a-b:
Ed Reschke; 36.26: Ed Reschke/Peter Arnold
Inc.; 36.27a: Ed Reschke; 36.27b: Biodisc/
Visuals Unlimited; 36.28a: Jerome Wexler/
cs
Ken Wagner/Phototake; 39.9(inset): Bruce
Iverson; 39.11a: Kjell Sandved/Butterfly
Alphabet; 39.11b: Runk/Schoenberger/Grant
Heilman Photography, Inc.; 39.13: Don Albert;
S. Ross; 42.27a: David Sieren/Visuals Unlimited;
42.27b: Barbara Gerlach/Visuals Unlimited;
42.30: Jerome Wexler/Photo Researchers, Inc.;
42.31a: Sinclair Stammers/Photo Researchers,
Visuals Unlimited; 36.28b: Lee W. Wilcox; 39.11c: Perennov Nuridsany/Photo Researchers, Inc.; 42.31b-d: From N. Kuchuk, R. G. Herrmann
si
36.28c: Runk/Shoenberger/Grant Heilman Apago PDF Enhancer
Inc.; 39.11d: Barry Rice; 39.16a-b: Courtesy and H.-U. Koop, Plant regeneration from leaf
Photography, Inc.; 36.28d: Chase Studio Inc/ of Nicholas School of the Environment and Earth protoplasts of evening primrose (Oenothera
Photo Researchers, Inc.; 36.28e: Charles D. Sciences, Duke University. Photo by Will Owens; hookeri), Plant Cell Reports, Vol. 17, Number 8,
hy
Winters/Photo Researchers, Inc.; 36.28f: Lee 39.18: Greg Harvey USAF; 39.19a: Office of the pp. 601-604 5 May 1998 Springer; 42.32a:
W. Wilcox; 36.29 (left)-(right): Scott Poethig, Guadiamar Green Corridor; 39.19b: Marcelo Anthony Arendt/Alamy; 42.32b: DAVID
University of Pennsylvania; 36.30a: Kjell del Pozo/Reuters; 39.19c: AP/Wide LAZENBY/Animals Animals - Earth Scenes.
Sandved/Butterfly Alphabet; 36.30b: Pat World Photo.
Chapter 43
p
36.32(top left), (top right), (bottom left), (bottom 40.1: Richard la Val/Animals Animals - Earth Delaware; Table 43.1a: Ed Reschke; Table 43.1b:
right): Reprinted from Current Biology, Volume 7, Scenes; 40.2: Photo by Scott Bauer, USDA/ARS; Arthur Siegelman/Visuals Unlimited; Table
Issue 8, Julie Hofer, Lynda Turner, Roger Hellens, 40.3a: Photo by William Wergin and Richard 43.1c: Ed Reschke; Table 43.1d: Gladden
Mike Ambrose, Peter Matthews, Anthony Michael, Sayre/USDA/ARS; 40.3b: Photo by Scott Bauer, Willis, M.D./Visuals Unlimited; Table 43.1e: Ed
sw
Noel Ellis, UNIFOLIATA regulates leaf and flower USDA/ARS; 40.6: C. Allan Morgan/Peter Reschke; 43.3: J Gross, Biozentrum/Photo
morphogenesis in pea, pp. 581-587, 1 August Arnold Inc.; Table 40.1a-c: Inga Spence/Visuals Researchers, Inc.; 43.4: BioPhoto Associates/
1997, with permission from Elsevier; 36.34: Unlimited; Table 40.1d: Heather Angel/Natural Photo Researchers, Inc.; Table 43.2a: Ed
Ed Reschke. Visions; Table 40.1e: Pallava Bagla/Corbis; 40.7: Reschke; Table 43.3b: Dr. John D. Cunningham/
Adam Jones/Photo Researchers, Inc.; 40.8(left): Visuals Unlimited; Table 43.2c: Chuck Brown/
.a
Chapter 37 Gilbert S. Grant/Photo Researchers, Inc.; Photo Researchers, Inc.; Table 43.2d: Ed
Opener: Norm Thomas/The National Audubon 40.8b(right): Lee W. Wilcox; 40.9: Michael Reschke; Table 43.2e: Kenneth Eward/Photo
Society Collection/Photo Researchers, Inc.; 37.4: J. Doolittle/Peter Arnold Inc.; 40.13: Courtesy Researchers, Inc.; Table 43.3a-c: Ed Reschke.
Edward Yeung (University of Calgary) and R.X. Latin. Reprinted with permission from
w
David Meinke (Oklahoma State University); Compendium of Cucurbit Diseases, 1996, American Chapter 44
37.6a-d: Kindly provided by Prof. Chun-ming Liu, Phytopathological Society, St. Paul, MN. Opener: Courtesy of David I. Vaney, University of
Institute of Botany, Chinese Academy of Sciences; Queensland Australia; 44.3: Enrico Mugnaini/
w
37.7: Jan Lohmann, Max Planck Institute for Chapter 41 Visuals Unlimited; 44.13: John Heuser,
Developmental Biology; 37.8c: Ben Scheres, Opener: Alan G. Nelson/Animals Animals - Washington University School of Medicine,
University of Utrecht; 37.8d-e: Courtesy of Earth Scenes; 41.5a-d: Niko Geldner, UNIL; St. Louis, MO.; 44.15: Ed Reschke; 44.17b:
w
George Stamatiou and Thomas Berleth; 37.10 41.8: Ray F. Evert; 41.10a(1)-(3): Jee Jung and Science VU/Lewis-Everhart-Zeevi/Visuals
(left)-(right): A. P. Mhnen; 37.11(top): Philip Benfey; 41.11: Lee W. Wilcox; 41.13: Unlimited; 44.25: Dr. Marcus E. Raichle,
S.Kirchner/photocuisine/Corbis; 37.11(bottom): Frank Krahmar/Zefa/Corbis; 41.16: Don Grall/ Washington University, McDonnell Center for
Barry L. Runk/Grant Heilman Photography, Inc.; Index Stock Imagery; 41.26a-c: Prof. Malcolm High Brain Function; 44.27: Lennart Nilsson/
37.13a: Ed Reschke/Peter Arnold Inc.; 37.13b: B. Wilkins, Botany Dept, Glasgow University; Albert Bonniers Frlag AB; 44.30: E.R. Lewis/
David Sieren/Visuals Unlimited; 37.15 (top 41.28: Robert Calentine/Visuals Unlimited; Biological Photo Service.
C-4 c re d i t s
m
Opener: Natures Images/Photo Researchers, Frlag AB, A Child Is Born, Dell Publishing Nick Gordon - Survival/OSF/Animals Animals -
Inc.; 46.10: John Paul Kay/Peter Arnold Inc.; Company; 54.1c-d: David M. Phillips/Visuals Earth Scenes; 55.35: Steve Hopkin/Getty
46.11: Bettmann/Corbis. Unlimited; 54.3a-d: Dr. Mathias Hafner Images; 55.36: Heinrich Van Den Berf/Peter
(Mannheim University of Applied Sciences, Arnold Inc.; 55.37: Stuart Westmorland/Getty
co
Chapter 47 Institute for Molecular Biology, Mannheim, Images; 55.38: Mark Moffett/Minden Pictures;
Opener: HAL BERAL/ Grant Heilman Germany) and Dr. Gerald Schatten (Pittsburgh 55.39: Nigel Dennis/National Audubon Society
Photography, Inc.; 47.3a: Ed Reschke/Peter Development Centre Deputy Director, Magee- Collection/Photo Researchers, Inc.
Arnold Inc.; 47.3b: David Scharf/Peter Arnold Womans Research Institute Professor and
Inc.; 47.3c: Dr. Holger Jastrow/http://www. Vice-Chair of Obstetrics, Gynecology & Chapter 56
y.
uni-mainz.de/FB/Medizin/Anatomie/workshop/ Reproductive Sciences and Professor of Cell Opener: Volume 44/Photodisc/Getty RF; 56.1:
EM/EMAtlas.html; 47.3d: CNRI/Photo Biology & Physiology Director, Division of Michael Fogden/Animals Animals - Earth
Reserachers, Inc.; 47.3e: Dr. Kessel & Dr. Developmental and Regenerative Medicine Scenes; 56.4: Stone Nature Photography/Alamy;
bl
Kardon/Tissue & Organs/Visuals Unlimted/Getty University of Pittsburgh School of Medicine 56.13: Christian Kerihuel; 56.15: Courtesy of
Images; 47.3f: Ed Reschke/Peter Arnold Inc.; Pittsburgh, PA 15213); 54.7: David M. Phillips/ Barry Sinervo; 56.21(left): Juan Medina/Reuters/
47.3g: Ed Reschke; 47.3h: Ed Reschke/Peter Visuals Unlimited; 54.8a: Cabisco/Phototake; Corbis; 56.21(right): Oxford Scientific/
ee
Arnold Inc.; 47.10a-b: Dr. H.E. Huxley; 47.21: 54.9: David M. Phillips/Visuals Unlimited; Photolibrary.
Treat Davidson/Photo Researchers, Inc. 54.11a: From An Atlas of the Development of the
Sea Urchin Lytechinus variegatus. Provided by Chapter 57
Chapter 48 Dr. John B. Morrill (left to right) Plate 20, pg 62, Opener: Corbis RF; 57.1: Daryl & Sharna
Opener: Gerlach Nature Photography/Animals #I; 54.11b: From An Atlas of the Development of Balfour/Okopia/Photo Researchers, Inc.; 57.6a-d:
.w
Animals - Earth Scenes; 48.10: Ron Boardman/ the Sea Urchin Lytechinus variegatus. Provided by Jonathan Losos; 57.10a: Edward S. Ross;
Stone/Getty Images; 48.19: Courtesy AMGEN. Dr. John B. Morrill (left to right) Plate 33, pg 93, 57.10b: Raymond Mendez/Animals Animals -
#C; 54.11c: From An Atlas of the Development of Earth Scenes; 57.11a-b: Lincoln P. Brower;
Chapter 49 the Sea Urchin Lytechinus variegatus. Provided by 57.12: Michael&Patricia Fogden/Corbis; 57.13:
Opener: Photodisc/Alamy RF; 49.1; Bruce
Watkins/Animals Animals - Earth Scenes; 49.3:
Juniors Bildarchiv/Alamy; 49.13a: Clark
Overton/Phototake; 49.13b: Martin Rotker/
Phototake; 49.14: Kenneth Eward/BioGrafx/
cs
Dr. John B. Morrill (left to right) Plate 38, pg 105,
#G; 54.17a-b: Courtesy of Manfred Frasch;
54.20c(1)-(2): Roger Fleischman, University of
Kentucky; 54.26a, 54.27a-d: Lennart Nilsson/
Albert Bonniers Frlag AB, A Child Is Born, Dell
Milton Tierney/Visuals Unlimited; 57.15:
Merlin D. Tuttle/Bat Conservation International;
57.16: Eastcott/Momatiuk/The Image Works;
57.17: Volume 44/Photodisc/Getty RF; 57.18:
Michael Fogden/DRK Photo; 57.19: Charles
si
Photo Researchers, Inc. Apago PDF Enhancer
Publishing Company. T. Bryson, USDA Agricultural Research Service,
Chapter 50 Bugwood.org; 57.21a: F. Stuart Westmorland/
Chapter 55 Photo Researchers, Inc.; 57.21b: Ann Rosenfeld/
Opener: BioPhoto Associates/Photo
hy
Opener: National Museum of Health and permission from Elsevier; 55.5a-b: Reprinted by Chapter 58
Medicine, Armed Forces Institute of Pathology/AP permission from Macmillan Publishers Ltd: Opener: Photodisc/Getty RF; 58.3:
Photo; 52.3: Manfred Kage/Peter Arnold Inc.; Nature Neuroscience 7, 1048-1054, The Worldwide Picture Library/Alamy; 58.6: Jeff
52.6: Wellcome Images; 52.12a-b: Dr. Andrejs neurobiology of pair bonding, Larry J Young, Schmaltz, MODIS Rapid Response Team, NASA/
sw
Liepins/Photo Researchers, Inc.; 52.22: CDC/ Zuoxin Wang 2004; 55.6a-c: Boltin Picture GSFC; 58.7a: U.S. Forest Service; 58.19a: Layne
Science Source/Photo Researchers, Inc. Library/The Bridgeman Art Library; 55.7: Kennedy/Corbis.
William Grenfell/Visuals Unlimited; 55.8:
Chapter 53 Thomas McAvoy, Life Magazine/Time, Inc./ Chapter 59
Opener: Geordie Torr/Alamy; 53.1: Dennis Getty Images; 55.9: Harlow Primate Opener: GSFC/NASA; 59.10: Andoni Canela/
.a
Kunkel Microscopy, Inc.; 53.2: Fred Laboratory; 55.11: Roger Wilmhurst/The agefotostock; 59.11: Image Plan/Corbis RF;
McConnaughey/The National Audubon Society National Audubon Society Collection/Photo 59.14a: Art Wolfe/Photo Researchers, Inc.;
Collection/Photo Researchers, Inc.; 53.4: Researchers, Inc.; 55.12a: Linda Koebner/ 59.14b: Bill Banaszowski/Visuals Unlimited;
Doug Perrine/SeaPics.com; 53.6: Hans Bruce Coleman/Photoshot; 55.12b: Jeff Foott/ 59.16: Provided by the SeaWiFS Project, NASA/
w
Pfletschinger/Peter Arnold Inc.; 53.7a: Tom Stack & Associates; 55.13a-c: SuperStock; Goddard Space Flight Center, and ORBIMAGE;
Jonathan Losos; 53.7b: David A. Northcott/ 55.14: Courtesy of Bernd Heinrich; 55.15b: 59.17: Digital Vision/Getty RF; 59.19a: Jim
Corbis; 53.7c-d: Michael Fogden/OSF/ Fred Breunner/Peter Arnold Inc.; 55.15c: Church; 59.19b: Ralph White/Corbis; 59.22a:
w
Animals Animals - Earth Scenes; 53.8: 2009 George Lepp/Getty Images; 55.18: Dwight Peter May/Peter Arnold Inc.; 59.22b: 2009
Frans Lanting/www.lanting.com; 53.9a: Jean Kuhn; 55.21: Tom Leeson; 55.22b: Scott Frans Lanting/www.lanting.com; 59.23:
Phllippe Varin/Jacana/Photo Researchers, Inc.; Camazine/Photo Researchers, Inc.; 55.23a: Gilbert S. Grant/National Audubon Society
w
53.9b: Tom McHugh/The National Audubon Gerald Cubitt; 55.24: Nina Leen, Life Collection/Photo Researchers, Inc.; 59.25a:
Society Collection/Photo Researchers, Inc.; Magazine/Time, Inc./Getty Images; 55.27(left): NASA/Goddard Space Flight Center Scientific
53.9c: Corbis Volume 86 RF; 53.12: David Peter Steyn/Getty Images; 55.27(right): Gerald Visualization Studio; 59.27: NASA Goddard
M. Phillips/Photo Researchers, Inc.; 53.17: Ed C. Kelley/Photo Researchers, Inc.; 55.28a: Institute for Space Studies; 59.29a: Dr. Bruno
Reschke; 53.21a: Jonathan A. Meyers/Photo Bruce Beehler/Photo Researchers, Inc.; 55.28b: Messerli; 59.29b: Prof. Lonnie Thompson,
Researchers, Inc.; 53.21b: The McGraw-Hill B. Chudleigh/Vireo; 55.30: Cathy & Gordon Ohio State University.
c re d i t s C-5
m
60.5b: Inga Spence/Visuals Unlimited/Getty Animals - Earth Scenes; 60.16: Peter Yates/ Madison Arboretum; 60.26b: Studio Carlo
Images; 60.6a: Jean-Leo Dugast/Peter Arnold Science Photo Library/Photo Researchers, Inc.; Dani/Animals Animals - Earth Scenes.
Inc.; 60.6b: Oxford Scientific/Photolibrary; 60.17(left): Jack Jeffrey; 60.17(right): Jack
co
y.
bl
ee
.w
cs
si
Apago PDF Enhancer
p hy
ar
sw
.a
w
w
w
C-6 c re d i t s
m
co
Boldface page numbers correspond Acoela, 644f, 660, 660f Adrenocorticotropic hormone Allele, 225
with boldface terms in the text. Page Acoelomate, 637, 637f, 643, 644f, (ACTH), 947-948 multiple, 233t, 233-235, 235f
numbers followed by an f indicate 656-660, 657f, 659f-661f Adsorption, of virus to host, 533 temperature-sensitive, 235, 235f
figures; page numbers followed by a Acoelomorpha, 644f Adventitious plantlet, 858 Allele frequency, 397, 399-400
t indicate tabular material. Acromegaly, 950 Adventitious root, 742, 746f, 765f changes in populations,
y.
Acrosomal process, 1106 Aerenchyma, 780, 781f 398-400, 399f
A Acrosome, 1106
ACTH, 947-948
Aerial root, 742, 743f
Aerobic capacity, 974
Allelopathy, 807, 807f
Allens rule, 1164
A band, 969
bl
Actin, 970f Aerobic metabolism, 129 Allergy, 1075, 1076f
Aardvark, 525, 525f
Actin filament, 76, 76f, 84, 84f Aerobic respiration, 124, 126, 126f, Alligator, 707t, 711, 711f
ABC model, of floral organ
Actinobacteria, 550f 129, 136f Allometric growth, 1128
specification, 846, 846f, 847f,
ee
Actinomyces, 550f, 561 ATP yield from, 137-138, 137f Allomyces, 615t, 620, 621f
848, 848f
Actinopoda (phylum), 583 evolution of, 143 Allopatric speciation, 442, 442f,
ABO blood group, 90t, 230t,
Action potential, 893-895 regulation of, 138, 138f 444-445, 444f
234-235, 235f, 1077
all-or-none law of, 894 Aesthetic value, of biodiversity, 1263 Allopolyploidy, 445, 445f, 477,
Abscisic acid, 779, 779f, 826t,
falling phase of, 893, 894f Afferent arteriole, 1046 477f, 479f
836, 836f
.w
generation of, 893-895, 894f-895f Afferent neuron. See Sensory neuron Allosteric activator, 117
Abscission, 823-824, 823f
propagation of, 894-895, 895f Aflatoxin, 630, 630f Allosteric enzymes, 117
Abscission zone, 823, 823f
rising phase of, 893, 894f, African savanna, 1186f Allosteric inhibitor, 117, 117f
Absolute dating, 424
895, 895f African sleeping sickness, 574 Allosteric site, 117
Absorption
in digestive tract, 982,
989-990, 989f
water and minerals in plants,
771f, 773-775, 774f-775f
Action spectrum, 153 cs
undershoot phase of, 893, 894f
Active site, 114, 114f engineering to, 346-349, reciprocal, 1154-1155, 1155f
Acacia, mutualism with ants,
Active transport, across plasma 346f-348f Alveolata, 515f, 570f, 576-579,
809, 809f, 1198, 1198f
membrane, 99-102, 104t applications of genomics to, 569f-579f
Acari (order), 682
Acute-phase protein, 1059 368-369, 368f-369f Alveoli, 1007-1008, 1008f
Acceptor stem, 291-292, 291f
ADA-SCID, 345 effect of global warming on, Alveoli, of protists, 576, 576f
p
Adaptive radiation, 446-447, Agrobacterium tumefaciens, 346, 346f, Amborella trichopoda, 521-522, 522f,
Accessory sex organs
446f-447f, 450, 450f 832, 833f 607, 607f
female, 1097-1098, 1098f
Adaptive significance, AIDS, 470-471, 531, 532t, American basswood, 836f
male, 1092-1093, 1093f
of behavior, 1148 535-538, 1079 American woodcock
sw
Acetaldehyde, 35f
Adaptive value, of egg coloration, deaths in United States, 535 (Scolopax minor), 933
Acetic acid, 35f
1147-1148, 1147f gene therapy for, 345, 345t Amino acid, 44
Acetyl-CoA
Addiction, drug, 900-901, 900f Air pollution, monitoring with abbreviations for, 47f
in Krebs cycle, 131, 132, 133f,
Adenine, 42, 42f, 259f, 260, 262 lichens, 627 catabolism of, 141, 141f
138, 138f
Adenohypophysis, 946 Akiapolaau, 1270f chemical classes of, 46, 47f
from protein catabolism, 141f
.a
Adenosine diphosphate. See ADP Alanine, 35f, 46, 47f as neurotransmitters, 898-899
from pyruvate, 130, 130f
Adenosine monophosphate. See AMP Alaskan near-shore habitat, in proteins, 36f, 44
uses of, 142
Adenosine triphosphate. See ATP 1271-1272, 1272f structure of, 44-46, 47f
Acetylcholine, 897-898, 897f-898f,
Adenovirus, 531f Albinism, 227t, 228, 228f twenty common, 47f
w
I-1
m
704f-705f fruit dispersal by, 762, 763f Anthozoa (class), 654-655, 654f columella cells in, 739
brain of, 903, 903f gap junctions in, 83f, 84 Anthrax, 554, 561t CONSTANS gene in, 843
characteristics of, 703, 703t general features of, 634, Anthropoid, 721, 721f-722f det2 mutant in, 817, 817f
circulation in, 703, 1024, 1024f 634t-635t Antibiotic resistance, 558 development in, 375, 499
co
classification of, 705-706, 705f habitats of, 635t Antibiotics, bacteria susceptibility embryonic flower mutant in,
development in, 952, 952f movement in, 634t to, 64 841, 841f
eggs of, 1249f multicellularity in, 634t Antibody, 1063, 1068-1074, genome of, 358f, 364, 475f,
evolution of, 697, 703, 704-705, obtaining nutrients, 634t 1069f-1074f. See also 476-477, 479f, 486, 489, 595
y.
704f-705f phylogeny of, 640, 643-645, Immunoglobulin (Ig) GLABROUS3 mutant in,
fertilization in, 1088, 1088f-1089f 644f-645f antigen-binding site on, 1070, 735, 735f
first, 704-705 pollination by, 852-854, 852f-853f 1070f-1071f HOBBIT gene in, 757-758, 758f
gastrulation in, 1114, 1114f sexual life cycle in, 208, 208f monoclonal, 1077-1078, 1078f hot mutants in, 825
bl
heart of, 703, 1024, 1024f sexual reproduction in, 519, 635t polyclonal, 1077 KANADI gene in, 747f
invasion of land by, 704-705, succession in animal communities, recombinant, 349 LEAFY COTYLEDON
704f-705f 1203, 1203f specificity of, 1069-1070, 1070f gene in, 759
ee
kidney of, 1043 transgenic, 342 Anticodon loop, 291-292, 291f LEAFY gene in, 841
legs of, 703, 704f Animal breeding, thoroughbred Antidiuretic hormone (ADH), 947, MONOPTEROS gene in,
lungs of, 703, 1007, 1007f horses, 414, 414f 947f, 1034, 1049, 758, 758f
nitrogenous wastes of, 1044, 1045f Animal cells 1050-1051, 1051f overexpression of flowering
nuclear transplant in, 380 cell division in, 188f Antigen, 1061-1062, 1062f, 1074, gene in, 841f
.w
orders of, 703t cytokinesis in, 197, 197f 1074f, 1078f PHABULOSA gene in, 747f
population declines in, 1258t, genetically modified Antigen-binding site, 1070, PHAVOLUTA gene in, 747f
1264-1266, 1264f-1265f domesticated, 349 1070f-1071f phytochrome genes in, 815f, 816
prolactin in, 951 sexual life cycle in, 208, 208f Antigen drift, 1079 scarecrow mutant in, 740, 740f,
reproduction in, 704
respiration in, 703, 1004, 1003f-1004f
Amphioxus. See Branchiostoma
Ampullae of Lorenzini, 934
cs
structure of, 66f, 80-81, 81f, 81t
Animal pole, 377, 377f, 1110, 1110f
Animalia (kingdom), 13, 13f, 513f,
514, 515f, 517f, 518t, 640
Antigen-presenting cell, 1066
Antigen shift, 1079
Antigenic determinant, 1062
Antiparallel strands, in DNA,
820, 820f
SHOOTMERISTEMLESS gene in,
756, 757f
short root mutant, 820, 820f
Amygdala, 905 Anion, 19, 96 262f, 263 small RNAs in, 317
si
Amylopectin, 40, 40f Apago PDF Enhancer
Annelid, 140, 643, 644f, 673-676, Antiporter, 100 suspensor mutant in, 755, 756f
Amyloplast, 75, 739, 820, 820f 673f-676f Anura (order), 703, 703t, thaliana, 755, 757f, 759
Amylose, 39, 40, 40f body plan of, 673-674, 673f 705-706, 705f too many mouths mutant in,
hy
meiosis II, 213f, 214, 217f 673-676, 673f-676f Ape, 720t, 721-726 WOODEN LEG gene in, 759, 759f
mitotic, 192f, 195f, 196-197, Annotation, 359 compared to hominids, 722 YABBY gene in, 747f
197f, 216f Annual plants, 859f, 860 evolution of, 721-726 Arachidonic acid, 943
Anaphase A, 195f, 197-198 Anolis lizard Aperture (pollen grain), 609 Araneae (order), 681-682, 682f
sw
Anaphase B, 195f, 197-198 courtship display of, 443, 443f Apex, 730 Arbuscular mycorrhizae, 622,
Anaphase-promoting complex dewlap of, 443, 443f Aphasia, 906 628, 628f
(APC), 201 Anonymous marker, 248, 248f Aphid, feeding on phloem, 782, 782f Archaea (domain), 13, 13f, 483,
Anatomical dead space, 1010 Anopheles mosquito, 358f, 475f, Apical meristem, 731, 732, 514, 515, 515f, 516t, 517f, 518t,
Ancestral characters, 458-459, 459f 487, 1079 732f-733f, 832f 547, 549f
.a
Anchoring junction, 83f, 84 Anoxygenic photosynthesis, 143, Apical surface, 866, 987 Archaea (kingdom), 514
Andrews, Tommie Lee, 336, 336f 148, 156 Apicomplexans, 576, 576f, 577-578 Archaeal viruses, 533
Androecium, 608, 608f, 848-849 Ant Aplysina longissima, 650f Archaebacteria, 516, 549f.
w
Androgen, 956 ant farmer-fungi symbiosis, Apoda (order), 703, 703t, 705f, 706 See also Prokaryote
Aneuploidy, 214, 250, 481 629, 629f Apolipoprotein B, 320-321 bacteria versus, 547
Angelman syndrome, 251-252 mutualism with acacias, 809, 809f, Apomixis, 857 cell wall of, 64, 548-549
Angina pectoris, 1033 1198, 1198f Apoplast route, 775, 775f characteristics of, 516, 516t
w
Angiosperm. See Flowering plant social, 1158f Apoptosis, 305, 1067, 1067f gene architecture in, 549
Angle of incidence, 1231 Antagonistic effector, 877-878, 877f in development, 390-391, 391f membrane lipids of, 548, 549f
Animal(s) Anteater, 431f, 525, 525f genetic control of, 390-391, 391f nonextreme, 516
w
body plan of, evolution of, Antenna complex (photosynthesis), mechanism of, 390-391 plasma membrane of, 63-64, 548
636-640, 636f-637f, 639f 154-155, 155f, 157 Appendicular locomotion, 975 Archaefructus, 607, 607f
classification of, 522-525, 640, Antennal gland, 1041 Appendix, 990, 990f Archaeopteryx, 425, 425f, 712, 712f,
641t-642t, 643-645, 644f-645f Antennapedia complex, 388f, 389 Aquaculture, 1248 714, 714f
I-2 index
m
ART. See Assisted reproductive structure of, 18-20, 19f discovery of, 825, 827-828, 560-563, 561t, 562f
technology Atomic mass, 18-19 827f-828f in plants, 560
Arteriole, 1030 Atomic number, 18 effects of, 828, 829f Bacteriochlorophyll, 559
Arteriosclerosis, 1033 ATP, 43-44, 44f gravitropism and, 819, 820 Bacteriophage, 258, 528, 530-531,
co
Artery, 1030, 1030f energy storage molecule, 112-113 mechanism of action of, 530f, 533-534, 534f
Arthropod, 641t, 643, 644, 678-687, production of , 113, 113f. See also 828-830, 829f cloning vector, 330, 331f
679f-687f ATP synthase phototropism and, 829f Hershey-Chase experiment with,
body plan of, 679-681, 679f-681f in electron transport chain, synthetic, 829f, 830-831 258-259, 258f
y.
circulatory system of, 680, 680f 124, 124f, 135-136, thigmotropism and, 821 induction of, 533-534
classification of, 523f, 524-525 135f, 136f Auxin binding protein, 829 lysogenic cycle of, 533-534, 534f
economic importance of, 678 in glycolysis, 127, 127f, 129 Auxin receptor, 829 lytic cycle of, 533, 534f
excretory system of, 680f, 681 in Krebs cycle, 132, 131f, 133f Auxin response factor (ARF), 829 temperate, 533
bl
exoskeleton of, 679-680, 679f in photosynthesis, 148, 149f, AV node. See Atrioventricular node virulent, 533
groups of, 679t 151, 156-160, 156f, AV valve. See Atrioventricular valve Bacteriophage lambda, 533
jointed appendages of, 680 158f-159f Avascular bone, 966 cloning vector, 330, 331f
ee
locomotion in, 976 regulation of aerobic respiration, Avery, Oswald, 257 Bacteriophage T2, 531f
molting in, 680 138, 138f Aves (class), 699f, 712-715, Bacteriophage T4, 530f, 533
nervous system of, 680, 681f, role in metabolism, 125 712f, 714f-715f Bacteriorhodopsin, 95, 95f
901f, 902 structure of, 44f, 112, 112f Avian cholera, 1061 Bait protein, in DNA-binding hybrid,
respiratory system of, 680-681, synthesis of, 125-126, 125f, 126f Avian influenza, 539, 1079 341, 341f
.w
681f, 1006 uses of Avirulent pathogen, 811 Ball-and-socket joint, 967, 968f
segmentation in, 523, 523f, in active transport, 100-102, Axial locomotion, 975 Bank (fishing on continental
639-640, 679, 679f 100f, 101f Axil, 744 shelf ), 1243
taste in, 926, 926f in coupled transport, Axillary bud, 730f, 744, 744f, Barley, genome of, 363, 476, 479f
Arthropoda (phylum), 635, 641t,
644, 645f, 678-687,
679f-687f, 685t
Artificial selection, 10, 403, 422-423,
422f-423f
101-102, 101f
113f, 125
cs
in endergonic reactions, 113,
in muscle contraction,
971, 971f
802, 803f
Axon, 872, 873t
conduction velocities of,
895-896, 895t
diameter of, 895
Barnacle, 683-684, 683f
competition among species of,
1188, 1188f
Barometer, 1006
Baroreceptor, 919, 1034, 1035f
si
domestication, 422-423, 423f Apago PDF Enhancer
in protein folding, 51, 51f myelinated, 895-896, 895f, Barr body, 243, 243f, 251
laboratory experiments, 422, 422f in sodium-potassium pump, 895t, 896f Barro Colorado Island, 1221
Artificial transformation, 558 100-101, 100f unmyelinated, 895-896, 895f, 895t Basal body, 79, 79f
hy
Ascaris, 208, 641t, 663 ATP cycle, 113, 113f Aznalcllar mine spill (Spain), Basal ganglia, 902t, 904
Ascocarp, 624, 624f ATP-dependent remodeling factor, 799-800, 799f Basal metabolic rate (BMR), 995
Ascomycetes, 615, 615f, 624-625, 624f 317, 317f Azolla, 599 Basal surface, 866
Ascomycota (phylum), 615, 615f, ATP synthase, 126, 126f, 136, 136f, Base, 29-30
p
Asexual reproduction, 572 genetically engineered, 343 B lymphocyte, 1063, 1063 Basidiomycetes, 615, 615f,
in ascomycetes, 624-625 Atrioventricular (AV) node, 1027, Babbitt, Bruce, 1275 622-623, 623f
in plants, 857-859, 858f 1028f, 1034 Bacillary dysentery, 560 Basidiomycota (phylum), 615, 615f,
in protists, 572 Atrioventricular (AV) valve, Bacillus, 550f, 552 615t, 622
sw
in sponges, 651 1026, 1027f Bacillus anthracis, 550f, 561t Basidiospore, 622, 623f
in zygomycetes, 621, 621f Atrium, 1023, 1023f Bacillus thuringiensis insecticidal Basidium, 622, 623f
Aspen, 859 Attachment protein, 347-348 Basophil, 1062, 1062t
Aspergillus flavus, 630, 630f in HIV infection cycle, 536-537 Bacon, Francis, 5 Bat, 525f, 717-718, 717f
Aspirin, 348, 943 of virus to host, 533 Bacteria, 550f-551f. See also pollination by, 854, 1196f
.a
(ART), 1102 Australopithecus, 722 cell wall of, 64, 548-549 1195f, 1196
Assortative mating, 402 Australopithecus afarensis, 724 endosymbiotic, 568 Batrachochytrium dendrobatidis,
Aster (mitosis), 195, 196f Autocrine signaling, 169-170 flagella of, 64f, 65, 548, 619, 630
Asteroidea (class), 689, 689f, 690 Autoimmune disease, 1075 553, 553f Beadle, George, 6, 279
w
Asthma, 1012 Autologous blood donation, 1077 genetically engineered, 564 Bean, 760, 760f, 765f, 822, 823f
Atherosclerosis, 55, 1033, 1033f Automated DNA sequencing, Gram staining of, 552-553, Bee
Atmosphere 337f, 339 552f-553f chromosome number in, 189t
w
of early earth, 509 Autonomic nervous system, 888, 889f, intestinal, 564 pollination by, 852, 852f-853f
reducing, 509 909, 909t, 910, 910f, 911f photosynthetic, 63-64, 64f, 150, solitary, 852
Atmospheric circulation, 1231-1233, Autophosphorylation, 175-176, 175f 156, 156f, 547, 548, 569-570 Beetle, species richness in,
1231f-1232f Autopolyploidy, 445, 445f, 477, 479f plasma membrane of, 63-64, 93, 548 469-470, 469f
index I-3
m
communication and, 1225, 1225f Bivalve mollusk, 667, 668f, 669 Bohr, Niels, 18
1144-1147, 1144f-1147f Bioinformatics, 359, 364 Bivalvia (class), 671, 671f Bohr shift, 1014
development of, 1139-1141 Biological community, 3f, 4, Black walnut (Fuglans nigra), 807, 807f Boll weevil (Anthonomus grandis),
foraging, 1148-1149, 1148f 1186-1187, 1186f-1187f Blackman, F. F., 150 684f
co
innate, 1133, 1133f Biological species concept, 437-438, Bladder Bolus, 985
learning and, 1135, 1135f, 438t, 463 swim, 701-702, 701f Bone, 869t, 870, 963-967
1137-1138, 1138f, 1140 weaknesses in, 440-441 urinary, 1045, 1046f avascular, 966
migratory, 1142-1144, Biomarker, 547 Bladderwort (Utricularia), 794 compact, 965f, 966
y.
1142f-1143f Biome, 1235-1238, 1235f-1238f Blade, of leaf, 730f, 747 development of, 963-966, 964f
reproductive strategies, climate and, 1236, 1236f BLAST algorithm, 359 endochondral, 965-966, 965f
1150-1154, 1150f-1153f distribution of, 1235f Blastocladiomycetes, 619-620, 620f intramembranous, 963,
study of, 1133-1134, 1133f predictors of biome distribution, Blastocladiomycota (phylum), 615, 964f, 965
bl
territorial, 1149, 1149f 1236, 1236f 615f, 619 medullary, 965f, 966
Behavioral ecology, 1147-1149, 1148 Biopharming, 348-349 Blastocoel, 1110 remodeling of, 966-967,
Behavioral genetics, 1135-1137, Bioremediation, 564 Blastoderm, 1114, 1115f 966f-967f
ee
1135f-1137f Biosphere, 3f, 4, 1230-1253 Blastodisc, 1111 spongy, 965f, 966
in fruit flies, 1135-1136 influence of human activity on, Blastomere, 373, 373f, 1110, 1112 structure of, 965f, 966
in mice, 1136, 1136f 1245-1253 Blastopore, 392f, 635, 638, vascular, 966
Behavioral genomics, 369 Biostimulation, 564 639f, 1114 Bone morphogenetic protein 4 (BMP4),
Behavioral isolation, 438t, 439, 439f Bioterrorism, 368, 368t Blastula, 635, 1110 1124, 1124f
.w
Bergeys Manual of Systematic Biotic potential, 1173 Bleaching (global warming), 1252 Bony fish, 701-702, 701f, 1004-1006,
Bacteriology, 550 Bipedalism, 722, 723-724 Blending inheritance, 399 1004f, 1042
Beta wave, 905 Bipolar cell, 930, 931f Blinking, 908 Book lung, 681
barrel, 50, 95, 95f Biramous appendage, 524, 524f Blood, 869t, 870, 1018-1021, Borrelia burgdorferi, 550f, 561t
-oxidation, 141, 142f
-pleated sheet, 48, 95, 95f
motif, 50, 50f
Betacyanin, 824
Birch (Betula), 854f
Bird, 641t, 699f, 712-715, 712f,
714f-715f
altruism in, 1156-1157, 1157f
cs 1018f-1021f
functions of, 1018-1019
regulation of, 1034-1035, 1035f
Blood acidosis, 30
Bottleneck effect, 402f, 403, 403f
Bottom-up effect, 1219,
1221-1223, 1222f
Botulism, 550f, 554, 561t
Bicarbonate, 30 bones of, 712 Blood alkalosis, 30 Bowmans capsule, 1042,
si
bicoid gene, 384, 385f, 386 Apago PDF Enhancer
brain of, 903, 903f Blood cells, 1019f 1047, 1047f
Bicuspid valve, 1026 characteristics of, 712, 715 Blood clotting, 1021, 1021f Box jellyfish, 655, 655f
Biennial plants, 860 circulation in, 715, 1025, 1025f Blood flow, 1034-1035 Boysen-Jensen, Peter, 827
hy
Bilateral symmetry, 636-637, cost of reproduction in, Blood group Brachiopoda (phylum), 642t, 643,
636f-637f 1171, 1172f ABO, 90t, 233t, 234-235, 644f, 676, 677-678, 677f-678f
Bilaterally symmetrical flower, 499, declining populations of 235f, 397 Brachyury gene, 496-497, 497f
849-850, 849f songbirds, 1268, 1268f genetic variation in, 397-398 Bract, 749
p
Bilateria, 644f, 656-660, 657f, digestive tract of, 984, 984f Blood plasma, 1019 Bradykinin, 942
659f-661f evolution of, 425, 424f-425f, 463, Blood pressure Brain, 902t
Bile, 983, 988f 466, 467f, 712, 712f, 714, 714f measurement of, of amphibians, 903, 903f
ar
Bile pigments, 989 eyes of, 933 1029-1030, 1029f of birds, 903, 903f
Bile salts, 989 fertilization in, 1088-1089, sensing, 919 divisions of, 902-903, 902t
Bilirubin, 1077 1088f-1089f, 1112f Blood transfusion, 1077 of fish, 902-903, 903f
Binary fission, 187, 187f gastrulation in, 1114-1115, 1115f Blood typing, 1077 of mammals, 903, 903f
sw
Binocular vision, 721, 933 habituation in, 1137 Blood vessel, 1026-1030 primitive, 902
Binomial name, 512 kidney of, 1043-1044, 1044f characteristics of, 1030-1033, of reptiles, 903, 903f
Biochemical pathway, 118, 118f locomotion in, 976-977, 977f 1030f-1033f size of, 903, 903f
evolution of, 118 magnetic field detection by, 934 paracrine regulation of, 942-943 of vertebrates, 903f
regulation of, 118-119, 119f migration of, 1142-1143, tissue layers of, 1030, 1030f Brainstem, 905
.a
Biodiversity, 4, 1223-1226. See also 1143f, 1252 Blue crab, 644f Branch point (nucleotide), 290, 290f
Species richness nitrogenous wastes of, 1044, 1045f Blue-footed booby, 439, 439f Branchial chamber, 1004
biodiversity crisis, 1257-1261, orders of, 713t Blue-light receptors, in plants, Branching diagrams, 457, 457f
w
1257f-1260f parental care in, 464 818, 818f Branching morphogenesis, 1118
conservation biology, 1256-1278 pollination by, 852-854, 853f BMR. See Basal metabolic rate Branchiostoma, 696, 696f
economic value of, 1261-1263, present day, 715 Bobolink (Dolichonyx oryzivorus), Hox genes in, 389
1261f-1263f respiration in, 715, 1008, 1009f 1143, 1143f Branchless gene, in Drosophila, 1118
w
ethical and aesthetic values selection and beak sizes, 409-410, Body cavity Brassica
of, 1263 410f, 418-419, 418f-419f evolution of, 637f, 638 evolution of, 495, 495f
factors responsible for extinction, sex chromosomes of, 241t kinds of, 638 genome of, 479f
w
1264-1275 territorial behavior in, 1149, 1149f Body plan Brassica juncea, 799
Bioenergetics, 107 thermoregulation in, 715 animal, evolution of, 636-640, Brassinosteroid, 826t, 834, 834f
Biofilm, 548, 561-562 Bird flu, 539, 1079 636f-637f, 639f Bread mold, 279
Biogenic amine, 899 Birdsong, 1140, 1140f, 1145, 1149 of vertebrates, 864-865, 865f Breakbone fever, 1253
I-4 index
m
Brenner, Sydney, 282, 283, 299 Calvin, Melvin, 161 in trophic level ecosystem, 1215, growth factors and, 202
Briggs, Winslow, 828, 829f Calyx, 848 1215f, 1218 Cell cycle control, 198-204
Bright-field microscope, 62t CAM plants, 164, 165, 165f Carnivorous plants, 793-794, 794f in cancer cells, 202-204, 203f, 204f
Brittle star, 689, 689f, 690 Cambrian explosion, 645-646, 646f Carotene, 153-154, 348, 348f checkpoints, 200, 200f
co
Bronchi, 1007, 1008f Camel, 525 Carotenoid, 152f, 153-154, history of investigation into,
Brood parasite, 1140, 1140f cAMP. See Cyclic AMP 153f, 853 198-200
Brown algae, 517f, 518, 569, 580, Campylobacter pylori, 562 Carotid body, 1011, 1011f in multicellular eukaryotes,
580f, 581f Canaliculi, 870, 965, 965f Carpel, 606, 608, 608f, 848f, 849 201-202, 202f
y.
Brush border, 988 Cancer, 175, 202 Carrier protein, 90t, 96, 97, Cell death, 390-391, 391f
Bryophyte, 463f, 593-595, 593f-595f of breast, 808 97f, 104t Cell determination, 375, 1117
Bryozoa (phylum), 641t, 643, 644f, cell cycle control in, 202-204, 203f Carrying capacity, 1174 Cell division, 186-204. See also
676-677, 677f of cervix, 541 Cartilage, 869t, 870, 963 Cell cycle
bl
Bt crops, 347-348 hormonal responses in, 957 Cartilaginous fish, 698f, 700-701, in animal cells, 188f
Budding, virus release from lung, 1012, 1012f 700f, 1043, 1065 during development, 372,
cells, 537 telomerase and, 273 Casparian strip, 741, 741f 373-375, 373f-374f, 390
ee
Buffer, 30, 30f treatment of gene therapy, 345t Cassava (Mannihot esculenta), in prokaryotes, 187-188, 188f, 548
Bulb (plant), 746, 746f viruses and, 540-541 805, 806t in protists, 188f
Bulbourethral gland, 1091f, 1092 Candida, 630 Castor bean (Ricinus communis), in yeast, 188f
Bulk transport, 102 Candida milleri, 625 807, 807f Cell identity, 82, 82t
Bumblebee (Bombus), 852f CAP. See Catabolite activator protein Cat Cell junction, 83-85, 83f, 84f, 85f
.w
Bushmeat, 471 5 Cap mRNA, 288, 188f coat color in, 233t, 235, 235f, Cell-mediated immunity, 1063,
Buttercup (Ranunculus), 741f Capillary, 1030, 1030f, 1031 243, 243f 1066-1068, 1066t, 1067f, 1069f
alpine, New Zealand, Capsid, viral, 529, 529f ovary in, 1096f Cell membrane, 81t
450-451, 450f Capsule, of bacteria, 63f, 64, 553 Catabolism, 117 Cell migration, in development,
Butterfly, 807, 880
effect of global warming on,
1252, 1252f
eyespot on wings of, 498, 498f
metapopulations of, 1167, 1168f
Captive breeding,
1276-1277, 1276f cs
Carbohydrates, 33, 36f, 37, 38-41
catabolism of, 124, 138
function of, 37t
of proteins and fats, 140-142,
141f, 142f
Catabolite activator protein (CAP),
310-311, 310f
Catalyst, 25, 37, 111-112, 111f
391-392, 392f
Cell plate, 195f, 197-198, 198f
Cell signaling
between cells
autocrine signaling, 169-170
si
mimicry in, 1195-1196, 1195f Apago PDF Enhancer
structure of, 36f Catecholamine, 899 by direct contact, 169,
Buttress root, 743, 743f Carbon Caterpillar, 809 169f, 170
chemistry of, 24, 34-37 Cation, 19, 96 endocrine signaling, 169,
hy
9f, 418f, 441, 448, 448f Carbon cycle, 1208-1209, 1208f cdc2 gene, 199 of prokaryotes, 553-554
Cadherin, 83f, 84, 84f, 391-392 Carbon dioxide Cdc2 kinase, 200-201, 201f of protists, 571
Cadherin domain, 391 atmospheric, 1209, 1252, 1251f Cdk. See Cyclin-dependent Cell surface marker, 63, 82, 82t, 90t,
Caecilian, 703, 703t, 705f, 706 as electron acceptor, 139 protein kinase 91, 93, 94f
sw
Caenorhabditis elegans from ethanol fermentation, 140 Cdk1, 200 Cell surface receptor, 93, 94f,
development in, 373, 374f, from Krebs cycle, 131-132, 133f cDNA library, 332, 332f 171-173, 172f, 172t
390-391, 391f, 644, 662 from pyruvate oxidation, 130, 130f Cech, Thomas J., 116 Cell theory, 12, 12f, 59-63
small RNAs in, 317 transport in blood, Cecum, 990, 990f Cell wall, 63, 63f
transposons in, 484 1002-1015, 1015f Cedar Creek experimental fields, of archaebacteria, 64, 548
.a
CAL gene, 495, 495f use in photosynthesis, 1223-1224, 1223f of bacteria, 64, 548, 552
Calciferol. See Vitamin D 147-151, 149f Cell(s) of eukaryotes, 67f, 78t, 81t
Calcitonin, 320, 321f, 952-953 Carbon fixation, 148, 151, 160-163, earliest, 546, 546f of fungi, 616
w
Calcitonin gene-related peptide 161f, 546-547, 563, 1209 in hierarchical organization of plant cells, 40, 67f, 80, 80f, 81t,
(CGRP), 320, 321f Carbonic acid, 30, 114 of living things, 2f, 3 393, 393f, 731, 731f
Calcium Carbonic anhydrase, 114 as information-processing primary, 80, 80f
in fertilization, 1108, 1108f Carbonyl group, 35, 35f systems, 14 of prokaryotes, 63, 63f, 64, 81t,
w
homeostasis, 952-953, 953f Carboxyl group, 35, 35f, 44-46, 46f origin of, 512, 546, 546f 548-549, 552-554, 552f-553f
in muscle contraction, Cardiac cycle, 1026, 1027f shape of, 390 secondary, 80, 80f
972-973, 972f-973f Cardiac muscle, 871-872, 871t, 872f size of, 60, 61f Cellular blastoderm, 384, 384f, 1110
w
as second messenger, Cardiac output, 1034 in prokaryotes, 548 Cellular immune response, 345
181-182, 182f Cardioacceleratory center, 1034 structure of, 62-63, 62f Cellular organization, as characteristic
California condor (Gymnogyps Cardioinhibitory center, 1034 visualizing structure of, 60-62 of life, 2-3f, 3, 508, 508f
californianus), 1276-1277 Cardiovascular disease, 1033, 1033f Cell adhesion, 83-85 Cellular respiration, 123
index I-5
m
Central chemoreceptor, 927 Chemoreceptor, 916, Chondroitin, 870 of arthropods, 680, 680f
Central Dogma, 280, 280f 925-927, 926f-927f Chordata (phylum), 513f, 641t, 645f, of birds, 715, 1025, 1025f
Central nervous system, 872, central, 927 693, 694-695, 695f closed, 638, 1022f, 1023
901-909, 901f-908f internal, 927 Chordate of fish, 699, 1023, 1023f
co
Central vacuole, 65 peripheral, 927 characteristics of, 694, 694f of invertebrates, 1022-1023,
Centriole, 66f, 76-77, 77f, 81t Chewing, 967, 982, 984 eyes of, 928f, 929 1022f
Centromere, 189f, 191, 193, 193f, 211 Chewing the cud, 991 nonvertebrate, 695-696, of mammals, 1025, 1025f
Centrosome, 76-77 Chiasmata, 210, 211f, 215 695f-696f of mollusk, 669
y.
Cephalization, 637 terminal, 211 segmentation in, 523, 523f, open, 638, 1022f, 1023
Cephalopod, 667-668, 668f Chicken, 189t 639-640 of reptiles, 709, 709f, 1024
Cephalopoda (class), 668f, 671-672, clutch size in, 414 vertebrate, 696-697, 697f-698f of vertebrates, 1023-1025,
671f-672f development in, 1110f Chorion, 706, 708f, 1089 1023f-1025f
bl
Cercariae, 658, 659f genome of, 482 Chorionic villi sampling, 253, 253f Cisternae, of Golgi body, 71, 71f
Cercomeromorpha (class), Chicken pox, 529, 532t, 1061 Chromatid, 191, 191f, 193, 193f. Cisternal space, 69
659-660, 660f Chief cells, 986, 986f See also Sister chromatid(s) Citrate, 131, 132, 133f
ee
Cerebellum, 902, 902t Chihuahua, 423f Chromatin, 68, 68f, 190, 190f, Citrate synthetase, 138, 138f
Cerebral cortex, 902t, 904, 904f, Childbirth, 947, 1128, 1128f. See also 316-317, 316f-317f Citric acid cycle. See Krebs cycle
905f, 932-933 Uterine contractions Chromatin-remodeling complex, 317 Clade, 459
Cerebral hemisphere, 903, 904f positive feedback during, 878f Chromosomal mutation, Cladistics, 458-461, 459f-460f
Cerebrum, 902t, 903 Chilling, of plant, 825 300-301, 301f Cladogram, 459, 459f
.w
Cervical cap (birth control), Chimpanzee (Pan), 457, 457f Chromosomal theory of inheritance, Cladophyll, 746f, 747
1099t, 1100 chromosome number in, 189t 240-241, 240f Clam, 666, 667, 668, 671, 671f
cGMP. See Cyclic GMP (cGMP) cognitive behavior in, 1141, 1141f exceptions to, 244 Clarks nutcracker (Nucifraga
CGRP. See Calcitonin genome of, 362-363, 475f, 476, Chromosome, 65, 78t, 81t, 193 columbiana), 1138, 1138f
gene-related peptide
Chaetae, 673f, 674
Chaetognatha (phylum), 642t,
643, 645f
482, 482f, 484
Chiral molecule, 35, 35f
Chitin, 37t, 41, 41f, 616, 962
Chiton, 668f, 670, 670f
cs artificial, 330-331, 356
bacterial artificial chromosome
(BAC), 330-331, 356
banding patterns, 353, 354f
Class (taxonomic), 512, 513f, 514
Classical conditioning, 1137
Classification, 461, 512-514
of animals, 522-525, 640
Chagas disease, 487, 488, 488f, 574 Chitridiomycetes, 619 discovery of, 189 grouping organisms, 514-520
si
Chain terminator, 336 Apago PDF Enhancer
Chlamydia, 561t duplication of, 480f-481f, 481 of organisms, 512-514
Chambered nautilus (Nautilus heart disease and, 563 of eukaryotes, 65, 189-191, of prokaryotes, 549-550,
pompilius), 667, 667f, 671-672 sexually-transmitted disease, 189f-191f, 189t, 548 549f-551f
hy
Chancre, 562 562-563, 562f fusion of, 482 of protists, 520, 520f,
Channel-linked receptor, 171-172, Chlamydia trachomatis, 561t, 562 homologous, 191, 191f, 570f-571f, 571
172f, 172t Chlamydomonas, 244, 591, 591f, 595 209-210, 209f systematics and, 461-464,
Channel protein, 96, 97f, 104t Chloramphenicol, 554 of prokaryotes, 548 462f-464f
p
Chaperone protein, 51, 51f Chlorella, 154 structure of, 189-191, 190f-191f of viruses, 519-520
Chara, 592, 592f Chlorofluorocarbons, 1248-1250 yeast artificial chromosome Clean Air Acts, 421
Character displacement, 447, Chlorophyll, 148, 149f (YAC), 331, 356 Cleavage, 373, 373f, 635t, 1106t,
ar
447f, 1190 absorption spectra of, 152, 152f Chromosome number, 189, 189t, 1110-1112, 1110f-1112f
Character state, 458 action spectrum of, 153, 153f 207-208 holoblastic, 1110-1111,
Charales, 521, 521f, 592, 592f structure of, 152-153, 152f Chronic obstructive pulmonary 1111f, 1111t
Chargaff, Ertwin, 260 Chlorophyll a, 152, 152f disease (COPD), 1012 in insects, 1110
sw
Chargaffs rules, 260 Chlorophyll b, 152, 152f Chrysalis, 686 in mammals, 1112, 1112f
Charging reaction, tRNA, 292, 292f Chlorophyta (phylum), 521, 521f, 582 Chrysophyta (phylum), 580 meroblastic, 1111-1112,
Charophyte, 589, 592, 592f Chlorophyte, 591-594, 591f-592f Chylomicron, 990 1111t, 1112f
Checkpoint, cell cycle, 198, Chloroplast, 67f, 74-75, 74f, 78t, Chyme, 987 radial, 638, 639f
200, 200f 81t, 518t Chymotrypsin, 988 spiral, 638, 639f, 643
.a
Chelicerae, 681 diversity of, 569 Chytrid, 615, 615f, 619, 619f Cleavage furrow, 195f, 197, 197f
Chelicerata (class), 679t, DNA of, 74, 74f Chytridiomycetes, 619 Climate. See also Global climate
681-682, 682f of euglenoids, 573-574, 574f Chytridiomycosis, 630, 630f change, Global warming
w
Chelonia (order), 707t, 710, 710f genetic code in, 284 Chytridiomycota (phylum), 615, 615f, biomes and, 1236, 1236f
Chemical bond, 23, 25. See also specific genome of, 364 615t, 619-620, 619f effects on ecosystems, 1230-1235,
types of bonds maternal inheritance, 244 Cichlid fish 1230f-1234f
Chemical defenses origin of, 517, 517f, Lake Barombi Mbo, 446 El Nio and, 1243-1244,
w
of animals, 1194, 1194f 569-570, 569f Lake Malawi, 495-496, 496f 1244f, 1252
of plants, 1193 photosynthesis, 147-165 Lake Victoria, 449-450, 449f, 1271 elevation and, 1234, 1234f
Chemical digestion, 982 Choanocyte, 641t, 650f, 651 pike cichlid, 412-413, 412f human impact on climate change,
w
Chemical messenger, 938-939, 938f Choanoflagellate, 520, 571f, 583, Cigarette smoking. See Smoking 1250-1253
Chemical reaction, 25 583f, 644f Cilia, 66f, 79-80, 79f, 80f. See also microclimate, 1235
activation energy, 111-112, 111f Cholecystokinin (CCK), 993, 993f, Ciliate selection to match climatic
energy changes in, 110-111, 111f 994t, 996, 997, 997f Ciliate, 284, 576, 579-580, 578f conditions, 404
I-6 index
m
Clitoris, 1094, 1094f Coleoptile, 765, 765f Competitive inhibitor, 117, 117f Copy numbers, 486
Clonal selection, 1063 Coleorhiza, 765, 765f Complement system, 1059-1060 Coral, 636, 641t, 654
Clone, 330 Collagen, 45t, 81, 81f, 392, 868, Complementary base-pairing, 43, 43f, Coral reef, 654-655, 1243,
Clone-by-clone sequencing, 868f, 870 262, 262f, 265, 265f 1243f, 1252
co
357, 357f Collar cell. See Choanocyte base-pairs, 262, 262f Coriolis effect, 1232-1233, 1232f
Cloning Collared flycatcher, 442, 442f Complete flower, 848, 848f Cork, 745f
DNA libraries, 331-332, 331f Collecting duct, 1047, 1047f Complexity, as characteristic of life, 3 Cork cambium, 732, 733f, 744,
host/vector systems, 330-331, 331f Collenchyma cells, 736, 736f Compound, 23 745, 745f
y.
identifying specific DNA Colloblast, 656 Compound eye, 414, 414f, 680, Cork cells, 745
in complex mixtures, 332-333 Colon, 990. See also Large intestine 680f, 681f Corm, 746
isolating specific clones from Colon cancer, 990 Compound leaf, 748, 748f Corn (Zea mays), 164, 369f, 743f,
library, 333, 333f Colonial flagellate hypothesis, Compsognathus, 714 765f, 836f
bl
of plants, 858f, 859 for origin of metazoans, 645 Concentration gradient, 96, 100 artificial selection in, 422, 423f
reproductive, 381 Colonization, human influence on, Concurrent flow, 1005, 1005f chromosome number in, 189t
of sheep, 381, 381f 1270-1271 Condensation, 37 endosperm of, 760, 760f
ee
therapeutic, 383, 383f Color blindness, 227t, 242, 933 Condensin, 191, 193, 201 epistasis in, 236, 236f
Cloning vector, 330 Color vision, 930, 930f Conditioning genome of, 363f, 475f, 476,
expression vectors, 342 Coloration, warning, 1194, 1195f classical (pavlovian), 1137 479f, 489
plasmids, 330, 331f Colorectal cancer. See Colon cancer operant, 1138 grain color in, 233t, 235-236,
Clonorchis sinensis, 658, 659f Columella root cap, 739, 739f Condom, 1099f, 1099t, 1100 236f, 245-246, 245f
.w
Closed circulatory system, 638, Columnar epithelium, 866, 867t Conduction (heat transfer), 880 oil content of kernels, 422
1022f, 1023 pseudostratified, 867t Cone (eye), 930, 930f, 931f recombination in, 245, 245f
Clostridium botulinum, 550f, 561t simple, 866, 867t Confocal microscope, 62t transgenic, 347
Clover, 842f Comb jelly, 641t, 656, 656f Confuciornis, 714f Cornea, 929, 929f
Club moss, 598, 601t
Clutch size, in birds, 414,
1172, 1172f
Cnidaria (phylum), 635t, 636, 636f,
637, 641t, 644f, 652-655,
Combined DNA Index System
(CODIS), 355
Commensalism, 564, 626,
1197, 1197f
cs
Combination joint, 967, 968f Congression, 196
Conidia, 624, 624f
Conifer, 602t, 603, 603f, 607f
Coniferophyta (phylum), 602t
Conjugation, 554
Corolla, 848, 848f
Coronary artery, 1029
Corpus callosum, 902t, 903-904, 904f
Corpus luteum, 1097, 1097f
Correns, Carl, 240, 244
si
652f-653f Apago PDF Enhancer
Communicating junction, 83f, 84-85 in bacteria, 554-556, 555f Cortex (plant), 741, 741f, 744
body plan of, 653, 653f Communication, animal, 1144-1147, gene transfer by, Cortical granule, 1108
body structure of, 652, 652f 1144f-1147f 555-556, 556f Corticosteroid, 954
hy
circulatory system of, 1022, 1022f Community, 3f, 4, 1186-1187, in ciliates, 579, 579f Corticotropin, 947
classes of, 654-655 1186f-1187f Conjugation bridge, 555, 555f Corticotropin-releasing hormone
digestive cavity of, 982, 982f across space and time, 1187, 1187f Connective tissue, 864, 868, 868f, (CRH), 949
life cycle of, 653, 653f concepts of, 1186 869t, 870 Cortisol, 943f, 954
p
nervous system of, 901-902, 901f fossil records of, 1187 dense, 868, 869t Corynebacterium diphtheriae, 534
Coactivator, 174, 314-315, 315f Community ecology, 1185-1204 dense irregular, 868 Cost of reproduction, 1171
Coal, 1246 Compact bone, 965f, 966 dense regular, 868 Costa Rica, biosphere reserves in,
ar
Coastal ecosystem, destruction Compaction, 1112 loose, 868, 869t 1277, 1277f
of, 1248 Companion cells, 738, 738f special, 868, 870 Cotransduction frequency, 556-557
Cocaine, 900, 900f Comparative anatomy, 11, 11f Connell, Joseph, 1188 Cotton
Coccidioides posadasii, 625 Comparative biology, Consensus sequence, 357 genome of, 479f
sw
Codon, 282, 283t, 298f Comparator, 876 Constitutive heterochromatin, 359 Countertransport, 102
spaced or unspaced, 282-283 Compartmentalization Consumer, 1215, 1215f Coupled transport,
start, 283 in eukaryotes, 517, 518-519, 548 Consumption, of resources, 1181 101-102, 101f, 104t
w
stop (nonsense), 283, 296f, 297 in prokaryotes, 548 Contig, 353, 357 Courtship behavior/signaling, 439,
Coelom, 637f, 638 Competition Continental drift, 432 439f, 443, 443f, 1144f, 1145,
formation of, 639, 639f among barnacle species, Continental shelf, 1241f, 1242-1243 1152, 1152f
Coelomate, 637f 1188, 1188f Continuous variation, 232, 233f of Anolis lizards, 443, 443f
w
Coenzyme, 117 direct and indirect effects of, Contraception, 1098-1101, 1099f, of blue-footed boobies, 439, 439f
Coevolution, 1193 1200-1201, 1201f 1099t, 1101f of lacewings, 439, 439f
mutualism and, 1198 effect of parasitism on, 1200 Contractile root, 742, 743f Covalent bond, 23t, 24-25, 24f
w
of plants and animals, 807, experimental studies of, Contractile vacuole, 73, 99, 103 Cowpers gland, 1091f, 1092
1193-1194, 1193f, 1196 1191-1192, 1191f Control experiment, 6 Cowpox, 1061
predation and, 1193 exploitative, 1188 Controlling elements, 480 COX. See Cyclooxygenase
Cofactor, 117 interference, 1188 Conus arteriosus, 1023, 1023f COX-2 inhibitor, 943
index I-7
m
Creighton, Harriet, 245-246, 245f 660, 661f Decomposition, 563 evidence for, 428-429, 428f
Cretinism, 952 CYCLOIDIA gene, of snapdragons, Deductive reasoning, 4-5, 5f evolution of, 492-504, 497f
CRH. See Corticotropin-releasing 499, 849-850, 849f Deep sea, 1244-1245, 1244f of eye, 501-504, 501f-503f
hormone Cyclooxygenase-1 (COX-1), 943 Deer, 525f in frogs, 373f
co
Cri-du-chat syndrome, 300 Cyclooxygenase-2 (COX-2), 943 Defensin, 805, 1057, 1057f gene expression in, 304
Crick, Francis, 259-263, 261f, 280, Cyclosome, 201 Deforestation, 1210, 1210f, induction, 377-378, 377f
282, 283, 299 Cysteine, 35f 1246-1247 of limbs, 497-498, 497f
Crinoidea (class), 689f Cystic fibrosis, 51-52, 227t, 233, Degeneracy, 284 morphogenesis, 373, 390-393,
y.
Cro-Magnons, 725, 725f 249t, 335, 484 Dehydration reaction, 37, 37f 391f-393f
Crocodile, 699f, 707t, 711, gene therapy for, 345, 345t Dehydrogenation, 123 nuclear reprogramming, 380-383,
711f, 1025 Cytochrome, 45t Deinococcus, 550f 380f-383f
parental care in, 464, 465f Cytochrome b6-f complex, 157-158, Delamination, 1113 overview of, 372-373
bl
Crocodylia (order), 699f, 707t, 710f, 158f, 159f Delayed hypersensitivity, 1076 pattern formation, 373, 383-389,
711, 711f Cytochrome bc1, 134, 134f Deletion, 282-283, 300, 301f 384f-388f
Crop plant Cytochrome c, 134, 134f Delta wave, 905 in plants, 374-375
ee
artificial selection in, 422, 423f Cytokine, 942, 1067-1068, 1069f Demography, 1168 morphogenesis, 392-393, 393f
breeding of, 489 Cytokinesis, 192, 192f, 194f, 195f, Denaturation, of proteins, 52-53, 52f in sea urchins, 493, 493f
transgenic, 346-349 197, 212f-213f, 214 Dendrite, 872, 873t, 889, 889f in tunicates, 376f, 377
Cross-fertilization, 223, 223f in animal cells, 197, 197f Dendritic cell, 1062-1063, 1062t of wings, 497, 497f
Cross-pollination, 223, 223f, 851 in fungi, 198 Dendritic spines, 889 Dewlap, of Anolis lizard, 443, 443f
.w
Crossing over, 209f, 210, 210f, 211, in plant cells, 197-198, 198f Dengue fever, 1253 Diabetes insipidus, 98, 1050
212f, 215, 216f, 244-246, 245f Cytokinin, 826t, 831-832, Denitrification, 1211 Diabetes mellitus, 955
multiple crossovers, 247, 247f 831f-832f Denitrifier, 563 treatment of, 955
Crown gall, 832, 833f synthetic, 831f Dense connective tissue, 868, 869t type I (insulin-dependent), 955
CRP. See Cyclic AMP (cAMP)
response protein
Crustacean, 679t, 682-684, 682f-683f
body plan in, 682, 683f
Cytological maps, 353
Cytoplasm, 62, 892t
Cytoplasmic receptor, 1057
Cytosine, 42, 42f, 259f, 260, 262
cs Dense irregular connective tissue, 868
Dense regular connective tissue, 868
Density-dependent effect, 1175-1176,
1175f-1176f
type II (non-insulin-dependent),
955
Diacylglycerol, 180f, 181
Diagnostics, 1078-1079, 1078f
decapod, 683, 683f Cytoskeleton, 65, 67f, 75-79, 76f, 78t Density-independent effects, Diaphragm (birth control), 1099f,
si
habitats of, 682 Apago PDF Enhancer
attachments to, 93, 94f 1176, 1176f 1099t, 1100
reproduction in, 682-683 Cytosol, 62 Dental caries, 561-562, 561t Diaphragm (muscle), 1009, 1010f
sessile, 683-684, 683f Cytotoxic T cell, 1062t, 1066-1067, Deoxyhemoglobin, 1013 Diapsid, 708f, 709, 709f
hy
Ctenidia, 668 1066t, 1067f Deoxyribonucleic acid. See DNA Diastole, 1026, 1027f
Ctenophora (phylum), 642t, 643, Dephosphorylation, of proteins, 170 Diastolic pressure, 1029, 1029f
644f, 656, 656f Depolarization, 892-893, 893f Diatom, 571, 580-581, 581f
Cuboidal epithelium, 866, 867t D Derepression, 312 Diazepam, 899
p
simple, 866, 867t 2,4-D, 829f, 830 Derived characters, 458-459, 459f Dicer, 319, 319f, 320
Cubozoa (class), 655, 655f Dachshund, 423f shared, 458, 463-464 Dichlorophenoxyacetic acid (2,4-D),
Cuenot, Lucien, 233 Dalton (unit of mass), 19 Dermal tissue, of plants, 829f, 830
ar
Culex, 686f Dance language, of honeybees, 731, 733-736, 734f-735f, 756, Dichogamous plant, 855
Cultivation, 788-789, 788f 1146, 1146f 758, 803 Dictyostelium discoideum, 180, 358f,
Cutaneous respiration, 1006 Darevsky, Ilya, 1085 Desert, 1237 585, 585f
Cuticle, of plant, 734 Dark-field microscope, 62t Desmosome, 83f, 84 Dideoxynucleotide, 336-337, 337f
sw
Cutin, 734 Dark reaction, 150 Determinate development, 638, 639f Didinium, 1192, 1192f
Cuttlefish, 667, 668, 672 Darwin, Charles, 399, 403, 412, 1156. Determination, 375-377, 375f-376f Diencephalon, 902t, 903
Cyanobacteria, 64, 64f, 143, 148, See also Galpagos finch molecular basis of, 376 Diethystilbestrol (DES), 957
152, 517f, 547, 548, 554f, 559, critics of, 432-433 reversal of, 380-381 Differential-interference-contrast
563. See also Lichen invention of theory of natural standard test for, 375-376, 375f microscope, 62t
.a
Cyanogenic glycosides, 805, selection, 9-11 Detritivore, 1215, 1215f Differentiation, 14, 372-373,
806t, 807 Malthus and, 10 Deuterostome, 523, 523f, 638, 639f, 375-379, 375f-379f
Cycad, 602t, 603, 605, 605f, 607f On the Origin of Species, 8, 10, 397 643, 644f, 645, 1114 Diffuse pollution, 1246
w
Cycadophyta (phylum), 602t, photograph of, 8f Development Diffusion, 96-97, 96f, 104t
605, 605f plant studies, 825, 827 in animals, 372-373, 373f, 635t, facilitated, 96-97,
Cyclic AMP (cAMP), as second theory of evolution, 8-10, 397 638, 639f 97f, 104t
messenger, 173, 179-181, 180f voyage on Beagle, 1, 1f, 8, 9f, apoptosis in, 390-391, 391f Fricks Law of, 1002
w
Cyclic AMP (cAMP) response protein 10, 418 of behavior, 1139-1141 Digestion, 123
(CRP), 310-311, 310f Darwin, Francis, 827 in Caenorhabditis elegans, 373, 374f, chemical, 982
Cyclic GMP (cGMP), 174, 932 Dating, of fossils, 424, 424f 390-391, 391f in insects, 686
w
signal transduction in Day-neutral plant, 842f, 843 cell differentiation in, 375-379, of plant material, 717
photoreceptors, 932, 932f DDT, 577-578, 1245, 1245f 375f-379f in small intestine, 987, 988,
Cyclic photophosphorylation, 156, Deamination, 141 cell division in, 372, 373-375, 988f-989f
156f, 160 of amino acids, 141, 141f 373f-374f in stomach, 986-987
I-8 index
m
of ruminants, 991, 992f manipulation of, 327-349 Dog Earth
types of, 982-983, 982f-983f methylation of, 252 Brachyury gene mutation in, 496 age of, 11
of vertebrates, 982-983, 983f minor groove of, 262f breeds of, 422-423, 423f atmosphere of early Earth, 509
variations in, 990-992, of mitochondria, 74 chromosome number in, 189t circumference of, 4-5, 5f
co
991f-992f noncoding, 359-360, Dolly (cloned sheep), 381, 381f formation of, 17
Digestive tract, 982f, 983 485-486 Dolphin, evolution of, 425 orbit around sun, 1231, 1231f
layers of, 983, 983f of prokaryotes, 62 Domain (protein), 50-51, 51f origin of life on, 509-510, 511f
neural and hormonal regulation proof that it is genetic material, Domain (taxonomic), 513, 513f rotation of, 1231-1233,
1231f-1232f
y.
of, 993, 993f, 994t 256-259, 257f-258f Domestication, 422-423, 423f
Dihybrid cross, 228-229, 229f, 233t protein-coding, 359 Dominant hemisphere, Earthworm, 641t, 675, 675f, 901f, 902
Dihydroxyacetone phosphate, 128f recombinant. See Recombinant 905-906, 906f circulatory system of, 1022f
Dikaryon, 617, 623 DNA Dominant trait, 224-228, 224f-225f digestive system of, 982, 982f
bl
Dikaryotic hyphae, 616 replication of. See Replication codominance, 233t, 234, 234f locomotion in, 962, 962f
Dinoflagellate, 576-577, 576f-577f RNA versus, 43, 43f in humans, 227t nephridia of, 1040, 1041f
Dinosaur, 424f, 453, 462f, 697, 707t, segmental duplications, 481 incomplete dominance, 233t, Ebola virus, 529, 532t, 540, 540f
ee
708-709, 708f-709f sequencing of, 50, 336-337, 234, 234f Ecdysis, 680
feathered, 714 336f-338f, 339. See also Dopamine, 899, 900, 1134 Ecdysone, 957, 957f
parental care in, 464, 465f Genome sequencing Dormancy Ecdysozoan, 523-524, 523f, 643,
Dioecious plant, 606, 855 with sticky ends, 328, 328f in plants, 823-824, 823f-824f 644-645, 644f-645f
Dioxin, 831 structural, 359, 360t in seed, 824, 824f, 836, 836f ECG. See Electrocardiogram
.w
Diphtheria, 534, 560, 561t structure of, 37t, 42-43, 43f, Dorsal body cavity, 864, 865f Echinoderm, 523f, 641t, 645,
Diploblastic animal, 637, 643 259-263, 259f-262f Dorsal nerve cord, 1118 687-690, 688f-689f
Diploid (2n), 191, 208, 208f, supercoiling of, 267, 267f Dorsal protein, 386-387, 387f body plan of, 688-689, 688f
225, 1109 template strand, 265, 265f Dorsal root, 909 classes of, 689-690
development in, 687-688
partial, 556
Diplomonads, 570f, 572-573, 573f
Diplontic life cycle, 590, 590f
Diptera (order), 684f, 685t
Direct contact, cell signaling by,
259-261, 259f-260f
topological state of, 267
in transformation.
See Transformation
cs
three-dimensional structure of, Dorsal root ganglia, 909, 910f
Dosage compensation, 243
Double circulation, 1024
Double covalent bond, 24, 24f
Double fertilization, 608, 609f, 610,
diversity in, 689f
endoskeleton of, 688-689
nervous system of, 901f
regeneration in, 689
si
169, 169f, 170 Apago PDF Enhancer
Watson-Crick DNA molecule, 856-857, 856f-857f reproduction in, 689
Directional selection, 410-411, 262f, 263 Double helix, 41-42, 41f, 43, 43f, respiration in, 1003f
410f-411f X-ray diffraction pattern of, 261-261, 261f, 262f water-vascular system of, 688, 689
hy
Disaccharide, 38-39, 39f 260-261, 260f Douche, 1100 Echinodermata (phylum), 641t, 645f,
Disassortative mating, 402 DNA-binding motifs, in regulatory Down, J. Langdon, 250 687-690, 688f-689f
Disease proteins, 306-307, 307f Down syndrome, 250, 250f Echinoidea (class), 689f, 690
causes of, 487 DNA-binding proteins, 48 maternal age and, 250-251, Echolocation, 924
Ecological footprint, 1181-1182,
p
differences, 487-488 DNA helicase, 267, 268t, 269f 780, 780f Ecological pyramid, 1218-1219, 1219f
Dispersive replication, 263f, 264, 265 DNA library, 331-332, 331f Drugs inverted, 1218, 1219f
Disruptive selection, 409-410, DNA ligase, 268t, 269, 269f-270f, for AIDS treatment, Ecological species concept, 441
410f, 445-446 328, 328f, 331f 537-538, 537f Ecology
sw
Dissociation, of proteins, 53 DNA microarray, 364 drug addiction, 900-901, 900f behavioral, 1147-1149
Distal convoluted tubule, 1047, analysis of cancer, 364 drug development, community, 1185-1204
1047f, 1049-1050 preparation of, 364, 365f 487-488, 488f of fungi, 625-629, 626f-629f
Distal-less gene, 498, 498f, 524, 524f DNA polymerase, 265-266, 265f manufacture of illegal, 605 population, 1162-1182
Disturbances, biological, 1203, proofreading function of, 273 nonsteroidal anti-inflammatory Economic value, of biodiversity,
.a
1204, 1204f DNA polymerase delta, 271 drug, 943 1261-1263, 1261f-1263f
DNA, 12-13, 41-42, DNA polymerase epsilon, 271 pharmaceutical plants, Ecosystem, 3f, 4, 1208. See also
256-275. See also Gene DNA polymerase I, 266-267, 268t, 1261-1262, 1261f specific types
biogeochemical cycles in,
w
in chromosomes. beta subunit of, 268, 268f Dugesia, 657f, 658 disruption of ecosystems,
See Chromosome processivity of, 268 Duodenum, 987, 988f 1271, 1272f
cloning of. See Cloning sliding clamp, 268, 268f-269f Duplication (mutation), 300, 301f, dynamics of, 1207-1227
w
coding strand, 280, 285f, 286f DNA primase, 268-269, 268t, 480, 480f-481f, 481 effect of global warming on,
complementary. See cDNA library 269f, 272 Dwarfism, 950 1251-1252, 1251f
double helix, 41-42, 41f, 43, 43f, DNA rearrangement, 483, Dynactin complex, 77 effect of human activity on,
261-262, 261f, 262f 1072-1074, 1073f Dynein, 77, 77f, 79 1245-1250
index I-9
m
Ectomycorrhizae, 628, 628f Embryo (plant), 754, 754f flow in living things, 3, 108-109 Epiphyses, 965, 965f
Ectoprocta, 641t, 644f Embryo sac, 850, 850f, 851, 851f flow through ecosystem, Epistasis, 233t, 235-236, 236f, 414
Ectotherm, 710, 880-881 Embryo transfer, 1102 1214-1219 Epithelial tissue, 864, 865-866, 867t
Edema, 994, 1032 Embryogenesis, 754f forms of, 108 columnar, 866, 867t
co
Edge effect, 1267 Embryonic development laws of thermodynamics, 109-110 cuboidal, 866, 867t
EEG. See Electroencephalogram human, 429f prokaryotes need for, 559 keratinized, 866
Eel, 975, 975f in plants, 754-760, 754f-760f Energy expenditure, 995, 997 regeneration of, 866
Effector, 876 Embryonic flower mutant, Energy level, 21, 21f simple, 866
y.
antagonistic, 877-878, 877f in Arabidopsis, 841, 841f Enhancement effect, 157, 157f squamous, 866, 867t
Effector protein, 179-182, 179f Embryonic stem cells, 342-343, Enhancer, 313-314, 314f stratified, 866
Efferent arteriole, 1047 342f-343f, 379, 379f Enkephalin, 899 structure of, 866
EGF. See Epidermal growth factor Emergent properties, 4, 14 Enteric bacteria, 551f Epithelium, 865
bl
Egg Emerging viruses, 540 Enterobacteriaceae, 558 EPSP. See Excitatory postsynaptic
amniotic, 706, 708f Emerson, R. A., 236 Enterogastrone, 993 potential
fertilization, 1106-1109, 1106t, Emphysema, 1012 Enthalpy, 110 Equilibrium constant, 111
ee
1107f-1109f Enantiomer, 35, 35f Entropy, 110, 110f Equilibrium model, of island
of frogs, 1109, 1109f Encephalitozoon cuniculi, 358f, Environment biogeography, 1226-1227, 1226f
of reptiles, 706, 708f 618, 618f effect on enzyme function, Equilibrium potential, 891, 892t
Egg coloration, adaptive value of, Endangered species 116-117, 116f Equisetum, 599, 599f
1147-1148, 1147f conservation biology, 1256-1278 effect on gene expression, 233t, ER. See Endoplasmic reticulum
.w
Ejaculation, 1093 preservation of, 1275-1276 235, 235f Eratosthenes, 4-5, 5f
EKG. See Electrocardiogram Endemic species, 1258-1261, individual responses to changes in, Erythrocytes, 870, 1019, 1019f
El Nio Southern Oscillation, 1259f, 1260t 1162-1163 facilitated diffusion in, 97
1243-1244, 1244f, 1252 Endergonic reaction, 110-111, 111f, limitations on population growth, membrane of, 90t
Elasmobranch, 934, 1043
Elastin, 81, 81f, 392
Eldredge, Niles, 451
Electrical synapse, 896
113, 113f
965-966, 965f
cs
Endochondral development, of bone,
Electromagnetic receptor, 916 Endocytosis, 102, 102f, 104t Enzymatic receptor, 172-173, introduction of foreign DNA into,
Electromagnetic spectrum, receptor-mediated, 102f, 172f, 172t 329-330
151, 151f 103, 104t Enzyme, 44, 45t, 113-117 lac operon of, 308, 309-310,
Electron, 18, 19, 19f Endoderm, 637, 637f, 864, activation energy, 113-114 308f-310f
p
in chemical behavior of atoms, 1113, 1113f attached to membranes, 93, 94f mutations in, 558
20, 20f Endodermis, 741, 741f, 775 catalytic cycle of, 114, 115f replication in, 266-270
energy level of, 21, 21f Endogenous opiate, 899 cofactors, 117 Esophagus, 985-986, 986f
ar
valence, 22 Endomembrane system, 65, 69-73 defects in gene disorders, 279 Essay on the Principle of Population
Electron acceptor, 124, 124f, Endonuclease, 266 digestive, 994t (Malthus), 10
139-140, 139f Endoparasite, 1199 genetic variation in, 398 Essential amino acids, 998
Electron carriers, 124, 125f, 134-135 Endophyte, 626, 626f inhibitors and activators of, Essential nutrient, 997-998, 998t
sw
Electron microscope, 61, 61f, 62t Endoplasmic reticulum (ER), 65, 117, 117f in plants, 790t
microscopy of plasma membrane, 69-71, 78t, 81t intracellular receptors as, 174 EST. See Expressed sequence tag
91-92, 91f origin of, 568, 568f multienzyme complex, Estrogen, 956, 1093t
scanning, 61, 62t, 91 proteins targeted to, 296f, 297 115-116, 115f Estrus, 1090, 1097
transmission, 61, 62t, 91 rough, 69-70, 70f nonprotein, 116 Estuary, 1243
.a
Electron orbital, 19, 20f smooth, 70, 70f pH effect on, 52-53, 116-117, 116f Ethanol, 35f
Electron transport chain, 124f, 125, Endorphin, 899 restriction, 328, 328f, 331f, Ethanol fermentation, 140, 140f
132, 133f Endoskeleton, 962, 963, 963f 353, 353f Ethics
w
ATP production in, 134-136, 134f, of echinoderm, 688-689 RNA, 116 ownership of genomic
135f, 136f of vertebrates, 696 temperature effect on, 52-53, information, 369
photosynthetic, 156 Endosperm, 754, 754f, 760, 760f 116, 116f of stem cell research, 379
production of ATP by Endospore, 554 Enzyme-substrate complex, 114, 114f value of biodiversity, 1263
w
chemiosmosis, 135-136, 135f Endosteum, 966 Eosinophil, 1062, 1062t Ethology, 1133-1134
Electronegativity, 24, 25t, 34 Endosymbiont theory, 75, 75f, Ephedra, 602t, 605, 760 Ethylene, 826t, 835-836, 835f
Electrophoresis, 398 568-569, 569f, 570 Ephedrine, 605 Etiolation, 817, 817f
w
Element, 18 Endosymbiosis, 75, 75f, 517, Epidermal cells, of plants, 734, Eucalyptus, 749
inert, 22 568-569, 569f 734f, 740 Euchromatin, 190
in living systems, 22-23 secondary, 569 Epidermal growth factor (EGF), Eudicot, 499, 607f, 608
periodic table, 22-23, 22f Endothelin, 942 202, 942 leaf of, 741-742, 741f, 748, 748f
I-10 index
m
cell structure in, 65-69, 66f, 67f, Darwins theory of, 8-10, 432 of reproductive systems, in historical time, 1258, 1258t
68f, 81t of development, 492-504 1087-1088, 1088f introduced species and, 1264t,
cell wall of, 67f, 78t, 81t of diseases, 470-471, 470f-471f of reptiles, 697, 708-709, 1269-1271
chromosomes of, 65, 78t, 189-191, of eukaryotes, 75, 75f, 188 708f-709f of Lake Victoria cichlid fish,
co
189f-191f, 189t, 548 evidence for, 417-433 of seed plants, 602-603, 603f 449-450, 449f, 1271
compartmentalization in, 517, age of Earth, 11 of shark, 701 loss of keystone species,
518-519, 548 anatomical record, 428-430, of snakes, 425 1272, 1273f
cytoskeleton of, 65, 75-79, 76f 428f-430f of social system, 1157-1159 mammals, extinct, 718t
y.
DNA of, 62 biogeographical studies, 430 speciation and, 451-452, 451f over time, 452-453
endomembrane system of, comparative anatomy, 11, 11f in spurts, 451-452 overexploitation and, 1264t,
65, 69-71 convergence, 431-432, 431f of tobacco, 477f, 480, 480f 1268-1269
evolution of, 75, 75f, 188, development, 428-429, 428f of vertebrate brain, 903f population size and, 1273-1275,
bl
568-570, 568f-569f experimental tests, 411-413, of vertebrates, 697, 698f, 1273f-1274f
flagella of, 66f, 78t, 79-80, 79f, 80f, 412f-413f, 422, 22f 1121, 1121f in prehistoric time,
81t, 548 fossil record, 10-11, 424-428, of whales, 425, 425f 1257-1258, 1257f
ee
gene expression in, 305, 312-315, 424f-427f of wheat, 478f Extra-pair copulation,
313f-315f, 322f homologous structures, of wings, 497, 498, 976-977, 977f 1153-1153, 1153f
genome of, 358f 428, 428f Evolutionary adaptation, as Extracellular fluid, 892t
gene organization in, 360t imperfect structures, characteristic of life, 3 Extracellular matrix, 80-81, 81f, 868
noncoding DNA in, 359-360 429-430, 429f Evolutionary age, species richness Extracellular regulated kinase, 178f
.w
initiation in, 295 molecular biology, 11-12, 11f and, 1225 Extraembryonic coelom, 1116
key characteristics of, vestigial structures, 430, 430f Evolutionary conservation, 14 Extraembryonic membrane,
518-519, 518t of eye, 414, 414f, 429, 429f, Excision repair, 274-275, 274f 1116, 1116f
origin of, 517-518, 517f, 568-570, 501-504, 501f-503f Excitation-contraction coupling, Extraterrestrial life, 508-509, 509f
568f-570f
plasma membrane of, 66f
prokaryotes versus, 81t, 547-548
promoters of, 287-288
replication in, 271-273, 271f-272f
702, 702f
of flight, 467f
cs
of eyespot on butterfly wings, 498f
of fish, 698, 700-701, 700f,
transcription in, 287-289, 288f 406-407, 407f of mollusks, 669 928-929, 928f
transcriptional control in, 305, genetic drift and, 401f, 402-403, Exercise focusing of, 929f
312-315, 322f 402f, 406 bone remodeling and, 967f of insects, 414, 414f, 501, 501f
translation in, 295 genetic variation and, 396-397, effect on metabolic rate, 995 of mollusks, 429, 429f, 501, 501f
p
vacuoles of, 81t 397f, 412, 412f muscle metabolism during, 974-975 of planarian, 501, 501f
Eumetazoa (subkingdom), 640, 643, of genomes, 474-489 Exergonic reaction, 110-111, 111f structure of, 929-930, 929f
644f, 652-656, 652f-656f of glycolysis, 129, 143 Exhalant siphon, 671, 671f of vertebrates, 429, 429f, 501,
ar
Euryarchaeota, 550f of heart, 1026f Exocrine gland, 866 501f, 929-930, 929f
Eusociality, 1156 of homeobox genes, 389 Exocytosis, 103, 103f, 104t Eye color
Eutherian, 524, 525f of hominids, 722-724 Exon, 289, 289f in fruit fly, 240-241, 240f
Eutrophic lake, of horses, 414, 414f, 426-428, Exon shuffling, 290 in humans, 232-233, 233t
sw
1240-1241, 1240f 426f-427f Exonuclease, 266, 268 Eyeless gene, 342, 502, 502f
Evaporation, 880 human impact on, 453 Exoskeleton, 41, 41f, 679-680, 679f,
Evening primrose (Oenothera of humans. See Human evolution 962-963, 963f
biennis), 852 on islands, 431-432, 431f, Experiment, 5f, 6 F
Evergreen forest 444-445, 444f control, 6 F plasmid, 554-556, 555f
.a
temperate, 1238 of land plants, 521f, 571, 589-590 test, 6 F plasmid transfer, 555, 555f
warm moist, 1235f, 1236 of leaf, 596-597, 597f Expiration, 1009-1011, 1010f F1 generation. See First filial
Evolution, 396-397. See also of life on earth, 511f Exploitative competition, 1188 generation
w
Coevolution of mammals, 525f, 697, 698f, Expressed sequence tag (EST), F2 generation. See Second filial
of aerobic respiration, 143 718, 718f 361, 361f generation
agents of, 401-405, 401f-405f marsupial-placental convergence, Expression vector, 342 Facilitated diffusion, 96-97, 97f, 104t
interactions among, 430-431, 431f Extensor muscles, 969f Facilitation, 1203
w
406-407, 407f of mitosis, 570 External fertilization, 1088, 1089f Facultative symbiosis, 626
of amphibians, 697, 703, 704-705, of mollusks, 667 External intercostal muscle, 1009 FAD, 44, 131
704f-705f mutation and, 301, 401, 401f, 406 Exteroceptor, 916 FADH
w
of apes, 721-726 natural selection. See Natural Extinction, 452-453, 452f in ATP yield, 137, 137f
of biochemical pathways, 118 selection conservation biology, 1256-1278 contributing electrons to electron
of birds, 424f-425f, 425, 463, 466, of nitrogen fixation, 143 disruption of ecosystems and, transport chain, 134, 134f, 135
467f, 712, 712f, 714, 714f of oysters, 426 1271, 1272f from Krebs cycle, 131, 132, 133f
index I-11
m
caloric content of, 53 armored, 699t Floral organ identity gene, 846, Food intake, regulation of, 995-997
as energy-storage molecules, 54-55 bony, 701-702, 701f, 1004-1006, 846f-847f, 848 Food poisoning, 1079
structure of, 53-54, 54f 1004f, 1042 Florigen, 844 Food preservation, 52-53
Fatty acids, 36f, 55 brain in, 902-903, 903f Flower Food security, 792
co
catabolism of, 141-142, 142f cartilaginous, 698f, 700-701, 700f, complete, 848 Food storage, in plants, 759-760, 760f
polyunsaturated, 53, 54f 1043, 1065 evolution of, 469-470, 499, Food storage root, 742, 743f
saturated, 53, 54f characteristics of, 698-702 848-850 Food supply, population cycles
trans-fatty acids, 55 circulation in, 699, 1023, 1023f floral symmetry, 499 and, 1177
y.
unstaurated, 53, 54f depletion of, 1247-1248, 1248f incomplete, 848 Foraging behavior, 1148-1149, 1148f
Fatty acid desaturase, 93 evolution of, 698, 700-701, 700f, initiation of flowering, Foraminifera (phylum), 571, 584, 584f
Feather, 712, 712f 702, 702f 840-841, 840f Forebrain, 902f, 902t
Feather star, 689 fertilization in, 1087f, 1088, 1088f male and female structures, human, 903-905, 904f-905f
bl
Feces, 990 hearing in, 920-921, 921f separation of, 855-856 Forest ecosystem
Fecundity, 1169 heart in, 1023, 1023f morphology of, 848-849 biogeochemical cycles in,
Feedback inhibition, 117, jawed, 699-700, 700f production of 842-848, 12-1213, 1213f
ee
118-119, 119f jawless, 700, 1065-1066 842f-848f effect of deforestation on,
Female infertility, 1101 kidney of autonomous pathway of, 1246-1247
Female reproduction, hormonal cartilaginous fish, 1043 845-846, 845f-846f Fork head gene, in Drosophila, 1117
control of, 1093t freshwater fish, 1042, 1043f flowering hormone, 844 fosB gene, 1136
Female reproductive system, 875f, marine bony fish, 1042, 1043f formation of floral meristems Fossil record, 424-428, 424f-427f
.w
876, 1090, 1090f, 1094-1098, lobe-finned, 698f, 699t, 702, and floral organs, 846, angiosperms, 606-607, 607f
1094f-1098f 702f, 704f 846f-847f, 848, 848f community, 1187
Fermentation, 124, 129, 139-140, 140f nitrogenous wastes of, 1045f gibberellin-dependent early eukaryotic, 568, 568f
ethanol, 140, 140f path to land, 702, 702f pathway, 845 evidence for evolution, 10-11,
Fern, 589f, 590, 598-601, 599,
599f-600f, 601t
Ferredoxin, 158, 159f
Fertilization, 208, 208f, 1087-1090,
predation on insects, 408, 408f
prostaglandins in, 943
cs
ray-finned, 698f, 699t, 702, 702f
respiration in, 1004-1006,
light-dependent pathway,
842-844, 842f-843f
phase change and,
840-841, 841f
424-428, 424f-427f, 432
gaps in, 425, 432
history of evolutionary change,
425-426, 425f
1106-1109, 1106t, 1107f-1109f 1003f-1005f temperature-dependent microfossils, 546, 546f
si
in amphibians, 1088, 1088f-1089f Apago PDF Enhancer
spiny, 699t, 700 pathway, 844 Founder effect, 402-403
in birds, 1088-1089, 1088f-1089f swimming by, 975-976, 975f shape of, 499 Four oclock, flower color in, 233t,
double, 608, 609f, 610, 856-857, taste in, 926 structure of, 848-849, 848f 234, 234f, 244
hy
856f-857f viviparous, 1087, 1087f Flower color, 853-854, 853f Fox, 423, 423f
external, 1088, 1089f FISH. See Fluorescence in situ Flowering hormone, 844 FOXP2 gene, 485, 1147
in fish, 1087f, 1088, 1088f hybridization Flowering plant, 589f, 602t, 606-610, Frameshift mutation, 283, 299
internal, 1087-1090, 1087f-1090f Fitness, 405-406, 406f, 414 606f-610f Franklin, Rosalind, 260-261, 260f
p
in plants, 605, 609, 609f, 610, 5 Cap mRNA, 288, 288f angiosperm, 606, 754f Free energy, 110
856-857, 856f-857f Flagella, 65 dichogamous, 855 Free water, 98, 98f
in reptiles, 1089-1090 of bacteria, 64f, 65, 548, 553, 553f dioecious, 855 Freeze-fracture microscopy,
ar
Fertilization envelope, 1108 of eukaryotes, 66f, 78t, 79-80, 79f, evolution of, 469-470 91-92, 91f
Fertilizer 80f, 81t, 548 fertilization in, 856-857, 856f-857f Frequency-dependent selection,
nitrogen, 1211 of prokaryotes, 63f, 65, 81t, 548, gamete formation in, 850-851, 407-408, 408f
phosphorus, 1212 552, 553, 553f 850f-851f Freshwater habitat,
sw
pollution from, 1251 of protists, 572-573, 575f gene duplication in, 499-500, 1238-1241, 1239f-1240f
Fever, 883 Flame cells, 657-658 499f-500f changes with water depth,
Fiber, dietary, 990 Flatworm, 523f, 641t, 643, 657-660, life cycle of, 608-610, 609f, 840f 1239-1240, 1239f-1240f
Fibrin, 1021 657f, 659f-660f monoecious, 855 oxygen availability in, 1239
Fibrinogen, 1019 classification of, 658-660 pollination. See Pollination pollution of, 1246, 1246f
.a
Fibroblast growth factor, 378, digestive cavity of, 657, 657f, 982 trends in, 849-850, 849f Fricks Law of Diffusion, 1002
378f, 1118 excretion and osmoregulation in, Fluid mosaic model, 89, 90f, 92-93 Frog (Rana), 703, 703t, 705-706, 705f
Fibronectin, 81, 81f, 392, 392f 657-658, 657f, 1040-1041, Fluidity, membrane, 92-93, 93f chromosome number in, 189t
w
Fiddlehead, 600, 600f 1040f-1041f Fluke, 658-659, 659f declining populations of,
Filament (flower), 608, 608f, eyespot of, 657, 657f, 928, 928f Fluorescence in situ hybridization 1265, 1265f
848f, 849 free-living, 657, 658 (FISH), 353, 354f development in, 373f, 1110f, 1111f
Filial imprinting, 1139 nervous system of, 657f, 658, Fluorescence microscope, 62t fertilization in, 1088-1089,
w
Filopodia, 1113 901f, 902 Fly, eye development in, 502, 502f 1089f-1090f, 1109, 1109f
Filovirus, 532t, 540, 540f reproduction in, 657f, 658 Flying fox, declining populations of, gastrulation in, 1114, 1114f
Filtration, 1040 Flavin adenine dinucleotide. See FAD 1272-1273, 1273f hybridization between species of,
w
in kidney, 1045, 1046-1047, 1047f Flavivirus, 531f, 532t Flying phalanger, 431f 439, 440
Finch, Darwins, 8, 9f Flemming, Walther, 189, 207 Flying squirrel, 431f Frond, 600, 600f
beaks of, 408, 418-419, 418f, Flesh-eating disease, 560 Folic acid, 998t Frontal lobe, 904, 904f
1191, 1191f Flexor muscles, 969f Foliose, 627f Fructose, 38, 39f
I-12 index
m
evolution of, 606f cytokinesis in, 198 evolution of, 1001-1002, 1003f 406-407, 407f
kinds of, 762, 763f ecology of, 625-629, 626f-629f in lungs, 1009, 1010f interactions among evolutionary
ripening of, endophytic, 626, 626f in single cell organisms, 1003f forces, 406-407, 407f
835-836, 835f genome of, 477 in tissues, 1010f speciation and, 442
co
Fruit fly (Drosophila) key characteristics of, 615, 615t Gastric inhibitory peptide (GIP), 993, Gene-for-gene hypothesis, 811, 811f
behavioral genetics in, 1135-1136 major groups of, 615, 615f, 615t 993f, 994t, 996, 997, 997f Gene therapy, 345, 345t
body color in, 246-247, 246f mating type in, 177 Gastric juice, 986, 986f General transcription factor,
branchless gene in, 1118 mitosis in, 616-618 Gastrin, 993, 993f, 994t 313, 313f
y.
bristle number in, 422, 422f obtaining nutrients, 614, Gastrodermis, 652, 652f Generalized transduction,
development in, 494, 617-618, 617f Gastrointestinal tract. See 556-557, 557f
1117-1118, 1117f phylogeny of, 615, 615f, 615t Digestive tract Generation time, 1168, 1169f
eye color in, 240-241, 240f reproduction in, 614, 617, 617f Gastropod, 668, 668f, 669, 670f Generative cell, 605, 609f, 610
bl
eyeless gene from, 342 in rumen, 620 Gastropoda (class), 670-671, 670f Genetic code, 42-43, 43f, 282-284,
gene expression of, 304f in symbioses, 626-629 Gastrovascular cavity, 982, 282f, 283t, 284f
genetic map of, 246-247, 246f, 354 Fungi (kingdom), 13, 13f, 514, 1022, 1022f in chloroplasts, 284
ee
genome of, 354, 358f, 362, 517f, 518t Gastrula, 635 in ciliates, 284
475f, 486 Fusarium, 630 Gastrulation, 392, 392f, 1106t, deciphering, 283
Hawaiian, 443, 447, 447f Fusion protein, 341, 341f 1112-1116, 1113f-1116f, 1113t degeneracy of, 283-284
heart development in, 1118, 1118f in amphibian, 1114, 1114f in mitochondria, 284
hedgehog signaling molecule in, in birds, 1114-1115, 1115f triple nature of, 282-283, 282f
G
.w
1124 in mammals, 1115, 1115f universality of, 284
heterozygosity in, 398 G-protein, 173, 179-183, 179f, 912, in sea urchins, 1113-1114, 1113f Genetic counseling, 252-253
homeotic genes in, 5, 388, 388f 912f, 946 Gated ion channel, 96, 892, 893f, 917 Genetic disorder, 249-253, 249t
homeotic mutations in, 307, 494 G-protein-coupled receptor, 946 Gause, Georgii, 1189 enzyme deficiency, 279
meiosis in, 214
Morgans experiments with,
240-241, 240f, 354
pattern formation in 383-389,
384f-388f
172t, 173, 179-183, 179f
G0 phase, 192-193, 202
G1 phase, 192, 192f, 202
cs
G-protein-linked receptor, 95, 172f,
segmentation in, 388-389, 388f 440-441, 448, 448f pleiotropic effect of, 413 human proteins produced
selection for negative Gallbladder, 988f, 989 in populations, 396-414 in bacteria, 343-344
phototropism, 410-411, 411f Gallstones, 989 segmental duplication, 481 medical applications of, 343-345,
ar
sex chromosomes of, 241, 241t Gametangium, 590 Gene cloning, 330 344f, 345t
toll receptor in, 1056 Gamete, 208, 208f, 214, 1084 Gene disorder social issues raised by, 348
transposons in, 484 plant, 850-851, 850f-851f enzyme deficiency in, 279 Genetic Information
wing traits in, 246-247, 246f prevention of fusion of, 438t, 440 important disorders, 227t Nondiscrimination Act
sw
X chromosome of, 241, 245 Gametic intrafallopian transfer Gene disorder. See Genetic disorder (GINA), 369
Fruticose lichen, 627f (GIFT), 1102 Gene duplication, 480, 480f-481f, Genetic map, 244-248, 352-355, 353
FSH. See Follicle-stimulating hormone Gametophyte, 590, 590f, 594f, 595, 481, 499-500, 500f of Drosophila, 246-247, 246f
FtsZ protein, 188, 188f 608, 608f, 609, 850-851 Gene expression, 278-301, 298f, 298t of humans, 247-248, 248f
Fucus (zygote), 754, 755, 755f Gametophytic self-incompatibility, Central Dogma, 280, 280f using recombination to make
.a
Fumarate, 132, 133f 856, 856f chromatin structure and, 316-317, maps, 245f, 246-247, 246f
Funch, Peter, 660 Ganglia, 909, 910f 316f-317f Genetic mosaic, 243
Function, of living systems, 13 Ganglion cell, 930, 931f control of, 14, 304-324 Genetic recombination. See
w
Functional genomics, 364-366, Gap genes, 385f, 387 in development, 1117 Recombination
365f-366f, 484, 500 Gap junction, 83f, 84 environmental effects on, 233t, Genetic relationships, 1155f
Functional group, 35, 35f Gap phase, 192, 192f 235, 235f, 308-309 Genetic sex determination, 1086
Functional magnetic resonance Garden pea (Pisum sativum) in eukaryotes, 305, 312-315, Genetic template, 1140
w
imaging (fMRI), 1134, 1134f chromosome number in, 189t 313f-315f, 322f Genetic variation
Fundamental niche, 1188, 1188f flower color in, 224-228, 225f, in plants, 830f evolution and, 396-397, 397f,
Fungal disease, 626 226f, 231-232, 231f in polyploids, 480 412, 412f
w
in animals, 630, 630f genome of, 479 posttranscriptional control, genes within populations, 396-414
in humans, 630 Knights experiments with, 222 317-321, 318f-319f, 321f maintenance of, 407-409,
in plants, 629-630, 629f, Mendels experiments with in prokaryotes, 305, 308-312, 408f-409f
804-805, 804f 222-229, 222f-229f 308f-312f in nature, 398, 398f
index I-13
m
conserved regions in, 362-363 GIFT. See Gametic intrafallopian Glycoprotein hormones, 948 3, 508
downsizing of, 479, 479f transfer Glyphosate, 346, 347f Growth factor, 202, 203f, 942
eukaryotic, 358f Gigantism, 950 Gnathostomulida, 643 cell cycle and, 202, 203f
gene organization in, 360t Gill(s) Gnathozoa, 643 characteristics of, 202, 203f
co
noncoding DNA in, 359-360 of fish, 699, 702, 1004-1006, Gnetophyta (phylum), 602t, 605-606, Growth factor receptor, 202
evolution of, 474-489 1004f-1005f 605f, 607f Growth hormone (GH), 948,
finding genes in, 358-359 internal, 699 GnRH. See Gonadotropin-releasing 950-951, 950f
gene swapping evidence in, Gill cover, 702 hormone Growth hormone-inhibiting
y.
483-484, 483f Gill filament, 1005 Goblet cell, 866 hormone (GHIH), 949
human. See Human genome Ginkgo biloba, 605f, 606 Goiter, 949, 949f Growth hormone-releasing hormone
of mitochondria, 364 Ginkgophyta (phylum), 602t, 603, Golden rice, 348, 348f (GHRH), 949
of moss, 595 605f, 606, 607f Golgi apparatus, 70-71, 70f, 71f, GTP, 132, 133f
bl
prokaryotic, 358f GIP. See Gastric inhibitory peptide 78t, 81t Guanine, 42, 42f, 259f, 260, 262
rearrangement of, 482, 482f Girdling of tree, 738 Golgi body, 70, 739 Guano, 1044
size and complexity of, 358, GLABROUS3 mutant, in Arabidopsis, Golgi, Camillo, 70 Guard cells, 734, 734f
ee
358f, 486 735, 735f Golgi tendon organs, 919 Guppy, selection on color in, 412-413,
of virus, 529, 531 Glacier, 1251, 1251f Gonadotropin-releasing hormone 412f-413f
Genome map, 352-355, 353f-355f. Glaucoma, juvenile, 227-228, 227f (GnRH), 949, 1093, 1094f Gurdon, John, 380
See also Physical map Gliding joint, 967, 968f Gonorrhea, 561t, 562, 562f Gurken protein, 386, 387f
Genome sequencing, 356-358, Global climate change, 369f, Gooseneck barnacle (Lepas anatifera), Gustation, 926
.w
356f-357f 1187, 1209 683f Gut, 996
clone-by-clone method, 357, 357f crop production and, 795-797 Gore, Al, 1250 Guttation, 776
databases, 358-359 Global warming, 1250-1253 Gorilla (Gorilla), 457, 457f, 482, 482f Gymnopphiona. See Apoda (order)
shotgun method, 357, 357f carbon dioxide and, 1251, 1251f Gould, Stephen Jay, 451 Gymnosperm, 603, 605f, 607f
using artificial chromosomes, 356
Genome-wide association (GWA)
mapping, microarray analysis and,
364-365
computer models of, 1250
effect on humans, 1252-1253
effect on natural ecosystems,
1251-1252, 1251f
cs Gout, 1044
Graafian follicle, 1095, 1096f
Graded potential, 892-893, 893f
Gradualism, 451, 451f
Gynoecium, 608, 608f, 849
H
Genomic imprinting, 251-252, 381 geographic variation in, Gram-negative bacteria, 552-553, H band, 969
si
Genomic library, 331 Apago PDF Enhancer
1250, 1250f 552f-553f H1N1 virus, 1079
Genomics, 352-369, 363f Globulin, 1019 Gram-positive bacteria, 550f, H5N1 virus, 539, 1079
agricultural applications of, Glomeromycetes, 622 552-553, 552f-553f HAART therapy, 538
hy
368-369, 368f-369f Glomeromycota (phylum), 615, 615f, Gram stain, 552-553, 552f-553f Haberlandt, Gottlieb, 831
applications of, 367-369, 615t, 622 Grana, 74, 74f Habitat destruction, 1266, 1266f
368f-369f Glomerulus, 1042, 1042f, 1046, 1047f Grant, Peter, 419, 441 Habitat, economic value of,
behavioral, 369 Glomus, 615, 615t Grant, Rosemary, 419, 441 1262, 1262f
p
comparative, 362-363, 363f, Glottis, 1007, 1008f Granular leukocytes, 1019 Habitat fragmentation, 1267-1268,
474-477, 475f, 500 Glucagon, 955, 994-995, 995f Granulosa cell, 1095 1267f
functional, 364-366, 365f-366f Glucocorticoids, 954 Grape, 834, 834f Habitat loss, 1245-1247, 1245f-1247f,
ar
medical applications of, 368, Gluconeogenesis, 995 Grass, 1237 1264t, 1266-1268, 1266f-1268f
487-488, 488f Glucose Grasshopper, 1022f Habitat occupancy, population
ownership of genomic in aerobic respiration, 132 Grassland, temperate, 1237 dispersion and, 1167
information, 369 alpha form of, 38, 39, 39f Gravitropism, 819-820, 819f-820f Habituation, 900, 1137
sw
Genotype, 226 beta form of, 38, 39, 39f negative, 819f, 820 Haeckel, Ernst, 645
Genotype frequency, 399f, 400 blood, regulation of, positive, 820 Haemophilus influenzae, 352, 352f,
Genus, 512, 513 994-995, 995f Gravity sensing, in plants, 819f, 820 353, 357
Geographic distribution, variation catabolism of, 124 Green algae, 463f, 517-518, Hagfish, 698f, 699, 699t
within species, 437, 437f oxidation of, 25, 124-125 517f, 571, 589, 589f, 591-592, Hair, 716
.a
Geographic isolation, 437t polymers of, 40f 591f-592f Hair cell, 921, 921f
Geography, of speciation, 444-446, priming of, 127, 128f Greenbriar (Smilax), 741f Hair-cup moss (Polytrichum), 594f
444f-445f reabsorption in kidney, 1048 Greenhouse gas, 1251, 1251f Hairpin, 286, 286f
w
Germ cell, 1092 structure of, 38, 38f, 39f Gregarine, 578, 578f Haldane, J. B. S., 1155
Germ layers, 864, 1113 Glucose 6-phosphate, 128f Greyhound dog, 422-423, 423f Half-life, 19-20, 424
Germ-line cells, 208, 208f Glucose repression, 310-311, 310f Griffith, Frederick, 257, 257f, 329, 557 Halobacterium, 95f, 550f
Germination, of seeds, 393, 393f, 610, Glucose transporter, 45t, 97, Gross primary productivity, 1215 Halophyte, 781
w
764-766, 764f-766f, 817 101, 101f Ground finch, 448, 448f Halorespiration, 564
GH. See Growth hormone Glutamate, 141, 141f, 898 large ground finch (Geospiza Hamilton, William D., 1155-1156
Ghrelin, 996 Glyceraldehyde 3-phosphate, 127, magnirostris), 9f, 418f, 448f Hamstring, 968, 969f
w
GHRH. See Growth hormone- 128f, 161f, 162 medium ground finch (Geospiza Handicap hypothesis, 1152
releasing hormone (GHRH) Glycerol, 53, 55, 55f fortis), 419, 419f, 441, 448f Hansen disease (leprosy), 560, 561t
Giant clam (Tridacna maxima), Glycerol phosphate, 35f small ground finch (Geospiza Hantavirus, 540
667, 667f Glycine, 46, 47f fuliginosa), 441, 448f Haplodiploidy, 1156
I-14 index
m
399-400, 399f plants, 346-347, 347f in Drosophila, 388, 388f Hotspots, 1259-1261,
Hardy-Weinberg principle, 399-400 Herbivore, 982 evolution of, 389 1259f-1260f, 1260t
Hashimoto thyroiditis, 1075 digestive system of, 991f, 992 in mouse, 388f population growth in,
Hatfill, Steven J., 368 plant defenses against, 810, 810f, Homeotic mutants, 388 1260-1261, 1260f
co
Haversian canals, 966 1193-1194, 1193f Hominid, 482f, 722-724, 723f Hox genes, 389, 493, 494, 523f, 524,
Haversian lamellae, 966 teeth of, 984f compared to apes, 722 639, 646, 756
Haversian system, 965f, 966 in trophic level ecosystem, evolution of, 722-724 Hubbard Brook Experimental Forest,
Hawaiian Drosophila, 443, 447, 447f 1215, 1215f Hominoid, 722-723, 721f, 722f 1212-1213, 1213f
y.
Hawaiian Islands, 1270, 1270f Heredity, 221-236. See also Homo erectus, 724, 725 Human
hCG. See Human chorionic Gene entries Homo floresiensis, 724, 724f birth weight in, 411, 411f
gonadotropin as characteristic of life, 508 Homo (genus), 722, 724 cleavage in, 1112
Head, of vertebrates, 696, 697f mechanism as evidence for Homo habilis, 724 development in, 1125-1129,
bl
Hearing, 920-925, 920f-925f evolution, 11 Homo heidelbergensis, 725 1126f-1128f
Heart, 1023 Hermaphrodite, 658, 1085, 1085f Homo neanderthalensis, 725 effect of global warming on,
of amphibians, 703, 1024, 1024f Herpes simplex virus, 344, 531f, 532t Homo sapiens, 723, 724, 725, 726f 1252-1253
ee
of birds, 1025, 1025f Herpes zoster, 529 Homokaryotic hyphae, 616 effect on biosphere, 1245-1250
cardiac cycle, 1026, 1027f Hershey-Chase experiment, Homologous chromosomes, 191, evolutionary relationships of,
contraction of, 1026 258-259, 258f 191f, 209-210, 209f 457, 457f
development in Drosophila, 1118 Heterochromatin, 190 Homologous recombination, 555 extinctions due to
of fish, 1023, 1023f Heterochrony, 493 Homologous structures, 11, 11f, 428, in historical time, 1258, 1258t
.w
four-chambered, 1025, 1026-1030 Heterokaryon, 616, 623 428f, 464, 465f, 497 in prehistoric times,
of mammals, 1025, 1025f Heterotherm, 880 Homologue, 191, 211 1257-1258, 1257f
of reptiles, 1024 Heterotrimeric G protein, 179, 179f Homoplasty, 459-460, 460f, 464-465, forebrain of, 903-905, 904f-905f
Heart attack, 1033 Heterotroph, 123, 139, 559, 634t 465f, 498 gastrulation in, 1115
Heart disease, chlamydia and, 563
Heat, 108-109, 1216
Heat-losing center, 882
Heat of vaporization, 28
of water, 27t, 28
Heterozygosity, 398
Heterozygote advantage,
408-409, 409f
cs
Heterozygote, 225, 227t, 399-400
1069, 1070f High-density lipoprotein (HDL), 516, 521-522, 522f, 548 survivorship curve for, 1170,
Heavy metal, phytoremediation for, 54, 1033 Hormonal control 1170f-1171f
799-800, 799f Hill, Robin, 151 of digestive tract, 993, 993f, teeth of, 717, 717f
Hedgehog signaling molecule, Hindbrain, 902, 902f, 902t 994t, 997f Human chorionic gonadotropin
p
in Drosophila, 1124 Hinge joint, 967, 968f of osmoregulatory functions, (hCG), 1097
Helical virus, 530 Hippocampus, 902t, 903, 905 1050-1052, 1051f-1052f Human chromosomes, 189-191,
Helicase, DNA, 267, 268t, 269f Hippopotamus, 525, 525f Hormone, 44, 45t, 169f, 170, 938, 189-f, 189t, 190f, 241-243
ar
Helicobacter, 551f Hirudinea (class), 676, 676f 940t-941t. See also specific hormones alterations in chromosome
Helicobacter pylori, 561t, 562, 987 Histogram, 232, 233f chemical classes of, 939 number, 250-251, 250f-251f
Heliotropism, 822f Histone, 190, 190f, 316-317, 316f female reproductive artificial, 356
Helium, 23f HIV. See Human immunodeficiency hormones, 1093t chromosome number, 189t
sw
Helix-turn-helix motif, 50, 50f, virus hydrophilic, 939, 942, 942f, karyotype, 191f
306-307, 307f, 311 HLA. See Human leukocyte antigen 945-946, 945f sex chromosomes, 241-243,
Helper T cell, 1062t, 1066, (HLA) lipophilic, 939, 942, 942f, 943-945, 241t, 248f
1067-1068, 1069f H.M.S. Beagle (Darwins ship), 1, 1f, 8, 943f-944f Human disease
Hematopoiesis, 1021, 1062-1063 9f, 10, 418 male reproductive hormones, bacterial, 558, 560-563, 561t, 562f
.a
Heme group, 1013 HOBBIT gene, in Arabidopsis, 1093, 1093t, 1094f effect of global warming on, 1253
Hemidesmosome, 83f, 84 757-758, 758f plant. See Plant hormone flukes, 658-659, 659f
Hemiptera (order), 685t Holistic concept, of community, protein, 45t fungal, 630
w
effect of pH and temperature on, Holothuroidea (class), 689f Hormone response element, 944 human races, 726, 726f
1014, 1014f Holt-Oram syndrome, 497 Horn (animal), 717 Human Gene Mutation
evolution of, 11, 11f Homeobox, 389, 493, 646 Hornwort, 463f, 589f, 595, 595f Database, 250
w
structure of, 46, 48, 49, 1013, 1013f Homeodomain, 307, 389 Horse, 525, 525f, 865f Human genome, 4
Hemolymph, 669, 1023 Homeodomain motif, 307 chromosome number in, 189t comparative genomics,
Hemolytic disease of newborns Homeodomain protein, 14, 14f evolution of, 414, 414f, 426-428, 474-476, 475f
(HDN), 1077 Homeosis, 494 426f-427f gene swapping in, 484
index I-15
m
Human immunodeficiency virus Hydrophilic hormone, 939, 942, 942f, Immunoglobulin D (IgD), Ingen-Housz, Jan, 150
(HIV), 531, 531f, 532t, 535-538, 945-946, 945f 1071t, 1072 Ingression, 1113
1080, 1080f Hydrophilic molecule, 28 Immunoglobulin E (IgE), 1071t, Inhalant siphon, 671, 671f
effect on immune system, Hydrophobic exclusion, 28-29 1072, 1075, 1076f Inheritance, patterns of, 221-236
co
535, 1080 Hydrophobic interaction, 23t Immunoglobulin G (IgG), 1071f, Inhibiting hormone, 948, 949
evolution of, 470-471, 470f-471f Hydrophobic molecule, 28 1071t, 1072 Inhibition, 1203
during infection, 537 Hydroponics, 791, 791f Immunoglobulin (Ig), 1063, 1063f. Inhibitor, 117
human effect of, 1080 Hydrostatic skeleton, 962, 962f See also Antibody allosteric, 117, 117f
y.
infection cycle of, Hydrothermal vent, 1244-1245 classes of, 1071-1072, 1071t competitive, 117, 117f
536-537, 536f, 1080 Hydroxyapatite, 963 diversity of, 1072-1074 noncompetitive, 117, 117f
latency period in humans, 535 Hydroxyl group, 35, 35f, 43 structure of, 1069-1070, 1070f Inhibitory postsynaptic potential
progression of, 1080 Hydrozoa (class), 655, 655f Immunoglobulin M (IgM), (IPSP), 899, 899f, 900
bl
testing for presence, 535 Hymen, 1098 1071-1072, 1071f, 1071t Initiation complex, 288, 288f, 294,
tracking evolution of AIDS among Hymenoptera (order), 684f, 685t Immunohistochemistry, 61 294f, 313, 313f
individuals, 471, 471f Hypercholesterolemia, 249t Immunological tolerance, 1075 Initiation factor, 294, 294f
ee
transmission of, 535 Hyperosmotic solution, 98, 98f Immunosuppression, 1080 Initiator tRNA, 294, 294f
treatment of, 537-538, 537f Hyperpolarization, 892-893, 893f Implantation, 1125 Innate behavior, 1133, 1133f
blocking viral entry, 538 Hypersensitive response, in plants, Imprinting, 1139 Innate releasing mechanism, 1133
combination therapy, 538 811, 812f In situ hybridization, 353 Inner cell mass, 1112, 1112f
HAART therapy, 538 Hypersensitivity, delayed, 1076 In vitro fertilization, 1102 Inner ear, 922, 922f
.w
integrase inhibitors, 538 Hypertension, 1030 In vitro mutagenesis, 342 Inorganic phosphate, 113
protease inhibitors, 538 Hyperthyroidism, 951 Incomplete dominance, 233t, Inositol phosphate, 180f, 181
reverse transcriptase Hypertonic solution, 98, 98f, 1039 234, 234f Inositol triphosphate (IP3/calcium)
inhibitors, 538 Hyperventilation, 1010-1011, 1012 Incomplete flower, 848, 848f second messenger system, 179,
vaccine therapy, 538
Human leukocyte antigen
(HLA), 1066
Human population
Hyphae, 616, 616f, 617
Hypolimnion, 1239
Hypoosmotic solution, 98, 98f
Hypophysectomy, 950
cs Incus, 921
Independent assortment, 214,
229, 229f
Indeterminate development,
180f, 181, 181f
Inositol triphosphate (IP3), 946
Insect, 679t, 684-686, 684f, 685t, 686f
Bt crops resistance to, 347-348
in developing and developed Hypophysis, 946 638, 639f chromosome number in, 189t
si
countries, 1180-1181, Apago PDF Enhancer
Hypothalamohypophyseal portal Indian pipe (Hypopitys uniflora), cleavage in, 1110
1180f, 1180t system, 948 794, 794f digestive system of, 686
growth of, 1178-1182, Hypothalamus, 876, 882-883, Individualistic concept, of community, diversity among, 684f
hy
1179f-1181f, 1180t 883f, 905 1186 excretory organs in, 1041, 1041f
decline in growth rate, 1181 control of anterior pituitary, Indoleacetic acid (IAA), 828-829, 829f external features of, 684, 685f, 686
exponential, 1178, 1179f 948-949, 948f Indolebutyric acid, 830 eyes of, 414, 414f, 501, 501f, 680,
future situation, production of neurohormones, 947 Induced fit, 114, 114f 680f, 681f, 928f
p
1180-1181 Hypothesis, 5-6, 5f Inducer exclusion, 310 fish predation on, 408, 408f
in hotspots, 1260-1261, Hypothyroidism, 951 Induction (development), 377-378, hormones in, 956f, 957
1260f Hypotonic solution, 98, 98f 377f, 1117 internal organization of, 686
ar
population pyramids, Hyracotherium, 426-428, 426f primary, 1124 locomotion in, 976-977
1178-1180, 1179f secondary, 1124, 1125f nitrogenous wastes of, 1044, 1045f
Hummingbird, 852, 853f, 883 Induction of phage, 533-534, 534f orders of, 685t
Humoral immunity, 1063, 1068-1074, I Induction of protein, 308 pheromones of, 686
sw
Hyalin, 1108 injection Inert element, 22 sex chromosomes of, 241, 241t
Hybridization (between species), 222, Ileum, 987 Inferior vena cava, 1029 social, 1157, 1158f
437-438, 438f, 440-441 Immune system, 875f, 876, Infertility, 1101 taste in, 926, 926f
w
Hybridization (nucleic acid), 1055-1080 female, 1101 thermoregulation in, 880, 880f
332-333, 333f cells of, 1062t male, 1101 wings of, 498-499, 498f, 684, 686f
Hybridoma cell, 1078 effect of HIV on, 1080 treatment of, 1102 Insectivore, digestive system of, 991f
Hydra, 641t, 652f, 653, 655, organs of, 1064-1065, Inflammatory response, Insectivorous leaf, 750
w
982f, 1022f 1064f-1065f 1058-1059, 1060f Insertion sequence (IS), 555, 555f
Hydration shell, 28, 29f pathogens that invade, Influenza, 532t, 539 Insertional inactivation, 330
Hydrocarbon, 34 1079-1080, 1080f bird flu, 539 Instantaneous reaction, 110
w
in ancient rocks, 547 Immunity Influenza virus, 529f, 531f, 532t, Instinct, learning and, 1138, 1138f,
Hydrochloric acid, gastric, 986, 987 active, 1063, 1074f 539, 1079 1140, 1140f
Hydrocortisone, 943f, 954 adaptive, 1061-1066, H subtypes, 539 Insulin, 954-955, 955f, 994-995,
Hydrogen, 24, 24f 1061f-1065f, 1062t H1N1 strain, 1079 995f, 996
I-16 index
m
Integrin-mediated link, 84 Ion channel, 90t, 96-97, 97f, 171, Kaufmann, Thomas, 389 Lactation, 1128
Integument (flower), 602 172f, 172t, 891 Keratin, 76, 866 Lactic acid fermentation, 140, 140f
Integumentary system, 875f, 876 chemically gated, 892 Keratinized epithelium, 866 Lactose, 39
Intelligent design theory, against gated, 96, 892, 893f -Ketoglutarate, 132, 133f, 141, 141f Lactose intolerance, 39, 988
co
theory of evolution, 432-433 ligand-gated, 892 -Ketoglutarate dehydrogenase, 133f Lacunae, 870
Intercalated disk, 871, 1027 stimulus-gated, 917, 917f Kettlewell, Bernard, 420-421 Lagging strand, 267f,
Interference competition, 1188 transient receptor potential, 918 Key innovation, 446 268-269, 269f-270f
Interferon, 1057-1058 voltage-gated, 893, 894f Key stimulus, 1133, 1133f Lake, 1239-1241, 1239f-1240f
Keystone species, 1201, 1201f eutrophic, 1240-1241, 1240f
y.
Intergovernmental Panel on Climate Ionic bond, 23-24, 23f, 23t, 48, 48f
Change, 795, 1250, 1253 Ionic compound, 24 loss of, 1272, 1273f oligotrophic, 1240, 1240f
Interior protein network, 90t, 91 Ionization of water, 29 Khorana, H. Gobind, 283 thermal stratification of,
Interleukin-1 (IL-1), 1059 IP. See Inositol phosphate Kidney, 956 1239-1240, 1240f
bl
Intermediate filament, 76, 76f, 83f, 84 IP3. See inositol triphosphate of amphibians, 1043 Lake Victoria cichlid fish, 449-450,
Intermembrane space, of IPSP. See Inhibitory postsynaptic of birds, 1043-1044, 1044f 449f, 1271
mitochondria, 74 potential excretion in, 1048 Lamarck, Jean-Baptiste, 397
ee
Internal chemoreceptor, 927 Irreducible complexity argument, filtration in, 1046-1047, 1047f Lamellae, 1005
Internal fertilization, 1087-1090, against theory of evolution, 433 of fish Lamellipodia, 1113
1087f-1090f IS. See Insertion sequence cartilaginous fish, 1043 Lamprey, 698f, 699, 699t
Internal membranes, of prokaryotes, Island freshwater fish, 1042, 1043f Lancelet, 696, 696f
554, 554f biogeography of, marine bony fish, 1042, 1043f Land plants
.w
Internal organs, of vertebrates, 1226-1227, 1226f hormonal regulation of, evolution of, 521f, 571, 589-590
696, 697f evolution on, 431-432, 431f, 1050-1052, 1051f-1052f innovations in, 597f
International Human Genome 444-445, 444f of mammals, 1043-1044, 1044f, Langerhans, Paul, 954
Sequencing Consortium, 357 extinctions on, 1258, 1266, 1266f 1045-1050, 1046f-1050f Language, 905-906, 906f
reabsorption in, 1046, 1048, Large intestine, 983, 983f, 990, 990f
Internet, 183
Interneurons, 873t, 888, 888f
Internode, 730f, 744, 744f
Interoceptor, 916
Interoparity, 1173
Island dwarfism, 724
Islets of Langerhans,
954-955, 988f, 989
Isocitrate, 132, 133f
cs
Island biogeography, 1226-1227, 1226f
1049f, 1050-1051, 1051f
of reptiles, 1043
secretion in, 1046, 1048
of vertebrates, 1041-1044,
Large offspring syndrome, 381
Larva
loss in marine invertebrates,
468, 469f
si
Interphase, 192, 192f, 193-194, Apago PDF Enhancer
Isomer, 35 1042f-1044f of snails, 466-468, 467f-468f
193f-194f of sugars, 38, 39f Killer strain, Paramecium, 579 Larynx, 985, 985f
Intersexual selection, 1150f, Isomotic regulation, 99 Killfish (Rivulus hartii), 412-413, 412f Latent virus, 529
hy
1151-1152 Isomotic solution, 98, 98f Kilocalorie, 108, 995 Lateral geniculate nuclei, 932, 933f
Interspecific competition, 1188, Isoptera (order), 684f, 685t Kin selection, 1155-1157, Lateral line system, 701, 920, 921f
1191, 1191f Isotonic solution, 98, 98f, 1039 1155f-1156f Lateral meristem, 731, 732, 733f
Intertidal region, 1241f, 1243 Isotope, 19, 19f Kinase cascade, 176-177, 177f, 178 Lateral root cap, 739, 739f
Kinesin, 77, 77f LDL. See Low-density lipoprotein
p
173-174, 173f Ivy, 744f 211, 211f, 216 Leaf, 730f, 747-750, 747f-749f,
Intracytoplasmic sperm injection Kinetoplastid, 574-575, 575f 809, 809f
(ICSI), 1102 Kingdom (taxonomy), 512, 513f, 514 abscission of, 823-824,
Intramembranous development, J evolutionary relationships among 823f-824f
sw
of bone, 963, 964f, 965 Jacob syndrome, 251 kingdoms, 517f alternate, 744, 744f
Intramolecular catalysis, 116 Jasmonic acid, 810 Kinocilium, 920, 921f of carnivorous plant, 793-794
Intrasexual selection, 1151, 1152f Jaundice, 989 Kinorhyncha (phylum), 640, 644f compound, 748, 748f
Intrauterine device (IUD), Jaws Klinefelter syndrome, 251, 251f establishing top and bottom of,
1099t, 1100 evolution of, 698, 700, 700f Knee-jerk reflex, 908, 908f 747, 747f
.a
Intrinsic factor, 987 of fish, 699-700, 700f, 1065-1066 Knight, T. A., 222 evolution of, 596-597, 597f
Introduced species, 1264t, Jejunum, 987 Knockout mice, 342-343, 342f-343f external structure of, 747-748,
1269-1271 Jellyfish, 634t, 636, 641t, 655-656, Klreuter, Josef, 222 747f-748f
Komodo dragon (Varanus komodoensis), internal structure of,
w
distribution of, 290 movement at, 968, 968f-969f 131-133, 131f, 133f, 141, 141f pinnately compound, 748f
Invaginate, 1113 types of, 967, 968f ATP production in, 132, 131f, simple, 748, 748f
Inversion, 300-301, 301f Jointed appendages, of arthropods, 680 133f, 138, 138f transpiration of water from. See
w
index I-17
m
(LHON), 244 Lion (Panthera leo), 438, 438f, 984f 1009, 1010f Malpighian tubule, 679f, 680f, 681
Leech, 641t, 675-676, 676f Lipase, 988 Lung cancer, 1012, 1012f MALT. See Mucosa-associated
Leeuwenhoek, Anton van, 12, 59 Lipid(s), 33, 36f, 37, 53-56. See also smoking and, 1012 lymphoid tissue
Leg(s), of amphibians, 703, 704f Phospholipid Luteinizing hormone (LH), 948, 950, Malthus, Thomas, 10
co
Leishmaniasis, 488, 574 functions of, 37t, 53-56 1093, 1093t, 1094f Maltose, 39, 39f
Lens, 929, 929f membrane, 548, 549f Lycophyta (phylum), 589f, 596, 597, Mammal, 641t, 698f, 716-720,
Lenticel, 745, 746f structure of, 53-56 597f, 598, 598f, 601t 716f-719f
Leopard frog (Rana), postzygotic Lipid bilayer, 56, 56f Lyme disease, 560, 561t brain of, 903, 903f
y.
isolation in, 440, 440f Lipid raft, 91 Lymph, 1032 characteristics of, 716-718,
Leopold, Aldo, 1221 Lipophilic hormone, 939, 942, 942f, Lymph heart, 1032 716f-717f
Lepidoptera (order), 684f, 685t 943-945, 943f-944f Lymphatic system, 875f, 876, circulatory system of,
Lepidosauria, 699f Lipopolysaccharide, 553, 553f, 1056 1032-1033, 1032f 1025, 1025f
bl
Leprosy, 560, 561t Little paradise kingfisher (Tanysiptera Lymphocyte, 1063, 1063f, classification of,
Leptin, 996, 996f hydrocharis), 444, 444f 1064, 1065f 718-719, 718f
Lettuce, genome of, 479f Liver, 988f, 989, 994 Lysenko, T. D., 844 cleavage in, 1112, 1112f
ee
Leucine zipper motif, 307, 307f Liverwort, 463f, 589f, 590, 593, 593f Lysogenic cycle, of bacteriophage, digestion of plants by, 717
Leukocytes, 870, 1019, 1058 Lizard, 699f, 707t, 711, 711f 533-534, 534f egg-laying. See Monotreme
granular, 1019 Llama, 525 Lysogeny, 533 evolution of, 525f, 697, 698f,
nongranular, 1019 Lobe-finned fish, 698f, 699t, 702, Lysosomal storage disorder, 71 718, 718f
Lewis, Edward, 388 702f, 704f Lysosome, 71-72, 72f, 78t, 81t extinctions, 718t
.w
Lichen, 626-627, 627f Lobster, 682, 683, 683f Lysozyme, 1056 flying, 717-718, 717f
as air quality indicators, 627 Local anaphylaxis, 1075 Lytic cycle, of bacteriophage, 258, gastrulation in, 1115, 1115f
foliose, 627f Locomotion, 639, 975-977 533, 534f kidney of, 1043-1044, 1044f,
fruticose, 627f in air, 976-977, 977f 1045-1050, 1046f-1050f
Life
characteristics of, 2-3
hierarchical organization of,
3-4, 3f
appendicular, 975
axial, 975
on land, 976, 976f
in water, 975-976, 975f
cs M
M phase. See Mitosis
M-phase-promoting factor (MPF),
lungs of, 1007-1008, 1008f
marine, 720t
nitrogenous wastes of, 1044, 1045f
nuclear transplant in,
origin of. See Origin of life Locomotor organelles, 198-199, 199f, 200, 200f, 201 380-381, 381f
si
science of, 2-4 Apago PDF Enhancer
of protists, 572 MacArthur, Robert, 1190, 1226 orders of, 720t
Life cycle Logarithmic scale, 29 macho-1 gene, 377, 378, 378f placental. See Placental mammal
of brown algae, 581f Long-day plant, MacLeod, Colin, 257 pouched. See Marsupial
hy
of Plasmodium, 577f Long-term memory, 906 Madreporite, 689 Mammary gland, 716
of Ulva, 592f Long-term potentiation (LTP), MADS-box genes, 389, 493, 494, Manatee, 430
Life history, 1171-1173, 1171f-1172f 906, 907f 499, 500, 500f Mandible, of crustaceans,
Life table, 1169-1170, 1170t Long terminal repeat (LTR), Magnetic field, sensing of, 934 678-679, 679t
sw
Ligand, 168, 169f 360-361, 361f Maidenhair tree (Ginkgo biloba), Mangold, Hilde, 1122
Ligand-gated channel, 892 Loop of Henle, 1044, 1047, 1047f, 605f, 606 Mangrove, 780-781, 781f
Light, cue to flowering in plants, 1048-1049 Maize. See Corn (Zea mays) Mangrove swamp, 1243, 1248
842-844, 842f-843f Loose connective tissue, 868, Major groove, 262f, Mannose-binding lectin (MBL)
Light chain (polypeptide), 868f, 869t 305-306, 306f protein, 1057, 1060
.a
1069, 1070f Lophophore, 523f, 642t, 643, Major histocompatibility complex Mantle, 667, 668f
Light-dependent reactions, 676-678, 677f-678f (MHC), 1064, 1065f Mantle cavity, 1004
of photosynthesis, 148, 149f, 150, Lophotrochozoan, MHC class I protein, 1066, 1066t MAP kinase. See Mitogen-activated
w
156-160, 156f-160f 523-524, 523f, 643, 644f, 669 MHC class II protein, protein kinase
Light-harvesting complex, 155, Lorenz, Konrad, 1139, 1139f, 1146 1066, 1066t Marine habitat,
155f, 157 Loricifera (phylum), 642t, 644f MHC proteins, 45t, 1241-1245, 1241f-1244f
Light-independent reactions, Low-density lipoprotein (LDL), 54, 82-83, 1066 human impacts on,
w
of photosynthesis, 148, 150, 150f 103, 320-321, 1033 Malaria, 577-578, 577f, 808, 1253 1247-1248, 1248f
Light microscope, 61, 61f, 62t LTP. See Long-term potentiation drug development, 487-488, 488f Markers, cell, 63
Light-response genes, 815-816, LTR. See Long terminal repeat eradication of, 577 Markov, Georgi, 808
w
815f-816f Lubber grasshopper (Romalea genome of, 475f Marler, Peter, 1140
Lignin, 736 guttata), 684f sickle cell anemia and, 250, Marrow cavity, 966
Lily, 851f Lumen, of endoplasmic reticulum, 69 409, 409f Mars, life on, 509, 509f
Limb bud, 497 Luna moth (Actias luna), 684f vaccine for, 578, 1079 Marsilea, 600
I-18 index
m
Mastication, 967, 982, 984 Melanotropin-inhibiting hormone transport from nucleus, hormone
Mastiff, 423f (MIH), 949 321, 322f Milk, 1128
Maternal inheritance, 244 Melatonin, 956 Metabolic rate, 995 Milk let-down reflex, 1128
Maternity plant, 858 Membrane(s), 88-104. See also specific Metabolism, 117, 508 Milk snake (Lampropeltis triangulum),
co
Mating membranes biochemical pathways, geographic variation in, 437f
assortative, 402 Membrane attack complex, 118-119, 118f Milk sugar, 39
disassortative, 402 1060, 1060f evolution of, 142-143 Miller, Stanley L., 509
nonrandom, 401f, 402 Membrane potential, 97, 890-891 in prokaryotes, 559-560 Miller-Urey experiment,
y.
See also Courtship entries Memory, 906 Metamorphosis, 384, 384f 509-510, 510f
Mating behavior, 439, 439f long-term, 906 Metaphase Millipede, 641t, 679t,
selection acting on, 443, 443f short-term, 906 meiosis I, 211, 211f, 212f, 216f 686-687, 687f
sexual selection and, 1151-1152, Mendel, Gregor, 11, 301, 399 meiosis II, 213f, 214, 217f Mimicry
bl
1151f-1152f experiments with garden pea mitotic, 192f, 195f, 196, 196f, Batesian, 1195, 1195f, 1196
Mating ritual, 439 222-229, 222f-229f 197f, 216f Mllerian, 1195-1196, 1195f
Mating success, 405 experimental design, 223 Metaphase plate, 195f, 196, 211, 211f Mineral(s)
ee
Mating system, portrait of, 223f Metazoa, 640, 644f absorption by plants, 771f,
1153-1154, 1153f rediscovery of ideas, 232 Metazoan, origin of, 645 773-775, 774f-775f
Mating type, in fungi, 177 Mendeleev, Dmitri, 22 Methane, 139, 1209, 1251 in plants, 790t, 791, 791f
Matrix Mendelian ratio, 225 Methanococcus, 550f in soil, 787-788, 787f
extracellular. See Extracellular modified, 236, 236f Methanogen, 139, 516, 517f transport in plants,
.w
matrix Meninges, 907 Methicilin-resistant Staphylococcus 770-783
of mitochondria, 74 Menstrual cycle, aureus (MRSA), 559 Minimal medium, 558
Matter, 18 1095-1097, 1095f-1096f Methyl group, 35f Miracidium, 658, 659f
Mauna kea silversword follicular (proliferative) phase, Methylation miRNA. See Micro-RNA
(Argyroxiphium sandwicense),
1259, 1259f
Mayr, Ernst, 437
Mccarty, Maclyn, 257
McClintock, Barbara,
1095-1096, 1095f
luteal phase, 1095f, 1097
menstrual phase, 1097
ovulation, 1095f,
1096-1097, 1096f
cs of DNA, 252, 316, 316f
of histones, 316
MHC. See Major histocompatibility
complex
Micelle, 56, 56f
Missense mutation, 299, 300f
Mite, 678, 682
Mitochondria, 73-75, 74, 74f, 78t,
81t, 126f, 136f, 162f, 518t
division of, 74
si
245-246, 245f, 360, 480 Apago PDF Enhancer
secretory phase, 1097 Micro-RNA (miRNA), 281, 318-319, DNA of, 74
MCS. See Multiple cloning site Menstruation, 1090 319f, 320, 360, 360t genome of, 364
Measles, 532t Mercury pollution, 1246 Microarray maternal inheritance, 244
hy
Mechanical isolation, 438t, 439-440 Mereschkowsky, Konstantin, DNA, 364, 365f origin of, 75, 75f, 517, 517f,
Mechanoreceptor, 916, 917-919, 568-569 protein, 367 568-569, 569f
918f-919f Meristem, 374-375, Microbe-associated molecular pattern ribosomes of, 74f
Mediator, 314-315, 315f 731-732, 731f (MAMP), 1056 Mitogen-activated protein (MAP)
p
Medicago truncatula, 479, 479f, apical, 731, 732, 732f-733f, 832f Microbody, 72, 78t kinase, 176-177, 177f, 178,
483f, 489 floral, 846, 846f-847f Microclimate, 1235 182-183, 202, 203f
genome of, 479f ground, 732, 733f, 741, 758 Microfilament, 76 Mitosis, 189, 192, 192f, 193-194,
ar
Meerkat (Suricata suricata), Mesoglea, 653, 653f Microsporidia, 615, 615f, Molecular clock, 461
1158, 1159f Mesohyl, 651 618-619, 618f Molecular cloning, 330, 558.
Megakaryocyte, 1021 Mesophyll, 748-749 Microtubule-organizing centers, 76 See also Cloning
Megapascal, 770 palisade, 749, 749f Microtubule(s), 76, 76f, 80, 81t, 188f Molecular formula, 24
w
Megaphyll, 747 spongy, 749, 749f kinetochore, 188f, 193, 193f Molecular hybridization,
Meiosis, 208-218, 208f Messenger RNA (mRNA), 42, 69, spindle, 188f 332-333, 333f
compared to mitosis, 215-218, 281. See also Primary transcript Microvilli, 866, 987-988, 988f Molecular motor, 77, 77f, 79
w
216f-217f degradation of, 321 Midbrain, 902f, 902t, 903 Molecular record, evidence for
errors in, 214 5 cap, 288, 288f Middle ear, 921, 921f evolution, 11-12, 11f
sequence of events during, making cDNA library, 332, 332f Middle lamella, 80, 80f, 198 Molecule, 2f, 3, 23, 24
209-214, 208f-213f mature, 288 Miescher, Friedrich, 259 Mollicutes, 64
index I-19
m
diversity among, 667, 667f Brachyury gene mutation in, 496 Mutation Natural selection, 8, 10, 397, 403
economic significance of, 667 chromosome number in, 189t cancer and, 203f adaptation to environmental
evolution of, 667 coat color in, 404, 404f evolution and, 401, 401f, 406 conditions, 1164
excretion in, 669 embryo of, 694f interactions among evolutionary ecological species concept
co
eye of, 429, 429f, 501, 501f, eye development in, 502, 502f forces, 406-407, 407f, and, 441
928f, 929 genome of, 475f, 476, 487 495-496 evidence of, 418-421, 418f-421f
feeding an prey capture in, homeotic genes in, 388f kinds of, 299-301, 299f-301f evolution and, 9, 10, 404, 433
668-669, 669f knockout, 342-343, 342f, 343f in prokaryotes, 558-559 experimental studies of, 411-413,
y.
locomotion in, 976 marsupial, 431f Mutualism, 564, 626, 412f-413f
nervous system of, 901f ob gene in, 996, 996f 1197f-1198f, 1198 invention of theory of, 9-11
reproduction in, 669, 669f Mouth, 984-985, 985f coevolution and, 1198 maintenance of variation in
shell of, 668 Mouthparts fungal-animal, populations, 407-409,
bl
Molting, in arthropods, 680 of arthropods, 679t 628-629, 629f 408f-409f
Molting hormone, 957 of insects, 684, 685f Mutually exclusive events, 230 in speciation, 443
Monarch butterfly (Danaus plexippus), MPF. See M-phase-promoting factor Mycellium, 616, 616f testing predictions of, 10-12
ee
migration of, 1142, 1142f mRNA. See Messenger RNA primary, 622 Nauplius larva,
Monoamine oxidase-A (MAOA), MRSA, 559 secondary, 623 682-683, 683f
1137, 1141 MSH. See Melanocyte-stimulating Mycobacterium tuberculosis, Neanderthals, 725
Monoamine oxidase (MAO), 1137 hormone 560-561, 561t Nearsightedness, 929f
Monoclonal antibody, Mucosa-associated lymphoid tissue evasion of immune system, Nectar, 608
.w
1077-1078, 1078f (MALT), 1064, 1064f, 1065, 1065f 1079-1080 Nectary, 608
Monocot, 607f, 608 Mucosa, of gastrointestinal tract, multidrug-resistant strains, Negative feedback loop, 876, 877f,
leaves of, 741f, 748, 748f, 749 983, 983f 560-561 949, 949f, 1175
Monocyte, 1062, 1062t Mucus, 1056 Mycoplasma, 64 Negative gravitropism, 819f, 820
Monoecious plant, 855
Monogamy, 1153
Monohybrid cross,
224-228, 226f, 230-231
Mller, Fritz, 1195
Mllerian mimicry,
1195-1196, 1195f
Multicellular organism, 518t
cs Mycorrhizae, 593,
627-628, 628f, 793
arbuscular, 622, 628, 628f
ectomycorrhizae, 628, 628f
Negative pressure breathing, 1007
Negative-strand virus, 531
Neisseria gonorrhoeae, 561t, 562,
562f, 1080
Monokaryotic hyphae, 616, 622-623 cell cycle control in, Myelin sheath, 872, 890, 890f Nematocyst, 641t, 652f, 653-654
si
Monomer, 36f, 37 Apago PDF Enhancer
201-202, 202f Myofibril, 871, 969, 969f Nematoda (phylum), 641t, 643, 644,
Mononucleosis, 532t Multicellularity Myofilament, 969, 969f 645f, 661-663, 662f
Monophyletic group, in animals, 634t Myoglobin, 974, 1014 Nematode, 523f, 644-645. See also
hy
461-462, 462f, 464 in eukaryotes, 519 Myosin, 44, 45t, 79, 970, 970f, 971. Caenorhabditis elegans
MONOPTEROS gene, in Arabidopsis, in protists, 572 See also Thick myofilament circulatory system of, 1022f
758, 758f Multidrug-resistant strains, 560-561 Myriapoda (class), 679t, 686-687 digestive system of, 982, 982f
Monosaccharide, 38, 38f, 39f Multienzyme complex, 115-116, Myriapods, 687f eaten by fungi, 617, 617f, 618
p
Monsoon, 1234 Multipotent stem cells, 379 NAA. See Naphthalene acetic acid 672-673, 672f
Moon snail, 669 Muscle NAD+, 44, 123-124, 123f Neocallimastigo mycetes, 619, 620,
Morgan, Thomas Hunt, 240, 245, lactic acid accumulation in, as electron acceptor, 124, 125f 628-629
246, 301, 354 140, 140f regeneration of, 129-130, 129f Neocallimastix, 620
sw
Morning after pill metabolism during rest and NADH, 123 Neocallismastigo mycota (phylum),
(birth control), 1100 exercise, 974-975 in ATP yield, 137, 137f 615, 615f, 620
Morphine, 805, 806t organization of, 969f contributing electrons to electron Neodermata (class), 658
Morphogen, 386, 384, 385f, 386-387, Muscle contraction, transport chain, 132, 133f, 135 Neonate, 1128
386f-387f, 1110, 1122 969-975, 969f-974f as electron acceptor, 124, 125f Neotyphodium, 626, 626f
.a
Morphogenesis, 373, sliding filament model of, from glycolysis, 126f, 127, 127f Nephridia, 669, 673f, 674,
390-393, 391f-393f 969-971, 970f-971f inhibition of pyruvate 1040, 1041f
in plants, 392-393, 393f, Muscle fatigue, 975 dehydrogenase, 138, 138f Nephrogenic diabetes insipidus, 98
w
759, 759f Muscle fiber, 871, 970f from Krebs cycle, Nephron, 1042, 1042f, 1046-1048
Morphology, adaptation to fast-twitch (type II), 974, 974f 131-132, 131f organization of, 1042f
environmental change, 1163, 1163f slow-twitch (type I), 974, 974f in photosynthesis, 148, 149f, 151, structure and filtration,
Mortality, 1169 types of, 973-974 156-160, 158f-159f 1046-1048, 1047f
w
Mortality rate, 1169 Muscle spindle, 919, 919f from pyruvate oxidation, 130, 130f transport processes in, 1048-1050,
Mosquito, 189t, 358f, 475f, 577-578, Muscle tissue, 864, 864f, 870-872, recycling into NAD, 129-130, 129f 1049f-1050f
577f, 684, 686f 871t, 872f structure of, 125f Nephrostome, 669, 1040
w
Moss, 463f, 589f, 590, 594-595, Muscular dystrophy NADH dehydrogenase, 134, 134f Neritic waters, 1241f, 1242
594f-595f Duchenne, 227t, 249t NADP reductase, 158, 159f Nerve, stimulation of muscle
Moth, 853f, 880, 880f gene therapy for, 345 Nanog gene, 382 contraction, 972-973, 972f-973f
Motif, protein, 50, 50f Muscular system, 874f nanos gene, 384, 385f, 386 Nerve cord, dorsal, 694, 694f, 695f
I-20 index
m
of cnidarians, 901-902, 901f Nitrogen Nucleoid region, 554 Oligotrophic lake, 1240, 1240f
of earthworms, 901f, 902 electron energy levels for, 23f Nucleolus, 65, 68, 68f, 78t Oligotrophic ocean, 1242, 1242f
of echinoderms, 901f in plants, 792, 792f, 797 Nucleosome, 190, 190f, 316 Ommatidia, 680, 681f
of flatworms, 657f, 658, Nitrogen cycle, Nucleotide, 13, 37t, 42, 42f, 259, 259f phenotypic variation in,
co
901f, 902 1210-1211, 1211f numbering carbon atoms in, 414, 414f
of mollusks, 901f Nitrogen fixation, 563 259-260, 259f Omnivore, 982, 984f
neurons and supporting cells, evolution from, 143 Nucleotide oligerization domain On the Origin of Species (Darwin), 8,
889-890, 889f-890f in nitrogen cycle, 1211, 1211f (NOD)-like receptor (NLR), 1057 10, 397
y.
peripheral, 872, 888, 909-912, in plants, 792, 792f Nucleus, cellular, 65-68, 66f, 68f, Oncogene, 175, 203
909f-912f, 909t, 911t Nitrogenous base, 42, 42f, 78t, 82t One-gene/one-enzyme hypothesis,
Net primary productivity, 1215 259-260, 259f origin of, 568, 568f 6, 280
Neural crest, 696, 1119-1121, tautomeric forms of, 261 transplantation of One-gene/one-polypeptide
bl
1119f-1121f Nitrogenous wastes, 1044, in amphibians, 380 hypothesis, 6, 280
Neural groove, 1118, 1119f 1045f, 1211 cloning of animals, 380f, Onychophora (phylum), 640,
Neural plate, 1118 Nitrous oxide, 1251 381, 381f 642t, 645f
ee
Neural tube, 1119, 1119f NMP, 124 transport of RNA out of, 321, 322f Oocyte
Neuroendocrine reflex, 947 No-name virus, 540 Nudibranch, 670-671, 670f primary, 1095, 1096f
Neurofilament, 76 Noble gas, 22 Nsslein-Volhard, Christiane, 384 secondary, 1096, 1096f
Neuroglia, 872, 889 Nocieptor, 918 Nutrient Oogenesis, 1096f
Neurohormone, 938-939, 947 Node (plant stem), 730f, 744, 744f essential, 997-998, 998t Oomycete, 580, 581-582
.w
Neurohypophysis, 946 Nodes of Ranvier, 872, 889f, 890 fungi obtaining nutrients, 614, Open circulatory system, 638,
Neuromuscular junction, 897, 898f, Nodule (plant), 792, 792f 617-618, 617f 1022f, 1023
973, 973f Noncompetitive inhibitor, 117, 117f limiting, 1212 Open reading frame (ORF), 359
Neuron, 872, 889-890, 889f-890f. Noncyclic photophosphorylation, plant, 790-792, 790t, 791f Operant conditioning, 1138
See also specific types of neurons
Neuropeptide, 899
Neuropeptide Y, 997
Neurospora
Beadle and Tatums experiment
157-158, 158f
involving autosomes,
250-252, 250f
cs
Nondisjunction, 250-251, 250f-250f
Neurotransmitter, 169f, 170, Nonextreme archaebacteria, 516 Opposite leaf, 744, 744f
896-899, 897f, 898f Nongranular leukocytes, 1019 O Optic tectum, 903
in behavior, 1134 Nonpolar covalent bond, 24-25 Oak (Quercus), 738, 841f Optimal foraging theory, 1148
drug addiction and, Nonpolar molecule, 28-29 ob gene, in mice, 996, 996f Optimum pH, 116, 116f
p
900-901, 900f Nonrandom mating, 401f, 402 Obesity, 995 Optimum temperature, 116, 116f
Neurotropin, 942 Nonsense mutation, 299, 300f Obligate symbiosis, 626 Oral contraceptives, 1099f,
Neurulation, 392, 1118-1119, 1119f Nonspecific repair mechanism, Ocean 1099t, 1100
ar
Neutron, 18, 19f 274-275, 274f oligotrophic, 1242, 1242f risk involved with, 1100
Neutrophil, 1058, 1062, 1062t Nonsteroidal anti-inflammatory drug open, 1242 Oral surface, 688
New World monkey, 721, 721f (NSAID), 943, 1075 Ocean circulation, Orangutan (Pongo), 457, 457f, 482f
New York City, watersheds of, Nonvertebrate chordate, 695-696, 1233-1235, 1233f Orbital of electron, 19, 19f
sw
competition for niche occupancy, Norwalk virus, 349 Odonata (order), 685t Organ system, 3f, 3, 864,
1188, 1188f Notochord, 497, 497f, 641t, 694, Offspring 864f, 874f
fundamental, 1188, 1188f 694f, 695f, 1118 number of, 1172, 1172f Organelle, 2f, 3, 62, 65, 78t, 81t
w
niche overlap and coexistence, NSAID. See Nonsteroidal anti- parent-offspring interactions, Organic compound, 22-23
1189-1190 inflammatory drug 1139-1140, 1139f fermentation use of,
realized, 1188, 1188f Nucellus, 604, 604f, 608f parental investment per offspring, 139-140, 140f
restrictions, 188-1189 Nuclear envelope, 62, 65, 68, 68f, 1172-1173, 1172f Organic matter, in soil, 787, 787f
w
Nicolson, Garth J., 89 188f, 194f, 195 size of each, 1172, 1172f Organism, 3-4, 3f
Nicotinamide adenine dinucleotide. Nuclear lamins, 68, 68f Oil (fossil fuel), 1208f, 1209 Organizer, 1122-1125
See NAD+ Nuclear pore, 65, 68f clean up of oil spill, 564 Organogenesis, 1106t, 1116-1121,
w
index I-21
m
Origin of replication, 266, 266f, Parazoa, 640, 644f, 650-651, 650f Perennial plants, 859-860, 859f
271, 330 Parenchyma cells, 736, 736f, Perforin, 1058
Ornithischia (order), 707t P 738, 741 Pericardial cavity, 865, 865f
Orthoptera (order), 684f, 685t P53 gene, 202-203, 203f Parent-offspring interactions, Pericarp, 762
co
Oscillating selection, 408 P53 protein, 203, 203f 1139-1140, 1139f Pericentriolar material, 76
Osculum, 650f, 651 Paal, Arpad, 827 Parental investment, 1150 Pericycle, 741, 741f
Osmoconformer, 1039 Pacific giant octopus (Octopus Parietal cells, 986, 986f Periderm, 745, 745f
Osmolarity, 1038-1040, dofleini ), 672f Parietal lobe, 904, 904f Periodic table, 22-23, 22f
y.
1039, 1039f Pacific yew (Taxus brevifolia), Parietal pleural membrane, 1009 Peripheral chemoreceptor, 927
Osmoregulator, 1039-1040 806t, 808 Parsimony, principle of, Peripheral membrane protein, 89, 90f
Osmoregulatory functions, Pacinian corpuscle, 918f 459-460, 460f Peripheral nervous system, 872, 888,
of hormones, 1050-1052, Pain receptor, 918 Parthenogenesis, 1085 909-912, 909f-912f, 909t, 911t
bl
1051f-1052f Pair-rule genes, 385f, 387 Partial diploid, 556 Peristalsis, 986, 986f
Osmoregulatory organs, 1040-1041, Paired appendages, of fish, 699 Partial pressure, 1006-1007 Peritoneal cavity, 865
1040f-1041f Paired-like homeodomain Passeriformes (order), 713t, Peritubular capillary, 1047, 1047f
ee
Osmosis, 98, 98f, 104t, 770-771 transcription factor 1(pitx1), 715, 715f Periwinkle, 744f
Osmotic balance, 99, 497-498 Passive immunity, 1063 Permafrost, 1238
1038-1040, 1039f paleoAP3 gene, in plants, Passive transport, across plasma Peroxisome, 72-73, 72f
Osmotic concentration, 98, 98f 499-500, 499f membrane, 96-99, 104t Peroxisome biogenesis disorders
Osmotic potential. See Solute Paleopolyploid, 477 Pasteur, Louis, 6, 1061 (PBDs), 72
.w
potential Palila, 1270f Pathogen, 626 Pesticide resistance, in insects,
Osmotic pressure, 98, 99f, 1039 Palindrome, 328 avirulent, 811 404-405, 405f
Osmotic protein, 45t Palisade mesophyll, 749, 749f that invade immune system, Petal, 608, 608f
Ossicle, 688 Pancreas, 988-989, 988f 1079-1080, 1080f development of,
Osteoblast, 963
Osteocyte, 870
Osteoporosis, 967
Ostracoderm, 699t, 700
secretions of, 988-989
Pancreatic amylase, 988
Pancreatic duct, 988, 988f
Pancreatic hormone,
cs Pathogen-associated molecular
pattern (PAMP), 1056
Pattern formation, 373, 383-389,
384f-388f
499-500, 499f-500f
Petiole, 747
pH, 29-30
of blood, 1014, 1014f
Otolith, 920 954-955, 955f in Drosophila, 383-389, 384f-388f effect on enzymes, 52,
si
Outcrossing, 851, 855-856, 855f Apago PDF Enhancer
Pancreatic juice, 983 in plants, 389 116-117, 116f
Outer bark, 745 Panspermia, 508 Pattern recognition receptor pH scale, 29-30, 30f
Outer ear, 921 Pantothenic acid. See Vitamin (PFF), 1056 of rainwater, 1246, 1246f
hy
1268-1269 Paracrine regulator, 938, 942-943 PCNA. See Platelet-derived Phage, 258-259, 258f
Oviduct. See Fallopian tube Paracrine signaling, 169, growth factor Phage. See Bacteriophage
Oviparity, 1087 169f, 170 PCNA. See Proliferating cell Phage conversion, 534
ar
Ovoviviparity, 1087 Paramecium, 80f, 99, 578, 578f nuclear antigen in Vibrio cholerae, 534
Ovulation, 950, 1095f, 1096-1097, competitive exclusion among PCR. See Polymerase chain reaction Phagocytosis, 71, 102, 102f, 103, 104t
1096f, 1100 species of, 1189-1190, 1189f Peat moss (Sphagnum), 594-595 Phagotroph, 572
Ovule, 602, 603f, 848f, 849 killer strains of, 579 Pedigree analysis, 227, 227f, 242-243, Pharmaceuticals
sw
Oxaloacetate, 131, 132, 133f life cycle of, 579f 242f, 252 applications of genetic
Oxidation, 21, 109, 109f, 123, 123f predation by Didinium, Pedipalp, 681 engineering, 348-349
without oxygen, 139-140, 139f 1192, 1192f Peer review, 8 from plants, 1261-1262, 1261f
Oxidation-reduction (redox) reaction, Paramylon granule, 574f Pellicle, 574, 574f, 578, 578f Pharyngeal pouch, 694, 694f
109, 109f, 123-124, 123f Paraphyletic group, 462, 462f, Pelvic inflammatory disease Pharyngeal slits, 694, 695f
.a
Oxidative phosphorylation, 464, 464f (PID), 563 Pharynx, 662, 662f, 694
126, 126f Parapodia, 674 Pelycosaur, 708, 708f Phase change, in plants,
Oxygen Parasite, 626 Penguin, 1089f 840-841, 841f
w
atomic structure of, 19f, 24f effect on competition, 1200 Penicillin, 64, 70, 553 Phase-contrast microscope, 62t
in freshwater ecosystem, 1239 external, 1199, 1199f Penicillium, 624 PHAVOLUTA gene,
oxidation without, internal, 1199 Penis, 1091, 1093, 1093f in Arabidopsis, 747f
139-140, 139f manipulation of host behavior, Pentaradial symmetry, 687 Phenotype, 226, 405, 408
w
partial pressure, 1006-1007 1199, 1199f Peppered moth (Biston betularia), Phenotype frequency, 399, 399f
from photosynthesis, 143 Parasitic plant, 794, 794f industrial melanism and, 420-421, Phenylketonuria, 249t
transport in blood, 1002-1015, Parasitic root, 742, 743f 420f-421f Pheromone, 439, 620, 686, 938, 1145
w
1003f, 1013f-1015f Parasitism, 564, 574, 1196, 1197f, Pepsin, 986 Phloem, 596, 738, 738f, 741f
Oxygenic photosynthesis, 148 1198-1199, 1199f Pepsinogen, 986 primary, 733f, 741f, 742
Oxyhemoglobin, Parasitoid, 1199, 1199f Peptic ulcer, 561t secondary, 733f
1013-1014, 1013f Parasitoid wasp, 809, 809f Peptide, 939 transport in, 781-783, 782f, 783f
I-22 index
m
261-262, 262f Photosystem II, 157, 158, 158f, 159f Pinocytosis, 102, 102f, 103, 104t 589-590
Phosphodiester bond, 42, 42f, 260, Phototroph, 572 Pinworm (Enterobius), 641t, genome of, 476-479,
260f, 261f Phototropin, 818, 818f 662-663 477f-479f, 486
Phosphoenolpyruvate, 128f Phototropism, 817-818, 817f Pit organ, 934, 934f gravitropism in,
co
Phosphofructokinase, 138, 138f auxin and, 829f Pitcher plant (Nepenthes), 750, 819-820, 819f-820f
2-Phosphoglycerate, 128f negative, in Drosophila, 793, 794f heliotropism in, 822f
3-Phosphoglycerate, 128f 410-411, 411f Pith, 741f, 742, 744 heterozygosity in, 398
Phospholipase C, 179, 180f Phycobiloprotein, 154 Pituitary dwarfism, 950 leaves of, 747-750. See also Leaf
y.
Phospholipid, 37t, 55, 89 Phyla, animal, 640, 641t-642t Pituitary gland, 946-948, 947f life cycles of, 590, 590f
in membranes, 55-56, 55f, 89, 89f, Phyllotaxy, 744 anterior, 946, 947-948, life span of, 859-860, 859f
90t, 92-93 Phylogenetic species concept (PSC), 948-951, 950f nutritional adaptations
structure of, 55, 55f, 89, 89f, 92 463-464, 464f posterior, 946-947 in, 792-795, 792f-795f
bl
Phosphorus, fertilizer, 1212 Phylogenetic tree, 12 PKU. See Phenylketonuria nutritional requirements in,
Phosphorus cycle, 1212, 1212f Phylogenetics Placenta, 716, 716f, 1112 790-792, 790t, 791f
Phosphorylase kinase, 182, 182f comparative biology and, 464-470, formation of, 1125 organization of plant body, 730f
ee
Phosphorylation cascade, 176, 177f 465f-469f functions of, 1125 parasitic, 794, 794f
Phosphorylation, of proteins, disease evolution and, 470-471, hormonal secretion by, pattern formation in, 389
170-171, 171f, 198-199, 200-201 470f-471f 1126, 1127f perennial, 859-860, 859f
Phosphotyrosine, 176 plant origins and, 521, 521f structure of, 1126f photomorphogenesis in, 815
Photic zone, 1239, 1239f Phylogeny, 457, 457f Placental mammal, 524, 525f, 719, photosynthesis in,
.w
Photoautotroph, 559, 1214 of animals, 640, 719f, 1090, 1090f 148-149, 148f
Photoefficiency, 153 643-645, 644f-645f marsupial-placental convergence, photosystems of,
Photoelectric effect, 152 of fungi, 615f 430-431, 431f 156-158, 157f-159f
Photoheterotroph, 559 of vertebrates, 698f orders of, 720t phototropism in,
Photolyase, 274, 274f
Photomorphogenesis, 815
Photon, 151-152
Photoperiod, 842-844, 842f-843f
Photopigment, 931
Phylum, 512, 513f, 514, 640
cs
Physical map, 353, 355, 355f
correlation with genetic map, 355
landmarks on, 335, 353
types of, 353-354, 353f-354f
Plague, 561t
Planarian, 982
eyespot of, 501, 501f, 503
Plant(s). See also Flowering plant
annual, 859f, 860
817-818, 817f
phytoremediation in, 797-800,
798f-799f
plasmodesmata in, 67f,
84-85, 85f
si
Photopsin, 930 Apago PDF Enhancer
Physiology, adaptation to asexual reproduction in, 857-859, polyploidy in, 479, 479f
Photoreceptor, 928 environmental change, 858f primary plant body, 732
sensory transduction in, 1163, 1163t biennial, 860 primary tissues of, 732
hy
931-932, 932f Phytoaccumulation, 798f body plan in, 730-750 reproduction in, 839-860
in vertebrates, 930-931, 930f-931f Phytoalexin, 811 C3, 164, 164f, 165f responses to flooding, 780, 781f
Photorepair, 274, 274f Phytochrome, C4, 164-165, 164f, 165f, 749 roots of, 739-743. See also Root
Photorespiration, 815-816, 815f CAM, 164, 165, 165f saline conditions, under,
p
anoxygenic, 143, 148 Phytoestrogen, 806t, 808 chilling of, 825 806t, 808
in bacteria, 63-64, 64f, 150, Phytophthora infestans, 582 circadian rhythm in, 818, secondary plant body, 732
156, 156f Phytoplankton, 1239 822, 823f secondary tissues of, 732
C3, 161, 164, Phytoremediation, classification of, sensory systems in, 814-836
sw
164f, 165f 797-800, 798f-799f 463-464, 463f, 521f spacing of, 817
C4, 164-165, 164f, 165f, 749 for heavy metals, cloning of, 858f, 859 stem of, 743-747, 743f-746f.
Calvin cycle, 160-163, 161f 799-800, 799f coevolution of animals and, 807 See also Stem
carbon levels in plants and, for trichloroethylene, conducting tubes in, 466, 466f thermotolerance in, 825
795-797 798-799, 798f development in thigmotropism in,
.a
discovery of, 149-151, 150f for trinitrotoluene, 799 374-375, 392-393, 393f 821-822, 821f
electron transport system in, 156 Phytovolatilization, 798f embryonic, 754-760, tissue culture, 859
evolution of, 139, 143, 156 PI gene, in plants, 754f-760f tissues of, 733-738,
w
light-dependent reactions of, 148, 499-500, 499f-500f establishment of tissue 734f-738f, 742f
149f, 150, 150f PID. See Pelvic systems, 757f-758f, transgenic. See Transgenic plants
oxygen from, 143 inflammatory disease 758-759 transport in, 769-783
oxygenic, 148 Pied flycatcher, 442, 442f food storage, turgor movement in,
w
saturation of, 154, 154f PIF. See Prolactin-inhibiting factor 759-760, 760f 821-822, 822f
soil and water in, Pigment, 151 fruit formation, vacuole of plant cells, 73,
149-150 photosynthetic pigments, 761-763, 762f-763f 73f, 81t
w
summary of, 148-149, 148f, 149f 151-154, 152, 151f, 152f, 153f morphogenesis, vascular. See Vascular plant
Photosynthetic pigments, 151-154 Pike cichlid (Crenicichla alta), 392-393, 393f, 759, 759f vegetative propagation of,
absorption spectra of, 152-154, 412-413, 412f seed formation, 746-747
152f, 153f Pillbug, 682 760-761, 761f wound response, 810, 810f
index I-23
m
animals that protect plants, 743f, 781 elimination of duplicated genes, transcript, 320, 321f, 322f
809, 809f Pneumocystis jiroveci, 630 480, 480f RNA editing, 320-321
pathogen-specific, Pneumonia, bacterial, in evolution of flowering plants, small RNAs, 317-320, 318f-319f
810-811, 811f-812f 560, 561t 479, 479f Postzygotic isolating mechanisms,
co
physical defenses, Poa annua, 1169, 1170t speciation through, 445, 445f 438, 438t, 440, 440f
802-805, 802f-804f Poikilotherm, 880 synthetic polyploids, 478 Potassium channel, voltage-gated,
toxins, 805-808, 805f, 806t, Poinsettia, 843f transposon jumping in, 480-481 893, 894f
807, 807f Point mutation, 299 Polysaccharide, 39 Potato
y.
Plant disease, 802-812 Point-source pollution, 1246 Polyspermy, 1108 eye of, 858
bacterial, 560 Polar body, 1096 Polyubiquitination, 323 genome of, 479f
fungal, 629-630, 629f, Polar covalent bond, 25 Polyunsaturated fatty acid, 53, 54f Irish potato famine, 582
804-805, 804f Polar molecule, 25, 28 Polyzoa, 641t Potential energy, 21, 108, 108f
bl
nematodes, 803, 803f-804f Polar nuclei, 851, 851f Pond, 1239-1241, 1239f-1240f Power of Movement of Plants,
viral, 810f Polarity, in development, 383 Pons, 902, 902t The (Darwin), 827
Plant hormone, 825-836 Polarized character states, 458-459 Popper, Karl, 7 Poxvirus, 531f
ee
functions of, 826t Polio, 531f, 532t Population, 3f, 4, 1165 Prader-Willi syndrome, 251-252, 487
that guide plant growth, 825 Pollen, 168, 609f age structure of, 1168 Prairie, 1237
production and location of, 826t dispersal of, 407, 407f change through time, 1170 Prairie chicken (Tympanuchus cupido
transport in phloem, 781-783, Pollen grain, 603, 604, 604f, 605, human. See Human population pinnatus), 1274-1275, 1274f
782f-783f 850, 851f metapopulations, Prairie dog
.w
Plant receptor kinase, 175 formation of, 609, 609f, 1167-1168, 1168f (Cynomys ludovivianus), 1146f
Plantae (kingdom), 13, 13f, 514, 515f, 850-851, 850f survivorship curves for, 1170, Pre-mRNA splicing,
517f, 518t, 521f Pollen tube, 603, 604f, 609, 609f, 1170f-1171f 289-291, 290, 290f
Plantlet, 858 610, 610f Population cycle, Precocial young, 1153
Planula larva, 653, 655
Plasma cell, 1062t
Plasma membrane, 62-63, 67f, 78t
active transport across,
851-857, 852f-857f
by animals, 852-854, 852f-853f
by bats, 854, 1196f
cs
Pollination, 604f, 608, 609-610, 610f, 1176-1177, 1177f
Population demography, 1168-1171,
1169f-1171f
Population dispersion
Predation, 1192
evolution of prey population,
412-413, 412f
fish, 408, 408f
99-102, 104t by bees, 852, 852f-853f clumped spacing, 1167 population cycles and, 1177
si
of archaebacteria, 65, 548 Apago PDF Enhancer
by birds, 852-854, 853f habitat occupancy and, 1167 prey populations and, 1192-1193
of bacteria, 548 by insects, 852, 852f-853f human effect on, 1166 reduction of competition by,
bulk transport across, 102-103 by wind, 852, 854, 854f mechanisms of, 1166, 1166f 1199-1200, 1200f
hy
components of, 90t, 92-93 Pollinator, 851-852 randomly spaced, 1167 species richness and, 1225
electron microscopy of, 91-92, 91f Pollution, 1245-1250 uniformly spaced, 1167 Predator
of eukaryotes, 66f, 78t diffuse, 1246 Population genetics, 397 animal defenses against,
fluid mosaic model, 89, 90f, of freshwater habitats, 1246, 1246f Population growth 1194, 1194f
p
92-93, 548 habitat loss and, 1267 factors affecting growth rate, search image for prey, 407-408, 408f
passive transport across, 96-99 of marine habitats, 1248 1168-1169, 1169f selection to avoid, 404, 404f
of prokaryotes, 63-64, 63f, 548 phytoremediation, 797-800, in hotspots, 1260-1261, 1260f Predator avoidance, 404, 404f
ar
conjugative, 554-556, 555f Polychaeta (class), 674-675, 674f Population range, thransport, 782, 783f
resistance, 558 Polychaete, 641t, 674-675, 1165-1166, 1165f-1166f Pressure potential, 772, 772f
Plasmodesmata, 67f, 674f, 675f Population size Presynaptic cell, 896
84-85, 85f, 592 Polyclonal antibody, 1077 density-dependent effects on, Prey defense, 1137
Plasmodium, 577-578, 577f, 1079 Polydactyly, 227t, 403 1175-1176, 1175f-1176 Prey protein, in DNA-binding
.a
Plasmodium falciparum, 409, 409f, 487, Polygenic inheritance, 232-233, density-independent effects on, hybrid, 341, 341f
487f, 578 232f, 233t 1176, 1176f Prezygotic isolating mechanisms,
genome of, 358f, 475f, 488 Polymer, 36f, 37, 40f extinction of small populations, 438-440, 438f-439f, 438t
w
Plasmodium (slime mold), Polymerase chain reaction (PCR), 1273-1275, 1273f-1274f Priestly, Joseph, 149-150
584-585, 585f 339-340, 340f human, 1179f Primary carnivore, 1215, 1215f
Plasmolysis, 771 applications of, 340 Pore protein, 95, 95f Primary induction, 1124
Plastid, 75 procedure for, 339-340 Porifera (phylum), 640, 641t, 643, Primary lymphoid organs, 1064,
w
Platyhelminthes (phylum), 641t, 643, in enzymes, 398, 398f Positive feedback loop, 878, 878f, Primary motor cortex, 904, 905f
644f, 657-660, 657f, 659f, 902 single nucleotide, 248 950, 1176 Primary mycellium, 622
Platyzoa, 643, 644f Polynomial name, 512 Positive gravitropism, 820 Primary oocyte, 1095, 1096f
Pleiotropic effect, 233, 233t, 413 Polynucleotides, 42 Positive pressure breathing, 1007 Primary phloem, 733f, 741f, 742
I-24 index
m
Primary structure, of proteins, shape of, 551-552 structure of, 37t, 46-49 Pulmonary vein, 703, 1024,
46, 49f size of, 548 synthesis of. See Translation 1024f, 1029
Primary succession, 1202, 1202f symbiotic, 563-564 tertiary structure of, 46, 48-49, 49f Pulvini, 822, 822f
Primary tissue, 864 transcription in, 284-287, transport within cells, 70-71, 71f, Punctuated equilibrium, 451, 451f
co
of plant, 732 284f-287f 296f, 297 Punnett, R. C., 227
Primary transcript, 288, 288f transcriptional control in, 305, ubiquitination of, 323-324, 323f Punnett square, 226f,
Primary xylem, 733f, 737, 308-312, 308f-312f Protein-encoding gene, 359, 360t 226-227, 229, 229f, 400
741-742, 741f unicellularity of, 548 Protein hormones, 948 Pupa, 686
y.
Primate, 525, 525f, 721 Prolactin, 948, 951, 1093t Protein kinase, 170, 171f, 173, Purine, 42, 259f, 260
evolution of, 721-726, 721f-726f Prolactin-inhibiting factor 176-177, 177f, 945 Pvull, 328
hunting for bushmeat, 471 (PIF), 949 Protein kinase A, 180, 180f, 182, 182f Pyramid of energy flow,
language of, 1147, 1147f Proliferating cell nuclear antigen Protein kinase C, 181 1218, 1219f
bl
Primer, for replication, 268-269 (PCNA), 271 Protein-protein interactions Pyrimidine, 42, 259f, 260
Primitive streak, 1115 Prometaphase, 193f, 194f, 196 protein microarrays, 367 Pyrogen, 883
Primordium, 608, 608f Promoter, 285, 285f two-hybrid system, Pyruvate
ee
Primosome, 269 in eukaryotes, 340-341, 341f conversion to acetyl-CoA,
Prion, 541-542, 542f 313-314, 313f Proteobacteria, 551f 130, 130f
Probability, 230-231 Proofreading function, of DNA Proteoglycan, 81, 81f from glycolysis, 126f, 128f, 130
Procambium, 732, 733f, 759 polymerase, 273 Proteome, 366 oxidation of, 130, 130f
Processivity, of DNA polymerase III, Prop root, 742, 743f Proteomics, 366-367 Pyruvate dehydrogenase, 115, 115f,
.w
268 Propane, 34 Prothoracicotropic hormone 130, 138, 138f
Prochloron, 64, 64f Prophage, 534, 534, 557 (PTTH), 957 Pyruvate kinase, 128f
Product of reaction, 25 Prophase Protist, 512-513, 567-585
Product rule, 230 meiosis I, 210-211, 212f, 214f asexual reproduction in, 572
Q
Productivity, 1215
primary, 1186, 1215, 1222-1223,
1222f, 1224, 1224f, 1236,
1236f
secondary, 1216
Proprioceptor, 919
Prosimian, 721, 721f-722f
Prosoma, 679
cs
meiosis II, 213f, 214, 217f
mitotic, 192f, 194f, 195, 216f
cell division in, 188f
cell surface of, 571
classification of, 520, 520f,
570f-571f, 571
cysts of, 571
Q10, 878-879
Quantitative traits, 232, 233f
Quaternary structure, of proteins,
46, 49, 49f
si
species richness and, 1225 Apago PDF Enhancer
Prostaglandin, 37t, 54, 943 cytokinesis in, 197
Quiescent center, 739
Quinine, 806t, 808
Progesterone, 956, 1093t Prostate gland, 1092 defining, 571-572
Proglottid, 659-660, 660f Protease, 45t, 323, 816 flagella of, 572-573, 575f
hy
cell division in, 187-188, Protective layer, 824 Proto-oncogene, Rabies, 349, 532t
188f, 548 Protein, 33, 36f, 37, 433 203-204, 204f Rabies virus, 531f
cell organization of, 63-65, 63f anchoring, 94 Protoderm, 732 Race, human, 726, 726f
ar
cell size of, 548 catabolism of, 141, 141f, 142 Protogyny, 1085f Radial canal, 688
cell structure in, central dogma, 280, 280f Proton, 18, 19f Radial cleavage, 638, 639f
551-554, 552f-554f degradation of, 322-324, Protonephridia, 1040, 1040f Radial symmetry, 636, 636f
cell walls of, 63, 63f, 64, 81t, 323f-324f Protoplast, plant, 858f, 859 Radially symmetrical flower, 499
sw
548-549, 552-554, denaturation of, 52-53, 52f Protostome, 523, 638, 639f, Radiation (heat transfer), 879, 879f
552f-553f domains of, 50-51, 51f 643-645, 644f Radicle, 764, 765f
classification of, folding of, 51-52, 51f Proximal convoluted tubule, 1047, Radioactive decay, 19
549-550, 549f-551f functions of, 37t, 44-46, 1047f, 1048 dating of fossils using,
compartmentalization in, 548 45t, 46f Prusiner, Stanley, 541 424-425, 424f
.a
eukaryotes versus, 81t, 547-548 functions of, 93, 94f Pseudogene, 359, 360, 360t, 482 Rain forest
first cells, 546, 546f kinds of, 93, 94f Pseudomonas fluorescens, 489 loss of, 1246-1247, 1247f
flagella of, 63f, 65, 81t, 548, movement of, 92-93, 93f Pseudomurein, tropical, 1236-1237, 1237f
553, 553f structure of, 94-95, 95f 548-549, 552 Rain shadow, 1233-1234, 1234f
w
gene expression in, 305, 308-312, transmembrane domains of, Pseudostratified columnar Ram ventilation, 1005
308f-312f, 549 94-95, 95f epithelium, 867t Rape case, 336, 336f
genetics of, 554-559, 555f-558f motifs of, 50, 50f, 367, 367f Psilotum, 599 Raphe, 581, 581f
w
genome of, 358f nonpolar regions of, Pterophyta (phylum), 596, 597, 597f, Ras protein, 176, 178, 178f, 203f, 204f
internal membranes of, 554, 554f 46-49, 48f 598-601, 599f-600f, 601t Rat, genome of, 475f, 487
metabolic diversity in, 548 one-gene/one-polypeptide Pterosaur, 707t Raven, cognitive behavior in,
metabolism in, 559-560 hypothesis, 6, 280 Pterosauria (order), 707t 1141, 1142f
index I-25
m
Reactant, 25 Reinforcement, 442, 442f 438, 438t Reticular-activating system, 905
Reaction center, 155, 155f Relative dating, 424 evolution of, 441-442, 442f Reticular formation, 905
Reading frame, 283 Releasing hormone, 948-949 Reproductive leaf, 749 Retina, 930, 931f
Realized niche, 1188, 1188f REM sleep, 905 Reproductive strategy, 1084-1086, Retinoblastoma susceptibility gene
co
Receptor kinase, 945, 945f Remodeling, bone, 966-967, 1085f-1086f, 1150-1154, (Rb), 204, 204f
Receptor-mediated endocytosis, 102f, 966f-967f 1150f-1153f Retrotransposon, 360, 486
103, 104t Renal cortex, 1045, 1046f Reproductive system, 875f, 876, Retrovirus, 280, 529, 531
Receptor potential, 917 Renal medulla, 1045, 1046f 1084-1102 Reverse genetics, 343
y.
Receptor protein, 63, 90t, 93, 94f, Renal pelvis, 1045 evolution of, 1087-1088, 1088f Reverse transcriptase, 280, 332, 332f,
168, 169f Renaturation, of proteins, 52f, 53 female, 875f, 876, 1090, 1090f, 531, 536f, 538
intracellular, 171-174, 172f, Replica plating, 558 1094-1098, 1094f-1098f RFLP. See Restriction fragment
172t, 173f Replication, 263-266, 263f-265f male, 875f, 876, 1091-1094, length polymorphism analysis
bl
Receptor tyrosine kinase, 174-178, conservative, 1091f-1094f, 1093t Rh factor, 1077
175f-178f, 182-183, 202 263-265, 263f Reptile, 703t, 706-711, 708f-711f Rh-negative individual, 1077
autophosphorylation of, direction of, 265, 266f, 267, brain of, 903, 903f Rh-positive individual, 1077
ee
175-176, 175f 267f, 272f characteristics of, 706-707, 707t Rheumatic fever, 560
inactivation of, 178 dispersive, 263f, 264, 265 circulation in, 1024 Rhinoceros, 525
Recessive trait, 224-228, 224f elongation stage of, 265-266 eggs of, 706, 708f Rhizobium, 563, 792, 793f
in humans, 227t enzymes needed for, 268t, evolution of, 697, Rhizoid, 594, 594f, 601
Reciprocal altruism, 1154-1155, 269-270, 269f 708-709, 708f-709f Rhizome, 600, 746, 746f, 858
.w
1155f errors in, 273 fertilization in, 1089-1090 Rhizopoda, 583, 583f
Reciprocal cross, 223 in eukaryotes, 271-273, heart of, 709, 709f, 1024 Rhizopus, 615t, 621f
Recognition helix, 306 271f-272f kidney of, 1043 Rhodophyta (phylum), 515f, 570f,
Recombinant DNA, 327 in HIV infection cycle, 537 lungs of, 1007 582, 582f
construction of, 327, 328, 328f
introduction of foreign DNA into
bacteria, 329-331, 331f
in vaccine production,
lagging strand, 267f, 268-269,
269f-270f
leading strand, 267f, 268,
cs
initiation stage of, 265-266, 271 nitrogenous wastes of,
1044, 1045f
orders of, 707f, 710-711,
710f-711f
Rhodopsin, 930
Rhynchocephalia (order), 707t,
710, 710f
Ribbon worm, 642t, 672-673, 672f
344-345, 344f 269f-270f, 272f present day, 709-710, 709f regeneration of eyespot, 503, 503f
si
Recombination, 210, Apago PDF Enhancer
Meselson-Stahl experiment, respiration in, 707 Ribonuclease, 52f, 53
245-247, 275 264-265, 264f skin of, 707 Ribonucleic acid. See RNA
in eukaryotes, 548 Okazaki fragments, 268-269, skull of, 708f Ribosomal RNA (rRNA), 69, 281
hy
homologous, 555 269f-270f thermoregulation in, 710 Ribosome, 63, 78t, 81t
in prokaryotes, 548 in prokaryotes, 187-188, 187f, Research, 7-8 A site on, 292-293,
using recombination to make 266-270, 266f-270f, 549 Resolution (microscope), 60 293f-296f, 295
maps, 245f, 246-247, 246f rolling circle, 555, 555f Resource depletion, 1245-1250 E site on, 292-293, 293f,
p
in viruses, 539 semiconservative, 263-265, 263f Resource partitioning, 1190-1191, 294f, 296f
Recombination frequency, 246 semidiscontinuous, 1190f of eukaryotes, 68-69, 69f, 78t
Recombination nodule, 211 267-268, 267f Resources free, 69
ar
Recruitment, 973 suppression between meiotic competition for limited, functions of, 293
Rectum, 990 divisions, 216 1189-1190, 1189f membrane-associated, 69
Red algae, 463f, 517-518, 517f, 519, termination stage of, 265-266, 269 consumption of worlds, 1181 of mitochondria, 74f
521f, 570, 570f, 582, 582f, 589f of virus, 530 Respiration, 123-126, 1215 P site on, 292-293, 293f-296f,
sw
Red-bellied turtle (Pseudemys Replication fork, 268-269, aerobic. See Aerobic respiration 295, 296
rubriventris), 710f 269f-270f in amphibians, 703, 1004, of prokaryotes, 63, 293f, 554
Red blood cell(s). See Erythrocytes Replication origin, 187-188, 187f 1003f-1004f structure of, 293, 293f
Red-eyed tree frog (Agalychnis Replicon, 266, 271 in birds, 715, 1008, 1009f in translation, 293-297,
callidryas), 705f Replisome, 266f, 269-270, cutaneous, 1006 294f-296f
.a
Red maple (Acer rubrum), 737f 269f-270f in echinoderms, 1003f Ribosome-binding sequence, 294
Red tide, 576-577, 577f Reporter gene, 341, 341f in fish, 1004-1006, 1003f-1005f Ribulose 1,5-bisphosphate (RuBP),
Rediae, 658, 659f Repression, 308, 312 in insects, 1003f 161, 161f, 162
w
Redox, 109, 109f, 123-124, Repressor, 308 in mammals, 1003f, Ribulose bisphosphate carboxylase/
123f, 124f Reproduction 1007-1008, 1008f oxygenase (rubisco), 161,
Reduction, 7, 21, 109, 109f, in amphibians, 704 Respiratory control center, 1011 161f, 163
123, 123f as characteristic of life, 3, 508 Respiratory disease, 1012, 1012f Rice (Oryza sativa), 368f
w
Reduction division, 210 cost of, 1171-1173, 1171f-1172f Respiratory system, 875, 875f, genome of, 358f, 363, 363f, 475f,
Reductionism, 7 in crustaceans, 682-683 1001-1015 476-477, 479f, 486, 489
Reflex, 907-908, 908f in echinoderms, 689 of arthropods, 680-681, 681f golden, 348, 348f, 368
w
Regeneration in fish, 701 Resting potential, 890, transgenic, 348, 348f, 368
in echinoderms, 689 in flatworms, 657f, 658 891-892, 892f world demand for, 368
of planarian eyespot, 501, 501f in fungi, 614, 617, 621 Restoration ecology, Ricin, 807-808, 807f
of ribbon worm eyespot, 503, 503f in mollusks, 669, 669f 1275-1276, 1275f Ricksettsia, 517, 551f
I-26 index
m
functions of, 37t Saliva, 984 Sebaceous glands, 866, 1056 388-389, 388f
in gene expression, 281 Salivary gland, 984-985 Second filial generation, 224-225, evolution of, 523-524, 523f,
micro-RNA, 281, 318-319, development in Drosophila, 224f, 228-229, 229f 639-640
319f, 320 1117-1118, 1117f Second Law of Thermodynamics, molecular details of, 524
co
small, 317-320, 318f-319f Salmonella, 534, 551f, 560, 561t 110, 110f, 433, 879 Segmentation genes, 384f, 387
structure of, 37t, 41-42 evasion of immune system, 1079 Second messenger, 173, Segregation of traits, 222, 226
RNA editing, 320-321 type III system in, 560 179-182, 180f Selectable marker, 330, 331f
RNA interference, 319-320, Salt marsh, 1243 calcium, 181-182, 182f Selection, 401f, 403-404.
y.
319f, 322f Saltatory conduction, 896, 896f cAMP, 173, 179-181, 180f, See also Artificial selection;
RNA polymerase, 266, 271, Sand dollar, 641t, 689, 689f, 690 181f, 182 Natural selection
281f, 285 Sanger, Frederick, 46, 336, 339 cGMP, 174 to avoid predators, 404, 404f
core polymerase, 284f, 285 Saprolegnia, 582 for hydrophilic hormones, on color in guppies, 412-413,
bl
in eukaryotes, 287-288 Sarcomere, 969, 970f, 971f 945-946, 945f 412f-413f
holoenzyme, 284f, 285 Sarcoplasmic reticulum, IP3/calcium, 179, 180f, 181, 181f directional, 410-411, 410f-411f
in prokaryotes, 284f, 285 972, 972f Secondary carnivore, 1215, 1215f disruptive, 409-410, 410f
ee
RNA polymerase I, 270f SARS. See Severe acute respiratory Secondary chemical compound, 1193 frequency-dependent,
RNA polymerase II, 312, 313, syndrome Secondary endosymbiosis, 569 407-408, 408f
314-315, 313f-315f Satiety factor, 996 Secondary growth, in plants, interactions among evolutionary
RNA virus, 529, 529f, 531, 532t Saturated fatty acid, 53, 54f 732, 745f forces, 406-407, 407f
RNAi gene therapy, 345 Saturation, 97 Secondary induction, 1124, 1125f limits of, 413-414, 414f
.w
Rocky Mountain spotted fever, 560 Saurischia (order), 707t Secondary lymphoid organs, to match climatic conditions, 404
Rod, 930, 930f, 931f Savanna, 1237 1064-1065, 1064f oscillating, 408
Rodent, 525, 525f Scaffold protein, 177, 177f Secondary metabolite, 805, for pesticide and microbial
Root, 596, 730f, 739-743, 739f-743f Scallop, 666, 667 806t, 808 resistance, 404-405, 405f
adventitious, 742, 746f, 765f
gravitropic response in, 819f, 820
modified, 742-743, 742f
structure of, 739-743, 739f-741f
tissues of, 730-731
62t, 91
Scar (leaf), 744, 744f
cs
Scanning electron microscope, 61,
Root hair, 735-736, 735f, 739f, 741 Schleiden, Matthias, 12, 60 46, 48, 49f gametophytic, 856, 856f
Root pressure, 776 Schwann cells, 890, 890f Secondary succession, 1202 sporophytic, 856, 856f
Root system, 730 Schwann, Theodor, 12, 60 Secondary tissues, of Self-pollination, 851, 854-855
Rosin, 604 SCID. See Severe combined plant, 732 Self versus nonself
p
Rossmann fold, 50 immunodeficiency disease Secondary xylem, 733f, 737 recognition, 1066
Rotifera (phylum), 642t, 643, 644f, Science Secretin, 993, 994t Semelparity, 1173
663, 663f deductive reasoning in, 4-5 Secretion, 1041 Semen, 1092
ar
Rough endoplasmic reticulum, definition of, 4 in kidney, 1046, 1048 Semicircular canal, 924f,
69-70, 70f descriptive, 4 in stomach, 986-987 925, 925f
Roundworm, 641t, 644, 661-663, 662f hypothesis-driven, 5-7 Securin, 201 Semiconservative replication,
rRNA. see Ribosomal RNA inductive reasoning in, 5 Seed, 392, 393f, 597, 263-265, 263f
sw
Rubisco, 161, 161f, 163 Scientific method, 4, 7 602-603, 604f, 609f Semidiscontinuous replication,
Ruffini corpuscle, 918f Sclera, 929, 929f dispersal of, 1166, 1166f 267-268, 267f
Rule of addition, 230 Sclerenchyma cells, dormancy in, 824, 824f, Semilunar valve, 1026
Rule of eight, 22, 23f 736-737, 736f 836, 836f Senescence, in plants, 860
Rule of multiplication, 230 SCN. See Suprachiasmatic nucleus formation of, 392, 393f, 604f, Sensitive plant (Mimosa pudica),
.a
Rumen, 564, 620 SCNT. See Somatic cell nuclear 605, 760-761, 761f 822, 822f
Ruminant, 991, 991f-992f transfer germination of, 393, 393f, 610, Sensitivity, as characteristic of life,
Rumination, 991 Scolex, 659, 660f 764-766, 764f-766f, 817 3, 508
w
Runner, plant, 746, 746f, 858 Scouring rush. See Horsetail Seed bank, 764 Sensor, 876
Scrotum, 1091 Seed coat, 760 Sensory exploitation, 1152
Scutellum, 764, 764f Seed plant, 596, 602t Sensory information, path of, 916f
S Scyphozoa (class), 655, 655f evolution of, Sensory neuron, 873t, 888, 888f
w
S-layer, 553 Sea anemone, 636, 636f, 641t, 602-603, 603f Sensory organs, of flatworms,
S (synthesis) phase, 192, 192f 654, 654f Seedcracker finch (Pyrenestes ostrinus), 657f, 658
SA node. See Sinoatrial node Sea cucumber, 641t, 689 409-410, 410f Sensory receptor, 916-917,
w
index I-27
m
September 11, 2001, events of, 368 Short tandem repeat (STR), 962f-963f air in, 787, 788f
Septum 354-355, 368 Skeleton charges on soil particles, 787, 787f
in binary fussion, 188 Short-term memory, 906 hydrostatic, 962, 962f loss of, 788, 788f
in fungal hyphae, 616, 616f Shotgun cloning, 357 types of, 962-963, 963f minerals in,
co
Sequence-tagged site (STS), 354, Shotgun sequencing, 357, 357f Skin 787-788, 787f
355f, 357 Shrimp, 682, 683 as barrier to infection, 1056 organic matter in, 787, 787f
Sequential hermaphroditism, Shugoshin, 215 of reptiles, 707 saline, 789
1085, 1085f Sickle cell anemia, 49, 227t, 233, 233t, sensory receptors in human water content of, 787-788, 788f
y.
Serosa, of gastrointestinal tract, 249-250, 249f, 249t, 299, 299f, skin, 918f water potential of,
983, 983f 335, 408-409 Skinner, B. F., 1138 776-777, 787
Serotonin, 899, 1134 malaria and, 250, 409, 409f Skinner box, 1138 Solar energy. See also Sunlight
Serotonin receptor, 321 Sieve area, 738 Skull, 708f climate and, 1230-1235,
bl
Serum, 1019 Sieve cells, 738 Sleep, 905 1231f-1232f
Sessile crustaceans, Sieve plate, 738, 738f Sleep movement, in plants, distribution over Earths surface,
683-684, 683f Sieve tube, 738 822, 823f 1231, 1231f
ee
Set point, 876 Sieve-tube member, 738, 738f Sliding clamp, DNA polymerase III, seasonal variation in, 1231, 1231f
Severe acute respiratory syndrome Sigmoidal growth curve, 1174 268, 268f-269f sunlight, 1163
(SARS), 532t, 540, 540f Sign stimulus, 1133, 1133f Slime mold, 584-585, 585f Soldier fly (Ptecticus trivittatus), 684f
Severe combined immunodeficiency Signal recognition particle (SRP), cellular, 585, 585f Solenoid, 190-191, 190f
disease (SCID), 345, 345t 281, 296f, 297 plasmodial, 584-585, 585f Soluble receptor, 1057
.w
Sex chromosome, 240, Signal sequence, 296f, 297 Slow-twitch muscle fiber, 974, 974f Solute, 28, 97
241-243, 241t Signal transduction pathway, 14, 168, Slug (mollusk), 666, 667, 668, Solute potential, 772, 772f
of birds, 241t 169-170, 169f 670-671 Solvent, 27t, 28, 29f, 97
of humans, 241-243, 241t, 248f changes in pathways, 494 Small interfering RNA (siRNA), 318, Somatic cell, 208, 208f
of insects, 241t
nondisjunction involving,
251, 251f
Sex combs reduced (scr) gene, 1117
in development, 494
Signaling molecule sonic hedgehog
(Shh), 1124
Silent mutation, 299, 300f
cs 319f, 320
Small intestine, 983, 983f, 988f, 990f
absorption in, 989-990, 989f
accessory organs to, 988-989,
Somatic cell nuclear transfer
(SCNT), 381
Somatic motor neuron, 973, 973f
Somatic nervous system, 888, 889f,
Sex determination, 1086, 1086f Silkworm moth (Bombyx mori), 956f 988f-989f 909-910, 909t
si
genetic sex, 1086 Apago PDF Enhancer
Simberloff, Dan, 1227 digestion in, 987, 988, 988f-989f Somatostatin, 949
temperature-sensitive, 1086 Simian immunodeficiency virus (SIV), Small nuclear ribonucleoprotein Somite, 1119, 1119f
Sex linkage, 240f, 241 470-471, 470f-471f (snRNP), 281, 290, 290f Somitomere, 1119
hy
Sex steroid hormones, 956 Simple epithelium, 866 Smallpox, 344, 532t, 535, 1061 Song, birds, 1140, 1140f, 1145, 1149
Sexual dimorphism, 662 columnar, 866, 867t Smell, 926-927, 927f Songbirds, declining populations of,
Sexual reproduction, 207, 208-218, cuboidal, 866, 867t Smoking, 1012 1268, 1268f
519, 572, 1084-1086. See also squamous, 866, 867t cancer and, 1012, 1012f Sorghum, 164
p
Meiosis Simple leaf, 748, 748f cardiovascular disease and, 1033 genome of, 476, 479f
in animals, 635t Simple sequence repeats, 359, 360t nicotine addiction, 901 Sori, 601
Sexual selection, 405, 1150-1154, Sin nombre virus, 540 Smooth endoplasmic reticulum, SOS response, 275
ar
1150f, 1151 SINE. See Short interspersed element 70, 70f Sounds, navigation by, 923-924
Sexually transmitted disease (STD), Singer, S. Jonathan, 89 Smooth muscle, 870, 871t Source-sink metapopulation,
561t, 562-563, 562f, 1100 Single-copy gene, 359 Snail, 641t, 666, 667, 668, 669, 1167-1168, 1168f
Shade leaf, 750 Single covalent bond, 24, 24f 670-671, 670f Southern blot, 334f, 335-336
sw
Shark, 699t, Single nucleotide polymorphism marine, larval disposal in, 466-468, Southern, Edwin M., 335
700-701, 700f (SNP), 248, 361, 362f 467f-468f Soybean (Glycine max)
evolution of, 700 in human genome, 361 Snake, 699f, 707t, 711, 711f genome of, 479, 479f, 483f
teeth of, 700-701 single-base differences between evolution of, 425, 429f phytoestrogens in soy
Sheep, cloning of, 380f, 381, 381f individuals, 361-362 sensing infrared radiation, products, 808
.a
Shell, of mollusks, 667, 668, Single-strand-binding protein, 267, 934, 934f transgenic, 347
670f, 671 268t, 269f-270f Snake venom, 45t, 433 Spatial heterogeneity, species richness
Shigella, 560 Sink (plant carbohydrate), Snapdragon, 499, 849, 849f and, 1224-1225, 1224f,
w
gravitropic response in, 819-820, Siphonaptera (order), 685t ribonucleoprotein Specialized transduction, 556, 557
819f-820f siRNA. See Small interfering RNA Social system Speciation, 436-453
tissues of, 730 Sister chromatid, 191, 191f, 193, 193f, communication in social group, allopatric, 442, 442f,
w
I-28 index
m
endemic, 1258-1261, 1259f, 1260t Spongin, 650f, 651 Steroid, 37t, 54, 55f, 939 Succinate, 132, 133f
geographic variation within, Spongy bone, 965f, 966 Steroid hormone receptor, 173-174 Succinyl-CoA, 132, 133f
437, 437f Spongy mesophyll, 749, 749f Stickleback fish Suckers, plant, 858
hotspots, 1259-1261, Spontaneous courtship signaling in, 1144f, 1145 Sucrose, 28, 39, 39f
co
1259f-1260f, 1260t reaction, 110 gene evolution in, 498 transport in plants, 781, 782f
keystone, 1201, 1201f, Sporangiophore, 621, 621f Stigma, of flower, 598, 598f, 609 Sugar
1272, 1273f Sporangium, 585, 585f, 590, 590f, Stimulus, 916 isomers of, 38, 39f
nature of, 437 594, 594f, 600f Stimulus-gated ion channel, transport in plants,
y.
origin of, 436-453 Spore 917, 917f 781-782, 782f
sympatric, 437 of fern, 599-600 Stimulus-response chain, 1144f, 1145 Sugarcane, 164, 189t, 363f
Species concept of fungi, 617, 617f Stipule, 730f, 744, 747 chromosome number in, 189t
biological, 437-438, 438t, 463 of moss, 594, 594f Stolon, 746, 746f, 858 genome of, 476, 479f
bl
ecological, 441 of plant, 590, 590f Stomach, 986-987, 986f Sulfhydryl group, 35f
Species diversity cline, 1225, 1225f Spore mother cell, 590, 590f digestion in, 986-987 Sulfur bacteria, 139
Species name, 512 Sporocyst, 658, 659f four-chambered, 991, 992f Summation, 893, 893f, 900,
ee
Species richness, 469-470, 469f, Sporocyte. See Spore mother cell secretion by, 986-987 973, 974f
1186. See also Biodiversity Sporophyte, 590, 590f, 594f, 595, Stomata, 163-165, 163f-164f, 589, Sundew (Drosera), 750, 793, 794f
climate and, 1224f, 1225 595f, 600f, 609f, 610 734, 734f, 804f Sunflower (Helianthus annuus) , 822f
effects of, 1223-1224, 1223f Sporophytic self-incompatibility, opening and closing of, 778, genome of, 479f
evolutionary age and, 1225 856, 856f 778f, 779f Sunlight, 1163. See also Solar energy
.w
predation and, 1225 Squamata (order), 707t, 710f, STR. See Short tandem repeat in photosynthesis, 148, 150
productivity and, 1224, 1224f 711, 711f Stramenopile, 515f, 570f, 580-582, regulation of stomatal opening
spatial heterogeneity and, Squid, 667, 668, 671-672 580f-581f and closing, 778
1224-1225, 1224f, 1225-1226 SRP. See Signal recognition particle Stratification (seed), 764 Supercoiling, of DNA, 267, 267f
in tropics, 1225-1226, 1225f
Specific heat, 28
of water, 27t, 28
Specific repair mechanism, 274, 274f
Specific transcription factor,
reuptake inhibitor cs
SSRI. See Selective serotonin
Spemann, Hans, 1122 Stamen, 608, 608f, 848-849, 848f Streptococcus pneumoniae, 1170f-1171f
Spemann organizer, 1122-1125, Stanley, Wendell, 519 transformation in, 257-258, 257f Suspensor, 754
1122f-1125f Stapes, 921 Streptococcus sobrinus, 562 suspensor mutant, of Arabidopsis,
Sperm, 1092, 1092f Staphylococcus, 550f Streptomyces, 550f 755, 756f
p
blockage of, 1100 Staphylococcus aureus, antibiotic Streptophyta (phylum), 521, 521f Sutherland, Earl, 945
destruction of, 1100 resistance in, 404-405, 558, 559 Streptophyte, 591 Sutton, Walter, 240
fertilization, 1106, 1106-1109, Star jelly, 655, 655f Striated muscle, 870 Swallowing, 985, 985f
ar
1106t, 1107f-1109f Starch, 36f, 37t, 39-40, 40f Stroke, 1033 Sweet woodruff, 744f
penetration of egg by, 1106, Starfish. See Sea star Stroke volume, 1034 Swim bladder, 701-702, 701f
1107f, 1109 Starling (Sturnus vulgaris), migratory Stroma, 74, 74f, 148, Swimmeret, 683, 683f
Sperm competition, 1151 behavior of, 1143, 1143f 148f, 149f Swimming, 975-976
sw
Spermatid, 1092 START, in DNA synthesis, Stromatolite, 546, 546f by fish, 975-976, 975f
Spermatogenesis, 1091f 199, 200 Structural DNA, 359, 360t by terrestrial vertebrates, 976
Spermatozoa, 1092 Start site, 285 Structural formula, 24 Symbiosis, 75, 563, 626
Spermicide, 1099f, 1100 Starter culture, 625 Structural isomer, 35 coevolution and, 1196
Sphincter, 986 Stasis, 451 Structure, of living systems, 13 facultative, 626
.a
Sphygmomanometer, 1029 Statocyst, 924 STS. See Sequence-tagged site fungi in, 626-629
Spicule, 650f, 651 Staurozoa (class), 655, 655f Sturtevant, Alfred, 354 obligate, 626
Spider, 641t, 681-682, 682f STD. See Sexually Style, 608, 608f prokaryotes in, 563-564
w
poisonous, 682, 682f transmitted disease Stylet, 662 Sympathetic chain, of ganglia,
Spinal cord, 902f, 907-909, Ste5 protein, 177 Suberin, 741, 803 910, 911f
907f-908f Stegosaur, 707t Submucosa, of gastrointestinal tract, Sympathetic division, 910, 911f, 911t
injury to, 909 Stele, 741 983, 983f Sympathetic nervous system, 888,
w
Spinal muscular atrophy, 487 Stem, 596 Subspecies, 437, 437f 889f, 910
Spindle apparatus, 188f, 195, 196 gravitropic response in, Substance P, 899 Sympatric speciation, 437,
Spindle checkpoint, 200, 200f, 201f 819-820, 819f Substrate, 113, 117f 445-446, 445f
w
Spindle plaque, 617 modified, 745-747, 746f Substrate-level phosphorylation, Symplast route, 775, 775f
Spine (plant), 749 positive phototropism in, 125-126, 125f Symplesiomorphy, 459
Spinneret, 681 817-818, 817f Subunit vaccine, Symporter, 100
Spiracle, 680f, 681, 681f, 1006 structure of, 743-745, 743f-745f 344, 344f, 349 Synapomorphy, 459
index I-29
m
Synaptic integration, 900 dental caries, 561-562, 561t Thermodynamics, 108 Tmespiteris, 599
Synaptic plasticity, 906 of mammals, 717, 717f First Law of, 109 TMV. See Tobacco mosaic virus
Synaptic signaling, 169, 169f, saber-toothed-ness, Second Law of, 110, 110f, TNT. See Trinitrotoluene
170, 897f 464-465, 465f 433, 879 Toad (Bufo), 703, 703t, 705-706
co
Synaptic vesicle, 896 of sharks, 700-701 Thermogenesis, 882 hybridization between species of,
Synaptonemal complex, 209, 209f of vertebrates, 984, 984f Thermophile, 139, 139f, 516, 439, 440
Syncytial blastoderm, 384, Telencephalon, 902t, 903 517f, 550f Tobacco
384f, 1110 Telomerase, 272-273, 272f Thermoproteus, 550f evolution of, 477f, 480, 480f
y.
Syngamy, 208 Telomere, 271-272, 272f Thermoreceptor, 918 genome of, 480, 480f
Synteny, 363, 363f length of, 272 Thermoregulation Tobacco hornworm (Manduca sexta),
conservation of, 482, 483f Telophase in birds, 715 805, 805f
Synthetic polyploid, 478 meiosis I, 212f, 214 hypothalamus and mammalian, Tobacco mosaic virus (TMV),
bl
Syphilis, 562, 562f meiosis II, 213f, 214, 216f, 217f 882-883, 883f 519-520, 519f, 529f
Systematics, 456-458, 457, 457f mitotic, 192f, 195f, 197, 216f in insects, 880, 880f Tocopherol. See Vitamin E
classification and, Telson, 683, 683f in mammals, 716 Toe, grasping, 721
ee
461-464, 462f-464f Temperate deciduous forest, negative feedback loop, 876, 877f Toll-like receptor, 1056
Systemic acquired resistance, in 1238, 1238f regulating body temperature, Tomato (Lycopersicon esculentum)
plants, 811, 812f Temperate evergreen forest, 1238 878-883 genome of, 479f
Systemic anaphylaxis, 1075 Temperate grassland, 1237 in reptiles, 710 wound response in, 810, 810f
Systemic circulation, 1024 Temperate virus, 533 Thermotoga, 515f, 516 Tonicity, 1039
.w
Systemin, 810 Temperature Thermotolerance, in plants, 825 Tonoplast, 73
Systole, 1026, 1027f adaptation to specific range, 1162 Thick myofilament, 970-971, Too many mouths mutation,
Systolic pressure, 1029, 1029f altitude and, 1234, 1234f 970f-971f in Arabidopsis, 734, 734f
annual mean, 1231, 1231f Thigmomorphogenesis, 821 Tooth. See Teeth
T
2, 4,5-T, 831
T box, 496
carbon dioxide and, 1251
effect on chemical reactions, 25
effect on enzyme activity, 52,
116, 116f
cs Thigmonastic response, 821
Thigmotropism, 821-822, 821f
Thin myofilament, 970-971,
970f-971f
Top-down effect, 1219-1221, 1220f
Topoisomerase, 267
Topsoil, 787, 787f
Torpor, 883
T cell(s), 1020f, 1062, 1062t, 1063, effect on flower production, 844 Thiomargarita namibia, 548 Torsion, 670
si
1063f, 1068 Apago PDF Enhancer
effect on oxyhemoglobin Thoracic breathing, 707 Tortoise, 707t, 710, 710f
antigen recognition by, dissociation curve, 1014, 1014f Thorn-shaped treehopper Totipotent cells, 379
1062f, 1066t effect on plant respiration, 797 (Embonia crassiornis), 684f Touch, receptors in human skin,
hy
cytotoxic, 1062t, effect on transpiration, 779 Threshold potential, 893 918-919, 918f
1066-1067, 1066t, 1067f heat and water, 27t, 28 Thrombocytes, 870. See also Toxin, plant, 805, 806t,
helper, 1062t, 1066, Temperature-sensitive sex Platelet(s) 807-808, 807f
1067-1068, 1069f determination, 1086 Thylakoid, 74, 74f, 148, 148f, 149f, Toxoplasma gondii, 578, 578f
p
HIV infection of, 531, 531f, Template strand, 265, 265f, 280, 160, 160f Trace elements, 998
1080, 1080f 285f, 286f Thymine, 42, 42f, 259f, 260 Trachea, 1007, 1008f
T-cell receptor (TCR), 1064, 1065f, Temporal isolation, 438t, 439 Thymine dimer, 274, 274f Tracheae, 680, 681f, 1006, 1118
ar
1073-1074, 1074f Temporal lobe, 904, 904f Thymus, 956, 1064, 1064f Tracheid, 589, 593, 737, 737f, 777
T-even phage, 533 Temporal summation, 900 Thyroid gland, 949, 949f, 951-953, Tracheole, 680-681, 681f
T-Helper cells, 535 Tendon, 968 952f-953f Tracheophyte, 589, 596-597
T lymphocyte, 1063, 1063f Tendril, 730f, 746f, 747, 821 Thyroid hormone, 939, 951, Trailing arbutus (Epigaea repens), 843
sw
T tubule. See Transverse tubule Tensile strength, 777 952, 952f Trait, segregation of, 222, 226
Table salt. See Sodium chloride Terminal bud, 744, 744f Thyroid-stimulating hormone (TSH), Trans-fatty acids, 55
Taenia saginata, 660, 660f Terminator, 285, 286, 286f 948, 949 Transcription, 43, 280, 280f,
TAF. See Transcription-associated Termite, 684f Thyrotropin-releasing hormone 280-281
factor Terpene, 37t, 54, 55f (TRH), 949 coupled to translation,
.a
Tagmata, 679 Territorial behavior, 1149, 1149f Thyroxine, 943f, 949, 952f 286-287, 287f
Taiga, 1238 Tertiary follicle, 1095 Ti plasmid, 346, 346f DNA rearrangements and,
Tandem cluster, 359 Tertiary structure, of proteins, 46, Tick, 560, 682 1073, 1073f
w
Tandem duplication, 300 48-49, 49f Tiger, 438, 438f elongation phase of, 285-286, 286f
Tannin, 805 Test experiment, 6 Tiger salamander (Ambystoma in eukaryotes, 287-289, 288f
Tapeworm, 641t, 659-660, 660f Test tube baby, 1102 tigrinum), 705f initiation of, 284f, 285, 288, 288f,
Taq polymerase, 339-340, 340f Testcross, 231-232, 231f, 232t, 241 Tight junction, 83-84, 83f 304-305, 322f
w
Tardigrada, 640, 642t, 645f Testes, 1091, 1091f, 1094f Tiktaalik, 704, 704f posttranscriptional modifications,
Taste, 926, 926f Testosterone, 943f, 956, 1091, 1093t Tinbergen, Niko, 1146, 288-289, 288f
Taste bud, 926, 926f, 984 Testudines, 699f 1147-1148, 1147f in prokaryotes, 284-287,
w
Taste pore, 926 Tetanus (disease), 554, 560, 973 Tissue, 2f, 3, 82, 635, 864, 864f 284f-287f
Tatum, Edward, 6, 279 Tetrad, 209 evolution of, 637 termination of, 286, 286f, 288
Tautomer, of nitrogenous Tetrahedron, 26 primary, 732, 864 Transcription-associated factor
bases, 261 Tetrapod, 497 secondary, 732 (TAF), 313, 313f
I-30 index
m
376f, 377 Translocation (chromosome), 250, Tropical ecosystem, 1225-1226 Ubiquitin-proteasome pathway,
in development, 494, 494f, 300, 300f species richness in, 324, 324f
497-498 Translocation, Down 1225-1226, 1225f Ulcer, 562, 987
E2F, 203f syndrome, 250 Tropical forest, destruction of, Ultraviolet radiation, ozone layer and,
co
in eukaryotes, 313-314, 314f Translocation (translation), 1246-1247, 1247f 1248, 1249f
FOXP2, 485 295f, 296 Tropical rain forest, 1236-1237, Ulva, 592, 592f
general, 313, 313f Transmembrane protein, 89, 90f, 1237f Unicellularity, of prokaryotes, 548
specific, 313 90t, 94-95, 95f loss of, 1246-1247, 1247f Uniporter, 100
Unipotent stem cells, 379
y.
TFIID, 313, 313f Transmembrane route, 775, 775f Tropomyosin, 972, 972f
translated regions of, 494 Transmissible spongiform Troponin, 972, 972f Uniramous appendage, 524, 524f
Transcription unit, 285 encephalopathy (TSE), TRP ion channel. See Transient Universal Declaration on the Human
Transcriptional control, 305 541-542 receptor potential ion channel Genome and Human
bl
in eukaryotes, 305, Transmission electron microscope, trp operon, 308, Rights, 369
312-315, 322f 61, 62t, 91 311-312, 311f Unsaturated fatty acid, 53, 54f
negative, 308-310 Transpiration, 737, 770 trp promoter, 311, 311f Uracil, 42, 42f, 259f
ee
positive, 308 environmental factors affecting, trp repressor, 311-312, 311f Urea, 1044, 1045f
in prokaryotes, 305, 308-312, 779, 779f True-breeding plant, 222, 225f Ureter, 1045, 1046f
308f-312f regulation of rate of, 778-779, Trunk neural crest cells, Urethra, 1045, 1046f
Transcriptome, 366 778f-779f 1120-1121, 1120f Urey, Harold C., 509
Transduction, 554, 556-557, Transport protein, 44, 45t, 63, 93, Trypanosoma brucei, 488 Uric acid, 1044, 1045f
.w
557f 94f, 104t Trypanosoma cruzi, 488, 574 Uricase, 1044
generalized, 556-557, 557f Transposable element, Trypanosome, Urinary bladder, 1045, 1046f
sensory, 917, 917f 360-361, 360t 574-575, 575f Urinary system, 875, 875f
specialized, 556, 557 Transposon, 360, 480-481 Trypanosomiasis, 574 Urine, 1041, 1044, 1047-1048, 1056
pH of, 1048
Transfer RNA (tRNA), 69, 281,
291-293
binding to ribosomes,
292-293, 293f
charged, 292, 292f
dead, 361, 361f
in Drosophila, 484
in human genome, 484
Transverse tubule (T tubule),
972, 972f
cs Trypsin, 988
Tryptophan, 47f, 829f
repressor, 311-312, 312f
TSE. See Transmissible spongiform
encephalopathy
Urodela (order),
703, 703t, 705f, 706
Uropod, 683, 683f
Uterine contractions, 878, 878f, 947,
si
initiator, 294 Apago PDF Enhancer
Transversion (mutation), 299 TSH. See Thyroid-stimulating 1128, 1128f
structure of, 291-292, 291f Tree finch (Camarhynchus), hormone Uterine tube. See Fallopian tube
in translation, 293-297, 448, 448f Tuatara, 707t, 710, 710f Uterus, 1098, 1098f
hy
Transfusion, of blood, 1077 Trichomonas vaginalis, 573, 573f Turgor, 99 production using recombinant
Transgenic animals, 284f, 342, Tricuspid valve, 1026 Turgor movement, DNA, 344-345, 344f
343f, 349 Triglyceride, 36f, 53, 54f 821-822, 822f subunit, 344, 344f, 349
Transgenic organism, 330, 365 Trimester, 1125 Turgor pressure, 99, 772, 772f, 778, Vaccinia virus, 1061
Transgenic plants, 346-349, Trinitrotoluene (TNT), 779f, 782-783, 821-822 Vacuole
.a
365-366, 366f phytoremediation for, 799 Turner syndrome, 251, 251f in ciliates, 578-579, 578f
herbicide resistance in, 346-347, Triple covalent bond, 24, 24f Turpentine, 604 of eukaryotic cells, 81t
347f, 366f Triple expansion (mutation), 300 Turtle, 699f, 707t, 710, 710f of plant cells, 73, 73f, 81t
w
social issues raised by, 348 Triplet-binding assay, 283 Tutt, J. W., 420, 421 Vaginal secretions, 1056
Transient receptor potential ion Triploblastic animal, 637, 640, 643 Twin studies, 1141 Valence electron, 22
channel (TRP), 918 Trisomy, 189, 250, 250f Two-hybrid system, protein-protein Vampire bat (Desmodus rotundus),
Transition (mutation), 299 Trisomy 21. See Down syndrome interactions, 340-341, 341f 1155, 1155f
w
Translation, 280, 281 Trochophore, 643, 669, 669f 2,4-D, 829f, 830 Van Beneden, Edouard, 207-208
coupled to transcription, Trophic cascade, 1219-1220, Tympanum, 686 van der Waals attractions, 23t,
286-287, 287f 1220f, 1221f Type A flu virus, 539 48, 48f
w
DNA rearrangements and, Trophic level, 1214-1215, 1215f Type III secretion system, 560 Van Helmont, Jan Baptista, 149
1073, 1073f concepts to describe, Typhoid fever, 560, 561t Van Niel, C. B. (small v for van),
elongation stage of, 295-297, 1215-1216 Typhus, 561t 150-151
294f-296f, 298f defined, 1215 Tyrannosaur, 707t Vancomycin, 64
index I-31
m
Vas deferens, 1092 taste in, 926, 926f Wadlow, Robert, 950, 950f Whorl (leaf pattern), 744, 744f
Vasa recta, 1047, 1047f teeth of, 984, 984f Wall cress. See Arabidopsis Wieschaus, Eric, 384
Vascular bone, 966 Vertical gene transfer, 483 Wallace, Alfred Russel, 10 Wild geranium (Geranium
Vascular cambium, 732, 733f, Vervet monkey (Ceropithecus aethiops), Warbler finch (Certhidea), 418f, maculatum), 849f
co
745, 745f language of, 1147, 1147f 448, 448f Wilkins, Maurice, 261
Vascular plant, 463f, 730, 730f Vesicle, 65 Wasp, parasitoid, 809, 809f Wilson, Edward O., 1226-1227
extant phyla of, 596, Vessel member, 737, 737f Water, 1162 Wind, pollination by, 852, 854, 854f
601t-602t Vessel (xylem), 605, 777 absorption by plants, 773-775, Window leaf, 749-750
y.
features of, 596, 596f Vestibular apparatus, 925 774f-775f Wing traits, in fruit fly,
Vascular tissue of plants, Vestigial structure, 430, 430f adhesive properties of, 27, 27f 246-247, 246f
596, 731, 737-738, 737f-738f, Vibrio cholerae, 180, 548, 551f, 561t cohesive nature of, 26, 27f, 27t Wings
756, 759 phage conversion in, 534 forms of, 25-26, 26f development of, 497, 497f,
bl
Vasectomy, 1101f Victoria (Queen of England), heat of vaporization of, 27t, 28 976-977, 977f
Vasoconstriction, 1030-1031, 1031f 242-243, 242f hydrogen bonds in, 26, 26f of insects,
Vasodilation, 1030-1031, 1031f Villi, 987, 988f ionization of, 29 498-499, 498f
ee
Vasopressin, 1034 Vimentin, 76 lipids in, 56, 56f Wnt pathway, 1123
Vector, cloning. See Cloning vector Viridiplantae (kingdom), 519, 520, locomotion in, Wobble pairing, 296-297
Vegetal plate, 1113 521, 521f, 588, 590, 591 975-976, 975f Woese, Carl, 514
Vegetal pole, 1110, 1110f Virion, 528, 530 molecular structure of, 26, 26f Wolf, 423f, 431f, 1163, 1163f
Vegetarian finch (Platyspiza), 418f, Viroid, 542 osmosis, 97-99, 98f captive breeding of, 1277
.w
448, 448f Virulent virus, 533 properties of, 27t, 28-29 WOODEN LEG gene, in Arabidopsis,
Vegetative propagation, 746-747 Virus, 519f, 528-542 reabsorption in kidney, 1048, 759, 759f
Vegetative reproduction, in plants, bacteriophage. See Bacteriophage 1050-1051, 1051f Woody plant, 744, 744f
858, 858f cancer and, 540-541 soil, 787-788, 788f World Health Organization (WHO),
Vein (blood vessel), 1030, 1030f
Vein (leaf), 747-748
Veliger, 669, 669f
Velociraptor, 714, 714f
classification of, 519-520
disease-causing, 532t, 539-541
DNA, 529, 529f, 532t
emerging, 540
cs as solvent, 27t, 28, 29f
specific heat of, 27t, 28
transport in plants, 771f
Water cycle, 1209-1210, 1209f-1210f
348, 560, 1079
Wound response, in plants,
810, 810f
Venous pump, 1031, 1031f genome of, 529, 531 disruption by deforestation, 1247
X
si
Venous valve, 1031, 1031f Apago PDF Enhancer
host range of, 529 Water-dispersed fruit, 762, 763f
X chromosome, 241, 241t
Venter, Craig, 357 latent, 529 Water mold, 581
of fruit fly, 241, 245
Ventral body cavity, 864, 865f recombination in, 539 Water potential, 770-772, 772f, 774f
hy
737f, 741f
of fish, 698-699 tissue tropism, 529 Water-vascular system, 688,
primary, 733f, 737,
Vertebrate, 635, 693-726 virulent, 533, 534f 688f, 689
741-742, 741f
characteristics of, Viscera, 870 Watersheds, of New York City,
secondary, 733f, 737
696-697, 697f-698f Visceral mass, 668 1262-1263, 1263f
sw
vessels, 605
circulatory system of, 1023-1025, Visceral muscle, 870 Waterwheel (Aldrovanda), 794, 794f
water and mineral transport
1023f-1025f Visceral pleural membrane, 1009 Watson, James, 259-263, 261f, 358
through, 776-777, 776f-777f
development in, Vision, 928-933, 928f-933f Weinberg, Wilhelm, 399
1118-1119, 1119f binocular, 721, 933 Welwitschia, 602t, 605, 605f
digestive system of, color, 930, 930f Wendell, Stanley, 519-520 Y
.a
evolution of, 697, 698f, Vitamin, 997-998, 998t Western blot, 335 251f
1121, 1121f Vitamin A, 998t Whale, 525, 525f YABBY gene, in Arabidopsis, 747f
eye in, 1125f Vitamin B-complex vitamins, 998t evolution of, 425, 425f, 430f YAC. See Yeast
fertilization and development in, Vitamin C, 998t overexploitation of, 1269, 1269f artificial chromosome
w
1087-1090, 1087f-1090f Vitamin D, 953, 953f, 998t Whaling industry, 1269, 1269f Yeast, 614, 625, 625f
hearing in, 921-922, 921f, 923 Vitamin E, 998t Wheat (Triticum) cell division in, 188f
invasion of land by, Vitamin K, 992, 998t chromosome number in, 189t chromosome number in, 189t
w
703-705, 704f-705f Viviparity, 1087, 1087f evolution of, 478f ethanol fermentation in, 140f
kidneys of, 1041-1044, Voltage-gated ion channel, 893, 894f genome of, 363, 363f, 476-477, genome of, 358f, 475f
1042f-1044f potassium channel, 893, 894f 478f, 479f, 486 Yeast artificial chromosome (YAC),
locomotion in, 976, 976f sodium channel, 893, 894f transgenic, 366f 331, 356
I-32 index
m
Yolk sac, 706, 708f motif, 307 621, 621f 755, 755f
co
y.
bl
ee
.w
cs
si
Apago PDF Enhancer
p hy
ar
sw
.a
w
w
w
index I-33