Stahel Priska 201606 PHD

Effects of Selenized Casein and Carbohydrate Components of Milk on Insulin
Sensitivity in Rats
by
Priska Stahel
A Thesis
presented to
The University of Guelph
In partial fulfilment of requirements

for the degree of
Doctor of Philosophy
in
Animal Biosciences
Guelph, Ontario, Canada

Priska Stahel, June, 2016
ABSTRACT
EFFECTS OF SELENIZED CASEIN AND CARBOHYDRATE COMPONENTS OF

MILK ON INSULIN SENSITIVITY IN RATS
Priska Stahel Advisor:

University of Guelph, 2016 Professor J. P. Cant
Several epidemiological studies have demonstrated improvements in glucose tolerance
and incidence of type II diabetes with increased dairy product consumption. Elucidating which
components of milk have beneficial effects on insulin sensitivity could lead to the development
of novel dairy products for the treatment and/or prevention of type II diabetes. This thesis
involved supplementing rat diets with various milk components fed for up to 9 weeks prior to the
use of the hyperinsulinemic-euglycemic clamp procedure enhanced by glucose tracer infusion to
measure insulin sensitivity in vivo. Insulin signalling components in hepatic and peripheral
tissues were analyzed in fasted vehicle- and insulin-stimulated rats.
Dietary inclusion of selenium (Se)- enriched casein (a milk protein) to provide 1, 2 and 8
times the Se requirement, impaired hepatic insulin sensitivity when included in low-fat diets but
had no impact on insulin sensitivity when included in high-fat diets. The ability for insulin to
stimulate Akt phosphorylation at Thr308 was decreased in all insulin-responsive tissues. Hepatic
oxidation state and expression of the selenoproteins SeP and GPx1 was unaffected while
expression of IRS1, IRS2 and PGC-1 alpha was decreased with supra-nutritional Se and HF
intake. Expression of PI3k-regulatory and catalytic subunits was decreased with supra-nutritional
intake.
A second study was designed to assess insulin sensitivity in response to 15% dietary
inclusion of galactose, a monomer of the milk disaccharide lactose, compared to the
monosaccharides glucose and fructose. In addition, the lactose-derived prebiotic galacto-
oligosaccharides was assessed in comparison to methylcellulose. Galactose improved hepatic
insulin sensitivity relative to glucose and fructose and increased fed-state hepatic glycogen
content with increased ability for insulin to maintain active glycogen synthase abundance.
Galacto-oligosaccharides elicited bifidogenic responses with no impact on insulin sensitivity.
Of the milk components assessed in these studies, galactose demonstrated the greatest
insulin sensitizing effects, while consumption of galacto-oligosaccharides improved gut
microbial profile it did not alter insulin sensitivity. Intakes of Se-enriched casein to provide up to
8x the requirement impaired hepatic insulin sensitivity in a mechanism similar to high-fat
feeding, via attenuated IRS/PI3K/AKT signalling and decreased PGC-1 alpha.

iv
Acknowledgements
First and foremost, I would like to thank my wonderful advisor John for always believing
in me and encouraging me to believe in myself. Our many discussions about life and science
over the past 7 years have helped me become who I am today and will always be some of my
favourite memories of grad school. I look forward to all our future collaborations and lunch
meetings throughout my career.
This thesis would not have been possible without my friends and lab mates. Special
thanks to Julie for all your wisdom in the lab and loyal friendship. Richelle, Jenny, Diane thank
you for all the great memories in the lab, in the barn, at the bar, on the beach and many more to
come! Sabrina, Ashley and Robin thank you for being constants in my life.
Lastly, thank you to my family, especially my sisters and parents, your amazing work
ethic and humility have had a profound impact on my expectations for myself. Cedrick,
Malcolm, Nathan, Kyle, Liam, and Heidi, you may be too young to understand anything in here
yet but you guys inspire me more than anyone else with your endless curiosity and optimism. To
my incredibly supportive fiance Sharifa, thank you a million times for your encouragement, for
being patient with the slow progress, for forcing me to be rational, for making me laugh or
letting me cry, for moving to the little town of Guelph for me and for being so adventurous and
open-minded! Our biggest adventure is still to come!

v
Table of Contents
List of Tables ................................................................................................................................ vii
List of Figures .............................................................................................................................. viii
Abbreviations ................................................................................................................................. ix
1.0. Literature Review: Effects of milk components on insulin sensitivity .................................... 1
1.1. Milk consumption and type II diabetes ................................................................................ 1
1.2. Lactose ................................................................................................................................. 4
1.3. Selenium-enriched milk ....................................................................................................... 5
1.3.1. Anti-diabetic effects of selenium .................................................................................. 6
1.3.2. Pro-diabetic effects of selenium.................................................................................... 7
1.4. Milk oligosaccharides ........................................................................................................ 11
1.4.1. Prebiotic oligosaccharides and insulin sensitivity ...................................................... 12
1.4.2. Linking gut microbiota and host insulin sensitivity.................................................... 13
1.4.3. Current evidence from galacto-oligosaccharides ........................................................ 15
1.5. Objectives and Hypotheses ................................................................................................ 16
2.0. Selenized milk casein and insulin sensitivity......................................................................... 18
2.1. Abstract .............................................................................................................................. 18
2.2. Introduction ........................................................................................................................ 19
2.3. Materials and Methods ....................................................................................................... 21
2.4. Results ................................................................................................................................ 27

vi
2.5. Discussion .......................................................................................................................... 41
2.6. Conclusions ........................................................................................................................ 45
3.0. Carbohydrate components of milk and insulin sensitivity..................................................... 46
3.1. Abstract .............................................................................................................................. 46
3.2. Introduction ........................................................................................................................ 47
3.3. Materials and Methods ....................................................................................................... 49
3.4. Results ................................................................................................................................ 55
3.5. Discussion .......................................................................................................................... 64
3.6. Conclusions ........................................................................................................................ 68
4.0. General Discussion ................................................................................................................ 69
5.0. Literature Cited ...................................................................................................................... 75
6.0 Appendices .............................................................................................................................. 97
6.1. Appendix 1- Supplementary information for Chapter 2 .................................................... 97
6.2. Appendix 2- Supplementary information for Chapter 3 .................................................. 100

vii
List of Tables
2.1. Selenium and macronutrient (%) composition of experimental diets 22
2.2. Hepatic mineral content on a dry matter basis, triacylglycerol (TAG) content and 28
plasma TAG concentration
2.3. Hepatic total (GSH), oxidized (GSSG) and percent oxidized glutathione (% GSSG) 28
3.1. Ingredient composition (g) of experimental diets 50
3.2. Body weight, composition and fat-free dry mass (FFDM) of overnight fasted rats 55
3.3. Steady-state tissue glucose uptake index (Rg) from 2-[1-14C]-deoxyglucose infusion 58
3.4. Tissue glucose uptake (Rg) across all dietary treatments 59
3.5. Fecal DNA analysis of microbial populations 60
3.6. Proximal colon gene expression 61
3.7. Hepatic glycogen content (mg/g tissue) following the hyperinsulinemic-euglycemic 62
clamp, 3-hours post-feeding or an overnight fast
3.8. Hepatic vehicle and insulin-stimulated glycogen synthase (GS) and glycogen 63
phosphorylase (GP) protein abundance relative to -actin

viii
List of Figures
2.1. Hepatic gene expression for low-fat (LF) diets containing 0.25, 0.5 and 2.0 ppm Se 32
relative to the high-fat diet containing 0.25ppm Se (0.25HF)
2.2 Basal and hyperinsulinemic-euglycemic clamp parameters 30
2.3. Hepatic protein abundance on low-fat (LF) diets containing 0.25, 0.5 and 2.0 ppm Se 33
and the high-fat diet containing 0.25ppm Se (0.25HF) relative to -actin abundance
2.4. Protein abundance on low-(LF) and high-fat (HF) diets containing 0.25, 0.5 and 2.0 36
ppm Se in omental adipose tissue relative to -actin
ppm Se in soleus muscle relative to GAPDH
ppm Se in gastrocnemius muscle relative to GAPDH
2.7. Percent of proliferating pancreatic beta-cells 40
3.1. Basal and hyperinsulinemic-euglycemic clamp parameters 57
3.2. Representative western blots of phosphorylated glycogen synthase (pGS), total 63
glycogen synthase (GS), total glycogen phosphorylase (GP) and -actin detected in
overnight fasted vehicle and insulin-stimulated hepatic tissue.
4.1. Flow diagram of protein, fat and carbohydrate fluxes 72
4.2. Hypothetical output from proposed mathematical model 74

ix
Abbreviations
ACC, acetyl-CoA carboxylase; AMPK, AMP-activated protein kinase; AUC, area under the
curve; CP, crude protein; EGP, endogenous glucose production; FAS, fatty acid synthase;
FFDM, fat-free dry mass; FOXO1, forkhead box O1; FRC, fructose; G6Pase, glucose-6-
phosphatase; GAL, galactose; GIR, glucose infusion rate; GLC, glucose; GLP-1, glucagon-like
peptide-1; GLP-2, glucagon-like peptide-2; GOS, galacto-oligosaccharides; GP, glycogen
phosphorylase; GPx, glutathione peroxidase; GS, glycogen synthase; GSH, glutathionine; GSSG,
oxidized glutathione; HF, high-fat; iBAT, interscapular brown adipose tissue; IRS, insulin
receptor substrate; LF, low-fat; MC, methylcellulose; PEPCK, phosphoenol pyruvate
carboxykinase; PGC-1, peroxisome proliferator-activated receptor coactivator-1; pGS,
phosphorylated glycogen synthase; PGU, peripheral glucose utilization; PGU, peripheral
glucose utilization; PTP1B, protein-tyrosine phosphatase 1B; R g, glucose uptake index; ROS,
reactive oxygen species; SeP, selenoprotein P; SN, supra-nutritional; SREBP-1c, sterol
regulatory element binding protein-1c; TAG, triacylglycerol; UCP1, uncoupling protein-1.

CHAPTER 1
1.0. Literature Review: Effects of milk components on insulin sensitivity
1.1. Milk consumption and type II diabetes
Obesity is becoming increasingly prevalent worldwide and is reaching epidemic levels in
many countries. In 2008, 62.1% of Canadian adults were classified as either obese or overweight
with estimates suggesting obesity and its related chronic diseases are costing the Canadian
healthcare system up to $7.1 billion a year (PHAC, 2011). Many health issues such as vascular
disease, dyslipidemia and type II diabetes can be attributed to obesity from sedentary lifestyles
and over-nutrition.
Type II diabetes is the more advanced disease form of metabolic syndrome which arises
from obesity. Metabolic syndrome is characterized by multiple abnormalities including enlarged
waist circumference indicating abdominal obesity, elevated fasting blood glucose and
triglycerides, elevated blood pressure and reduced HDL cholesterol (Alberti et al., 2006). With
changes in dietary and lifestyle choices, the progression to type II diabetes can be avoided.
However, type II diabetes is diagnosed when, in addition to the characteristics of metabolic
syndrome, insulin levels are lower than normal (Alberti and Zimmet, 1998). This
hypoinsulinemia occurs because pancreatic -cells become exhausted by persistently elevated
blood glucose and eventually are unable to maintain the insulin release stimulated by elevated
glucose.
In addition to impaired insulin release, lower insulin sensitivity of target tissues is often a
contributing factor to the elevated blood glucose in type II diabetes. Insulin resistance in adipose
tissue limits insulin suppression of lipolysis thereby increasing circulating NEFA levels. This
1
could lead to excessive lipid storage in skeletal muscle and liver in which lipids in the form of
ceramides impair insulin signalling through inhibition of AKT, while diacylglyceride and fatty
acyl-coA activate PKC which inhibits IRS-1 via serine phosphorylation (Griffin et al., 1999, Yu
et al., 2002). In addition, adipose tissue of obese animals interferes with insulin sensitivity of
liver and muscle by releasing pro-inflammatory cytokines like interleukin-6 (IL-6) and tumor
necrosis factor- (TNF-; Xu et al., 2003; Sell et al., 2006).
Several epidemiological studies have linked increased dairy consumption with lower
rates of type II diabetes and improvements in glucose homeostasis control. Particularly in
overweight individuals with a body mass index > 25 kg/m 2, Pereira et al. (2000) noted 71%
lower odds of developing metabolic syndrome with consumption of > 35 servings of dairy
products per week compared to < 10 servings. This lower risk included decreased incidence of
abnormal glucose homeostasis, hypertension and dyslipidemia with higher dairy consumption.
For each additional daily serving of a dairy product, the risk of developing metabolic syndrome
decreased by 21%. Similarly, consumption of dairy products one or more times per day
decreased prevalence of metabolic syndrome by 40%, with a more pronounced difference in men
than women (Mennen et al., 2001). Weight and fat loss are accelerated with consumption of
dairy products in some studies (Zemel et al., 2004, Josse et al., 2011) but not all (Bowen et al.,
2005).
Understanding the precise mechanisms by which specific milk components improve
insulin sensitivity and mitigate progression to type II diabetes could lead to the development of
novel dairy products specifically targeting pre-diabetic and diabetic patients. Several components
of milk may contribute to its anti-diabetic effect. Whey protein improves glucose tolerance via
insulinotropic effects of increased intestinal glucagon-like peptide-1 (GLP-1) secretion
2
(Jakubowicz et al., 2014). This may be related to the high branched chain amino acid content of
milk proteins (Nilsson et al., 2007) in particular, the high leucine content could be responsible
for improved insulin sensitivity (Binder et al., 2013; Eller et al., 2013). In addition, there are
several short peptides generated during small intestinal digestion of milk proteins that have the
potential to increase postprandial GLP-1 concentrations (Tulipano et al., 2011; Jakubowicz and
Froy, 2013; Brandelli et al., 2015; Patil et al., 2015). In addition, dairy calcium improves glucose
tolerance to a greater extent than elemental calcium (De Angel et al., 2009) while dietary trans-
palmitoleate, a monounsaturated fatty acid existing exclusively in ruminant products, is
negatively correlated with insulin resistance and dyslipidemia (Mozaffarian et al., 2010).
While milk proteins and fats have been extensively researched in relation to obesity and
glucose tolerance, the milk sugars have received less attention in this regard. However, the roles
of oligosaccharides and galactose as prebiotics and glycogen precursors, respectively, justify
investigations into their potential insulin-sensitizing actions.
In addition to isolating fractions of milk with anti-diabetic properties, there is also the
potential to manipulate the diet of the dairy cow so that the anti-diabetic effect of her milk is
more potent, or less potent as the case may be. Adding organic selenium to the diet of cows
results in selenization of the milk proteins that has beneficial effects on mammary and colon
cancer development and progression in mice (Hu et al., 2008; Warrington et al., 2013), but may
impact insulin sensitivity as well. The following sections review potential mechanisms by which
milk sugars and selenized proteins in the diets of animals may impact responses of their tissues
to insulin.
3
1.2. Lactose
Lactose, a disaccharide of glucose and galactose, is a sugar found exclusively in milk.
Due to its unique hepatic metabolism, galactose could perhaps serve as a substitute for glucose
and fructose sweeteners without any negative impacts of elevated intake on obesity and insulin
resistance. Virtually 100% of dietary galactose absorbed from the gastrointestinal tract is
converted to hepatic glycogen (Barosa et al., 2012) where a series of enzymatic reactions convert
galactose to UDP-glucose. UDP-glucose is an immediate precursor for glycogen synthesis that is
not readily reversed through UDP-glucose pyrophosphorylase to glucose-1-phosphate in vivo.
Therefore, in order for galactose to contribute to blood glucose, it must first enter into glycogen
and then be released via glycogenolysis. However, there is an upper limit to the concentration of
glycogen that can be maintained in hepatocytes (Ercan et al., 1994) so glycogen synthesis from
galactose may reduce incorporation of glucose into glycogen. Adding galactose to a diet can
induce hyperglycemia (Ramana et al., 2006) by sparing glucose from entry into glycogen, but
isocaloric substitution of galactose for glucose does not affect glycemia (Otsyula et al., 2003).
Replacing dietary glucose and fructose with galactose provides an energy source able to
replenish glycogen stores, possibly without elevating plasma insulin or glucose and would
therefore not lead to obesity and the ensuing type II diabetes that are common with high glucose
and fructose intakes. However, the lower sweetness and apparent off-taste might limit the
maximal amount of galactose that could be incorporated into human and animal diets and
minimize its possible use for complete replacement of glucose and fructose (Glaser et al., 2000).
Lactose concentration in milk cannot be changed by cow management strategies because
lactose is an osmotic regulator of milk volume wherein greater lactose production results in
4
higher milk volume. Development of a product high in galactose would require isolation of milk
lactose followed by lactase treatment to yield the monomers galactose and glucose.
1.3. Selenium-enriched milk
A relatively easy manipulation of milk composition that has the potential to be beneficial
for the treatment or prevention of type II diabetes is the generation of selenium-enriched milk.
Selenium (Se) is found in milk proteins as the amino acids selenocysteine and selenomethionine.
Supplementing lactating dairy diets with organic Se sources such as selenized yeast increases
non-specific incorporation of these seleno-amino acids into milk protein (Knowles et al., 1999).
Increasing the Se status of the human population is considered beneficial because of its
anti-oxidant and anti-cancer effects. Antioxidant properties are primarily due to the role of
selenocysteine at the active site of glutathione peroxidases (GPx) that neutralize oxygen free
radicals produced in all cells, thereby preventing DNA damage and cell stress (Steinbrenner and
Sies, 2009). The well-established, anti-cancer properties of organic Se occur when Se is
consumed at supra-nutritional intakes above the requirement for maximum synthesis of GPx. In
particular, Se-enriched milk, fed at levels above the Se requirement, has been shown to suppress
colorectal cancer by reducing cell proliferation and frequency of carcinogenic mutations (Hu et
al., 2008) and decrease progression of mammary tumors in mice (Warrington et al., 2013).
Several links have been identified between Se supplementation and alterations in insulin
sensitivity and carbohydrate metabolism, including both beneficial anti-diabetic and deleterious
pro-diabetic effects.
5
1.3.1. Anti-diabetic effects of selenium
Interest in effects of Se on glucose metabolism was initiated by observations of insulin-
mimetic properties of vanadate, a compound with the same oxidation state as selenate. Vanadate
stimulated adipocyte glucose uptake in vitro (Dubyak and Kleinzeller, 1980), and normalized
hyperglycemia in streptozotocin-diabetic rats through stimulation of hepatic and muscle glucose
uptake (Meyerovitch et al., 1987) and restoration of hepatic glucokinase and
phosphofructokinase-2 activities (Gil et al., 1988). It was subsequently found that 100 M
selenate stimulated glucose uptake in adipocytes in vitro through GLUT4 translocation (Ezaki
1990), potentially via phosphorylation of IRS-1 (Pillay and Makgoba, 1992). Insulin-like effects
were also demonstrated in vivo with sodium selenate decreasing plasma glucose in
streptozotocin-induced diabetic rats (McNeill et al., 1991; Berg et al., 1995) and restoring
insulins effects on glycolysis and gluconeogenesis (Becker et al., 1996). Activity and expression
of the glycolytic enzymes glucokinase and pyruvate kinase, and the lipogenic enzymes glucose-
6-phosphate dehydrogenase and fatty acid synthase, increased, whereas activity and expression
of the gluconeogenic enzyme PEPCK decreased (Berg et al., 1995; Becker et al., 1996). Sodium
selenite supplementation of non-obese diabetic mice decreased blood glucose and plasma
triglycerides and stimulated hepatic phosphorylation of the insulin signalling components
phosphatidyl inositol 3-kinase (PI3K) and Akt (Hwang et al., 2007). Feeding a Se-deficient diet
to diabetic rats lowered glomerular GPx levels in the kidneys, increased blood glucose
concentrations, and increased the extent of renal oxidative stress and glomerular damage from
the elevated blood glucose (Reddi and Bollineni, 2001).
Though early investigations revealed insulin-mimetic properties and insulin-sensitizing
effects of Se, more recent studies have tended to demonstrate pro-diabetic effects and therefore
6
provide contraindications for recommending elevated Se intake for anti-cancer and anti-oxidant
benefits.
1.3.2. Pro-diabetic effects of selenium
The Selenium and Vitamin E Cancer Prevention Trial (SELECT) was designed to
evaluate the effects of selenomethionine and vitamin E on prostate cancer in men in the US,
Canada and Puerto Rico over a supplementation period of 7 years. Unfortunately, the trial was
terminated after just 4 years due to a tendency for an increased risk of type II diabetes (P = 0.16)
observed in only the selenomethionine supplemented group (Lippman et al., 2009). This
highlighted concerns that recommending Se supplementation for cancer prevention or treatment
may be premature since its effects on insulin sensitivity are not well understood. In agreement
with the SELECT findings, higher Se levels in blood have been associated with increased
cholesterol (Stranges et al., 2010a) and prevalence of diabetes (Bleys et al., 2007, Stranges et al.,
2010b).
Several potential molecular explanations for the pro-diabetic phenomenon have been
proposed. One potential mechanism is that increased Se will increase intracellular GPx to the
point where it will overquench free radicals that are necessary for proper insulin signalling in
insulin-responsive tissues (McClung et al., 2004; Labunskyy et al., 2011). When insulin binds to
its receptor, NADPH oxidases are activated to release low concentrations of H 2O2. This localized
burst of H2O2 at the cell membrane transiently inhibits the phosphatases PTP1B and PTEN that
inhibit insulin signalling, allowing the insulin signal to be amplified (Loh et al., 2009). With
attenuation of the H2O2 burst by a greater activity of intracellular GPx, inhibition of the insulin
signal could occur. PTP1B inhibition may be exacerbated by glutathionylation of the enzyme
7
when cellular glutathione becomes more reduced (Mueller et al., 2009). Thus, oxidation of
glutathione by GPx can further activate PTP1B and inhibit insulin signalling.
Overexpression of GPx-1 in mice resulted in a decrease in phosphorylation of the
subunit of the hepatic insulin receptor, as well as decreases in Akt phosphorylation in liver and
soleus muscle, indicating impairments in insulin signal transduction in these tissues (McClung et
al., 2004). The mice exhibited hyperglycemia and hyperinsulinemia as well as increased body
weight and body fatness (McClung et al., 2004). Although H2O2 was not measured,
overexpression of GPx1 is expected to decrease cellular H2O2, possibly to the extent of allowing
greater PTP1B and PTEN inhibition of insulin signal transduction. Placing these mice on a Se-
deficient diet prevented overexpression of GPx-1 and partly rescued them from the diabetic
phenotype. The Se deficiency decreased pancreatic gene expression of transcription factors and
enzymes involved in insulin synthesis and secretion, resulting in lower glucose-stimulated
insulin release and reversing the hyperinsulinemia. As well, down-regulation of enzymes
involved in glycolysis, gluconeogenesis and lipogenesis in liver and muscle lowered plasma
glucose and lipid concentrations, resulting in reversal of the hyperglycemia detected in GPx-
overexpressing mice and an improvement in insulin sensitivity (Yan et al., 2012).
Overfeeding Se induces similar effects as overexpressing GPx1. Se intake in the form of
daily intragastric sodium selenite at 1.33 times the requirement resulted in decreased glucose
tolerance and insulin sensitivity compared to a Se-deficient state (Wang et al., 2014). When
hepatocytes in culture were exposed to Se, insulin did not increase intracellular reactive oxygen
species (ROS) generation as on low-Se media, but actually suppressed ROS production, leading
the authors to conclude that hepatic insulin signalling was impaired by weakening of insulin-
stimulated ROS generation (Wang et al., 2014). Impaired insulin signalling was also exhibited in
8
vivo by decreased phosphorylation of AKT, greater expression of gluconeogenic enzymes
PEPCK and G6Pase, and weaker stimulation of glycogen synthesis (Wang et al., 2014).
Treatment of hepatocytes with a mitochondrial antioxidant reversed the Se-induced inhibition of
insulin signalling (Wang et al., 2014), demonstrating that increased mitochondrial ROS
production is one way that Se impairs insulin signalling. The authors suggested that a chromium
deficiency induced by dietary Se resulted in greater lipolysis in adipose tissue leading to a
greater influx and oxidation of fatty acids in the liver. This increased oxidation of fatty acids
generated the mitochondrial ROS responsible for impaired insulin signalling.
ROS appear to be either beneficial or detrimental to insulin signalling, depending on their
site of production. ROS generated in proximity to insulin receptors upon insulin binding help
propagate the insulin signal by inhibiting PTP1B and PTEN (Loh et al., 2009). However,
mitochondrially generated ROS appear to be detrimental by altering the redox state of the cell,
which can lead to IKK and JNK activation of PKC which serine phosphorylates various
elements of the insulin signalling pathway (Hulver and Dohm, 2004). Se appears to impair
insulin signalling through both over-quenching of the beneficial ROS generated upon insulin
binding to its receptor and over-production of mitochondrial ROS that alter the redox state of the
cell.
In addition to these potentially GPx-mediated effects, selenoprotein P (SeP), a protein
secreted from the liver that supplies other tissues with Se, has been shown to induce both hepatic
and peripheral insulin resistance. Misu et al. (2010) demonstrated insulin signalling impairments
after treating hepatocytes and myocytes in vitro with purified SeP, measured as decreased insulin
receptor tyrosine phosphorylation and increased IRS-1 serine phosphorylation, the latter of
which is inhibitory to IRS-1 activity. In vivo, SeP injection confirmed its inhibitory effect on
9
hepatic and peripheral insulin sensitivity. Associated with these impairments were increased
expression of gluconeogenic enzymes PEPCK and G6Pase as well as increased glucose release
from hepatocytes, and decreased insulin-stimulated glucose uptake into myocytes. These effects
were prevented by inhibition of glutathione synthesis (Misu et al., 2010), suggesting GPx may
play a role in the effects of SeP. However, SeP was also found to inhibit activatory
phosphorylation of adenosine monophosphate-activated protein kinase (AMPK) in liver cells
both in vitro and in vivo (Misu et al., 2010). AMPK is a serine/threonine kinase that
phosphorylates a variety of enzymes involved in energy metabolism, and promotes insulin
sensitivity by activating catabolic pathways such as skeletal muscle glucose uptake and hepatic
fatty acid oxidation and inhibiting anabolic pathways such as lipogenesis (Winder and Hardie,
1999). AMPK is activated by low energy status within the cell, indicated by elevated AMP
concentration. AMPK also mediates the effects of the adipose-derived hormones leptin and
adiponectin which promote insulin sensitivity in muscle and liver by stimulating fatty acid
oxidation (Kahn et al., 2005). Misu et al. (2010) observed SeP-mediated inhibition of hepatic
AMPK phosphorylation without any changes in intracellular energy status, and instead suggested
that SeP exerts this effect through an increase in abundance of protein phosphatase 2C, a
negative regulator of AMPK. This mechanism is an alternative to the GPx stimulation by which
Se can exert its pro-diabetic effects.
There is an interesting reciprocal relationship of SeP to hepatic insulin sensitivity. Not
only does SeP affect responses to insulin but insulin also affects SeP expression. Insulin
decreases expression of gluconeogenic enzymes in the liver via Akt-mediated phosphorylation of
peroxisome proliferator-activated receptor-y coactivator-1 (PGC-1) and forkhead box O1
(FOXO1; Postic et al., 2004). Phosphorylation of these transcription factors that activate
10
gluconeogenic gene expression leads to their exclusion from the nucleus and inhibition of the
fasting-induced up-regulation of hepatic glucose output (Puigserver et al., 2003; Li et al., 2007).
Like the gluconeogenic genes, transcription of the SeP gene is also regulated by PGC-1 and
FOXO1 (Speckman et al., 2008).
Purported effects of Se on insulin sensitivity are conflicting, with evidence for both pro-
and anti-diabetic actions. Growing interest in cancer prevention and treatment with dietary Se
has led to the marketing of Se-enriched animal products in North America and Europe.
Considering the high prevalence of diabetes and metabolic syndrome, it is important to arrive at
a solution to the question of whether Se is beneficial or not, and understand the mechanism by
which Se affects insulin sensitivity.
1.4. Milk oligosaccharides
Of potential relevance to type II diabetes are milk oligosaccharides that are primarily
found free in milk but are also bound to proteins of the milk fat globule membrane and lipids
(Nwosu et al., 2012). Unlike plant oligosaccharides which form straight chains, those of milk are
complex, branched polymers of 3 to 6 glucose, galactose, N-acetylglucosamine, fucose and sialic
acid moieties. Various combinations of these monomers and branching patterns have led to over
40 different oligosaccharides being identified in bovine milk (Tao et al., 2008; Nwosu et al.,
2012).
Oligosaccharides are non-digestible, fermentable carbohydrates that enter the proximal
colon intact and serve as an energy substrate for gut microbes which are dominated by two main
phylla, Bacteroidetes and Firmicutes, followed by the Actino- and Proteo-bacteria (Cani et al.,
2009). Because of the high level of oligosaccharides in human milk, breast-fed infants develop
11
intestinal microbiota dominated by Bifidobacterium, a genus of the phylum Actinobacteria, and
Lactobacillus, a genus of the phylum Firmicutes, which have been shown to minimize pathogen
colonization in the gut, beneficially alter mucosal physiology and barrier function, and modulate
systemic immune and inflammatory responses (Sela and Mills, 2010). Prebiotics are defined as
a selectively fermented ingredient that results in specific changes in the composition and/or
activity of the gastrointestinal microbiota, thus conferring benefit(s) upon host health (Gibson et
a., 2010). The immune-modulatory beneficial effects of prebiotics on the host may provide a link
between the gut and host energy metabolism (Cani et al., 2007). It is of interest to mimic these
effects with bovine milk oligosaccharides, or enzymatically synthesized galacto-oligosaccharides
(GOS), to improve infant formulas and maintain proper gut health in adults.
1.4.1. Prebiotic oligosaccharides and insulin sensitivity
Individuals with type II diabetes have lower gut microbial populations of Bifidobacterium
than normal, lean individuals (Kalliomaki et al., 2008; Wu et al., 2010). In addition, obesity is
associated with increases in Firmicutes and decreases in Bacteroidetes in rodents and humans
(Hildebrandt et al., 2009; Ley et al., 2006; Parnell and Reimer, 2012) but weight loss can
normalize this ratio (Ley et al., 2006). A causal link between gut microbiota, adiposity and host
metabolism is demonstrated by germ-free mice having 40% less body fat than conventional mice
and lower fasting plasma glucose and insulin concentrations (Backhed et al., 2007), while
inoculation of germ-free mice with microbes from obese versus lean donors increased cecal
Firmicutes and fat mass in the body (Turnbaugh et al., 2006).
Supplementing diets of streptozotocin-induced diabetic rats, a model for type I diabetes,
with 10% plant oligosaccharides increased Bifidobacterium and Lactobacillus in the caecum and
reduced fasting blood glucose as well as diabetic complications such as urinary glucose excretion
12
and renal lesions (Gobinath et al., 2010). Inclusion of oligofructose or arabinoxylan
oligosaccharides in high-fat diets restored Bifidobacterium quantities and restored glucose
tolerance and insulin sensitivity that were impaired by high-fat feeding (Cani et al., 2007;
Neyrinck et al., 2010). The hyperinsulinemic-euglycemic clamp revealed improvements in
hepatic insulin sensitivity due to oligofructose, which was associated with increased
phosphorylation of the insulin signalling components IRS-2 and Akt (Cani et al., 2006).
1.4.2. Linking gut microbiota and host insulin sensitivity
Communication between the gut and adipose tissue responsible for changes in host
insulin sensitivity may be mediated by gut permeability-induced changes in appearance of
bacterial products such as lipopolysaccharide (LPS; Geurtz et al., 2014). LPS induces
inflammation throughout the body, indicated by circulating plasma concentrations of interleukins
and TNF-, which cause insulin resistance in tissues (Xu et al., 2003; Sell et al., 2006). LPS
enters the circulation through leaky junctions between intestinal cells. L cells in the colon control
gut permeability by secreting glucagon-like peptide-2 (GLP-2), which promotes tight junction
formation between colonocytes via increased colonic expression of occludin and zona occludens-
1 (ZO-1; Cani et al., 2009). These L cells are stimulated to express the proglucagon gene and
secrete its splice product GLP-2 by luminal butyrate (Tappenden et al., 2003). Increased colonic
short-chain fatty acid production from prebiotics lowers pH (Campbell et al., 1997) which
favours butyrate-producing microbes (Walker et al., 2005), thereby stimulating GLP-2 secretion
and strengthening the intestinal barrier to LPS absorption.
A further link between prebiotics and gut barrier function is mediated by the
endocannabinoid system. Muccioli et al. (2010) demonstrated that favourable shifts in microbial
populations due to addition of oligosaccharides to a high-fat diet decreased colonic expression of
13
cannabinoid receptors and decreased gut permeability, resulting in less LPS-induced adipocyte
differentiation and lipogenesis. Similarly, a cannabinoid receptor antagonist decreased gut
permeability. The obese (ob/ob) mouse model has greater colonic expression of cannabinoid
receptors compared to lean littermates, with impaired colonic tight junction protein expression
and elevated plasma LPS concentrations, all of which were normalized by prebiotic treatment
(Muccioli et al., 2010).
In addition to promoting gut barrier function, L cells also secrete the gut peptides GLP-1
and peptide YY which stimulate pancreatic insulin secretion and increase peripheral tissue
glucose uptake, respectively, and exert satiating effects at the hypothalamus (Vrang et al., 2006;
Chaudhri et al., 2008). Inclusion of oligosaccharides in both high-fat and standard diets increased
intestinal populations of Bifidobacterium and Lactobacillus, increased colonic proglucagon
expression, the progenitor of GLP-1, and plasma GLP-1 concentration, leading to decreased
body weight gain, food intake and insulin resistance (Cani et al., 2004, 2005, 2006). Anti-
diabetic effects of oligosaccharides were abolished by knockout of the GLP-1 receptor (Cani et
al., 2006).
The above evidence suggests that shifts in gut microbiota due to plant-derived
oligosaccharides influence host metabolism through decreased inflammatory responses and fat
mass accumulation, ultimately improving glucose tolerance. To our knowledge, GOS have not
been studied in regards to insulin sensitivity, although evidence from studies involving human
infants and rodent models have already established their prebiotic effects.
14
1.4.3. Current evidence from galacto-oligosaccharides
GOS increase fecal Bifidobacterium when included in infant formulas at 8 to 10 g/litre
(Haarman and Knol 2005; Boehm et al., 2005), at a supplementary 10 g/d to adults (Ito et al.,
1990) and at 4 g/d per kg body weight for rats (Holma et al., 2002). Murine diets supplemented
with 27% compared to 5% GOS decreased caecal pH and conferred protection against colorectal
cancer, possibly due to increased butyrate production (Wijnands et al., 1999). Similarly, addition
of 10% GOS to a basal diet increased total caecal short chain fatty acids with significant
increases in butyrate (1.5-fold) and lactate (3.5-fold). However these changes did not result in
any body weight or fat mass differences (Sakaguchi et al., 1998). The increased butyrate
production with GOS supplementation suggests the possibility for stimulation of L cell GLP-1,
peptide YY or GLP-2 secretion. Interestingly, GLP-1 and peptide YY secretion were increased
with 6% GOS supplementation despite decreased proximal colon butyrate concentration
(Overduin et al., 2013). Decreases in fat pad weight observed by Overduin et al., 2013 suggest
GOS could mediate improvements in host metabolism, such as improved insulin sensitivity, via
mechanisms established in studies of plant-derived oligosaccharides, but this has not been
explicitly studied to our knowledge.
Investigating not only the prebiotic, but also the potential insulin-sensitizing, effects of
GOS using the hyperinsulinemic-euglycemic clamp would be novel and provide incentives for
further research in this area to develop novel dairy products for the mitigation of type II diabetes.
To our knowledge, effects of manipulation of the lactating dairy cows diet on milk content of
oligosaccharides have not been studied and mechanisms of milk oligosaccharide production are
not well understood. To create milk products with concentrated levels of oligosaccharides, it may
be more feasible to use milk processing methods rather than altering the cow diet or genetics.
15
Oligosaccharides can be isolated from milk (Martinez-Ferez et al., 2006), or whey permeate
(Barile et al., 2009), a by-product of cheese making, via ultra and nanofiltration using tubular
ceramic membranes with molecular mass cut-offs as low as 1 kDa. Alternatively, commercially
available GOS, synthesized for use in infant formulas (Neo Cremar Co., Seoul, South Korea),
can be generated in vitro from lactose or lactulose via enzymatic hydrolysis and
transgalactosylation (Marin-Manzano et al., 2013).
1.5. Objectives and Hypotheses
The research described in this thesis aims to investigate potential alterations in insulin
sensitivity by specific milk components in vivo through the use of the hyperinsulinemic-
euglycemic clamp procedure in rats. To our knowledge, selenized milk casein has not previously
been studied in regards to insulin sensitivity but shows promise as a therapeutic anti-cancer agent
(Hu et al., 2008; Warrington et al., 2013) and is therefore a potential novel nutraceutical product.
Due to conflicting evidence of pro- and anti-diabetic effects of elevated Se intake, we established
an objective of characterizing the response to Se given at 1, 2, and 8 times the requirement in the
form of enriched milk casein on low- and high-fat diets to detect impairments and improvements
in insulin sensitivity, respectively. Alterations in insulin signalling pathway components and
target proteins were investigated to further our understanding of the molecular mechanisms
underlying Se-induced changes in insulin sensitivity.
A second study was designed to evaluate the effects of milk sugars on insulin sensitivity.
Glucose, fructose, galactose, GOS or methylcellulose provided 15% of dry matter as milk sugars
in 5 cafeteria-style rodent diets that were fed for nine weeks. We hypothesized that galactose
would improve insulin sensitivity relative to glucose and fructose due to the requirement for it to
be stored as glycogen in the liver prior to generating glucose-6-phosphate for glucose release or
16
glycolysis. Abundance of gut microbial populations was assessed to quantify the anticipated
prebiotic effect of GOS. We hypothesized that, like plant-derived oligosaccharides, GOS would
have bifidogenic effects that may impact host metabolism via increased intestinal GLP-1
secretion resulting in increased pancreatic insulin secretion and improved insulin sensitivity.
17
CHAPTER 2
2.0. Selenized milk casein and insulin sensitivity
Supra-nutritional selenium intake from enriched milk casein impairs hepatic insulin
sensitivity via attenuated IRS/PI3K/AKT signalling and decreased PGC-1 expression in
male Sprague-Dawley rats
2.1. Abstract
Dietary selenium (Se) serves antioxidant functions and has therapeutic potential against
cancer. However, both anti-diabetic and pro-diabetic effects have been attributed to selenium.
Our objective was to evaluate the effect of Se- enriched milk casein on insulin sensitivity in rats
when given at requirement (0.25 ppm Se) and supra-nutritionally. 216 male Sprague-Dawley rats
were fed either low-fat (LF) or high-fat (HF) diets containing 0.25, 0.5 or 2.0 ppm Se for 7
weeks. Glucose infusion rate decreased 22% and endogenous glucose production increased 76%
during hyperinsulinemic-euglycemic clamps with increasing Se content on LF diets, suggesting
impaired hepatic insulin sensitivity. This also decreased the ability for insulin to stimulate Akt
phosphorylation at Thr308. Hepatic oxidation state and expression of the selenoproteins SeP and
GPx1 was unaffected while expression of IRS1, IRS2 and PGC-1 was decreased with supra-
nutritional Se and HF intake. Expression of PI3k-regulatory and catalytic subunits was decreased
with supra-nutritional intake. Se intake from enriched casein up to 8 times the requirement
impairs hepatic insulin sensitivity in a mechanism similar to HF feeding, via attenuated
IRS/PI3K/AKT signalling and decreased PGC-1.
Key words: hepatic insulin signalling, insulin sensitivity, selenium, milk casein
18
2.2. Introduction
The dietary micro-mineral selenium (Se) is essential for endogenous synthesis of
selenoproteins that specifically incorporate the amino acid selenocysteine (SeCys) at their active
site (Forstrom et al., 1978), many of which, like glutathione peroxidase (GPx) and thioredoxin
reductase (TR), serve anti-oxidant functions. Beyond anti-oxidant benefits, anti-cancer effects
have been attributed to elevated Se status (Yoshizawa et al., 1998) and supra-nutritional Se
intakes (Clark et al., 1996) above the requirement for selenoprotein synthesis. As a consequence,
there has been growing interest in increasing the Se status of the human population by dietary
means. Selenized milk proteins, produced by feeding SeMet to dairy cows, have been shown to
decrease incidence and progression of cancerous tumors in the mammary glands and colon of
rodents, when fed at greater than the Se requirement (Hu et al., 2008; Warrington et al, 2013).
Initial analysis of the SELECT clinical trial, in which supra-nutritional SeMet intake for
prevention of prostate cancer in over 30,000 men was studied, revealed a statistically
nonsignificant (P = 0.16) increase in risk of type 2 diabetes diagnosis (Lippman et al., 2009).
Although this risk was eliminated in follow-up analyses (P = 0.34; Klein et al., 2011), recent
studies have demonstrated impairments in insulin sensitivity with supra-nutritional Se intake in
experimental models (Liu et al., 2012; Zeng et al., 2012).
The mechanism behind a putative Se-induced impairment of insulin sensitivity remains
unclear. Early investigations into the link between Se and carbohydrate metabolism revealed
insulin-mimetic properties of Se such as the stimulation of glucose uptake by adipocytes in
culture (Ezaki, 1990; Hei et al., 1998), and the reversal of diabetes-inducing levels of expression
of glycolytic and gluconeogenic enzymes in the liver (Becker et al., 1996; Mueller and Pallauf,
2006). Impairment of insulin sensitivity by supra-nutritional Se intakes could be related to GPx-
19
mediated overquenching of free radicals required for insulin signalling through Akt (McClung et
al., 2004; Labunskyy et al., 2011). Conversely, it has been suggested that insulin signalling may
be inhibited by overproduction of mitochondrial reactive oxygen species (ROS) when chromium
depletion due to Se supplementation increases fatty acid oxidation (Wang et al., 2014).
Alternatively, selenoprotein P (SeP) over-expression has been shown to decrease insulin-
stimulated phosphorylation of Akt in liver, possibly via inhibition of the AMP-activated kinase
(AMPK) (Misu et al., 2010). It has also been proposed that up-regulation of GPx expression by
dietary Se decreases inhibitory glutathionylation of protein-tyrosine phosphatase 1B (PTPIB), an
enzyme that dephosphorylates the insulin receptor, thereby decreasing insulin sensitivity
(Mueller et al., 2008). Finally, Se enhances pancreatic function (Campbell et al., 2008) which
could result in chronic hyperinsulinemia, as seen with pancreatic GPx1 over-expression (Wang
et al., 2008).
The evidence supports both anti-diabetic and pro-diabetic effects of Se. To clearly
establish whether organic Se supplementation at supra-nutritional, anti-cancer levels would
impair or enhance insulin sensitivity, hyperinsulinemic-euglycemic clamps were performed on
rats fed selenized casein at Se levels of 1, 2 and 8 times the requirement in low- (LF) and high-
fat (HF) diets. The HF base was chosen to induce insulin resistance and allow insulin-sensitizing
effects of Se to be detected, while the LF base was designed to reveal insulin-desensitizing
effects of Se. We found that Se had no effect when added to HF diets but Se supplementation
decreased the ability of insulin to suppress endogenous glucose production (EGP) on LF diets.
Down-regulation of expression of peroxisome proliferator-activated receptor coactivator-1
(PGC-1) was a common element in the hepatic responses to dietary fat and Se supplementation,
consistent with induction of insulin resistance.
20
2.3. Materials and Methods
All animal procedures were approved by the Animal Care Committee of the University of
Guelph.
Selenized milk casein. Holstein cows were fed diets containing no additional selenium or 5 ppm
organic selenium (Sel-Plex, Alltech Inc., Nicholasville, KY) for four weeks. During the fourth
week, Se-enriched and non-enriched milk casein were isolated by acid precipitation, as described
previously (Warrington et al, 2013). Briefly, raw milk was pasteurized at 72C with a flow rate
of 1.3 - 1.5 L/min and subsequently defatted through centrifugal separation. Skimmed milk was
then cooled to approximately 42C before lactic acid (88% food grade, Univar Canada, North
York, ON) was slowly added to achieve pH 4.6 causing casein to precipitate out of the fluid
milk. The milk was drained through cheese cloth and the precipitated casein was then washed
with distilled water and drained through cheese cloth twice to minimize the remaining lactose,
whey protein and fat. The casein was allowed to dry overnight in elevated cheese cloth bags
before being laid out on aluminum trays and placed in a freeze dryer for 3 days. The dried,
milled product was stored at -20C before being mixed into the rat diets.
Rat diets. Low- and high-Se casein were mixed into low- (LF) and high-fat (HF) diets to provide
10% and 60% of kcal from fat, respectively, 20% of kcal from casein, and final selenium levels
of 0.056, 0.11 and 0.43 mg/kcal (equivalent to 0.25, 0.5 and 2.0 ppm Se in the LF diet) (Research
Diets, New Brunswick, NJ).
Diets were analyzed for mineral composition by near-infrared spectroscopy and macronutrient
composition by AOAC (1996) methods 930.15, 990.03, 942.05, 962.09 and 920.39 (1) (Table
2.1).
21
Table 2.1. Selenium and macronutrient (%) composition of experimental diets
Diet
0.25LF 0.5LF 2.0LF 0.25HF 0.5HF 2.0HF
Dry matter basis

Se (ppm)* 0.270.13 0.480.13 1.930.13 0.300.14 0.730.14 2.250.17
Protein* 22.20.78 19.70.83 19.40.83 26.90.88 27.50.88 26.71.04
Ash* 4.30.27 3.80.29 3.80.31 4.80.31 4.80.31 4.80.39
Crude Fibre* 2.70.21 2.50.23 2.70.25 3.60.25 4.00.25 3.90.30
Crude Fat* 4.00.20 4.20.21 4.40.23 34.40.23 34.80.23 34.20.28
Carbohydrates* 72.00.84 73.10.89 73.70.97 37.00.97 36.10.97 37.01.18
(calculated)
Kilocalories/g 4.080.03 4.080.03 4.130.04 5.650.04 5.670.03 5.620.05
Per kilocalorie
Se (g/kcal) 0.0580.03 0.110.03 0.470.04 0.054.0.04 0.120.04 0.390.04
Protein 5.160.16 4.740.17 4.750.18 4.770.18 4.850.18 4.710.22
Ash 1.060.08 0.930.08 0.920.09 0.850.09 0.850.09 0.860.11
Crude Fibre 0.670.04 0.620.05 0.660.05 0.630.05 0.710.05 0.690.06
Crude Fat* 0.990.03 1.040.03 1.060.04 6.080.04 6.130.04 6.090.05
Carbohydrates* 17.620.14 17.920.15 17.870.16 6.550.16 6.360.16 6.580.19
(calculated)
Data are means standard error; N=6. Low-fat (LF) and high-fat (HF) diets providing 10% or
60% of kilocalories from fat, respectively, were formulated to contain either 0.25, 0.5 or 2.0 ppm
of selenium (Se) from enriched- milk casein supplying 20% of kilocalories. * P<0.001 for HF
versus LF. P<0.001 for linear effects on LF and HF.
22
Rat feeding and housing. 216 male Sprague-Dawley rats were acquired from Charles River
Laboratories (Toronto, ON) at 225 250 g body weight in blocks of 12 per week, housed in
groups of three under controlled conditions (22C, 12-hour light/dark) and ad libitum access to
water. Each group was fed one of the six diets (36 rats per diet) for seven weeks. Weekly body
weights were recorded. Within each block, LF and HF groups were pair-fed to achieve similar
body weight gains. In the seventh week, one rat per cage was used for the hyperinsulinemic-
euglycemic clamp procedure while the remaining two were used for tissue collection (12 rats per
procedure).
Jugular vein and carotid artery catheterization. Under isoflurane general anesthesia and local
anesthesia (50:50 solution of 0.2% lidocaine and 0.5% bupivacaine 1ml/kg s.c.), catheters were
inserted into the right jugular vein and advanced to the right atrium. The catheter consisted of a
~1.5-cm portion of silastic tubing (ID 0.51mm, OD 0.94mm, Dow Corning, Midland, MI) for
inside the vessel, linked to a ~25-cm portion of polyethylene tubing for outside the vessel (Clay
Adams PE-50, ID 0.58 mm, OD 0.965 mm, Becton Dickinson, East Rutherford, NJ). An
identical catheter was inserted into the left carotid artery and advanced to the aortic arch. Three
silk suture knots were used to secure the catheters in the vessels. The catheters were then
tunnelled subcutaneously to the dorsal side of the neck and anchored in place. Catheters were
locked with a 50:50 glycerol:heparin solution and flushed two days after surgery. The analgesic
meloxicam (1 mg/kg s.c.) was given prior to surgery and 24 hours after surgery.
Hyperinsulinemic-Euglycemic Clamp. Rats were given 3-4 days to recover before undergoing the
hyperinsulinemic-euglycemic clamp. Those that lost more than 5% of body weight were not
used in the clamp. Clamps were performed on overnight-fasted, conscious rats. The basal period
(-90 to 0 minutes) was initiated by jugular infusion of 0.4 Ci/kg/min [3- 3H] glucose (Perkin-
23
Elmer, Waltham, MA) to quantify basal endogenous glucose production (EGP). Arterial blood
glucose was measured every 10 minutes during the last 30 - 40 minutes (OneTouch UltraBlue 2,
LifeScan Canada, Burnaby, BC). Approximately 300 l blood was collected into heparin-
containing tubes for future quantification of the tracer and insulin.
The clamp period (0 to 120 minutes) began with an insulin bolus of 20 mU/kg/min for 2
minutes, (porcine insulin, Sigma, St-Louis, MO) for LF and HF treatment groups, followed by a
continuous jugular infusion of 4 mU/kg/min insulin and 0.8 Ci/kg/min [3-3H] glucose. 25% D-
glucose solution was infused at variable rates adjusted every 10 minutes to clamp blood glucose
at basal levels. Once blood glucose and glucose infusion rates (GIR) were stable for 30 minutes,
approximately 900 l blood were collected into heparin (6 USP units/300 l blood) tubes for
future quantification of the tracer and insulin. Difference in hematocrit between basal and clamp
periods was used to disprove anemia due to excessive blood sampling, with less than 10%
difference considered acceptable. Plasma was stored at -20C until further analysis. Rats were
euthanized with jugular pentobarbital infusion.
Plasma Analysis. Heparinized plasma from basal and clamp periods were dried at 65C after
deproteinization by barium hydroxide and zinc sulfate (Sigma, St. Louis, MO). The tracer [3-
3
H]-glucose was counted in dried samples using Ultima Gold scintillation fluid cocktail (Sigma,
St. Louis, MO) and a Beckman LS6000 liquid scintillation counter (Beckman, Brea, CA).
Samples of infusates were also counted.
Plasma insulin was quantified by enzyme-linked immunosorbent assay (Crystal Chem, Downers
Grove, IL).
24
Glucose Flux. Glucose fluxes (mmol/min) during the basal and clamp periods were calculated as
tracer infusion rate (dpm/min)/specific activity of plasma glucose (dpm/mmol) and adjusted for
body weight to yield glucose fluxes in mg/kg/min. EGP was calculated as glucose flux GIR.
Percent suppression of EGP by insulin was calculated from the difference in EGP between clamp
and basal periods. A portion of the GIR compensates for EGP suppression and the remainder
compensates for stimulation of peripheral glucose utilization (PGU). Stimulation of PGU was
calculated as clamp glucose flux basal glucose flux.
Tissue Collection. In situ tissue collection under pentobarbital anesthesia was performed eight
minutes after i.p. injection of either 10 U/kg porcine insulin or the equivalent volume/kg of
vehicle (saline). Pancreatic tissue was collected in formalin; liver, omental adipose tissue,
gastrocnemius and soleus muscles were snap-frozen in liquid nitrogen and stored at -80C until
further analysis. Blood was collected after tissue collection via cardiac puncture into heparin-
and EDTA-containing tubes. Rats were euthanized by cardiac trauma.
Plasma Analysis. Heparinized plasma from vehicle-treated rats was used for the quantification of
plasma triacylglycerol (TAG) via colorimetric assay (Cayman Chemical, Ann Arbor, MI).
Hepatic tissue analysis. Liver mineral content was analyzed by Inductively Coupled Plasma
Mass Spectroscopy (AOAC, 2005) and colorimetry was used to quantify TAG (Abcam,
Cambridge, UK), total glutathione (GSH) and oxidized glutathione (GSSG) (Cayman Chemical,
Ann Arbor, MI).
RNA analysis. Liver RNA, isolated via the TRIzol method, was reverse transcribed (High
Capacity cDNA Reverse Transcription Kit; Applied BioSystem, Waltham, MA). Primers (Table
A1.1) were used in qPCR (PerfeCta SYBR Green FastMix; Quanta BioScience, Gaithersburg,
25
MD) with an Applied Biosystems 7300 Real Time PCR instrument. Gene expression was
analyzed by the 2-Ct method (Kivak and Schmittgen, 2001) with -actin as the reference gene
and presented as fold-change relative to the 0.25HF diet.
Western blot analysis. Protein concentration of homogenized tissues was quantified by BCA
assay (Thermo Scientific, Waltham, MA). 20 g protein was loaded per well on 6-10% SDS-
PAGE gels, separated and transferred to nitrocellulose membranes. All primary antibodies were
from Cell Signalling (Danvers, MA, USA) and incubated at room temperature at 1:1000 unless
otherwise stated; phosphorylated AKT (pAktSer-473 Cat no. 4051, pAktThr-308 Cat no.2965),
total AKT (Cat no. 9272), -actin (1:40000 Abcam, Cambridge, MA, USA, Cat no. 6276), fatty
acid synthase (FAS 1:2000 Cat no. 3138), acetyl-coA carboxylase 1 (ACC1 1:2000 Cat no.
3676), phosphoenol pyruvate carboxykinase (PEPCK Cat no. 12940), forkhead box O1 (FOXO1
Cat no. 9454), PGC-1 (Abcam, Cat no. 54481) or glucose-6-phosphatase (G6Pase, Abcam, Cat
no. 83690). Insulins ability to phosphorylate Akt was calculated as the ratio of insulin-
stimulated pAkt: vehicle pAkt for rats from the same cage. Membranes were then incubated
with secondary anti-rabbit (1:10,000, Cat no. 7074) or anti-mouse (1:2000, Cat no. 7076). Bands
were visualized with enhanced chemiluminescence (Bio-Rad, Hercules, CA), and imaged using
the chemidoc MP imager (Bio-Rad, Hercules, CA). Imagelab software version 5.1 was used to
determine background-subtracted band density.
Immunofluorescence to detect pancreatic beta cell proliferation. Embedded pancreatic tissues
were mounted onto slides and deparaffinised. All antibodies were purchased from Cell
Signalling (Danvers, MA, USA). Sequential double immunofluorescence was performed for Ki-
67 (1:400) and insulin (1:800). ProLong Gold Anti-fade with DAPI (Cell Signalling, Danvers,
MA, USA) was used as counterstain. Images of four islets per section were captured (Leica
26
DML compound microscope, Leica Microsystems Inc., Richmond Hill, ON). A technician,
blinded to treatment, counted Ki-67-positive -cells from a minimum of 1500 -cells per sample.
Immunofluorescence to detect pancreatic beta cell apoptosis. Apoptotic beta cells were counted
following sequential double immunofluorescence using the DeadEnd Fluorometric TUNEL
System (Promega Corp., Madison, WI) and insulin, as described above.
Statistical Analysis. ANOVA using PROC GLM of SAS according to the model Y ijk= u. +
blocki + fatj + Sek + fat*sejk + ijk where i =1 to 17, j=1 to 2, and k = 1 to 3. Data are presented as
means standard error unless there are missing data points, in which case least-square means are
presented. Linear effects of Se within LF or HF diets were determined by pre-planned orthogonal
contrasts using coefficients matched to dose with PROC IML of SAS. Effects of supra-
nutritional (SN) Se (0.5 and 2.0 ppm) versus requirement (0.25 ppm) were estimated by pre-
planned orthogonal contrasts on LF and HF diets separately. P-values less than 0.05 denote
significant effects while P-values between 0.05 and 0.1 are considered trends. We randomly
assigned 36 rats per diet, intending to have 12 rats per procedure for 80% power to detect an
insulin sensitivity difference of 10% (1.43mg/kg/min) with P < 0.05.
2.4. Results
Body weight gains were not altered by Se or fat intake, as intended with pair-feeding
(Table A1.2). From 0.25 to 2.0 ppm Se intake, hepatic Se content increased by 96% and 1.1-fold
on LF and HF diets, respectively (Table 2.2). However, hepatic expression of SeP and GPx was
not affected by Se content (Fig.2.1A). Hepatic total glutathione (GSH) decreased 14% with HF
intake (P < 0.001) but was unaffected by Se. Oxidized glutathione (GSSG) percentage decreased
linearly by 15% with increasing Se on HF diets (P = 0.012) (Table 2.3).
27
Table 2.2. Hepatic mineral content on a dry matter basis, triacylglycerol (TAG) content and
plasma TAG concentration
Diet
0.25LF 0.5LF 2.0LF 0.25HF 0.5HF 2.0HF
Chromium 1.190.21 1.40.17 1.360.20 1.410.20 1.310.20 1.410.20

(ppm)
Selenium 2.90.37 3.180.29 5.680.35 2.490.35 3.060.35* 5.250.35*
(ppm)*
Liver TAG 13.27.5 17.66.6 22.18.1 18.97.5 27.87.5 31.96.6
(mol/g wet
tissue)
Plasma TAG 79.115.1 70.013.5 37.716.1 51.514.2 40.914.2 28.114.2
(mg/dl)
Data are the least-square means standard error; N=7. Low-fat (LF) and high-fat (HF) diets
providing 10% or 60% of kilocalories from fat, respectively, were formulated to contain either
0.25, 0.5 or 2.0 ppm of selenium from enriched- milk casein supplying 20% of kilocalories.
* P<0.001 for linear effect on LF and HF; P<0.001 for supra-nutritional intake (0.5 and 2.0 ppm)
versus requirement (0.25ppm) on HF. P<0.05 for supra-nutritional intake (0.5 and 2.0 ppm)
versus requirement (0.25ppm) on LF. P<0.10 for HF versus LF; P<0.10 for linear effects on LF.
Table 2.3. Hepatic total (GSH), oxidized (GSSG) and percent oxidized glutathione (% GSSG)
Diet
0.25LF 0.5LF 2.0LF 0.25HF 0.5HF 2.0HF
GSH * 3.100.12 3.220.11 3.160.12 2.650.14 2.720.12 2.790.11

GSSG 1.540.09 1.630.08 1.530.09 1.630.10 1.440.09 1.440.08
%GSSG * 49.72.01 50.71.84 48.71.98 60.92.26 53.01.98 51.71.85
Data are least-square means standard error; N=17. Low-fat (LF) and high-fat (HF) diets
providing 10% or 60% of kilocalories from fat, respectively, were formulated to contain either
0.25, 0.5 or 2.0 ppm of selenium from enriched- milk casein supplying 20% of kilocalories. *
P<0.001 for HF versus LF; P<0.05 for linear effects on HF; P<0.05 for supra-nutritional intake
(0.5 and 2.0 ppm) versus requirement (0.25ppm) on HF.
28
Liver TAG content was unaffected by diet while plasma TAG concentrations tended to
be 35% lower on HF diets compared to LF diets (P = 0.071) and decreased linearly by 52% with
increasing Se from 0.25HF to 2.0HF (P = 0.056) (Table 2.2).
Increasing Se content decreased GIR and increased EGP on LF diets
Basal plasma glucose (P = 0.002) and insulin levels (P = 0.048) were elevated in HF
diets compared to LF diets (Fig. 2.2A, B). A trend for increased basal insulin concentration is
noted with increasing Se on HF (P = 0.099). Euglycemia was maintained during the clamp
period by exogenous glucose infusion sustaining the elevated blood glucose on HF diets
(P=0.085) (Fig. 2.2C). GIR was greatest on the 0.25LF diet at 15.1 1.32 mg/kg/min and
increasing Se to 2.0 ppm on LF diets caused a linear 22% decrease in GIR to 11.6 1.43
mg/kg/min (P=0.058) (Fig. 2.2D). GIR was lower on all HF diets compared to LF diets, with Se
having no impact on HF GIR. Supra-nutritional Se intake on HF diets increased basal EGP
(P=0.031) but had no effect on clamp EGP. Se increased clamp EGP linearly by 76% on LF diets
(P=0.054) (Fig.2.2E), while percent suppression of EGP was unaffected by fat or Se intake (Fig.
2.2F). Stimulation of PGU was unaffected by Se content or HF feeding.
29
Figure 2.2. Basal and hyperinsulinemic-euglycemic clamp parameters
A B Basal: PFat = 0.048; PLin HF = 0.099; PSN LF = 0.063

8 Basal: PFat = 0.002 Basal Clamp 12 Clamp: PLin HF = 0.071
Clamp: PFat = 0.085 Basal
7
10 Clamp
6
Plasma insulin (ng/ml)

Blood glucose (mM)
5 8
4 6
3
4
2
1 2
0 0
0.25LF 0.5LF 2.0LF 0.25HF 0.5HF 2.0HF 0.25LF 0.5LF 2.0LF 0.25HF 0.5HF 2.0HF
D
Diet
C
Diet
8 18
PFat = 0.085 PFat < 0.001
16 PLin LF = 0.058
7
14
6
Blood glucose (mM)
12
GIR (mg/kg/min)
5
10
4
8
3 6
0.25LF 0.5LF 2.0LF
2 4
0.25HF 0.5HF 2.0HF
1 2
0 0
10 20 30 40 50 60 70 80 90 0.25LF 0.5LF 2.0LF 0.25HF 0.5HF 2.0HF
Last 90 minutes of clamp (min) Diet
E Basal: PSN HF = 0.031 F

35 Clamp: PFat = 0.002 Basal 100
NS
PLin LF = 0.054 90
30 Clamp 80
% suppression of EGP
25 70
EGP (mg/kg/min)
20 60
50
15 40
10 30
20
5
10
0 0
0.25LF 0.5LF 2.0LF 0.25HF 0.5HF 2.0HF 0.25LF 0.5LF 2.0LF 0.25HF 0.5HF 2.0HF
Diet Diet
Data are least-square means standard error; N=12.
A: Blood glucose. B: Plasma insulin. C: Blood glucose during the last 90 minutes of the clamp
period. D: Glucose infusion rate. E: Endogenous glucose production during basal and during final
30 minutes of clamp period. F: Percent suppression of endogenous glucose production during final
30 minutes of clamp period.
30
PFat represents effects of HF compared to LF, PSN LF and PSN HF represent effects of supra-
nutritional (0.5 and 2.0 ppm Se) compared to requirement (0.25ppm Se) on LF and HF,
respectively. PLin LF and PLin HF represent linear effects of increasing Se intake on LF and HF,
respectively.
Hepatic gene expression of insulin signalling components, energy metabolism enzymes and
transcription factors
Due to the absence of Se effects on HF-feeding glucose flux in the clamp, hepatic gene
expression and protein abundance analyses were only performed on rats fed 0.25, 0.5 and 2.0
ppm Se on LF diets, using the 0.25HF diet as a HF control. Expression of IRS1 and IRS2 was
greatest on 0.25LF, with supra-nutritional Se intake decreasing expression (IRS1 P = 0.003;
IRS2 P = 0.03) (Fig.2.1B). HF feeding also decreased expression of IRS1 (P = 0.03) and tended
to decrease IRS2 (P = 0.09). The downstream PI3K-regulatory subunit decreased linearly with
increasing Se (P = 0.02), and supra-nutritional Se intake (P = 0.01), while the PI3K-catalytic
subunit expression tended to decrease (P = 0.08) (Fig. 2.1C).
No effects of Se or HF feeding were noted for the gluconeogenic enzymes PEPCK or
G6Pase (Fig. 2.1D), the lipogenic enzymes ACC1 or FAS (Fig. 2.1E), and the transcription
factors FOXO1a or SREBP-1c (Fig. 2.1F). HF feeding decreased expression of the transcription
factor PGC-1 (P=0.04) as did supra-nutritional Se intake (P=0.03).
Figure 2.1. Hepatic gene expression for low-fat (LF) diets containing 0.25, 0.5 and 2.0 ppm Se
relative to the high-fat diet containing 0.25ppm Se (0.25HF)
31
A B
3
2 SeP IRS1: PSN = 0.003
NS PFat = 0.031
GPx1 IRS1
IRS2: PSN = 0.027
Relative mRNA levels

2 PFat = 0.087 IRS2
1
1
0 0
C
0.25LF 0.5LF Diet 2.0LF 0.25HF
D 0.25LF 0.5LF
Diet
2.0LF 0.25HF
3 2 G6Pase
PI3k-reg: PSN = 0.01 NS
PLin = 0.021 PEPCK
PI3k-reg

PI3k-cat: PSN = 0.08

2 PI3k-cat
1
0 0
0.25LF 0.5LF 2.0LF 0.25HF 0.25LF 0.5LF 2.0LF 0.25HF
E F
Diet Diet
7 NS
4 PGC1: PFat = 0.042
6 ACC1 FOXO1a PSN = 0.027
5 3 PGC1
FAS
SREBP1c
4
2
3
2
1
1
0 0
Diet Diet
Data are means standard error; N=6.

A: SeP and GPx1. B: FOXO1a, PGC-1 and SREBP-1c. C: IRS1 and IRS2. D: PI3K-regulatory
and -catalytic subunits. E: G6Pase and PEPCK. F: ACC1 and FAS.
PFat represents effects of HF compared to LF, PSN represents effects of supra-nutritional (0.5 and
2.0 ppm Se) compared to requirement (0.25ppm Se), PLin represents linear effects of increasing
Se intake.
32
Protein abundance of insulin signalling pathway components
Supra-nutritional Se intake tended to decrease hepatic IRS2 (P=0.098) while HF feeding
tended to decrease hepatic IRS1 abundance (P=0.067) (Fig.2.3A). Total Akt abundance tended to
decrease linearly with increasing Se (P=0.071) and with supra-nutritional Se intake (P=0.077).
(Fig.2.3B). The insulin effect on hepatic Akt phosphorylation at Thr-308 decreased linearly by
73% with increasing Se content (P=0.030) (Fig. 2.3E).
Figure 2.3. Hepatic protein abundance on low-fat (LF) diets containing 0.25, 0.5 and 2.0 ppm Se
and the high-fat diet containing 0.25ppm Se (0.25HF) relative to -actin abundance.
33
F ref 0.25LF 0.5LF 2.0LF 0.25HF
E Thr-308: PLin = 0.03

G6Pase
Ser-473 Thr-308
-actin
3
Ratio of pAkt/total insulin:
PLin = 0.002
pAkt/total vehicle
1
PSN = 0.008
2
Arbitrary Units
0.5
1
0 0
Diet Diet
G ref 0.25LF 0.5LF 2.0LF 0.25HF H 0.25LF 0.5LF 2.0LF 0.25HF
PEPCK FAS
-actin -actin
ref - - - - Insulin
NS
4
2
PFat = 0.051
3
Arbitrary Units
Arbitrary Units
2 1
*
1
0 0
Diet Diet
I 0.25LF 0.5LF 2.0LF 0.25HF

ACC1 J 0.25LF 0.5LF 2.0LF 0.25HF
-actin FOXO1
ref - - - - Insulin -actin
NS 1.5 ref + - + - + - + - Insulin
1
PFat <0.001
Arbitrary Units
1
Arbitrary Units
0.5
0.5
0 0
0.25LF 0.5LF 2.0LF 0.25HF 0.25LF 0.5LF Diet 2.0LF 0.25HF
Diet
34
A: Mean of vehicle and insulin-stimulated total Akt. B: Mean of vehicle and insulin-stimulated
IRS1 and IRS2. C: Phosphorylation of Akt at Thr-308 relative to total Akt. D: Phosphorylation
of Akt at Ser-473 relative to total Akt. E: The ability for insulin to stimulate phosphorylation of
Akt at Thr-308 and Ser-473. F: G6Pase. G: PEPCK. H: ACC1. I: FAS. J: FOXO1. K: PGC-1.
PFat represents effects of HF compared to LF, PSN represents effects of supra-nutritional (0.5 and
2.0 ppm Se) compared to requirement (0.25ppm Se), PLin represents linear effects of increasing
Se intake.
Similar effects were noted in adipose tissue, where the insulin effect on Akt
phosphorylation at Thr-308 decreased linearly by 37% with increasing Se content (P = 0.044)
and with supra-nutritional intake on LF diets (P=0.017). In addition, HF diets had 42% higher
total Akt than LF diets (P = 0.029) (Fig.2.4).
In soleus muscle, supra-nutritional Se decreased total Akt on LF (P<0.001) and HF diets
(P<0.001) while tending to decrease insulin-stimulated phosphorylation of Akt at Thr-308 (P =
0.099) on LF diets (Fig. 2.5). The ability for insulin to phosphorylate Akt at Thr-308 (P=0.04)
and Ser-473 (P=0.09) was decreased by HF intake. Increasing Se on HF diets caused a 3.2-fold
linear increase in the insulin effect on Thr-308 phosphorylation (P=0.004).
35
Figure 2.4. Protein abundance on low-(LF) and high-fat (HF) diets containing 0.25, 0.5 and 2.0
ppm Se in omental adipose tissue relative to -actin
A: Total Akt B: Vehicle and insulin-stimulated phosphorylation of Akt at Thr-308 relative to

total Akt. C: Vehicle and insulin-stimulated phosphorylation of Akt at Ser-473 relative to total
Akt. D: The ability for insulin to stimulate phosphorylation of Akt at Thr-308 and Ser-473.
respectively.
36
ppm Se in soleus muscle relative to GAPDH

respectively.
37
ppm Se in gastrocnemius muscle relative to GAPDH

respectively.
38
In gastrocnemius muscle, supra-nutritional Se intake decreased total Akt on LF (P=0.034)
and HF diets (P=0.017) (Fig.2.6). Increasing Se on HF diets linearly decreased the insulin-
stimulated phosphorylation of Akt at Thr-308 (P=0.013) and the ability for insulin to
phosphorylate Akt at Thr-308 (P=0.036).
Protein abundance of hepatic gluconeogenic and lipogenic enzymes
Of the gluconeogenic enzymes, G6Pase decreased linearly with increasing Se (P = 0.002)
and supra-nutritional intake (P = 0.008) (Fig. 2.3F). Of the lipogenic enzymes, FAS was
decreased by HF intake (P = 0.051) but was unaffected by Se (Fig. 2.3H).
Protein abundance of hepatic transcription factors
HF intake decreased FOXO1 (P < 0.001) and tended to decrease PGC-1 (P=0.091)
abundance (Fig. 2.3J and K).
Beta-cell proliferation and apoptosis
Pancreatic -cell proliferation was unaffected by Se content or fat intake (Fig.2.7). A
positive control was used in the TUNEL assay to detect apoptotic cells, but none were detected
in -cells of the pancreas slices on any of the treatments.
39
Figure 2.7. Percent of proliferating pancreatic beta-cells
A: Pancreatic insulin-positive cells (green) undergoing proliferation detected as Ki-67-positive
cells (red). DAPI-stained nuclei are blue. Arrows indicate cells counted as positive.
B: Ki-67 positive cells per insulin- and DAPI-positive cell.

Data are means standard error; N = 8.
40
2.5. Discussion
The objective of this study was to characterize the effects of organic Se supplementation
on insulin sensitivity when given in the form of selenized milk casein at 1, 2 and 8 times the Se
requirement. These levels were administered in LF and diabetes-promoting HF diets to test for
potential impairment or enhancement of insulin sensitivity, respectively, given that both pro- and
anti-diabetic effects of Se have been reported previously (Becker et al., 1996; Hei et al., 1998;
Mueller et al., 2009; Sheng et al., 2005; Wang et al., 2014). Increased EGP during the
hyperinsulinemic-euglycemic clamp revealed a linear reduction in hepatic insulin sensitivity with
increasing Se content on LF diets, while decreased GIR and elevated EGP on all three HF diets
demonstrated impaired hepatic insulin sensitivity on all three HF diets, regardless of Se level.
Although insulin signalling to Akt at the Thr-308 site in peripheral tissues was negatively
affected by Se on both LF and HF diets, the stimulation of PGU was not affected indicating no
change in total peripheral insulin sensitivity. These results led us to look for mechanisms
underlying Se-induced hepatic insulin resistance by analyzing gene expression and protein
abundances of insulin signaling pathway components in livers of rats fed the three LF diets,
using the 0.25HF diet as an insulin-resistant control.
Consistent with lower hepatic insulin sensitivity on high-Se, LF diets, we found
decreased hepatic expression of IRS1, IRS2 and the regulatory and catalytic subunits of PI3K.
Protein abundances of IRS2 and total Akt also tended to decrease, as did the ability for insulin to
stimulate Akt phosphorylation at the Thr-308 site, suggesting Se from selenized casein impairs
hepatic insulin sensitivity by decreasing expression of components of the signaling cascade.
Increasing dietary Se from 0.1 to 0.2 ppm with inorganic sodium selenite has been shown to
reduce hepatic insulin sensitivity and decrease Akt phosphorylation state in the liver (Wang et
41
al., 2014), while 5 mol/kg injections of selenite (~0.6 ppm dietary Se) decreased total hepatic
PI3K protein and increased PI3K phosphorylation in diabetic mice (Hwang et al., 2007).
However, to our knowledge, our finding of a decreased capacity for hepatic insulin signalling
upstream of Akt in response to supra-nutritional organic Se supplementation is novel and has not
been reported previously.
Phosphorylated Akt counteracts the fasting-induced transcriptional upregulation of the
gluconeogenic enzymes PEPCK and G6Pase to decrease hepatic glucose output (Postic et al.,
2004). Glucagon activates transcription of PGC-1, which then acts as a coactivator of
gluconeogenic gene expression, along with FOXO1, hepatocyte nuclear factor-4 (HNF4), and
the glucocorticoid receptor complex (Desvergne et al., 2006). Akt-mediated phosphorylation of
PGC-1 and FOXO1 leads to their exclusion from the nucleus, thereby decreasing
gluconeogenic gene expression (Li et al., 2007; Puigserver et al., 2003). Although PGC-1 is a
stimulator of gluconeogenic gene expression, we found that the high-Se and HF diets on which
EGP was hyper-activated also exhibited lower hepatic PGC-1 expression. This paradoxical
effect of fat feeding has been noted several times previously (Hirschey et al., 2011; Wang et al.,
2011) and may be related to the alternative role of PGC-1 in stimulating mitochondrial
biogenesis (Lustig et al., 2011). Mitochondrial oxidative fluxes are decreased by 3 days of HF
feeding, and rescued by liver-specific overexpression of PGC-1 (Morris et al., 2013). Thus, the
control of oxidative ATP production from energy-dense fatty acids may provide a reason for
PGC-1 down-regulation. Similarly, hepatic steatosis and fatty acid oxidation induced by dietary
Se (Mueller et al., 2009; Wang et al., 2014) may contribute to down-regulation of PGC-1
expression. In our study, liver fat content was not significantly altered by HF, likely due to the
pair-feeding protocol, or Se content but there was a negative correlation (r = -0.37. P < 0.05)
42
between PGC-1 mRNA level and liver TAG concentration, similar to that reported elsewhere
(Estall et al., 2009; Morris et al., 2013). Down-regulation of PGC-1 expression on either high-
Se or HF diets may be responsible for the impaired insulin signalling we observed. Additions of
either selenized casein or fat to the diet affected PGC-1, IRS1, IRS2, and PI3K expression
similarly. When liver-specific PGC-1 expression was knocked down insulin stimulation of Akt
phosphorylation decreased (Estall et al., 2009). If both high-Se and HF diets interfere with
hepatic insulin signalling via PGC-1 down-regulation, the redundancy can account for the
absence of Se effects on hepatic glucose fluxes on HF diets.
Supra-nutritional Se decreased the insulin suppression of EGP without increasing PEPCK
and G6Pase expression. Similarly, hepatic PGC-1 knockdown impaired insulin signalling with
no increase in PEPCK or G6Pase expression (Estall et al., 2009). Higher EGP after fat feeding
was not accompanied by higher expression of PEPCK and G6Pase, consistent with previous
findings (Jin et al., 2013; Lam et al., 2003; Song et al., 2001). Jin et al., (2013) pointed out that
gluconeogenic gene expression often does not match with gluconeogenic flux because net
glucose production is a consequence of substrate cycling through reactions promoting
gluconeogenesis and glycolysis simultaneously. Additionally, intermediates of fatty acid
catabolism can increase gluconeogenic flux by allosteric means without changing gluconeogenic
gene expression (Cotter et al., 2014; Lam et al., 2003). Thus, it is possible that facilitation of
hepatic fat oxidation by high-Se (Wang et al., 2014), and HF diets not only was responsible for
PGC-1 down-regulation and reduced insulin signalling capacity, but also contributed to
allosteric activation of gluconeogenesis.
The mechanism by which Se oversupply is detected by hepatocytes remains to be
determined. Because selenoproteins generally carry out anti-oxidative functions, ROS have been
43
investigated as potential effectors of insulin signalling. Both low and high intracellular
concentrations of ROS have been blamed for insulin resistance because, on the one hand, an
oxidative burst is required for insulin signaling (McClung et al., 2004) and, on the other hand,
oxidative stress interferes with insulin signaling (Wang et al., 2014). Mueller et al., (2009)
suggested that increased GPx expression due to inorganic Se supplementation was responsible
for an increased oxidation state of hepatic glutathione, leading to less inhibitory glutathionylation
of protein tyrosine phosphatase 1B (PTP1B) that dephosphorylates and inactivates IRS1 and
IRS2. However, we found no differences in hepatic expression of the selenoproteins SeP or
GPx1, nor was there an effect of Se on total GSH or an increase in GSSG%, indicating that
PTP1B glutathionylation is likely not the mechanism by which Se-enriched casein impairs
insulin signalling. Hepatic SeP over-expression has been shown to decrease hepatic insulin
sensitivity and reduce AMPK activity, leading to decreased ACC activity in hepatocytes (Misu et
al., 2010), yet we found no change in SeP or ACC expression or hepatic TAG and therefore
suspect our results are also not due to changes in SeP. In fact, supra-nutritional supplementation
of Se, by definition, is above the dietary requirement to maximize synthesis of selenoproteins.
Barnes et al., (2009) showed that hepatic mRNA expression levels of SeP and GPx in rats were
maximized at 0.075 and 0.1 ppm dietary Se, respectively, while our lowest Se concentration was
0.25 ppm. Thus, the insulin resistance effects we found were not related to selenoprotein
expression levels. Furthermore, the changes in expression and abundance of insulin signaling
compounds that we observed indicate long-term changes in the capacity for insulin signaling.
Rather than short-term, selenoprotein-mediated changes in intracellular ROS concentrations or
AMPK activity, we propose that hepatic insulin resistance from chronic feeding of Se-enriched
casein is due to direct effects of SeMet, SeCys or intermediates of their catabolism. We propose
44
that the Se metabolites stimulate hepatic fat oxidation, leading to down-regulation of PGC-1
expression and a subsequent decrease in expression of insulin signaling compounds upstream of
Akt.
2.6. Conclusions
Whether supra-nutritional Se in an organic form is anti-diabetic or pro-diabetic has
important implications for its use in cancer therapy. Our findings clearly establish, for the first
time, that supra-nutritional selenium intake up to 8x the requirement in the form of enriched milk
casein impaired hepatic insulin sensitivity on low-fat diets via decreased expression of IRS, PI3K
and Akt, and decreased insulin-stimulated phosphorylation of Akt at Thr-308. High-fat feeding
caused a similar impairment of insulin signalling and EGP with no further impact of Se. Both fat
and Se decreased hepatic PGC-1 expression, which may have been responsible for the
depressed insulin signaling. The Se effects were not due to changes in selenoprotein expression
or glutathione oxidation state. Although supra-nutritional intake of Se is of interest for its anti-
oxidant and anti-cancer benefits, supra-nutritional intakes at 2 and 8 times the requirement via
enriched milk casein has similar negative effects on hepatic insulin sensitivity as consuming a
high-fat diet. This finding is an important contraindication for the use of dietary Se in the
treatment and prevention of cancer.
45
CHAPTER 3
3.0. Carbohydrate components of milk and insulin sensitivity
Galactose, but not prebiotic galacto-oligosaccharides, improves insulin sensitivity in male
Sprague-Dawley rats
3.1. Abstract
Background: Elevated glucose and fructose intakes are associated with insulin resistance.
Galactose is readily converted to glycogen in the liver; however its effects on insulin sensitivity
have not been assessed. Prebiotic oligosaccharides alter gut microbiota and can influence host
metabolism.
Objective: Our objective was to assess the effect of 15% dietary inclusion of galactose compared
to glucose and fructose as well as galacto-oligosaccharides compared to methylcellulose on
insulin sensitivity.
Methods: Diets designed to contain 15% of dry matter from glucose, fructose, galactose, galacto-
oligosaccharides, or methylcellulose were fed to 36 rats per diet for 9 weeks. The
hyperinsulinemic-euglycemic clamp with [3-3H]- glucose infusion and steady-state 2-[1-14C]-
deoxyglucose bolus was used to assess insulin sensitivity and glucose distribution. Tissue was
collected in fed, fasted and fasted insulin-stimulated states.
Results: Galactose increased glucose infusion rate by 53% and decreased endogenous glucose
production by 57% compared to the combined effects of glucose and fructose. Fed-state hepatic
glycogen content was greater with galactose compared to glucose and fructose, supported by
increased hepatic glycogen synthase. Galactose decreased the fecal Firmicutes:bacteroidetes ratio
46
while GOS increased fecal Bifidobacterium 451-fold compared to MC, and also increased
Lactobacillus and bacteroidetes. GOS tended to increase proximal colon expression of mucin 3
and GLUT2.
Conclusions: Galactose at 15% of daily intake improved hepatic insulin sensitivity in rats
compared to glucose and fructose. Galactose caused an increase in fed-state hepatic glycogen
content and a favourable shift in gut microbial populations. Intake of galacto-oligosaccharides
improved the gut microbial profile but did not improve insulin sensitivity.
3.2. Introduction
Epidemiological studies assessing dairy product consumption by questionnaire (Pereira et
al., 2002, Mennen et al., 2000) and biomarker analyses (Mozaffarian et al., 2010) have linked
increased dairy consumption with decreased markers of metabolic syndrome. Similarly, type 2
diabetes risk is decreased by 9% and 4% in men (Choi et al., 2005) and women (Liu et al., 2006),
respectively, with each additional serving of low-fat dairy products per day. Some studies
demonstrate accelerated weight and fat loss in obese and overweight individuals consuming
dairy products (Zemel et al., 2004, Josse et al., 2011), while others show no effect (Bowen et al.,
2005). Elucidating the mechanisms by which specific milk components exert these effects could
lead to the development of novel dairy products with the potential for use in the treatment or
prevention of type 2 diabetes.
Many components of milk may contribute to its anti-diabetic effect. Whey protein in the
diet improves glucose tolerance which has been attributed to the insulinotropic effects of
increased GLP-1 secretion (Jakubowicz et al., 2014) and amino acid absorption (Nilsson et al.,
2007). Dairy calcium improves glucose tolerance to a greater extent than elemental calcium (de
47
Angel et al., 2009) while dietary trans-palmitoleate, a monounsaturated fatty acid existing
exclusively in ruminant products, is negatively correlated with insulin resistance and
dyslipidemia (Mozaffarian et al., 2010). The milk sugars, lactose and galacto-oligosaccharides,
have been studied little in the context of insulin sensitivity.
Estimates of food consumption from 1997 suggested that average North American
fructose consumption accounted for 16% of daily energy intake (Elliot et al., 2002), while the
WHO (2015) recommends not to exceed 10% of daily energy intake from simple sugars.
Chronically high intakes of glucose and fructose have long been linked to disorders in insulin
sensitivity, partially explained by pancreatic -cell failure (Kasuga 2006) and high lipogenicity
(Basciano et al., 2005), respectively. Galactose, a monomer of the lactose disaccharide, is a
dietary alternative to glucose and fructose that passes into hepatic glycogen upon absorption
(Barosa et al., 2012) which may impact glucose utilization and insulin sensitivity, although these
effects have not yet been studied, to our knowledge.
Human breast milk oligosaccharides are essential for favourable development of gut
microbiota in infants (Bode, 2012) therefore a majority of research into bovine milk
oligosaccharides is directed towards assessing their ability to mimic the human forms in infant
formulas. Galacto-oligosaccharides can be synthesized via chemical processing of lactose in
vitro and have been shown to increase beneficial colonic Bifidobacterium and Lactobacillus spp.
in vivo (Hernandez-Hernandez et al., 2012). These favourable shifts in gut microbiota can
improve hepatic metabolism and insulin sensitivity in the host by altering colonic short-chain
fatty acid production, gut peptide secretion and gut barrier function (Geurts et al., 2014).
48
The objective of our study was to evaluate effects on insulin sensitivity of galactose in
comparison to glucose and fructose, and galacto-oligosaccharides in comparison to
methylcellulose, when consumed at 15% of otherwise identical diets. We hypothesized that
galactose would result in greater insulin sensitivity than glucose and fructose due to its lower
lipogenicity and propensity to be stored as glycogen. Galacto-oligosaccharide intake was
expected to improve gut microbial profile by increasing bifidobacteria and decreasing
Firmicutes, leading to improvements in hepatic insulin sensitivity.
3.3. Materials and Methods
All animal procedures were approved by the Animal Care Committee of the University of
Guelph.
Rat feeding and housing. 180 male Sprague-Dawley rats were acquired from Charles River
Laboratories (Toronto, ON) at 225 to 250g body weight in blocks of 24 rats. They were housed
in groups of three in a climate-controlled room at approximately 22C and 80% humidity with a
12-hour light/dark cycle and ad libitum access to water. Each group was fed one of five diets for
nine weeks. Weekly body weights were recorded. In the ninth week, one rat per cage was used
for the hyperinsulinemic-euglycemic clamp procedure while the remaining two were used for
tissue collection.
Rat diets. Rodent diets were formulated by Research Diets, Inc. (New Brunswick, NJ) to provide
35% of kcal from fat and 15% of the dry matter from glucose (GLC), fructose (FRC), galactose
(GAL), galacto-oligosaccharides (GOS; Cremar, Seoul, South Korea) or methylcellulose (MC;
Table 3.1).
49
Table 3.1. Ingredient composition (g) of experimental diets
Diet
GLC FRC GAL GOS MC
Casein 200 200 200 200 200

Corn Starch 210 210 210 210 210
Maltodextrin 100 100 100 100 100
Soybean Oil 25 25 25 25 25
Lard 133 133 133 133 133
Dextrose 137 0 0 0 0
Fructose 0 137 0 0 0
Galactose 0 0 137 0 0
Galacto- 0 0 0 137 0
oligosaccharides
Methylcellulose 0 0 0 0 137
Jugular vein and carotid artery catheterization. Under isoflurane general anesthesia and local
anesthesia (50:50 solution of 0.2% lidocaine and 0.5% bupivacaine 1ml/kg s.c.), catheters were
inserted into the right jugular vein and advanced to the right atrium. The catheter consisted of a
~1.5-cm portion of silastic tubing (ID 0.51mm, OD 0.94mm, Dow Corning, Midland, MI) for
inside the vessel, linked to a ~25-cm portion of polyethylene tubing for outside the vessel (Clay
Adams PE-50, ID 0.58 mm, OD 0.965 mm, Becton Dickinson, East Rutherford, NJ). An
identical catheter was inserted into the left carotid artery and advanced to the aortic arch. Three
silk suture knots were used to secure the catheters in the vessels. The catheters were then
tunnelled subcutaneously to the dorsal side of the neck and anchored in place. Catheters were
50
locked with a 50:50 glycerol:heparin solution and flushed two days after surgery. The analgesic
meloxicam (1 mg/kg s.c.) was given prior to surgery and 24 hours after surgery.
Hyperinsulinemic-Euglycemic Clamp. Rats were given 3 days to recover from the catheterization
surgery before undergoing the hyperinsulinemic-euglycemic clamp. Those that lost more than
5% of body weight after surgery were not used in the clamp. Clamps were performed on
overnight-fasted, conscious rats. The basal period (-90 to 0 minutes) involved a primed, jugular
infusion of 0.4 Ci/kg/min [3-3H] glucose (Perkin-Elmer, Waltham, MA) to quantify basal
endogenous glucose production (EGP). Blood was drawn from the carotid artery to measure
glucose concentration every 10 minutes during the last 30 to 40 minutes (OneTouch UltraBlue 2,
LifeScan Canada, Burnaby, BC). Approximately 100 l blood was collected into heparin-
containing tubes for future quantification of tracer and insulin.
The clamp period (0 to ~120 minutes) began with an insulin bolus of 20 mU/kg/min for 2
minutes (porcine insulin, Sigma, St-Louis, MO) followed by a continuous jugular infusion of 4
mU/kg/min insulin and 0.8 Ci/kg/min of [3-3H] glucose. A 25% D-glucose solution was infused
at variable rates adjusted every 10 minutes to clamp blood glucose at basal levels. Once blood
glucose and glucose infusion rates (GIR) were stable for 30 minutes, a 40-Ci bolus of 2-[1-
C]-deoxyglucose (2-DOG; Perkin Elmer, Waltham, MA) was infused through the venous
14
catheter. Subsequent blood samples of 80 l were taken at 7, 10, 15, 20 and 30 minutes in
heparin-containing tubes. Difference in hematocrit between basal and clamp periods was used to
disprove anemia due to excessive blood sampling, with less than 10% difference considered
acceptable. Plasma was stored at -20C until further analysis. Rats were anaesthetized by i.v.
pentobarbital infusion prior to in situ tissue collection of gastrocnemius and soleus muscle,
51
omental adipose tissue, diaphragm, interscapular brown adipose tissue, brain and heart. Tissue
samples were snap-frozen in liquid N2 and stored at -80C until further analysis.
Tissue glucose uptake. Tissue samples were homogenized in 0.5% perchloric acid and
centrifuged at 2000 g for 20 minutes. Neutralized supernatant radioactivity was measured for
total activity in 2-DOG and 2-DOG phosphate. Radioactivity in 2-DOG was measured after
deproteinization by barium hydroxide and zinc sulfate (Sigma, St-Louis, MO). Tissue [2-
14
C]DOG phosphate was calculated as the difference between total and 2-DOG activity.
Glucose uptake index (Rg) (mM*mg-1*min-1) was calculated as:
[2- 14C]DOG phosphatetissue

glucoseplasma
AUC 2-14C DOGplasma
where glucoseplasma is the average concentration of plasma glucose after 2-DOG injection, and
area under the curve (AUC [2-14C]DOGplasma) was estimated from fits of the dual-exponential
equation A1e k1t A 2e k 2 t to measured [2-14C]DOG counts at time points t up to the last
sample at tfinal, using the Solver function of Microsoft Office Excel 2007:
AUC 2-14C DOGplasma= A1 -k1 tfinal

k1 1-e +
A2 -k2 tfinal
k2 1-e .
Plasma Analysis. Heparinized plasma from basal and clamp periods was dried at 65C after
deproteinization by barium hydroxide and zinc sulfate (Sigma, St. Louis, MO). The tracers [3-
3
H]-glucose and [2-14C]DOG were counted in dried samples using Ultima Gold scintillation fluid
cocktail (Sigma, St. Louis, MO) and a Beckman LS6000 liquid scintillation counter (Beckman,
Brea, CA). Samples of infusates were also counted. Plasma insulin was quantified by enzyme-
linked immunosorbent assay (Crystal Chem, Downers Grove, IL).
52
Glucose Flux. Glucose fluxes (mmol/min) during the basal and clamp periods were calculated as
tracer infusion rate (dpm/min)/specific activity of plasma glucose (dpm/mmol) and adjusted for
body weight to yield glucose fluxes in mg/kg/min. EGP was calculated as glucose flux - GIR.
Percent suppression of EGP by insulin was calculated from the difference in EGP between clamp
and basal periods. A portion of the GIR compensates for EGP suppression and the remainder
compensates for stimulation of peripheral glucose utilization (PGU). Stimulation of PGU was
calculated as clamp glucose flux - basal glucose flux.
Fasted and fed state tissue collection. In situ tissue collection under pentobarbital anesthesia was
performed in fasted rats eight minutes after i.p. injection of either 10 U/kg porcine insulin or the
equivalent volume/kg of vehicle (saline). Liver tissue was snap-frozen in liquid N 2 and stored at -
80C until further analysis. Proximal colon (two centimetres of colon tissue distal to the ileocecal
junction) and liver tissue were collected three hours post-feeding.
Body composition. Carcasses from vehicle and insulin-stimulated rats were frozen before being
ground and dried at 65C for 72 hours to obtain moisture, crude protein and lipid (ether extract)
composition following AOAC procedures (AOAC, 1975).
Gene expression analysis. Proximal colon RNA, isolated via the TRIzol method, was reverse
transcribed (High Capacity cDNA Reverse Transcription Kit; Applied BioSystem, Waltham,
MA). Fecal DNA was isolated (MP Biomedicals FastDNA SPIN kit for feces) from fecal
samples collected during the 8th week from bedded cages. Primers (Table A2.1) were used in
qPCR (PerfeCta SYBR Green FastMix; Quanta BioScience, Gaithersburg, MD) with an Applied
Biosystems 7300 Real Time PCR instrument. Gene expression was analyzed by the 2-Ct
53
method (Kivak and Schmittgen, 2001) with -actin (liver) and universal bacterial gene (fecal) as
the reference genes and presented as fold-change relative to the MC diet.
Hepatic glycogen content- Hepatic glycogen content (galactosyl units (mg)/tissue (g)) from fed-
state, fasted vehicle and clamp rats was determined following methods of Liu et al. (2011),
calculated as the difference in glucose measurement by colorimetric assay (Sigma, St-Louis,
MO) with and without 2-hour 37C incubation with amyloglucosidase (EC 3.2.1.3. Sigma, St-
Louis, MO).
Western blotting. Protein concentration of homogenized liver was quantified by BCA assay
(Thermo Scientific, Waltham, MA). 20 g protein was loaded per well on 6 to 10% SDS-PAGE
gels, separated and transferred to nitrocellulose membranes. All primary antibodies were from
Cell Signalling (Danvers, MA, USA) and incubated at room temperature at 1:1000 unless
otherwise stated; total glycogen synthase (GS), phosphorylated GS (pGS), glycogen
phosphorylase (GP), and -actin (1:40,000). Insulins ability to suppress inhibitory
phosphorylation of GSK was calculated as the ratio of vehicle pGSK:insulin-stimulated pGSK
for rats in the same cage. Uncoupling protein 1 (UCP1) abundance in inter-scapular brown
adipose tissue (iBAT) was detected from 20 g protein to confirm the proportion of iBAT tissue
in the sample. Membranes were then incubated with secondary anti-rabbit (1:10,000) or anti-
mouse (1:2000). Bands were visualized with enhanced chemiluminescence (Bio-Rad, Hercules,
CA), and imaged using the chemidoc MP imager (Bio-Rad, Hercules, CA). Imagelab software
version 5.1 was used to determine background-subtracted band density.
Statistical Analysis. ANOVA using PROC GLM of SAS according to the model Y ijk= u. +
blocki + dietj + ij where i = 1 to 8 and j = 1 to 5. Normality was assessed using PROC
54
UNIVARIATE of SAS. If not normal, data were log-transformed to obtain P-values and
treatment differences. Least-square means were then exponent-transformed to present in tables.
Tukey adjustments were performed for treatment comparisons. Comparisons of GAL versus the
combined effects of GLC and FRC (P GAL V GF), as well as GOS versus MC (PO v MC), were
determined by orthogonal contrasts. Significance was declared at P < 0.05, while P-values
between 0.05 and 0.1 were considered trends. We randomly assigned 36 rats per diet, intending
to have 12 rats for the hyperinsulinemic-euglycemic clamp procedure for 80% power to detect an
insulin sensitivity difference of 10% (1.43 mg/kg/min) with P < 0.05.
3.4. Results
Body composition
After nine weeks of feeding, fat-free dry mass was unaffected by diet. However, body
weight was greatest with FRC consumption and significantly lower on GLC and MC treatments
(Table 3.2). FRC intake increased fat mass accumulation over GLC and GAL. GOS intake
significantly increased body weight, crude protein and fat masses as well as fat-free dry mass in
comparison to MC.
Table 3.2. Body weight, composition and fat-free dry mass (FFDM) of overnight fasted rats
Diet
GLC FRC GAL GOS MC PGal v GF PGos v MC
BW (g) 497 11.0b 551 15.6a 502 10.5ab 520 11.2ab 481 11.0b 0.16 0.02
CP dry (g) 99.3 2.5ab 105.5 2.9a 100.13.2ab 102.72.5ab 93.6 2.0b 0.49 0.01
Fat dry (g) 52.7 4.5b 79.5 3.9a 56.5 3.9b 64.7 6.7ab 50.9 4.0b 0.13 0.05
FFDM (g) 132.1 4.4 138.7 3.5 134.2 4.2 137.6 3.2 124.8 3.2 0.86 0.02
55
Data are means standard error; N>8. Values within a row with different letter superscripts are
significantly different (P<0.05). PGal v GF represents effects of galactose compared to glucose and
fructose. PGos v MC represents effects of galacto-oligosaccharides compared to methylcellulose.
Hyperinsulinemic-euglycemic clamp
MC intake lowered basal plasma insulin in comparison to GOS, GLC and FRC with no
difference in basal plasma glucose or glucose flux (Fig. 3.1). Steady-state GIR during the clamp
period was 53% greater with GAL treatment in comparison to the combined effects of GLC and
FRC, but did not differ from GOS and MC. EGP was 57% lower with GAL than GLC and FRC
with greater suppression by insulin. GOS and MC did not differ in any clamp period parameters.
56
Figure 3.1. Basal and hyperinsulinemic-euglycemic clamp parameters.
B
A 8
9 NS Basal Clamp Basal Clamp
8 7
7 6
Plasma insulin (ng/ml)

Blood glucose (mM)
6 5
5 4
4 *
3
3
2
2
1 1
0 0
GLC FRC GAL GOS MC GLC FRC GAL GOS MC
D
Diet Diet
C #
8 # * 25
**
7
20
6
Blood glucose (mM)
GIR (mg/kg/min)
5 15
4
3 10
2 GLC FRC GAL GOS MC

5
1
0 0
10 20 30 40 50 60 70 80 90 GLC FRC GAL GOS MC
F
Diet
E
Last 90 minutes of clamp (min)
140 *
14 Basal Clamp
120 % EGP suppression
12
* % Periph stim
100
10
EGP (mg/kg/min)
8 80
60
%
6
4 40
2 20
0 0
GLC FRC GAL GOS MC GLC FRC GAL GOS MC
Diet Diet
Data are least-square means standard error; N>8. Diets contained 15% of dry matter as
glucose (GLC), fructose (FRC), galactose (GAL), galacto-oligosaccharides (GOS) and
methylcellulose (MC).
(A) Basal and clamp period blood glucose (mg/ml); (B) Basal and clamp period plasma insulin
(ng/ml); (C) Blood glucose during last 90 minutes of clamp *P<0.05 for GOS vs MS, #P<0.05
for GAL vs GF; (D) Glucose infusion rate (mg/kg/min); (E) Endogenous glucose production
(mg/kg/min); (F) % suppression of EGP and % peripheral stimulation
*P<0.05; **P<0.001
57
No differences were observed in Rg in response to dietary treatment (Table 3.3).
However, within all treatments, cardiac tissue and brown adipose tissue had the greatest glucose
uptake (Table 3.4). Soleus, gastrocnemius and diaphragm muscles as well as the brain had
similar glucose uptakes while omental white adipose had the lowest glucose uptake rate.
Table 3.3. Steady-state tissue glucose uptake index (Rg; (mM*mg-1*min-1)) from 2-[1-14C]-
deoxyglucose infusion
Diet
GLC FRC GAL GOS MC PGal v GF PGos vMC
Diaphragm 7.35 8.79 8.75 1.63 7.79 1.19 10.11 0.37 0.09
0.76 1.57 2.42
Soleus 3.10 2.98 2.62 0.43 1.93 0.58 2.74 0.72 0.94 0.06
0.64 1.11
Gastrocnemius 1.27 2.61 0.91 2.30 0.48 1.39 0.52 2.51 0.85 0.90 0.07
0.32
Heart 29.68 30.50 33.78 27.91 33.81 0.67 0.64
4.34 5.52 4.57 2.77 6.46
Omental 0.38 0.28 1.87 1.61 0.24 0.10 0.65 0.30 0.14 0.91
adipose 0.16 0.09
Brain 10.37 9.19 15.92 9.37 0.90 12.14 0.12 0.45
0.45 0.93 6.12 1.25
iBAT/UCP1* 23.92 38.2 48.45 32.06 42.12 0.47 0.64
10.15 20.33 19.45 11.77 15.86
Data are means standard error; N>7. Diets contained 15% of dry matter as glucose (GLC),
fructose (FRC), galactose (GAL), galacto-oligosaccharides (GOS) and methylcellulose (MC).
PGal v GF represents effects of galactose compared to glucose and fructose. PGos v MC represents
effects of galacto-oligosaccharides compared to methylcellulose.*Interscapular brown adipose
tissue divided by UCP1 expression detected by western blotting.
58
Table 3.4. Tissue glucose uptake (Rg) (mM*mg-1*min-1) across all dietary treatments
Tissue
Diaphragm Soleus Gastroc Heart WA Brain iBAT/UCP1*
8.53 0.63b 2.69 0.31b 1.99 0.27b 31.082.01a 0.36 0.07b 10.090.40b 34.86 8.22a
Values with different letter superscripts are significantly different (P<0.05). *Interscapular
brown adipose tissue divided by UCP1 expression detected by western blotting.
Fecal DNA analysis
Monosaccharide intake affected fecal abundance of Clostridium coccoides and
Firmicutes with GLC increasing abundance of both classes compared to FRC and GAL (Table
3.5). GAL lowered Firmicutes abundance by 17% and the ratio of Firmicutes: Bacteroidetes by
70% in comparison to the combined effects of GLC and FRC.
GOS increased Bifidobacteria spp. 481-fold, Bacteroidetes by 86%, and Lactobacillus
spp. 1.2-fold compared to intake of the non-digestible, non-fermentable MC. In addition, GOS
tended to increase Clostridium coccoides by 47% and decrease Enterobacteriaceae by 67% over
MC.
59
Table 3.5. Fecal DNA analysis of microbial populations
Diet
Bdetes 0.14 0.04c 0.27 0.10c 0.380.07 bc
1.93 0.46a 1.03 0.09b 0.34 0.007
Bifido 53.8 13.1b 59.3 10.1b 168.9122 1204 137a
b
2.5 0.89b 0.20 <0.0001
C. cocc 2.28 0.19a 1.51 0.13b 1.55 0.17b 1.50 0.20b 1.02 0.08b 0.04 0.08
Enterob 1.160.28ab 0.980.14ab 1.61 0.42a 0.38 0.12b 1.170.23ab 0.20 0.07
Firm 1.69 0.09a 1.37 0.05b 1.270.06bc 1.110.07bc 1.01 0.05c 0.001 0.17
Lbacil 0.900.17b 1.110.17ab 1.170.26ab 2.430.82a 1.090.15ab 0.61 0.02
Firm:Bdet 16.2 0.81 9.511.52
a ab
3.83 0.59 0.66 0.71 1.00 0.53
b c c
<0.001 0.64
es
PGal v GF represents effects of galactose compared to glucose and fructose. Values within a row
with different letter superscripts are significantly different (P<0.05). PGal v GF represents effects of
galactose compared to glucose and fructose. PGos v MC represents effects of galacto-
oligosaccharides compared to methylcellulose
Fed-state proximal colon gene expression
Fed-state proximal colon expression of Glut1 and Sglt1 were decreased by GAL
consumption compared to GLC and FRC, while expression of Glut2 tended to be increased
(Table 3.6). GOS intake tended to increase Glut2 and Mucin3 expression relative to MC.
60
Table 3.6. Proximal colon gene expression
Diet
Prog 0.11 0.84 0.40 0.78 0.88 0.56 0.77 0.54 0.3 0.84 0.11 0.41
Pc1 1.45 0.20 0.97 0.19 1.31 0.19 1.17 0.15 0.88 0.19 0.64 0.34
Pc2 2.75 0.32 0.85 0.31 1.59 0.31 1.21 0.25 0.71 0.31 0.90 0.26
Glut1 2.41 0.18 2.58 0.18 1.62 0.17 1.39 0.14 1.61 0.19 0.039 0.61
Glut2 4.51 0.69 3.95 0.66 16.5 0.66 6.9 0.54 0.89 0.92 0.08 0.09
Glut5 2.51 0.38 1.72 0.36 1.36 0.36 1.53 0.29 1.32 0.50 0.30 0.81
Sglt1 1.94 0.23 a
1.43 0.21 ab
0.98 0.22 1.07 0.18
b ab
1.22 0.30 ab
0.04 0.73
Mucin2 1.85 0.29 1.41 0.29 1.08 0.27 1.19 0.22 1.03 0.22 0.20 0.73
Mucin3 2.87 0.19a 1.32 0.18ab 1.91 0.19ab 1.55 0.15ab 0.90 0.22b 0.93 0.07
Mucin4 0.85 0.33 0.53 0.31 0.96 0.31 0.73 0.25 0.87 0.37 0.32 0.71
Data are least-square means standard error; N>6. Diets contained 15% of dry matter as glucose
(GLC), fructose (FRC), galactose (GAL), galacto-oligosaccharides (GOS) and methylcellulose
(MC). PGal v GF represents effects of galactose compared to glucose and fructose. Values within a
row with different letter superscripts are significantly different (P<0.05). PGal v GF represents
effects of galactose compared to glucose and fructose. PGos v MC represents effects of galacto-
oligosaccharides compared to methylcellulose
Hepatic glycogen content
Fasted- and clamp-state hepatic glycogen content (Table 3.7) did not differ with dietary
treatment. Three hours post-feeding hepatic glycogen content was 21% greater with GAL
compared to the combined effects of GLC and FRC intake. GOS intake tended to increase fed-
state glycogen content by 13% compared to MC.
Hepatic glycogen synthase and phosphorylase
Total hepatic glycogen phosphorylase abundance did not differ with dietary treatment
while total glycogen synthase tended to be decreased with GOS compared to MC (Table 3.8; Fig
3.2). Vehicle- and insulin-stimulated phosphorylation of glycogen synthase did not differ, but
61
insulins ability to suppress inhibitory phosphorylation of GS was significantly greater with GAL
compared to combined effects of GLC and FRC.
Table 3.7. Hepatic glycogen content (mg/g tissue) following the hyperinsulinemic-euglycemic
clamp, 3-hours post-feeding or an overnight fast
Diet
Clamp 61.9 1.05 82.0 0.66 57.7 0.84 56.6 1.10 46.5 2.18 0.38 0.99
Fed 34.0 3.63 41.5 4.00 55.1 4.01 58.5 4.95 45.9 4.21 0.05 0.08
Fasted 30.9 4.17 21.5 2.85 39.4 3.58 41.3 6.11 23.4 3.86 0.18 0.12
(MC). PGal v GF represents effects of galactose compared to glucose and fructose. PGal v GF
represents effects of galactose compared to glucose and fructose. PGos v MC represents effects of
galacto-oligosaccharides compared to methylcellulose
62
Table 3.8. Arbitrary units of hepatic vehicle and insulin-stimulated glycogen synthase (GS) and
glycogen phosphorylase (GP) protein abundance relative to -actin
Diet
Total GP 0.93 0.08 0.86 0.08 0.86 0.07 0.83 0.08 0.88 0.08 0.69 0.65
Total GS 0.83 0.15 0.69 0.17 1.02 0.14 0.59 0.17 0.97 0.16 0.13 0.07
pGS/total
Insulin 1.12 0.25 1.39 0.28 0.81 0.23 1.60 0.28 1.03 0.26 0.18 0.32
Vehicle 1.13 0.29 1.55 0.32 1.40 0.27 1.63 0.32 1.34 0.30 0.88 0.70
Insulin 0.97 0.11 0.86 0.12 1.11 0.10 1.28 0.12 0.82 0.11 0.053 0.86
effect
(MC). PGal v GF represents effects of galactose compared to glucose and fructose. PGal v GF
represents effects of galactose compared to glucose and fructose. PGos v MC represents effects of
galacto-oligosaccharides compared to methylcellulose
Figure 3.2. Representative western blots of phosphorylated glycogen synthase (pGS), total
glycogen synthase (GS), total glycogen phosphorylase (GP) and -actin detected in overnight
fasted vehicle and insulin-stimulated hepatic tissue.
63
3.5. Discussion
The objective of this study was to evaluate the effects of milk sugars on insulin
sensitivity when given at 15% of dry matter intake. Galactose, a monomer of the milk
disaccharide lactose, was compared to fructose and glucose, the monosaccharide moieties of the
plant disaccharide sucrose. Glucose catabolism is highly regulated in insulin-responsive tissues
through insulin activation, as well as intracellular ATP and citrate inhibition, of the glycolytic
enzyme phosphofructokinase (EC 2.7.1.11), preventing unnecessary, irreversible glucose
breakdown. In contrast, dietary fructose is exclusively catabolized in the liver where fructokinase
(EC 2.7.1.4) and aldolase (EC 4.1.2.13) split fructose into 2 triose phosphates, bypassing the
highly regulated phosphofructokinase step (Elliot et al., 2002) and yielding acetyl-CoA building
blocks for de novo lipogenesis more readily than glucose. Thus, high-fructose intake is a major
contributing factor to the obesity epidemic (Bray et al., 2004) and has been exploited to
experimentally create hypertriglyceridemia-induced insulin resistance (Zavaroni et al., 1980,
Thorburn et al., 1989).
Galactose is metabolized in the liver where epimerization to glucose occurs while
attached to UDP, yielding UDP-glucose. UDP-glucose is the immediate precursor for glycogen
synthesis and is not readily reversed through UDP-glucose pyrophosphorylase (EC 2.7.7.9) to
glucose-1-phosphate in vivo. Therefore, in order for galactose to contribute to blood glucose, it
must first enter into glycogen and then be released via glycogenolysis. As a consequence of this
pathway, which is perhaps one of the evolutionary advantages of GAL in milk sugars, virtually
100% of dietary GAL absorbed from the gastrointestinal tract is converted to hepatic glycogen
(Barosa et al., 2012). There is an upper limit to the concentration of glycogen that can be
maintained in hepatocytes (Ercan et al., 1994) so glycogen synthesis from GAL may reduce
64
incorporation of GLC into glycogen. Adding galactose to a diet can induce hyperglycemia
(Ramana et al., 2006) by sparing glucose from entry into glycogen, but isocaloric substitution of
galactose for glucose does not affect glycemia (Otsyula et al., 2003). Although inefficient hepatic
uptake of galactose from diets containing > 30% galactose leads to hypergalactosemia that is
used to mimic symptoms of diabetes (Kowluru et al., 2001), whether the preferential diversion of
GAL into hepatic glycogen influences the sensitivity of glucose flux to insulin has not been
investigated previously.
Here we report that isocaloric substitution of galactose for glucose or fructose, at 15% of
dietary dry matter, improved hepatic insulin sensitivity with no alteration in plasma glucose
concentration. Similarly, replacement of starch with 50% galactose did not affect plasma glucose
(Otsyula et al., 2003). To our knowledge, there has been little evaluation of the effect of
galactose on insulin sensitivity. Pantophlet et al. (2016) found no difference between glucose,
fructose or lactose consumed at 15% of dry matter intake by calves in the QUICKI index of
hepatic insulin sensitivity estimated from fasting plasma glucose and insulin concentrations. Our
study is the first to show, with the hyperinsulinemic-euglycemic clamp, that GAL can increase
hepatic insulin sensitivity. We also found increased hepatic glycogen content three-hours post-
feeding in response to GAL intake compared to GLC or FRC, which was associated with a GAL-
induced enhancement of the effect of insulin on the proportion of glycogen synthase (EC
2.4.1.11) in the non-phosphorylated, active state, and no change in glycogen phosphorylase (EC
2.4.1.1) abundance. Consistent with our results, oral gavage of galactose compared to glucose led
to faster hepatic glycogen accumulation (Kliegman and Morton, 1988) and prolonged activatory
dephosphorylation of glycogen synthase (Niewohner and Niel, 1992) in rats. Active glycogen
synthase is required for hepatic clearance of GAL from blood (Barosa et al., 2012) but it also
65
incorporates glucose-derived carbon into glycogen. It is possible that the more potent activation
of hepatic glycogen synthase during GAL treatment accounts for the increased hepatic insulin
sensitivity we observed.
Despite activation of glycogen synthase following galactose gavage in the experiment of
Niewohner and Niel (1992), hepatic glycogen accumulated more rapidly after a glucose dose and
it was suggested that the capacity for hepatic uridylation of galactose can be exceeded at high
doses of galactose, leading to hypergalactosemia and loss of galactose into urine. Inclusion of
galactose into diets at greater than 30% of dry matter content induces hypergalactosemia and
symptoms of diabetes. Thus, the improvement in hepatic insulin sensitivity from galactose
consumed at 15% of dry matter intake may not be maintained at higher galactose intakes.
To our knowledge, this is the first study showing prebiotic effects of GAL. There were
decreases in fecal C. coccoides and total Firmicutes counts and the Firmicutes: Bacteriodetes
ratio in comparison to GLC and FRC. A high Firmicutes:Bacteriodetes ratio is associated with
obesity, and prebiotic fibres decrease the ratio, resulting in higher circulating GLP-1 (Parnell and
Reimer, 2012). The tendency for GAL to increase colonic proglucagon expression may provide a
link between prebiotic effects and improved insulin sensitivity although basal plasma insulin was
not affected.
In contrast to GAL, GOS are indigestible but exert prebiotic effects, which can increase
colonic short-chain fatty acid production (Knol et al., 2004) and ameliorate high-fat diet induced
endotoxemia, thereby improving inflammatory status and glucose tolerance (Tuohy et al., 2005,
Cani et al., 2007). In this study, the effects of GOS intake were compared to methylcellulose
66
which serves as a negative control since it is indigestible, but also non-fermentable, while GOS
is indigestible and fermentable.
Prebiotic GOS decreased firmicutes while increasing bacteriodetes, bifidobacterium and
lactobacilli in comparison to MC. In particular, the bifidogenic effect is typical of
oligosaccharide intake (Geurts et al., 2014), with as little as 1% w/w dietary GOS synthesized
from lactulose resulting in a 9% increase in bifidobacteria (Marin-Manzano et al., 2013).
Bifidogenic effects are observed after just 7 days of 50 g/kg inulin intake with 21% increases in
comparison to cellulose (Paturi et al., 2012). This shift in microbial populations is associated
with increased GLP-1 secretion from intestinal L-cells and improved glucose tolerance (Cani et
al., 2005). Supplementing diets containing 72% of calories from fat with 10% oligofructose
improved hepatic insulin sensitivity via increased insulin-stimulated phosphorylation of IRS1
and Akt (Cani et al., 2006), with increased intestinal proglucagon expression and no effect on
peripheral insulin sensitivity. However, oligofructose supplementation on diets containing 58%
of calories from fat did not alter colonic proglucagon expression nor blood glucose or insulin
concentrations (Delmee et al., 2006). This anti-diabetic effect on only the highest of high-fat
diets may explain why the inclusion of 15% GOS in our diet providing just 35% kcal from fat
did not alter insulin sensitivity nor colonic proglucagon expression.
The tendencies for increased colonic GLUT2 and mucin 3 expression are evidence of a
functional response of the intestine to the prebiotic GOS at 15% of intake. Mucins, produced by
goblet cells, form a protective barrier layer on all mucosal surfaces. In the gastro-intestinal tract,
mucins 3 and 4 are membrane-bound, while mucin 2 is secreted and forms a gel-like barrier on
the apical side of intestinal epithelial cells (Corfield et al., 2000). Like us, Paturi et al. (2012)
reported that colonic mucin 3 expression increased with 5% dietary inulin while mucins 2 and 4
67
were unaffected. However, mice fed 5% GOS increased ileal mucin 2, but not mucin 4
expression (Leforestier et al., 2004). These GOS effects on intestinal barrier function may be
related to bifidogenesis or direct modulation of intestinal goblet cells by GOS (Bhatia et al.,
2015).
Despite improvements in colonic microbial profile, barrier function and proglucagon
expression, GOS had no effect on GIR, EGP or PGU during the clamp. Furthermore, GOS
tended to decrease glucose uptake indices in diaphragm, soleus and gastrocnemius muscles, and
significantly decreased glucose uptake in brown adipose tissue in comparison to MC. Diets
containing 33% fructose instead of glucose had a similar effect on glucose uptake indices
(Thorburn et al., 1989). Glucose transport into skeletal muscle and adipose is insulin-responsive
so the low 2-DOG uptakes indicate peripheral insulin resistance. To our knowledge, this study is
the first assessment of in vivo glucose uptake using the 2-DOG tracer in a clamp technique in
response to GOS intake.
3.6. Conclusions
In conclusion, galactose at 15% of daily intake improved hepatic insulin sensitivity in rats
compared to glucose and fructose as assessed by the hyperinsulinemic-euglycemic clamp.
Galactose caused an increase in fed-state hepatic glycogen content and a favorable shift in gut
microbial populations. Intake of galacto-oligosaccharides improved the gut microbial profile but
did not improve insulin sensitivity.
68
CHAPTER 4
4.0. General Discussion
Nutritional strategies to prevent or treat type II diabetes aim to minimize post-prandial
hyperglycemia by decreasing both the maximal blood glucose concentration reached and the
duration of hyperglycemia. Shifting relative intakes of the macronutrient classes (proteins, fats
and carbohydrates) away from refined carbohydrates will improve the glycemic response by
decreasing the proportion of readily available glucose in the diet (Willett et al., 2002). While
caloric balance and dietary macronutrient proportions are known to impact metabolic health
outcomes, the studies presented in this thesis show that specific characteristics of those
macronutrients can affect insulin sensitivity. In particular, the seleno-amino acid content of milk
proteins and the monosaccharide profile of carbohydrate intake were shown to alter insulin
sensitivity.
Consumption of selenium (Se)-enriched casein to supply up to 8 times the Se requirement
impaired hepatic insulin sensitivity in rats fed low-fat diets. While there has been conflicting
evidence about supra-nutritional Se effects on insulin sensitivity, this study clearly demonstrates
a pro-diabetic effect explained by specific molecular mechanisms in hepatic and peripheral
tissues.
It is debatable whether the dietary treatments used in this study are directly transferable to
human nutrition and thus whether similar molecular changes would also be observed in humans
in response to Se-enriched milk intake to provide 8x the Se requirement. The dietary treatments,
consisting of either 10% or 60% of energy intake from fat, were predicted to induce high- and
low-insulin sensitivity states, respectively, on which we could observe either insulin-sensitizing
69
or impairing effects of increasing Se intake. To establish accurate recommendations about
consumption of Se-enriched milk, future studies should be performed on a more realistic basal
diet of 35% of energy intake from fat, representing the typical North American energy intake.
Since we have established that Se levels of 8x the requirement impairs insulin sensitivity, future
studies on a 35% fat diet could investigate the appropriate supra-nutritional intake level, likely
somewhere between 1.5 to 8 times the requirement, to acquire Ses anti-cancer benefits while not
compromising insulin sensitivity. If a perfect Se intake were established, humans would likely
not fulfil that supra-nutritional intake from enriched-casein alone. Due to Se toxicity concerns,
current Canadian dairy cow rations are restricted to a maximum Se content of 0.3ppm which
results in approximately 59 g Se/L milk (Walker et al., 2010). Therefore, one 8-ounce glass of
milk per day provides 27% of our required Se intake. If dairy rations were formulated to supply 1
ppm of Se, milk Se content would increase to 178 g/L and thus supply 81% of our requirement
in one glass of milk. Therefore, to reach a modest 2x the Se requirement you would need to drink
approximately 2.5 glasses of Se-enriched milk per day.
In our second study, regarding milk carbohydrate components, we used Western-style
diets which provide 35% of energy intake from fat, 20% from protein and 45% from
carbohydrate, reflecting typical North American consumption patterns with 15% of carbohydrate
intake from simple sugars. Therefore, the insulin-sensitizing effects of galactose seen in our
study may be transferrable to human nutrition and metabolism, although the perceived off-taste
and low sweetness of galactose would minimize its maximal intake. Although feed intake was
not measured in our study, the rats had no apparent adverse reaction to the galactose diet and
maintained weight gains similar to the glucose treatment.
70
We observed a strong bifidogenic response to galacto-oligosaccharides but this did not
alter insulin sensitivity. Fructo-oligosaccharides dose-dependently increase Bifidobacterium in
healthy individuals (Bouhnik et al., 1999) and improved glucose tolerance in one study
(Yamashita et al., 1984) but not another (Luo et al., 2000). However, intakes above 12% are
reported to cause gastrointestinal discomfort in some individuals, and therefore limit maximal
oligosaccharide intake and its potential therapeutic use in type II diabetes (Macfarlane et al.,
2008).
Understanding the molecular mechanisms behind nutritional effects on insulin sensitivity
can help us predict blood glucose response to various meals and across different individuals. In
my opinion, the ultimate outcome from nutritional, mechanistic studies would be the
development of a mathematical model to predict post-prandial glycemia from dietary and bio-
metric inputs. We have previously developed a model of intermittent gastric emptying and
glucose-insulin dynamics using data from dairy calves consuming milk replacer that predicted
plasma glucose and insulin levels up to 7 hours post-meal with average root-mean square
prediction errors of 9.9 0.7% and 38.1 3.2% for glucose and insulin, respectively (Stahel et
al., 2016).
This model could be expanded on to include effects of dietary protein on gastric
emptying rate which would alter glucose appearance from intestinal absorption and provide a
more accurate prediction of post-prandial glucose. As well, the amino acid composition of the
diet could be used to provide an estimate of the insulinotropic effect of leucine. Our Se-enriched
milk casein study suggests information about the selenocysteine and selenomethionine content of
the diet may be a necessary input into the model to improve the predictive accuracy by
71
accounting for its effect on endogenous glucose production, although parameter sensitivity
analysis would be performed to minimize the necessary inputs.
A flow diagram of our proposed model is presented below with boxes representing
gastric, intestinal, plasma and tissue pools of protein (PROT), carbohydrates (CHO) and fat.
Solid arrows represent carbon flux between the pools while dashed arrows represent stimulatory
effects and dotted arrows represent inhibitory effects.
Figure 4.1. Flow diagram of protein, fat and carbohydrate fluxes
stomach PROT CHO FAT
intestine PROT CHO FAT
plasma
AAs Ins Glc Gluc TGs
tissues
PROT Glc FAT
The model requires that each flux is represented mathematically by a differential equation
to be integrated at intervals of 0.001days. For example, the differential equation for the plasma
insulin pool would include an influx from pancreatic secretion that follows Michaelis-Menten
72
kinetics stimulated by plasma glucose and leucine as well as an outflux representing linear
hepatic clearance of insulin.
=
1+ , + , ,
Biometric information entered into the model to describe an individual, such as body fat
percentage or fasting blood glucose levels could be used to personalize the individuals
pancreatic responsiveness by increasing KGl,Pin (the Michaelis constant for glucose-stimulated
insulin secretion (mmol/L)) with increasing body fat percentage or fasting blood glucose.
We envision this model developing into a user-friendly app for lay people to become
more familiar with how their dietary choices impact their metabolic health. Users would enter
biometric information describing themselves, such as gender, age, body weight, and an estimate
of body fat percentage which would inform the model about their glucose tolerance based on
epidemiological data. Meal entries would be made in a manner similar to what is currently
available in apps such as Fitbit and myfitnesspal from which glucose load, glycemic index,
amino acid composition and fat content would inform influxes into the stomach pools.
Predictions of post-prandial plasma glucose would appear as outputs in the form of time-course
data after each entered meal, as well as whole day summaries as shown in the image below.
Indications of total time spent with predicted blood glucose above a certain threshold would
allow for easy comparison between different meal choices and days.
73
Figure 4.2. Hypothetical output from proposed mathematical model
April 3rd
9
300min
8
7
6
5 1 cup 2% milk
4 1 cup oatmeal
3 1 banana
2
1
0
0 200 400 600 800 1000 1200
This week: 0.7lbs fat lost

You are 2.3% closer to your goal!
0.5lbs muscle gained
As users continue to experiment with entering different meals, meal rankings would
allow for easy comparison of hypothetical and actual meals to make dietary decisions based on
predicted effects on metabolic health. Through improved education of the general public,
informed by nutritional, mechanistic studies such as those presented in this thesis, the incidence
of metabolic syndrome and type II diabetes could be decreased to improve overall health and
productivity.
74
5.0. Literature Cited
Alberti KGMM, Zimmet P, Shaw j. Metabolic syndrome - a new world-wide definition. A
consensus statement from the International Diabetes Federation. Diabet Med 2006; 23:469-480.
Alberti KGMM, Zimmet PZ. Definition, diagnosis and classification of diabetes mellitus and its
complications. Part 1: Diagnosis and classification of Diabetes mellitus provisional report of a
WHO consultation. Diabet Med 1998; 15:539-553.
AOAC International. Official Methods of Analysis. 16th ed. Arlington VA: AOAC International,
1996.
AOAC, 1975. Animal feed. In: Horwitz, W. (Ed.), Official Methods of Analysis of the
Association of Official Analytical Chemists, (12th edition) Association of Official Analytical
Chemists, Washington, USA, pp.129-146.
Backhed F, Manchester JK, Semenkovich CF, Gordon JI. Mechanisms underlying the resistance
to diet-induced obesity in germ-free mice. PNAS 2007; 104: 979-984.
Barile D, Tao N, Lebrilla CB, Coisson J-D, Arlorio M, Berman JB. Permeate from cheese whey
ultrafiltration is a source of milk oligosaccharides. Int Dairy J 2009; 19: 524-530.
Barnes KM, Evenson JK, Raines AM, Sunde RA. Transcript analysis of the selenoproteome
indicates that dietary selenium requirements of rats based on selenium-regulated selenoproteim
mRNA levels are uniformly less than those based on glutathione peroxidase activity. J Nutr
2009; 139:199-206.
75
Barosa C, Silva C, Fagulha A, Barros L, Caldeira MM, Carvalheiro M, Jones JG. Sources of
hepatic glycogen synthesis following a milk-containing breakfast meal in healthy subjects.
Metabolism 2012; 61: 250-254.
Basciano H, Federico L, Adeli K. Fructose, insulin resistance, and metabolic dyslipidemia.
Nutrition & Metabolism 2005; 2-5:1-14.
Becker DJ, Reul B, Ozcelikay AT, Buchet JP, Henquin JC, Brichard SM. Oral selenate improves
glucose homeostasis and partly reverses abnormal expression of liver glycolytic and
gluconeogenic enzymes in diabetic rats. Diabetologia 1996; 39: 3-11.
Berg EA, Wu JY, Campbell L, Kagey M and Stapleton SR. Insulin-like effects of vanadate and
selenate on the expression of glucose-6-phosphate dehydrogenase and fatty acid synthase in
diabetic rats Biochimie 1995; 12: 919924.
Bhatia S, Prabhu PN, Benefiel AC, Miller MJ, Chow J, Davis SR, Gaskins HR. Galacto-
oligosaccharides may directly enhance intestinal barrier function through the modulation of
goblet cells. Mol Nutr Food Res 2015; 59:566-573.
Binder E, Bermudez-Silva FJ, Andre C, Elie M, Romero-Zerbo SY, Leste-Lasserre T, Belluomo
I, Duchampt A, Clark S, Aubert A, Mezzullo M, Fanelli F, Pagotto U, Laye S, Mithieux G, Cota
D. Leucine supplementation protects from insulin resistance by regulating adiposity levels. PLoS
One 2013; 8: e74705.
Bleys J, Navas-Acien A, Guallar E. Serum selenium and diabetes in U.S. adults. Diabetes Care
2007; 30: 829-834.
76
Bode L. Human milk oligosaccharides: Every baby needs a sugar mama. Glycobiology 2012; 22:
1147-62.
Boehm G, Stahl B, Jelinek J, Knol J, Miniello V and Moro GE. Prebiotic carbohydrates in
human milk and formulas. Acta Pediatrica 2005; 94: 1821.
Bouhnik Y, Vahedi K, Achour L, Attar A, Salfati J, Pochart P, Marteau P, Flourie B, Bornet F,
Rambaud J-C. Short-chain fructo-oligosaccharides administration dose-dependently increases
fecal Bifidobacteria in healthy humans. J Nutr 1999; 129: 113-116.
Bowen J, Noakes M, Clifton PM. Effect of calcium and dairy foods in high protein, energy-
restricted diets on weight loss and metabolic parameters in overweight adults. Int J Obesity 2005;
29:957-965.
Brandelli A, Daroit DJ, Correa APF. Whey as a source of peptides with remarkable biological
activities. Food Res Int 2015; 73: 149-161.
Bray GA, Nielsen SJ, Popkin BM. Consumption of high-fructose corn syrup in beverages may
play a role in the epidemic of obesity. Am J Clin Nutr 2004; 79:537-543.
Campbell JM, Fahy GC, Wolf BW. Selected indigestible oligosaccharides affect large bowel
mass and fecal short-chain fatty acids, pH and microora in rats. J Nutr 1997; 127: 130136.
Campbell SC, Aldibbiat A, Marriott CE, Landy C, Ali T, Ferris WF, Butler CS, Shaw JA,
Macfarlane WM. Selenium stimulates pancreatic beta-cell gene expression and enhances islet
function. FEBS Lett 2008; 582: 2333-37.
77
Cani PD, Daubioul CA, Reusens B, Remacle C, Catillon G, Delzenne NM. Involvement of
endogenous glucagon-like peptide-1(7-36) amide on glycaemia-lowering effect of oligofructose
in streptozotocin-treated rats. J Endocrinol 2005;185: 457-465.
Cani PD, Hoste S, Guiot Y, Delzenne NM. Dietary non-digestible carbohydrates promote L-cell
differentiation in the proximal colon of rats. Brit J Nutr 2007; 98: 32-37.
Cani PD, Knauf C, Iglesias MA, Drucker DJ, Delzenne NM, Burcelin R. Improvement of
glucose tolerance and hepatic insulin sensitivity by oligofructose requires a functional glucagon-
like peptide 1 receptor. Diabetes 2006; 55:1484-90.
Cani PD, Neyrinck AM, Fava F, Knauf C, Burcelin RG, Tuohy KM, Gibson GR, Delzenne NM.
Selective increases of bifidobacteria in gut microbiota improve high-fat-diet-induced diabetes in
mice through a mechanism associated with endotoxaemia. Diabetologia 2007; 50: 2374-83.
Cani PD, Possemiers S, Van de Wiele T, Guiot Y, Everard A, Rottier O, Geurts L, Naslain D,
Neyrinck A, Lambert DM, Muccioli GG, Delzenne NM. Changes in gut microbiota control
inflammation in obese mice through a mechanism involving GLP-2-driven improvement of gut
permeability. Gut 2009; 58:1091-1103.
Chaudhri OB, Salem V, Murphy KG, Bloom SR. Gastrointestinal satiety signals. Annu Rev
Physiol 2008; 70: 239-255.
Chaudhri OB, Salem V, Murphy KG, Bloom SR. Gastrointestinal satiety signals. Annu Rev
Physiol 2008; 70:239-255.
Choi HK, Willett WC, Stampfer MJ, Rimm E, Hu FB. Dairy consumption and risk of type 2
diabetes mellitus in men: a prospective study. Arch Intern Med 2005;165:9971003.
78
Clark LC, Combs GF, Turnbull BW, Slate EH, Chalker DK, Chow J, Davis LS, Glover RA,
Graham GF, Gross EG, Krongrad A, Lesher JL, Park HK, Sanders BB, Smith CL, Taylor JR.
Effect of selenium supplementation for cancer prevention in patients with carcinoma of the skin.
J Am Med Assoc 1996; 276:195763.
Corfield AP, Myerscough N, Longman R, Sylvester P, Arul S, Pignatelli M. Mucins and mucosal
protection in the gastrointestinal tract: new prospects for mucins in the pathology of
gastrointestinal disease. Gut 2000; 47:589-594.
Cotter DG, Ercal B, Huang X, Leid JM, dAvignon A, Graham MJ Dietzen DJ, Brunt EM, Patti
GJ, Crawford PA. Ketogenesis prevents diet-induced fatty liver injury and hyperglycemia. J Clin
Invest 2014; 124: 5175-90.
De Angel RE, Berrigan D, Nunez NP, Hursting SD, Perkins SN. Dietary calcium source
influences body composition, glucose metabolism and hormone levels in a mouse model of
postmenopausal obesity. In Vivo 2009; 23:527-535.
Delmee E, Cani PD, Gual G, Knauf C, Burcelin R, Maton N, Delzenne NM. Relation between
colonic proglucagon expression and metabolic response to oligofructose in high fat diet-fed
mice. Life Sciences 2006; 79:1007-13.
Desvergne B, Michalik L, Wahli W. Transcriptional regulation of metabolism. Physiol Rev
2006; 86: 465-514.
Dubyak GR and Kleinzeller A. Insulin-mimetic effects of vanadate in isolated rat adipocytes. J
Biol Chem 1980; 255: 53065312.
79
Eller LK, Saha DC, Shearer J, Reimer RA. Dietary leucine improves whole-body insulin
sensitivity independent of body fat in diet-induced obese Sprague-Dawley rats. J Nutr Biochem
2013; 24: 1285-94.
Elliot SS, Keim NL, Stern JS, Teff K, Havel PJ. Fructose, weight gain, and the insulin resistance
syndrome. Am J Clin Nutr 2002; 76:911-922.
Ercan N, Gannon MC, Nuttall FQ. Liver glycogen synthase, phosphorylase, and the glycogen
concentration in rats given a glucose load orally: A 24-hour study. Arch Biochem Biophys 1994;
315: 35-40.
Estall JL. Kahn M. Cooper MP, Fisher FM, Wu MK, Laznik D, Qu L, Cohen DE, Shulman GI,
Spiegelman BM. Sensitivity of lipid metabolism and insulin signalling to genetic alterations in
hepatic peroxisome proliferator-activated receptor-y coactivator-1a expression. Diabetes 2009;
58: 1499-508.
Ezaki 0. The insulin-like effects of selenate in rat adipocytes. J Biol Chem 1990; 265:1124-28.
Forstrom JW, Zakowski JJ, Tappel AL. Identification of the catalytic site of rat liver glutathione
peroxidase as selenocysteine. Biochemistry 1978; 17: 2639-2644.
Geurts L, Neyrinck AM, Delzenne NM, Knauf C, Cani PD. Gut microbiota controls adipose
tissue expansion, gut barrier and glucose metabolism: novel insights into molecular targets and
interventions using prebiotics. Beneficial Microbes 2014; 5:3-17.
80
Gibson GR, Scott KP, Rastall RA, Tuohy KM, Hotchkiss A, Dubert-Ferrandon A, Gareau M,
Murphy EF, Saulnier D, Loh G et al. Dietary prebiotics: current status and new definition. Food
Sci Technol Bull Funct Foods 2010; 7: 1-19.
Gil J, Miralpeix M, Carreras J, Bartrons R. Insulin-like effects of vanadate on glucokinase
activity and fructose 2,6-bisphosphate levels in the liver of diabetic rats. J Biol Chem 1988;
1868-71.
Glaser D, Wanner M, Tinti JM, Nofre C. Gustatory responses of pigs to various natural and
artificial compounds known to be sweet in man. Food Chem 2000; 68: 375-385.
Gobinath D, Madhu AN, Prashant G, Srinivasan K, Prapulla SG. Beneficial effect of xylo-
oligosaccharides and fructo-oligosaccharides in streptozotocin-induced diabetic rats. Brit J Nutr
2010; 104: 40-47.
Griffin ME, Marcucci MJ, Cline GW, Bell K, Barucci N, Lee D, Goodyear LJ, Kraegen EW,
White MF, Shulman GI.Free fatty acid-induced insulin resistance is associated with activation of
protein kinase C theta and alterations in the insulin signaling cascade. Diabetes 1999; 48: 1270
4.
Haarman M and Knol J. Quantitative real-time PCR assays to identify and quantify fecal
Bidobacterium species in infants receiving a prebiotic infant formula. Appl Environ Microbiol
2005; 71: 231824.
Hayashi H, Sakamoto M, Benno Y. Fecal microbial diversity in a strict vegetarian as determined
by molecular analysis and cultivation. Microbiol Immunol 2002; 46:819-831.
81
Hei Y-j, Farahbakhshian S, Chen X, Battel ML, McNeill JH. Stimulation of MAP kinase and S6
kinase by vanadium and selenium in rat adipocytes. Mol Cell Biochem 178: 367-375, 1998.
Hernandez-Hernandez O, Marin-Manzano C, Rubio LA, Moreno J, Sanz ML, Clemente A.
Monomer and linkage type of galacto-oligosaccharides affect their resistance to ileal digestion
and prebiotic properties in rats. J Nutr 2012; 142:1232-39.
Hildebrandt MA, Hoffmann C, Sherrill-Mix SA, Keilbaugh SA, Hamady M, Chen Y-Y, Knight
R, Ahima RS, Bushman F, Wu GD. High-fat diet determines the composition of the murine gut
microbiome independently of obesity. Gastroenterol 2009; 137: 1716-24.
Hirschey MD, Shimazu T, Jing E, Grueter CA, Collins AM, Aouizerat B, Stancakova A,
Goetzman E, Lam MM, Schwer B, Stevens RD, Muehlbauer MJ, Kakar S, Bass NM, Kuusisto J,
Laakso M, Alt FW, Newgard CB, Farese RV Jr, Kahn Cr, Verdin E. SIRT3 deficiency and
mitochondrial protein hyperacetylation accelerate the development of the metabolic syndrome.
Mol Cell 2011; 44:177-190.
Holma R, Juvonen P, Asnawi MZ, Vapaatalo H, Korpela R. Galacto-oligosaccharides stimulate
the growth of Bifidobacteria but fail to attenuate inflammation in experimental colitis in rats.
Scand J Gastroenterol 2002; 1042-47.
Hu Y, McIntosh GH, Le Leu RK, Woodman R, Young GP. Suppression of colorectal
oncogenesis by selenium-enriched milk proteins: apoptosis and K-ras mutations. Cancer Res
2008; 68: 4936-44.
Hulver MW, Dohm GL. The molecular mechanism linking muscle fat accumulation to insulin
resistance. PNAS 2004; 63: 375-380.
82
Hwang H, Seo S, Kim Y, Kim C, Shim S, Jee S, Lee S, Jang M, Kim M, Yim S, Lee S-K, Kang
B, Jang I, Cho J. Selenium acts as an insulin-like molecule for the down-regulation of diabetic
symptoms via endoplasmic reticulum stress and insulin signalling proteins in diabetes-induced
non-obese diabetic mice. J Biosci 2007; 32: 723735.
Ito M, Deuguchi Y, Miyamori A, Matsumote K, Kikuchi H, Matsumoto K, Yajima T and Kan T.
Effects of administration of galactooligosaccharides on the human faecal microora, stool weigh
and abdominal sensation. Microb Ecol Health Dis 1990; 3: 285292.
Jakubowicz D, Froy O. Biochemical and metabolic mechanisms by which dietary whey protein
may combat obesity and type 2 diabetes. J Nutr Biochem 2013; 24: 1-5.
Jakubowicz D, Froy O, Ahren B, Boaz M, Landau Z, Bar-Dayan Y, Ganz T, Barnea M,
Wainstein J. Incretin, insulinotropic and glucose-lowering effects of whey protein pre-load in
type 2 diabetes: a randomized clinical trial. Diabetologia 2014; 57:1807-11.
Jin ES, Beddow SA, Malloy CR, Samuel VT. Hepatic glucose production pathways after three
days of high-fat diet. Metab Clin Exp 2013; 62:152-162.
Josse AR, Atkinson SA, Tarnopolsky MA, Philips SM. Increased consumption of dairy foods
and protein during diet- and exercise-induced weight loss promotes fat mass loss and lean mass
gain in overweight and obese premenopausal women. J Nutr 2011; 14:1626-34.
Kahn BB, Alquier T, Carling D, Hardie DG. AMP-activated protein kinase: Ancient energy
gauge clues to modern understanding of metabolism. Cell Metab 2005; 1: 15-25.
Kalliomaki M, Collado MC, Salminen S and Isolauri E. Early differences in fecal microbiota
composition in children may predict overweight. Am J Clin Nutr 2008; 87: 534-538.
83
Kasuga M. Insulin resistance and pancreatic -cell failure. J Clin Invest 2006; 116: 1756-60.
Kivak JK, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative
PCR and the 2-Ct method. Methods 2001; 25: 402-408.
Klein EA, Thompson Jr IM, Tangen CM, Crowley JJ, Lucia MS, Goodman PJ, Minasian LM,
Ford LG, Parnes HL, Gaziano JM et al. Vitamin E and the risk of prostate cancer- The selenium
and vitamin E cancer prevention trial (SELECT) JAMA; 2011;306:1549-56.
Kliegman RM, Morton S. Sequential intrahepatic metabolic effects of enteric galactose
alimentation in newborn rats. Pediatr Res 1988; 24:302-307.
Knol J, Scholtens P, Kafka C, Steenbakkers J, Gross S, Helm K, Klarczyk M, Schoepfer H,
Boeckler H-M, Wells J. Colon microbiota in infants fed formula with galacto- and fructo-
oligosaccharides: more like breast-fed infants. J Pediatr Gastr Nutr 2004; 40: 36-42.
Knowles SO, Grace ND, Wurms K, Lee J. Significance of amount and form of dietary selenium
on blood, milk, and casein selenium concentrations in grazing cows. J Dairy Sci 1999; 82: 429-
437.
Kowluru RA, Tang J, Kern TS. Abnormalities of retinal metabolism in diabetes and
experimental galactosemia. VII. Effect of long-term administration of antioxidants on the
development of retinopathy. Diabetes 2001; 50: 1938-42.
Labunskyy VM, Lee BC, Handy DE, Loscalzo J, Hatfield DL, Gladyshev VN. Both maximal
expressions of selenoproteins and selenoprotein deficiency can promote development of type 2
diabetes-like phenotype in mice. Antiox Redox Signal 2011; 14: 2327-36.
84
Lam TKT, Van de Werve G, Giacca A. Free fatty acids increase basal hepatic glucose
production and induce hepatic insulin resistance at different sites. Am J Physiol 2003; 284:
E281E290.
Leforestier G, Blais A, Blachier F, Marsset-Baglieri A, Davila-Gay A-M, Perrin E, Tom D.
Effects of galacto-oligosaccharide ingestion on the mucosa-associated mucins and sucrase
activity in the small intestine of mice. Eur J Nutr 2009; 48:457-464.
Ley RE, Turnbaugh PJ, Klein S, Gordon JI. Human gut microbes associated with obesity. Nature
2006; 444: 1022-23.
Li X, Monks B, Ge Q, Birnbaum MJ. Akt/PKB regulates hepatic metabolism by directly
inhibiting PGC-1 transcription coactivator. Nature 2007; 447: 1012-16.
Lippman SM, Klein EA, Goodman PJ, Lucia MS, Thompson IM, Ford LG, Parnes HL, Minasian
LM, Gaziano JM, Hartline JA, et al. Effect of selenium and vitamin E on risk of prostate cancer
and other cancers: The Selenium and Vitamin E Cancer Prevention Trial (SELECT). JAMA
2009; 301: 39-51.
Liu S, Choi HK, Ford E, Song Y, Klevak A, Buring JE, Manson JE. A prospective study of dairy
intake and the risk of type 2 diabetes in women. Diabetes Care 2006; 29:1579-84.
Liu Y, Zhao H, Zhang Q, Tang J, Li K, Xia X-J, Wang K-N, Li K, Lei XG. Prolonged dietary
selenium deficiency or excess does not globally affect selenoprotein gene expression and/or
protein production in various tissues of pigs. J Nutr 2012;142:1410-6.
Liu W-J, Ma L-Q, Liu W-H, Zhou W, Zhang K-Q, Zou C-G. Inhibition of hepatic glycogen
synthesis by hyperhomocysteinemia mediated by TRB3. Am J Pathol 2011; 178:1489-99.
85
Loh K, Deng H, Fukushima A, Cai X, Boivin B, Galic S, Bruce C, Shields BJ, Skiba B, Ooms
LM, et al. Reactive oxygen species enhance insulin sensitivity. Cell Metab 2009; 10: 260-272.
Luo J, Yperselle MV, Rizkalla SW, Rossi F, Bornet FRJ, Slama G. Chronic consumption of
short-chain fructooligosaccharides does not affect basal hepatic glucose production or insulin
resistance in type 2 diabetes. J Nutr 2000; 130: 1572-77.
Lustig Y, Ruas JL, Estall JL, Lo JC, Devarakondo S, Laznik D, Choi JH, Ono H, Olsen JV,
Spiegelman BM. Separation of the gluconeogenic and mitochondrial functions of PGC-1
through S6 kinase. Genes Dev 2011; 25: 1232-44.
Macfarlane GT, Steed H, Macfarlane S. Bacterial metabolism and health-related effects of
galacto-oligosaccharides and other prebiotics. J Appl Microbiol 2008; 305-344.
Marin-Manzano MC, Abecia L, Hernandez-Hernandez O, Sanz ML, Montilla A, Olano A, Rubio
LA, Moreno FJ, Clemente A. Galacto-oligosaccharides derived from lactulose exert a selective
stimulation on the growth of Bifidobacterium animalis in the large intestine of growing rats. J
Agric Food Chem 2013; 61:7560-67.
Martinez-Ferez A, Rudloff S, Guadix A, Henkel CA, Pohlentz G, Boza JJ, Guadix EM, Kunz C.
Goats' milk as a natural source of lactose-derived oligosaccharides: isolation by membrane
technology. Int Dairy J 2006; 16: 173-181.
Maurer AD, Chen Q, McPherson C, Reimer RA. Changes in satiety hormones and expression of
genes involved in glucose and lipid metabolism in rats weaned onto diets high in fibre or protein
reflect susceptibility to increased fat mass in adulthood. J Physiol 2009;587:679-691.
86
McClung JP, Roneker CA, Mu W, Lisk DJ, Langlais P, Liu F, Lei XG. Development of insulin
resistance and obesity in mice overexpressing cellular glutathione peroxidase. PNAS 2004; 101:
8852-57.
McNeill JH, Delgatty HL, Battell ML. Insulin-like effects of sodium selenate in streptozocin-
induced diabetic rats. Diabetes 1991; 40: 1675-79.
Mennen LI, Lafay L, Feskens EJM, Novak M, Lepinay P, Balkau B. Possible protective effect of
bread and dairy products on the risk of the metabolic syndrome. Nutr Res 2000; 20: 335-347.
Meyerovitch J, Farfel Z, Sack J, Schecter Y. Oral administration of vanadate normalizes blood
glucose levels in streptozotocin-treated rats. J Biol Chem 1987; 262: 6658-62.
Misu H, Takamura T, Takayama H, Hayashi H, Matsuzama-Nagata N, Kurita S, Ishifura K,
Ando H, Takeshita Y, Ota T, et al. A liver-derived secretory protein, Selenoprotein P, causes
insulin resistance. Cell Metab 2010; 12:483-495.
Morris EM, Jackman MR, Meers GM, Johnson GC, Lopez JL, MacLean PS, Thyfault JP.
Reduced hepatic mitochondrial respiration following acute HF diet is prevented by PGC-1
overexpression. Am J Physiol 2013; 305: G868G880.
Mozaffarian D, Cao H, King IB, Lemaitre RN, Song X, Siscovick DS, Hotamisligil GS. Trans-
palmitoleic acid, metabolic risk factors, and new-onset diabetes in U.S. adults. Ann Intern Med
2010; 153: 790-799.
Muccioli GG, Naslain D, Backhed F, Reigstad CS, Lambert DM, Delzenne NM and Cani PD.
The endocannabinoid system links gut microbiota to adipogenesis. Molecular Systems Biology
2010; 6: 392.
87
Mueller AS, Bosse AC, Most E, Klomann SD, Schneider S, Pallauf J. Regulation of the insulin
antagonistic protein tyrosine phosphatase 1B by dietary Se studied in growing rats. J Nutr
Biochem 2009; 20:235-247.
Mueller AS, Klomann SD, Wolf NM, Schneider S, Schmidt R, Spielmann J, Stangl G, Eder K,
Pallauf J. Redox regulation of protein tyrosine phosphatase 1B by manipulation of dietary
selenium affects the triglyceride concentration in rat liver. J Nutr 2008; 138: 2328-36.
Mueller AS, Pallauf J. Compendium of the antidiabetic effects of supra-nutritional selenate
doses. In vivo and in vitro investigations with type II diabetic db/db mice. J Nutr Biochem 2006;
17: 548-560.
Neyrinck AM, Van Hee VF, Piront N, De Backer F, Toussaint O, Cani PD, Delzenne NM.
Wheat-derived arabinoxylan oligosaccharides with prebiotic effect increase satietogenic gut
peptides and reduce metabolic endotoxemia in diet-induced obese mice. Nutrition and Diabetes
2012; 2: e28.
Niewohner CB, Niel B. Mechanism of delayed hepatic glycogen synthesis after an oral galactose
load vs. an oral glucose load in adult rats. Am J Physiol 1992; 263:E42-E49.
Nilsson M, Holst JJ, Bjorck IME. Metabolic effects of amino acid mixtures and whey protein in
healthy subjects: studies using glucose-equivalent drinks. Am J Clin Nutr 2007; 85:996-1004.
Nwosu CC, Aldredge DL, Lee H, Lerno LA, Zivkovic AM, German JB, Lebrilla CB.
Comparison of the human and bovine milk N-glycome via high-performance microfluidic chip
liquid chromatography and tandem mass spectrometry. J Proteome Res 2012; 11: 2912-24.
88
Otsyula M, King MS, Ketcham TG, Sanders RA, Watkins III JB. Oxidative stress in rats after 60
days of hypergalactosemia and hyperglycemia. Int J Toxicol 2003; 22: 423-427.
Overduin J, Schoterman MHC, Calame W, Schonewille AJ, Ten Bruggencate SJM. Dietary
galacto-oligosaccharides and calcium: effects on energy intake, fat-pad weight and satiety-
related, gastrointestinal hormones in rats. Brit J Nutr 2013; 109: 1338-48.
Pantophlet AJ, Gilbert MS, van den Borne JJGC, Gerrits WJJ, Roelofsen H, Priebe MG, Vonk
RJ. Lactose in milk replacer can partly be replaced by glucose, fructose, or glycerol without
affecting insulin sensitivity in veal calves. J Dairy Sci 2016; 99:3072-80.
Parnell JA, Reimer RA. Prebiotic fibres dose-dependently increase satiety hormones and alter
bacteriodetes and Firmicutes in lean and obese JCR:LA-cp rats. J Nutr 2012; 107:1-25.
Patil P, Mandal S, Tomar SK, Anand S. Food protein-derived bioactive peptides in management
of type 2 diabetes. Eur J Nutr 2015; 54: 863-880.
Paturi G, Butts CA, Stoklosinski H, Ansell J. Effects of early dietary intervention with a
fermentable fibre on colonic microbiota activity and mucin gene expression in newly weaned
rats. Journal of functional foods 2012; 4:520-530.
Pereira MA, Jacobs Jr DR, Van Horn L, Slattery ML, Kartashov AI, Ludwig DS. Dairy
consumption, obesity, and the insulin resistance syndrome in young adults. JAMA 2002;
287:2081-89.
Pillay TS, Makgoba MW. Enhancement of epidermal growth factor (EGF) and insulin stimulated
tyrosine phosphorylation of endogenous substrates by sodium selenate. FEBS Lett 1992; 308:
3842.
89
Pinto A, Juniper DT, Sanil M, Morgan L, Clark L, Sies H, Rayman MP, Steinbrenner H.
Supranutritional selenium induces alterations in molecular targets related to energy metabolism
in skeletal muscle and visceral adipose tissue in pigs. J Inorg Biochem 2012; 114: 47-54.
Pinto A, Speckmann B, Heisler M, Sies H, Steinbrenner H. Delaying of insulin signal
transduction in skeletal muscle cells by selenium compounds. J Inorg Biochem 2011; 105: 812-
820.
Postic C, Dentin R, Girard J. Role of the liver in the control of carbohydrate and lipid
homeostasis. Diabet Metab 2004; 30:398-408.
Public Health Agency of Canada, 2011. A joint report from the Public Health Agency of Canada
and the Canadian Institute for Health Information. Ottawa, Canada, p. 10.
Puigserver P, Rhee J, Donovan J, Walkey CJ, Yoon JC, Oriente F, Kitamura Y, Altomonte J,
Dong H, Accili D, Spiegelman BM. Insulin-regulated hepatic gluconeogenesis through FOXO1-
PGC-1 interaction. Nature 2003; 423: 550-555.
Quiepo-Ortuno MI, Seoane LM, Murri M, Pardo M, Gomez-Zumaquero JM, Cardona F,
Casanueva F, Tinahones FJ. Gut microbiota composition in male rat models under different
nutritional status and physical activity and its association with serum leptin and ghrelin levels.
Plos One 2013;8:e65465.
Ramana RV, Kumar VV, Krishna PNR, Kumar CS, Reddy PUM, Raju TN. Effect of quercetin
on galactose-induced hyperglycaemic oxidative stress in hepatic and neuronal tissues of Wistar
rats. Acta Diabetol 2006; 43:135-141.
90
Reddi AS, Bollineni JS. Selenium-deficient diet induces renal oxidative stress and injury via
TGF-1 in normal and diabetic rats. Kidney Int 2001; 59: 1342-53.
Reimer RA, Russell JC. Glucose tolerance, lipids, and GLP-1 secretion in JCR:LA-cp rats fed a
high protein fiber diet. Obesity 2008; 16:1-19.
Sakaguchi E, Sakoda C, Toramaru Y. Caecal fermentation and energy accumulation in the rat
fed on indigestible oligosaccharides. Brit J Nutr 1998; 80: 469-476.
Sela DA, Mills DA. Nursing our microbiota: molecular linkages between bifidobacteria and milk
oligosaccharides. Trends Microbiol 2010; 18: 298-307.
Sell H, Dietze-Schroeder D, Eckel J. The adipocyte-myocyte axis in insulin resistance. Trends
Endocrin Met 2006; 17: 416-422.
Sheng X-Q, Huang K-X, Xu H-B. Influence of alloxan-induced diabetes and selenite treatment
on blood glucose and glutathione levels in mice. J Trace Elem Med Biol 2005; 18: 261-267.
Song S, Adrikipoulos S, Filippis C, Thorburn AW, Kahn D, Proietto J. Mechanism of fat-
induced hepatic gluconeogenesis: effect of metformin. Am J Physiol 2001; 281: E275-E282.
Speckman B, Walter PL, Alili L, Reinehr R, Sies H, Klotz L-O, Steinbrenner H. Selenoprotein P
expression is controlled through interaction of the coactivator PGC-1 with Fox01a and
hepatocyte nuclear factor 4 transcription factors. Hepatology 2008; 48:1998-2006.
Stahel P, Cant JP, MacPherson JAR, Berends H, Steele MA. A mechanistic model of intermittent
gastric emptying and glucose-insulin dynamics following a meal containing milk components.
PLoS One 2016; 11(6):e0156443. doi:10.1371/journal.pone.0156443.
91
Steinbrenner H, Sies H. Protection against reactive oxygen species by selenoproteins. Biochim
biophys acta 2009; 1790: 1478-85.
Stranges S, Laclaustra M, Ji C, Cappuccio FP, Navas-Acien A, Ordovas JM, Rayman M, Guallar
E. Higher selenium status is associated with adverse blood lipid profile in British adults. J Nutr
2010a; 140: 81-87.
Stranges S, Sieri S, Vinceti M, Grioni S, Guallar E, Laclaustra M, Muti P, Berrino F, Krogh V. A
prospective study of dietary selenium intake and risk of type 2 diabetes. BMC Public Health
2010b; 10:564.
Tao N, DePeters EJ, Freeman S, German JB, Grimm R, Lebrilla CB. Bovine milk glycome. J
Dairy Sci 2008; 91: 3768-78.
Tappenden KA, Albin DM, Bartholome AL, Mangian HF. Glucagon-like peptide-2 and short-
chain fatty acids: a new twist to an old story. J Nutr 2003; 133:3717-3720.
Thorburn AW, Storlien LH, Jenkins AB, Khouri S, Kraegen EW. Fructose-induced in vivo
insulin resistance and elevated plasma triglyceride levels in rats. Am J Clin Nutr 1989; 49:1155-
63.
Tulipano G, Sibilia V, Caroli AM, Cocchi D. Whey proteins as source of dipeptidyl dipeptidase
IV (dipeptidyl peptidase-4) inhibitors. Peptides 2011; 32: 835-838.
Tuohy KM, Rouzaud GC, Bruck WM, Gibson GR. Modulation of the human gut microflora
towards improved health using prebiotics-assessment of efficacy. Curr Pharm Des 2005; 11: 75-
90.
92
Turnbaugh PJ, Ley RE, Mahowald MA, Magrini V, Mardis ER, Gordon JI. An obesity-
associated gut microbiome with increased capacity for energy harvest. Nature 2006; 444: 1027-
31.
Vrang N, Madsen AN, Tang-Christensen M, Hansen G, Larsen PJ. PYY(3-36) reduces food
intake and body weight and improves insulin sensitivity in rodent models of diet-induced
obesity. Am J Physiol Regul Integr Comp Physiol 2006; 291: R367-R375.
Walker AW, Duncan SH, Leitch ECM, Child MW, Flint HJ. pH and peptide supply can radically
alter bacterial populations and short-chain fatty acid ratios within microbial communities from
the human colon. Appl Environ Microb 2005; 71: 3692-700.
Walker GP, Dunshea FR, Heard JW, Stockdale CR, Doyle PT. Output of selenium in milk, urine
and feces is proportional to selenium intake in dairy cows fed a total mixed ration supplemented
with selenium yeast. J Dairy Sci 2010; 93: 4644-50.
Walter PL, Steinbrenner H, Barthel A, Klotz L-O. Stimulation of selenoprotein P promoter
activity in hepatoma cells by FoxO1a transcription factor. Biochem Bioph Res Co 2008; 365:
316-321.
Wang S, Kamat A, Pergola P, Swamy A, Tio F, Cusi K. Metabolic factors in the development of
hepatic steatosis and altered mitochondrial gene expression in vivo. Metab Clin Exp 2011; 60:
1090-99.
Wang X, Zhang W, Chen H, Liao N, Wang Z, Zhang X, Hai C. High selenium impairs hepatic
insulin sensitivity through opposite regulation of ROS. Toxicol Lett 2014; 224: 16-23.
93
Wang XD, Vatamaniuk MZ, Wang SK, Roneker CA, Simmons RA, Lei XG. Molecular
mechanisms for hyperinsulinemia induced by overproduction of selenium-dependent glutathione
peroxidase-1 in mice. Diabetologia 2008; 51:1515-24.
Warrington JM, Kim JJ, Stahel P, Cieslar SRL, Moorehead RA, Coomber BL, Corredig M, Cant
JP. Selenized milk casein in the diet of BALB/c nude mice reduces growth of intramammary
MCF-7 tumors. BMC Cancer 2013; 13:492- 503.
Wijnands MVW, Appel MJ, Hollanders VMH, Woutersen RA. A comparison of the effects of
dietary cellulose and fermentable galacto-oligosaccharide, in a rat model of colorectal
carcinogenesis: fermentable fibre confers greater protection than non-fermentable fibre in both
high and low fat backgrounds. Carcinogenesis 1999; 20: 651-656.
Willett W, Manson J, Liu S. Glycemic index, glycemic load, and risk of type 2 diabetes. Am J
Clin Nutr 2002; 76: 274S-80S.
Winder WW, Hardie DG. AMP-activated protein kinase, a metabolic master switch: possible
roles in type 2 diabetes. Am J Physiol 1999; 277:E1-E10.
World Health Organization, 2015. Guideline: Sugars intake for adults and children. Geneva,
Switzerland, pp 3-4.
Wu X, Ma C, Han L, Nawaz M, Gao F, Zhang X, Yu P, Zhao C, Li L, Zhou A, Wang J, Moore
JE, Millar BC, Xu J. Molecular characterisation of the faecal microbiota in patients with type II
diabetes. Curr Microbiol 2010; 61: 69-78.
94
Xu H, Barnes GT, Yang Q, Tan G, Yang D, Chou CJ, Sole J, Nichols A, Ross JS, Tartaglia LA,
Chen H. Chronic inflammatino in fat plays a crucial role in the development of obesity-related
insulin resistance. J Clin Invest 2003; 112: 1821-30.
Yadav H, Lee J-H, Lloyd J, Walter P, Rane SG. Beneficial metabolic effects of a probiotic via
butyrate-induced GLP-1 hormone secretion. J Biol Chem 2013; 288:25088-97.
Yamashita K, Kaawai K, Itakura M. Effects of fructooligosaccharides on blood glucose and
serum lipids in diabetic subjects. Nutr Res 1984; 4: 961966.
Yan X, Pepper MP, Vatamaniuk MZ, Roneker CA, Li L, Lei XG. Dietary selenium deficiency
partially rescues type 2 diabetes-like phenotypes of glutathione peroxidase-1 overexpressing
male mice. J Nutr 2012; 1975-82.
Yoshizawa K, Willet WC, Morris SJ, Stampfer MJ, Spiegelman D, Rimm EB, Giovannucci E.
Study of prediagnostic selenium level in toenails and the risk of advanced prostate cancer. J Natl
Cancer Inst 1998; 90: 1219-24.
Yu C, Chen Y, Cline CW, Zhang D, Zong H, Wang Y, Bergeron R, Kim JK, Cushman SW,
Cooney GJ, Atcheson B, White MF, Kraegen EW, Shulman GI. Mechanism by which fatty acids
inhibit insulin activation of insulin receptor substrate-1 (IRS-1)-associated phosphatidylinositol
3-kinase activity in muscle. J Biol Chem 2002; 277: 50230-6.
Zavaroni I, Sander S, Scott S, Reaven GM. Effect of fructose feeding on insulin secretion and
insulin action in the rat. Metabolism 1980; 29: 970-973.
Zemel MB, Thompson W, Milstead A, Morris K, Campbell P. Calcium and dairy acceleration of
weight and fat loss during energy restriction in obese adults. Obes Res 2004; 12: 582-590.
95
Zeng M-S, Li X, Liu Y, Zhao H, Zhou J-C, Li K, Huang J-Q, Sun L-H, Tang J-Y, Xia X-J et al.
A high-selenium diet induces insulin resistance in gestating rats and their offspring. Free Radical
Bio Med 2012;52:1335-42.
96
6.0 Appendices
6.1. Appendix 1- Supplementary information for Chapter 2
Table A1.1. Primers used for hepatic mRNA analysis by qPCR
Gene Forward primer 5 3 Reverse primer 5-3 NCBI gene ID
- GGAGATTACTGCCCTGGCTCCTA GACTCATCGTACTCCTGCTT NM031144.3

actin GCTG
SeP TCCTTCCTCACTTTCCCGTA TCTGAGGGCTCTGTGGTTTT NM001083911.

1
GPx-1 TGCAATCAGTTCGGACATC CACCTCGCACTTCTCAAACA NC005107.4
G6Pas AACGTCTGTCTGTCCCGGATCTA ACCTCTGGAGGCTGGCATTG NM013098.2

e C
PEPC CTCACCTCTGGCCAAGATTGGTA GTTGCAGGCCCAGTTGTTGA BC081900.1

K
FAS CACAGCATTCAGTCCTATCCACA CACAGCCAACCAGATGCTTC X62888.1
GA A
ACC1 ATTTCGTCAGGATCTTTGATGAA ATAGAGTGAAGTGTGACCG NM022193.1

GTAA GACTCT
IRS-1 GTCCGGTTCTCCTAGCGATG GGGAATCTGGGGTGACACTG NM012969.1
IRS-2 CCACACGCCTTTCGCTAGA GTACCCCCTTCACCAAAGTC NM001168633.

AA 1
PI3K AGGGGTACCAGTACAGAGCG GTCAGGATGTCCCCCAAGTG NC005101.4

p85a
PI3K ATGAGGCACTCAGGGAAAGC CTTCACGCTGAGCTTCAGGA XM006243643.
p110a 1
SREB GGAGCCATGGATTGCACATT AGGCCAGGGAAGTCACTGTC NM001276708.

P-1c T 1
PGC1 GGCCGGAGCAATCTGAGTTA GGCCGTTTAGTCTTCCTTTCC NM006251044.

T 1
FOX CAGGCCGGAGTTTAACCAGT CTCGCTCTCTTCTAGCAGGC NM001191846.

O1a 2
97
Abbreviations: -actin (Beta-actin), SeP (selenoprotein P), GPx-1 (glutathione peroxidase 1), G6Pase
(glucose-6-phosphatase), PEPCK (phosphoenolpyruvate carboxykinase), FAS (fatty acid synthase),
ACC1 (acetyl-coA carboxylase 1), IRS-1 (insulin receptor substrate 1), IRS-2 (insulin receptor
substrate 2), PI3K-p85a (phosphoinositide 3 kinase p85 regulatory subunit alpha), PI3K-p110a
(phosphoinositide 3 kinase p110 catalytic subunit alpha), SREBP-1c (sterol regulatory element binding
protein 1c), PGC1 (peroxisome proliferator-activated receptor gamma coactivator 1-alpha) FOXO1a
(Forkhead box protein O1a)
98
Table A1.2. Mean weekly body weights through first 6 weeks of dietary treatments
Diet
Day of trial 0.25LF 0.5LF 2.0LF 0.25HF 0.5HF 2.0HF
0 234 248 253 242 250 250
2 281 279 280 297 279 275
9 313 308 312 317 315 314
16 341 337 339 350 349 344
23 371 364 361 374 375 366
30 401 392 390 404 400 396
37 428 423 418 432 427 425
99
6.2. Appendix 2- Supplementary information for Chapter 3
Table A2.1. Primers used for proximal colon gene expression and fecal DNA analysis
Gene Forward primer 5 3 Reverse primer 5-3 NCBI gene ID Source

Proximal colon
-actin CTGACCGAGCGTGGCTA GGTGCTAGGAGCCAG NM031144.3 Cani et al.,
CAG GGCAG 2005
GLUT1 CTGTAGGGCTGGACCTT AATGGAGCCTGGACC NM_138827.1 NCBI

TGG CCTAT
XM_0062322 Maurer et al.,

GLUT2 GTTGCTGGATAAGTTCA GATTGGACCTGGCCC 07.2 2009
CCTGGAT AATCT
D28562.1 Maurer et al.,
GLUT5 GGCCTCATCTTCCCATTC GGGTAGCAGGTGGGA 2009
ATTCAA GGTCATTA
CTACATCCAGTCCATCA CCAATCAGGAAGCCG NM_013033.2 Maurer et al.,
SGLT1
CCCAGTTAC AGAATCAG 2009
ProG ACCGCCCTGAGATTACT AGTTCTCTTTCCAGGT NM_012707.2 Reimer and
TTTCTG TCACCAC Russell 2008
PC1 GGTACCCAAAAACTCCA GGCTTGTTGAGCTTTT XM_0087738 Cani et al.,

GCA CCAG 59.1 2005
PC2 TCGATCAGGTGGTGAGG GCGTGGCCCTAGTTCT NM_012746.1 NCBI

GAT TTCT
MUC 2 GCAAGGACTGTGTTTGC TTCAGCTTTGCACCGT XM_0087600 NCBI

CTG TTGG 48.1
CTTGAGGAGGTGTGCAA CCCCAGGGTGACATA XM_0087691 Paturi et al.,

MUC3 GAAA CTTTG 85.1 2012
GCTTGGACATTTGGTGA GCCCGTTGAAGGTGT XM_0062484 Paturi et al.,
MUC4 TCC ATTTG 71.2 2012
Fecal DNA analysis
Univer AGAGTTTGATCCTGGCT GGTTACCTTGTTACGA Hayashi et al.,
sal CAG CTT 2002
Firm AGCTGACGACAACCA Quiepo-
ATGTGGTTTAATTCGAA TGCAC Ortuno et al.,
G 2013
Lbacil AGCAGTAGGGAATCTTC CACCGCTACACATGG Yadav et al.,
CA AG 2013
100
C. cocc ACTCCTACGGGAGGCAG GCTTCTTAGTCARGTA Parnell and
C CCG Reimer, 2012
Bdetes GAAGGTCCCCCACATTG CAATCGGAGTTCTTC Yadav et al.,

GTG 2013
Bifido CGCGTCYGGTGTGAAAG CCCCACATCCAGCAT Parnell and

CCA Reimer, 2012
Entero CATTGACGTTACCCGCA CTCTACGAGACTCAA Parnell and

b GAAGAAGC GCTTGC Reimer, 2012
Abbreviations: Beta-actin (B-actin); ribosomal protein L19 (RLP19); Glucose transporter type 1, 2 and
5 (GLUT1, GLUT2 and GLUT5); proglucagon (ProG); proprotein convertase 1 and 2 (PC1 and PC2);
mucin 2, 3 and 4 (Muc2, Muc3 and Muc4); Firmicutes (Firm); Lactobacillus (Lbacil); Clostridium
coccoides (C. cocc); Bacteroidetes (Bdetes); Bifidobacterium (Bifido); Enterobacterium (Enterob)
101

Stahel Priska 201606 PHD

Transféré par

Informations du document

Titre original

Copyright

Formats disponibles

Partager ce document

Partager ou intégrer le document

Options de partage

Avez-vous trouvé ce document utile ?

Ce contenu est-il inapproprié ?

Droits d'auteur :

Formats disponibles

Stahel Priska 201606 PHD

Transféré par

Droits d'auteur :

Formats disponibles

Effects of Selenized Casein and Carbohydrate Components of Milk on Insulin

In partial fulfilment of requirements

Guelph, Ontario, Canada

EFFECTS OF SELENIZED CASEIN AND CARBOHYDRATE COMPONENTS OF

Priska Stahel Advisor:

Several epidemiological studies have demonstrated improvements in glucose tolerance

use of the hyperinsulinemic-euglycemic clamp procedure enhanced by glucose tracer infusion to

tissues were analyzed in fasted vehicle- and insulin-stimulated rats.

inclusion of galactose, a monomer of the milk disaccharide lactose, compared to the

monosaccharides glucose and fructose. In addition, the lactose-derived prebiotic galacto-

oligosaccharides was assessed in comparison to methylcellulose. Galactose improved hepatic

Galacto-oligosaccharides elicited bifidogenic responses with no impact on insulin sensitivity.

insulin sensitizing effects, while consumption of galacto-oligosaccharides improved gut

8x the requirement impaired hepatic insulin sensitivity in a mechanism similar to high-fat

feeding, via attenuated IRS/PI3K/AKT signalling and decreased PGC-1 alpha.

meetings throughout my career.

open-minded! Our biggest adventure is still to come!

List of Figures .............................................................................................................................. viii

1.0. Literature Review: Effects of milk components on insulin sensitivity .................................... 1

1.1. Milk consumption and type II diabetes ................................................................................ 1

1.2. Lactose ................................................................................................................................. 4

1.3. Selenium-enriched milk ....................................................................................................... 5

1.3.1. Anti-diabetic effects of selenium .................................................................................. 6

1.3.2. Pro-diabetic effects of selenium.................................................................................... 7

1.4. Milk oligosaccharides ........................................................................................................ 11

1.4.1. Prebiotic oligosaccharides and insulin sensitivity ...................................................... 12

1.4.2. Linking gut microbiota and host insulin sensitivity.................................................... 13

1.4.3. Current evidence from galacto-oligosaccharides ........................................................ 15

1.5. Objectives and Hypotheses ................................................................................................ 16

2.0. Selenized milk casein and insulin sensitivity......................................................................... 18

2.1. Abstract .............................................................................................................................. 18

2.2. Introduction ........................................................................................................................ 19

2.3. Materials and Methods ....................................................................................................... 21

2.4. Results ................................................................................................................................ 27

2.5. Discussion .......................................................................................................................... 41

2.6. Conclusions ........................................................................................................................ 45

3.0. Carbohydrate components of milk and insulin sensitivity..................................................... 46

3.1. Abstract .............................................................................................................................. 46

3.2. Introduction ........................................................................................................................ 47

3.3. Materials and Methods ....................................................................................................... 49

3.4. Results ................................................................................................................................ 55

3.5. Discussion .......................................................................................................................... 64

3.6. Conclusions ........................................................................................................................ 68

4.0. General Discussion ................................................................................................................ 69

5.0. Literature Cited ...................................................................................................................... 75

6.0 Appendices .............................................................................................................................. 97

6.1. Appendix 1- Supplementary information for Chapter 2 .................................................... 97

6.2. Appendix 2- Supplementary information for Chapter 3 .................................................. 100

2.1. Selenium and macronutrient (%) composition of experimental diets 22

plasma TAG concentration

3.1. Ingredient composition (g) of experimental diets 50

3.4. Tissue glucose uptake (Rg) across all dietary treatments 59

3.5. Fecal DNA analysis of microbial populations 60

3.6. Proximal colon gene expression 61

3.7. Hepatic glycogen content (mg/g tissue) following the hyperinsulinemic-euglycemic 62

clamp, 3-hours post-feeding or an overnight fast

phosphorylase (GP) protein abundance relative to -actin

relative to the high-fat diet containing 0.25ppm Se (0.25HF)

2.2 Basal and hyperinsulinemic-euglycemic clamp parameters 30

ppm Se in omental adipose tissue relative to -actin

ppm Se in soleus muscle relative to GAPDH

ppm Se in gastrocnemius muscle relative to GAPDH

2.7. Percent of proliferating pancreatic beta-cells 40