The FASEB Journal Research Communication

Essential nutrient supplementation prevents heritable

metabolic disease in multigenerational intrauterine
growth-restricted rats
Danielle Goodspeed,* Maxim D. Seferovic,* William Holland, Robert A. Mcknight,
Scott A. Summers, D. Ware Branch,{ Robert H. Lane,|| and Kjersti M. Aagaard*,1
*Department of Obstetrics and Gynecology, Baylor College of Medicine, Houston, Texas, USA;

Department of Internal Medicine, Department of Pediatrics, and {Department of Obstetrics and
Gynecology, University of Utah, Salt Lake City, Utah, USA; Program in Cardiovascular and Metabolic
Diseases, Duke-National University of Singapore Graduate Medical School, Singapore; and ||Department
of Pediatrics, Medical College of Wisconsin and Childrens Hospital of Wisconsin, Milwaukee,
Wisconsin, USA

ABSTRACT Intrauterine growth restriction (IUGR)
confers heritable alterations in DNA methylation, render-
ing risk of adult metabolic syndrome (MetS). Because CpG
methylation is coupled to intake of essential nutrients
along the one-carbon pathway, we reasoned that essential
nutrient supplementation (ENS) may abrogate IUGR-
conferred multigenerational MetS. Pregnant Sprague-
Dawley rats underwent bilateral uterine artery ligation
causing IUGR in F1. Among the F2 generation, IUGR lin-
eage rats were underweight at birth (6.7 vs. 8.0 g, P <
0.0001) and obese by adulthood (p160: 613 vs. 510 g; P <
0.0001). Dual energy X-ray absorptiometry studies re-
vealed increased central fat mass (D+40 g), accompanied
by dyslipidemic (>30% elevated, P < 0.05) serum trigly-
cerides (139 mg/dl), very-LDLs (27.8 mg/dl), and fatty
acids (632 mM). Hyperglycemic-euglycemic clamp studies
and glucose tolerance testing revealed insulin resistance.
Conversely, IUGR lineage ENS-fed rats did not manifest
MetS, with signicantly lower body weight (p160: 410 g),
>5-fold less central fat mass, normal hepatic glucose ef-
ux, and >70% reduced circulating triglycerides and very-
LDLs compared with IUGR control-fed F2 offspring
(P < 0.01). Moreover, increased methylation of the IGF-1
P2 transcriptional start site among IUGR lineage F2 off-
spring was reversed in ENS (P < 0.04). This is an initial
demonstration that supplementation along the one-carbon
pathway abrogates adult morbidity and associated epi-
genomic modications of IGF-1 in a rodent model of
multigenerational MetS.Goodspeed, D., Seferovic, M. D.,
Holland, W., Mcknight, R. A., Summers, S. A., Branch,
D. W., Lane, R. H., Aagaard, K. M. Essential nutrient
supplementation prevents heritable metabolic disease in
multigenerational intrauterine growth-restricted rats.
FASEB J. 29, 807819 (2015). www.fasebj.org
THE GESTATIONAL ENVIRONMENT is a key arbiter of the relative
risk of health and disease in later life. In utero metabolic
substrate restriction and uteroplacental insufciency lead-
ing to intrauterine growth restriction (IUGR) is thought
to bestow lifelong epigenetic changes that are malad-
aptive to the postnatal environment. This phenomenon
is referred to as the developmental origins of health and
disease hypothesis and was originally identied by asso-
ciating low birth weight neonates with increased mor-
tality from coronary heart disease much later in life (1, 2).
IUGR has now been associated with increased incidence
of health conditions including vascular dysfunction (3,
4), type II diabetes and dyslipidemia (5, 6), obesity, and
hypertension (2, 7, 8). A symptomatic grouping of these
IUGR health complications later in life is broadly char-
acterized as metabolic syndrome (MetS), a condition
approaching global epidemic prevalence (9). The clini-
cal criteria for MetS is evolving as it struggles to account
for large differences in global populations, age, and race
(10). Currently, the consensus of clinical criteria includes
the following: dyslipidemia, characterized by elevated
triglycerides, ApoB lipoproteins, and reduced HDL; el-
evated blood pressure; and altered glucose homeostasis,
with elevated central fat mass/obesity and insulin re-
sistance (1012).
Maternal inuences, including poor nutrition and ute-
roplacental insufciency, are associated with IUGR and
adult MetS (1316). Rodent IUGR models that restrict ei-
ther protein or carbohydrates have demonstrated adult-
onset MetS associated with important epigenetic regula-
tory changes to key metabolic pathways (1720), and our
previous data in primates have demonstrated that a caloric-
dense maternal diet can inuence epigenetic changes in
the fetal liver (21). Although nutrient deprivation is a risk

Key Words: one-carbon pathway epigenomics methyl donors

IGF-1 obesity
Abbreviations: DEXA, dual energy X-ray absorptiometry;
ENS, essential nutrient supplementation; HGO, hepatic glu-
cose output; IUGR, intrauterine growth restriction; MetS,
metabolic syndrome; VLDL, very-LDL
1
Correspondence: Baylor College of Medicine, Division of
Maternal-Fetal Medicine, One Baylor Plaza, Jones 314, Houston,
TX 77030; E-mail: aagaardt@bcm.tmc.edu
doi: 10.1096/fj.14-259614
This article includes supplemental data. Please visit http://
www.fasebj.org to obtain this information.

0892-6638/15/0029-0807 FASEB 807

for MetS regardless of IUGR etiology (13, 2224), maternal
deprivation is not a predominant cause of IUGR in all but
the most underdeveloped countries. Rather, uteropla-
cental insufciency is the predominant cause of fetal nu-
trient restriction leading to IUGR, which is independent of
maternal nutrition. Thus, maternal nutrient restrictive
models inadequately replicate the broad deprivation of
metabolites and essential nutrients (including methyl
donors) in placental insufciency, as well as other impor-
tant changes such as hypoxia and acidosis, waste product
accumulation, and associated biochemical changes such as
inammation, key regulatory factor alterations, and broad
transcriptional changes particularly associated with hyp-
oxia. Ergo, the surgical bilateral uterine artery ligation
procedure represents a more appropriate model to study
epigenetic changes associated with placental insufciency
as it replicates restriction due to circulatory defects and in
this way leads to reduced maternal/fetal exchange. The
immediate consequences are persistent in utero hypo-
insulinemia, hypoglycemia, acidosis, and hypoxia (25, 26).
Extensive study of animal models has uncovered some
specic epigenetic-mediated molecular mechanisms im-
plicated in long-term heath complications (20, 2735).
IGF-1 is the primary driver of late gestational and postnatal
growth and has been implicated in altered weight and
development (36, 37). Decreased expression is associated
with insulin resistance later in life, as well as increased in-
cidence of MetS (38). In a number of model systems,
a perturbed in utero environment lending epigenomic
modications (both histone variations and differential
methylation) leads to IGF-1 expression changes (3335,
39). Of interest to our studies herein, an identical bilateral
uterine artery ligation procedure results in altered IGF-1
expression changes, which are accompanied by site-
specic differential methylation (33). Of the splice var-
iants, the IGF-1B was shown to be particularly variable both
in its expression and its methylation (33).
Although DNA methylation is relatively stable, there are
developmental time points, such as gamete imprinting,
preimplantation development, and post-midgestational
development, when methylation changes are active (40).
These windows provide intervention points where meth-
ylation is particularly plastic and, for imprinting and post-
implantation events, amenable to dietary inuence.
Dietary methylation supplementation is now known to lead
to variable gene expression (41, 42). These epigenetic
changes associated with methylation supplementation
continue to inuence biology after weaning (43). For ex-
ample, glucose tolerance in later life is associated with
methyl deciency during gestation (44), and supplemen-
tation of methyl donors alters hepatic promoter methyla-
tion and the transcriptional prole in nonalcoholic fatty
liver disease (45).
DNA methylation changes as causative agents of dis-
ease have long been established. It was discovered that
methylation of our DNA is sufciently sensitive to es-
sential dietary methyl sources and cofactors to cause
human disease over a decade ago (46). For example,
methyl sources related to seasonal food consumption in
Gambia affect DNA methylation patterns (47). This
sensitivity is likely caused by methyl group substrates and
cofactors that constitute the one-carbon metabolism
pathway, many components of which are essential, and
808 Vol. 29 March 2015 The FASEB Journal x www.fasebj.org
therefore can only be derived from dietary sources (48).
Methylation of CpG islands is catalyzed by DNA meth-
yltransferases with S-adenosyl methionine as the methyl
donor, synthesized from methionine via dietary methyl
donors or one-carbon metabolism (49). Notably, the
essential amino acid methionine is a methyl donor, itself
dependent on B12 as a methionine synthase cofactor,
which also uses a downstream product of folic acid as
a substrate. In an alternate liver pathway, methionine is
synthesized from betaine, which is derived from cho-
line. Further, several of the enzymes are zinc dependent
(46, 50). Methylation is further inuenced along the
renal arginine-dependent nitric oxide pathway (51).
Studies have made use of these essential nutrients to
study how epigenetic methylation changes relate to dis-
ease. For example, male mice have shown epigenetic
reprogramming of sperm that leads to birth defects in
offspring when fed a folate-decient diet (52). In another
example, rats using essential nutrient methyl-donor dietary
supplementation (ENS) have shown modications in DNA
methylation and decreased hepatic triglyceride accumu-
lation and nonalcoholic fatty liver disease, which are one of
the rst hepatic alterations of metabolic syndrome (53). In
humans, methylation changes to IGF-1 that were associ-
ated with nonalcoholic fatty liver disease were partially re-
versed as a result of nutritional adjustment following
bariatric surgery (54).
Given that DNA methylation is modiable by ENS of the
diet, we hypothesized that supplementation initiated after
weaning and continued through gestation and lactation of
the F1 generation would abrogate the heritable adult
metabolic disease resulting from in utero IUGR among F2
offspring. To study these effects, we rendered uteropla-
cental insufciency-induced IUGR by performing late-
gestation bilateral uterine artery ligation on grandparental
(P1) pregnant Sprague-Dawley rats at e19, with subsequent
delivery of the F1 pups at e21. The F1 generation was al-
located onto either control or ENS-supplemented diet at
weaning (p21) and then allowed to breed spontaneously;
the F1 generation was not surgically manipulated during
pregnancy. Regardless, the resultant IUGR lineage rats in
the F2 generation weighed signicantly less at birth than
the sham lineage pups. By p160, a sex-specic MetS phe-
notype was apparent. IUGR lineage males fed a control
diet exhibited obesity, increased central fat mass accumu-
lation, glucose intolerance, insulin resistance, and in-
creased triglyceride, very-LDL (VLDL), and fatty acids.
ENS-fed IUGR lineage males exhibited no obesogenicity,
glucose intolerance, insulin resistance or increases in tri-
glycerides, VLDL, or fatty acids, indicating a diet induced
reversal of metabolic disease. Accompanying these notable
and signicant phenotypic alterations are signicant site-
specic differences in DNA methylation of the IGF-1 pro-
moter 2 region. Specically, we demonstrate that there is
an observable and signicant corresponding increase in
methylation among F2 generation IUGR lineage rats rel-
ative to sham controls; a nding that reversed with ENS diet
supplementation in the F1 and F2 generation. Collectively,
we observe a multigenerational transmission of the IUGR
phenotype with manifestation of adult MetS and variations
in site specic methylation of the P2 promoter of IGF-1,
which is abrogated by dietary supplementation of one-
carbon intermediates in the F1 generation.
GOODSPEED ET AL.
MATERIALS AND METHODS
IUGR rat model development
The experiments were conducted with the review and approval of
the University of Utah Animal Care committee. Surgical proce-
dures were performed as previously described (55). Briey,
pregnant Sprague-Dawley rats were obtained on e17 and accli-
mated to their environment for 2 d prior to surgery. On day e19,
pregnant females were anesthetized with an intraperitoneal in-
jection of xylazine (8 mg/kg) and ketamine (40 mg/ml). After
conrmation of anesthetization, bilateral uterine artery ligation
was performed to produce the uteroplacental insufciency IUGR
model, or sham surgeries were performed for controls. Pups were
born via cesarean section after 21 d of gestation, and litters were
culled to 8 pups. On p21, suckling F1 offspring were weaned onto
an ad libitum lifelong diet of either control rat chow (Harlan
Teklad 8640; Harlan Laboratories, Indianapolis, IN, USA) or
a custom-formulated isocaloric Harlan Teklad 8640 rat chow
supplemented with 15 mg of folic acid, 15 mg of choline, 1.5 mg of
B12, 15 g of betaine, 11 g of L-methionine, 50 g of L-arginine, and
150 mg of zinc for every kilogram of Harlan Teklad 8640, con-
stituting the ENS diet. Mating pairs were established by p80, prior
to the development of F1 MetS. Mating pairs were shammat 3
shampat, IUGRmat 3 shampat, shammat 3 IUGRpat, and IUGRmat 3
IUGRpat for both the control diet and ENS diet, giving a total of
8 different mating sets. Four hours after spontaneous delivery of
the F2 generation (N = 512), fetal weights were obtained, and
litters were again culled to 8 pups (N = 32). On p21, the F2
generation was weaned onto the same diet of their maternal and
paternal lineage. Rats were weighed both at birth and at p160.
Dual energy X-ray absorptiometry
Dual energy X-ray absorptiometry (DEXA) Norland XR-36 Bone
Densitometer (Norland Products, Inc., Cranbury Township, NJ,
USA) was used to assess rat whole body global and regional body
composition. DEXA relies on X-ray technology to separate the
lean and fat mass based on density and has been previously used
extensively for nutritional studies (56, 57). Rats were anesthetized
before measurements with an intraperitoneal injection of xyla-
zine (8 mg/kg) and ketamine (40 mg/ml) and then placed in
prone position with extremities extended and stabilized with tape
to enable full scanning of the radius and ulna. Spatial resolution
was 6.0 3 6.0 mm. Scans were performed at a speed of 60 mm/s.
The scan eld width was 12 cm, and scanning time for each ani-
mal was ,3 min. Following the scan, rats were immediately eu-
thanized. To determine central fat mass, a region of interest
including the torso area was extracted from the whole body scan,
and fat mass was determined.
Fasting serum lipid proling
Adult p160 rats were fasted for 12 h, and then blood was collected
by nicking the end of the tail with a scalpel once. Blood ow was
maintained throughout by gentle stroking of the tail. Bleeding
was stopped after sampling by dipping the tail in alcohol and
subsequent application of direct pressure. A coronary risk and
lipid proling panel was run on each serum sample. Triglyceride
and VLDL concentrations were obtained by clinical laboratory
testing performed by ARUP Laboratories (Salt Lake City, UT,
USA) using standard quantitative enzymatic assays. Free fatty
acids were measured from serum using the Roche Half-Micro
Test Kit (Indianapolis, IN, USA). The kit was scaled down for use
in a 96-well plate (one-fth suggested amount for each reagent;
10 ml serum). All preparation was performed according to the
PREVENTION OF HERITABLE METABOLIC DISEASE
manufacturers instructions. Palmitate standard was made by
dissolving 74 mg palmitate into a solution of 35 ml ethanol and
65 ml 6% Triton X-100 to make a high standard of 2.878 mM
and then serially diluted. Absorbance was assessed on a UV/Vis
microplate reader. A standard curve was generated from which
total fatty acid contents from serum samples were interpolated
using the average of triplicate wells.
Glucose tolerance test
Adult p160 rats were fasted for 6 h and then weighed. Blood
samples were collected by tail vein as previously described. A
sample of blood was collected before administration of glucose,
which was then administered orally to each rat (2.5 g glucose/kg
body weight). Blood samples were subsequently collected at
15, 30, 45, 60, 90, and 120 min after glucose challenge from the
tail as described. Serum insulin levels were measured using an
ELISA kit.
Hyperinsulinemic-euglycemic clamp studies
The use of hyperinsulinemic-euglycemic clamp studies was car-
ried out to determine insulin resistance, as the most accurate and
sensitive laboratory method that is specic to hepatic insulin
resistance (58). Experiments were performed as described pre-
viously (59). Adult p160 rats were fasted for 6 h prior to com-
mencement of the experiment. Following aseptic placement of
jugular (for infusion) and carotid (for blood sampling) catheters,
animals were allowed to recover to presurgical weight (710 d).
Clamps were performed in conscious unrestrained animals using
swivels and tethers (Instech, Plymouth Meeting, PA, USA) to al-
low uninterrupted movement of the animal without disruption of
infusion lines. Hyperinsulinemia was initiated by intravenous in-
fusion of insulin (4 mU/kg per min). Blood was sampled from
arterial lines in 7 min intervals and analyzed with a Beckman
Glucose analyzer II (Beckman Coulter, Fullerton, CA, USA).
Euglycemia was maintained by variable infusion of 20% dextrose.
Steady-state glucose (;130 mg/dl) was achieved ;90 min after
initiating hyperinsulinemia and maintained for $45 min. Glu-
cose infusion rates were calculated as the average glucose infusion
rate during the steady-state period. Additional blood samples
were taken before initiating hyperinsulinemia and at the end of
the clamp for analysis of insulin. [14C]Glucose and [3H]2-deox-
yglucose were given as a bolus during the steady state for estimation
of hepatic glucose output and 2-deoxyglucose uptake, as previously
described (60).
Methylation-specic PCR
To map IGF-1 promoter methylation changes, a standard PCR-
based method following bisulte modication was performed as
described previously (33). Briey, primer sets were designed to
probe 3 regions of CpG sites of the IGF-1 P2 transcription start
site. These were forward 59-GGAGGGTTTAATTTATAAAA-
GATTTTAG, reverse 59-CCCAAACCACTTCCTTACCTAA; for-
ward 59-GTTGTTGTTGTTATTGTTYGTGGTA, reverse 59-
CTAAAATCTTTTATAAATTAAACCCTCC; and forward 59-TT-
AGGTAAGGAAGTGGTTTGGG, reverse 59-CACTATCTCAAC-
TACCAAACCAC. PCR conditions were as follows: 95C for 10 min,
and then 94C for 30 s, annealing at 53C for 30 s, and 72C for
30 s for 35 cycles. Primers were designed and gures prepared
with the use of University of California, Santa Cruz Genome
Browser (61). A subset of 8 p21 animals was used for each
condition. PCR products were cloned into the vector pSC-A
(Stratagene, Cedar Creek, TX, USA), and 6 colonies from each
809
cloning were inoculated on SeqPrep 96 plates (Edge Bio-
systems, Gaithersburg, MD, USA). The SeqPrep 96 Plasmid
Prep Kit (Edge Biosystems) was used to prepare the plasmid
DNA according to manufacturers instructions, and the DNA
was then sequenced.
Statistical analyses
Statistical analyses were performed using Prism v6.0 (GraphPad
Software Incorporated, La Jolla, CA, USA). One-way ANOVA with
Bonferronis post hoc analysis was used to compare mean
changes in weight. Students t test was used to compare body mass
composition and serum lipid prole and mean hepatic glucose
output (HGO). Means are reported 6 SEM. Signicance was de-
termined at P , 0.05.
RESULTS
Development of a multigenerational heritable IUGR
rat model
P1 Sprague-Dawley female rats fed a control diet un-
derwent either a sham or bilateral uterine artery ligation
surgery at day 19 after gestation (Fig. 1A). The rats spon-
taneously delivered either the F1 sham control or IUGR
lineage litters (Fig. 1A) and were thereafter culled (n = 8
pups per litter). On p21, the F1 offspring were weaned
onto isocaloric diets of either control or ENS consisting of
the control diet with added folic acid, choline, B12, betaine,
methionine, arginine, and zinc. To establish the F2 line, F1
rats were mated at approximately day 80 of life (Fig. 1B).
IUGR females and males were either fed control or ENS
diets and were paired to establish the IUGRmat/IUGRpat
Figure 1. Mating scheme for heritable growth
restriction in rats. A) Pregnant female Sprague-
Dawley rats (P1) underwent either a bilateral
uterine artery ligation or sham surgery at
gestation day e19. Uterine ligation F1 rats
exhibiting IUGR or sham control rats were
then assigned to a lifelong diet of either control
chow (control) or ENS chow at weaning (p21).
B) At P80, males and females were mated in all
combinations of both maternal and paternal
IUGR lineage with and without ENS. The
resultant F2 generation was assigned the
parental diet of either ENS or control at p21,
generating 8 F2 study groups (n = 512 animals).
810 Vol. 29 March 2015 The FASEB Journal x www.fasebj.org
lineage groups. Rats with either maternal or paternal IUGR
lineage were also mated with sham partners of the same
diet. Additionally, sham males and females were paired
and fed either control or ENS diets. The F1 dams were fed
their lifelong control or ENS diet throughout gestation and
suckling. At weaning, the F2 rats were placed on the same
diet as their F1 parents. All experiments were performed
on the F2 generation.
Multigenerational heritable growth restriction
modiable by ENS in F1 and F2
After spontaneous delivery, fetal weights were obtained
and litters were culled (n = 8 pups per litter). Pups de-
rived from the Shammat/Shampat lineage were signi-
cantly larger at birth than the pups derived from the
IUGRmat/IUGRpat lineage (Fig. 2A, B). Quantication
of birth weights revealed IUGRmat/IUGRpat pups from
the maternal control diet to be 16% less at birth than the
Shammat/Shampat lineage (P , 0.0001; 6.7 vs. 8.0 g, re-
spectively). Pups from either IUGRmat/Shampat (5.8 g)
or Shammat/IUGRpat (6.1 g) lineage also weighed 27%
and 24% less at birth, respectively, than the Shammat/
Shampat lineage (P , 0.0001). With maternal ENS-fed
rats, a 30% decrease in birth weight with the IUGRmat/
IUGRpat lineage was observed, which was statistically
identical to the nonsupplemented IUGRmat/IUGRpat
lineage rats. Similarly, Shammat/IUGRpat ENS-treated
rats showed a marked decrease in birth weight (35%,
P , 0.0001), whereas IUGRmat/Shampat ENS-treated
rats did not show any signicant decrease in weight
compared with Shammat/Shampat controls (Fig. 2B).
GOODSPEED ET AL.
Figure 2. Uterine artery ligation in rats confers heritable growth restriction and adult obesity. A) F2 pups at birth from F1
IUGRpat/IUGRmat lineage and F1 Shampat/Shammat lineage show substantial birth weight differences. B) Differences in mean
birth weight of the F2 generation from the F1 lineage fed either a control or ENS diet. Signicant differences from Shampat/
Shammat control diet are indicated. C) F2 males at p160 from the IUGRpat/IUGRmat lineage fed either a control or ENS diet.
Mean p160 weights for F2 male (D) and female (E) rats, bred from the F1 lineage that were fed either a control or ENS diet.
Signicant differences from Shampat/Shammat control diet are indicated. (aP , 0.05, bP , 0.01, cP , 0.001, dP , 0.0001, 1-way
ANOVA with Bonferronis post hoc test).

These results suggest a multigenerational effect of low
birth weight for the F2 pups, resultant from uteropla-
cental insufciency of the F1 generation.
Male and female pups reassessed at p160 demonstrated
a signicant effect of ENS treatment. Figure 2C shows the
IUGRmat/IUGRpat males fed an ENS diet were smaller
than the IUGRmat/IUGRpat males fed a control diet, which
was true for females as well. Males derived from IUGRmat/
IUGRpat fed a control diet weighed ;17% greater than
males from the Shammat/Shampat (Fig. 2D; P , 0.0001).
Similarly, the females from the IUGRmat/IUGRpat fed
a control diet weighed ;19% more than the Shammat/
Shampat females (Fig. 2E; P , 0.0001). Interestingly how-
ever, both male and female IUGRmat/IUGRpat rats repor-
ted an average ; 20% reduction in weight gain when fed
an ENS diet compared with the Shammat/Shampat control
diet (Fig. 2D, E; P , 0.0001). For IUGRmat/Shampat rats fed
a control diet, there was no statistically signicant differ-
ence in weights from the Shammat/Shampat and only
a small 8% decrease for Shammat/IUGRpat, in female rats
only (P , 0.05; Fig. 2D, E). However, when fed an ENS diet,
the IUGRmat/Shampat males and females weighed signi-
cantly less than the Shammat/Shampat (P , 0.0001 and
0.01, respectively), but Shammat/IUGRpat was signicantly
decreased for males only (P , 0.0001; Fig. 2D, E). Whereas
the Shammat/Shampat showed no signicant change in
mean weight when fed an ENS diet, the obesity evident in
the IUGRmat/IUGRpat control fed was abolished by ENS,
with a more pronounced effect apparent in the males.
Multigenerational heritable obesity and dyslipidemia
modiable by ENS in F1 and F2
To determine the basis for the weight changes in IUGR, the
relative body fat and lipid prole of the animals was char-
acterized as an indication of metabolic health. IUGRmat/
IUGRpat rats fed a control diet were observed to have visibly
more fat mass than either IUGRmat/IUGRpat rats fed an
ENS diet or Shammat/Shampat rats (Fig. 3A). Lean mass
and central fat mass were quantied on adult animals
(p160) using DEXA on a clinical caliber Norland scanner,
for which representative scans are shown in Fig. 3B. No
signicant difference in lean mass in either males or
females was apparent (Fig. 3C, D). The IUGRmat/
IUGRpat males fed a control diet, however, had 3 times
more central fat mass than Shammat/Shampat control
fed (P = 0.05), which was also signicantly greater than

PREVENTION OF HERITABLE METABOLIC DISEASE 811

Figure 3. ENS prevents adult obesity. A) Representative image of the central fat found in IUGR males fed either a control or ENS
diet. BF) DEXA scans for body fat analysis based on tissue density. B) Representative DEXA scans of Shampat/Shammat and
IUGRpat/IUGRmat males fed either a control or ENS diet. Mean lean mass in F2 males (C) and females (D) fed either a control or
ENS diet are indicated compared with Shampat/Shammat control. Differences in mean central fat mass of Shampat/Shammat and
IUGRpat/IUGRmat F2 males (E) and females (F) fed either a control or ENS diet compared with IUGRmat/IUGRpat control fed.
(aP , 0.05 considered signicant, independent Student t test).

either IUGRmat/IUGRpat and Shammat/Shampat males
fed the ENS diet (P = 0.01; Fig. 3E). IUGRmat/IUGRpat
females fed a control diet also had signicantly more
central fat mass than the IUGRmat/IUGRpat females fed
an ENS diet (Fig. 3F; P , 0.01). The increased central fat
mass observed in IUGRmat/IUGRpat males and females
suggests that ENS prevents central fat deposition.
Fasting serum lipid proles were then assessed as
markers of dyslipidemia, which accompanies atheroscle-
rotic disease and is an indication of MetS. Triglycerides
were elevated in IUGRmat/IUGRpat control fed males and
females (P , 0.04), with a signicant reduction in both
Shammat/Shampat and the IUGRmat/IUGRpat ENS fed for
both males and females (P , 0.003; Fig. 4A, B). Similarly,
VLDL appeared elevated for both males and females. Al-
though it did not reach statistical signicance (P = 0.13
and 0.09, respectively), VLDL was nevertheless lowered to
normal levels with ENS supplementation for both sexes
(P , 0.005; Fig. 4C, D). Serum free fatty acid levels also
exhibited the trend of lineage-induced elevation in
IUGRmat/IUGRpat control diet, with males showing ;50%
elevation (P = 0.009), which was reversed in both IUGRmat/
IUGRpat and Shammat/Shampat ENS-fed rats (P , 0.01; Fig.
4E, F). The alterations in serum lipid concentrations sug-
gest that ENS supplementation reverses the IUGR-induced
increases that characterize metabolic disease.
Multigenerational heritable glucose intolerance and
dysglycemia modiable by ENS in F1 and F2
Given the strong relationship between insulin re-
sistance and MetS, hyperinsulinemic-euglycemic clamp
studies with carbon 14-labeled glucose and tridium-
labeled 2-deoxy glucose tracers were performed on
adult animals. These clamp studies were used to discern
the hepatic insulin resistance, as opposed to overall or
peripheral, as a highly specic indication of metabolic
dysregulation. HGO was signicantly higher in IUGRmat/
IUGRpat males than Shammat/Shampat males fed a control
diet (Fig. 5A; P , 0.001), indicative of impaired hepatic in-
sulin sensitivity. When fed an ENS diet, IUGRmat/IUGRpat

812 Vol. 29 March 2015 The FASEB Journal x www.fasebj.org GOODSPEED ET AL.
Figure 4. ENS prevents adult dyslipidemia. Mean triglyceride levels in F2 males (A) and females (B) fed either a control or ENS
diet compared with IUGRmat/IUGRpat control fed. Mean VLDL levels in F2 males (C) and females (D) fed either a control or
ENS diet compared with IUGRmat/IUGRpat control fed. Mean free fatty acid levels in F2 males (E) and females (F) fed either
a control or ENS diet compared with IUGRmat/IUGRpat control fed. (P , 0.05 considered signicant and all signicant values
annotated, independent Student t test).

males exhibited enhanced insulin-mediated suppres-
sion of HGO, reversing them to Shammat/Shampat
control levels (Fig. 5A; P , 0.02). Similarly signicantly
distinct HGO proles were observed among female
offspring (Fig. 5B).
To test for insulin responsiveness, glucose tolerance tests
were also performed. Serum insulin levels were increased
in the IUGRmat/IUGRpat rats fed a control diet compared
with Shammat/Shampat following a glucose challenge (Fig.
5C, D). At 50 min, the insulin levels of both male and female
IUGRmat/IUGRpat rats failed to return to control baseline,
and the levels were still severalfold elevated at 90 min
compared with sham (Fig. 5C, D). For both male and fe-
male rats, their ENS-fed insulin response was very different.
For males, insulin was not discernibly elevated in IUGRmat/
IUGRpat rats fed the ENS diet compared with Shammat/
Shampat (Fig. 5E). For females, there appeared to be a sig-
nicant amelioration of the insulin response for ENS-fed
IUGRmat/IUGRpat rats compared with control diet; how-
ever, insulin remained elevated above baseline at 50 min
(Fig. 5F). Overall, the changes associated with IUGR and
also the abrogation of the phenotype are considerably
more pronounced in the male rats compared with the
females.
IGF-1 promoter methylation in IUGR abrogated
by ENS
To test whether ENS was acting to affect methylation of
critical metabolic regulatory genes, we mapped the meth-
ylation status of the second promoter (P2) of the IGF-1
from liver tissue of the variously treated groups. The pro-
moter map is depicted in Fig. 6A, where vertical lines are
indicative of individual CpG dinucleotides, and amplicons
from each of the areas IIII of the P2 promoter are shown.
Sequencing of bisulte-modied hepatic genomic DNA
revealed site (CpG dinucleotide) specic differential
methylation. Specically, among IUGRmat/IUGRpat
control-fed F2 offspring destined to manifest adult MetS,
we observed signicantly increased P2 methylation com-
pared with Shammat/Shampat control-fed F2 offspring (P =
0.03). Consistent with our phenotypic analysis, there was

PREVENTION OF HERITABLE METABOLIC DISEASE 813

Figure 5. ENS prevents adult insulin resistance. Mean HGO of Shampat/Shammat and IUGRpat/IUGRmat F2 males (A) and
females (B) fed either a control or ENS diet compared with IUGRpat/IUGRmat control. Representative insulin response of
Shampat/Shammat and IUGRpat/IUGRmat F2 male and female without (C, D) and with (E, F) ENS supplementation, respectively,
after glucose challenge. Insulin was measured by ELISA (P , 0.05 considered signicant and all signicant values annotated,
independent Student t test).

no apparent effect of ENS alone on the non-IUGR lineage
animals (Shammat/Shampat ENS fed; Fig. 6B, C). Promoter
area II amplicons retained CpG sites where signicant
methylation changes occurred, whereas areas I and III
showed minimal changes (Fig. 6B). When fed a diet sup-
plemented with essential nutrients inclusive of the one-
carbon intermediates, methylation of the P2 promoter
CpG dinucleotides were signicantly decreased in the
IUGRmat/IUGRpat rats compared with control-fed off-
spring (P = 0.04; Fig. 6C). The altered methylation pat-
terning in a site (CpG dinucleotide and region-specic
manner) suggests that IUGR-mediated methylation
changes in a critical metabolic organ are neither global nor
indiscriminate. Further, the changes in promoter methyl-
ation appear in agreement with IGF-mediated restricted
growth in F1 as previously reported (33).
DISCUSSION
In this study, we used our well-established bilateral uterine
artery ligation model of uteroplacental insufciency to
demonstrate that IUGR induces MetS in the F1 generation
(33, 34) and in the F2 generation. Our novel ndings are
consistent with other ndings of multigenerational effects
in the human population and a single prior maternal lin-
eage rodent study (15, 62). Remarkably, the adult F2
generation exhibited excessive weight with increased
central adiposity and a highly transformed metabolism.
Additionally, the adult F2 phenotype included dyslipi-
demia, signicant insulin resistance, and altered glucose
metabolism, which altogether are characteristics of MetS.
The observed changes were signicant in the males, who
exhibited much greater heritability compared with
females. Most interestingly, the phenotypes were nearly
completely reversed with ENS along the one-carbon
metabolic pathway regardless of sex or amplitude. IGF-1
methylation was also shown to be reversed by ENS. These
results suggest that adaptive epigenomic changes are
modiable and sufciently plastic to reverse or prevent
an inherited diseased epigenome.
The phenotypic consequences of bilateral intrauterine
artery ligation to the F1 generation rats are well established
and include the MetS phenotype of insulin resistance, di-
abetes, hypertriglyceridemia, dyslipidemia, and hyperten-
sion (13, 55, 62, 63). Additionally, a myriad of physiologic
and biochemical changes underlying the phenotype have
been found. These include metabolic changes related to
altered islet development and dysglycemia (20), increased
hepatic glucocorticoid activity (27), altered GLUT1 and
GLUT2 expression (28), hepatic glucose production, he-
patic one-carbon metabolism, altered hepatic fatty acid
metabolism, muscle mitochondrial lipid metabolism, and
cerebral chromatin structure (2931, 64). There is evidence

814 Vol. 29 March 2015 The FASEB Journal x www.fasebj.org GOODSPEED ET AL.
Figure 6. IGF-1 promoter methylation mediated by IUGR and ENS. A) The 3 analyzed regions of promoter 2 of IGF-1 are
depicted together with the amplied areas sequenced. CpG dinucleotides are represented as vertical lines. In total, among the 3
indicated regions, the methylation status of 11 CpG dinucleotides was determined in bisulte-treated hepatic tissue. B)
Methylation patterns of CpG islands on the P2 transcription start site. Open circles are unmethylated CpGs, whereas closed
circles indicate methylated. Promoter site in indicated on the horizontal axis. C) Quantitation of overall methylation changes at
the 11 CpG sites for IUGR and Sham linage mice with and without supplementation. Differences from IUGRmat/IUGRpat are
indicated (independent Student t test, SEM).

of compromised kidney development and function and
an altered intestinal morphology (32, 65, 66). Further,
important molecules related to development and to
a MetS phenotype, such as IGF-1, PGC-1, CPTI, and
PDX1, have been shown to be epigenetically altered (33,
34, 67, 68).
In these extensive and multigenerational experiments,
we were able to enrich our deep phenotyping data across
both the F1 and F2 generations with initial interrogations
into key regulatory genes, such as IGF-1 (33, 34, 67, 68). We
were guided in our decision of which genes and promoters
to interrogate by the established biology, as well as the
known role of methylation in regulating alternate splice
sites for transcription of the IGF-1 P2 promoter (33). We
show that CpG site-specic methylation of the IGF-1 P2
promoter was altered specically and signicantly in the
liver with inclusion of one-carbon metabolism inter-
mediates as dietary supplements. Of note, these mod-
ications occurred only among animals arising from the
IUGR lineage and thus accompany reversal of the adult
MetS phenotype. Although at rst glance it might be
expected that ENS would lead to diffuse methylation
effects in multiple organ and tissue types, it is particularly
signicant that IGF-1 (a central anabolic and devel-
opmental regulator with systemic endocrine function) is
altered by ENS; this is consistent with prior ndings in
a single generation model of uterine artery ligation in the
rat (33).
Hepatic expression of IGF-1 has diverse and systemic
roles in development, growth, and glucose homeostasis,

PREVENTION OF HERITABLE METABOLIC DISEASE 815

and it is known to be adaptively regulated in IUGR (6971).
Increased promoter methylation in the F1 IUGR rat liver
dampens IGF-1 expression in what is also thought to be an
additional epigenetically mediated adaptive mechanism
(33). It is well established that the IGF-1 gene sequence has
variable epigenetic regulation, and accompanying tran-
scriptional changes have been shown repeatedly and by
multiple investigators (33, 35, 39, 54). Despite this, the
mechanisms for multigenerational inheritance observed
here are thus far unclear. Aside from its role in growth and
development, low levels of IGF-1, like those seen accom-
panying increased methylation following placental in-
sufciency (33), is critical to later glucose homeostasis and
insulin resistance (37, 72, 73). Our ndings herein signif-
icantly contribute to the role of epigenomic modications
in both regulating IUGR-mediated adult MetS and an ac-
companying variation in IGF-1 expression and demon-
strate a favorable impact of one-carbon intermediate
supplementation.
Although the metabolic effects to those born of IUGR
pregnancies are well documented, fewer studies have
reported on the multigenerational metabolic effects of
IUGR. Recently, a study focusing on the F2 generation
uncovered that rats with low maternal birth weight due to
late-gestation (e19) uteroplacental insufciency exhibited
a sex-specic reduced insulin response and altered pan-
creatic morphology (55). In another study, female F2 rats
exhibited increased hepatic weight with aberrant glucose
and insulin metabolism (74). Natural experiments and
comparisons to human populations have borne out the
validity of the rodent IUGR models, nding similarities in
epigenetic metabolic regulation (23, 33, 55, 65). Of par-
ticular interest, the Dutch famine studies have identied
transgenerational epigenetic modications and a pro-
pensity for increased adiposity and poor health in F2 as
a result of F1 in utero metabolic restriction (23, 24).
Therefore, although some aspects of metabolic dysfunc-
tion have been demonstrated, it was previously unclear that
MetS can be passed down from F1.
The heritable MetS found in our IUGR model of ute-
roplacental insufciency indicates there are sex-specic
phenotypes for heritability. For instance, males are more
severely affected than females in our model, which is
highlighted by IUGRmat/IUGRpat lineage males de-
veloping the entire spectrum of MetS by adulthood.
However, we are able to ameliorate the metabolic syn-
drome apparent in the IUGRmat/IUGRpat lineage male
rats with feeding of an ENS diet. Conversely, although
IUGRmat/IUGRpat lineage females show a trend toward
MetS, the distinction between IUGRmat/IUGRpat com-
pared with Shammat/Shampat was most evident with re-
spect to adult weight. Similarly, the metabolic end points of
insulin dyslipidemia and insulin resistance were consider-
ably more robust for males. Nevertheless, there was both
evidence of signicant multigenerational inheritance of
the adult MetS phenotype in IUGR lineage offspring, as
well as a statistical amelioration when fed the ENS diet,
regardless of sex. These results are consistent with reports
from others that show sex-specic differences in IUGR (27,
62, 7577). A suggested mechanism to account for the
protected phenotype in females is thought to be through
estrogen signaling, where estrogen regulates levels of
choline, a critical downstream substrate of methionine
816 Vol. 29 March 2015 The FASEB Journal x www.fasebj.org
synthesis. Higher levels of choline have been shown to be
protective of metabolic decits, potentially decreasing the
effects of heritable epigenetic aberrations in females (78, 79).
We nd the effectiveness of ENS supplementation re-
markable in nearly reversing IUGR-associated adult meta-
bolic morbidities. We intentionally initiated the ENS diet
intervention in the F1 at the time of weaning and prior to
the onset of adult MetS, in an effort to both introduce
supplementation prior to adolescence, as well as prior to
evidence of metabolic dysfunction. We demonstrated the
development of the multigenerational phenotype and
the adult MetS phenotypic reversal (but not multigenera-
tional IUGR per se) is abrogated with an early in life ENS
intervention.
Although the ndings here present an interesting
model of the principle of nongenomic coded inheritance
and its implications for human health, there are never-
theless limitations. In humans, as in mice, a variety of fac-
tors, including a nonstandard environment, variable
parental care, and unique nonepigenetically determined
biology of the mother, can inuence the development of
the fetus and confer health altering changes that are not
genetically heritable (80). Likewise, it must also be con-
sidered that the F2 germ line was exposed to relative re-
striction and rescuing ENS supplementation, whereas their
F1 mothers were undergoing growth restriction in utero.
There are examples of germ-line inherited changes that
disappear in F3 (81). It is conceivable that the F2 effects
and reversal thereof came about through epigenetic
modications in meiosis. Nevertheless, this does not di-
minish the signicance that epigenetically programmed
changes regardless of when they occurred are subject to
intervention and mitigation with appropriate diet. It has
been suggested that supplementation along the one-
carbon pathway alters the biochemical balance of reac-
tions for carbohydrate metabolism. As with most experi-
ments of this kind, it is not possible to fully isolate the
desired readouts resultant from genetic regulatory
changes from the direct effects of treatment on metabo-
lism. Although it is suggested here that maternal supple-
mentation of ENS diet may stave off later metabolic disease,
this conclusion is tempered by the use of an animal model.
Further, our model of uteroplacental insufciency is
a particularly severe one.
To our knowledge, we are the rst group to show a near-
complete reversal of heritable MetS through dietary sup-
plementation, as well as a multigenerational transmission
down both maternal and paternal lineages. Using robust
metrics of central fat mass, glucose tolerance, hepatic glu-
cose efux, serum lipid, and free fatty acids, we show that
supplementation with essential nutrients along the one-
carbon pathway prevents adult obesity, dyslipidemia, and
insulin resistance, indicative of metabolic disease. The
novel demonstration of a paternal inheritance of adult
MetS has substantial translational implications, as it
underlines the role of paternal, as well as maternal, factors
as important to noncoded heritability of MetS. Identi-
cations of the mechanisms and genetic targets of herita-
ble epigenetic-mediated metabolic changes and the
molecular mechanisms of phenotypic reversal through
ENS supplementation will reveal insights into the causes
of the developmental origins of health and disease as
they relate to IUGR. Supplementation of IUGR offspring,
GOODSPEED ET AL.
as rst identied at birth, may be a viable intervention to
mitigate the risks conferred by multigenerational in-
heritance of metabolic-related diseases.
The authors thank Xing Yu for the technical contributions
made during this project. Funding for this project was
provided by U.S. National Institutes of Health (NIH) Grant
DP21DP2OD001500-01 (Mapping the Fetal Primate Epige-
nome and Metabolome), and the U.S. NIH Eunice Kennedy
Shriver National Institute of Child Health and Human
Development Reproductive Scientist Development Program
Grant 5K12HD00849 (Transgenerational Growth Restriction
through Altered Placental Epigenetics) (to K.A.).
REFERENCES
1. Barker, D. J., Winter, P. D., Osmond, C., Margetts, B., and
Simmonds, S. J. (1989) Weight in infancy and death from
ischaemic heart disease. Lancet 2, 577580
2. Barker, D. J., Osmond, C., Golding, J., Kuh, D., and Wadsworth,
M. E. (1989) Growth in utero, blood pressure in childhood and
adult life, and mortality from cardiovascular disease. BMJ 298,
564567
3. Skilton, M. R., Evans, N., Grifths, K. A., Harmer, J. A., and
Celermajer, D. S. (2005) Aortic wall thickness in newborns with
intrauterine growth restriction. Lancet 365, 14841486
4. Koklu, E., Ozturk, M. A., Gunes, T., Akcakus, M., and Kurtoglu, S.
(2007) Is increased intima-media thickness associated with pre-
atherosclerotic changes in intrauterine growth restricted new-
borns? Acta Paediatr. 96, 1858
5. Barker, D. J. P., Hales, C. N., Fall, C. H., Osmond, C., Phipps, K.,
and Clark, P. M. (1993) Type 2 (non-insulin-dependent) diabetes
mellitus, hypertension and hyperlipidaemia (syndrome X): re-
lation to reduced fetal growth. Diabetologia 36, 6267
6. Barker, D. J., Martyn, C. N., Osmond, C., Hales, C. N., and Fall,
C. H. (1993) Growth in utero and serum cholesterol concen-
trations in adult life. BMJ 307, 15241527
7. Curhan, G. C., Chertow, G. M., Willett, W. C., Spiegelman, D.,
Colditz, G. A., Manson, J. E., Speizer, F. E., and Stampfer, M. J.
(1996) Birth weight and adult hypertension and obesity in
women. Circulation 94, 13101315
8. Curhan, G. C., Willett, W. C., Rimm, E. B., Spiegelman, D.,
Ascherio, A. L., and Stampfer, M. J. (1996) Birth weight and
adult hypertension, diabetes mellitus, and obesity in US men.
Circulation 94, 32463250
9. Ervin, R. B. (2009) Prevalence of metabolic syndrome among
adults 20 years of age and over, by sex, age, race and ethnicity,
and body mass index: United States, 2003-2006. National Health
Statistics Report 13, 17
10. Kassi, E., Pervanidou, P., Kaltsas, G., and Chrousos, G. (2011)
Metabolic syndrome: denitions and controversies. BMC Med. 9, 48
11. Cornier, M.-A., Dabelea, D., Hernandez, T. L., Lindstrom, R. C.,
Steig, A. J., Stob, N. R., Van Pelt, R. E., Wang, H., and Eckel, R. H.
(2008) The metabolic syndrome. Endocr. Rev. 29, 777822
12. Eckel, R. H., Alberti, K. G., Grundy, S. M., and Zimmet, P. Z.
(2010) The metabolic syndrome. Lancet 375, 181183
13. Simmons, R. A., Templeton, L. J., and Gertz, S. J. (2001) In-
trauterine growth retardation leads to the development of type 2
diabetes in the rat. Diabetes 50, 22792286
14. Benyshek, D. C., Johnston, C. S., and Martin, J. F. (2006) Glucose
metabolism is altered in the adequately-nourished grand-
offspring (F3 generation) of rats malnourished during gesta-
tion and perinatal life. Diabetologia 49, 11171119
15. Jimenez-Chillaron, J. C., Isganaitis, E., Charalambous, M., Gesta,
S., Pentinat-Pelegrin, T., Faucette, R. R., Otis, J. P., Chow, A.,
Diaz, R., Ferguson-Smith, A., and Patti, M. E. (2009) In-
tergenerational transmission of glucose intolerance and obesity
by in utero undernutrition in mice. Diabetes 58, 460468
16. Gallo, L. A., Tran, M., Moritz, K. M., Mazzuca, M. Q., Parry, L. J.,
Westcott, K. T., Jefferies, A. J., Cullen-McEwen, L. A., and
Wlodek, M. E. (2012) Cardio-renal and metabolic adaptations
during pregnancy in female rats born small: implications for
PREVENTION OF HERITABLE METABOLIC DISEASE
maternal health and second generation fetal growth. J. Physiol.
590, 617630
17. Sohi, G., Marchand, K., Revesz, A., Arany, E., and Hardy, D. B.
(2011) Maternal protein restriction elevates cholesterol in adult
rat offspring due to repressive changes in histone modications
at the cholesterol 7alpha-hydroxylase promoter. Mol. Endocrinol.
25, 785798
18. Gong, L., Pan, Y.-X., and Chen, H. (2010) Gestational low pro-
tein diet in the rat mediates Igf2 gene expression in male off-
spring via altered hepatic DNA methylation. Epigenetics 5,
619626
19. Zheng, S., Rollet, M., and Pan, Y.-X. (2011) Maternal protein
restriction during pregnancy induces CCAAT/enhancer-binding
protein (C/EBPb) expression through the regulation of histone
modication at its promoter region in female offspring rat
skeletal muscle. Epigenetics 6, 161170
20. Schwitzgebel, V. M., Somm, E., and Klee, P. (2009) Modeling
intrauterine growth retardation in rodents: Impact on pancreas
development and glucose homeostasis. Mol. Cell. Endocrinol. 304,
7883
21. Suter, M., Bocock, P., Showalter, L., Hu, M., Shope, C.,
McKnight, R., Grove, K., Lane, R., and Aagaard-Tillery, K. (2011)
Epigenomics: maternal high-fat diet exposure in utero disrupts
peripheral circadian gene expression in nonhuman primates.
FASEB J. 25, 714726
22. Hales, C. N., Barker, D. J., Clark, P. M., Cox, L. J., Fall, C.,
Osmond, C., and Winter, P. D. (1991) Fetal and infant growth
and impaired glucose tolerance at age 64. BMJ 303, 10191022
23. Heijmans, B. T., Tobi, E. W., Stein, A. D., Putter, H., Blauw, G.
J., Susser, E. S., Slagboom, P. E., and Lumey, L. H. (2008)
Persistent epigenetic differences associated with prenatal ex-
posure to famine in humans. Proc. Natl. Acad. Sci. USA 105,
1704617049
24. Painter, R. C., Osmond, C., Gluckman, P., Hanson, M., Phillips,
D. I., and Roseboom, T. J. (2008) Transgenerational effects of
prenatal exposure to the Dutch famine on neonatal adiposity
and health in later life. BJOG 115, 12431249
25. Ogata, E. S., Bussey, M. E., and Finley, S. (1986) Altered gas
exchange, limited glucose and branched chain amino acids, and
hypoinsulinism retard fetal growth in the rat. Metabolism 35,
970977
26. Ogata, E. S., Bussey, M. E., LaBarbera, A., and Finley, S. (1985)
Altered growth, hypoglycemia, hypoalaninemia, and ketonemia
in the young rat: postnatal consequences of intrauterine growth
retardation. Pediatr. Res. 19, 3237
27. Baserga, M., Hale, M. A., McKnight, R. A., Yu, X., Callaway, C. W.,
and Lane, R. H. (2005) Uteroplacental insufciency alters he-
patic expression, phosphorylation, and activity of the glucocor-
ticoid receptor in fetal IUGR rats. Am. J. Physiol. Regul. Integr.
Comp. Physiol. 289, R1348R1353
28. Lane, R. H., Crawford, S. E., Flozak, A. S., and Simmons, R. A.
(1999) Localization and quantication of glucose transporters in
liver of growth-retarded fetal and neonatal rats. Am. J. Physiol.
276, E135E142
29. Lane, R. H., Kelley, D. E., Ritov, V. H., Tsirka, A. E., and
Gruetzmacher, E. M. (2001) Altered expression and function of
mitochondrial beta-oxidation enzymes in juvenile intrauterine-
growth-retarded rat skeletal muscle. Pediatr. Res. 50, 8390
30. Lane, R. H., MacLennan, N. K., Hsu, J. L., Janke, S. M., and
Pham, T. D. (2002) Increased hepatic peroxisome proliferator-
activated receptor-gamma coactivator-1 gene expression in a rat
model of intrauterine growth retardation and subsequent insulin
resistance. Endocrinology 143, 24862490
31. Ke, X., Lei, Q., James, S. J., Kelleher, S. L., Melnyk, S., Jernigan,
S., Yu, X., Wang, L., Callaway, C. W., Gill, G., Chan, G. M.,
Albertine, K. H., McKnight, R. A., and Lane, R. H. (2006) Ute-
roplacental insufciency affects epigenetic determinants of
chromatin structure in brains of neonatal and juvenile IUGR
rats. Physiol. Genomics 25, 1628
32. Baserga, M., Hale, M. A., Ke, X., Wang, Z. M., Yu, X., Callaway,
C. W., McKnight, R. A., and Lane, R. H. (2006) Uteroplacental
insufciency increases p53 phosphorylation without triggering
the p53-MDM2 functional circuit response in the IUGR rat kid-
ney. Am. J. Physiol. requl. Integr. Comp. Physiol. 291, R412R418
33. Fu, Q., Yu, X., Callaway, C. W., Lane, R. H., and McKnight, R. A.
(2009) Epigenetics: intrauterine growth retardation (IUGR)
817
 modies the histone code along the rat hepatic IGF-1 gene.
FASEB J. 23, 24382449
34. Park, J. H., Stoffers, D. A., Nicholls, R. D., and Simmons, R. A.
(2008) Development of type 2 diabetes following intrauterine
growth retardation in rats is associated with progressive epige-
netic silencing of Pdx1. J. Clin. Invest. 118, 23162324
35. Tosh, D. N., Fu, Q., Callaway, C. W., McKnight, R. A., McMillen,
I. C., Ross, M. G., Lane, R. H., and Desai, M. (2010) Epigenetics
of programmed obesity: alteration in IUGR rat hepatic IGF1
mRNA expression and histone structure in rapid vs. delayed
postnatal catch-up growth. Am. J. Physiol. Gastrointest. Liver Physiol.
299, G1023G1029
36. Woods, K. A., Camacho-Hubner, C., Savage, M. O., and Clark,
A. J. (1996) Intrauterine growth retardation and postnatal
growth failure associated with deletion of the insulin-like growth
factor I gene. N. Engl. J. Med. 335, 13631367
37. Netchine, I., Azzi, S., Houang, M., Seurin, D., Perin, L., Ricort,
J. M., Daubas, C., Legay, C., Mester, J., Herich, R., Godeau, F.,
and Le Bouc, Y. (2009) Partial primary deciency of insulin-like
growth factor (IGF)-I activity associated with IGF1 mutation
demonstrates its critical role in growth and brain development.
J. Clin. Endocrinol. Metab. 94, 39133921
38. Woods, K. A., Camacho-Hubner, C., Bergman, R. N., Barter, D.,
Clark, A. J., and Savage, M. O. (2000) Effects of insulin-like
growth factor I (IGF-I) therapy on body composition and insulin
resistance in IGF-I gene deletion. J. Clin. Endocrinol. Metab. 85,
14071411
39. Tan, Y., Liu, J., Deng, Y., Cao, H., Xu, D., Cu, F., Lei, Y.,
Magdalou, J., Wu, M., Chen, L., and Wang, H. (2012) Caffeine-
induced fetal rat over-exposure to maternal glucocorticoid and
histone methylation of liver IGF-1 might cause skeletal growth
retardation. Toxicol. Lett. 214, 279287
40. Morgan, H. D., Santos, F., Green, K., Dean, W., and Reik, W.
(2005) Epigenetic reprogramming in mammals. Hum. Mol. Genet.
14, R47R58
41. Waterland, R. A., and Jirtle, R. L. (2003) Transposable elements:
targets for early nutritional effects on epigenetic gene regulation.
Mol. Cell. Biol. 23, 52935300
42. Waterland, R. A., and Jirtle, R. L. (2004) Early nutrition, epige-
netic changes at transposons and imprinted genes, and en-
hanced susceptibility to adult chronic diseases. Nutrition 20,
6368
43. Waterland, R. A., Lin, J. R., Smith, C. A., and Jirtle, R. L.
(2006) Post-weaning diet affects genomic imprinting at the
insulin-like growth factor 2 (Igf2) locus. Hum. Mol. Genet. 15,
705716
44. Jahangir, E., Vita, J. A., Handy, D., Holbrook, M., Palmisano, J.,
Beal, R., Loscalzo, J., and Eberhardt, R. T. (2009) The effect of L-
arginine and creatine on vascular function and homocysteine
metabolism. Vasc. Med. 14, 239248
45. Seki, Y., Williams, L., Vuguin, P. M., and Charron, M. J. (2012)
Minireview: Epigenetic programming of diabetes and obesity:
animal models. Endocrinology 153, 10311038
46. Van den Veyver, I. B. (2002) Genetic effects of methylation diets.
Annu. Rev. Nutr. 22, 255282
47. Dominguez-Salas, P., Moore, S. E., Cole, D., da Costa, K. A., Cox,
S. E., Dyer, R. A., Fulford, A. J., Innis, S. M., Waterland, R. A.,
Zeisel, S. H., Prentice, A. M., and Hennig, B. J. (2013) DNA
methylation potential: dietary intake and blood concentrations
of one-carbon metabolites and cofactors in rural African women.
Am. J. Clin. Nutr. 97, 12171227
48. Cordero, P., Campion, J., Milagro, F. I., and Martinez, J. A.
(2013) Transcriptomic and epigenetic changes in early liver
steatosis associated to obesity: effect of dietary methyl donor
supplementation. Mol. Genet. Metab. 110, 388395
49. Niculescu, M. D., and Zeisel, S. H. (2002) Diet, methyl donors
and DNA methylation: interactions between dietary folate, me-
thionine and choline. J. Nutr. 132(8, Suppl)2333S2335S
50. Anderson, O. S., Sant, K. E., and Dolinoy, D. C. (2012) Nutrition
and epigenetics: an interplay of dietary methyl donors, one-
carbon metabolism and DNA methylation. J. Nutr. Biochem. 23,
853859
51. Dominguez-Salas, P., Cox, S. E., Prentice, A. M., Hennig, B. J.,
and Moore, S. E. (2012) Maternal nutritional status, C(1) me-
tabolism and offspring DNA methylation: a review of current
evidence in human subjects. Proc. Nutr. Soc. 71, 154165
818 Vol. 29 March 2015 The FASEB Journal x www.fasebj.org
52. Lambrot, R., Xu, C., Saint-Phar, S., Chountalos, G., Cohen, T.,
Paquet, M., Suderman, M., Hallett, M., and Kimmins, S. (2013)
Low paternal dietary folate alters the mouse sperm epigenome
and is associated with negative pregnancy outcomes. Nat. Com-
mun. 4, 2889
53. Cordero, P., Gomez-Uriz, A. M., Campion, J., Milagro, F. I., and
Martinez, J. A. (2013) Dietary supplementation with methyl
donors reduces fatty liver and modies the fatty acid synthase
DNA methylation prole in rats fed an obesogenic diet. Genes
Nutr. 8, 105113
54. Ahrens, M., Ammerpohl, O., von Schonfels, W., Kolarova, J.,
Bens, S., Itzel, T., Teufel, A., Herrmann, A., Brosch, M.,
Hinrichsen, H., Erhart, W., Eqberts, J., Sipos, B., Schreiber, S.,
Hasler.R., Stickel, F., Becker, T., Krawczak, M., Rocken,
C., Siebert, R., Schafmayer, C., and Hampe, J. (2013) DNA
methylation analysis in nonalcoholic fatty liver disease suggests
distinct disease-specic and remodeling signatures after bariatric
surgery. Cell Metab. 18, 296302
55. Lane, R. H., Kelley, D. E., Gruetzmacher, E. M., and Devaskar,
S. U. (2001) Uteroplacental insufciency alters hepatic fatty acid-
metabolizing enzymes in juvenile and adult rats. Am. J. Physiol.
Regul. Integr. Comp. Physiol. 280, R183R190
56. Lukaski, H. C. (1993) Soft tissue composition and bone mineral
status: evaluation by dual-energy X-ray absorptiometry. J. Nutr.
123(2, Suppl), 438443
57. Howie, G. J., Sloboda, D. M., Kamal, T., and Vickers, M. H.
(2009) Maternal nutritional history predicts obesity in adult off-
spring independent of postnatal diet. J. Physiol. 587, 905915
58. Kim, J. K. (2009) Hyperinsulinemic-euglycemic clamp to assess
insulin sensitivity in vivo. Methods Mol. Biol. 560, 221238
59. Holland, W. L., Brozinick, J. T., Wang, L. P., Hawkins, E. D.,
Sargent, K. M., Liu, Y., Narra, K., Hoehn, K. L., Knotts, T. A.,
Siesky, A., Nelson, D. H., Karathansis, S. K., Fonternot, G. K.,
Birnhaum, M. J. and Summers, S. A. (2007) Inhibition of
ceramide synthesis ameliorates glucocorticoid-, saturated-fat-,
and obesity-induced insulin resistance. Cell Metab. 5, 167179
60. Ye, J. M., Doyle, P. J., Iglesias, M. A., Watson, D. G., Cooney, G. J.,
and Kraegen, E. W. (2001) Peroxisome proliferator-activated
receptor (PPAR)-alpha activation lowers muscle lipids and
improves insulin sensitivity in high fat-fed rats: comparison with
PPAR-gamma activation. Diabetes 50, 411417
61. Karolchik, D., Hinrichs, A. S., Furey, T. S., Roskin, K. M., Sugnet,
C. W., Haussler, D., and Kent, W. J. (2004) The UCSC Table
Browser data retrieval tool. Nucleic Acids Res. 32, D493D496
62. Tran, M., Gallo, L. A., Jefferies, A. J., Moritz, K. M., and Wlodek,
M. E. (2013) Transgenerational metabolic outcomes associated
with uteroplacental insufciency. J. Endocrinol. 217, 105118
63. Baserga, M., Bares, A. L., Hale, M. A., Callaway, C. W., McKnight,
R. A., Lane, P. H., and Lane, R. H. (2009) Uteroplacental in-
sufciency affects kidney VEGF expression in a model of IUGR
with compensatory glomerular hypertrophy and hypertension.
Early Hum. Dev. 85, 361367
64. MacLennan, N. K., James, S. J., Melnyk, S., Piroozi, A., Jernigan,
S., Hsu, J. L., Janke, S. M., Pham, T. D., and Lane, R. H. (2004)
Uteroplacental insufciency alters DNA methylation, one-carbon
metabolism, and histone acetylation in IUGR rats. Physiol.
Genomics 18, 4350
65. Fu, Q., McKnight, R. A., Yu, X., Wang, L., Callaway, C. W., and
Lane, R. H. (2004) Uteroplacental insufciency induces site-
specic changes in histone H3 covalent modications and affects
DNA-histone H3 positioning in day 0 IUGR rat liver. Physiol.
Genomics 20, 108116
66. Baserga, M., Bertolotto, C., Maclennan, N. K., Hsu, J. L., Pham,
T., Laksana, G. S., and Lane, R. H. (2004) Uteroplacental in-
sufciency decreases small intestine growth and alters apoptotic
homeostasis in term intrauterine growth retarded rats. Early
Hum. Dev. 79, 93105
67. Thompson, R. F., Fazzari, M. J., Niu, H., Barzilai, N., Simmons,
R. A., and Greally, J. M. (2010) Experimental intrauterine growth
restriction induces alterations in DNA methylation and gene
expression in pancreatic islets of rats. J. Biol. Chem. 285,
1511115118
68. Ganu, R. S., Harris, R. A., Collins, K., and Aagaard, K. M. (2012)
Early origins of adult disease: approaches for investigating the
programmable epigenome in humans, nonhuman primates, and
rodents. ILAR J. 53, 306321
GOODSPEED ET AL.
69. Seferovic, M. D., Ali, R., Kamei, H., Liu, S., Khosravi, J. M.,
Nazarian, S., Han, V. K., Duan, C., and Gupta, M. B. (2009)
Hypoxia and leucine deprivation induce human insulin-like
growth factor binding protein-1 hyperphosphorylation and in-
crease its biological activity. Endocrinology 150, 220231
70. Abu Shehab, M., Inoue, S., Han, V. K. M., and Gupta, M. B.
(2009) Site specic phosphorylation of insulin-like growth factor
binding protein-1 (IGFBP-1) for evaluating clinical relevancy in
fetal growth restriction. J. Proteome Res. 8, 53255335
71. Watson, C. S., Bialek, P., Anzo, M., Khosravi, J., Yee, S. P., and
Han, V. K. (2006) Elevated circulating insulin-like growth factor
binding protein-1 is sufcient to cause fetal growth restriction.
Endocrinology 147, 11751186
72. Sjogren, K., Wallenius, K., Liu, J. L., Bohlooly-Y, M., Pacini, G.,
Svensson, L., Tornell, J., Isaksson, O. G., Ahren, B., Jansson, J. O.,
and Ohlsson, C. (2001) Liver-derived IGF-I is of importance for
normal carbohydrate and lipid metabolism. Diabetes 50,
15391545
73. Haluzik, M., Yakar, S., Gavrilova, O., Setser, J., Boisclair, Y., and
LeRoith, D. (2003) Insulin resistance in the liver-specic IGF-1
gene-deleted mouse is abrogated by deletion of the acid-labile
subunit of the IGF-binding protein-3 complex: relative roles of
growth hormone and IGF-1 in insulin resistance. Diabetes 52,
24832489
74. Thamotharan, M., Garg, M., Oak, S., Rogers, L. M., Pan, G.,
Sangiorgi, F., Lee, P. W., and Devaskar, S. U. (2007) Trans-
generational inheritance of the insulin-resistant phenotype
in embryo-transferred intrauterine growth-restricted adult fe-
male rat offspring. Am. J. Physiol. Endocrinol. Metab. 292, E1270
E1279
PREVENTION OF HERITABLE METABOLIC DISEASE
75. Maloney, C. A., Hay, S. M., Young, L. E., Sinclair, K. D., and Rees,
W. D. (2011) A methyl-decient diet fed to rat dams during the
peri-conception period programs glucose homeostasis in adult
male but not female offspring. J. Nutr. 141, 95100
76. Fu, Q., McKnight, R. A., Yu, X., Callaway, C. W., and Lane, R. H.
(2006) Growth retardation alters the epigenetic characteristics of
hepatic dual specicity phosphatase 5. FASEB J. 20, 21272129
77. Lane, R. H., Maclennan, N. K., Daood, M. J., Hsu, J. L., Janke,
S. M., Pham, T. D., Puri, A. R., and Watchko, J. F. (2003) IUGR
alters postnatal rat skeletal muscle peroxisome proliferator-
activated receptor-gamma coactivator-1 gene expression in a -
ber specic manner. Pediatr. Res. 53, 9941000
78. Fischer, L. M., Costa, K., Kwock, L., Galanko, J., and Zeisel, S. H.
(2010) Dietary choline requirements of women: effects of es-
trogen and genetic variation. Am. J. Clin. Nutr. 92, 11131119
79. Resseguie, M., Song, J., Niculescu, M. D., da Costa, K. A., Randall,
T. A., and Zeisel, S. H. (2007) Phosphatidylethanolamine N-
methyltransferase (PEMT) gene expression is induced by estro-
gen in human and mouse primary hepatocytes. FASEB J. 21,
26222632
80. Grossniklaus, U., Kelly, W. G., Ferguson-Smith, A. C., Pembrey,
M., and Lindquist, S. (2013) Transgenerational epigenetic in-
heritance: how important is it? Nat. Rev. Genet. 14, 228235
81. Waterland, R. A., Travisano, M., and Tahiliani, K. G. (2007) Diet-
induced hypermethylation at agouti viable yellow is not inherited
transgenerationally through the female. FASEB J. 21, 33803385
Received for publication July 23, 2014.
Accepted for publication October 14, 2014.
819