362

Journal of Food Protection, Vol. 65, No. 2, 2002, Pages 362366

Copyright Q, International Association for Food Protection

Identi cation of Cows Milk in Buffalo Cheese by

Duplex Polymerase Chain Reaction
M. T. BOTTERO, 1* T. CIVERA,1 A. ANASTASIO, 2 R. M. TURI,1 AND S. ROSATI 3

1Dipartimento di Patologia Animale, Universita degli Studi Torino, Italy; 2Dipartimento di Scienze Zootecniche e Ispezione degli alimenti, Universita
degli Studi Napoli, Italy; and 3 Dipartimento di Produzioni Animali, Epidemiologia ed Ecologia,
Universita degli Studi Torino, Italy

MS 01-230: Received 22 June 2001/Accepted 11 September 2001

ABSTRACT
A duplex polymerase chain reaction (PCR) was developed to identify the milk of bovine and buffalo species in cheese
products, particularly in mozzarella cheese, a typical Italian cheese made from buffalos milk. Two sets of primers were
designed on the basis of the alignment of the sequence codifying mitochondrial cyt b available in the GenBank database. The
primers proved to be species-specic, giving rise to 279-bp (bovine) and 192-bp (buffalo) ampli ed fragments. Since the
ampli cation conditions for bovine and buffalo primers were identical, a duplex PCR was successfully applied to identify the
two species in a single reaction step. This technique, when used to test cheese products from the retail trade, allowed the
detection of partial or even total substitution of cows milk for buffalos milk, in some cases in samples of cheese misleadingly
labeled pure buffalo mozzarella.

Identi cation of the species of origin for milk products
is important from a theoretical standpoint and useful in
practice, because it allows the detection of fraud in the form
of the substitution of a less costly type of milk for one of
a higher quality. Electrophoretic methods have been used
extensively to achieve the identi cation of milks species
of origin. Two-dimensional electrophoresis and isoelectric
focusing have been applied for the detection of cows milk
in buffalo mozzarella cheese (1, 8) and in ewes milk cheese
(2), respectively. More recently, capillary electrophoresis
has been reported to be an ef cient and quick method for
the differentiation of cows, ewes, and goats milk (7, 17,
18). However, electrophoretic methods are expensive, time-
consuming, and not always applicable to foodstuffs that
have been subjected to severe heat treatments.
In the last few years, biomolecular techniques have
been applied for milk differentiation and have proved to be
reliable, sensitive, and fast. Nevertheless, in dairy products
as well as in other foodstuffs (9, 14, 20), some dif culties
have emerged in recognizing the milks of closely related
species, such as sheep and goats, cows and buffalos, and
pigs and wild boars, because of the possibility of cross-
reaction. To overcome this problem, more than one tech-
nique may be applied contemporarily, e.g., polymerase
chain reaction associated with restriction fragment length
polymorphism (PCR-RFLP), which entails the ampli ca-
tion of a common fragment followed by digestion with one
or more species-speci c restriction enzymes (4, 6). An al-
* Author for correspondence. Present address: Dipartimento di Patologia
Animale, via Leonardo da Vinci 44, 10095 Grugliasco Torino, Italy. Tel:
1 39 11 6709215; Fax: 1 39 11 6709212;
E-mail: bottero@veter.unito.it.
ternative approach might be to design species-speci c prim-
ers so as to achieve the same result in a single PCR step.
The aim of this study was to develop a duplex PCR
capable of identifying and discriminating between bovine
and buffalo DNA in a single PCR reaction. This method
was used to detect cows milk in cheeses labeled pure
buffalo. Evaluation of the species of origin of the milk
used in these products is important mainly in Italy, where
the milk of the water buffalo (Bubalus bubalus) is exclu-
sively used in some cheeses, particularly in mozzarella di
bufala campana, a high-grade, high-quality cheese typical
of southern Italy that in 1996 obtained the European Pro-
tected Denomination of Origin (DOP) mark (11). DOP is
the mark given by the European community to special food
products whose peculiar characteristics are strictly related
to the area in which they are manufactured as well as to
the raw matter and manufacturing practices. The results of
this evaluation are discussed and compared with those re-
ported in the literature.
MATERIALS AND METHODS
Specimens. Six buffalo blood samples from the Mediterra-
nean breed (the only buffalo breed raised in Italy) were obtained
from different farms. Eight samples of cows blood were obtained
from different breeds, and Aubek cell culture was used as a bovine
reference specimen. Blood samples and the Aubek cell line were
preliminarily used as known controls to assess the ability of each
primer set to speci cally recognize the homologous target.
Samples of soft and ripened cheeses included three samples
of mozzarella di bufala campana DOP, two mozzarella cheeses
made with cows milk, six samples allegedly made with only buf-
falos milk, and one cheese made with both cows milk and buf-
falos milk (mixed mozzarella). All samples were purchased from
Italian supermarkets. Moreover, one sample of mozzarella cheese
J. Food Prot., Vol. 65, No. 2 IDENTIFICATION OF COWS MILK IN BUFFALO CHEESE
was prepared from a mixture of 70% cows milk and 30% buf-
falos milk in a cheese factory under controlled conditions.
DNA extraction. To extract DNA from blood, heparinated
samples were subjected to centrifugation at 3,000 rpm for 20 min,
and 1 ml of buffy coat was withdrawn and stored at 2208C. DNA
was extracted using the Blood and/or Tissue Protocol (Qiagen)
from 50 ml of buffy coat and 200 ml of Aubek cells (;5 3 106
cells per ml) following the manufacturers protocol. The DNA
obtained from the Aubek cells and from the buffalo blood and the
cow blood was quanti ed by specrophotometry (Ultraspec 2000,
Amersham Pharmacia Biotech, Uppsala, Sweden) and diluted to
obtain a concentration of 10 ng/ml. DNA from cheese samples
was extracted following the Blood and/or Tissue Protocol as mod-
i ed by Bottero et al. (5). The DNA concentration was measured
as described above.
PCR and duplex PCR. Alignment of 15 buffalo and 4 bo-
vine mitochondrial cyt b sequences available in the GenBank da-
tabase was carried out with CLUSTAL W, version 1.6 (12). Spe-
cies-speci c primers (synthesized by Roche Diagnostic, Monza,
Italy) were designed for the gene fragment in which dissimilarities
between the two species were marked in order to generate species-
speci c amplicons of different lengths. Oligonucleotide sets were
14814 (59-GGCTTATATTACGGGTCTTACACT-39; sense) and
15092 (59-GGCAATTGCTATGATGATAAATGGA-39; antisense)
for the cow (GenBank accession number J01394) and 301 (59-
GGCATATACTACGGATCATATACC-39; sense) and 492 (59-
AATTCATTCAACCAGACTTG TACCA-39; antisense) for the
buffalo (GenBank accession number D82894).
Ampli cations were carried out with a nal volume of 50 ml
containing 10 mM Tris-HCl (pH 8.3), 1 U of AmpliTaq Gold
DNA polymerase (PE Applied Biosystems, Foster City, Calif.),
0.2 mM dATP, 0.2 mM dCTP, 0.2 mM dGTP, 0.2 mM dTTP
(Pharmacia, Uppsala, Sweden), 2.5 mM MgCl2, 25 pmol of each
primer, and 50 ng of DNA template. An initial denaturation step
at 948C for 5 min was followed by 35 cycles of 948C for 30 s,
608C for 1 min, and 728C for 1 min and a nal extension at 728C
for 5 min. PCR fragments of the expected length were puri ed
with the Concert Rapid PCR Puri cation System (GIBCO) and
cycle sequenced (both strands) with PCR-derived primers on an
ABI 310 Genetic Analyzer (Applied Biosystems) by the dideoxy
chain termination method with uorescence dye terminators (Ap-
plied Biosystems).
Nucleotide sequences were submitted to a BLASTn sequence
similarity search (3) of the National Center for Biotechnology In-
formation database and were aligned with the aforementioned bo-
vine and buffalo sequences available in the GenBank database. In
order to develop an assay to identify both species in a single
reaction, a duplex PCR was carried out as described above, but
the reaction mixture contained the two sets of primers in a single
tube. Amplimers were resolved with 2.5% agarose electrophoresis,
which was carried out with Tris acetate EDTA buffer for 60 min
at 120 V, and stained with ethidium bromide (0.4 mg/ml for 20
min.).
PCR-RFLP. For six samples labeled pure buffalo for eterolog species, respectively, further supporting the spec-
which the duplex PCR had indicated the presence of bovine milk,
a PCR-RFLP analysis was performed as a con rmatory test. Prim-
ers for the ampli cation of mammalian mitochondrial cyt b se-
quences, L 14841 (59-CCATCCAACATCTCAGCATGATGAAA-
39) and H 15149 (59-GCCCCTCAGAATGATATTTGTCCTCA-39)
(13), were synthesized by Roche Diagnostic and stored at 2208C.
The PCR reaction was performed with a nal volume of 50 ml
following the protocol described by Branciari et al. (6) except for
363
FIGURE 1. PCR of a bovine cyt b gene fragment (279 bp) with
bovine blood samples obtained from different breeds. M, 100-bp
ladder; lane 1, Montbeillard; lanes 2, 3, and 6, crossbreed; lanes
4, 5, and 7, Piemontese; lane 8, Pezzata rossa; lane 9, buffalo
negative control (blood); lane 10, control reagents.
the MgCl2 and Taq concentrations (2.5 mM and 2 U, respec-
tively), which gave an optimal yield. Twelve microliters of PCR
product was digested in a total volume of 15 ml containing 3 U
of restriction enzyme (HinfI) under the conditions suggested by
the manufacturer. The fragments were resolved on agarose gel
prepared as described above, but at a 2% concentration instead of
a 2.5% concentration.
RESULTS
Preliminary tests were carried out on cow and buffalo
blood samples to verify the species speci cities of the two
sets of primers we designed. The primers speci c for the
cow, tested individually, were challenged with one sample
of DNA extracted from buffalo blood and one extracted
from bovine Aubek cells. The analysis revealed only the
speci c bovine band of 279 bp, while no band appeared in
presence of buffalo DNA. Similarly, the primers speci c
for the buffalo produced a band at 192 bp only in the pres-
ence of buffalo DNA, without showing any cross-reaction
with the cow (not shown).
Analogous tests were performed on eight samples of
the blood of different breeds of cow (Figs. 1 and 4) and on
six samples of the blood of the only breed of buffalo raised
in Italy (Figs. 2 and 3). The results con rmed the strong
speci city of our primers in discriminating cow DNA from
buffalo DNA. Moreover, a BLASTn similarity search con-
ducted with bovine sequences generated in our study re-
vealed 100 and 88% homology between bovine and buffalo
sequences available in GenBank, respectively (with the
primer sequence not included). On the other hand, when
the buffalo sequence generated in our study was analyzed,
98 and 86% similarities were obtained with homolog and
i city of the test.
When duplex PCR was carried out on analogous sam-
ples, the set of primers retained the same speci city and
was used to test the cheese made from 70% cows milk and
30% buffalos milk under controlled conditions (Fig. 5).
After these preliminary assays, the test was applied to sam-
ples of cheeses from the retail trade. Figure 6 summarizes
364 BOTTERO ET AL.
FIGURE 2. PCR of a bovine cyt b gene fragment (279 bp) with
buffalo blood samples obtained from different geographical lo-
cations. M, 100-bp ladder; lanes 1 through 4, district of Salerno;
lanes 5 and 6, district of Caserta; lane 7, bovine positive control
(Aubek cells); lane 8, control reagent.
typical test results. A unique 192-bp fragment appeared in
samples relating to the three mozzarella di bufala campana
DOP samples (Fig. 6, lanes 3, 4, and 5). Similarly, for
cows milk mozzarella cheese samples, only the 279-bp
fragment was detectable (Fig. 6, lanes 13 and 14). The con-
temporary presence of the two speci c bands was observed
in samples labeled mixed bovine and buffalo cheese
(Fig. 6, lanes 11 and 12). Both types of milk were also
detected in some samples of cheeses claiming to be pure
buffalo (Fig. 6, lanes 6 through 10). Finally, a unique
bovine amplimer with no apparent buffalo-related signal in
one sample labeled pure buffalo (lane 2) suggested that
in this case cows milk was entirely substituted for buffalos
milk. Samples that did not match what was claimed on the
label were subsequently submitted to PCR-RFLP assays for
con rmation. The results unambiguously con rmed those
obtained with duplex PCR.
FIGURE 3. PCR of a buffalo cyt b gene fragment (192 bp) with
buffalo blood samples obtained from different geographical lo-
cations. M, 100-bp ladder; lane 1, control reagents; lanes 2
through 5, district of Salerno; lanes 6 and 7, district of Caserta;
lane 8, bovine negative control (Aubek cells).
J. Food Prot., Vol. 65, No. 2
FIGURE 4. PCR of a buffalo cyt b gene fragment (192 bp) with
bovine blood samples obtained from different breeds. M, 100-bp
ladder; lanes 1 through 8, as in Figure 1; lane 9, control re-
agents; lane 10, bovine negative control (Aubek cells); lane 11,
buffalo positive control (blood).
DISCUSSION
The aim of our study was to determine whether it was
possible to differentiate between cows milk and buffalos
milk in dairy products with a single PCR test. To differ-
entiate between closely related species, other authors have
used universal primers that were able to amplify a 359-bp
fragment of mitochondrial cyt b common to various mam-
mals to develop a PCR-RFLP assay (6, 16, 19).
We attempted to design species-speci c primers based
on the alignment of several sequences available in Gen-
Bank. The region chosen for primer design showed mod-
erate variability between the two species, although it was
constant within each species. The primers were designed to
have 25 to 28% mismatch; in fact, as pointed out by Mat-
sunaga et al. (15), in a multiplex PCR involving six differ-
ent species, it is advisable to design primers having at least
15% mismatch. The annealing temperature of 608C was
very similar for each primer, allowing a highly speci c am-
pli cation that nevertheless did not compromise sensitivity,
FIGURE 5. Results of 2.5% agarose gel electrophoresis of duplex
PCR products ampli ed from buffalo blood (lane 1), cow blood
(lane 2), mixed mozzarella (70% bovine and 30% buffalo; lane3),
and control reagent (lane 4). M, 100-bp ladder.
J. Food Prot., Vol. 65, No. 2 IDENTIFICATION OF COWS MILK IN BUFFALO CHEESE
FIGURE 6. Duplex PCR of bovine and buffalo cyt b gene frag-
ments (279 and 192 bp, respectively) in cheese samples purport-
ing to be made from buffalos milk (lanes 2 through 10), a mixture
of cows milk and buffalos milk (lanes 11 and 12), and cows
milk (lanes 13 and 14). Lane 1, control reagent; lane 15, bovine
positive control (Aubek cells); lane 16, buffalo positive control
(blood); M, marker (100-bp ladder).
since the amplimer yields were satisfactory and no false
negatives were recorded.
Furthermore, PCR assays performed on blood samples
indicated the primers speci city, which was subsequently
con rmed by sequencing. At the same time, the interfer-
ence of any breed or individual was excluded. It must be
noted that the only buffalo breed raised in Italy is the Bu-
falo Mediterraneo breed and that the DOP protocol for the
mozzarella di bufala campana cheese compels the use of
milk from this breed, prohibiting any importation of buf-
falos milk from foreign countries (11). Since the two PCR
protocols for individually tested bovine and buffalo primers
were practically identical with regard to their ampli cation
365
conditions, we developed a duplex PCR to detect both spe-
cies in a single reaction step, a strategy that has been pro-
posed by other authors to differentiate the pig from the cow
(16).
The two ampli ed fragments differed by 87 bp, a dif-
ference that was easily resolved by 2.5% agarose gel elec-
trophoresis; polyacrylamide gel electrophoresis is undoubt-
edly less suitable for routine analysis and was therefore
avoided. For the cheeses we tested, the duplex PCR re-
vealed disagreements with what was claimed in some cases,
for example, for cheeses labeled pure buffalo, for which
the DNA pattern was characteristic of a mixture of cows
milk and buffalos milk or even cows milk alone.
To con rm our results, we performed a PCR-RFLP
analysis on the samples that were shown to contain both
cows milk and buffalos milk despite the pure buffalo
label, in order to compare our method with a method ex-
tensively used to discriminate between bovine and buffalo
products in various foodstuffs (4, 6, 16, 19). The test con-
rmed our previous results. When the bovine band alone is
present for a cheese labeled pure buffalo, fraud is un-
mistakable. On the other hand, the presence of both the
bovine and the buffalo bands could be due to either inad-
vertent contamination or fraudulent use of bovine milk in
the manufacture of mozzarella cheese. To investigate the
contamination hypothesis, we examined several samples of
buffalo mozzarella made in a plant where cows milk
and buffalos milk are processed in sequence and with the
same equipment. Duplex PCR analysis revealed extensive
bovine contamination of buffalo products (not shown). This
nding indicates that the presence of a bovine band in buf-
falo cheese samples is not always attributable to fraud. In
fact, the majority of the cheese plants in the south of Italy
process milk from both species, and this practice may ex-
plain the presence of bovine DNA in pure buffalo sam-
ples.
It can be concluded that this novel duplex PCR test is
effective in discriminating between cows milk and buffa-
los milk. The assay may be suitable as a routine test, since
it is more rapid than conventional methods and shows con-
siderable sensitivity. However, when the PCR test detects
the contemporary presence of the milk of both species in
products purported to be made from the milk of a single
species, it is dif cult to establish whether this nding
should be ascribed to fraud or to inadvertent contamination
during processing. For this reason, where DOP buffalo
mozzarella cheese is concerned, an accurate separation of
the different manufacturing chains is advisable.
In addition, the same test could be suitable for the de-
tection of buffalo species in meat products subjected to se-
vere heat treatment, producing fragmentation of DNA (9,
10). Such detection could be possible because of the small
sizes of the fragments ampli ed in the duplex PCR de-
scribed in this paper.
ACKNOWLEDGMENTS
The research presented in this paper has been supported by a grant
from the Italian Ministry of University and Scienti c Research (MURST).
366 BOTTERO ET AL.
The nucleotide sequence data reported in this paper have been submitted
to GenBank under accession numbers AF371961 and AF371962.
REFERENCES
1. Addeo, F., L. Moio, L. Chianese, and G. Nota. 1989. Evaluation of
bovine and water buffalo milk in mixtures of liquid milk and moz-
zarella cheese by gel isoelectric focusing. Ital. J. Food Sci. 3:7180.
2. Addeo, F., L. Moio, L. Chianese, C. Stingo, P. Resmini, I. Berner, I.
Krause, A. Di Luccia, and A. Bocca. 1990. Use of plasmin to in-
crease the sensitivity of the detection of bovine milk in ovine cheese
by gel isoelectric focusing of g2 -caseins. Milchwissenschaft 45:708
711.
3. Altschul, S. F., W. Gish, W. Miller, E. W. Myers, and D. J. Lipman.
1990. Basic local alignment search tool. J. Mol. Biol. 215:403410.
4. Bardin, M. G., C. Bandi, P. Bolla, A. Caroli, and G. Damiani. 1994.
Identi cazione e dosaggio di DNA bovino miscelato a DNA di bu-
falo mediante polymerase chain reaction. Sci. Tec. Latt. Casear. 45:
8794.
5. Bottero, M. T., T. Civera, R. M. Turi, and S. Rosati. 1999. Impiego
della polymerase chain reaction (PCR) nel controllo delle frodi leg-
ate alla sostituzione di specie in prodotti sottoposti ad alte temper-
ature. Ind. Alim. 38:1820.
6. Branciari, R., I. J. Nijman, M. E. Plas, E. Di Antonio, and J. A.
Lenstra. 2000. Species origin of milk in Italian mozzarella and Greek
feta cheese. J. Food Prot. 63:408411.
7. Cartoni, G. P., F. Coccioli, R. Jasionowska, and M. Masci. 1998.
Determination of cow milk in ewe milk and cheese by capillary
electrophoresis of the whey protein fractions. Ital. J. Food Sci. 10:
317327.
8. Chianese, L., P. Laezza, L. A. Smaldone, C. Stingo, L. Del Giovine,
and F. Addeo. 1990. Evaluation of bovine milk in the buffalo moz-
zarella cheese by two-dimensional electrophoresis. Sci. Tec. Latt.
Casear. 41(Suppl.):315326.
9. Chikuni, K., T. Tabata, M. Kosugiyama, M. Monma, and M. Saito.
1994. Polymerase chain reaction assay for detection of sheep and
goat meats. Meat Sci. 37:337345.
J. Food Prot., Vol. 65, No. 2
10. Ebbehj, K. F., and P. D. Thomsen. 1991. Species differentiation of
heated meat products by DNA hybridization. Meat Sci. 30:221234.
11. Gazzetta Uf ciale della Comunita Europea. 1996. Riconoscimento
della denominazione di origine protetta per la mozzarella di bufala
campana. Gazz. Uf c. Com. Eur. 148:1516.
12. Higgins, D. G., A. J. Bleasby, and R. Fuchs. 1992. CLUSTAL W:
improved software for multiple sequence alignment. Comput. Appl.
Biosci. 8:44204449.
13. Kocher, T. D., W. K. Thomas, A. Meyer, S. V. Edwards, S. Paabo,
F. X. Villablanca, and A. C. Wilson. 1989. Dynamics of mitochon-
drial DNA evolution in animals: ampli cation and sequencing with
conserved primers. Proc. Natl. Acad. Sci. USA 86:62016205.
14. Koh, M. C., C. H. Lim, S. B. Chua, S. T. Chew, and T. W. Phang.
1998. Random ampli ed polymorphic DNA (RAPD) ngerprints for
identi cation of red meat animal species. Meat Sci. 48:275285.
15. Matsunaga, T., K. Chikuni, R. Tanabe, S. Muroya, K. Shibata, J.
Yamada, and Y. Shinmura. 1999. A quick and simple method for the
identi cation of meat species and meat products by PCR assay. Meat
Sci. 51:143148.
16. Meyer, R., C. Hofelein, J. Luthy, and U. Candrian. 1995. Polymerase
chain reactionrestriction fragment length polymorphism analysis: a
simple method for species identi cation in food. J. AOAC Int. 78:
15421551.
17. Molina, E., M. De Frutos, and M. Ramos. 2000. Capillary electro-
phoresis characterization of the casein fraction of cheeses made from
cows, ewes and goats milks. J. Dairy Res. 67:209216.
18. Molina, E., P. J. Martin-Alvarez, and M. Ramos. 1999. Analysis of
cows, ewes and goats milk mixtures by capillary electrophoresis:
quanti cation by multivariate regression analysis. Int. Dairy J. 9:99
105.
19. Partis, L., D. Croan, Z. Guo, R. Clark, T. Coldham, and J. Murby.
2000. Evaluation of a DNA ngerprinting method for determining
the species origin of meats. Meat Sci. 54:369376.
20. Rea, S., K. Chikuni, and P. Avellini. 1996. Possibility of using single
strand conformation polymorphism (SSCP) analysis for discriminat-
ing European pig and wild board meat samples. Ital. J. Food Sci. 3:
211220.