INFECTION AND IMMUNITY, Aug. 1998, p. 39253930 Vol. 66, No.

8
0019-9567/98/$04.0010
Copyright 1998, American Society for Microbiology. All Rights Reserved.

Passive Immunization with Antibodies against Three Distinct

Epitopes on Plasmodium yoelii Merozoite Surface
Protein 1 Suppresses Parasitemia
LILIAN M. SPENCER VALERO, SOLABOMI A. OGUN, SUZANNE L. FLECK, IRENE T. LING,
TERRY J. SCOTT-FINNIGAN, MICHAEL J. BLACKMAN, AND ANTHONY A. HOLDER*
Division of Parasitology, National Institute for Medical Research, London NW7 1AA, United Kingdom
Received 10 February 1998/Returned for modification 31 March 1998/Accepted 6 May 1998

We have produced monoclonal antibodies against Plasmodium yoelii merozoite surface protein 1 (MSP-1)
and have assessed their ability to suppress blood stage parasitemia by passive immunization. Six immuno-
globulin G antibodies were characterized in detail: three (B6, D3, and F5) were effective in suppressing a lethal
blood stage challenge infection, two (B10 and G3) were partially effective, and one (B4) was ineffective. MSP-1

Downloaded from http://iai.asm.org/ on June 1, 2017 by guest

is the precursor to a complex of polypeptides on the merozoite surface; all of the antibodies bound to this
precursor and to an ;42-kDa fragment (MSP-142) that is derived from the C terminus of MSP-1. MSP-142 is
further cleaved to an N-terminal ;33-kDa polypeptide (MSP-133) and a C-terminal ;19-kDa polypeptide
(MSP-119) comprised of two epidermal growth factor (EGF)-like modules. D3 reacted with MSP-142 but not
with either of the constituents MSP-133 and MSP-119, B4 recognized an epitope within the N terminus of
MSP-133, and B6, B10, F5, and G3 bound to MSP-119. B10 and G3 bound to epitopes that required both
C-terminal EGF-like modules for their formation, whereas B6 and F5 bound to epitopes in the first EGF-like
module. These results indicate that at least three distinct epitopes on P. yoelii MSP-1 are recognized by
antibodies that suppress parasitemia in vivo.

Malaria is a disease caused by parasites of the genus Plas-
modium, which have a complex life cycle with several distinct
stages in vertebrates. A number of antigens that may be targets
of protective host immune responses have been identified. The
asexual stage of parasite multiplication within erythrocytes
leads to the release of merozoites that invade further erythro-
cytes. Merozoite surface protein 1 (MSP-1) has been identified
as a target of protective immune responses and a potential
vaccine candidate. In Plasmodium falciparum this protein is
synthesized as a precursor during schizogony and then is pro-
cessed to a complex of polypeptides on the merozoite surface
(19, 27). A similar processing may occur in other species of
Plasmodium (5, 12, 20, 28). At or just before invasion, proteo-
lytic cleavage of the C-terminal ;42-kDa polypeptide (MSP-
142) produces a new membrane-bound, ;19-kDa fragment
(MSP-119), which is carried into the newly invaded erythrocyte
(2), and a soluble ;33-kDa fragment (MSP-133), which is shed
from the surface with the rest of the complex. MSP-119 is a
cysteine-rich domain composed of two epidermal growth fac-
tor (EGF)-like modules containing disulfide bonds that main-
tain the three-dimensional structure (3). Mice immunized with
recombinant Plasmodium yoelii MSP-119 are protected against
challenge infection with this parasite (9, 23, 31), and this pro-
tection appears to be antibody mediated (10, 23, 25). One
monoclonal antibody (MAb), MAb 302, that reacts with the
C-terminal cysteine-rich region of P. yoelii MSP-1 (6) and on
passive immunization is effective against a blood stage chal-
lenge infection (26) has been described. Here we describe
additional MAbs that bind to P. yoelii MSP-1 and suppress
blood stage parasitemia. These inhibitory antibodies define at
* Corresponding author. Mailing address: Division of Parasitology,
National Institute for Medical Research, Mill Hill, London NW7 1AA,
United Kingdom. Phone: (44) 181 959 3666, ext. 2175. Fax: (44) 181
913 8593. E-mail: aholder@nimr.mrc.ac.uk.
least three distinct epitopes, two in MSP-119 and a third that is
detected only on intact MSP-1 and the C-terminal MSP-142.
MATERIALS AND METHODS
Expression and purification of recombinant proteins. Both the C-terminal
fragment of MSP-1 containing both EGF-like modules (MSP-119, residues 1649
to 1754 in the amino acid sequence [22]) and the two individual modules were
expressed in Escherichia coli as glutathione S-transferase (GST) fusion proteins
(23, 24) and purified by binding to glutathione-agarose (30). Recombinant MSP-
119 (rMSP-119) was produced by cleavage of GSTMSP-119 with the protease
factor Xa (Boehringer) and separated from GST by gel filtration (24). Three
recombinant GST fusion proteins, corresponding to most of the sequence of
MSP-133 and to the N- and C-terminal parts, were produced. The oligonucleo-
tides 59-CTAGGATCCACACAAAAAGGTTGGGTAG (primer 1), 59-CCAG
AATTCATTTAATTCCGTCAGTAGTTG (primer 2), 59-CTAGGATCCAAG
CTGCAGTAAAGGAACA (primer 3), and 59-CCAGAATTCAGTGTTTATT
ATTTTCTGCATG (primer 4) were used to amplify DNA by PCR from the
clone PyM4.3 (kindly provided by Alan Lewis), corresponding to amino acid
residues Thr1415 to Lys1513 (primers 1 and 2; PyMSP133B), Ala1527 to His1619
(primers 3 and 4; PyMSP133C), and Thr1415 to His1619 (primers 1 and 4;
PyMSP133A). The DNA was restricted with BamHI and EcoRI (sites in the
primers above are underlined) and then cloned into the corresponding sites of
the plasmid pGEX3X. The fusion proteins were purified as described above.
Production and characterization of MAbs. Female BALB/c mice were immu-
nized intraperitoneally with the recombinant protein GSTMSP-119 by using
Freunds adjuvant (23). Alternatively, the mice were immunized by infection
following passive immunization with an inhibitory MAb derived from the first
fusion: mice that had been challenged with 5 3 103 parasites after passive
immunization with MAb B10 (see below) were inoculated with a further 5 3 108
parasitized erythrocytes on three occasions. Spleen cells were fused with SP2/0-
Ag14 mouse myeloma cells in the presence of 50% polyethylene glycol, using 8 3
107 spleen cells and 2 3 107 myeloma cells. The cells were dispensed into 96-well
culture plates in 100 ml of hypoxanthine-aminopterin-thymidine selective me-
dium. After 10 days, the supernatants were tested for specific antibody by indi-
rect immunofluorescence on acetone-fixed preparations of erythrocytes infected
with P. yoelii YM and by enzyme-linked immunosorbent assay (ELISA) with
rMSP-119. The hybridomas producing antibody considered positive in one or
both of the assays were cloned by three rounds of limiting dilution in hypoxan-
thine-thymidine medium, and selected hybridomas were expanded by growth in
RPMI 1640 medium containing 10% (vol/vol) fetal calf serum.
The antibodies secreted by the hybridomas B4, B6, B10, D3, F5, and G3 were
affinity purified from culture supernatant on columns of protein G-Sepharose 4
Fast Flow (Pharmacia) (1) according to the manufacturers recommendations,
and purity was monitored by sodium dodecyl sulfate-polyacrylamide gel electro-

3925
3926 SPENCER VALERO ET AL. INFECT. IMMUN.

TABLE 1. Properties of MSP-1-specific MAbs Passive immunization and parasite challenge. Female BALB/c mice from 8
weeks of age and bred under specific-pathogen-free conditions were used in
Reaction Binding to recombinant GST fusion proteinb: groups of 10 animals. The purified MAbs (a total of 1.5 mg/mouse) were admin-
MAb Subclass with istered by intraperitoneal injection on three occasions, i.e., 1 day before, 1 day
MSP-1a MSP1EGF1 MSP1EGF2 MSP-119 MSP-133 after and on the day of challenge infection. The parasite used for the challenge
was the lethal YM strain of P. yoelii; the parasite stock was stored at 2195C and
B4 IgG1 1 2 2 2 1 passaged once before use in the experiment. The challenge was administered by
B6 IgG3 1 1 2 1 2 intravenous injection into the lateral tail vein with 5 3 103 parasitized erythro-
B10 IgG2b 1 2 2 1 2 cytes per mouse, at least 1 h after administration of the MAb. Parasitemia was
D3 IgG2a 1 2 2 2 2 assessed daily on smears made from tail blood and stained with Giemsas re-
F5 IgG3 1 1 2 1 2 agent.
G3 IgG1 1 2 2 1 2 Immunoprecipitation, immunoblotting, and immunofluorescence. Blood was
harvested from P. yoelii-infected mice, passed through a cellulose powder (CF-
a
The reaction with MSP-1 was determined by immunofluorescence, immuno- 11) column to eliminate the leukocytes, and eluted with Krebs glucose saline.
precipitation, and Western blotting. The parasites were then washed with RPMI 1640 medium (methionine and
b
The binding of the MAbs to the different recombinant proteins was deter- cysteine free) containing 2 mM glutamine. Trophozoites and schizonts were
mined by Western blotting and ELISA. MSP1EGF1 is the first EGF-like module isolated by centrifugation through a Percoll gradient (60 to 80%) and metabol-
of P. yoelii MSP-119, MSP1EGF2 is the second EGF-like module of MSP-119, ically radiolabelled with 5 MBq of Tran35S-label (70% L-[35S]methionine, 15%
MSP-119 is the two combined EGF-like modules, and MSP-133 is the N-terminal 35
L-[ S]cysteine) (ICN) per ml at 37C for 2 to 3 h. The preparation of detergent
part of MSP-142; all of the recombinant proteins were expressed as GST fusion extract and the immunoprecipitation and analysis of labelled polypeptides by
proteins in E. coli. SDS-PAGE and fluorography were carried out essentially as described previ-
ously (24). For immunoblotting, recombinant proteins or parasite extract was

Downloaded from http://iai.asm.org/ on June 1, 2017 by guest

phoresis (SDS-PAGE). Antibody isotypes were determined by double diffusion
and capture ELISA with a kit (Sigma) according to the manufacturers recom-
mendations. Antibody titers were determined by indirect immunofluorescence
and by ELISA with rMSP-119, using twofold serial dilutions of antibody, essen-
tially as described previously (24).
denatured in SDS sample buffer, fractionated by SDS-PAGE, and electro-
phoretically transferred to nitrocellulose (Schleicher and Schuell; 0.2-mm pore
size). The detection of proteins on the blot with specific antibody was carried out
as described previously (24). MAb 25.1 (18), normal mouse serum, and a poly-
clonal antiserum raised by immunization with GSTMSP-119 (24) were used as
controls.
For immunofluorescence studies, erythrocytes infected with P. yoelii YM were

FIG. 1. Course of P. yoelii YM infection in groups of 10 BALB/c mice injected intraperitoneally with solutions of MAbs, followed by intravenous challenge with
5 3 103 parasitized erythrocytes per mouse. Mice in each group received 0.5 mg of IgG in PBS intraperitoneally on days 21, 0, and 11 relative to the day of parasite
challenge (day 0). B6 (), F5 (}), and D3 (E) substantially modified the course of the infection; B10 (F) and G3 ({) were less effective. The parasitemias in mice treated
with B4 () and in mice treated with an irrelevant MAb (data not shown) were indistinguishable from that in the group that received PBS (). All of the mice cleared
the infection, except for those that received B4 and PBS, which died on day 7, and 40% of the mice treated with G3, which died on days 8 and 9. Each point represents
the geometric mean parasitemia of mice in each group at the time after parasite challenge, and the vertical bars indicate the standard errors.
VOL. 66, 1998 PASSIVE IMMUNIZATION AGAINST P. YOELII 3927

washed, aliquoted onto multiwell slides, and fixed in methanol-acetone (1:1,

vol/vol) for 10 min. MAbs were diluted 1:100 and incubated on the slide for 30
min at room temperature. After washing, the slides were incubated with fluo-
rescein isothiocyanate-conjugated goat anti-mouse immunoglobulin G (IgG)
(Sigma) for 30 min, washed, and dipped in 0.05% Evans blue1 mg of DAPI
(49,6-diamidino-2-phenylindole) per ml. They were then examined by fluores-
cence microscopy.
Competition ELISA. The wells of 96-well microplates (Dynatech Immulon-4)
were coated with 1 mg of rMSP-119 per ml and then blocked with bovine serum
albumin, as described previously (24). After incubation for 1 h at 37C with the
first MAb, the wells were washed three times with washing buffer and then
incubated with the second biotinylated MAb (prepared by using sulfo-NHS-
biotin [Pierce] according to the manufacturers recommendation) for 1 h at 37C,
using a concentration that had been determined previously by titration. The wells
were washed three times, and then 100 ml of horseradish peroxidase-conjugated
streptavidin (10 mg/ml) was added and left for 1 h at 37C. After a final three
washes, 100 ml of o-phenylenediamine substrate was added. The color reaction
was stopped by addition of 50 ml of 1 M sulfuric acid, and the absorbance was
read at 492 nm as described previously (24). The ability of a MAb to inhibit the
binding of the biotinylated second MAb to the antigen was analyzed by compar-
ing the mean absorbance values in the presence of different competitor MAbs by
the Kruskal-Wallis test.

Downloaded from http://iai.asm.org/ on June 1, 2017 by guest

RESULTS

Passive immunization suppresses parasitemia. Of 12 hy-

bridoma cell lines that were cloned, 6 (B4, B6, B10, D3, F5,
and G3) that secrete antibody specific for P. yoelii MSP-1 were
characterized further, and the MAbs were analyzed in detail.
Hybridomas B10 and G3 were produced after immunization
with the recombinant protein GSTMSP-119, and the others
were produced after passive immunization with B10 and infec-
tion with the parasite. The subclass of each antibody is shown
in Table 1.
The ability of the MAbs to protect mice against a blood
stage challenge infection with P. yoelii YM by passive immu-
nization was evaluated. Purified IgG was inoculated into
groups of mice at the time of parasite challenge, and the
development of parasitemia was monitored (Fig. 1). One an-
tibody (B4) had no effect on the course of parasitemia; all mice
developed a fulminating infection similar to that in the group
inoculated with phosphate-buffered saline (PBS) alone, and
none survived beyond day 7. Two of the antibodies (B10 and
G3) produced a partial suppression of parasite growth. How-
ever, the mean parasitemia in the group that received G3
exceeded 70% on day 14, and only 60% of the mice cleared the
infection; in the group that received B10, the parasitemia ex-
ceeded 50%, although all of the mice cleared the infection and
survived. Three of the antibodies (B6, D3, and F5) mediated a
substantial reduction in parasitemia, and all of the mice in
these groups cleared the infection. In the animals that received
MAb D3, the parasites were largely restricted to reticulocytes.
The MAbs react with MSP-1 and its fragments in parasite
extracts. As determined by indirect immunofluorescence, all of
the MAbs produced a distinctive pattern with schizonts and
merozoites, characteristic of an antigen present on the parasite
surface (Fig. 2). In addition, B6 (Fig. 2a), B10, F5, and G3 also
reacted with ring stage parasites. All MAbs immunoprecipi-
tated the 230-kDa MSP-1 precursor from detergent lysates of
schizonts (Fig. 3); this protein was also recognized by MAb
25.1 (18) and a polyclonal serum specific for MSP-1 (23) but
not by antibodies in normal mouse serum. As determined by
Western blotting, all of the MAbs recognized MSP-142 in par-
asite extract enriched for merozoites (Fig. 4A); this protein was
also detected by polyclonal antibodies raised by immunization
with GSTMSP-119. In addition, MAbs B6 (Fig. 4A, lane 2),
B10 (lane 3), F5 (lane 5), and G3 (lane 6) detected MSP-119.
In merozoite extracts incubated for 1 h to allow further MSP-1
processing and the formation of MSP-133, MAb B4 detected an
FIG. 2. Immunofluorescence patterns of MAbs reactive with MSP-1 on
methanolacetone-fixed smears of erythrocytes infected with P. yoelii YM. The
smears were incubated with MAb B6 (a) or MAb B4 (b), and antibody binding
was detected with a second fluorescein isothiocyanate-labelled antibody. (c and
d) Corresponding smears stained with DAPI to locate DNA. Note the reaction
with schizonts and ring stages in panel a and with schizonts alone in panel b,
despite the presence of young parasites detected in panel d by nuclear staining.
No specific fluorescence was detected with an irrelevant first antibody or with the
second labelled antibody alone (data not shown).
additional species of ;33 kDa (Fig. 4B, lane 1) that was not
detected by D3 (lane 2) or F5 (lane 3).
Some of the MAbs react with recombinant proteins. To
locate more precisely the epitopes recognized by the MAbs,
the ability of the antibodies to bind to recombinant proteins
expressed from parts of the MSP-1 gene was investigated by
Western blotting. The results of this analysis are summarized
in Table 1. MAbs B6, B10, F5, and G3 bound to GSTMSP-
119, indicating that they recognize epitopes in the C-terminal
cysteine-rich region of MSP-1. None of the MAbs bound to the
second EGF-like module fused to GST (GST-MSP1EGF2),
but both B6 and F5 bound to the first EGF-like module fused
to GST (GST-MSP1EGF1). This reactivity was abolished
when the recombinant proteins were reduced and alkylated
with iodoacetic acid before SDS-PAGE, a treatment that de-
stroys epitopes that require disulfide bonds for their integrity
(23, 24). MAbs B4 and D3 did not bind to GSTMSP-119.
However, B4 reacted with the recombinant proteins GST
MSP-133A (Fig. 5, lane 1) and GSTMSP-133B (Fig. 5, lane 2)
but not with GSTMSP-133C (Fig. 5, lane 3), indicating that it
bound an epitope in the N-terminal half of MSP-133.
Analysis of the antibodies by competition ELISA. To study
the epitopes on rMSP-119 recognized by the different MAbs,
they were analyzed by competition ELISA (Table 2). MAbs G3
and B10 competed with each other for binding to GSTMSP-
119 but not with any of the other antibodies. F5 competed with
itself but not with B6, although B6 was able to compete effec-
3928 SPENCER VALERO ET AL. INFECT. IMMUN.

FIG. 5. MAb B4 binds to an epitope in the N-terminal end of MSP-133.

Recombinant proteins consisting of MSP-133 sequences fused to GST were
fractionated by SDS-PAGE on a 12.5% polyacrylamide gel under reducing
conditions, transferred to nitrocellulose, and then probed with the MAb. Lane 1,
PyMSP133A (Thr1415 to His1619); lane 2, PyMSP133B (Thr1415 to Lys1513); lane 3,
PyMSP133C (Ala1527 to His1619). The mobilities of molecular mass standards
(New England Biolabs) (in kilodaltons) are shown. The antibody did not react
with GST alone, none of the other MAbs reacted with GSTMSP-133A, and each
of the fusion proteins was detected with antibody specific for GST (data not
shown).

Downloaded from http://iai.asm.org/ on June 1, 2017 by guest

FIG. 3. The MAbs immunoprecipitate MSP-1 from extracts of 35S-labelled P.
yoelii YM-infected erythrocytes solubilized with buffer containing detergent. In
this experiment the following MAbs were used: B6 (lane 1), D3 (lane 2), F5 (lane
3), and G3 (lane 4). The immunoprecipitates were analyzed by SDS-PAGE on a
7.5% polyacrylamide gel and detected by fluorography. The position of MSP-1
on the left and the mobilities of standard molecular mass markers (Pharmacia)
(in kilodaltons) on the right are indicated. MSP-1 was also precipitated by B4,
B10, 25.1, and a polyclonal antiserum to GSTMSP-119 but not by antibodies in
normal mouse serum (not shown).
tively with F5. As expected from the Western blot data, D3 and
B4 did not bind to rMSP-119 (not shown) and did not compete
with the other antibodies.
DISCUSSION
Previous studies have shown that immunization of mice with
P. yoelii MSP-1 provides some protection against challenge
infection with lethal strains of the parasite (15, 18). Immuni-
zation with recombinant protein corresponding to the C-ter-
minal cysteine-rich region of P. yoelii MSP-1 has been found to
be highly effective (9, 17, 23), and it has been suggested that
antibody is important in mediating the protection observed
(10, 17, 23, 25). In previous studies polyclonal antibodies raised
by immunization with affinity-purified MSP-1 (15) or a MAb
specific for an epitope at the N terminus of the protein (14)
was not effective by passive immunization. In contrast, a MAb
specific for the C-terminal cysteine-rich region of MSP-1 (26)
and polyclonal antibodies raised by immunization with recom-
binant MSP-119 (10, 25) were at least partly effective in sup-
pressing parasitemia. In this study we report six additional
MSP-1-specific MAbs and define additional specificities for
antibodies that are at least partially protective after passive
immunization. One of these (D3) defines an epitope on the
larger C-terminal fragment MSP-142.
Of the three MAbs that were most effective at suppressing
the parasitemia after passive immunization, two of them (F5
and B6) are of the IgG3 subclass, and the other (D3) is an
IgG2a. The subclass and specificity (see below) of F5 and B6
suggest that they are antibodies similar to MAb 302, the IgG3
reported by Majarian et al. (26). Two other MAbs, B10 and G3
(IgG2b and IgG1, respectively), were also able to modify the
course of parasitemia, and some mice survived the challenge
infection. MAb B4 was unable to modify the course of infec-
tion after passive immunization, and all mice developed a
fulminating infection, a pattern similar to that obtained with a
control MAb (data not shown). Determination of whether
there is a correlation between subclass, as well as epitope
specificity, and the ability of IgG to protect mice requires
further investigation. The specific contributions of different
IgG subclasses to protection mediated by immunization with

FIG. 4. The MAbs react with fragments of MSP-1 in an extract of P. yoelii YM merozoites by Western blotting. (A) The samples were subjected to SDS-PAGE
(without prior reduction) on a 5 to 15% polyacrylamide gradient gel, blotted onto nitrocellulose and then probed with MAb B4 (lane 1), B6 (lane 2), B10 (lane 3), D3
(lane 4), F5 (lane 5), or G3 (lane 6) or with polyclonal anti-GSTMSP-119 (lane 7) and normal mouse serum (lane 8). The positions of MSP-142 and MSP-119 on the
left and the mobilities of standard molecular mass markers (in kilodaltons) on the right are indicated. (B) The merozoites were incubated in vitro to allow processing
to continue before analysis. The samples were fractionated on a 12.5% polyacrylamide gel, blotted, and probed with MAbs B4 (lane 1), D3 (lane 2), and F5 (lane 3).
The positions of MSP-142, MSP-133, and MSP-119 on the left and the mobilities of standard molecular mass markers (in kilodaltons) on the right are indicated.
VOL. 66, 1998
TABLE 2. Comparison of the different MAbs by
competition ELISA
Competition with labelled MAba:
Competitor
MAb B6 B10 F5 G3
B6 1 2 1 2
B10 2 1 2 1/2
F5 2 2 1 2
G3 2 1 2 1
B4 2 2 2 2
D3 2 2 2 2
PBS 2 2 2 2
a
1, inhibition of binding of biotinylated MAb to MSP-119 by nonlabelled
MAb; 2, no inhibition of binding of biotinylated MAb to MSP-119 by nonla-
belled MAb.
recombinant proteins corresponding to the C terminus of
MSP-1 have not been evaluated in detail, although correlations
of protection with subclass have suggested that IgG1, IgG2a,
and IgG2b are important (11, 13, 25, 31). Passive immunization
with IgG fractions isolated from sera of mice immune to P.
yoelii infection suggested that IgG2a was of particular impor-
tance (33). The fact that MAbs against P. falciparum MSP-119
that inhibit erythrocyte invasion in vitro appear to do so by
inhibiting secondary processing of MSP-142 suggests that their
activity is based on a steric effect rather than one requiring a
specific Fc-mediated function (4). It will be of interest to de-
termine whether the P. yoelii MSP-1-specific MAbs that are
effective after passive immunization also inhibit P. yoelii MSP-1
processing in vitro.
All of the antibodies react with the intact MSP-1 precursor
as assessed by immunoprecipitation from schizont extracts and
with the C-terminal MSP-142 in merozoite extracts. The West-
ern blotting results with the recombinant proteins indicate that
B10 and G3 recognize epitopes in MSP-119 that require both
EGF-like modules to be present in the protein, whereas B6
and F5 recognize epitopes in the first EGF-like module. The
specificity of B6 and F5 appears to be similar to that of MAb
302, described previously (6). The epitopes for all of these
antibodies are constrained by disulfide bonds, since they do not
recognize the reduced and alkylated GSTMSP-119. These re-
sults are consistent with the results of the competition ELISA,
which suggest that the epitopes for B10 and G3 overlap, may
be identical, and are different from the epitopes for B6 and F5,
which also appear to overlap each other but clearly are distinct
epitopes. All of these antibodies recognize schizont and ring
stage parasites as determined by indirect immunofluorescence,
indicating that they react with the small C-terminal fragment of
MSP-1 that results from secondary processing of MSP-1 at the
time of invasion and is carried into newly invaded erythrocytes
(2, 5, 28).
MAbs D3 and B4 did not recognize ring stage parasites as
determined by immunofluorescence, suggesting that they do
not bind directly to MSP-119. The epitope for B4 was mapped
to the N-terminal region of MSP-142 by reaction with a recom-
binant protein containing amino acid sequences from this re-
gion. This antibody also reacted with an ;33-kDa polypeptide
present in merozoite preparations that had been incubated for
1 h to allow processing to proceed. This polypeptide is prob-
ably analogous to the soluble 33-kDa fragment (PfMSP-133)
resulting from secondary processing of P. falciparum MSP-142
and shed from the merozoite surface at the time of erythrocyte
invasion (4). This is the first description of a MAb to this part
of P. yoelii MSP-1, and it will be of use in studying the proteo-
lytic processing of this molecule. MAb D3 reacts with MSP-142
PASSIVE IMMUNIZATION AGAINST P. YOELII 3929
but not with either the N-terminal (MSP-133) or C-terminal
(MSP-119) part alone, suggesting that it binds to the site of
secondary processing or to an epitope that requires intact
MSP-142.
The results are consistent with the demonstration that im-
munization with the C terminus of P. yoelii MSP-1 can protect
mice against challenge infection with blood stage parasites and
that this protection is mediated, at least in part, by antibody.
Although two of the protective antibodies are directed against
the first EGF-like module, immunization with GST-MSP1EGF1
alone does not protect mice against blood stage challenge (7,
24). Immunization with a recombinant protein containing the
two EGF-like modules (MSP-119) does protect against a blood
stage parasite or sporozoite challenge (9, 17, 23, 29, 31). How-
ever, the identification of a MAb that is effective on passive
immunization and does not recognize just the C terminus of
MSP-1 alone suggests that the optimal immunogen may con-
tain sequence in addition to MSP-119. Successful immunization
Downloaded from http://iai.asm.org/ on June 1, 2017 by guest
with a GSTMSP-142 recombinant protein was reported re-
cently, but the protection observed was no better than that
mediated by MSP-119 alone (32). For development of a vaccine
against P. falciparum, both MSP-142 and MSP-119 are being
considered (8, 21), but comparative studies of the two have not
been performed so far. The development of effective vaccines
based on MSP-1 may also be compromised by the presence of
epitopes that induce blocking antibodies that abrogate the
action of neutralizing antibodies (4, 16), so it will be important
to define in detail the fine specificity of MSP-1-specific IgG
with biological activity and to modify the antigen to remove
epitopes that induce blocking antibodies without affecting
those that induce protective antibodies.
ACKNOWLEDGMENTS
Lilian Spencer was in receipt of a studentship from CONICIT,
Venezuela. This work was supported in part by the UNDP/World
Bank/WHO Special Programme for Research and Training in Tropical
Diseases (TDR), EC contract TS3*93 0228, and the Medical Research
Council.
We thank M. Goggin for cell culture.
REFERENCES
1. Akerstrom, B., T. Brodin, K. Reis, and L. Bjorck. 1985. Protein G: a powerful
tool for binding and detection of monoclonal and polyclonal antibodies.
J. Immunol. 135:25892592.
2. Blackman, M. J., H.-G. Heidrich, S. Donachie, J. S. McBride, and A. A.
Holder. 1990. A single fragment of a malaria merozoite surface protein
remains on the parasite surface during red cell invasion and is the target of
invasion-inhibiting antibodies. J. Exp. Med. 172:379382.
3. Blackman, M. J., I. T. Ling, S. C. Nicholls, and A. A. Holder. 1991. Proteo-
lytic processing of the Plasmodium falciparum merozoite surface protein-1
produces a membrane-bound fragment containing two epidermal growth
factor-like domains. Mol. Biochem. Parasitol. 49:2934.
4. Blackman, M. J., T. J. Scott-Finnigan, S. Shai, and A. A. Holder. 1994.
Antibodies inhibit the protease-mediated processing of a malaria merozoite
surface protein. J. Exp. Med. 180:389393.
5. Blackman, M. J., E. D. Dennis, E. M. A. Hirst, C. H. Kocken, T. J. Scott-
Finnigan, and A. W. Thomas. 1996. Plasmodium knowlesi: secondary pro-
cessing of the malaria merozoite surface protein-1. Exp. Parasitol. 83:229
239.
6. Burns, J. M., W. R. Majarian, J. F. Young, T. M. Daly, and C. A. Long. 1989.
A protective monoclonal antibody recognizes an epitope in the carboxyl-
terminal cysteine-rich domain in the precursor of the major merozoite sur-
face antigen of the rodent malarial parasite, Plasmodium yoelii. J. Immunol.
143:26702676.
7. Calvo, P. A., T. M. Daly, and C. A. Long. 1996. Plasmodium yoelii: the role
of the individual epidermal growth factor-like domains of the merozoite
surface protein-1 in protection from malaria. Exp. Parasitol. 82:5464.
8. Chang, S. P., S. E. Case, W. L. Gosnell, A. Hashimoto, K. J. Kramer, L. Q.
Tam, C. Q. Hashiro, C. M. Nikaido, H. L. Gibson, C. T. Lee-Ng, P. J. Barr,
B. T. Yokota, and G. S. N. Hui. 1996. A recombinant baculovirus 42-kilo-
dalton C-terminal fragment of Plasmodium falciparum merozoite surface
protein 1 protects Aotus monkeys against malaria. Infect. Immun. 64:253
261.
3930 SPENCER VALERO ET AL.
9. Daly, T. M., and C. A. Long. 1993. A recombinant 15-kilodalton carboxyl-
terminal fragment of Plasmodium yoelii yoelii 17XL merozoite surface pro-
tein 1 induces a protective immune response in mice. Infect. Immun. 61:
24622467.
10. Daly, T. M., and C. A. Long. 1995. Humoral response to a carboxyl-terminal
region of the merozoite surface protein-1 plays a predominant role in con-
trolling blood-stage infection in rodent malaria. J. Immunol. 155:236243.
11. Daly, T. M., and C. A. Long. 1996. Influence of adjuvants on protection
induced by a recombinant fusion protein against malaria infection. Infect.
Immun. 64:26022608.
12. David, P. H., T. J. Hadley, M. Aikawa, and L. H. Miller. 1984. Processing of
a major parasite surface glycoprotein during the ultimate stages of differen-
tiation in Plasmodium knowlesi. Mol. Biochem. Parasitol. 11:267282.
13. de Souza, J. B., I. T. Ling, S. A. Ogun, A. A. Holder, and J. H. L. Playfair.
1996. Cytokines and antibody subclass associated with protective immunity
against blood stage malaria in mice vaccinated with the C terminus of
merozoite surface protein 1 plus a novel adjuvant. Infect. Immun. 64:3532
3536.
14. Freeman, R. R., A. J. Trejdosiewicz, and G. A. M. Cross. 1980. Protective
monoclonal antibodies recognising stage-specific merozoite antigens of a
rodent malaria parasite. Nature 284:366368.
15. Freeman, R. R., and A. A. Holder. 1983. Characteristics of the protective
response of BALB/c mice immunized with a purified Plasmodium yoelii
schizont antigen. Clin. Exp. Immunol. 54:609616.
16. Guevara Patino, J. A., A. A. Holder, J. S. McBride, and M. J. Blackman.
1997. Antibodies that inhibit malaria merozoite surface protein-1 processing
and erythrocyte invasion are blocked by naturally acquired human antibod-
ies. J. Exp. Med. 186:111.
17. Hirunpetcharat, C., J.-H. Tian, D. C. Kaslow, N. van Rooijen, S. Kumar,
J. A. Berzofsky, L. H. Miller, and M. F. Good. 1997. Complete protective
immunity induced in mice by immunization with the 19-kilodalton carboxyl-
terminal fragment of the merozoite surface protein-1 (MSP119) of Plasmo-
dium yoelii expressed in Sacchromyces cerevisiae. J. Immunol. 159:34003411.
18. Holder, A. A., and R. R. Freeman. 1981. Immunization against blood-stage
rodent malaria using purified parasite antigens. Nature 294:361364.
19. Holder, A. A., and R. R. Freeman. 1982. Biosynthesis and processing of a
Plasmodium falciparum schizont antigen recognized by immune serum and a
monoclonal antibody. J. Exp. Med. 156:15281538.
20. Holder, A. A., and R. R. Freeman. 1984. Characterization of a high molecular
weight protective antigen of Plasmodium yoelii. Parasitology 88:211219.
21. Kumar, S., A. Yadava, D. B. Keister, J.-H. Tian, M. Ohl, K. A. Perdue-
Greenfield, L. H. Miller, and D. C. Kaslow. 1995. Immunogenicity and in vivo
Editor: J. M. Mansfield
INFECT. IMMUN.
efficacy of recombinant Plasmodium falciparum merozoite surface protein-1
in Aotus monkeys. Mol. Med. 1:325332.
22. Lewis, A. P. 1989. Cloning and analysis of the gene encoding the 230-kDa
merozoite surface antigen of Plasmodium yoelii. Mol. Biochem. Parasitol.
36:271282.
23. Ling, I. T., S. A. Ogun, and A. A. Holder. 1994. Immunisation against malaria
with a recombinant protein. Parasite Immunol. 16:6367.
24. Ling, I. T., S. A. Ogun, and A. A. Holder. 1995. The two epidermal growth
factor-like modules of Plasmodium yoelii Merozoite Surface Protein-1 are
required for an effective immune response to the parasite. Parasite Immunol.
17:425433.
25. Ling, I. T., S. A. Ogun, P. Momin, R. L. Richards, N. Garcon, J. Cohen, W. R.
Ballou, and A. A. Holder. 1997. Immunization against the murine malaria
parasite Plasmodium yoelii using a recombinant protein with adjuvants de-
veloped for clinical use. Vaccine 15:15621567.
26. Majarian, W. R., T. M. Daly, W. P. Weidanz, and C. A. Long. 1984. Passive
immunization against murine malaria with IgG3 monoclonal antibody. J. Im-
munol. 132:31313137.
27. McBride, J. S., and H.-G. Heidrich. 1987. Fragments of the polymorphic Mr
185,000 glycoprotein from the surface of isolated Plasmodium falciparum
merozoites form an antigenic complex. Mol. Biochem. Parasitol. 23:7184.
28. ODea, K. P., P. G. McKean, A. Harris, and K. N. Brown. 1995. Processing
of the Plasmodium chabaudi chabaudi AS merozoite surface protein 1 in vivo
Downloaded from http://iai.asm.org/ on June 1, 2017 by guest
and in vitro. Mol. Biochem. Parasitol. 72:111119.
29. Renia, L., I. T. Ling, M. Marussig, F. Miltgen, A. A. Holder, and D. Mazier.
1997. Immunization with recombinant C terminus of Plasmodium yoelii mer-
ozoite surface protein 1 protects mice against homologous but not heterol-
ogous P. yoelii sporozoite challenge. Infect. Immun. 65:44194423.
30. Smith, D. B., and K. S. Johnson. 1988. Single step purification of polypep-
tides expressed in Escherichia coli as fusions with glutathione S-transferase.
Gene 67:3140.
31. Tian, J.-H., L. H. Miller, D. C. Kaslow, J. Ahlers, M. F. Good, D. W. Alling,
J. A. Berzofsky, and S. Kumar. 1996. Genetic regulation of protective im-
mune response in congenic strains of mice vaccinated with a subunit malaria
vaccine. J. Immunol. 157:11761183.
32. Tian, J.-H., S. Kumar, D. C. Kaslow, and L. H. Miller. 1997. Comparison of
protection induced by immunization with recombinant proteins from differ-
ent regions of merozoite surface protein 1 of Plasmodium yoelii. Infect.
Immun. 65:30323036.
33. White, W. I., C. B. Evans, and D. W. Taylor. 1991. Antimalarial antibodies of
the immunoglobulin G2a isotype modulate parasitemias in mice infected
with Plasmodium yoelii. Infect. Immun. 59:35473554.