Académique Documents
Professionnel Documents
Culture Documents
TABLE OF CONTENTS
1.0 INFLAMMATION
1.1 Purification of mononuclear and polymorphonuclear
cells......................................................................................4
1.2 Isolation of cells from the peritoneal cavities of mice 8
1.3 Adherence purification of monocytes...........................9
1.4 Antibody- or C3b-dependent phagocytosis...................10
1.5 Activation of macrophages...........................................12
1.6 Monokine Bioassays......................................................14
1.6.1 Assay for IL-1 activity.......................................14
1.6.2 Assay for IL-6 activity.......................................17
1.6.3 Cytotoxicity assay for TNFa..............................19
1.7. Neutrophil chemotaxis assay.......................................21
1.8. FceRI-dependent activation of mast cells....................24
APPENDICES
5.1 APPENDIX A -- GENERAL METHODS.............................83
5.1.1 Anti-sheep RBC antisera...................................83
5.1.2 Cell counting.....................................................83
5.1.3 C3b opsinization of yeast..................................84
5.1.4 Cytocentrifuge preparations.............................85
5.1.5 Dialysis tubing...................................................85
5.1.6 Fixation of tissues for ISH or IHC.....................85
5.1.7 Lung cells (single cell suspension)..................86
5.1.8 Lysis of red blood cells.....................................86
5.1.8.1 Hypotonic lysis with H2O......................86
5.1.8.2 Lysis with ammonium chloride.............86
5.1.9 Opsinization of SRBC with antibody.................87
5.4.10 Protein assay in microtiter plates..................87
5.1.11 Splenocytes (single cell suspensions)............87
5.1.12 Splenocytes (spleen cell-conditioned medium)
.....................................................................................88
5.1.13 Staining Protocols...........................................89
5.1.13.1 Giemsa stains......................................89
5.1.13.1.1 Wrights-Giemsa staining.........89
3
1.0 INFLAMMATION:
In the first week of this course we will begin to acquire some of
the basic skills needed to examine several components of the
inflammatory cascade, a series of responses that are integrally
intertwined with the immune system. First we will begin to acquire
some basic skills in tissue culture, and the purification of selected
cells associated with the immunoinflammatory system (i.e.,
peripheral blood [PBL] monocytes and neutrophils [PMN or
polymorphonuclear cells]). Then we will learn how to identify them
using morphologic criteria, and how to assess a couple of functions
associated with monocytes/macrophages - phagocytosis (a
subfunction of antibody-dependent cellular cytotoxicity) and
activation-dependent monokine production.
Materials
BALB/c mouse
anaesthetic (methoxyfluorane)
clinical centrifuge, 15 ml centrifuge tubes, 4 ml round bottom p.s.
tubes
23-25 ga needles & 1 ml syringes
pipettes/pipettors (micro- and macropipettes)
microscope slides (frosted end; & pencil for labeling)
sterile surgical tools (optional, for open body cardiac puncture)
laminar flow hood, inverted microscope, hemocytometer
6
Reagents
anticoagulant (heparin 1000U/ml)
DMEM with 1 U/ml heparin or with 3 mg/ml EDTA anticoagulant
DMEM-10% FCS (see Appendix A)
70% ethanol
isotonic Percoll(see Appendix C)
RBC sedimentation buffer (4.5% dextran-T500 in PBS)
cytocentrifuge
METHOD
1. Obtain blood from surgically anaesthetized (or euthanized)
mouse either by closed- or open-body cardiac puncture.
Withdraw blood slowly into a 1 ml syringe containing 100 l of
heparin, being careful not to hemolyse the red blood cells by
using too much back pressure on syringe. Work fairly quickly, or
mix the blood with the anticoagulant in the syringe fairly often,
so that the blood doesn't coagulate.
2. Mix the blood with the RBC sedimentation buffer (1 volume sed.
buffer: 1 volume blood) in the 4 ml tubes and allow the mixture to
stand undisturbed on the bench for 20 - 45' (the time can be
highly variable, depending on the species of animal) . The RBC's 1
1 RBC do not sediment from bovine blood using this dextran sedimentation protocol.
Alternately, with bovine blood, one can either use the density gradients directly
with diluted (1:1 with PBS) anticoagulated blood, followed by RBC lysis of the red
cell rich-PMN fraction, or use the buffy coat of white blood cells from the top of
sedimented whole anticoagulated whole blood and fractionate these cells using
density gradient centrifugation as noted.
7
After resuspending the cell pellet from step 3, gently layer this
suspension on top of the 70% isotonic Percoll 'cushion', so that
there is no mixing of the two layers. Centrifuge the cell
gradients for 25 min at 2000 rpm (room temperature) in the
clinical centrifuge, and allow the centrifuge rotor to coast to a
stop (i.e., no brake).
5. The completed gradient will appear much as it did before
spinning, but now the PMN and RBC will reside as a pellet at the
bottom of the tube and the mononuclear cells (monocytes and
lymphocytes) will reside as a band of cells at the interface
between the tissue culture medium and the isotonic Percoll. To
harvest the mononuclear cells, simply pipette the cells directly
from the interface, trying to avoid aspirating any substantial
volume of the Percoll. Transfer the cells to a new tube and dilute
any of the density gradient medium by topping up the tube with
additional medium. To harvest the PMN, carefully aspirate the
remaining Percoll solution, then resuspend the pelleted cells by
2 This fairly low speed centrifugation step reduces the platelet contamination of
the mononuclear cell fraction of the blood. Platelets are a very rich source of a
number of cytokines (including TGF) and other potent biologically active
mediators.
3 Alternately, the platelet-rich leukocyte-plasma can be loaded directly onto the
gradients. This saves some time in the purification procedure, but leaves the
mononuclear cell fraction containing high levels of platelets, which can be gotten
rid of by a subsequent low-speed spin (i.e., 1000 rpm for 10 min, in the clinical
centrifuge)
4 Alternately, one can use other density gradient media, such as Ficoll-Hypaque or
Lymphocyte Separation Medium (see ALTERNATE PROTOCOL), which is useful for
the preparation of mononuclear cells from an array of species. Furthermore, LSM
gradients are run for only 15-25 min.
8
20'@
transfer WBC- 2000 rpm
rich plasma to
70% percoll
plasma
30' @
RT
mononuclear cells
percoll percoll
Materials
all materials required for the Percoll isolation procedure (1.1)
Reagents
all reagents required for the Percoll isolation procedure (1.1)
Lymphocyte Separation Medium (LSM; Organon-Technika Inc)
METHOD
1-3. Obtain leukocyte/platelet-rich plasma as in the Percoll procedure
(1.1).
4. Pipette 3 ml of LSM into a 15 ml p.p. conical centrifuge tube,
then carefully overlay this with either the platelet-rich leukocyte-
plasma or with platelet depleted, washed white blood cells.
5. Centrifuge the gradients for 15 - 25 min at 1500 rpm in the
5
5 Fifteen minutes is usually adequate to fully purify the mononuclear cells from the
polymorphonuclear cells and is sufficient to sediment any contaminating red blood
cells, but is is not adequate to sediment the neutrophils in the LSM. A longer spin
time (e.g., 25') is required to sediment these cells.
10
Materials
all materials required for the Percoll isolation procedure (1.1)
a continuous density gradient pouring apparatus (commercial or
"home-made")
Percoll solutions of the required density 6
Reagents
all reagents required for the Percoll isolation procedure (1.1)
METHOD
6 The formula for calculating the volumes of materials needed to achieve specific
densities with Percoll is: , where
11
mixer peristaltic
pump
centrifuge
tube
delivery
tubing or
needle
flow
high
low
density withdraw
density
Percoll needle with
Percoll
(chamber 2) advancing
(chamber1) gradient
Materials
BALB/c mouse
anaesthetic (methoxyfluorane)
clinical centrifuge, 15 ml centrifuge tubes, 4 ml round bottom p.s.
tubes
23-25 ga needles & 10 ml syringes
pipettes/pipettors (micropipettes and macropipettes)
sterile surgical tools (optional, for open body cardiac puncture)
laminar flow hood
inverted microscope
hemocytometer
Reagents
Ca++Mg++-free-HBSS (HBSS)
DMEM-10% FCS (see Appendix A)
70% ethanol
cytocentrifuge
METHOD
1. Euthanize mouse with methoxyfluorane and cervical dislocation,
and then wet its abdomen with 70% ethanol. Fully reflect the
abdominal skin dorsally and ventrally, being careful to not tear
any holes in the abdominal wall (small holes discovered during
step 2 can be clamped off using hemostats).
2. Using a 25 ga needle, inject 10 ml of HBSS into the peritoneal
cavity, through the abdominal wall, and then massage the
distended gut to wash the serosal cells into the HBSS.
14
Materials/Reagents
all materials for purification of mononuclear and PMN from mouse
PBL ( 1.1) or peritoneal macrophages (1.2)
plastic petri dishes or multi-well microscope slides
DMEM-0% FCS
DMEM-10% FCS
METHOD
1. Resuspend the mononuclear or serosal cells at 3x106 cells/ml
in DMEM-0% FCS and add 300 l of the cell suspension to each
well of the multiwell slide.
2. Incubate the cells at 37C in the CO2 incubator for 3 h.
3. Remove the non-adherent cells by repeatedly pipetting the
culture medium directly onto the cell monolayer that has formed
on the bottom of each well. If you are not thorough enough at
this stage, large numbers of lymphocytes will remain with the
monocytes/macrophages on the plastic/glass surface. Remove
the resuspended, non-adherent cells by aspirating the medium
(save the aspirates if you want to retain the monocyte-depleted
lymphocyte preparation). Repeat this procedure as needed,
monitoring the success of washing by direct visual observation
under the inverted microscope.
4. To remove the cells from the plastic, you can either remove the
medium from the cells and replace it with 0.02% EDTA in saline,
and then transfer the dishes onto ice for 10-15 min. By smoothly
16
Materials
monolayers of PBL monocytes in 8-well multi-well slides ( 1.3); or
use peritoneal lavage cells from normal or proteose/peptone-
injected mice
humidified 37C CO2 incubator
clinical centrifuge & tubes
sterile eppendorf tubes
Reagents
C3b-coated zymosan beads (5.4.12)
0.5% suspension of SRBC in PBS
anti-SRBC-coated SRBC (5.4.13).
normal mouse serum (heat-inactivated at 56C for 30 min)
DMEM-10% FCS
METHOD
1. Take the monocyte/macrophage monolayers, in multi-well slides
out of the 37C incubator and to pairs of the wells add either 20
l of either: the antibody-coated SRBC, normal SRBC suspension,
C3b-coated zymosan, or 'activated' zymosan suspension.
Incubate the cells/slides for 60 min at 37C.
2. Remove the slides from the incubator and wash the free SRBC or
zymosan from the cultures by resuspending the sedimented cells
with your pipetter and aspirating the contents. Examine the
18
3. At the end of the experiment, take the well casing from the slide
itself and fix the cells by immersion in 100% ethanol for 2 min.
Allow the slides to air dry, and stain the slides with Giemsa
stain (Appendix D).
5. Calculate the mean numbers (+/- SEM) of SRBC or zymosan
particles in the macrophages in each treatment group. To do
this, you will count the numbers of SRBC contained within 25
macrophages in each of ten 40x microscope fields, for each well
on the slide. Perform an ANOVA test to determine the statistical
significance of your results, and plot the data (including means,
SEM, and probability values) on a graph.
19
Materials
laminar flow hood
humidified 37C CO2 incubator
subconfluent monolayer cultures of Pu5-1.8 cells in DMEM-10% FCS
clinical centrifuge & tubes
inverted microscope
sterile eppendorf tubes
cell scraper
-20C freezer & freezer bags
Reagents
bacterial endotoxin, 1 mg/ml DMEM-0% FCS (E. coli
lipopolysaccharide; LPS)
DMEM-10% FCS (see Appendix A)
METHOD
1. Take a look at the growing Pu5 cells under the inverted
microscope to get a feeling of how they 'should' look under
normal conditions.
20
2. Using a cell scraper, dislodge the Pu5 cells from the plastic and
then transfer them to a 50 ml centrifuge tube. Remove 20 l of
the cell suspension for cell counting with the hemocytometer.
3. While counting the Pu5 cells, sediment them by centrifugation
(10 min at 1500 rpm in the clinical centrifuge). To resuspend
them in fresh DMEM-10% FCS, completely aspirate the
supernatant from the tubes, and then very briskly and repeatedly
flick the tube with the cell pellet to disperse the pellet.
Dispersal will be complete when the pellet has become a paste
on the walls of the tube. Add sufficient DMEM-10% FCS to bring
the cells to a concentration of 3x106 cells/ml, and then dispense
the cell suspension into the wells of 24-well plates, at 1 ml per
well. You will need 8 wells of cells (4 wells of unstimulated cells
& 4 wells of stimulated cells) for todays experiment, as well as 4
wells which contain medium but no cells (LPS-medium controls)
4. Add LPS (to a final concentration of 10 g/ml) to the 4
'stimulated cells' wells and to the 4 'LPS-medium control' wells,
and an equivalent amount of DMEM to the 4 wells of
unstimulated Pu5 cells. Return the cultures to the 37C CO 2
incubator.
5. Label the eppendorf tubes with your initials, the date, and the
sample information (e.g., Pu5 supn't. + [or -] LPS; 1 [or 6, or 24]
h). In addition to the supernatants from the cell cultures, save
several aliquots of the DMEM-10% FCS that was used for the
cultures (as medium controls)
6. At 1, 6, and 24 h post-challenge, examine the cells to get a
feeling for whether the LPS has affected them in any visible
manner. At each time, also harvest the culture medium from the
appropriate wells, centrifuge them for a few minutes at full
speed in the microfuge, and then aliquot each one into four
eppendorf tubes (200 l/tube). Store all aliquots in the -20
freezer (long-term storage requires a -80 freezer).
7. At the end of the experiment, place all of the plasticware & cells
in the contaminated-discard pan.
21
Materials
humidified CO2 incubator
96-well tissue culture plates
micropipetters, tips
multi-channel pipetter
clinical centrifuge, tubes 15 ml
15 ml centrifuge tubes
hemocytometer
ELISA plate reader (with a 595 nm wavelength filter)
Reagents
LM-1 cells which have not been fed fresh IL-1-containing medium for
5-7 days, and which were washed and held overnight in Click's-
10% FCS without conditioned medium (i.e., IL-1-starved LM-1
cells)
Click's-10% FCS without conditioned medium (Click's-10% FCS-CM-)
recombinant mouse IL-1 (our present stock soln is at a concentration
of 7.5 ng/l)
22
METHOD
1. Starve the LM-1 cells 4-7 days before assay (feed them fresh
conditioned medium some 4-7 days before the assay, and then
do not feed them again). The night before the assay, wash the
cells in fresh Click's-10% FCS-CM- and leave them in culture
overnight.
2. On the day of the assay, resuspend the LM-1 cells to 4X105
cells/ml in Click's-10% FCS-CM- and dispense into the 96-well
plates at 100 l/well, using a template pattern similar to the one
depicted.
1 2 3 4 5 6 7 8 9 10 11 12
A
B standards
(pg/ml)
C plate blank (A1-H1)
cytokine standards (4 doses)
D 0.5 5.0 50 500
test samples (10/plate)
E medium control
F 'plate-effect' blank wells
G
H
-Do not add any cells to the first column (i.e., wells A1, B1, ...,
H1) of each plate, but do add all other reagents (e.g., Click's
without IL-1) -- this will be the plate blank.
-Do not use the outer wells of the plate for any samples (there is
an 'edge-effect' of the plates), but add DMEM-0% FCS to
these wells.
-Always include a medium-only control (i.e., the same medium as
that used for the experimental treatments, but which has not
been exposed to the experimental cells). Use the same
volume of experimental medium as that used in the test
samples wells -- if you have multiple doses of test samples,
use equivalent multiple doses of medium controls.
-In this format, one plate will accept 10 experimental samples,
each done in quadruplicate.
24
Materials
humidified CO2 incubator
96-well tissue culture plates
micropipetters, tips
multi-channel pipetter
clinical centrifuge, tubes 15 ml
15 ml centrifuge tubes
hemocytometer
ELISA plate reader (with a 595 nm wavelength filter)
Reagents
7TD1 cells in RPMI-10% FCS supplemented with rhIL-6 (80 pg/ml)
RPMI-10% FCS (see Appendix B)
recombinant human IL-6 (rhIL-6; our stock solution is at 100 ng/ml)
MTT (5 mg/ml in PBS)
acidified isopropanol
METHOD
1. Wash the 7TD1 cells two times in RPMI-10% FCS, and resuspend
to a concentration of 2.5x104 cells/ml in RPMI-10% FCS.
2. Add 100 l of cells to each well in plate, using the same or a
similar sample plate format to that indicated in 1.5.1 (IL-1
assay).
3. Add cytokine standards (2.5, 25, 250 & 2500 pg/ml final
concentration) in 20 l of RPMI-10% FCS, and add your samples
and experimental medium controls in appropriate volumes. In
this assay, we will use 1.0, 2.0, and 5.0 l of the LPS-stimulated
Pu5 cell culture supernatants, so you will need three sets of
'medium controls', each containing 1.0, 2.0 or 5.0 l of DMEM-
10% FCS supplemented with 10 g/ml of LPS.
26
Materials
humidified CO2 incubator
96-well tissue culture plates
micropipetters, tips
multi-channel pipetter
clinical centrifuge, tubes 15 ml
15 ml centrifuge tubes
hemocytometer
ELISA plate reader (with a 595 nm wavelength filter)
Reagents
L-929 cells in DMEM-10% normal horse serum (NHS).
DMEM-0% NHS
recombinant murine TNFa standards (diluted as in Appendix D)
Actinomycin-D (stock 5 mg/ml in 95% ethanol)
MTT (5 mg/ml PBS)
Acidified isopropanol (lysis buffer)
METHOD
1. On the day before the assay, harvest L929 cells from a flask by
trypsinization (remove DMEM-10 % NHS medium and add DMEM-
0% NHS medium. Add 4 - 5 drops of 1% trypsin/10 ml of
medium and allow the typsin to digest the cells off of the plastic.
This process can be expedited by watching the cells and, when
they are beginning to lift well, but many still remain attached,
28
forcefully slapping the flask down on your thigh. All cells will be
dislodged instantaneously.
2. Wash the dislodged cells in DMEM-10% NHS medium, resuspend
them to 4.5x105 cells/ml, and dispense 70 l to each well of a 96-
well plate (for plate format, see 1.5.1; IL-1 assay). Return plate
to the 37C CO2 incubator.
3. The next day, just prior to running the assay, remove all of the
serum-containing medium from the wells by inverting the plate
and vigorously flicking it. Add 180 l of DMEM-0% NHS
containing 2.5 g/ml of actinomycin D (i.e., a 2000-fold dilution of
the stock Act D).
4. Add TNFa standards (0.04, 0.4, 4.0 and 40 units/well), control
medium, and experimental samples (LPS-stimulated Pu5 cell
supernatants & controls) to their appropriate wells, each in a 20
l total volume, so that the total well volumes equal 200 l.
5. Return plate to the 37C CO2 incubator overnight.
6. The next day, examine the cells under the inverted microscope
to get a feeling for the relative levels of L929 cell death in each
well. Add 20 l of MTT (5 mg/ml PBS) to each well (including
plate blank wells), and again return the plates to the incubator.
7. After 45 - 60', re-examine the cells to confirm that adequate
levels of MTT conversion to formazan dye have occurred in the
mitochondria (see 1.5.1, IL-1 assay) and then remove 150 l of
medium from each well in the plate and replace it with 100 l of
acidified isopropanol.
8. Vortex the plates on an ELISA plate shaker to solubilize the
formazan dye, and read the plates on the ELISA plate reader at
595 nm wavelength. Calculate the cytotoxicity in each of the
wells using the formula:
percent cytotoxicity =
mean OD590 medium control wells - OD 590 experimental well x 100
mean OD590 medium control wells
9. Calculate the mean (+/- SEM) cytotoxicities for the standards and
each treatment group, express them in terms of units (+/- SEM) of
TNF activity (a unit of TNF activity is that amount of cytokine
29
required to kill 50% of the cells in the assay) and graph your
results. Perform a statistical analysis to confirm that your
results are meaningful.
30
Materials
humidified CO2 incubator
microchemotaxis chamber (NeuroProbe Inc)
PVP-free (PVPF) polycarbonate cell migration filters (5 m pore size;
Millipore or NeuroProbe)
micropipetters, tips
purified peripheral blood granulocytes
Reagents
DMEM-0% FCS media
Ca/Mg --HBSS
f-met-leu-phe bacterial tripeptide
zymosan-activated serum ( 5.4.11)
interleukin 8 (or CINC)
METHOD
1. Generate a neutrophil-rich population from the peripheral blood,
using dextran sedimentation (or if your experiments require
purified cells, percoll-purified neutrophils), adjusting the
population to a final concentration of 2x106 cells/ml of HBSS.
31
supernatants from these cells will contain abundant TNFa, and the
cells will contain very high levels of TNFa mRNA.
Materials
humidified CO2 incubator
T75 flasks
hemocytometer
micropipetters, tips
clinical centrifuge, tubes 15 ml
polypropylene 4 ml culture tubes
Reagents
DMEM-10% FCS media
Cl.MC/C57.1 cells in DMEM-10% FCS.
MAb IgE anti-DNP (ascites fluid; use at 1:3000 for Cl.MC/C57.1 cells).
7 Expression of the FceRI is inducible in mast cells, and this is at least in part
regulated the concentrations of exogenous IgE, such that in the presence of high
concentrations of IgE, mast cells express more IgE receptors. Thus, freshly
purified tissue mast cells, which will likely have the vast majority of their existing
FceRI occupied by IgE antibodies of irrelevant specificities, can be best sensitized
with IgE of the desired specificity by incubating the cells overnight in high
concentrations of the antibody.
34
METHOD
1. Obtain some Cl.MC/C57.1 cells and adjust the cell concentration
to 3 X 106 cells/ml. You will only need 0.5 ml of mast cell
supernatant/time point, so set up 3 ml of cells (i.e., 9x106 cells
in 3 ml).
2. Add MAb IgE anti-DNP to the tube of C57 cells to a final IgE
dilution of 1:3000, and incubate the cells for 30 - 60' at room
temperature in order to saturate the cells' high affinity IgE
receptors.
3. Wash the cells two times with DMEM-10% FCS and resuspend
them again at 3x106 cells/ml. Bring the cells to 37C by placing
them in a water bath. Add DNP30-40HSA to the cells to a final
concentration of 10 ng/ml and place the tubes upright and lightly
capped in the 37C CO2 incubator for 15 - 20 min to allow them to
gas (i.e., exchange CO2 into the tube). After this, cap the tubes
tightly and lay them on their side in the incubator (or use a
slowly moving rotator at 37C).
4. At each of the indicated times after allergen challenge (i.e., 0.5,
1, 2, and 4 h), remove a tube of cells from the CO 2 incubator and
sediment the cells by centrifugation (8-10' @ 1500 rpm), and
then aliquot the supernatants into labelled eppendorf tubes (100
l/tube). Freeze the aliquots at -20C (or -80C for longer term
storage). The cells can be either discarded (as in our first
Cl.MC/C57.1 experiment), fixed (e.g., for our in situ hybridization
experiments), or processed for total cellular RNA extraction (e.g.,
our Northern analysis experiments).
35
Materials
T75 tissue culture flasks
clinical centrifuge and 50 ml polypropylene tubes
Reagents
GK1.5 (anti-CD4) and TIB 211 (anti-CD8) hybridoma cells
RPMI-10% FCS
METHOD
1. Set up two T75 (i.e., 75 cm2) tissue culture flasks, one each for the
TIB 211 and GK1.5 cells. Start each flask as a 40 ml culture, at a
cell density of 105 cells/ml of RPMI-5% FCS medium.
2. Allow the cells to continue growing until the medium has gone
completely yellow (acidic) and the cells have essentially all died
(about 5 - 7 days; terminal cultures).
3. Collect the supernatant from each flask and centrifuge it for 15
min at 12,000 rpm in the RC-5B superspeed centrifuge to sediment
all particulate matter.
36
Materials
T75 tissue culture flasks
clinical centrifuge and 50 ml polypropylene tubes
AVID-AL IgG affinity column matrix
10 ml polyprep column, or 5-10 ml syringe and glass wool
dialysis tubing
centrifugal concentrators (e.g., Centricon tubes)
Reagents
AVID-CHROM Ig pure kit for purification of IgG
-column binding buffer (>1M proprietary salt)
-neutral elution buffer (1M Tris [pH 7.4], 20% glycerol)
-regeneration buffer (buffered methanol)
GK1.5 (anti-CD4 hybridoma) cells in RPMI-10% FCS
PBS
METHOD
1. Collect the supernatant from a 4 day culture of GK1.5 cells (see
2.1) and centrifuge it for 15 min at 2,500 rpm in clinical centrifuge
to sediment all particulate matter, and then filter the supernatant
through a 0.45 m filter. pH the supernatant to 7.2 - 7.4.
2. Set up the affinity matrix column by pipetting 1.5 ml of a 50%
matrix slurry into a 15 ml centrifuge tube and add 10 ml of
38
Materials
protein A-Sepharose (Pharmacia, or Sigma)
clinical centrifuge and 50 ml polypropylene tubes
10 ml polyprep column, or 5-10 ml syringe and glass wool
spectrophotometer or UV monitor (equipped for reading OD 260)
dialysis tubing
Reagents
0.1 M citric acid (pH 4.5)
supernatant from a terminal culture of GK1.5 (rat IgG2a anti-CD4
hybridoma) cells
PBS (pH 7.2)
PBS/20% ethanol
1M Tris (pH 9.0)
METHOD
1. Filter the GK1.5 culture supernatant through a 0.45 m filter and
pH it to 7.2 - 7.4.
2. Pipette 1 ml of the protein A-Sepharose 50% matrix slurry into the
column and wash it with several column volumes of PBS.
40
Materials
beaker and stir bar
clinical centrifuge & tubes
dialysis tubing
0.45 m filters
pH meter and pH reagents
stir plate
syringe and 20 ga needle
Reagents
culture medium from a terminal culture of TIB211 (IgM anti-CD8)
hybridoma cells
saturated ammonium sulfate solution
borate-buffered saline
Method
42
Materials
PAGE mini-gel apparatus and power pack
Reagents
Commercial acrylamide/bisacrylamide solution (40% acryl/0.8%
bisacryl)
Commercial separating and stacking gel buffers
ammonium persulfate 10% solution (freshly prepared)
isobutyl alcohol (H2O-saturated)
PAGE 2x sample prep buffer (for denaturing & reducing the samples)
PAGE 5x SDS/run buffer (dilute 1:5 with H2O before use)
PAGE gel fix solution (25% isopropanol, 10% acetic acid)
rapid Coomassie blue stain (0.006% Coomassie Brilliant Blue G-250 in 10%
glacial acetic acid)
protein samples
biotinylated molecular weight markers (for Western blots)
unstained molecular weight markers (for protein staining gels)
METHOD
1. Clean the glass plates and gaskets, and assemble the PAGE
apparatus. Place a mark on the glass at the 6 cm mark (from
the bottom).
44
8 For non-reducing conditions, the sample prep buffer does not contain 2-
mercaptoethanol, while for reducing condtions, the buffer should contain 10% 2-
mercaptoethanol.
9 Load the proteins such that individual protein bands should contain 1-2 g of
protein. For complex mixtures of proteins, you will need to run greater amounts of
protein in order to visualize the multiple bands in the samples. Thus, for protein A-
purified IgG, you could run only 1-2 g, while for ammonium sulfate precipitated
IgM-containing culture supernatants, you would need to run perhaps 20 g of
protein.
45
6. Run the gel at 150 volts until the bromophenol blue dye front
reaches the bottom of the gel. Turn off the power, disassemble
the PAGE gel apparatus.
7. Incubate the gel for 10 - 15 min in isopropanol fix solution, stain
it in the rapid Coomassie brilliant blue for 2 h to overnight at
room temp, and then destain in several changes of 10% glacial
acetic acid over 5-8 h.
8. For permanent storage, the gel can be dried down using a
commercially available drying apparatus.
Materials
Western blotting transfer apparatus (wet)
Whatman #1 filter paper
nitrocellulose transfer membrane (do not handle with bare hands)
Reagents
METHOD
1. Equilibrate the gel after electrophoresis to Western blot transfer
buffer by incubation for 45 min. Also equilibrate a sheet of
nitrocellulose (cut to the same size as the half the gel to be used
for Western blotting) to the same buffer.
2. Transfer the gel to the gel blotting bracket, such that the gel is
sandwiched immediately next to the nitrocellulose (with no air
bubbles between the two) and both are sandwiched between two
sheets of filter paper, with two 'brillo' pads flanking the filter
paper. This arrangement of gel, nitrocellulose membrane and
pads (depicted below) is clamped between the Western blotting
electrodes such that the gels is on the negative electrode side
and the nitrocellulose is on the positive electrode side (the
proteins will be negatively charged due to the SDS in the PAGE
sample prep buffer).
47
'brillo' pads
3. Set the gel assembly in the gel apparatus, fill it with transfer
buffer and then move the whole apparatus to the cold room. Run
the transfer at 100 volts for 2-3 h (IgM may migrate through the
nitrocellulose membrane in 3 h).
4. Disassemble the transfer assembly and stain the gel as in
2.4.1.
5. Transfer the nitrocellulose membrane into a large weigh boat
containing 15 ml of TTBS-5% Carnation skim milk powder for 2 h to
overnight to block the non-specific binding of other proteins to the
nitrocellulose membrane.
6. Wash the membrane two times for 5 min each with PBST and place
the blot into 15 ml PBST containing biotinylated rabbit anti-rat IgG
and IgM (1:1500 final dilution) for 60 min at room temperature.
7. Wash the blot three times 5 min in PBST and place the blot in 15
ml of PBST containing a 1:5000 final dilution of streptavidin-
alkaline phosphatase conjugate for 90 min at room temperature.
8. Wash the blot three times 15 min in H2O, and then transfer into 15
ml of freshly-prepared TMS -BCIP/NBT mixture. (To prepare the
BCIP-NBT substrate: to 5 ml of 0.1 M Tris (pH 9.5), 0.1 M NaCl, 0.05
M MgCl2, add 22 l BCIP; mix by inverting then add 16.5 l NBT and
again mix). Incubate for 30 - 40 min until the bands become well-
defined, and then wash the blot with H2O and air dry.
9. Plot the relative migration distances of each of the molecular
weight marker proteins on a graph, and use the plot and the
migration distances of the bands in the IgG and IgM lanes to
48
Materials
single cell suspension of mouse splenocytes (at 1x107 cells/ml;
Appendix D)
clinical centrifuge and 4, 15 and 50 ml polypropylene tubes
Reagents
GK1.5 (anti-CD4 hybridoma) cell supernatants (from a 2-4 day culture)
TIB211 (anti-CD8 hybridoma) cell supernatants (from a 2-4 day culture)
purified GK1.5 IgG antibodies
purified HB121 IgG antibodies (control IgG; specificity: mouse IgG1
anti-human IgE)
fluorescein-labelled anti-mouse CD4 IgG antibodies
phycoerythrin-labelled anti-mouse CD8 IgG antibodies
Low-tox rabbit C' (Cedar Lane)
METHOD
1. Label and set up a series of tubes to receive reagents as follows:
2. Add 100 l of the splenocyte suspension (i.e., 106 cells) and 100 l
of appropriately diluted antibody (10, 1.0 or 0.1 g protein from the
HB121, GK1.5, or TIB211 preparations) to each tube. Incubate the
cells with the antibody for 30 min at room temperature.
3. Add 100 l of the guinea pig complement to each tube, and
incubate the tubes at 37C for 30 min. Wash the cells two times
with DMEM-10% FCS (8 min at 1500 rpm in the clinical centrifuge).
4. Resuspend the cells to 100 l in DMEM-10% FCS, and add 3 l of
FITC-labelled anti-CD4 and 3 l of PE-labelled anti-CD8 IgG to each
tube and incubate the cells on ice for 30 min.
5. Wash the cells once more with an excess of DMEM-10% FCS and
resuspend to 100 l with DMEM-10% FCS. Add 100 l of 1%
paraformaldehyde and fix the cells on ice for 30 min, then wash
the cells one time with PBS and resuspend to 100 l with PBS.
6. Store the cells in the refrigerator overnight, for FACS analysis the
next day.
51
Materials
single cell suspension of mouse splenocytes (at 1x107 cells/ml;
Appendix D)
clinical centrifuge and 4, 15 and 50 ml polypropylene tubes
Mini-MACS separation column (type MS; capacity 107 positive
cells/column)
Mini-MACS column magnet (Miltenyi Biotec Gmbh)
Reagents
GK1.5 (anti-CD4 hybridoma) cell supernatants, purified IgG (2.1)
TIB211 (anti-CD8 hybridoma) cell supernatants, ammonium sulfate ppt.
IgM (2.1)
PBS (pH 7.2), containing 5% FCS & 2 mM EDTA (PBS/EDTA)
mouse anti-rat IgG-conjugated paramagnetic beads (Miltenyi Biotec)
mouse anti-rat IgM-conjugated paramagnetic beads (Miltenyi Biotec)
fluorescein-labelled anti-mouse CD4 IgG antibodies
phycoerythrin-labelled anti-mouse CD8 IgG antibodies
52
METHOD
1. Label and set up a series of tubes to receive reagents as follows:
2. Add 1 ml of the splenocyte suspension (i.e., 107 cells) and 250 l of
appropriately diluted antibody (HB121, GK1.5, or TIB211; i.e., 25 g)
to each tube. Incubate the cells with the antibody for 30 min at
room temperature.
3. Wash the cells one time with DMEM-10% FCS (8 min at 1500 rpm in
the clinical centrifuge) and resuspend to 300 l of PBS/EDTA.
4. While the cells are washing, also wash the Mini-MACS column,
flushing it through with the PBS/EDTA . If air bubbles are present
13
13The first 10-20 drop to elute from this wash step will appear quite cloudy (due to
elution of matrix residue). You should continue washing at least until the
cloudiness of the eluting buffer diminishes to background.
53
Materials
humidified CO2 incubator
96-well tissue culture plates
micropipetters, tips
multi-channel pipetter
clinical centrifuge, tubes 15 ml
15 ml centrifuge tubes
hemocytometer
ELISA plate reader (with a 595 nm wavelength filter)
55
Reagents
BALB/c mouse splenocytes (5x107 nucleated cells/ml) in DMEM-10%
FCS
DMEM-10% FCS media
Concanavalin A (our stock is a 4 mg/ml solution in DMEM)
MTT 5 mg/ml in PBS)
acidified isopropanol
METHOD
1. In one 96-well plate, set up both cell number-response and Con A
dose-response curves using the plate format indicated below,
and the volumes indicated in the table.
1 2 3 4 5 6 7 8 9 10 11 12
A
B cell number-response
C (cells x10 6 well)
D
cell numbers titration ConA dose-response
E (g ConA/ml)
F medium control
G
H
Materials
sheep red blood cells (SRBC; 2x108/ml), washed in PBS 14
Reagents
PBS
H20 & 10x HBSS for hypotonic lysis of spleen RBC
guinea pig serum diluted 1:2 in PBS/10% FCS
Method
1. Inject 0.2 ml of the SRBC suspension (i.e., 4x107 cells) either
intravenously or intraperitoneally into 8-10 week old mice.
2. Euthanize the mice after 4 days if they were immunized
intravenously (or after 5 days if they were vaccinated
intraperitoneally), and generate single cell suspensions from their
spleens. Lyse the residual splenic red blood cells by hypotonic or
ammonium chloride lysis (5.4.8) and bring the nucleated cells to a
final concentration of 5x106 cells/ml
3. To a series of labelled eppendorf tubes, add either 0, 30, 60, or 120
l of the splenocyte suspension, 30 l of the 20% SRBC suspension
(i.e., in PBS/10% FCS), 30 l of diluted guinea pig serum and 240,
210, 180, or 120 l of RPMI-10%, as appropriate to bring the final
volume of each tube to 300 l, and thoroughly mix the contents of
each tube.
4. Load 80 l of the mixture into each assay slide chamber (see
diagram below) and seal each with wax.
lower to appose
against bottom slide microscope slide (2)
double-sided
tape gaskets (3)
Materials
splenocyte suspensions from mice vaccinated with:
- ovalbumin/alum (i.p.: on dy 1 and dy 14; harvest cells on dy 21)
- SRBC (i.v.: dy 1, 200 l of 0.1% SRBC; dy 14, 200 l of 1% SRBC)
pipettes/pipettors
clinical centrifuge, 15 ml tubes
96-well ELISPOT plate
Reagents
anti-mouse IL-4 and anti-mouse IFN capture antibodies (1 g/ml
coating buffer stock)
bromo-chloryl-indoyl phosphate/nitroblue tetrazolium (BCIP/NBT)
substrate
biotinylated anti-mouse IL-4 and anti-mouse IFN antibodies (detection
antibodies)
DMEM-10% FCS
ELISPOT blocking solution (DMEM-10% FCS)
ELISPOT coating buffer (carbonate/bicarbonate, pH 9.4)
Lymphocyte separation medium
ovalbumin (5 g/ml coating buffer stock solution)
PBST (PBS with 0.05% Tween 20)
streptavidin-alkaline phosphatase conjugate (strep-AP; diluted 1:5000
in PBST)
60
METHOD
1. Precoat each of the ELISPOT plates with capture antibodies or
antigen (this can be done several days in advance). To do this, to
each well of the plate, add the purified anti-IL-4 or anti-IFN
antibodies in ELISPOT coating buffer at a concentration of 1 g/ml
or the ovalbumin at a concentration of 5 g/ml. Cover and seal the
plates with parafilm and incubate overnight at 4C.
A
anti-OVA IgG1, IgG2a, IgM, IgE antibody ELISPOT
1 2 3 4 5 6 7 8 9 10 11 12
A con't con't
1x10e6, 1x10e5,
B no Ag, with Ag, no IFNg
G1,G2a,M 1x10e6, G1,G2a,M
C with Ag, no cells
D G1,G2a,M,E no secondary
no a-IL-4
no cells,
E with Ag, no cells
G1,G2a,M anti-IFNg,
F no secondary no Ag,
5x10e5, 1,5,10x10e5
G 1x10e6 cells with Ag, anti-IL-4,
with Ag, G1,G2a,M no Ag,
H no biotin Ab 1,5,10x10e5 no blocking
B
OVA mice anti-SRBC mice
1 2 3 4 5 6 7 8 9 10 11
12
A anti-IL-4, no secondary no cells
anti-IL-4
B + ovalbumin, anti-IL-4, no secondary
1,5,10x10e5
C 1,5,10x10e5, anti-IFNg,
+SRBC 1,5,10x10e5,
D no SRBC
anti-IFNg,
anti-IFNg
E + ovalbumin anti-IL-4,
1,5,10x10e5
1,5,10x10e5,
F anti-IFNg,
no SRBC
1,5,10x10e5,
G no anti-IL-4
+SRBC no blocking
H no cells no anti-IFNg
anti-SRBC mice
2. The next morning, remove the capture antibody from the wells by
inverting the plate and sharply flicking it. Rinse out each well with
200 l of blocking solution by pipetting the solution up and down
several times with a multichannel pipetter (do not touch the
bottom of the well with the pipette tips!). Remove the blocking
solution, rinse as above and add 100 l of fresh blocking solution to
each well. Incubate the plates at 37C for a minimum of 1 hour (or
until the cells from the next step are ready).
3. Generate a single cell suspension from the spleens of an OVA- and
SRBC-sensitized mice, and resuspend the cells to 1x107 cells/ml
DMEM-10% FCS.
4. Remove the ELISPOT plate from the incubator and dump out the
blocking solution. Add 100l of spleen cells and 100 l of antigen
(ovalbumin @ 2.5 g/ml or SRBC @ 1.0% suspension) to each well,
and incubate the plates at 37 C for 8 hours. Do not to disturb the
plates while they are incubating, so that each cell secretes all of
its cytokine/antibody in only one location.
5. After 8 h, remove the cells from the plate by first agitating the
plates on the ELISA plate shaker for 3 min, and then inverting
62
them and vigorously flicking the contents from the wells. Continue
washing the wells with 200 l of PBST -- vigorously pipette the
contents up and down, but do not touch the bottom of the wells,
and flick the PBST out as above. Remove the excess PBST by
banging the plate upside down on paper towels. Repeat this wash
procedure 6 times.
6. Add 100 l of biotinylated anti-cytokine or anti-isotype antibody
(diluted to 1 g/ml in PBST) to each well, and incubate the plates
overnight at 4C.
7. Wash the plates 5 times with PBST as in step 6, add 100 l of
diluted strep-AP to each well, and incubate the plates for 1.5 h at
room temperature.
8. Wash the plates 10 times by repeatedly dunking the plate in a
large beaker of distilled-deionized H2O, each time removing all of
the H2O from each well as above (i.e., flicking and banging on
paper towels). Careful washing is important, for it will reduce the
assay background substantially.
9. Add 100 l of freshly prepared BCIP/NBT substrate to each well.
(To 5 ml of 0.1 M Tris (pH 9.5), 0.1 M NaCl, 0.05 M MgCl 2, add 22 l
BCIP, mix by inverting and then add 16.5 l NBT and again mix; for
smaller volumes, use 3.75 ml buffer, 16.5 l BCIP & 12.37 l NBT).
10. Incubate the plates at room temperature in the dark until spots
develop or the plate
background begins to increase (approximately 30-45 minutes).
11. To stop the reaction, flick out the substrate and wash the plates 3
times in H2O by the dunking method. Allow them to dry overnight
(with the lids off), as the background fades dramatically when the
plates dry.
12. Count the spots under low magnification under the dissecting
scope, or using an image analyser
63
Materials
Immulon-4 ELISA plates
pipettes/pipettors
Reagents
experimental sera or other putative antibody source (e.g., from ova-
vaccinated mice)
64
METHOD
1. Coat the wells of the Immunolon-4 plates with the antigen to be
used for antibody capture (ovalbumin @ 5 g/ml in carbonate
coating buffer) or with the diluted antibody standards, as
appropriate. Add 100 l per well, then cover the plate(s) and
incubate overnight at 4C.
2. Wash the wells 2 times with PBST. To do this, one can either use a
squirt bottle of PBST or a multichannel pipettor to fill each of the
wells and allow to stand for 30 - 60 seconds, then turn the plate
upside down and flick the wash fluid into a sink, then fairly
forcefully hit the plate upside down on a stack of paper towels to
15 ATCC MAb # (mouse IgG1 anti-human IL-8), ATCC MAb # HB121 (mouse IgG2a
anti-human IgE) and ATCC MAb (mouse IgE anti-DNP) ascites fluids work well for the
antibody ELISA standards, using ascites fluid dilutions ranging from 1:50 >
1:1,000,000. Alternately, one can use high antibody value reference sera generated
by vaccinated of mice with the antigen of interest. For example, BALB/c mice
produce a very strong IgE and IgG1 response following intraperitoneal vaccination
(dy 0) and boosting (dy 14) with 5 g of ovalbumin conjugated to 1 mg of alum. Sera
or plasma from these mice can be used as reference standards.
16 In our hands, the streptavidin-horse radish peroxidase/ ABTS enzyme/substrate
combination gives vastly superior results to those obtained with the SA-AP/p-
nitrophenyl phosphate enzyme/substrate system although, in all honesty, we have
not "played" with the latter system sufficiently to suggest that it could not yield
equivalent results under the correct circumstances.
65
remove the excess fluid from each well. Block the plates by adding
200 l of DMEM-10% FCS to each well and incubate, covered, at
room temperature for 2 hours.
3. Wash the wells 2 times with PBST as in step 2, and to the
ovalbumin-coated sample wells add 100 l of the samples (diluted
1:50 in DMEM-10% FCS) to each well. Add 200 l of PBST to the
antibody standard wells. Cover the plate and incubate overnight at
4 C.
4. Wash the wells 4 times with PBST. Dilute the biotinylated anti-Ig
isotype
antibodies to 0.5 - 2.5 g/ml in PBST (the optimal concentration will
need to be determined empirically), and add 100 l of each per
well, as appropriate for each sample or standard. Cover and
incubate at room temperature for 90 min.
5. Wash the wells 8 - 10 times with PBST, and add 100 l of either SA-
HRP (1:5000 in PBST) or SA-AP (1:5000 in PBST) to each well.
Incubate at room temperature for 90 min.
6. Wash the plates 8 - 10 times with distilled H2O by the dunking
method, making sure to remove the excess fluid as above. Add 100
l of the ABTS substrate (SA-HRP avidin-enzyme conjugate only) or
freshly prepared 3 mMp-nitrophenyl phosphate substrate (SA-AP
avidin-enzyme conjugate only) to each well, then place the plates
in a dark location (e.g., a drawer works well) and allow the
reactions to develop for 20 - 45 min at room temperature. The
17
Materials
Immulon-4 ELISA plates
pipettes/pipettors
experimental samples for cytokine assay
Reagents
cytokine capture and biotinylated detection antibody pairs
ELISA carbonate coating buffer
PBST (PBS with 0.05% Tween 20)
DMEM-10% FCS
SA-horse radish peroxidase (SA-HRP)
2-2'-azino-di[3-ethyl-benzthiazoline sulfonate (6)] with H 2O2 (ABTS;
1 component substrate for SA-HRP)
1% sodium dodecyl sulfate (SDS; optional stop solution for reactions)
METHOD
1. Dilute the capture antibody of each pair to 0.5 - 2.5 g/ml in
coating buffer, as empirically determined, and add 100 l to the
appropriate wells of the ELISA plate. Cover the plate and incubate
overnight at 4C.
2. Wash the wells 2 times with PBST, as above (3.6.1, step 2), and
block the plate by adding 200 l of DMEM-10% FCS to each well
and incubate, covered, at room temperature for 2 hours.
67
3. Wash the wells 2 times with PBST, and add 100 l of the standards
or samples (diluted in DMEM-10% FCS) to each well. The precise
levels of standards to use will depend on the detection limits of the
antibody pairs employed, but will often cover the range of from 1
pg/ml to 1500 pg/ml. Cover the plate and incubate overnight at 4
C.
4. Wash the wells 4 times with PBST. Dilute the biotinylated anti-Ig
isotype
antibodies to an empirically-determined optimal concentration
(usually 0.5 - 2.5 g/ml) in PBST and add 100 l of each per well, as
appropriate. Cover and incubate at room temperature for 90 min.
5. Wash the wells 8 - 10 times with PBST, and add 100 l of the
diluted SA-HRP (1:5000) to each well. Incubate at room
temperature for 90 min.
6. Wash the plates 8 - 10 times with distilled H2O, making sure to
remove excess fluid. Add 100 l of ABTS substrate to each well
and allow the reactions to develop for 20 - 45 min at room
temperature. The reactions can be stopped by adding 100 l of 1%
SDS to each well.
7. Read the plates using the ELISA plate reader, set at a reading
wavelength of 405 nm.
68
Materials
Ovalbumin- and SRBC-immune mice
Tissue processor (for processing biopsies to paraffin blocks)
1 ml syringes and 30 ga needles
scalpel blades
Reagents
Ovalbumin in Ca++/Mg ++-free HBSS (40 g/ml)
SRBC in Ca++/Mg ++-free HBSS (5% suspension)
In situ hybridization fixative
70% ethanol
METHOD
1. Set up the antigens for the intradermal skin tests in the 1 ml
tuberculin syringes equipped with 30 ga needles. The bevel side of
the needle and the calibrated side of the syringe should be aligned if
you are going to inject defined volumes based on the calibration of
the syringe.
2. Lightly anaesthetize each mouse it turn (i.e., two ovalbumin-
sensitized mice and two SRBC-sensitized mice), so that it can be
injected intradermally in the ear. If this will take some time, also set
up a 15 ml tube (with cotton batting and methoxyfluorane) that you
can use during the procedure, in order to keep the mouse
anaesthetized on the bench.
3. Inject 25 l of the 5% SRBC suspension intradermally into the right
ear of the mouse and inject 25 l of the 40 g/ml ovalbumin solution
intradermally into the left ear.
4. Return the mouse to its cage, making sure that you keep it warm (use
a heat lamp if necessary) and safe (from any overly dominant
littermates) during recovery.
5. At four hours post-injection and then again at 24 h, euthanize one
mouse from each group (i.e., one SRBC- and one ovalbumin-sensitized
mouse) and take biopsies of the reaction sites. To do this, use a fresh
#12 scalpel blade to remove the ear and cut it in half longitudinally,
69
through the middle of the reaction (injection) site. Trim away and
discard the tissue from the outside of the ear, away from the injection
sites.
6. Transfer each half of the ear into ice-cold ISH fixative and fix the
tissue for 3 h on ice.
7. Replace the ISH fixative with ice-cold 70% ethanol and store the
tissue in this solution at -20C until you are ready for tissue
processing.
8. Place the tissues into labelled tissue-tek cassettes and transfer into
the tissue processor at the 70% ethanol step. The processor will
automatically process the tissue through to molten paraffin.
9. Embed the tissues in paraffin such that the ear tissues are standing
straight up in the molds, so that upon sectioning you will obtain
cross-sections of the tissue.
10. Cut 6 m paraffin sections of the tissues and dry them onto slides
overnight at 42C.
11. Stain the sections with Giemsa stain using the stipulated protocol
(6.4.9.1.2), mount with permount and examine the tissues under the
microscope.
70
Materials
micropipetters
ISH-fixed cell suspensions or paraffin-embedded 5-7 M tissue sections
Reagents
xylene
graded alcohol baths (i.e., 100%, 90%, 70%, 50%) for hydrating tissue
sections
PBST - PBS containing 0.05% Tween 20
normal goat serum
primary anti-cytokine antibody (suitable for immunohistochemistry;
e.g., rabbit anti-TNF)
biotinylated secondary antibody (e.g., biotinylated goat anti-rabbit IgG
antibody; 3.5)
commercial streptavidin-alkaline phosphatase (SA-AP; 3.5)
BCIP/NBT (see 3.5)
METHOD
1. Run paraffin sections through two xylene baths (10' & 5') to remove
the paraffin, then rehydrate the tissues by passing the slides
71
through the graded ethanol baths (2x100%, 90%, 70%, 50%, each <
1 min), then equilibrate to PBST buffer for 2-3'.
2. Circle the tissue sections with wax pencil to reduce the amount of
reagents required to saturate the tissue sections in each of the
following steps.
3. Incubate the rehydrated tissue sections in 10% normal goat serum
for 2 h @ RT in order to block the non-specific binding capacity of
the tissue immunoglobulin receptors (FcR) for the antibodies to be
used subsequently.
4. Overlay the tissue sections with 75 l of the primary antibody,
using empirically-determined optimal concentrations of the
antibodies (culture supernatants are often used @ 1:5- 1:100;
commercial preparations of purified antibodies @ 1:50-1:250; and
monoclonal antibody ascites fluids @ 1:250-1:10,000) ON @ 4C.
5. Wash the tissue sections three times for 5' each in PBST.
6. Overlay the tissue sections with 75 l of the biotinylated
secondary antibody, again using empirically-determined optimal
concentrations of the antibodies, generally for 2h @ RT.
7. Wash the tissue sections three times for 5' each in PBST.
8. Overlay the tissue sections again, this time with SA-AP diluted to
1:5000 in PBST, and incubate for 90 ' @ RT to label the secondary
antibodies in the tissue sections.
9. Wash the tissue sections three times for 5' each in PBST.
10. Overlay the tissue sections with the commercial solution of
BCIP/NBT for 20 - 40' @ RT (continue staining until the antigen of
interest becomes apparent or until a non-specific general tissue
background staining begins to appear).
11. Transfer slides to H2O and counter-stain with a water-based
counter-stain such as Gill's haemotoxylin ( ) and cover-slip with
aqueous mounting medium.
72
Materials
samples for RNA extraction (tissues or cultured cells)
RNAse-free pipettes, tips, test tubes
micropipetters
single cell suspensions of activated and control Cl.MC/C57.1 cells
(time course of 0, 3 & 6 h)
Reagents
DEPC-H20
20% lauryl sarcosine
73
METHOD
1. At each time in the activation time course, pellet the appropriate
tubes of C57 cells by centrifugation, then generate a paste on the
tube walls by vigorously flicking the tubes. Add 3 ml of GSCN lysis
solution to each tube, and vortex vigorously for 30 sec - 1 min. 18
18 When extracting RNA from tissues, grind the tissues using a polytron-type
homogenizer in GSCN without sarcosine (to avoid foaming), then add the sarcosine
after the tissue homogenization. Pre-centrifuge the homogenized tissues for 30 min
to 2 hours in the ultracentrifuge to get rid of any insoluble tissue remnants. In place
of a polytron to grind up the tissues, one could also use a mortor and pestle with
liguid nitrogen to accomplish the same thing.
75
7. The next day, after the rotor has stopped, switch off the vacuum, open
the door and remove the rotor from the spindle, and the buckets from
the rotor. Take the tubes from the buckets, wash them out with hot
tap water & dry, and check the "O" rings and lubricate using vacuum
grease, if necessary.
8. Completely aspirate the liquid contents of the tube using a Pasteur
pipette attached to a vacuum apparatus. The last few milliliters are
best gotten by turning the tube upside down to allow the fluid to drain
to the pipette. Stay away from the gelatin-like pellet of RNA at the
bottom of the tube. The pellet will be anywhere from 1 - 8 mm across.
9. One at a time, cut the tubes off about 1 cm above the bottom using a
heated scalpel blade, break up the RNA pellet with the tip of the
eppendorf tip, and dissolve the pellet in 50 - 400 l of DEPC-H 2O
(depending on the size of the pellet) by repeated vigorous pipetting.
If necessary, repeat the H2O step to make sure you get all of the RNA,
transferring both washes into an RNAse-free 1.5 ml eppendorf tube.
Close the tube and transfer it to a 65C H2O bath for 5 min to
completely dissolve the RNA, then briefly microfuge to sediment the
contents.
10. Remove 5 l of the RNA from each tube and transfer to another tube
containing 995 l of H2O. Immediately transfer the stock tubes of
RNA to dry ice and then to the -80C freezer. Determine the optical
density (260 nm and 280 nm wavelength; use quartz cuvettes) of each
of the samples. Calculate the OD260:OD280 ratio and the
concentrations of the stock RNA solutions as follows: The 260:280
ratio should be between 1.5 and 2.0 (pure nucleotide solutions have
an OD260 of 2.0 -- the lower the ratio, the more protein contamination
but, practically speaking, ratios of 1.5 are not uncommon and may
still yield excellent results with Northern analyses). To calculate the
concentration of the stock RNA, multiply the OD260 by 10 to get the
concentration in g/l (i.e., an OD260 of 0.108 would mean that the
stock RNA concentration was 1.08 g/l; for a 300 l solution, that
would mean that you had purified 1.08 x 300 = 324 g of RNA).
11. If your RNA solution is too dilute for subsequent Northern analysis
(e.g., 20 g represent >30 l of RNA), then you will need to
concentrate the samples. To do this, take the calculated volume
76
Materials
RNAse-free horizontal gel electrophoresis gel apparatus & power-pack
Zeta-bind transfer membrane (or other)
RNAse-free glass or plastic pipettes
micropipetters & tips
filter paper (e.g., Whatman #1) & absorbent paper (e.g., paper towels)
Reagents
agarose
DEPC-H20
ammonium acetate
formaldehyde
5X MOPS,
10xSSC
1.2% agarose gel
10 mg/ml ethidium bromide
0.03% methylene blue in 0.3M ammonium acetate
RNA sample prep solution (for denaturation of RNA prior to
electrophoresis)
RNA sample dye/loading solution (for visualization of progress during run)
METHOD
1. Wash the Northern blotting apparatus with DEPC-H2O, and then pour
a 1.2% agarose/formaldehyde/MOPS gel (appendix , pg 94) to a depth
of about 8-10 mm (since the RNA samples will be negatively charged
and will migrate towards the positive electrode, make sure that you
position the gel with the wells closest to the negative electrode).
When the gel is fully solidified (this can be expedited by doing the
last of the cooling step in a refrigerator), remove the comb from the
78
gel and fill up the chamber with 1x MOPS running buffer, covering the
gel to a depth of 2-3 mm with buffer.
2. To eppendorf tubes containing 20 g samples of RNA in a volume of
10 - 20 l of H2O, add 15 l of the RNA sample prep buffer and 2 l
of RNA load buffer/dye. Incubate the samples in a 65C water bath for
10 min, then briefly pulse microfuge the tubes and hold on ice until
ready to use.
3. Load the RNA samples into the wells in the gel, being careful to not
puncture the very fragile bottoms of the wells with the pipette tips.
Run two sets of samples, one for Northern blotting, and a separate
set for staining with ethidium bromide (for confirmation that the RNA
samples are intact). When all the samples are loaded, run the gel
until the leading dye front is approximately 50 - 75% down the gel.
(The leading dye front will migrate just in front of the 18s rRNA, while
the trailing dye front will migrate just behind the 28s rRNA in each
sample.)
4. Remove the gel from the gel apparatus and carefully cut it to
separate the Northern blotting portion from that destined for ethidium
bromide staining. Transfer both 'halves' into DEPC-H2O, and incubate
the gel in the water bath for 20 min with gentle rocking. For the half
of the gel to be transferred to the nylon membrane, follow steps 5 - 7,
for the portion to be stained with ethidium bromide, follow alternate
steps 5a - 6a.
5. Equilibrate the half for transfer to 10xSSC, by incubating in 10x SSC
for 20 min with gentle rocking.
5a. The portion to be stained with ethidium bromide should be incubated
for another 20 min in H2O.
6. Assemble the northern blotting apparatus as follows: Cut a wick of 4
- 5 layers of Whatman #1 filter paper that can run the full length of
the gel apparatus gel platform and extend down into the fluid
reservoirs. Place the gel, upside-down onto this wick, making sure
that there are no air bubbles trapped underneath. Apply a piece of
the Zeta-bind membrane (cut the overlap the gel by a few millimeters)
directly to the gel, and then apply several more pieces of filter paper,
cut to the size of the membrane, directly on top of the transfer
membrane, and cover this whole construct with 4-5 inches of paper
79
towel, which will absorb the buffer that wicks through the gel and
Zeta-bind membrane. Next, cut some large pieces of parafilm
membrane and place them around the gel, so that the transfer buffer
can only wick into the paper towel by going through the gel. Finally,
place a weight on top of the paper towel (e.g., a 500 ml reagent bottle
that is half full) and secure in place.
paper towel
filter paper
nylon membrane
10x SSC
gel/blotting apparatus
(pH 5.2) for 45 seconds (or more, if required), then destaining the
blots in DEPC-treated distilled water for 2 minutes. If the RNA is
intact and transferred efficiently, you will readily see the 18s and 28s
ribosomal RNA bands on the blots, as well as a subtle smear of mRNA
that runs from above the 28 s rRNA band to below the 18 s rRNA band.
(If the rRNA bands are not crisp and sharp looking, then some RNA
degradation has taken place the extent of the degradation can be
judged readily in this manner.)
81
Materials
cDNAs for each mRNA of interest
Plexi-glass 32P-energy-blocking safety shield
glass pipettes
plastic wrap
Geiger counter
Reagents
32P-labelled dCTP (Mandel-New England Nuclear; 3000-8000 Ci/mmol)
METHOD
1. Mix together 500-1000 ng of purified cDNA and H2O, to a final volume
of 34 l, then denature the cDNA by heating to 90C for 10-15 min.
Transfer the cDNA to a 37C incubator for 5 min.
2. Add 10l of the oligolabelling reaction mixture (i.e., NTPs/random
hexamer soup), 5 l of 32P-dCTP, and 1 l of Klenow fragment.
3. Incubate the reaction mixture overnight at room temperature (or for
>3 h @ 37C).
4. Purify the 32P-labelled cDNA from the unbound probe by column
chromatography (see accompanying diagram). Run the 50 l reaction
mixture over an 8 ml Sepharose G-50 column, carefully chasing the
50 l reaction into the matrix with 2 sequential 1 ml aliquots of STE
buffer, and eluting the labelled cDNA with STE. Follow the isotope
using a Geiger counter, masking from the Geiger counter the column
82
itself and the collection vessel, but not the elution tubing. Thus the
Geiger counter will detect all of the elution of label from the column
(both that incorporated into the cDNA and that still unincorporated).
unincorporated
32P beta energy
bound 32P
elution tubing
gieger counter
collection tubes
8. Clean up your work area, making sure to monitor all pipettes, shields
benches, etc, for 32P contamination. Wipe test all surfaces and
equipment to confirm your Geiger counter survey and clean up any
remaining contamination using a detergent such as Count-Off (New
England Nuclear). Enter your wipe test results in the lab log books.
19 32Pis a highly unstable isotope, so that the labelled probes cannot be stored for
any more than 3 days to a week without decaying beyond usefulness.
84
Materials
Plexi-glass 32P-energy-blocking safety shield
U.V. irradiation apparatus (e.g., Stratalinker) or vacuum oven
rotary hybridization oven with hybridization tubes
(or water bath, heat-sealable bags, & heat-sealing unit)
glass pipettes
plastic wrap
Geiger counter
Reagents
0.1x SSC/0.5% SDS
2x SSC/0.1 % SDS
0.2x SSC/0.1% SDS
pre-hyb/hybridization solution
32P-labelled cDNA probes (TGF, TNFa & actin)
METHOD
1. After transfer of the RNA from the gel to the Zeta-bind membrane,
cross-link the RNA onto the membranes either by U.V. irradiation or by
baking the blot in a vacuum oven (50C for 4 h).
2. Block the non-specific 32P-cDNA-binding sites on the membranes by
incubating the blot in the hybridization oven for 60 min at 65C in 15
ml of 0.1X SSC/0.5% SDS.
3. Remove the Northern blot blocking solution from the blot and replace
it with 15 ml of hybridization solution. Pre-hybridize the blots in this
solution for 3 h to overnight at 42C.
4. Next, add 1.5x107 cpm of 32P-labelled cDNA probe (250 - 1000 l
volume) to the 15 ml of hybridization solution containing the blot. The
probe must be boiled before addition to the blot to denature the
double-stranded DNA (and allow the anti-sense strand to hybridize to
the mRNA on the blots), and should not be allowed to cool before
85
addition to the blot. Incubate the blots with the probe again
overnight at 42C, making sure that the oven rotator is operating.
5. The next day, remove the very radioactive hybridization solution from
the hybridization bottles (discard in the 32P-liquid waste canister),
and rinse the bottles twice for 5 min each with 2xSSC/0.1% SDS,
discarding the spent washing into the 32P-liquid discard canister.
6. Add 25 - 50 ml of 0.2xSSC/0.1% SDS to each bottle and incubate for
30 min at 42C. Repeat this 30 min/42C wash a second time, and
discard the spent washings into the 32P-liquid discard canister.
7. Remove the blot from the bottle and lay it flat out on a piece of
plastic-wrap. Do not allow it to dry at this point, as drying will
permanently fix all of the (i.e., specifically and any residual non-
specifically bound) 32P-labelled cDNA probe to the blot. Using the
Geiger counter, scan the blot to determine whether most, if not all, of
the radioactivity is associated with bands at the expected position
(molecular mass) on the blot. If it is not, then you need to continue
washing the blot(s), increasing the stringency of the washes (i.e.,
decreasing the SSC concentration &/or increasing the wash
temperature) but, most of the time, 60 min at 42C in 0.2xSSC/0.1%
SDS wash is adequate. If the counts appear to be specifically bound,
wrap the blot completely in plastic wrap and either store it in a
freezer until ready to proceed or place in the autoradiography
exposure cassette (again, do not allow the blot to dry!).
86
Materials
autoradiography exposure cassettes ('enhancing screens' highly
desirable)
Kodak X-OMAT AR x-ray film
automated x-ray film processing unit (or hand processing
equipment/solutions)
Reagents
none, unless processing by hand
METHOD
1. In the laboratory, and for autoradiography cassettes without built-in
'enhancing screens', place two 'enhancing screens' into the cassette
on top of each other (as in a sandwich), such that their shiny surfaces
face one another. Place the probed, plastic-wrapped blot in the
cassette, outside of the enhancing screen sandwich.
2. In the dark-room, under safelight illumination, place a sheet of x-ray
film inside the enhancing screen 'sandwich' (i.e., not in contact with
the blot), and then close and lock the cassette. For the much less
expensive 'leatherette' cassettes, clamp sheets of plywood or
plexiglass to the outside of the cassettes to hold all layers of the
assembled exposure apparatus tightly together.
3. Place the exposure cassette in a -80C freezer until you are ready to
develop the film. The length of time will vary depending on the
intensity of the specific mRNA signal (roughly determined with the
Geiger counter [see step 7, NORTHERN BLOTTING: Pre-hybridization,
Hybridization, and High-stringency Washing ]). If the signal is readily
detectable with the Geiger counter, then a 1 - 3 day exposure is
usually adequate, but if it is not easily detectable, then the exposure
time may need to be extended to 1 - 3 weeks. You may need to do a
short exposure to get a feel for the intensity of the signal, and then
adjust the time to get an optimal signal intensity.
4. For development of the film, remove the cassette from the -80C
freezer and allow it to come to room temperature (this avoids
87
Materials
micropipetters & tips
RNAse-free eppendorf tubes
Reagents
in vitro transcription kit or reagents
RNAid RNA purification kit
35S-UTP (12.5 mCi/ml; 1000 Ci/mmol)
METHOD
1. Synthesize the cRNA probes by transcribing the cDNA in the
linearized in vitro transcription vector (i.e., a vector with SP6, T3 or
89
5. Add 2 l RNAid-kit 'glass milk' and vortex each tube to disperse the
'glass milk' evenly. Incubate the tubes for 5 min @ room
temperature to allow the RNA to bind to the scintered glass.
6. Pulse-spin the tubes for 4 counts (i.e., 4 sec; spinning too long
will pack the glass into too hard a pellet for subsequent dispersal)
and remove and discard the highly radioactive supernatant using a
1 ml pipetman set at 500 l.
7. Add 400 l of RNAid kit wash solution to each tube and resuspend
the pellet by repeatedly vigorously expelling and not too vigorously
aspirating the 400 l wash solution with a P200 micropipetter set
at 150 l (too vigorous an aspiration action will 'bump' the solution
up onto the end of the micropipetter, inside the tip, leaving you
with RNAse contamination of your purified preparation). Vortex
and pulse-spin the tubes for 4 counts, and remove and discard the
highly radioactive supernatant using a 1 ml pipetman set at 500 l,
as above. Repeat step 7 for a total of three washes.
8. Resuspend the pellet in 25 l of DEPC-H2O (this time notice that
the pellet can be resuspended very easily), and place the tubes in
a 55C water bath for 3 min. During this incubation, set up some
new, labelled Eppendorf tubes with 25 l of deionized formamide
(this will be the final storage tube for the purified 35S-cRNA).
9. Microfuge the tubes for 3 - 5 min (full speed) to pellet the 'glass
milk' and carefully remove the 35S-cRNA (supernatant)) from each
tube. It is critical to avoid aspirating any glassmilk at this point,
so remove the supernatant 10 l at a time using your 1 - 10 l
pipetter. Transfer this eluted cRNA into the deionized formamide-
Eppendorf tubes (step 8), so that you should now have a total 35S-
cRNA (i.e., probe) volume of 50 l.
10. Remove 1 l of this purified probe from each tube, and dot it onto a
filter paper disc (labelled B). Transfer the paper disc into another
scintillation vial (labelled B) for -counting.
11. Transfer the purified probe to a -70C freezer until you are ready to
use it.
12. Add 4 ml of aqueous-miscible scintillation cocktail to scintillation
vials A and B, cap them securely and use a liquid scintillation
counter to determine the 35S counts in each tube.
91
The raw data obtained from the 1 l aliquots taken in steps 3 & 10 is:
Materials
37C water bath
60C water bath
90C water bath
slide-staining apparatus (12 'coplin' jars are adequate)
10 ml glass pipettes (baked or commercial disposable)
micropipetters (P200 & P2000) and tips
50 ml graduate centrifuge tubes (adequate for measuring reagents)
pH paper strips (0.5 pH unit sensitivity is fine).
Reagents
10 M NaOH
xylene
ethanol (100%, 90%, 70%, & 50%)
DEPC-treated H2O (500 ml)
0.2 M HCl (16 ml concentrated HCl in 984 ml DEPC-H2O)
TE buffer (10mM Tris/1 mM EDTA in H2O)
PBS
proteinase K (1 - 40 g/ml in TE; prepare immediately before use, from
frozen stocks).
0.2% glycine in PBS (3 ml of 10% glycine IN 147 ml PBS)
4% paraformaldehyde in PBS (dissolve at 60C at high pH, then adjust
pH to neutral).
0.1 M triethanolamine (prepare just before use)
acetic anhydride
METHOD
1. Normally, when you are doing ISH with paraffin sections, you need
to first de-wax and rehydrate the sections with sequential
treatments with xylene and ethanol. Since cytocentrifuge
preparations are not embedded in paraffin and are stored already
in 70% ethanol, they enter the process at the 70% ethanol stage,
and then are treated as with the paraffin sections protocol.
94
Materials
40 - 65C hybridization oven
90C water bath
micropipetter (P200) and tips
pH paper strips (0.5 pH unit sensitivity is fine).
Reagents
DEPC-treated H2O (500 ml)
ISH hybridization buffer
thio-UTP (non-radioactive; for additional blocking of non-specific
binding of 35S-UTP)
35S-UTP-labelled sense and anti-sense cRNA probes (concentrations
known)
METHOD
1. Calculate the amounts of probe, thio-UTP and hybridization buffer
that you will require for your experiment. Base these calculations
on:
-using a final probe concentration of 0.25 ng of probe/l of final
hybridization cocktail/kilobase of cRNA probe complexity. For
a 1 kilobase cRNA probe, and applying 45 l of final
hybridization cocktail to each slide, then you will need 45 x
0.25 ng x 1.0 kb = 11.25 ng/slide;
-the 45 l for each slide must include 1.25 l of thio-UTP
-the balance of the 45 l for each slide comprises hybridization
buffer
A typical set of calculations for a ISH procedure in which you are going
to probe 8 sense (negative control) slides and 20 anti-sense
(experimental) slides with 35S-TNF cRNA probes that have cRNA
concentrations of 5 ng/l is as follows:
TGF:
anti- 26 1170 32.5 50 1087.5
sense
TNF:
sense 24 1080 30 50 1000
TNF:
anti- 21 945 27 50 868
sense
Materials
37C water bath
47C water bath
2 coplin jars
bath for removing cover slips
Geiger counter
plexi-glass shield for working with 35S
isotope disposal bins
Reagents
2x SSC
50% formamide/2xSSC/10 mM 2-mercaptoethanol
4xSSC/TE
RNAse A (10 mg/ml)
ethanol (i.e., 30, 50, 70, & 90%) each containing 0.3 M ammonium
acetate
100% ethanol
METHOD
1. Remove each of the slides from the hybridization chamber and
place, back-to-back, in the metal slide holder (as much as possible,
handle the slides by their frosted ends, away from the radioactive
area). Immerse the slides in a bath of 2xSSC until each of the
coverslips has fallen off of the slides.
2. Transfer slides to a tissue-tek holder and incubate for 30 min at
50C in 50% formamide-2xSSC-10mM 2-mercaptoethanol. After 30
min repeat this step, for a total time of 60 min. Discard the 2xSSC
solution from step 1, as well as the used contents of the two
reagent baths from step 2 in the liquid 35S waste bucket.
3. Equilibrate slides for 15 min at 37C in 4X SSC-TE
[4X SSC containing 10mM Tris and 1 mM EDTA]
4. Digest the single-stranded 35S-cRNA that is non-specifically bound
to the tissues (i.e., not hybridized to mRNA) with RNAse A, by
incubating the slides for 30 min at 37C in RNAse (20 g/ml) in
99
5. Wash the residual RNAse from the slides for 30 min at 37C in
4xSSC-TE
6. Perform one final high stringency wash to remove non-specifically
bound, digested 35S-UTP (or larger nucleotides) by incubating the
slides for 60 min at 50C in 50% formamide-2X SSC-10mM 2-
mercaptoethanol. Discard the used wash solutions in the liquid
35S waste bucket.
7. Equilibrate the slides to 2xSSC by incubating them for 3-5 min (at
room temperature) in this solution, and then dehydrate them by
sequentially transferring them through a graded series of ethanol
baths (30%, 50%, 70%, and 93%; each containing 0.3M ammonium
acetate), keeping the slides in each for 30 sec.
8. Complete the dehydration process in a 100% ethanol bath (30 sec)
and then transfer the slides to a paper towel on the bench and
allow them to air dry for 5 -10 min.
9. With the slides laid out flat on paper towels, scan each with a
Geiger counter to get a feeling for the levels of radioactivity
associated with each (this will determine roughly the exposure
times for the autoradiography -- short or long exposure time), and
label each of them with some sort of identification number. These
numbers will need to be visible in the darkroom, under safelight
illumination, so they are best done with a magic marker, on a clear
section of the glass that will not be come in contact with the
autoradiography emulsion (i.e., immediately adjacent to the
painted or frosted surface of the slide). Return the slides to tissue-
tek holder(s), clearly separated into "early" and "late" development
groups. Since all subsequent steps are performed in the darkroom
under safelight illumination, remember clearly exactly how you
have allocated your slides.
Subsequent steps are performed in the darkroom under safelight
illumination:
10. Place an aliquot of emulsion in alight-proof holder (half-filled with
water) within a 42-45C water bath. Allow 10-15 min for the
emulsion to melt. Also prewarm a the slide mailer.
100
11. When the emulsion is melted, fill vertical slide mailer with
emulsion.
12. Dip a clean (blank) slide in the emulsion and check for smooth,
"bubble-free" coating. One at a time, gently dip each experimental
slide in the emulsion, withdraw it and wipe the back with a glass
slide or razor blade and then standing vertically against the inner
sides of drying boxes. Place the covers on the boxes so that they
are light-proof (which will allow you to open the door of the
darkroom and walk out) and allow slides to dry for 30 min. Return
the unused emulsion from the mailer tube to the centrifuge tube
and return it to the refrigerator.
13. When the slides are dry, place each into black slide boxes, wrap in
2 layers of foil, label with tape, and store in a -20C freezer.
101
Materials
staining coplin jars
slide staining rack
cover slips
Reagents
Kodak D19 developer (diluted 1:1 with H2O)
H 2O
Kodak rapid fixer
running water bath
60% ethanol bath
0.2% toluidine blue in 60% ethanol bath
acetone bath (2)
xylene bath (2)
entellen or permount mounting medium
METHOD
1. Remove slides to be developed from the freezer and allow the still
foil-wrapped boxes to come to room temperature.
2. In the darkroom, under safelight illumination, transfer the slides to
a tissue tek slide holder, and then place them first in the D19
developer for 2.5 min, then in the H2O for 15 sec, and finally in the
fixer for 5 min. (Within a minute or two of transferring the slides
into the fixer, it is safe to turn on the lights).
3. Soak the slides in gently running water for 2 hours.
4. Transfer slides into 60% ethanol for 30 sec, then into the 0.2%
toluidine blue in 60% ethanol for 30 sec
5. Dip the slides in the water bath 3 times and then transfer to the
first acetone bath for 2.5 min, followed by a second acetone bath
for another 2.5 min.
6. Transfer to xylene #2 for 2.5 min, then to xylene #1 for 2.5 min
(complete submersion is required to remove all H 2O, which will irreversibly turn
the dehydrated emulsion opaque)
102
Materials
thermocycler
42 & 70C water baths & an ice bath
micropipetter (0.5-10l) and tips
horizontal gel electrophoresis apparatus and powerpac
Reagents
purified total cellular RNA (see 4.1.1)
oligo(dT)
DEPC-treated H2O
10x PCR buffer ()
50 mM MgCl2
10 mM dNTP mix (dATP, dCTP, dGTP & dTTP)
104
20At temperatures above 56C the gel apparatus will warp badly, so do not pour the
gel into the mold until it is sufficiently cool
108
APPENDICES:
Reagents
0.4% trypan blue in saline
METHOD
1. Cap and gently invert or otherwise swirl cells several times to ensure an
even cellular distribution
2. Withdraw 20 ul of cells to a 0.5 ml eppendorf tube and add an equal
volume of 0.4% trypan blue
3. Pipette mixture up and down several times to mix the cells
4. Transfer 10 - 20 l of the cell suspension to the hemocytometer (with
coverslip in place). Capillary activity will draw the cells under the cover
slip and thereby fill the viewing chamber
5. Examine the cells under the microscope, first at low power setting and
when you have your bearings under the scope, switch to higher
magnification for actual cell counting.
6. You will note that the chamber is divided up into 9 larger squares, each of
which is in turn subdivided. Count the total numbers of cells in each of 5
of the larger squares (e.g., central , left, right, top and bottom ones),
noting the cell count in each. You should count all cells that lie inside the
boundary lines of the squares, and you should also count the cells that
fall on top of the lines delineating two of the four sides (for consistency,
pick whichever ones are easiest for you to remember, e.g., I always
include those on the top and left-hand side lines).
109
HEMOCYTOMETER FIELD
N.B. If your cell preparation includes clumps of cells, you have to decide
whether you can get an accurate estimate of the cell numbers with the
clumps present. If you feel that the clumps are evenly distributed in your
original cell suspension, then you might simply vigorously pipette the
cells in the eppendorf tube (i.e., the trypan blue/cell mixture) to disperse
the clumped cells and then recount. However, if the cells are very badly
clumped, you will have to disperse the cells in the stock suspension,
either by vigorous pipetting (which is very inefficient) or by re-
centrifuging and dispersing the cell pellet correctly.
1. Activate the zymosan A by boiling for 10 min in PBS and then washing
with PBS. Resuspend to a final concentration of 10 mg/ml.
2. To coat the zymosan beads with C3b, add 200 l of fresh mouse serum to
2 mg 'activated' zymosan and incubate for 15 min at 37C.
3. Wash the yeast with PBS and store at 4C until ready to use.
METHOD
1. prepare cell suspension of 5x105 - 106 cells/ml
2. assemble centrifuge chambers with labeled slides and filters in correct
orientation and load chambers into the centrifuge.
3. add 50 - 200 l of cells to each chamber (depending on the cell numbers,
concentrations, etc...)
4. centrifuge the cells for 4 - 5 min at 1500 rpm
5. when the rotor stops, remove slides from the chambers (being careful not
to scrape the cells off of the slides in this process) and allow the cells to
air dry (alternately, you can fix the cells in acetone or alcohol for 15 sec
and then air dry)
6. clean the disassembled chambers and clamp assemblies with H 2O and
allow to air dry after use.
7. the air-dried cells can be stained immediately or, depending on their
purpose, stored either at room temperature or in the freezer.
Reagents
0.05% EDTA (0.5 g/l; or 3.4 ml of 0.5 M stock/996.6 ml H 2O)
0.05% Na2CO3 (0.5 g/l H2O)
distilled H2O
111
50%ETOH
METHOD
1. cut tubing to suitable sizes, allowing for tying or clamping ends or
prepare large sections
2. boil the sections of tubing for 10' in 0.05% EDTA
3. boil a second time for 10' in 0.05% Na2CO3.
4. boil a third time for 10' in 0.05% NaCO3.
5. rinse several times with H2O and, finally, store at 4C in 50% ethanol
(keep the beaker covered with parafilm)
Reagents
DMEM-10%, MEM
density gradient media (e.g., Lymphocyte Separation Medium, Percoll...;
optional)
collagenase (Worthington Scientific); hyaluronidase (Worthington Scientific)
MEM containing 1.5 mg/ml collagenase and 0.75 mg/ml hyaluronidase
METHOD
1. Obtain lung tissues and dice them finely (to 0.5 mm 3) with a scalpel, in
MEM medium.
2. Transfer the tissues into fresh MEM containing
collagenase/hyaluronidase (1 g tissue/10 ml enzyme cocktail) and
incubate at 37C for 60 min, ideally on a rocker platform.
3. Disperse any undigested fragments of tissue by repeated aspirating
through a 20 ga. needle on a10 ml syringe.
4. Filter the digested tissues through 4 layers of sterile gauze to remove
undigested tissue fragments, and wash the dispersed cells in DMEM-
10%.
5. Either use the cells directly or, if necessary, carry on with the
purification, fractionating the cells by density gradient centrifugation.
112
6. Determine the cell yield and viability by direct counting of trypan blue-
treated cells using a hemocytometer.
21 SRBC are obtained by venipuncture (usually the jugular vein) of sheep directly
into EDTA-containing syringes or alternately into regular syringes followed
directly by transfer of the blood into EDTA-containing tubes. The cells are
washed two times with Alsevers solution (see Appendix C) and resuspended in
Alsevers solution, which is a good long-term storage reagent for SRBC.
113
Reagents:
Bio-Rad concentrated dye reagent
protein standard (we will use bovine serum albumin; BSA)
METHOD:
1. dilute dye reagent 1:5 with H2O (ie. 1 part reagent + 4 parts H 2O), and
filter through Whatman #1 filter paper. (store at 4C; stable for 2 weeks)
2. dilute BSA standards to a range that should bracket that of the unknowns
-- try standards of 5.0, 10, 25, 50, and 100 g/ml.
3. Pipette 160 l of standard and sample solution into separate wells of the
microtitre plate
4. Add 40 l of the diluted dye reagent to each well and mix the samples
thoroughly by repeated pipetting. Incubate the plates at room
temperature for at least 5 min, but no more than 1 h.
5. Measure the absorbance at a wavelength of 595 nm.
Reagents
DMEM/10% FCS (Appendix B)
70% ethanol
optional:
sterile surgical tools (scissors, forceps)
METHOD:
1. Euthanize a mouse (e.g., BALB/c) by inducing surgical-level anaesthesia
with methoxyfluorane and dislocating the cervical spinal column. To
dislocate the cervical spine effectively, place the mouse down on the
bench in sternal recumbancy (belly down), firmly place an instrument
(e.g., forceps or closed scissors) across the back of the neck and holding
the mouse in position with this instrument, firmly, but not too forcefully,
pull the mouse backwards by the tail. You will hear a popping sound as
the neck dislocates.
2. When the mouse ceases breathing (very shortly after step 1), lay it on its
right side, and soak the left side with 70% ethanol. Holding the skin over
the spleen up into a tent, incise it with a pair of scissors, and then grasp
114
both sides of the incision firmly between the thumb and forefinger of each
hand. Pull the skin open and reflect it full back, both dorsally and
ventrally.
3. Open the body wall over the spleen with the scissors, pull the spleen up
from the other viscera and clip away the vascular attachments and fat.
Place the spleen in a petri dish containing DMEM-0%FCS and tease the
tissues apart using two pairs of fine, curved forceps. Continue teasing
until all of the tissue clumps are dispersed as much as possible.
4. Using a pipette aid (electrical pipetting device) and a 10 ml pipette,
vigorously pipette the cells 20 - 25 times, to completely break up the
clumps. Filter the dispersed spleen cell preparation through 3 - 4 layers
of sterile gauze drawn across the top of a 15 ml centrifuge tube. Remove
20 l of the filtrate (now a single cell suspension) for hemocytometer
counting.
5. Wash the cells once by centrifuging and resuspending to the desired final
concentration in the desired medium. For our purposes, this will usually
be 3x106 cells/ml of DMEM-10% FCS. From one normal mouse spleen, you
may obtain anywhere from 2 - 12x106 nucleated cells.
Reagents:
DMEM/10% FCS (Appendix B)
concanavalin A (4 mg/ml stock solution in PBS, or DMEM or RPMI, etc..)
METHOD
1. Generate a single cell suspension of spleen cells from a normal mouse
with a cell concentration of 3x106 cells/ml of DMEM-10% FCS. Set up the
cells in a T75 flask.
2. Add ConA to the cultures to a final concentration of 4 g/ml and place the
cells in the CO2 incubator for 4 days.
3. Prior to harvesting the cells, examine the cultures to confirm that the
cells have aggregated as they should following ConA stimulation.
Provided the cells appear as they should, transfer them to 50 ml
centrifuge tubes and sediment the cells by centrifugation for 10 min at
1500 rpm.
4. Aliquot the supernatants and store at either -20C or -80C. This
conditioned medium will keep its activity for many months.
115
METHOD
1. Apply 50 - 100 l of stain to the cells on each slide, and allow to sit for 10
min.
2. flush the scum from the slide with 0.5 ml of buffered water
3. Add 100 l of neutral buffered water to the cells, incubate for 1 min, then
air dry standing up.
4. Mount coverslips on the slides with Permount or Entellen
5. Examine the cells under 40x - 100x power using a compound microscope.
The cells can be differentiated based on their staining and morphology, as
in figure x.
Results
The appearances of the different types of mouse PBL following Giemsa
staining are demonstrated below. In effect:
POLYMORPHONUCLEAR CELLS (all have highly lobulated nuclei)
--eosinophils have rather large, red-stained cytoplasmic granules that fill
all of the extranuclear compartment of the cells.
-- neutrophils have rather small, pale pink-stained cytoplasmic granules
that fill the extranuclear compartment of the cells.
--in the mouse, basophils are present in such low numbers that some
authors state that mice do not have basophils. They appear much like
monocytes, with one or two medium-sized deep purple-staining granules.
You probably will never see a mouse basophils (unless you begin working
with these cells.
MONONUCLEAR CELLS (all have round to slightly indented nuclei)
-- lymphocytes are present in substantial numbers in a number of
compartments. Most circulating lymphocytes are unstimulated ones and
appear as very small cells that contain large nuclei. In fact, often the
cytoplasm appears as a small rim of powder blue-coloured cytoplasm.
Activated lymphocytes (plasma cells) tend to be large, with nuclei the
same size as that of the small lymphocytes, but they have abundant
cytoplasm. The nuclei are usually very round, with few if any
indentations.
- monocytes are much like large lymphocytes, but the nuclei are
usually indented.
These are very simplified descriptions of the WBC, but they will probably serve
to fulfill most of your needs as far as differentiating these cells.
METHOD
1. Deparaffinize and rehydrate the tissue sections (2x 5' in xylene; 2x 30"
100% ethanol; 1x 30" 95% ethanol; 1x 30" 70% ethanol; 1x 30" 50%
ethanol.
2. Transfer the slides into the Giemsa stain bath & hold for 1 - 2 h . After
one hour, rinse the slides with water as in step 3 and briefly look at the
sections under the microscope. If they appear sufficiently stained,
proceed with step 4, if not continue staining until the desired intensity of
stain is achieved.
3. Briefly rinse the slides in tap water.
4. Dehydrate the slides by transferring through three baths (2.5 min each) of
isopropanol, one bath (2.5 min) isopropanol/xylene [1:1]; and two baths of
xylene (5 min each).
5. Mount coverslips on the slides with Permount or Entellen
METHOD
1. Transfer the IHC-stained slides from H2O into the Gill's stain for 45 sec
2. Transfer the slides quickly through 10% methanol (three quick dips to get
rid of excess stain).
3. Transfer the slides into the TBS for 1 min (to blue or differentiate the
stain), then into the H2O bath until ready for cover-slipping.
4. Cover-slip the slides with aqueous mounting medium.
METHOD
1. Place the water-washed, developed ISH slides into the 60% ethanol bath
for 3 min
2. Transfer the slides to 0.2% toluidine blue in 60% ethanol and hold for 30
seconds, then quickly rinse the excess stain from the slides by dipping in
water.
117
3. Transfer the slides through two changes of isopropanol (2.5 min each),
one change of 1:1 isopropanol:xylene (2.5 min), and finally two changes of
xylene (also 2-3 min each).
4. Cover-slip the slides with permount.
3. To add the standards to the plate, start adding the most dilute one to the
replicate wells, and sequentially move up the concentration gradient.
This way you won't have to change pipette tips for each standard in the
series, unless you contaminate a tip in the process.
so warm and cool them gradually - that means put them in a cold oven and then
turn on the heat and also allow them to cool completely before removing them
from the oven.
2. Wash the slides in a 2% solution of organosilane in high-grade acetone for 1
min with gentle agitation.
3. Rinse the slides in high-grade acetone for 1 min and air-dry.
4. Store the slides at room temperature indefinitely.
(N.B. If section or cell loss from the slides is still a problem, even greater
adhesiveness can be achieved by treating the dried slides after step 3
with a 10% formaldehyde solution for 60 min, followed by air drying)
119
Alsevers solution
Recipe for 1 liter
To 900 ml of H2O, add:
20.5 g dextrose (>114 mM)
7.9 g sodium citrate-2H2O (> 27 mM)
dissolve the reagents & adjust pH to 6.1 with 1M citric acid
Add H2O to 1000 ml & filter sterilize
Ammonium chloride
For lysis of red blood cells.
Recipe for 1 litre:
To 900 ml of H2O, add:
2.42 g Tris
7.56 g NH4Cl
pH to 7.2 with HCl
Add H2O to 1000 ml & filter sterilize
Borate-buffered saline
For dialysis with purified IgM antibodies.
Recipe for 1 liter
To 900 ml of H2O, add:
5.72 g sodium borate
8.76 g sodium chloride
pH to 8.5 with 1 M NaOH
Add H2O to 1000 ml & filter sterilize
0.4% Trypan Blue (in PBS) is a vital dye (i.e., is used with live cells) that is not taken up
by viable cells, but is taken up by effete cells. The nuclei of these cells stain an
intense blue colour, while fully dead cells or live ones take up no dye. The dead
ones can usually be distinguished morphologically from the live ones. For use in
hemocytometer counting of cells, dilute the cell samples 1:1 with 0.4% trypan
blue.
employing 35S-UTP probes. For the washing steps of the ISH protocols, 2-
mercaptoethanol can be substituted.
MOPS (1 M)
231.28 g MOPS powder
add DEPC-H2O to 1000 ml, and filter sterilize (0.45 m filter)
5X MOPS Buffer
MOPS 0.2 M (200 ml 1M)
sodium acetate 50 mM (16.6 ml 3M; pH 7)
EDTA (pH 8.0) 5 mM (10 ml 0.5 M)
Add DEPC- H2O to 1000 ml
Phenol (salt-saturated)
125
this recipe produces a very stable phenol solution. It stability largely arises from the
extra anti-oxidants added relative to many other recipes (recipe, Dan Tenen, Harvard
Medical School)
100g phenol (heat in a 56C water bath to melt the phenol
45.4 ml 2 M Tris pH 7.5
59.02 ml DEPC-treated H2O
11.35 ml m-cresol
454 l 2-mercaptoethanol
227 mg hydroxyquinolone
Reagents for purifying DNA from agarose gels (store in the dark at 4C)
NaI solution to dissolve agarose gel. To prepare 100 ml, add together:
90.8 g NaI
1.5 g Na2SO3
add DEPC-H2O to 100 ml & mix the solution
filter through Whatman #1 filter paper and then
place 0.5 g Na2SO3 into a piece of dialysis tubing, tie off the ends &
drop it into NaI solution (to keep it sodium sulfate-saturated.
Ethanol wash solution (store at -20C)
50% EtOH
0.1 M NaCl
10 mM Tris (pH 7.5)
salt level .
reagent none low medium high
Tris/HCl (pH 7.5) 100 mM 100 mM 100 mM 100 mM
MgCl2 100 mM 100 mM 100 mM 100 mM
dithiothreitol 10 mM 10 mM 10 mM
10 mM
BSA (mg/ml) 1 1 1 1
NaCl 0M 0.5 M 1.0 M 1.5 M
STE buffer
Tris 10 mM (0.5 ml of 2M)
EDTA 1 mM (200l of 0.5M)
NaCl 0.1 M (1 ml of 10M)
H 2O qs to 100 ml
128
7TD1 cells (for assay of IL-6). 7TD1 cells are an IL-6 dependent murine hybridoma
cell line that can be purchased from the American Type Culture Collection
(ATCC #CRL ). They are maintained in RPMI 1640, 10% FCS, L-glutamine,
antibiotics, 5x10-5M 2-Me and require a source of IL-6. 7TD1 cells are
normally adherent, and are passaged with versene and trypsin. They must be
maintained in a subconfluent state (i.e., 1x105 cells/ml), or they will lose
their IL-6 responsiveness. In our hands, these cells are responsive to bovine,
equine, murine and human IL-6. We maintain our cells in recombinant human
IL-6.
L-929 cells (for TNF bioassay). The line of L-929 cells that we are using are
exquisitely sensitive to the effects of TNFa (ATCC # ). TNF will kill these
cells with the kinetics observed with natural cytotoxic cells (i.e., 18 h), as
opposed to natural killer cells (which require much less time to kill their
targets). L929 cells are maintained in DMEM, 10% normal horse serum, L-
glutamine, penicillin, streptomycin, fungisone (PSF), and 5x10-5 M 2-
mercaptoethanol. The cells are necessarily maintained at sub-confluent
levels (over-growth dramatically diminishes their sensitivity to TNF). They
comprise an adherent cell line, that is best split by minimal trypsin digestion
in medium lacking FCS, followed quickly thereafter by washing with regular
growth medium to prevent over-digestion of the cells.
LM-1 cells (for assay of IL-1). LM-1 cells comprise a sub-clone of the IL-1-responsive
ATCC cell line D10.G4.1. They were sub-cloned by the immunologists at VIDO (U
of S), and were selected in part because, unlike thymocytes, they do not require
sub-mitogenic doses of mitogens (e.g., ConA or PHA) in order to respond to IL-1.
They are maintained in Clicks-10% FCS, supplemented with 10% Con A-
stimulated mouse spleen cell-conditioned medium.
PCR
PRODUCT
CYTOKINE 5' PRIMERS 3' PRIMERS (BP)
5'TGGCTTTGGAGTTGGAGATTTTTGG 207
G-CSF 5'-CTGTGGCACAGTGCACTCTGG 5'-GGAGGGCTTGGCTCAGGGCT 573
GM-CSF 5'-ATGTGGCTGCAGAGCCTGCTGC 5'-TCCAGCCTCATCGGCCGGT 456
LIFa 5'-TCTGAAGTGCAGCCCATAATGAAGGT 5'-
CCTCGGTTCACAGCACACACTTCAAGA 659
M-CSF 5'-AAAGTGAAAGTTTGCCTGGGTCCT 5'-GGCCACACACTCACCAGCCG 340
MCP-3 5'-ACCTGCAGATTTATCAATAAGAAAATCCC 5'-
CCCGGTCCTGAAATACTTCGTGGACCAGTGGTT 178
MIP-1a 5'-CAGACAGTGGTCAGTCCTTTC 5'-CCCTCAGGCACTCAGCTCTA 379
MIP-2 5'-GCTTCCCGACGCGTCTGCTGA 5'-GTAAGGGCAGGGACCACCCTG 417
22eaaa
IL-1 , IL-3, -4, -5, -6, -7, -8, -10, -11, &
-13, and IRAP, G-CSF, GM-CSF, LIF, M-CSF, MIP1a, MIP2, SCF & TNFa can be found in
Oka et al. (1995). Cytokine mRNA expression patterns in human esophageal
cancer cell lines. J Interf. & Cytokine Res 15: 1005-09.
23 The RT-PCR protocol for amplifying eotaxin mRNA is available in Bartels et al.
(1996). Human dermal fibroblasts express eotaxin: molecular cloning, mRNA
expression, and identification of eotaxin sequence variants. Biochem Biophys Res
Commun 25: 1045-51
132
http://galaxy.einet.net/galaxy/Medicine/MedicicalSpecialties/Immunology.htmi
The World Wide Web Virtual Library: Immunology
(Biosciences)..http://golgi.harvard.edu/biopages/immuno.htmi
Medical Research Council of Canada ........................................
..http://www.mrc.gc.ca/title.html
Society homepages
http://www.microbiology.adelaide.edu.au/fimsa.htm
International Society of Experimental Hematology.........................http://www.kcj.com/hema/
National Academy of Science (US).................................................http://www.nas.edu
pp 115-123
Differential complement activation by bovine IgG2 allotypes
FD Bastida-Corcuera, LB Corbeil
pp 143-149
Binding of bovine IgG2a and IgG2b allotypes to protein A, protein G,
and Haemophilus somnus IgBPs
FD Bastida-Corcuera, LB Corbeil
136
1 2 3 4 5 6 7 8 9 10 11 12
A
B
C
D
E
F
G
H
1 2 3 4 5 6 7 8 9 10 11 12
A
B
C
D
E
F
G
H
1 2 3 4 5 6 7 8 9 10 11 12
A
B
C
D
E
F
G
H
137
1 2 3 4 5 6 7 8 9 10 11 12
A
B
C
D
E
F
G
H
1 2 3 4 5 6 7 8 9 10 11 12
A
B
C
D
E
F
G
H
1 2 3 4 5 6 7 8 9 10 11 12
A
B
C
D
E
F
G
H
138
1 2 3 4 5 6 7 8 9 10 11 12
A
B
C
D
E
F
G
H
1 2 3 4 5 6 7 8 9 10 11 12
A
B
C
D
E
F
G
H
1 2 3 4 5 6 7 8 9 10 11 12
A
B
C
D
E
F
G
H
1
IL-6 activity 21
INDEX immunohistochemistry 58
in situ hybridization 72
10xSSC 63 intradermal skin test 56
32P-labelled cDNA probe
isopropanol fix 39
synthesis 66 isotonic Percoll 9
5X MOPS 63 L-929 cells 23
7TD1 cells 21 lauryl sarcosine 60
actinomycin-D 23
activation of macrophages 16
ammonium persulfate 38
anaesthetic 8, 12, 100 leukocyte/platelet-rich plasma 9
antibody-dependent lipopolysaccharide 16
phagocytosis 14 LM-1 cells 18
antibody-coated cells 14 low-tox rabbit C' 42
ADCC 14 LPS 16
anticoagulant 8 Lymphocyte separation medium
AVID-AL IgG affinity columns 32 50
blast assay 46 mast cells 29
bromophenol blue dye 39 monoclonal antibodies 31
C'-dependent cytotoxicity 42 monocyte/macrophage
capture antibodies 50 monolayers 14
cell counting 96 monokine bioassays 18
cellular RNA 60 morphologic identification of
cellular viability 97 PBL 101
Concanavalin A 46 MTT 18
CsCl/sodium acetate 60 neutrophil chemotaxis assay 25
cytocentrifuge preparations 97 neutrophils 8
cytotoxicity assay for TNFa 23 nitrocellulose 40
density gradient systems 8 Northern blot blocking solution
detection antibodies 50 68
detection of mRNA bands 70 Northern blotting 60
ELISPOT 50 Northern blotting apparatus 63
ELISPOT plates 50 PAGE 2x sample prep buffer 91
fluorescein-labelled anti-CD4 42 PAGE running buffer 91
Giemsa stain 57 paraffin section 57
Gill's hematoxylin 102 paraformaldehyde 43
GK1.5 (anti-CD4) 31 PBST 50
GSCN lysis solution 60 percoll 9
H2O-saturated isobutyl alcohol. peripheral blood 8
38 phycoerythrin-labelled anti-CD8
hemocytometer 96 antibodies 42
heparin 8 platelet 9
IgE anti-DNP antibody 29 PMN 8
IL-1 activity 18
2
polyacrylamide gel
electrophoresis 38
polymorphonuclear cells 8
pre-hybridization (Northerns) 68
radioactive hybridization
solution 68
rapid Coomassie blue stain 38
rapid Coomassie brilliant blue
39
RBC sedimentation buffer 9
recombinant human IL-6 21
RNA sample dye/loading solution
63
RNA sample prep solution 63
rouleaux 9
separating gel (PAGE) 38
stacking gel (PAGE) 39
streptavidin-AP conjugate 40, 50
Synthesize the cRNA probes 72
T cell responses 56
Th1 versus Th2 responses 56
A PRACTICAL GUIDE TO
CELLULAR AND MOLECULAR
RESEARCH METHODS IN IMMUNOLOGY
SECOND EDITION
---------------------------------------------------------------------------
Front cover:
top left - In situ hybridization autoradiography of mouse skin tissues undergoing
a passive cutaneous anaphylaxis response following intravenous allergen
challenge. The tissue was harvested at 8 h post-challenge and was probed with
a 35S-a1 (I) collagen cRNA probe, which hybridizes specifically with fibroblasts
activated by mast cell TNFa and TGF (Gordon & Galli, J Exp Med 180: 2027,
1994).
top right - Northern blot autoradiograph of mRNA from Cl.MC/C57.1 mast cells
challenged via the FceRI for varying periods of time. The blot was probed with a
32P-TNFa cDNA and washed at high stringency (Gordon & Galli, J Exp Med 174:
103, 1991).
2
bottom left - Antigen-driven IFN and IL-4 production in splenocyte cultures from
BALB/c mice vaccinated (dy 0) and boosted (dy 14) with a range of doses of
ovalbumin (0.05 - 10 g) in the context of alum (taken from Schneider & Gordon,
manuscript in preparation)
bottom right - Chemotaxis assay of the eosinophil chemotactic activities of
extracts from the skin of an eosinophilic epitheliotropic T cell lymphoma
patient. The tissues contained high levels of MCP-3, and moderate levels of
RANTES & GM-CSF (Hull, Saxena & Gordon, manuscript in preparation)