Vox Sanguinis (2013)

2013 International Society of Blood Transfusion

ORIGINAL PAPER DOI: 10.1111/vox.12056

Hepatitis E virus in Scottish blood donors

A. Cleland,1 L. Smith,1 C. Crossan,2 O. Blatchford,3 H. R. Dalton,4 L. Scobie2 & J. Petrik1,5
1
Scottish National Blood Transfusion Service, Edinburgh, UK
2
Glasgow Caledonian University, Glasgow, UK
3
Health Protection Scotland, Glasgow, UK
4
Royal Cornwall Hospital Trust and European Centre for Environment and Human Health, University of Exeter, Truro, UK
5
University of Edinburgh, Edinburgh, UK

Background and Objectives Published prevalence figures for hepatitis E virus

(HEV) reveal significant regional differences. Several studies have reported virus
transmission via blood transfusion. The aim of this study was to establish HEV
seroprevalence and investigate a potential HEV RNA presence in Scottish blood
donors.
Materials and Methods IgG and IgM were determined in individual serum sam-
ples. HEV RNA was investigated in plasma mini-pools corresponding to 43 560
individual donations using nested PCR. Samples amenable to reamplification with
primers from a different region were considered confirmed positives, sequenced
and analysed.
Results A total of 73 of 1559 tested individual sera (4
7%) were IgG positive,
none tested positive for IgM. Plasma mini-pool testing revealed an HEV RNA fre-
quency of 1 in 14 520 donations. Three confirmed positives belonged, as
expected to genotype 3.
Conclusions HEV IgG and RNA figures in Scottish blood donors are lower than
those published for the rest of the UK, but sufficiently high to prompt further
studies on potential transmission rates and effects of HEV infection, especially
Received: 15 March 2013,
revised 7 May 2013,
for immunosuppressed individuals.
accepted 8 May 2013 Key words: blood donors, HEV, NAT testing, serological testing.

of HEV being a zoonosis [1, 2]. Infections caused by

Introduction
Hepatitis E virus (Hepevirus, Hepeviridae) has for a long
time been considered a health problem restricted to devel-
oping countries. In this context, hepatitis E is caused by
HEV genotypes 1 and 2, is oro-faecally transmitted via
infected water in areas with poor sanitation, and results
in epidemics involving thousands of cases. An increasing
number of reports published recently have specified a dif-
ferent transmission route in industrialized countries. In
this setting, autochthonous (locally acquired) cases are
caused by HEV genotype 3 (and genotype 4 in Japan and
China), and the closeness of sequenced porcine HEV and
autochthonous HEV in human cases supports the concept
Correspondence: Juraj Petrik, Scottish National Blood Transfusion
Service, 21 Ellens Glen Road, Edinburgh EH17 7QT, UK
E-mail: juraj.petrik@nhs.net
the consumption of undercooked pork, and game (wild
boar, deer) products are well documented [36]. However,
swine manure may be a source of contamination of irri-
gation and drinking water, as well as of nearby rivers or
shellfish farms. Consumption of contaminated shellfish
has been implicated in sporadic cases of acute hepatitis
E [7, 8], and HEV RNA has been found in Scottish shell-
fish [9].
A wide variation in seroprevalence figures can be
found in published HEV seroprevalence studies amongst
both blood donors and the general population. Some of
this variation is due to the varying sensitivity of kits used
[3, 10], but many differences in seroprevalence between
countries and regions seem genuine, ranging from 1
8%
in western Japan and 4% in New Zealand to 32% in
China and 52
5% in south-western France [3, 1116]. In
the UK, seroprevalence figures between 10 and 16% have

1
2 A. Cleland et al.
published for England and Northern Wales [1719]. The
majority of the estimated 60 000 infections a year in
England [19] will involve infections in immunocompetent
individuals, which are frequently asymptomatic or cause
a minor, self-limiting illness. However, chronic infections
with potentially fatal outcome have been described in im-
munocompromized patients such as HIV-infected individ-
uals [20] or transplant recipients [2124] and represent a
growing health concern. In this context, the possibility of
HEV contaminating donated blood and blood components
is becoming an important issue, especially after several
reported transfusion-transmitted HEV cases [2528]. A
small number of studies published to date have shown
that HEV can be detected in donated blood much more
frequently than anticipated, varying between approxi-
mately 1 in 4500 in Germany to approximately 1 in
78000 in the UK, Sweden and Japan [2932].
Little is known about HEV in Scotland. The objective
of this study was to establish the anti-HEV IgG seropreva-
lence and frequency of HEV RNA in Scottish blood
donors.
Materials and methods
Samples used to estimate HEV seroprevalence
Samples were obtained from the Research Anonymous
Archive, which consists of aliqouts of serum and periph-
eral blood mononuclear cells (PBMC) from consented
Scottish blood donors. The Research Anonymous Archive
is used for epidemiological studies on emerging and new
infections potentially threatening the blood supply. The
only retained information is age, sex, first (versus repeat)
donor and the first three letters of the postcode. In total,
1559 individual donor samples were tested for anti-HEV
IgM and IgG: 283, 281, 283, 383 and 329, collected in
years 20042008, respectively.
The preparation of Research Anonymous Archive sam-
ples involves processing and separation into aliquots of
serum and PBMCs, and subsequent storage. To rule out
any possible effect of processing and/or long-term storage
on seroprevalence figures, sera from a further 528 donors
from 2012 (which had previously been used in routine
testing for mandatory markers) were studied.
Samples tested for HEV by PCR
Anonymized, previously tested plasma mini-pools were
studied. Two plasma mini-pools, consisting of 500 ll
aliqouts of 12 donations (used previously for routine
nucleic acid testing of HCV, HIV and HBV), were com-
bined to construct 1 ml 24-member mini-pools (41
6 ll
from each donation). In total, 1815 mini-pools, corre-
sponding to 43 560 individual donations, were tested for
HEV by PCR.
Serology
Anti-HEV IgM and IgG antibodies were studied using the
Wantai Hepatitis E Virus Diagnostic ELISA Kits (Beijing
Wantai Biological Pharmacy Enterprise Ltd) according to
the manufacturers instructions. Both the IgM and IgG
assays use recombinant antigens corresponding to the
structural regions of HEV ORF2.
HEV RNA: screening
To each of the mini-pools, 15 ll of bovine viral diarrhoea
virus (BVDV) was added as an internal control. It consists
of the reconstituted lyophilized cell-free BVDV culture
supernatant, prepared at Moredun Research Institute,
Edinburgh, as described previously [33]. Nucleic acid
extraction was carried out on a MagNA Pure LC extractor
using the LC total nucleic acid isolation kitLarge Vol-
ume (Roche Diagnostics, Mannheim, Germany) according
to the manufacturers instructions, and eluted in 50 ll.
10 ll of nucleic acid was used to perform cDNA synthesis
using the SuperScript VILO cDNA synthesis kit (Life Tech-
nologies, Carlsbad, CA, USA). 50 pmol of both the HEV
and BVDV antisense primers (HE364, Z5392) (Table 1)
were added to the final cDNA reaction.
A nested PCR was used for the HEV screening assay. In
the first round, 10 ll of cDNA was added to 40 lL of mas-
termix containing 1
25 units of Go Taq polymerase (Pro-
mega, Madison, WI, USA), 0
2 mM of dNTP mix, 1 lM of
each of the HEV primers (HE361, HE364) [34] and 200 nM
of each of the BVDV primers (Z5390, Z5392) [33]. Ampli-
fication was carried out at 94C for 2 min followed by 35
cycles at 94C for 30 s, 55C for 30 s and 72C for 90 s,
with a final cycle of 72C for 6 min. A second, round of
amplification was real-time PCR on a 7500 Fast real-time
PCR machine (Life Technologies). 2 ll of primary product
was amplified in a final volume of 20 ll, containing 10 ll
of 29 Taqman Fast Advanced mastermix (Life Techno-
logies), 900 nM of each HEV primer (HE363, HE366),
450 nM of each BVDV primer (Z5391, Z5395) and 250 nM
of each TaqMan probe (HEV, BVDV). Amplification and
detection was performed over 40 cycles of 95C for 3 s
and 62C for 30 s. Serial dilutions of the WHO interna-
tional standard (WHO IS 6329/10; Paul Ehrlich Institute,
Langen, Germany) were used as positive control, and pre-
viously tested negative plasma as a negative control.
If a pool was shown to be positive in the initial screen-
ing, the remaining material (120 ll) of the original
12-member mini-pool was retested as described above,
and if positive, it was subjected to confirmatory testing
and sequencing.
2013 International Society of Blood Transfusion
Vox Sanguinis (2013)
 HEV in Scottish blood donors 3

Table 1 PCR primers and probes

Primers Name 53 sequence Orientation References

HEV HE361 gcr gtg gtt tct ggg gtg ac Sense [34]
HE364 ctg ggm ytg gtc dcg cca ag Antisense
HE366X ggg ytg att ctc agc cct tcg c Sense Modified from [34]
HE363X gmy tgg tcd cgc caa ghg gar c Antisense
3156 aay tay gct cag tay cgz gtt g Sense [35]
3157 ccc ttr tcy tgc tgz gcr ttc tc Antisense
3158 gty atg cty tgy atz cay ggz t Sense
TAQ R gtc ggc tcg cca ttg gck gag Antisense This study
BVDV Z5390 cga agg ccg aaa aga ggc tag c Sense [33]
Z5392 ggc ccy ggy ttc agg tag at Antisense
Z5391 cat gcc ctt agt agg act agc a Sense
Z5395 ggc gac ccc cgc tca ggt ta Antisense This study

Probes 5 label Sequence 3 modification

HEV 6FAM cctatattcatccaaccaacc MGBNFQ This study

BVDV VIC aacagtggtgagttcgttggatggctt MGBNFQ This study

the governance of blood and tissue samples for nonthera-

HEV RNA: confirmatory testing, assay sensitivity
and sequencing
cDNA synthesis was performed using 10 ll of total
nucleic acid used for the screening assay as described
above, except 50pmol of primer 3157 (Table 1) was added
to each reaction. Primary and secondary PCR amplifica-
tion was performed using the conditions described above
for the initial primary PCR. Primers 3156 and 3157 [35]
were used for the primary reaction and 3158 [35], TAQR
for the secondary reaction, no BVDV primers were added.
Amplified DNA was visualized by agarose-gel electropho-
resis and gel red staining.
Ten fold serial dilutions of the WHO standard (see
above) were used to evaluate the sensitivity of screening
and confirmatory PCR assays. The sensitivity of both
assays was comparable, with detectable products in
1:10 000 dilution of the WHO standard. Probit analysis
for the screening assay revealed 95% detection limit of
201 IU/ML.
Aliqouts of the amplification reactions providing the
correct size band were sequenced by Eurofins MWG
Operon (Ebersberg, Germany). Sequence alignment was
carried out using Geneious Pro 5.6.2 software. GenBank
accession numbers: KC477203-5.
Ethics
Ethical approval for the Anonymous archive of Scottish
donations was granted by the West of Scotland Research
Ethics Service (10/S0704-0), and its particular use in this
project and the use of anonymized mini-pools for HEV
PCR testing were approved by the SNBTS committee for
peutic use, and donor research (Ref. No10-23).
Statistics
Statistical testing was performed with SPSS for Windows,
version 14 using the chi-squared test and chi-squared test
for trend or Fishers exact test, as indicated to compare
proportions of seropositive samples in different groups
[36]. Confidence intervals were calculated using Confi-
dence Interval Analysis [37].
Results
A total of 73 of 1559 donations (4
7%, 95% CI 3
65
8)
from the Research Anonymous Archive tested positive for
anti-HEV IgG, none for anti-HEV IgM. Of the 528 sera
from 2012, none was anti-HEV IgM positive, and 30
(5
7%, 95% CI 4
08
0) were anti-HEV IgG positive
(Table 2). There was no difference in seroprevalence
between these groups of samples (chi-square P = 0
36).
The annual seroprevalence in the Research Anonymous
Archive samples ranged from 3
9% to 5
7%; this variation
was not significant (chi-square P = 0
88, Table 3). Anti-
HEV IgG seroprevalence in these samples was associated
significantly with increasing age, ranging from 1
6%
amongst those aged 1524 years, to 9
8% amongst those
older than 55 (chi-square for trend P = 0
005). Amongst
women, 41 (5
7%) were anti-HEV IgG positive while 32
men (3
8%) were IgG positive. This was a nonsignificantly
(chi-square P = 0
069) higher seroprevalence amongst
women, due to an unexpectedly high proportion of sero-
positives amongst women in one age group. Five of 73

2013 International Society of Blood Transfusion

Vox Sanguinis (2013)
4 A. Cleland et al.

Table 2 HEV seroprevalence in blood donors Table 3 HEV seroprevalence in Scottish blood donors

No of IgG sero- Samples

tested prevalence ELISA kit HEV IgG
Country/region samples (%) used References Samples seropositive IgG seropositive
tested (n) (n ) [% (95% CI)]
Scotland 1559 4
7 Wantai This study
528 5
7 Wantai This study Total 1559 73 4
7 (3
75
8)
England 262 10 Wantai [18] Age (years)*
England & Wales 2731a 13 Wantai [19] 1524 245 4 1
6 (0
64
1)
England & Wales 595 16 Wantai [17] 2534 285 7 2
5 (1
25
0)
France (North) 1998 3
2 Genelabs [38] 3544 405 19 4
7 (3
07
2)
France 512b 16
6 Genelabs [39] 4554 338 15 4
4 (2
77
2)
(south-west) 512b 52
5 Wantai [3] 55 and above 286 28 9
8 (6
913
8)
Japan 12 600 3
4 In house [11] Sex
Eastern 5
6 Female 714 41 5
7 (4
37
7)
Western 1
8 Male 845 32 3
8 (2
75
3)
Japan 22 027a 5
3 In house [32] Year of donation
Northern 6
7 2004 283 11 3
9 (2
26
8)
Southern 3
2 2005 281 12 4
3 (2
57
3)
Switzerland 550 4
9 MP [13] 2006 283 16 5
7 (3
59
0)
diagnostics 2007 383 19 5
0 (3
27
6)
Germany 336 5
9 Mikrogen [14] 2008 329 15 4
6 (2
87
4)
USA 400 18 In house [15] New/repeat donors
New Zealand 265 4 Wantai [12] New 96 5 5
2 (2
211
6)
China 44 816 32 Wantai [16] Repeat 1463 68 4
6 (3
75
9)

a
General population.
b
Identical samples.
anti-HEV IgG-positive samples were first time donors
(5
2%), not differing significantly from a proportion of
positive samples amongst repeat donors (4
2%, Fishers
exact test P = 0
47). HEV seroprevalence in Scottish
blood donors was shown to increase with age, from 1
8%
in amongst 1524 year olds to 9
8% in over 55 years
donors. (Table 3).
Of the 1815 mini-pools tested (corresponding to
43 560 individual donations), 3 contained HEV RNA, as
determined by the testing algorithm described above. This
equates to 1 in 14 520 donations being HEV RNA posi-
tive. The assay sensitivity was determined as 201 IU/ML
at 95% detection limit. All three confirmed HEV positives
were genotype 3 and differed from each other, as well as
from the positive control, by several nucleotide changes
(Fig. 1). The BLAST search revealed that most related
sequenced (9798% homology) originated from Scottish
patients (GenBank accession numbers JX516034-52).
Discussion
This study has found an HEV seroprevalence in Scotland
of 4
7%, which is lower than the seroprevalences reported
elsewhere using the same assay. In blood donors from
south-west England, the seroprevalence was found to be
16% [17] and in England and Wales 13% [19]. These
*P = 0
0005 (chi-squared test for trend).
P = 0
069 (chi-squared test).
P = 0
88 (chi-squared test).
P = 0
47 (Fishers exact test).
findings suggest that the levels of circulating HEV are
lower in Scotland than in the rest of the UK, and show
that HEV seroprevalence can vary considerably within a
country. These data confirm the findings of previous
studies, which show that seroprevalence can vary sub-
stantially within countries. For example, in Japan, differ-
ences in HEV seroprevalence have been described
between eastern and western Japan (5
6 vs. 1
8%) [11], as
well as between northern and southern Japan (6
7 vs.
3
2%) [32]. An almost fivefold difference has been
reported between northern France [38] and south-western
France [3, 39]. The serology samples used in the current
study originated predominantly from the Edinburgh
region in south-east Scotland. The HEV seroprevalence in
other areas of Scotland is unknown; further studies to
investigate this are planned.
The reasons for such variations in seroprevalence both
between and within developed countries remain unclear.
The evidence suggests that in developed countries such as
Scotland HEV is most frequently a locally acquired por-
cine zoonosis [40]. Infection via consumption of infected
food is thought to be an important route of infection.
Eating habits, including consumption of uncooked pork
and game products, could explain at least a proportion of

2013 International Society of Blood Transfusion

Vox Sanguinis (2013)

Fig. 1 Sequence alignment of HEV-positive samples. Partial genome sequences derived from the HEV capsid protein (orf 2). Sequences of 3 confirmed
positive samples from plasma mini-pools of Scottish blood donors. WHO IS: corresponding sequence from the WHO International standard used as a
positive control for screening assay and for determination of assay sensitivity.
infections, as pig herds are known to have generally very
high HEV infection rates. HEV was found in 8 of 18
locally produced sausages in the Toulouse region [3], and
a direct link of HEV infections to eating air-dried liver
sausage in south-eastern France has been documented [4].
In the UK, 10% of pork sausages were contaminated at
the point of sale [41]. Genotype 3 HEV has also been
found in a high proportion of Scottish shellfish, some of
which were harvested from an area adjacent to an out-
flow pipe from a pig processing plant [9].
Some of these differing results can undoubtedly be
attributed to true geographical variations in seropreva-
lence. However, many of the previously published studies
have used anti-HEV IgG assays that have not been vali-
dated to accurately detect distant infection. For example,
one assay in common usage has been shown to under-
estimate the true seroprevalence by a factor of four [10].
In contrast, the assay used in the current study has been
shown to have a sensitivity of 96% against a bank of
convalescent sera from PCR proven cases. When applied
to a population of blood donors in south-west France, the
insensitive assay gave a seroprevalence result of 16%
[39]. In contrast, when the more sensitive Wantai assay
was employed on the same samples, the seroprevalence
result was 52% [3]. This indicates that HEV is hyperen-
demic in south-west France and suggests that much of
the previously published data on HEV seroprevalence
have significantly underestimated the true seroprevalence.
Despite the high levels of circulating HEV in south-west
France, the seroprevalence (determined by the Wantai
assay) in children aged 24 years in the same community
is very low (2%). This may reflect a cumulative effect of
2013 International Society of Blood Transfusion
Vox Sanguinis (2013)
HEV in Scottish blood donors 5
dietary HEV exposures over time. Age-related increase in
seroprevalence was observed also in Scottish donors.
Overall 4
7% seroprevalence is one of lowest results that
has ever been documented in an adult population using
this assay, suggesting low levels of circulating HEV in
Scottish population (see Table 3).
6798% of infections with HEV genotypes 3 and 4 are
thought to be asymptomatic [8, 40]. This makes it possi-
ble for donors who have an asymptomatic HEV infection
to donate blood containing HEV. A five-year screening
programme for HEV RNA in Hokkaido identified 168 pos-
itives amongst 1 375 000 screened donors (1 in 8185)
[31]. Samples collected from the general population in
Japan and tested in mini-pools yielded 3 RNA-positive
antibody-negative samples or 1 positive in 7342 individ-
ual samples [32]. In England, mini-pool testing identified
1 in 7000 HEV RNA-positive donations [30], a similar
frequency was described for pools from Sweden (1 in
7986), and an even higher frequency was observed in
pools from Germany (1 in 4525) [29]. Using a highly
sensitive assay, Vollmer et al. [14] described HEV RNA
presence 1 in 1240 donations. In contrast, 1 in 14 520
donations was positive in this study. The sensitivity of
our assay was lower than that of Vollmer et al. [14], but
slightly higher than that used by Bayliss et al. [29]. We
used relatively strict criteria to consider a sample con-
firmed positive. After being positive in an initial screen-
ing, it had to be positive in a split pool, and then
reamplified using a different set of primers, producing a
larger fragment from a different region. The sensitivity of
assays with the two sets of primers was similar, but there
is a slight possibility that certain templates would
6 A. Cleland et al.

amplify with the first, but not the second set of primers.
Although this was not the case for control samples, we
could not investigate such a possibility for some initially
positive samples due to the small volumes available. It is
interesting to note that both observed seroprevalence and
frequency of HEV in mini-pools is lower in Scottish com-
pared with English donors, although the relationship
between HEV seroprevalence and viraemia in donors
remains to be established.
The consequences of transfusing blood products that
are contaminated with HEV have been poorly docu-
mented, but are potentially of significant concern. There
have been only a small number of documented cases of
symptomatic cases of HEV transfusion-related hepatitis
[2528]. Assuming there is no difference between the nat-
ural history of parenterally and oro-faecally HEV-infected
individuals, immunocompetent recipients of HEV-contam-
inated blood products are likely to have an asymptomatic
infection, or a mild self-limiting bout of hepatitis. The
exception to this is immunocompetent patients who have
underlying chronic liver disease. Transfusing HEV-con-
taminated blood products to such individuals may have
serious consequences including a substantial associated
mortality [23, 40].
Chronic hepatitis E has been documented with HEV
genotype 3 in the immunocompromized. This includes
solid-organ transplant recipients, patients receiving che-
motherapy for haematological malignancy and individu-
als with HIV infection [2024]. Transfusion of blood and
use of blood products are common in the immunosup-
pressed. It is difficult to determine precisely what propor-
tion of blood and blood products is administered to
immunocompromized patients, but it is thought that in
the region of 5070% of platelets are destined for these
patient groups. The consequence of HEV infection can be
severe amongst these patients, and 60% of immunosup-
pressed solid-organ transplant recipients will develop
chronic HEV infection when exposed to HEV genotype 3
[24]. Such patients develop chronic hepatitis often with
rapidly progressive cirrhosis, with 10% becoming cir-
rhotic within 2 years [42]. It is unknown how many im-
munosuppressed individuals have received HEV-
contaminated blood products, what the clinical conse-
quences are and if the course of the disease differs for
parenteral and oro-faecal route of infection. This area
deserves further urgent study, but there are many other
research questions in this field that also deserve timely
consideration, such as the reasons behind significant
prevalence variation and a relation between seropreva-
lence and a chance of blood donation being HEV RNA
positive.
In summary, we found an anti-HEV seroprevalence in
Scottish blood donors of 4
7%. This figure was low com-
pared with other countries and other areas of the UK,
suggesting that the amount of circulating HEV in Scot-
land may also be lower than in other communities in the
developed world. Despite this, 1 in 14 520 blood dona-
tions was found to contain HEV. The clinical conse-
quences of the use of HEV-contaminated blood products
require further urgent study, and measures to prevent
HEV transmission to immunosuppressed recipients should
be considered.
Acknowledgements
This work was supported by a grant (ref ETM/32) from
the Chief Scientist Office Scotland (to LS, HD, OB, JP).
The authors wish to thank Lisa Jarvis for managing the
Anonymous archive of Scottish blood donors, Tony Jor-
dan and Tom Dunsford for help with anonymized routine
individual serum samples and plasma mini-pools.
Source of Funding
This work was supported by a grant (ref ETM/32) from
the Chief Scientist Office Scotland (to LS, HD, OB, JP).

hepatitis E virus transmission to 8 Said B, Ijaz S, Kafatos G, et al.: Hepa-

References
1 Balayan MS: Epidemiology of hepatitis
E virus infection. J Viral Hepat 1997;
4:155165
2 Meng XJ, Purcell RH, Halbur PG, et al.:
A novel virus in swine is closely related
to the human hepatitis E virus. Proc Natl
Acad Sci USA 1997; 94:98609865
3 Mansuy JM, Bendall R, Legrand-Abra-
vanel F, et al.: Hepatitis E virus anti-
bodies in blood donors, France. Emerg
Infect Dis 2011; 17:23092312
4 Colson P, Borentain P, Queyriaux B,
et al.: Pig liver sausage as a source of
humans. J Infect Dis 2010; 202:825
834
5 Li TC, Chijiwa K, Sera N, et al.: Hepa-
titis E virus transmission from wild
boar meat. Emerg Infect Dis 2005;
11:19581960
6 Tei S, Kitajima N, Takahashi K, et al.:
Zoonotic transmission of hepatitis E
virus from deer to human beings. Lan-
cet 2003; 362:371373
7 Cacopardo B, Russo R, Preiser W, et al.:
Acute hepatitis E in Catania (eastern
Sicily) 19801994. The role of hepatitis
E virus. Infection 1997; 25:313316
titis E outbreak on cruise ship. Emerg
Infect Dis 2009; 15:17381744
9 Crossan C, Baker PJ, Craft J, et al.:
Hepatitis E virus genotype 3 in shell-
fish, United Kingdom. Emerg Infect Dis
2012; 18:20852087
10 Bendall R, Ellis V, Ijaz S, et al.: A
comparison of two commercially
available anti-HEV IgG kits and re-
evaluation of anti-HEV IgG seropreva-
lence data in developed countries. J
Med Virol 2010; 82:799805
11 Takeda H, Matsubayashi K, Sakata
H, et al.: A nationwide survey for

2013 International Society of Blood Transfusion

Vox Sanguinis (2013)

prevalence of hepatitis E virus anti-
body in qualified blood donors in
Japan. Vox Sang 2010; 99:307313
12 Dalton HR, Fellows HJ, Gane EJ, et al.:
Hepatitis E in New Zealand. J Gastro-
enterol Hepatol 2007; 22:12361240
13 Kaufmann A, Kenfak-Foguena A,
Andre C, et al.: Hepatitis E virus sero-
prevalence among blood donors in
southwest Switzerland. PLoS ONE
2011; 6:e21150
14 Vollmer T, Diekmann J, Johne R,
et al.: Novel approach for detection of
hepatitis E virus infection in German
blood donors. J Clin Microbiol 2012;
50:27082713
15 Meng XJ, Wiseman B, Elvinger F,
et al.: Prevalence of antibodies to hep-
atitis E virus in veterinarians working
with swine and in normal blood
donors in the United States and other
countries. J Clin Microbiol 2002;
40:117122
16 Guo Q-S, Yan Q, Ge S-X, et al.: Preva-
lence of hepatitis E virus in Chinese
blood donors. J Clin Microbiol 2010;
48:317318
17 Dalton HR, Stableforth W, Thurairajah
P, et al.: Autochthonous hepatitis E in
Southwest England: natural history,
complications and seasonal variation,
and hepatitis E virus IgG seropreva-
lence in blood donors, the elderly and
patients with chronic liver disease. Eur
J Gastroenterol Hepatol 2008; 20:
784790
18 Beale MA, Tettmar K, Szypulska R,
et al.: Is there evidence of recent hep-
atitis E virus infection in English and
North Welsh blood donors? Vox Sang
2011; 100:340342
19 Ijaz S, Vyse AJ, Morgan D, et al.:
Indigenous hepatitis E virus infection
in England: more common than it
seems. J Clin Virol 2009; 44:272276
20 Dalton HR, Bendall RP, Keane FE,
et al.: Persistent carriage of hepatitis E
virus in patients with HIV infection. N
Engl J Med 2009; 361:10251027
21 Gerolami R, Moal V, Colson P: Chronic
hepatitis E with cirrhosis in a kidney-
2013 International Society of Blood Transfusion
Vox Sanguinis (2013)
transplant recipient. N Engl J Med
2008; 358:859860
22 Peron JM, Mansuy JM, Recher C, et al.:
Prolonged hepatitis E in an immuno-
compromised patient. J Gastroenterol
Hepatol 2006; 21:12231224
23 Kamar N, Selves J, Mansuy JM, et al.:
Hepatitis E virus and chronic hepatitis
in organ-transplant recipients. N Engl
J Med 2008; 358:811817
24 Kamar N, Garrouste C, Haagsma EB,
et al.: Factors associated with chronic
hepatitis in patients with hepatitis E
virus infection who have received
solid organ transplants. Gastroenterol-
ogy 2011; 140:14811489
25 Mitsui T, Tsukamoto Y, Yamazaki C,
et al.: Prevalence of hepatitis E virus
infection among hemodialysis patients
in Japan: evidence for infection with a
genotype 3 HEV by blood transfusion.
J Med Virol 2004; 74:563572
26 Boxall E, Herborn A, Kochethu G,
et al.: Transfusion-transmitted hepati-
tis E in a nonhyperendemic country.
Transfus Med 2006; 16:7983
27 Matsubayashi K, Kang JH, Sakata H,
et al.: A case of transfusion-transmit-
ted hepatitis E caused by blood from a
donor infected with hepatitis E virus
via zoonotic food-borne route. Trans-
fusion 2008; 48:13681375
28 Haim-Boukobza S, Ferey MP, Vetillard
AL, et al.: Transfusion-transmitted
hepatitis E in a misleading context of
autoimmunity and drug-induced toxic-
ity. J Hepatol 2012; 57:13741378
29 Baylis SA, Koc O, Nick S, et al.: Wide-
spread distribution of hepatitis E virus
in plasma fractionation pools. Vox
Sang 2012; 102:182183
30 Ijaz S, Szypulska R, Tettmar KI,
et al.: Detection of hepatitis E virus
RNA in plasma mini-pools from
blood donors in England. Vox Sang
2012; 102:272
31 Kato T, Matsubayashi K, Sakata H,
et al.: Five-year experience of NAT
screening for HEV in blood donors in
Hokkaido, Japan. Vox Sang 2010; 99
(Suppl. 1):72
HEV in Scottish blood donors 7
32 Takahashi M, Tamura K, Hoshino Y,
et al.: A nationwide survey of hepatitis
E virus infection in the general popu-
lation of Japan. J Med Virol 2010;
82:271281
33 Cleland A, Nettleton P, Jarvis L, et al.:
Use of bovine viral diarrhoea virus as
an internal control for amplification of
hepatitis C virus. Vox Sang 1999;
76:170174
34 Inoue J, Takahashi M, Yazaki Y, et al.:
Development and validation of an
improved RT-PCR assay with nested
universal primers for detection of hep-
atitis E virus strains with significant
sequence divergence. J Virol Methods
2006; 137:325333
35 Gyarmati P, Mohammed N, Norder H,
et al.: Universal detection of hepatitis E
virus by two real-time PCR assays: Taq-
Man and Primer-Probe Energy Transfer.
J. Vir Meth 2007; 146:226235
36 SPSS Inc. SPSS for Windows, Version
14.0. Chicago, SPSS Inc. Released
2005
37 Altman DG, Machin D, Bryant TN,
et al.: Statistics with Confidence, 2nd
edn. London, BMJ Books, 2000
38 Boutrouille A, Bakkali-Kassimi L, Cru-
ciere C, et al.: Prevalence of anti-hep-
atitis E virus antibodies in French
blood donors. J Clin Microbiol 2007;
45:20092010
39 Mansuy JM, Legrand-Abravanel F, Ca-
lot JP, et al.: High prevalence of anti-
hepatitis E virus antibodies in blood
donors from South West France. J Med
Virol 2008; 80:289293
40 Kamar N, Bendall R, Legrand-Abrava-
nel F, et al.: Hepatitis E. Lancet 2012;
379:24772488
41 Berto A, Martelli F, Grierson S, et al.:
Hepatitis E virus in pork food chain,
United Kingdom, 20092010. Emerg
Infect Dis 2012; 18:13581360
42 Kamar N, Abravanel F, Selves J, et al.:
Influence of immunosuppressive ther-
apy on the natural history of genotype
3 hepatitis-E virus infection after
organ transplantation. Transplantation
2010; 89:353360