Effect of Mode of Ripening on Ethylene Biosynthesis during Ripening of

Diploid Banana (Musa spp.) Fruit

O. Hubert1, M. Chillet2, P. Juliannus3, B. Fils-Lycaon3 and D. Mbgui-A-Mbgui4
1
Centre pour la Recherche Agronomique pour le Dveloppement, UMR 95, Qualisud,
Neufchteau, Capesterre-Belle-Eau, Guadeloupe, French West Indies, F-97130, France
2
Centre pour la Recherche Agronomique pour le Dveloppement, UMR 95, Qualisud,
Universidade de So Paulo, So Paulo, B-05508-900, Brasil
3
Institut Scientifique de Recherche Agronomique, UMR 1270, Qualitrop, Prise dEau,
Petit-Bourg, Guadeloupe, French West Indies, F-97170, France
4
Centre pour la Recherche Agronomique pour le Dveloppement, UMR 94, Qualitrop,
Neufchteau, Capesterre-Belle-Eau, Guadeloupe, French West Indies, F-97130, France

Keywords: ACC oxidase, ACC synthase, gene cloning, gene expression, quality

Abstract
Ripening is the main physiological process affecting banana (Musa spp.) fruit
quality traits. The progress of banana ripening process differs for fruit ripened on
the plant versus green harvested bunches and depends on the treatment of the fruit
after harvest. We investigated the effect of the mode of ripening on ethylene
biosynthesis of IDN 110 (Musa acuminata, AA genome) banana fruit ripened (a) in
planta (On-Plant); (b) ex planta in air (Air-Fruit); or (c) after acetylene treatment
(Ace-Fruit). The levels of ethylene production of the whole fruit and, those of 1-
aminocyclopropane-1-carboxylic acid (ACC) in pulp, and ACC oxidase (MA-ACO1
and MA-ACO2) and ACC synthase (MA-ACS1) mRNA in both peel and pulp tissues
were examined. From harvesting at mature-green stage, the ripening speed of fruit
was not correlated with ethylene production. Ace-Fruit took 10 days to reach
overripe stage with a maximum of 22.6 l kg-1 h-1 of ethylene production, whereas
Air-Fruit and On-Plant fruit took 27 and 33 days to reach overripe stage,
respectively, and produced 11.5 and 29.6 l kg-1 h-1 of ethylene, respectively. During
ripening, ACC accumulated differentially; except for On-Plant fruit, ACC level
increased during ripening and concomitantly with ethylene production and MA-
ACS1 mRNA level. Whatever the mode of ripening, the level of MA-ACO1 mRNA
was 100-fold higher than that of MA-ACO2. The mRNA level of MA-ACO1 and MA-
ACO2 were accumulated sequentially during fruit development and ripening. MA-
ACO1 gene was transiently induced between mature green and ripe stages while that
of MA-ACO2 increased mainly at the overripe stage. The pattern of MA-ACO2 gene
expression was correlated with that of ethylene production whatever the mode of
ripening while this correlation was observed with MA-ACO1 only On-Plant fruit.
These results suggest that: (a) the level of ripening-ethylene production of the whole
fruit is not the sole factor controlling the speed of fruit ripening in planta; (b) this
level is regulated at the downstream step of ACC biosynthesis mediated by the MA-
ACS1 gene; and (c) the product of MA-ACO2 might be involved in this regulation in
pulp tissue. These findings are also discussed in regard with improvement of banana
quality traits project throughout breeding programs.

INTRODUCTION
Ethylene regulates physiological processes in plants. Its concentration in plants is
normally low, but greatly increased during particular physiological processes such as seed
germination, leaf and flower abscission, fruit ripening, or in response to a wide range of
biotic and abiotic stimuli (Lin et al., 2009). The essential function of ethylene in fruit
ripening has been well documented (Lin et al., 2009) and its biosynthetic pathway in
higher plants is well established (Yang and Hoffman, 1984) as follows: methionine S-
adenosyl methionine (SAM) 1-aminocyclopropane-1-carboxylic acid (ACC)
ethylene.

Proc. IC on Banana & Plantain in Africa 385

Eds.: T. Dubois et al.
Acta Hort. 879, ISHS 2010
 The last two steps are catalyzed by ACC synthase and ACC oxidase, respectively,
and constitute in most cases the key steps of regulation along this pathway (Yang and
Hoffman, 1984; Kende, 1993; Lin et al., 2009). Banana (Musa spp.) fruit undergoes a
climacteric ripening process, characterized by a burst of an autocatalytic ethylene
production concomitant with a peak of respiration, biochemical and physicochemical
changes leading to changes of fruit colour, fruit sweetness, aroma, texture, etc. One of the
main features of banana fruit ripening is a sharp rise and fall in the rate of ethylene
production during the early climacteric increase of respiration, which is different from
most of the other climacteric fruits (Seymour, 1993; Liu et al., 1999). Understanding the
ethylene biosynthesis pathway at biochemical and molecular level will give insights in the
regulation of this pathway during banana fruit ripening and thus contribute to explain the
particular pattern of ethylene production (Dominguez and Vendrell, 1993; Liu et al.,
1999). The Ethylene production in banana fruit is regulated by transcription of ACC
synthase gene 1 until a climacteric rise and by a reduction of ACC oxidase activity
possibly through limited in situ availability of its cofactors once ripening has commenced.
All the above-mentioned studies were done on ex planta ripened Cavendish
(AAA genome) fruit, a dessert banana, and thus could not explain: (a) how the ripening
process occurs in other Musa types; and (b) the impact of harvesting and the occurrence
of ripening process on molecular mechanism of ethylene biosynthesis. Nevertheless, the
availability of an extended and well characterized genetic basis of Musa is important for
the improvement of banana fruit quality traits through conventional breeding and maker-
assisted selection. Indeed, this could allow to increase the number, and thus the
optimization, of useful parents in breeding programs. Additionally and concerning the
regulation of physiological metabolism that governs the elaboration of fruit quality traits,
getting more insights on the discrepancy between Musa types could improve the
identification of related markers.
In this paper, we investigated at physicochemical and molecular levels the
ethylene biosynthesis pathway of IDN 110 (AA genome), a dessert variety of banana.
IDN 110 is used as parent in the CIRAD breeding program. Little is known about its
ripening process in general and ethylene biosynthesis pathway in particular. Our data will
show that, in this cultivar, the level of ethylene is not the sole factor that controls the
speed of fruit ripening in planta and that the particular pattern of ethylene production, and
probably the regulation of its biosynthesis, observed in Cavendish fruit cannot be
generalized to other Musa types.

MATERIALS AND METHODS

Plant Material Samplings and Storage

Banana fruit were harvested from at least three banana plants of IDN 110 grown
at the research station of the Centre de Cooperation International en Recherche
Agronomique pour le Dveloppement (CIRAD) in Neufchteau, Guadeloupe, French
West Indies (250 masl; Andosol; rainfall is 3500 mm y-1). At each harvesting time, only
internal fingers of median hand, excluding extreme fingers, considered as comparable
(Liu, 1976), were taken into account for each bunch. For the ripening process in planta
(On-Plant), approximately 30 fruits were harvested at two green development stages
based on the heat unit concept (Ganry and Meyer, 1975): (a) at immature stage (36 days
after flowering (DAF)); and (b) at mature green stage (8488 DAF). For the late ripening
stage, fruits were harvested based on their colour evolution at (a) breaker (110 DAF); (b)
breaker+ (114 DAF); (c) ripe (119 DAF); and (d) overripe (121 DAF). For each harvest
stage, fruits were kept for 24 hours in chambers ventilated with humidified air and
samples of at least three fruits were made randomly for physicochemical analyses. Peel
and pulp tissues of an additional sample were separately frozen in liquid nitrogen to be
stored at minus 80C until use for gene expression analysis.
For the ripening process ex planta, banana fruits were harvested at mature green
stage and kept for 24 hours in chambers before being separated into two different lots.

386
One lot was kept in air (Air-Fruit) while the other one was acetylene-treated with 10000
ppm for 24 h at 20C (Ace-Fruit). Based on their colour evolution, a sample of at least
three Air-Fruit fruits was picked at breaker, Breaker+, ripe and overripe stages. These
stages correspond to 9, 12, 17 and 27 days after harvest for Air-Fruit and to one, two,
three and ten days after harvest for Ace-Fruit. For each harvest stage, Air-Fruit and Ace-
Fruit were subjected to physicochemical analyses and stored as described above.

Physicochemical Measurements
Physico-chemical parameters, including ethylene production of the whole fruit,
colour, firmness and ACC content of the pulp were measured individually on all fruits.
Ethylene production was measured at a constant room temperature of 20C by gas
chromatography (Hewlet Packard 5890A, GmbH, Waldbronn, Germany) as described by
Chambroy et al. (1995). Pulp firmness was measured using a TA-XT2 penetrometer as
described by Bugaud et al. (2006) and was expressed in Newton (N). Fruit colour was
estimated through the CIE L*a*b* system, using a Minolta chromameter CR-200
(Minolta, Roissy, France) and expressed by the a value. ACC was measured as
described by Chillet et al. (2004).

Designing of Oligonucleotide Primers for Real-Time Quantitative Polymerase Chain

Reaction (qPCR) Analysis
The oligonucleotide primers used for real-time qPCR analysis were designed
within the 3-UTR of banana ACC oxidase genes (MA-ACO1 and MA-ACO2), while
those of banana ACC synthase 1 gene (MA-ACS1) and actin gene (MA-ACT) were
designed within the coding region (Table 1). All primers were designed using the Primer
3 freeware program (Roten and Skaletsky, 2000) according to the default criteria. The test
gene-specificity of all primer sets and the measurement of primer efficiency were
performed as described by Mbgui-A-Mbgui et al. (2008).

Total RNA Extraction and Expression of Ethylene Biosynthesis Genes by qPCR

Analysis
Total RNA was isolated separately from peel and pulp of banana according to a
modified hot borate method (Wan and Wilkins, 1994; Mbgui-A-Mbgui et al. 2007).
First-strand cDNA was synthesized from 2 g of DNase-treated RNA using AMV reverse
transcriptase enzyme (Promega, Charbonnires, France) and random hexamer according
to the manufacturers instructions. To limit the putative PCR inhibitors that might be
present in the reverse transcriptase reaction and the pipeting errors, the cDNA was 10-fold
diluted with distilled water, and 5 l of the diluted cDNA taken with an automatic pipette
was used as a template for qPCR reactions on an ABI 7000 sequence detection system
apparatus (Applied Biosystems, Courtaboeuf, France). All qPCR reactions and the PCR
program were performed as described by Mbgui-A-Mbgui et al. (2008). The relative
differences of expression of each ethylene biosynthesis gene between samples were
determined using the 2-CT formula (Livak and Schmittgen, 2001) with MA-ACT gene as
reference and immature-green fruit as calibrator.

RESULTS AND DISCUSSION

Physiological Characterization of Banana Fruit during Green Development Phase

and Postharvest Ripening
Physicochemical characterization of IDN 110 showed that, whatever the mode of
ripening, the level of ethylene increased continuously from the immature-green to
overripe stage. Concomitantly, there were changes in colour and firmness (Fig. 1). The
rate of ethylene production did not decrease during ripening of this variety, unlike
observed in Cavendish banana (Liu et al., 1997). The level of ACC was affected by the
mode of ripening. For On-Plant fruit, the ACC level was low compared to that of ethylene
contrarily to that observed in Air-Fruit or Ace-Fruit. Additionally, and in contrast to that

387
observed in Air-Fruit and Ace-Fruit, the pattern of ACC accumulation was negatively
correlated to that of ethylene production from the breaker+ to overripe fruit. The absence
of a correlation between ACC and ethylene level indicates that the steps downstream of
ACC synthesis (e.g., availability of ACC for ACC oxidase activity and/or the regulation
of ACC oxidase activity) affect the regulation of ethylene biosynthesis as also observed in
Cavendish fruit. Finally, in this diploid variety the ripening speed of fruit was not
correlated with the level of ethylene production from mature green stage to overripe stage.
Ace-Fruit took 10 days to reach overripe stage with a maximum of 22.6 l kg-1 h-1 of
ethylene production, whereas Air-Fruit and On-Plant fruit took 27 and 33 days to reach
the overripe stage and produced 11.5 and 29.6 l kg-1 h-1 of ethylene, respectively.
Therefore, we suggest that additional mechanisms, e.g., the responsiveness of the fruit to
the level of ethylene and/or the interaction between ethylene and other antagonistic
factors, might be involved in the regulation of the ripening process of IDN 110.

Expression of the Banana Ethylene Biosynthesis Genes during Ripening of Banana

Fruit and in Other Tissues
Expressions of ethylene biosynthesis genes in banana tissues and during fruit
ripening were examined by real-time quantitative PCR method (Fig. 2). MA-ACS1, MA-
ACO1 and MA-ACO2 gene expression are not fruit specific (data not shown). In peel or
pulp tissues, whatever the ripening process, MA-ACS1 (a ripening- and ethylene-induced
gene) displayed a similar pattern of mRNA accumulation. In peel tissue, the MA-ACS1
mRNA level increased from the immature-green to breaker+ stage where it peaked before
to decrease during the late ripening stage. In pulp tissue of On-Plant and Ace-Fruit, MA-
ACS1 displayed a pattern of accumulation. Its level increased continuously from
immature-green stage to Breaker+ where it peaked, before slightly decreasing at ripe
stage, but increasing drastically again at overripe stage. In the same time for Air-Fruit, the
MA-ACS1 mRNA level increased continuously from immature-green stage to overripe
stage where it peaked. In this tissue, and in contrary to fruit ripening ex planta, there was
no correlation between the pattern of MA-ACS1 mRNA expression and ACC
accumulation during ripening of fruit ripened in planta. These results suggest that an
additional step occurs in the regulation of ACC synthesis at MA-ACS1 posttranscriptional
level in fruit ripened in planta but not ex planta. This regulation might occur throughout
the homeotic protein (MADS-RIN) or ETO1 protein identified as regulator of ACC
synthase activity at both transcriptional and posttranscriptional level (Wang et al., 2004;
Yoshida et al., 2005; Ito et al., 2008; Christians et al., 2009). To our knowledge, no
banana ETO1 gene has been reported in the literature. Recently, different MADS-like
genes have been isolated and characterized in banana fruit. One of them, MaMADS2
exhibited opposite directions of ethylene feedback regulation in the peel and pulp tissues
suggesting that MADS-box genes have important roles as transcription factors in
regulating climacteric fruit ripening (Inaba et al., 2007).
ACC oxidase mRNA accumulated differentially and sequentially in peel and pulp
tissues, whatever the mode of ripening. MA-ACO1 was more than 100-fold expressed
compared to MA-ACO2. In peel tissue, MA-ACO2 mRNA accumulation preceded that of
MA-ACO1 but both mRNA levels were transiently induced during ripening and decreased
at overripe stage. In pulp tissue, MA-ACO1 mRNA accumulated progressively until the
breaker+ stage and decreased throughout the late ripening stages in Air-Fruit and Ace-
Fruit but transiently in On-Plant fruit. Considering the most expressed MA-ACO1 gene,
its mRNA accumulated in both peel and pulp tissues. Its pattern of expression in pulp
tissue was positively correlated with that of ethylene production only for fruit ripening
On-Plant.
Taking together the expression of ethylene biosynthesis genes in peel and pulp
tissues, one should note that MA-ACS1, MA-ACO1 and MA-ACO2 genes displayed a
sequential pattern of expression during fruit development and ripening. Indeed, MA-
ACS1, MA-ACO1 and MA-ACO2 mRNA started to increase firstly in peel tissue followed
by pulp tissue. This data suggest that, as reported for Cavendish (Dominguez and

388
Vendrell, 1993; Inaba et al., 2007), both peel and pulp tissues contribute to ethylene
production of the whole fruit in IDN 110.

CONCLUSIONS
In this paper, we demonstrated that initiation conditions of harvesting and ripening
affect the ripening speed of IDN 110 fruit, concomitantly with ethylene production of
the whole fruit, firmness, ACC content of the pulp and fruit colour. Our data also point
out the importance of the ethylene fruit responsiveness process and/or the interaction
between ethylene and other antagonistic cues in the regulation of the duration of the
ripening process of IDN 110. Considering the impact of this duration on the commercial
life of banana, getting more insight into the banana responsiveness process appears as a
major question that needs to be addressed in the future.
In the prospect of breeding programs, the characterization of this diploid parent, as
well as others, is currently undertaken for other quality criteria, e.g., organoleptic (sugar,
organic acid, flavour, aroma etc.) or nutritional. Considering ethylene production criteria,
MA-ACS1, MA-ACO1 and MA-ACO2 genes appear as good candidates as their expression
in pulp appeared closely correlated with ethylene production of the whole fruit. These
genes will be further used for identification of molecular markers that will be usable in
marker-assisted selection. To this end, the relationship between gene structure, gene
expression and ethylene production will be undertaken using the CIRAD Musa collection.

ACKNOWLEDGEMENTS
The authors thank the Centre pour la Recherche Agronomique pour le
Dveloppement (CIRAD) in Petit-Bourg, Guadeloupe for providing them with the
quantitative real-time PCR apparatus. This research was supported by a special 1999 joint
funding grant from CIRAD and the Institut Scientifique de Recherche Agronomique
(INRA), and the Document Unique de Programmation (DOCUP) 2000-2006 fund.

Literature Cited
Bugaud, C., Chillet, M., Beaut, M.P. and Dubois, C. 2006. Physicochemical analysis of
mountain bananas from the French West Indies. Sci. Hortic. 108:167172.
Chambroy, Y., Souty, M., Audergon, J.M., Jacquemin, G. and Gomez, R.M. 1995.
Researches on the suitability of modified atmosphere packaging for shelf-life and
quality improvement of apricot fruit. Acta Hort. 384:633638.
Chillet, M., Galas, C., Gomez, R.M., Hubert, O., Juliannus, P., Mbgui-A-Mbgui, D.
and Fils-Lycaon, B. 2005. Is there a relationship between ethylene production of
bananas ripened on the plant and the length of the fruit growth period prior to ripening
onset? Fruit 60:8389.
Christians, M.J., Gingerich, D.J., Hansen, M., Binder, B.M., Kieber, J.J. and Vierstra,
R.D. 2009. The BTB ubiquitin ligases ETO1, EOL1 and EOL2 act collectively to
regulate ethylene biosynthesis in Arabidopsis by controlling type-2 ACC synthase
levels. Plant J. 57:332345.
Dominguez, M. and Vendrell, M. 1993. Ethylene biosynthesis in banana fruit: evolution
of EFE activity and ACC levels in peel and pulp during ripening. J. Hort. Sci. 68:63
70.
Ganry, J. and Meyer, J.P. 1975. Recherche dune loi daction de la temprature sur la
croissance des fruits du bananier. Fruits 30:375392.
Inaba, A., Liu, X., Yokotani, N., Yamane, M., Lu, W.J., Nakano, R. and Kubo, Y. 2007.
Differential feedback regulation of ethylene biosynthesis in pulp and peel tissues of
banana fruit. J. Exp. Bot. 58:10471057.
Ito, Y., Kitagawa, M., Ihashi, H., Yabe, K., Kimbara, J., Yasuda, J., Ito, H., Inakuma, T.,
Hiroi, S. and Kasumi, T. 2008. DNA-binding specificity, transcriptional activation
potential, and the rin mutation effect for the tomato fruit-ripening regulator RIN. Plant
J. 55:212223.
Lin, Z., Zhong S. and Grierson, D. 2009. Recent advances in ethylene research. J. Exp.

389
 Bot. 60:33113336.
Liu, F. 1976. Correlation between banana storage life and minimum treatment time
required for ethylene response. J. Amer. Soc. Hort. Sci. 101:6365.
Liu, X., Shiomi, S., Nakatsuka, A., Kubo, Y., Nakamura, R. and Inaba, A. 1999.
Characterization of ethylene biosynthesis associated with ripening in banana fruit.
Plant Physiol. 121:12571265.
Liu, J., Xu, B., Hu, L., Li, M., Su, W., Yang, J. and Jin, Z. 2009. Involvement of a banana
MADS-Box transcritpion factor gene in ethylene-induced fruit ripneing. Plant Cell
Rep. 28:103111.
Livak, K.J. and Schmittgen, T.D. 2001. Analysis of relative gene expression data using
real-time Quantitative PCR and the 2-CT Method. Methods 25:402408.
Mbgui-A-Mbgui, D., Hubert, O., Sabau, X., Chillet, M., Fils-Lycaon, B. and
Baurens, F.C. 2007. Use of suppression subtractive hybridization approach to identify
genes differentially expressed during early banana fruit development undergoing
changes in ethylene responsiveness. Plant Sci. 172:10251036.
Mbgui-A-Mbgui, D., Hubert, O., Fils-Lycaon, B., Chillet, M. and Baurens, F.C.
2008. EIN3-like gene expression during fruit ripening of Cavendish banana (Musa
acuminata cv. Grande naine). Physiol. Plant 133:435448.
Roten, S. and Skaletsky, H.J. 2000. Primers on the WWW for general users and for
biologist programmers. p.365386. In: S. Krawetz and S. Misener (eds.),
Bioinformatics Methods and Protocols: Methods in Molecular Biology. Humana
Press, Totowa.
Seymour, G.B. 1993. Banana. p.83106. In: G.B. Seymour, T.E. Taylor and G.A. Tucker
(eds.), Biochemistry of Fruit Ripening. Chapman and Hall, London.
Wan, C.Y. and Wilkins, T.A. 1994. A modified hot borate method significantly enhances
the yield of high-quality RNA from cotton. Anal. Bioch. 223:713.
Wang, K.L., Yoshida, H., Lurin, C. and Ecker, J.R. 2004. Regulation of ethylene gas
biosynthesis by the Arabidopsis ETO1 protein. Nature 428:945950.
Yang, S.F. and Hoffman, N.E. 1984. Ethylene biosynthesis and its regulation in higher
plants. Annu. Rev. Plant Physiol. 35:155189.
Yoshida, H., Nagata, M., Saito, K., Wang, K.L. and Ecker, J.R. 2005. Arabidopsis ETO1
specifically interacts with and negatively regulates type 2 1-aminocyclopropane-1-
carboxylate synthases. BMC Plant Biol. 5:114.

Tables

Table 1. Sequences of primers used in this study.

Product
Target Name Oligonucleotide sequence 5 3 Reference
size (bp)
MA-ACO1 ACO1-F AAGCTCTACGTCGGGCATAA 152 Inaba et al., 2007
ACO1-R GACAGCTTCCTAACGCGAAG
MA-ACO2 ACO2-F CCAAGGAACCGAGATTTGAA 125
ACO2-R TGGTAGCTTCCACGATGACA
MA-ACS1 ACS1-F AGAACTCCTCCTACTTCGAT 215 Liu et al., 1999
ACS1-R ATGATAGTCCTGAAAGTTGG
MA-ACT Act-F GAGAAGATACAGTGTCTGGA 231
Act-R ATTACCATCGAAATATTAAAAG

390
Figures

A
Ethylene ACC Pulp firmness a value
50 40 10
22 26 31 33 5
Ethylene (l. kg -1. h-1)

40 32

Pulp firmness (N)

0
ACC (nmol)

30 24 -5

a value
20 16 -10
-15
10 8
-20
0 0 -25
50 40 10
B
9 12 17 27 5
40
Ethylene (l. kg-1 . h -1 )

32
Pulp firmness (N)
0
ACC (nmol)

30 24 -5

a value
20 16 -10
-15
10 8
-20
0 0 -25
50
C 1 2 3 10
40 15
10
40
Ethylene (l. kg-1 . h -1 )

32
Pulp firmness (N)

5
ACC (nmol)

30 24 0

a value
-5
20 16 -10
-15
10 8
-20
0 0 -25
IM G M G Br Br+ Ri Or IMG MG Br Br+ Ri Or
Physiological stages of fruit Physiological stages of fruit

Fig. 1. Changes of physicochemical parameters of banana fruit during ripening in planta

and ex planta (A); in air (B) and after acetylene treatment (C). Changed in
physiochemical parameters observed included evolution of ethylene production of
the whole fruit, firmness and ACC content of pulp, and fruit color during banana
fruit ripen under different conditions. The physiological stages of fruits were IMG
(immature-green), MG (mature-green), Br (breaker), Br+ (breaker+), Ri (ripe) and
Or (overripe). Vertical bars indicate standard deviation (SD). When no bar is
shown, SD was smaller than the symbol. The numbers indicated within ethylene-
ACC graphs represent the days taken by fruit since IMG stage to reach the
corresponding physiological stage indicate at the abscise axe.

391
 PEEL PULP

In-Planta In-Planta
Air Air
ACE ACE
300 300
(cal IMG, ref actin)

240 240

(cal IMG, ref actin)

2 -Ct MA-ACS1

2 -Ct MA-ACS1
180 180

120 120

60 60

0 0
1000 1000

800
(cal IMG, ref actin)

(cal IMG, ref actin)

800
2 -Ct MA-ACO1

2 -Ct MA-ACO1

600 600

400 400

200 200

0 0

6 6
5 5
(cal IMG, ref actin)

(cal IMG, ref actin)

2 -Ct MA-ACO2

2 -Ct MA-ACO2

4 4
3 3
2 2
1 1
0
0
IMG MG Br Br+ Ri Or
IMG MG Br Br+ Ri Or
Physiological stages of fruit Physiological stages of fruit

Fig. 2. Expression of ethylene biosynthesis genes in pulp and peel tissues during banana
fruit ripening. Accumulation of MA-ACS1, MA-ACO1 and MA-ACO2 mRNA was
analysed in peel and pulp of fruit ripening in planta and ex planta as described in
Material and Methods. The physiological stages of fruits were IMG (immature-
green), MG (mature-green), Br (breaker), Br+ (breaker+), Ri (ripe) and Or
(overripe). Vertical bars indicate standard deviation (SD). When no bar is shown
SD was smaller than the symbol.

392